Field of the invention

The present invention is in the field of producing mechanical pulp from a biomass comprising lignocellulosic material. Such a process is useful in paper production. More in particular the invention relates to the process of wood pulping, such as mechanical wood pulping. It provides useful methods, compounds and compositions for reducing the energy requirements of the production of mechanical pulp.

Background of the invention

Pulp is a composition comprising lignocellulosic fibrous material prepared by chemically or mechanically separating cellulose fibers from biomass, such as wood, fiber crops or waste paper. The timber resources used to make wood pulp are referred to as pulpwood. Wood pulp comes from softwood trees such as spruce, pine, fir, larch and hemlock, and hardwoods such as eucalyptus, aspen and birch.

A pulp mill is a manufacturing facility that converts wood chips or other plant fiber source into a thick fiberboard which can be shipped to a paper mill for further processing. Alternatively, pulp and paper facilities may be integrated and wet pulp mass can be used directly for paper production.

Pulp is characterized by its ability to absorb and retain water, which may be quantified as Canadian Standard Freeness (CSF) measured in milliliters. Defibrated wood material can be considered as pulp if its CSF can be determined.

Pulp can be manufactured using mechanical, semi-chemical or fully chemical methods (Kraft and sulfite processes). The finished product may be either bleached or non-bleached, depending on the customer's requirements.

Wood and other plant materials that may be used to make pulp contain three main components (apart from water): cellulose fibers (desired for papermaking), lignin (a three-dimensional polymer that binds the cellulose fibers together) and hemicelluloses, (shorter branched carbohydrate polymers). A minor component of wood is pectin comprising galacturonic or rhamnogalacturonic acid polymers. Pectin adds in interlacing hemicellulose and lignin layers, thereby enhancing the strength of the material. In grassy plants, pectin is a major component providing rigidity.

The aim of the pulping process is to break down the bulk structure of the fiber source, be it chips, stems or other plant parts, into the constituent fibers.

Chemical pulping achieves this by chemically degrading the lignin and hemicellulose into small, water-soluble molecules which can be washed away from the cellulose fibers without depolymerizing the cellulose fibers. However, this process of chemically depolymerizing the hemicellulose weakens the fibers.

The various mechanical pulping methods, such as groundwood (GW) and refiner mechanical pulping (RMP), physically tear the cellulose fibers one from another. Much of the lignin remains adhered to the fibers. Strength may also be impaired because the fibers may be cut.

There are a number of related hybrid pulping methods that use a combination of chemical and thermal treatment, for instance an abbreviated chemical pulping process, followed immediately by a mechanical treatment to separate the fibers. These hybrid methods include chemi-thermomechanical pulping, also known as CTMP. The chemical and thermal treatments reduce the amount of energy subsequently required by the mechanical treatment, and also reduce the loss of strength suffered by the fibers.

Mechanical pulping of wood is extremely energy intensive process; for example, a typical newsprint pulp may need 2160 kWh of refiner energy per ton of feedstock to refine wood chips into pulp. Reducing this energy requirement is a very acute need of the industry.

As one of the solutions, enzymes capable of oxidizing lignin were proposed to be used for pretreatment of wood chips in order to decrease the energy required for grinding. This idea was perceived from natural observation that fungi, especially white-rot fungi are able to decay wood material by secreting lignolytic enzymes such as peroxidases and laccases.

This idea was first implemented as so-called bio-pulping, when fungal species were actually cultivated on wood chips before pulping. This resulted in substantial energy saving, but cultivation time comprised several weeks, which was not acceptable in industrial context.

Subsequently, it was proposed to use isolated enzyme preparations for wood pretreatment, rather than live species, which should in principle produce similar effect. This resulted in a limited number of publications wherein isolated fungal enzymes, such as laccases and xylanases were employed for wood chips pretreatment.

Other enzymes have been proposed as well for reducing the energy consumption of wood pulping. EP1552052 B1 describes a method comprising pretreatment of cellulose fiber material with pectin-degrading enzymes, so-called pectinases, alone or in combination with a chelating agent, for instance DTPA and/or sulfite, followed by mechanical defibration and refining to produce a mechanical pulp.

