The present invention relates to nucleic acids, oligonu- cleotides, PNA-oligomers, and to a method for the charac- terisation, grading, staging, treatment and/or diagnosis of colon cancer, or the predisposition to colon cancer, by analysis of the genetic and/or epigenetic parameters of genomic DNA and, in particular, with the cytosine me- thylation status thereof.

Prior Art Colon cancer is the second most common cause of cancer death in the United States. It describes any cancer in the colon (large intestine), from the beginning of the colon (cecum) to the end of the colon (rectum). Colon cancer is a malignant tumor in the lining of the large intestine. It starts with a single cell that mutates and grows into a visible polyp. If a polyp is allowed to re- main in the colon it can grow into a cancerous tumor that

can invade other organs. The mechanism behind the pro- gression to malignancy are not comletely understood, how- ever most polyps take 3-7 years to become cancerous. Pre- vention of colon cancer means stopping this process by removing the polyp before it becomes cancerous. Colon cancer represents an interaction between the genome of the colorectal epithelial cell and the host environment.

Both factors are essential for the development of tumors.

Colon cancers can be differentiated into nonhereditary types, which rarely occur before age 40 and hereditary colon cancers which often occur in younger people.

Human colon cancers undergo a multistage carcinogenesis pathway from adenomatous polyps to carcinoma. A number of genetic events have been characterized and include al- terations in"tumor suppressor"and susceptibility genes that normally encode for proteins regulating cell cycle progression and programmed cell death (Kinzler KW, Vogel- stein B. Landscaping the cancer terrain. Science. 1998 May 15 ; 280 (5366): 1036-7). Given the high incidence of co- lon cancer in the aging population and high mortality rates for advanced disease, new prevention strategies are needed. After the diagnosis of cancer has been made it is important to determine the extent or'stage'of the can- cer before deciding on the treatment plan. Staging is a method of evaluating the progress of the cancer in a pa- tient and defines the extent to which the cancer has spread to other parts of the body. There are several sys- tems for classifying the extent or stage of cancer. One of the the two most common systems is the Stage I, II, III, IV'system, which defines four stages of cancer.

Stage I represents early cancer, with a small tumor and no spread to the lymph nodes. In stages II and III, the tumor is progressively more advanced, while stage IV re- fers to metastatic disease that has spread to other areas of the body. One very important point to realize about

these staging systems is that they only provide rough es- timates of the stage of disease and chances of survival.

The numbers are just averages. They do not say anything about the outcome or prognosis of any one particular pa- tient.

Genes which are associated with colon cancer include the following. pl6 (Dai CY, Furth EE, Mick R, Koh J, Takayama T, Niitsu Y, Enders GH. pl6 (INK4a) expression begins early in human colon neoplasia and correlates inversely with markers of cell proliferation. Gastroenterology. 2000 Oct ; 119 (4): 929-42). p27 (Liu DF, Ferguson K, Cooper GS, Grady WM, Willis J. p27 cell-cycle inhibitor is inversely correlated with lymph node metastases in right-sided colon cancer. J Clin Lab Anal. 1999 ; 13 (6): 291-5). p53 (Arango D, Corner GA, Wadler S, Catalano PJ, Augenlicht LH. c-myc/p53 interaction determines sensitiv- ity of human colon carcinoma cells to 5-fluorouracil in vitro and in vivo. Cancer Res. 2001 Jun 15; 61 (12): 4910-5). cdc2 (Moragoda L, Jaszewski R, Majumdar AP. Curcumin in- duced modulation of cell cycle and apoptosis in gastric and colon cancer cells. Anticancer Res. 2001 Mar-Apr; 21 (2A): 873-8).

PCNA (Zhang Y, Iwama T, Sugihara K. Histochemical study of apoptosis and cell proliferation in hereditary intes- tinal diseases. J Med Dent Sci. 1998 Jun; 45 (2): 77-84).

CEA (Vogel I, Francksen H, Soeth E, Henne-Bruns D, Kremer B, Juhl H. The carcinoembryonic antigen and its prognos- tic impact on immunocytologically detected intraperito- neal colorectal cancer cells. Am J Surg. 2001 Feb; 181 (2): 188-93). c-erbB2 (Fric P, Sovova V, Sloncova E, Lojda Z, Jirasek A, Cermak J. Different expression of some molecular mark-

ers in sporadic cancer of the left and right colon. Eur J Cancer Prev. 2000 Aug ; 9 (4): 265-8).

Estrogen receptor (Campbell-Thompson M, Lynch IJ, Bhard- waj B. Expression of estrogen receptor (ER) subtypes and ERbeta isoforms in colon cancer. Cancer Res. 2001 Jan 15; 61 (2): 632-40).

Progesterone receptor (Reich 0, Regauer S, Urdl W, La- housen M, Winter R. Expression of oestrogen and proges- terone receptors in low-grade endometrial stromal sarco- mas. Br J Cancer. 2000 Mar; 82 (5): 1030-4) and myoglobin (Nakao A, Sakagami K, Uda M, Mitsuoka S, Ito H. Carcino- sarcoma of the colon: report of a case and review of the literature. J Gastroenterol. 1998 Apr ; 33 (2): 276-9).

5-methylcytosine is the most frequent covalent base modi- fication in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of ge- netic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by se- quencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic informa- tion carried by 5-methylcytosine is completely lost dur- ing PCR amplification.

A relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior. However, 5-methylcytosine remains un- modified under these conditions. Consequently, the origi- nal DNA is converted in such a manner that methylcyto- sine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be de-

tected as the only remaining cytosine using"normal"mo- lecular biological techniques, for example, by amplifica- tion and hybridization or sequencing. All of these tech- niques are based on base pairing which can now be fully exploited. In terms of sensitivity, the prior art is de- fined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with sin- gle-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisul- phite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15 ; 24 (24): 5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method. However, currently only in- dividual regions of a length of up to approximately 3000 base pairs are analyzed, a global analysis of cells for thousands of possible methylation events is not possible.

However, this method cannot reliably analyze very small fragments from small sample quantities either. These are lost through the matrix in spite of the diffusion protec- tion.

An overview of the further known methods of detecting 5- methylcytosine may be gathered from the following review article: Rein, T. , DePamphilis, M. L., Zorbas, H. , Nu- cleic Acids Res. 1998,26, 2255.

To date, barring few exceptions (e. g. , Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syn- drome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr; 5 (2): 94-8) the bisulfite technique is only used in research. Always, however, short, specific fragments of a known gene are amplified subsequent to a bisulfite treatment and either

completely sequenced (Olek A, Walter J. The pre- implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov; 17 (3): 275-6) or individual cytosine posi- tions are detected by a primer extension reaction (Gon- zalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15 ; 25 (12): 2529-31, WO Patent 9500669) or by enzymatic digestion (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15 ; 25 (12): 2532-4). In addition, de- tection by hybridization has also been described (Olek et al. , WO 99 28498).

Further publications dealing with the use of the bisul- fite technique for methylation detection in individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 Jun; 16 (6): 431-6, 431 ; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Hor- sthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader- Willi/Angelman syndrome region as determined by the ge- nomic sequencing method. Hum Mol Genet. 1997 Mar; 6 (3): 387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nu- cleic Acids Res. 1994 Feb 25 ; 22 (4): 695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic se- quencing indicates a correlation between DNA hypomethyla- tion in the 5'region of the pS2 gene and its expression in human breast cancer cell lines. Gene. 1995 May 19 ; 157 (1-2): 261-4 ; WO 97/46705, WO 95/15373 and WO 95/45560.

An overview of the Prior Art in oligomer array manufac- turing can be gathered from a special edition of Nature

Genetics (Nature Genetics Supplement, Volume 21, January 1999), published in January 1999, and from the literature cited therein.

Fluorescently labeled probes are often used for the scan- ning of immobilized DNA arrays. The simple attachment of Cy3 and Cy5 dyes to the 5'-OH of the specific probe are particularly suitable for fluorescence labels. The detec- tion of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially avai- lable.

Matrix Assisted Laser Desorption Ionization Mass Spec- trometry (MALDI-TOF) is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. La- ser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15; 60 (20): 2299-301). An analyte is embedded in a light- absorbing matrix. The matrix is evaporated by a short la- ser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner. The analyte is ionized by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accel- erated at different rates. Smaller ions reach the detec- tor sooner than bigger ones.

MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins. The analysis of nu- cleic acids is somewhat more difficult (Gut I G, Beck S.

DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends.

1995, 1 ; 147-57). The sensitivity to nucleic acids is ap- proximately 100 times worse than to peptides and de- creases disproportionally with increasing fragment size.

For nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is con- siderably less efficient. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. For the desorption of peptides, several very effi- cient matrixes have been found which produce a very fine crystallization. There are now several responsive ma- trixes for DNA, however, the difference in sensitivity has not been reduced. The difference in sensitivity can be reduced by chemically modifying the DNA in such a man- ner that it becomes more similar to a peptide. Phos- phorothioate nucleic acids in which the usual phosphates of the backbone are substituted with thiophosphates can be converted into a charge-neutral DNA using simple alky- lation chemistry (Gut IG, Beck S. A procedure for selec- tive DNA alkylation and detection by mass spectrometry.

Nucleic Acids Res. 1995 Apr 25; 23 (8): 1367-73). The cou- pling of a charge tag to this modified DNA results in an increase in sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impuri- ties which make the detection of unmodified substrates considerably more difficult.

Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard meth- odology is found in references such as Fritsch and Mani- atis eds. , Molecular Cloning: A Laboratory Manual, 1989.

Description of the invention The present invention discloses that atypical methylation in the genes estrogen receptor, p21, p27, pl6, pro- gesteron receptor, myoglobin, pcna, cdc2, c-erbB2, p53 and CEA, can be positively correlated with colon carcino- genesis. This allows the detection of colon carcinoma, or

the predisposition to colon cancer by an assay that de- tects methylation in the genes by restriction enzyme analysis, or using a nucleic acid based method.

The disclosed invention provides a method and nucleic ac- ids for the analysis of colon carcinomas. It discloses a means of distinguishing between healthy and cancerous co- lon tissue. This provides a means for the improved diag- nosis, prognosis, staging and grading of colon cancer, at a molecular level, as opposed to currently used methods of a relatively subjective nature such as histological analysis. Furthermore, the disclosed invention presents improvements over. the state of the art in that current methods of histological and cytological analysis require that the biopsy contain a sufficient amount of tissue.

The method according to the present invention can be used for classification of minute samples.

The invention provides a method for detecting a colon cell proliferative disorder characterised in that the target nucleic acid of one or more genes taken from the group comprising estrogen receptor, p21, p27, pl6, pro- gesteron receptor, myoglobin, pcna, cdc2, c-erbB2, p53 and CEA are contacted with a reagent or series of re- agents capable of distinguishing between methylated and non methylated CpG dinucleotides within the target se- quence.

The present invention makes available a method for ascer- taining genetic and/or epigenetic parameters of genomic DNA. The method is for use in the grading, staging, treatment and/or diagnosis of colon cancer. The method enables the analysis of cytosine methylations and single nucleotide polymorphisms.