Pectin is a structural heteropolysaccharide contained in the primary cell walls of terrestrial plants and is particularly abundant in the non-woody parts. The amount of pectin in softwood and hardwood is normally less than 1 %,and it is predominantly deposited in the compound middle lamella, and the tori of bordered pit-membranes of coniferous species (Hafren J. and Westermark U.: Nordic Pulp and Paper 16 (4), 284-290, 2001 ). The amount, structure and chemical composition of pectin differs among plants, within a plant over time, and in various parts of a plant.

Pectin allows primary cell wall extension and plant growth. During fruit ripening, pectin is broken down by the enzymes pectinase and pectinesterase, in which process the fruit becomes softer as the middle lamellae break down and cells become separated from each other.

The main component of pectin is polygalacturonan consisting of galacturonic acid units that are esterified to a various extent. When in free acid form, the carboxylic groups of the galacturonan having a negative charge can induce local swelling of the fibers in contact with aqueous solutions. The esterified groups, on the other hand, can be de-esterified through for instance alkaline treatment and thus contributing to swelling.

Despite the low abundance of pectin in wood material, the use of pectinases has been shown to contribute to energy saving during mechanical pulping (EP1552052 B1 ).

Notwithstanding the above contributions to the art, there remains a need in the art for improved methods and enzymes with an improved performance, wherein the improvement may reside in, among others, cost-effective production of mechanical pulp, energy saving in the process, speed of action, safety, stability, such as temperature stability, pH stability or potential for development. Legend to the figures

Figure 1 : Graph showing the specific energy consumption (SEC) expressed in kWh per ton of pulp (dry weight) according to example 4. SEC is plotted against achieved pulp freeness levels expressed as Canadian Standard Freeness levels (CSF) in milliliters. Reference samples 1 and 2 were impregnated with impregnation liquid without enzyme and incubated at 65 degrees Celsius. These are shown in dashed lines; the solid line depicts the energy consumption of the same process with a pectate lyase according to seq ID no 1 . Arrows indicate the reduction of energy requirement due to the use of the pectate lyase enzyme at CSF values of 100 and 300 milliliter.

Figure 2: Diagram showing the energy saving in a pulp production method according to example 4, wherein the wood chips are impregnated with the indicated enzymes, corresponding to pulps with SCF 100 ml and 300 ml (interpolated from energy curves as shown on figure 1 ). Energy saving was calculated as the difference between the refining energy of the runs with and without the enzyme or enzymes at a given CSF

(arrows in figure 1 ), divided by the energy of the reference runs without the enzyme(s) (average of 2 runs) times 100%. Enzymes used for the particular methods are indicated by their SEQ ID NO:s. Figure 3: Diagram showing the energy saving in a pulp production method according to example 5 with enzymatic treatment of the wood biomass after defibration, corresponding to pulps with SCF 100 ml and 300 ml (interpolated from energy curves as shown on figure 1 ). Energy saving was calculated as the difference between the refining energy of the runs with and without the enzyme or enzymes at a given CSF (arrows in figure 1 ), divided by the energy of the reference runs without the enzyme(s) (average of 2 runs) times 100%. Enzymes used for the particular methods are indicated by their SEQ ID NO:s.

Figure 4: Diagram showing the relative pectate lyase activity of polypeptides according to SEQ ID NO: 1 (WT) and its K235 variants SEQ ID NO: 2 (K235T), SEQ ID NO: 3 (K235S), SEQ ID NO: 4 (K235N), and SEQ ID NO: 5 (K235C). Pectate lyase activity was determined after a pre-incubation of 10 minutes at elevated temperatures, 70 C, 75 C and 80C. RT = Room Temperature, 70 C is 70 degrees Celsius. Figure 5: Diagram showing the relative pectate lyase activity of polypeptides according to SEQ ID NO: 6 (93% identity with SEQ ID NO: 1 ), and its K235 variants SEQ ID NO: 7 (K235T), SEQ ID NO: 8 (K235S), SEQ ID NO: 9 (K235N), and SEQ ID NO: 10 (K235C). Pectate lyase activity was determined after a pre-incubation of 10 minutes at elevated temperatures. RT = Room Temperature, 70 C is 70 degrees Celsius. Figure 6: Diagram showing the relative pectate lyase activity of polypeptides according to SEQ ID NO: 1 1 (89% identity with SEQ ID NO: 1 ), and its K235 variants SEQ ID NO: 12 (K235T), SEQ ID NO: 13 (K235S), SEQ ID NO: 14 (K235N), and SEQ ID NO: 15 (K235C). Pectate lyase activity was determined after a pre-incubation of 10 minutes at elevated temperatures. RT = Room Temperature, 70 C is 70 degrees Celsius.

Figure 7: Diagram showing the relative pectate lyase activity of polypeptides according to SEQ ID NO: 1 (WT) and its variants A231 L, K235S, K235T, A231 L+K235S and A231 L+K235T. Pectate lyase activity was determined after a pre-incubation of 10 minutes at elevated temperatures. RT = Room Temperature, 70 C is 70 degrees Celsius.

Figure 8: Diagram showing the relative pectate lyase activity of polypeptides according to SEQ ID NO: 6 (93% identical with SEQ ID NO: 1 ) and its variants A231 L, K235N and A231 L+K235N. Pectate lyase activity was determined after a pre-incubation of 10 minutes at elevated temperatures. RT = Room Temperature, 70 C is 70 degrees Celsius.

Figure 9: Diagram showing the relative pectate lyase activity of polypeptides according to SEQ ID NO: 1 1 (89% identical with SEQ ID NO: 1 ) and its variants A231 L,

K235C and A231 L+K235C. Pectate lyase activity was determined after a pre-incubation of 10 minutes at elevated temperatures. RT = Room Temperature, 70 C is 70 degrees Celsius. Summary of the invention

Surprisingly, we found that a pectate lyase enzyme (E.C. 4.2.2.2) was capable of lowering the energy consumption of a commercial mechanical pulping process.

Such a process is typically and advantageously performed at a high pH in order to facilitate fiber separation.

We show herein that a pectate lyase enzyme with an amino acid sequence according to SEQ ID NO: 1 significantly contributed to reducing the energy consumption of a mechanical pulping process when performed at a pH between 9 and 12.

Hence, the invention relates to a method for producing mechanical pulp from a biomass comprising lignocellulosic material, the method comprising the steps of contacting the biomass with a pectate lyase at pH 9 -12 and refining the biomass to obtain a mechanical pulp, wherein the pectate lyase comprises an amino acid sequence according to SEQ ID NO: 1 or an amino acid sequence at least 70% identical with SEQ ID NO: 1 .

The invention also relates to a composition, such as a fluidic

composition, a suspension or a solution comprising a biomass comprising a lignocellulosic material and a pectate lyase wherein the pectate lyase comprises an amino acid sequence according to SEQ ID NO: 1 or an amino acid sequence that is at least 70% identical with SEQ ID NO: 1 , wherein the composition has a pH between 9 and 12.

Moreover, the invention relates to a mechanical pulp, obtained by a method as described herein. Advantageously, the pectate lyase is obtained by

heterologous expression in Escherichia coli.

Detailed description of the invention

Biomass, such as wood and other plant materials used to make pulp contain three main components (apart from water): cellulose fibers (desired for papermaking), lignin (a three-dimensional polymer that binds the cellulose fibers together) and hemicelluloses, (shorter branched carbohydrate polymers). A minor component of wood is pectin (a polymer of galacturonic and/or rhamnogalacturonic acid) which is interlacing hemicellulose and lignin layers, thereby enhancing the strength of the material. In grassy plants, pectin is a major component providing rigidity.

Pulping is a process of preparing pulp. Pulp is a material comprising fibers such as cellulose fibers, mostly from wood. The aim of pulping is to break down the bulk structure of the fiber source, be it wood chips, stems or other plant parts, into the constituent fibers.

Pulp may be produced in a process called mechanical pulping. For the production of mechanical wood pulp, wood may be ground, such as for instance against a water lubricated rotating stone. The heat generated by grinding softens the lignin binding the fibers and the mechanical forces separate the fibers to form groundwood. This process is also referred herein as defibration. Hence, "defibration" as used herein refers to a process of separating wood fibers from each other.