In one embodiment of the method the genomic DNA sample is first isolated from tissue or cellular sources. Such sources may include cell lines, histological slides, body fluids, or tissue embedded in paraffin. Extraction may be by means that are standard to one skilled in the art, these include the use of detergent lysates, sonification and vortexing with glass beads. Once the nucleic acids have been extracted the genomic double stranded DNA is used in the analysis.

In a preferred embodiment the DNA may be cleaved prior to the chemical treatment, this may be any means standard in the state of the art, in particular with restriction en- donucleases.

In the third step of the method, the genomic DNA sample is treated in such a manner that cytosine bases which are unmethylated at the 5'-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be under- stood as'pretreatment'hereinafter.

The above described treatment of genomic DNA is prefera- bly carried out with bisulfite (sulfite, disulfite) and subsequent alkaline hydrolysis which results in the con- version of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.

In the fourth step of the method the bisulfite treated DNA is analysed using one or a combination of several methods which are known in the art namely real time PCR (Methyl Light assay), blocking oligonucleotides, methyla- tion specific single nucleotide polymorphism extension (hereinafter referred to as MsSNuPE), methylation spe-

cific PCR (hereinafter referred to as MSP), and nucleic acid sequencing.

Fluorescence-based Real Time Quantitative PCR (Heid et al. , Genome Res. 6: 986-994,1996) employs a dual-labeled fluorescent oligonucleotide probe (e. g. TaqMan PCR, us- ing an ABI Prism 7700 Sequence Detection System, Perkin Elmer Applied Biosystems, Foster City, California) that is hybridized concurrently with oligonucleotide primers during a continuosly monitered polymerase chain reac- tion.. The TaqMan PCR reaction employs the use of a nonextendible interrogating oligonucleotide, called a TaqMan probe, which is designed to hybridize to a GpC- rich sequence located between the forward and reverse am- plification primers. The TaqMan probe further comprises a fluorescent"reporter moiety"and a"quencher moiety" covalently bound to linker moieties (e. g. , phosphoramid- ites) attached to the nucleotides of the TaqMan oligonu- cleotide. For analysis of methylation within nucleic acids subsequent to bisulphite treatment it is required that the probe be methylation specific, as described in U. S. 6,331, 393, also known as the Methyl Light assay.

Variations on the TaqMan detection methodology that are also suitable for use with the described invention in- clude the use of dual probe technology (LightcyclerTM) or fluorescent amplification primers (Sunrise technology).

Both these techniques may be adapted in a manner suitable for use with bisulphite treated DNA, and moreover for me- thylation analysis within CpG dinucleotides.

A further suitable method for the for the assessment of methylation by analysis of bisulphite treated nucleic ac- ids is the use of blocker oligonucleotides. The use of such oligonucleotides has been described in BioTechniques 23 (4), 1997,714-720 D. Yu, M. Mukai, Q. Liu, C. Steinman.

Blocking probe oligonucleotides are hybridised to the bi-

sulphite treated nucleic acid concurrently with the PCR primers. PCR amplification of the nucleic acid is termi- nated at the 5'position of the blocking probe, thereby amplification of a nucleic acid is suppressed wherein the complementary sequence to the blocking probe is present.

The probes may be designed to hybridise to the bisulphite treated nucleic acid in a methylation status specific manner. For example, for detection of methylated nucleic acids within a population of unmethylated nucleic acids suppression of the amplification of nucleic acids which are unmethylated at the position in question would be carried out by the use of blocking probes comprising a 'CG'at the position in question, as opposed to a'CA'.

In a further preferred embodiment of the method the analysis is carried out by the use of template directed oligonucleotide extension, such as MS SNuPE as described by Gonzalgo and Jones (Nucleic Acids Res. 25: 2529-2531).

In an alternative embodiment of the method the assessment of the methylation state fo the CpG dinucleotides may be carried out by PCR analysis of the treated nucleic acid (s) using methylation specific PCR. Methylation spe- cific primers (MSP) have been described, for example in U. S. Patent 6,265, 171 to Herman et al. MSP primers con- sist of an oligonucleotide specific for annealing to a nucleotide sequence containing at least one bisulphite treated CpG dinucleotide. Therefore the sequence of said primers includes at least one CG, TG or CA dinucleotide.

MSP primers specific for non methylated DNA contain a'T' at the 3'position of the C position in the CpG. MSP primers generally contain relatively few cytosines as these are converted by the bisulphite reaction. However when the primers are specifc for methylated cytosine di- nucleotides said cytosine positions are conserved within the primer oligonucleotides.

The primers are extended by means of a polymerase and the resultant double stranded nucleic is denatured, pref- erably by means of heat treatment. Successive cycles of primer annealing, extension and denaturation are carried out according to the polymerase chain reaction as de- scribed in U. S. Pat. No. 4,582, 788 to Mullis.

In a further embodiment of the method the analysis is en- abled by sequencing and subsequent sequence analysis of the amplificate generated in the third step of the method (Sanger F. , et al. , 1977 PNAS USA 74: 5463-5467).

In a particularly preferred embodiment, the method com- prises the following steps: In the first step of the method the genomic DNA sample must be isolated from tissue or cellular sources. Such sources may include cell lines, histological slides, body fluids, or tissue embedded in paraffin. Extraction may be by means that are standard to one skilled in the art, these include the use of detergent lysates, sonification and vortexing with glass beads. Once the nucleic acids have been extracted the genomic double stranded DNA is used in the analysis.

In a preferred embodiment the DNA may be cleaved prior to the chemical treatment, this may be any means standard in the state of the art, in particular with restriction en- donucleases.