During the second half of the 20th century, newer mechanical techniques using 'refiners' were developed. In a refiner, woodchips are subjected to intensive shearing forces, for example, between a rotating steel disc and a fixed plate. This is also comprised in the term "defibration". Mechanical pulp comprises a mix of whole fibers and fiber fragments of different sizes. Paper made from mechanical pulp has a yellowish/grey tone with high opacity and a very smooth surface. Mechanical pulping provides a good yield from the pulpwood because it uses the whole of the log except for the bark, but the energy requirement for refining is high and can only be partly compensated by using the bark as fuel. The various mechanical pulping methods, such as groundwood (GW) and refiner mechanical (RMP) pulping, physically tear the cellulose fibers one from another. Much of the lignin remains adhered to the fibers. Strength of the fibers may be impaired because the fibers may be cut.

In subsequent modifications to this process, the woodchips are pre- softened by heat (thermo-mechanical pulping (TMP)) to make the defibration more effective. The resulting pulp is light-coloured and has longer fibers. Thermo-mechanical pulping (TMP) is a process in which wood chips are heated and run through a mechanical refiner for defibration (fiber separation), resulting in thermo-mechanical pulp.

In a typical TMP process, wood chips are fed to a presteamer and are steamed with process steam (typically 1 to 2 bar or above 100 degrees Celsius, such as 130 to 140 degrees C). Process steam may be obtained from the refiners. After a retention time of several minutes, the pressurized chips may be fed to the refiner with the feeding screw (plug feeder). The refiner separates the fibers by mechanical force via refiner mechanical means (e.g. between rotating disc plates). The refiner may be fed with fresh steam during startup, to increase the pressure up to 4 or 5 bar and about 150 degrees Celsius.

Thermomechanical pulping therefore refers to a process of producing pulp, which includes heating of biomass to a temperature above 100 degrees Celsius and mechanical defibration.

The term "refine" or "refining" as used herein refers to a mechanical process wherein a pulp is obtained with a measurable Canadian Standard Freeness (CSF). Pulp is characterized by its ability to absorb and retain water which may be quantified as freeness or CSF, measured in milliliters. Defibrated wood material can be considered as pulp if its CSF can be measured. Often and advantageously, mechanical defibration and refining may be performed at a temperature above 100 degrees Celsius.

Pulp is often refined in two stages. The process steam is typically taken to a heat recovery unit to produce clean steam. The refiner discharges the pulp and steam to a cyclone. The cyclone separates the steam from the pulp. As used herein, thermo-mechanical pulp is pulp produced by processing biomass such as wood chips using heat and a mechanical refining movement.

Wood chips are usually produced as follows: the logs are first stripped of their bark and converted into small chips, which have a moisture content of around 25- 30%. A mechanical force is applied to the wood chips in a crushing or grinding action which generates heat and water vapour and softens the lignin thus separating the individual fibers.

The pulp is then screened and cleaned, any material that was not sufficiently refined (did not pass in screening procedure) is separated as "reject" and reprocessed. The TMP process gives a high yield of fiber from the timber (around 95%) and as the lignin has not been removed, the fibers are hard and rigid.

As opposed to mechanical pulping, delignification may also be achieved in a chemical process. A typical example is the so-called "Kraft" delignification process, which uses sodium hydroxide and sodium sulfide to chemically remove lignin. After delignification, the color of the pulp is dark brown. If white paper is desired, the pulp is bleached. Delignified, bleached pulp is fed into paper machines after undergoing other chemical processes that produce the desired quality and characteristics for the paper. A chemical pulp or paper is called wood-free, although in practice a small percentage of mechanical fiber is usually accepted.

Chemical pulping applies so called cooking chemicals to degrade the lignin and hemicellulose into small, water-soluble molecules which can be washed away from the cellulose fibers without depolymerizing the cellulose fibers. This is advantageous because the de-polymerization of cellulose weakens the fibers. Using chemical pulp to produce paper is more expensive than using mechanical pulp or recovered paper, but it has better strength and brightness properties.

A further development of chemical pulping and thermo-mechanical pulping is chemical thermo-mechanical pulping (CTMP). Herein, the wood chips are impregnated with a chemical such as sodium sulphite or sodium hydroxide before the refining step. The end result is a light-coloured pulp with good strength characteristics. The chemical and thermal treatments reduce the amount of energy subsequently required by the mechanical refining, and also reduce the loss of strength suffered by the fibers. In CTMP, wood chips can be pretreated with sodium carbonate, sodium hydroxide, sodium sulfite and other chemicals prior to refining with equipment similar to a mechanical mill. The conditions of the chemical treatment are less vigorous (lower temperature, shorter time, less extreme pH) than in a chemical pulping process since the goal is to make the fibers easier to refine, not to remove lignin as in a fully chemical process.

Wood chips for TMP or CTMP are usually obtained from bark free and fresh tree wood. After manufacturing, the chips are screened to have specified size. For superior quality pulp, and optimal energy consumption, chips usually have thickness of 4- 6 mm and length (dimension along the fibers) of 10 - 50 mm, such as 15 - 40 mm or 16-22 mm. Before refining, the chips may be washed and steamed, these chips have a typical moisture content of above 20% such as around 25-30%.

In comparison, mechanical pulping requires a lot of energy, in the range of 1000-3500 kiloWatthour per ton of pulp whereas the chemical pulping process is self- sufficient. Chemical pulping yield better (longer) fibers whereas the fibers obtained in mechanical pulping are of different sizes. This results in low paper strength. Production costs of mechanical pulp are much less however in comparison to chemical pulping. Mechanical pulping has a yield of 95% as opposed to 45% of the chemical process. The yield in chemical processes is much lower, as the lignin is completely dissolved and separated from the fibers. However, the lignin from the sulphate and some sulphite processes can be burnt as a fuel oil substitute. In modern mills, recovery boiler operations and the controlled burning of bark and other residues makes the chemical pulp mill a net energy producer which can often supply power to the grid, or steam to local domestic heating plants. Nevertheless, chemical pulping has a stronger negative environmental impact than mechanical pulping due to excessive use of aggressive chemicals.

After grinding, the pulp is sorted by screening to suitable grades. It can then be bleached with peroxide for use in higher value-added products.

Freeness is a measure of drainability of a pulp suspension. It characterizes how fine the pulp has been refined. It can be determined by Canadian

Standard Freeness - (CSF) Method (Thode, E. F., and Ingmanson, W. L, Tappi 42(1 ): 74 (1959) especially p. 82.; Technical Section, Canadian Pulp & Paper Association, Official Standard Testing Method C.1 , "The Determination of Freeness") and is measured in milliliters. Higher CSF numbers mean faster draining, less refined pulp. Energy requirement for refining depends on the targeted freeness. Reaching lower freeness requires more energy. "Energy saving" in refining refers to a situation when the same freeness is achieved with less energy.

As used herein, the term "pulp mill" is a manufacturing facility that converts biomass such as wood chips or other plant fiber sources into a thick fiber board which can be shipped to a paper mill for further processing. Pulp can be manufactured using mechanical, thermo-mechanical, chemo thermo-mechanical or fully chemical methods. The finished product may be either bleached or non-bleached, depending on the customer requirements.

As used herein, the term "pulp" is intended to mean a composition comprising lignocellulosic fibrous material prepared by chemically and/or mechanically separating cellulose fibers from wood, fiber crops or waste paper. Pulp is characterized by its ability to absorb water, which can be measured in milliliters as Canadian Standard Freeness (CSF). Wood pulp is the most common raw material in papermaking.

The term lignocellulosic material refers to a material that comprises (1 ) cellulose, hemicellulose, or a combination thereof, and (2) lignin.

The timber resources used to make wood pulp are often referred to as pulpwood. Wood pulp comes from softwood trees such as spruce, pine, fir, larch and hemlock, and hardwoods such as eucalyptus, aspen and birch. Wood chipping is the act and industry of chipping wood for pulp, but also for other processed wood products and mulch. Only the heartwood and sapwood are useful for making pulp. Bark contains relatively few useful fibers and is removed and used as fuel to provide steam for use in the pulp mill.

Most pulping processes require that the wood be chipped and screened to provide uniform sized chips. Manufactured grindstones with embedded silicon carbide or aluminum oxide can be used to grind small wood logs called "bolts" to make stone ground wood pulp (SGW). If the wood is steamed prior to grinding it is known as pressure ground wood pulp (PGW). Most modern mills use chips rather than logs and ridged metal discs called refiner plates instead of grindstones. If the chips are just ground up with the plates, the pulp is called refiner mechanical pulp (RMP) and if the chips are steamed while being refined the pulp is called thermo-mechanical pulp (TMP). Steam treatment significantly reduces the total energy needed to make the pulp and decreases the damage (cutting) to fibers.