In the second step of the method, the genomic DNA sample is treated in such a manner that cytosine bases which are unmethylated at the 5'-position are converted to uracil, thymine, or another base which is dissimilar to cytosine

in terms of hybridization behavior. This will be under- stood as'pretreatment'hereinafter.

The above described treatment of genomic DNA is prefera- bly carried out with bisulfite (sulfite, disulfite) and subsequent alkaline hydrolysis which results in the con- version of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.

In the third step fragments of the pretreated DNA are am- plified, using sets of primer oligonucleotides according to Seq ID 76 to 97, and a, preferably heat-stable poly- merase. Because of statistical and practical considera- tions, preferably more than ten different fragments hav- ing a length of 100-2000 base pairs are amplified. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usu- ally, the amplification is carried out by means of a po- lymerase chain reaction (PCR).

The method may also be enabled by the use of alternative primers, the design of such primers is obvious to one skilled in the art. These should include at least two oligonucleotides whose sequences are each reverse comple- mentary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (Seq. ID No. 32 through Seq. ID No. 75). Said primer oli- gonucleotides are preferably characterized in that they do not contain any CpG dinucleotides. In a particularly preferred embodiment of the method, the sequence of said primer oligonucleotides are designed so as to selectively anneal to and amplify, only the colon tissue specific DNA of interest, thereby minimizing the amplification of background or non relevant DNA. In the context of the present invention, background DNA is taken to mean ge-

nomic DNA which does not have a relevant tissue specific methylation pattern, in this case, the relevant tissue being colon tissue, both healthy and diseased.

According to the present invention, it is preferred that at least one primer oligonucleotide is bound to a solid phase during amplification. The different oligonucleotide and/or PNA-oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being com- posed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.

The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Pre- ferred are labels in the form of fluorescence labels, ra- dionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrome- ter, it being preferred that the fragments that are pro- duced have a single positive or negative net charge for better detectability in the mass spectrometer. The detec- tion may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).

The amplificates obtained in the third step of the method are subsequently hybridized to an array or a set of oli- gonucleotides and/or PNA probes. In this context, the hy- bridization takes place in the manner described in the following. The set of probes used during the hybridiza- tion is preferably composed of at least 10 oligonucleo- tides or PNA-oligomers. In the process, the amplificates serve as probes which hybridize to oligonucleotides pre- viously bonded to a solid phase. Ina particularly pre-

ferred embodiment, the oligonucleotides are taken from the group comprising Seq IDs 98 to 523. The non- hybridized fragments are subsequently removed. Said oli- gonucleotides contain at least one base sequence having a length of 10 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 5th to gth nucleotide from the 5'-end of the 10-mer. One oligonucleotide exists for each CpG dinucleotide.

In the next step of the method, the non-hybridized ampli- ficates are removed.

In the final step of the method, the hybridized amplifi- cates are detected. In this context, it is preferred that labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleo- tide sequence is located.

According to the present invention, it is preferred that the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrome- ter. The mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualized by means of matrix assisted laser desorp- tion/ionization mass spectrometry (MALDI) or using elec- tron spray mass spectrometry (ESI). The produced frag- ments may have a single positive or negative net charge for better detectability in the mass spectrometer.

The aforementioned method is preferably used for ascer- taining genetic and/or epigenetic parameters of genomic DNA.

In order to enable this method, the invention further provides the chemically modified DNA of the genes estro- gen receptor, p21, p27, pl6, progesteron receptor, my- oglobin, pcna, cdc2, c-erbB2, p53 and CEA as well as oli- gonucleotides and/or PNA-oligomers for detecting cytosine methylations. The present invention is based on the dis- covery that genetic and epigenetic parameters and, in particular, the cytosine methylation patterns of genomic DNA are particularly suitable for characterisation, grad- ing, staging, and/or diagnosis of colon cancer.

The nucleic acids according to the present invention of Seq. ID No. 12 through Seq. ID No. 523 can be used for characterisation, grading, staging and/or diagnosis of genetic and/or epigenetic parameters of genomic DNA.

This objective is achieved according to the present in- vention using a nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated ge- nomic DNA according to one of Seq. ID No. 32 through Seq.

ID No. 75 and sequences complementary thereto.

The chemically modified nucleic acid could heretofore not be connected with the ascertainment of disease relevant genetic and epigenetic parameters.

The object of the present invention is further achieved by an oligonucleotide or oligomer for the analysis of pretreated DNA, for detecting the genomic cytosine methy- lation state, said oligonucleotide containing at least one base sequence having a length of at least 10 nucleo- tides which hybridizes to a pretreated genomic DNA ac-

cording to Seq. ID No. 32 through Seq. ID No. 75. The oli- gomer probes according to the present invention consti- tute important and effective tools which, for the first time, make it possible to ascertain specific genetic and epigenetic parameters of colon cancers, in particular, for use in characterisation, grading, staging, and/or di- agnosis of colon cancer. The base sequence of the oli- gomers preferably contains at least one CpG dinucleotide.

The probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties. Particularly preferred are oligonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is the 5th-9th nucleotide from the 5'-end of the 13-mer ; in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4th-6th nucleotide from the 5'-end of the 9- mer.

The oligomers according to the present invention are nor- mally used in so called"sets"which contain at least one oligomer for each of the CpG dinucleotides of the se- quences of Seq. ID No. 32 to Seq. ID No. 75. Preferred is a set which contains at least one oligomer for each of the CpG dinucleotides from one of Seq. ID No. 32 to Seq.

ID No. 75.

In the case of the sets of oligonucleotides according to the present invention, it is preferred that at least one oligonucleotide is bound to a solid phase. It is further preferred that all the oligonucleotides of one set are bound to a solid phase.

The present invention moreover relates to a set of at le- ast 10 n (oligonucleotides and/or PNA-oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No. 32 to Seq. ID No. 75

No. 75 and sequences complementary thereto). These probes enable characterisation, grading, staging and/or diagno- sis of genetic and epigenetic parameters of colon cancer.

Furthermore, the probes enable the diagnosis of predispo- sition to colon cancer. The set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in pretreated genomic DNA according to one of Seq. ID No.

32 to Seq. ID No. 75.

According to the present invention, it is preferred that an arrangement of different oligonucleotides and/or PNA- oligomers (a so-called"array") made available by the present invention is present in a manner that it is like- wise bound to a solid phase. This array of different oli- gonucleotide-and/or PNA-oligomer sequences can be char- acterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. The solid phase surface is preferably composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, sil- ver, or gold. However, nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are possible as well.

Therefore, a further subject matter of the present inven- tion is a method for manufacturing an array fixed to a carrier material for the grading, staging, and/or diagno- sis of colon cancer, in which method at least one oli- gomer according to the present invention is coupled to a solid phase. Methods for manufacturing such arrays are known, for example, from US Patent 5,744, 305 by means of solid-phase chemistry and photolabile protecting groups.

A further subject matter of the present invention relates to a DNA chip for the characterisation, grading, staging, and/or diagnosis of colon cancer. Furthermore the DNA chip enables the diagnosis of predisposition to colon

cancer. The DNA chip contains at least one nucleic acid according to the present invention. DNA chips are known, for example, in US Patent 5,837, 832.

Moreover, a subject matter of the present invention is a kit which may be composed, for example, of a bisulfite- containing reagent, a set of primer oligonucleotides con- taining at least two oligonucleotides whose sequences in each case correspond or are complementary to a 18 base long segment of the base sequences specified in the ap- pendix (Seq. ID No. 32 through Seq. ID No. 75), oligonu- cleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method.

However, a kit along the lines of the present invention can also contain only part of the aforementioned compo- nents.

The oligomers according to the present invention or ar- rays thereof as well as a kit according to the present invention are intended to be used for the characterisa- tion, grading, staging and/or diagnosis of colon cancer, or diagnosis of predisposition to colon cancer. According to the present invention, the method is preferably used for the analysis of important genetic and/or epigenetic parameters within genomic DNA, in particular for use in characterisation, grading, staging and/or diagnosis of colon cancer, and predisposition to colon cancer.

The methods according to the present invention are used, for example, for characterisation, grading, staging and/or diagnosis of colon cancer.

A further embodiment of the invention is a method for the analysis of the methylation status of genomic DNA without the need for chemical pretreatment. In the first step of the method the genomic DNA sample must be isolated from

tissue or cellular sources. Such sources may include cell lines, histological slides, body fluids, or tissue embed- ded in paraffin; for example, brain, central nervous sys- tem or lymphatic tissue. Extraction may be by means that are standard to one skilled in the art, these include the use of detergent lysates, sonification and vortexing with glass beads. Once the nucleic acids have been extracted the genomic double stranded DNA is used in the analysis.

In a preferred embodiment the DNA may be cleaved prior to the chemical treatment, this may be any means standard in the state of the art, in particular with restriction en- donucleases. In the second step, the DNA is then digested with methylation sensitive restriction enzymes. The di- gestion is carried out such that hydrolysis of the DNA at the restriction site is informative of the methylation status of a specific CpG dinucleotide.

In the third step the restriction fragments are ampli- fied. In a preferred embodiment this is carried out using a polymerase chain reaction.

In the final step the amplificates are detected. The de- tection may be by any means standard in the art, for ex- ample, but not limited to, gel electrophoresis analysis, hybridisation analysis, incorporation of detectable tags within the PCR products, DNA array analysis, MALDI or ESI analysis.

The present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous or relevant to patients or individuals in which important genetic and/or epigenetic parameters within genomic DNA, said parameters obtained by means of the present inven- tion may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the ba-

sis for a diagnosis and/or prognosis of events which are disadvantageous or relevant to patients or individuals.

In the context of the present invention the term"hy- bridization"is to be understood as a bond of an oligonu- cleotide to a completely complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure.

The term"functional variants"denotes all DNA sequences which are complementary to a DNA sequence, and which hy- bridize to the reference sequence under stringent condi- tions.

In the context of the present invention, "genetic parame- ters"are mutations and polymorphisms of genomic DNA and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).

In the context of the present invention, "epigenetic pa- rameters"are, in particular, cytosine methylations and further chemical modifications of DNA bases of genomic DNA and sequences further required for their regulation.

Further epigenetic parameters include, for example, the acetylation of histones which, cannot be directly ana- lyzed using the described method but which, in turn, cor- relates with the DNA methylation.

In the following, the present invention will be explained in greater detail on the basis of the sequences and exam- ples without being limited thereto.

Seq. ID 1 to 11 represent the genomic DNA of genes estro- gen receptor, p21, p27, pl6, progesteron receptor, my- oglobin, pcna, cdc2, c-erbB2, p53 and CEA. These se- quences are derived from Genbank and will be taken to in- clude all minor variations of the sequence material which are currently unforseen, for example, but not limited to, minor deletions and SNPs.

Sequence ID 12 to 31 represent segments of genomic DNA which are particularly useful for the determination of colon cell proliferative disorder.

Sequence ID 32 to 75 exhibit the chemically pretreated sequence of genes estrogen receptor, p21, p27, pl6, pro- gesteron receptor, myoglobin, pcna, cdc2, c-erbB2, p53 and CEA. These sequences will be taken to include all mi- nor variations of the sequence material which are cur- rently unforseen, for example, but not limited to, minor deletions and SNPs.

Sequences having even sequence numbers (e. g. , Seq. ID No.

32,34, 36,...) exhibit in each case sequences of chemi- cally pretreated genomic DNAs.

Sequences having odd sequence numbers (e. g. , Seq. ID No.

33,35, 37...) exhibit in each case the sequences of chemically pretreated genomic DNAs. Said genomic DNAs are complementary to the genomic DNAs from which the preceed- ing sequence was derived (e. g. , the complementary se- quence to the genomic DNA from which Seq. ID No. 32 is de- rived is the genomic sequence from which Seq. ID No. 33 is derived, the complementary sequence to the genomic DNA from which Seq. ID No. 33 is derived is the sequence from which Seq. ID No. 34 is derived, etc.)

Sequence ID 76 to 97 exhibit the sequence of primer oli- gonucleotides for the amplification of chemically pre- treated DNA according to Sequence IDs 32 to 75.

Sequence IDs 98 to 523 exhibit the sequence of oligomers which are particularly useful for the analysis of CpG po- sitions within chemically pretreated DNA according to Se- quence IDs 32 to 75.

The following examples describe the invention in detail without limiting the scope of the invention.

Example 1: Description of PCR The single gene PCR reaction was performed using a ther- mocycler (Epperdorf GmbH) using 10 ng of bisulfite treated DNA, 6 pmole of each primer, 200 uM of each dNTP, 1.5 mM MgCl2 and 1 U of HotstartTaq (Qiagen AG). The other conditions were as recommended by the Taq poly- merase manufacturer. Single genes were amplified by PCR performing a first denaturation step for 14 min at 96 °C, followed by 39 cycles (60 sec at 96°C, 45 sec at 55 °C, 75 sec at 72 °C) and a subsequent final elongation of 10 min at 72 °C. The bisulfite DNA was prepared according to a published procedure from genomic DNA individually iso- lated from 12 matched samples of adenocarzinoma of the colon and healthy colon tissue. The genomic DNA was iso- lated using the wizzard DNA isolation kit (Promega, Madi- son).

Example 2 : Methylation analysis of gene pl6.

The following example relates to a fragment of the gene pl6 in which a specific CG dinucleotide is to be analyzed for methylation.

In the first step, a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner

that all cytosines which are not methylated at the 5- position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5- position remain unchanged.

If bisulfite solution is used for the reaction, then an addition takes place at the non-methylated cytosine bases. Moreover, a denaturating reagent or solvent as well as a radical interceptor must be present. A subse- quent alkaline hydrolysis then gives rise to the conver- sion of non-methylated cytosine nucleobases to uracil.

The chemically converted DNA is then used for the detec- tion of methylated cytosines. In the second method step, the treated DNA sample is diluted with water or an aque- ous solution. Preferably, the DNA is subsequently desul- fonated. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably using a heat-resistant DNA polymerase. In the present case, cytosines of the gene pl6 are analyzed. To this end, a defined fragment having a length of 598 bp is am- plified with the specific primer oligonucleotides TTGAAAATTAAGGGTTGAGG (Sequence ID 82) and CACCCTCTAATAACCAACCA (Sequence ID No. 83).

The amplificate serves as a sample which hybridizes to an oligonucleotide previously bound to a solid phase, form- ing a duplex structure, for example TAAGTGTTCGGAGTTAAT (SEQ ID NO : 238), the cytosine to be detected being lo- cated at position 439 of the amplificate. The detection of the hybridization product is based on Cy3 and Cy5 fluorescently labelled primer oligonucleotides which have been used for the amplification. A hybridization reaction of the amplified DNA with the oligonucleotide takes place only if a methylated cytosine was present at this loca- tion in the bisulfite-treated DNA as shown for healthy

tissue in Figure 1A. Thus, the methylation status of the specific cytosine to be analyzed is inferred from the hy- bridization product.

In order to verify the methylation status of the posi- tion, a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase. Said olignonucleotide is identical to the oligonu- cleotide previously used to analyze the methylation status of the sample, with the exception of the position in question. At the position to be analysed said oligonu- cleotide comprises a thymine base as opposed to a cyto- sine base i. e TAAGTGTTTGGAGTTAAT (SEQ ID NO : 239). There- fore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed as shown for tumor tissue in Figure 1B.

Example 3: Differentiation between colon tumour and healthy colon tissue Differentiation of healthy samples and adenocarzinoma tu- mours. For tumour class prediction between healthy and tumor tissue we used a Support Vector Machine (SVM) on a set of selected CpG sites (F. Model, P. Adorjan, A. Olek, C.

Piepenbrock, Feature selection for DNA methylation based cancer classification. Bioinformatics. 2001 Juni17 Suppl 1 : S157-64.). First we ranked the CpG sites for a given separation task by their significance of the difference between the two class means. The significance of each CpG was estimated by a two sample t-test (W, Mendenhall, T, Sincich, Statistics for engineering and the sciences (Prentice-Hall, New Jersey 1995).

In order to relate the methylation patterns to a adeno- carcinoma tumour, it is initially required to compara- tively analyze the DNA methylation patterns of healthy tissue and adenocarzinoma tumours tissue (Figure 2 A and

B). These analyses were carried out, analogously to Exam- ples 1. The results obtained in this manner are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be carried out by determining individual CpG methyla- tion rates as can be done, for example, by sequencing, which is a relatively imprecise method of quantifying me- thylation at a specific CpG, or else, in a very precise manner, by a methylation-sensitive"primer extension re- action". In a particularly preferred variant, as illus- trated in the preceeding examples the methylation status of hundreds or thousands of CpGs may be analysed on an oligomer array. It is also possible for the patterns to be compared, for example, by clustering analyses which can be carried out, for example, by a computer.

A panel of genomic fragments of 11 different genes (listed in Table 1) were bisulphite treated and amplified by singleplex PCRs according to Example 1. However, as will be obvious to one skilled in the art, it is also possible to use other primers that amplify the genomic, bisulphite treated DNA in an adequate manner, and/or to carry out the PCRs in a multiplex format. However the primer oligonucleotide pairs as listed in Table 1 are particularly preferred. In order to differentiate adeno- carzinoma tumour from healthy control samples optimal re- sults were obtained by including at least 6 CpG dinucleo- tides, the most informative CpG positions for this dis- crimination being located within the pl6, p53, CEA, c- erbB2 and estrogen receptor genes (cf. Fig. 2, Tabl). In addition, the majority of the analysed CpG dinucleotides of the panel showed different methylation patterns be- tween the two phenotypes. The results prove that methyla- tion fingerprints are capable of providing differential diagnosis of adenocarzinoma tumours and could therefore be applied in a large number clinical situations

For class prediction a SVM was trained on the most sig- nificant CpG positions, where the optimal number of CpG sites depends on the complexity of the separation task. Implementation of the SVM used the Sequential Minimal Op- timization algorithm to find the 1-norm soft margin sepa- rating hyperplane (N. Christianini, J. Shawe-Taylor, An Introduction to Support Vector Machines, . Cambridge Uni- versity Press, Cambridge 2000). The box constraint was set to C=10. Generalization performance was estimated by averaging over 50 cross validation runs on randomly per- mutated samples partitioned into 8 groups.

Example 4: Analysis of the methylation status of the most informative CpG positions of the genes c-erbB2, p53, CEA, pl6 and ER1 The methylation status of the most informative CpG posi- tions of the gene fragments of genes c-erbB2, p53, CEA, pl6 and ER1 are shown in this example. Corresponding to Example 2, where the methylation status is demonstrated by spots, Table 2 describes in a more detailed way the methylation status of different gene fragments of various patients by calculating the methylation status of colon tumour and healthy colon tissue. The first column indi- cates the specific gene fragment, the second column de- scribes the investigated CpG Oligonukleotide, the third column depicts the diagnosis of the investigated tissue (T=tumor, H=healthy) and columns 4 to 17 show the loga- rithm of the ratio ofv the fluorescence signal of the CG oligonucleotide versus TG oligonucleotide of colon tumour and healthy colon tissue of 14 different patients. For example, a comparison of the methylation status of gene pl6, patient 11, shows that the healthy tissue is less methylated compared to the tumour tissue for this sample.

The opposite ratio can be observed, for example, for gene c-erbB2 for patient 11. In this case the tumour sample is

more methylated than the healthy, sample. The analyzed CpG positions show that the genes p53, CEA, pl6 and ER1 are hypermethylated, whereas c-erbB2 is hypomethylated in most of the tumour samples compared with the healthy con- trols.

Example 5: Identification of the methylation status of CpG sites of genes CEA and pl6 by methylation sensitive restriction enzyme digest.

In the CEA gene, a defined fragment having a length of 351 bp, which contains 7 CpG sites, is amplified with the specific primer oligonucleotides TGGTTAAATGTGTGGGAGAT (Sequence ID 524) and TCCTGAGTGATGTCTGTGTG (Sequence ID No. 525) and in the pl6 gene, a defined fragment having a length of 391 bp, which contains 26 CpG sites, is ampli- fied with the specific primer oligonucleotides ATGACACCAAACACCCCGAT (Sequence ID 526) and CTGTCCCTCAAATCCTCTG (Sequence ID No. 527). CGCG for gene CEA with Cytosins at positions 127 and 129 of the ampli- ficate and CGCG for gene pl6 with Cytosins at positions 362 and 364 of the amplificate, are located in a SacII restriction enzyme recognition sequence, CCGCGG. The cleavage of SacII is blocked by methylation of at least one of the two CpG dinucleotides.

The genomic DNA isolated from adenocarzinoma of colon tissue and from healthy colon tissue was hydrolysed by SacII as recommended by the manufacturer (New England Biolabs GmbH).

10 ng of the SacII restricted DNA was used as template for the amplification of the above indicated CEA and pl6 gene fragments. The PCR reaction was performed using a thermocycler (Eppendorf GmbH) using 10 ng of DNA, 6 pmole of each primer, 200 uM of each dNTP, 1.5 mM MgC12 and 1 U

of HotstartTaq (Qiagen AG). The other conditions were as recommended by the Taq polymerase manufacturer. Using the above mentioned primers, gene fragments were amplified by PCR performing a first denaturation step for 14 min at 96 °C, followed by 30-45 cycles (step 2: 60 sec at 96°C, step 3: 45 sec at 55 °C, step 4: 75 sec at 72 °C) and a subsequent final elongation of 10 min at 72 °C. The pres- ence of PCR products was analysed by agrarose gel elec- trophoresis.

PCR products were detectable with SacII hydrolyzed DNA isolated from colon cancer tissue, when step 2 to step 4 of the cycle program were repeated 34,37, 39,42 and 45 fold. In contrast PCR products were only detectable with SacII hydrolyzed DNA isolated from healthy colon tissue when step 2 to step 4 of the cycle program were repeated 42 and 45 fold. These results indicate that at least one of CpG positions located within the SacII recognition se- quence of the analysed CEA and the pl6 gene fragment showed a higher methylation status in cancer samples com- pared to the healthy control.

Description of figures Figure 1 Figure 1 shows the hybridisation of fluorescent labelled amplificates to a surface bound olignonucleotide. Sample A being from healthy tissue and sample B being from colon adenocarzinoma tissue. Fluorescence at a spot, denoted by an arrow, indicates hybridisation of the amplificate against the olignonucleotide. Hybridisation to a CG olignonucleotide with the sequence TAAGTGTTCGGAGTTAAT (SEQ ID NO: 238) denotes methylation at the cytosine po- sition being analysed, hybridisation to a TG olignonu- cleotide with the sequence TAAGTGTTTGGAGTTAAT (SEQ ID NO: 239) denotes no methylation at the cytosine position be-

ing analysed. It can be seen that sample A was umethy- lated for CG positions of the amplificate of gene pl6 whereas in comparison sample B had a higher degree of me- thylation at the same position.

Figure 2 Differentiation of colon tumour (A) from healthy colon tissue (B). High probability of methylation corresponds to red, uncertainty to black and low probability to green.

The labels on the left side of the plot are gene (e. g. for the topmost: 2064) and CpG (e. g. for the topmost: 1485A) identifiers. The hybridisation was carreid out with Cy5 labelled amplificates generated by singlplex PCR reactions using primer oligonucleotides as shown in Table 1. The labels on the right side give the significance (p- value, T-test) of the difference between the means of the two groups. Each row corresponds to a single CpG and each column to the methylation levels of one sample. CpGs are ordered according to their contribution to the distinc- tion to the differential diagnosis of the two lesions with increasing contribution from top to bottom.

Table 1<BR> List of genes, reference numbers (ID) according Fig 2 and primer oligonucleotides according<BR> toExample 2 and Figures 1 and 2.

Table 2 log (fluprescence CGoligo/fluorescence TGoligo) of matched pair of colon tumour (T) and healthy colon tissue (H)a gene CpG Diagnosis 11 3 9 1 8 2 4 13 12 14 15 5 10 6 c-erbB2 2064:148 T -1,07 -1,72 -1,11 -1,53 -1 -1,3 -1,63 -1,01 -1,64 -1,22 -1,33 -0,88 -1,57 -1,22 H -0.82 -1,09 -1,34 -1,17 -0,75 -1,09 -1,36 -0,89 -0,88 -0,72 -1,06 -0,93 -1,43 -0,7 p53 2317:122 T -2,17 -0,58 -2,37 -1,91 -2,08 -0,32 -0,3 -1,63 -2,19 -1,87 -1,71 -4,31 -3,15 -1 H -4,03 -3,01 -3,14 -3,83 -1,53 -2,29 -1,86 -2,96 -2,76 -4,09 -3,44 -4,77 -2,33 -3,97 p53 2317:153 T -2,38 -2,84 -2,77 -2,57 -2,93 -2,44 -2,89 -3,12 -2,77 -2,32 -2,7 -2,89 -2,13 -2,29 H -3,36 -3,36 -3,17 -3,32 -3,15 -3,47 -2 -2,94 -3,8 -3,77 -3,67 -4,12 -2,2 -3,12 CEA 2398:176 T -2,76 -1,84 -3,7 -2,42 -2,59 -0,83 -2,14 -1,96 -2,86 -4,02 -2,76 -5,71 -5,07 -2,33 H -4,32 -2,64 -4,72 -3,9 -4,43 -4,85 -2,95 -3 -2,67 -4,19 -2,92 -4,63 -4,53 -3,64 CEA 2398:227 T -3,35 -2,15 -3,83 -3,88 -4,02 -2,95 -2,81 -3,98 -3,9 -4,01 -4,75 -4,64 -4,34 -3,15 H -4,7 -4,37 -5,1 -5,77 -4,7 -4,64 -3,33 -3,65 -5,48 -5,2 -5,32 -5,75 -3,84 -5,4 p16 2035:181 T -1,64 -1,99 -2,66 -2,6 -3,78 -1,07 -2,21 -2,18 -3,24 -1,8 -2,19 -3,21 -3,25 -2,13 H -2,74 -3,02 -4,09 -3,52 -3,74 -3,87 -2,88 -2,76 -3,28 -2,27 -3,19 -3,38 -3,88 -3,49 ER1 41:2912 T -0,4 -0,37 -1,23 -0,96 -1,36 -0,47 -0,37 -0,34 -0,76 -0,85 -0,56 -1,32 -1,53 -1,33 H -0,8 -1,25 -2,1 -1,23 -1,52 -1,38 -0,44 -0,93 -1,26 -1,55 -1,21 -1,55 -1 -1,45 ER1 41:2860 T -1,06 -0,77 -2,06 -1,8 -1,7 -0,53 -1,52 -1,82 -1,19 -1,59 -0,82 -1,6 -1,85 -1,69 H -1,83 -2,03 -2,05 -2,22 -2,36 -2,13 -2,26 -1,72 -0,91 -2,11 -1,6 -2,05 -1,9 -2,14 ER1 41:2428 T 0,02 0,84 -1,41 -1,22 -1,39 0,67 -0,13 -0,33 -0,66 -1,41 0,22 -1,78 -1,61 -1 H -0,97 -0,86 -1,61 -1,36 -1,02 -1,78 -0,88 -1,05 -1,65 -1,29 -1,19 -1,53 -1,45 -1,96 ER1 41:2849 T -0,86 -0,43 -1,55 -0,98 -1,22 -0,97 -2,16 -1,2 -0,66 -1,07 -0,54 -1,59 -1,45 -0,78 H -1,11 -1,04 -1,97 -1,27 -2,06 -2,21 -2,77 -1,01 -1,08 -1,59 -1,08 -1,9 -2,02 -1,76 a) the velues indicate the meen of at leest 12 OG/TGoligo pairs analysed in 3 independtert chiphyloridisation