An advantageous effect of applying a mechanical force to the wood chips in a crushing or grinding action (herein also referred to as refining) is that it generates heat which softens the lignin thus adds in the separation of individual cellulose fibers.

Pretreatment (an optional step in TMP and obligatory in CTMP) is a process when chips are exposed to a certain chemical or enzymatic solution, or a mechanical treatment before refining. The purpose of pretreatment is to reduce refining energy consumption or to improve pulp properties. Physical pretreatment is often called size reduction and is aiming to reduce the physical size of the chips. This is also called low energy mechanical treatment. Chemical pretreatment is to remove chemical barriers so the cellulose fibers are more easily recoverable.

The term "low energy mechanical treatment" is used herein to indicate a process wherein the biomass containing the lignocellulosic material is subjected to mechanical forces such that the temperature of the biomass does not exceed 95 degrees Celsius.

Pretreatment is also often done by impregnation. Impregnation is a process when chips are first pressurized and upon slow release of pressure, the pretreatment solution is added to the chips. The pressure can be build up by mechanical force (e.g. impregnation screw) or by a steam-cooker principle. Thus impregnation can sometimes combine chemical and mechanical pretreatment. In industrial conditions impregnation is usually done on steamed chips, which facilitates impregnation.

Impregnation improves the penetration of the pretreatment solution inside the wood. Pretreatment may be continued in a reaction vessel following the impregnation stage in the process.

In an alternative procedure, pretreatment includes low energy mechanical treatment (the energy is low as compared to the refining energy) of wood chips to increase the surface of contact with the pretreatment solution. In a low energy mechanical pretreatment, there is no significant production of heat, in other words, the temperature of the wood chips in this step may not exceed 95 degrees C or less, such as 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, or 40 degrees Celsius.

"Destructured wood chips" are wood chips which were partially destroyed as a result of impregnation or low energy mechanical pretreatment. The term "low energy mechanical pretreatment" in this respect is to be interpreted as a process wherein the wood chips are partially destructured but not fiberized.

Defibration is herein defined as the process of separating fibers, preferably by a mechanical process.

In the work described herein we found that a particular enzyme with pectate lyase activity (E.C. 4.2.2.2), was capable of reducing the energy consumption of a commercial mechanical pulping process.

When pectate lyases are used in industrial processes, it is often advantageous that they are stable at higher temperatures (thermostable) and resistant to alkaline conditions. Thermostable alkaline pectate lyases for instance have potential applications in the textile industry as an alternative to chemical-based ramie degumming processes. Such enzymes have been described, and have been isolated and

characterized from bacterial sources, mainly Bacillus [Swarupa Rani Chiliveri et al.,

Carbohydrate Polymers (2014), 1 1 1 : 264-272, Zhou et al., Appl Environ Microbiol (2015) 81 : 5714-5723].

A high thermostability may also be advantageous in applications in pulp and paper industry, where wood material is steamed and heated to 60 degrees Celsius or above, such as 65 degrees Celsius or above for swelling of the wood and improved penetration of the chemicals.

Alkaline conditions in pulping applications also serve the purpose of facilitating the separation of wood fibers. Several alkaliphylic or alkaline pectinases have been described. Damak et al, 2013, (Cloning and heterologous expression of a thermostable pectate lyase from Penicillium occitanis in Escherichia coli., Int J Biol Macromol. V.62 p.549-56) and Damak et al. 201 1 (Purification and biochemical characterization of a novel thermoactive fungal pectate lyase from Penicillium occitanis., Process Biochemistry V 46, Issue 4, P. 888-893) describe a thermoactive alcaline pectate lyase, which is operational at pH 9 but its half life at 60 degrees Celsius is only 16 minutes.

Gang et al, 2010, (Cloning, expression, and characterization of a highly active alkaline pectate lyase from alkaliphilic Bacillus sp. N16-5., J Microbiol

Biotechnol. 2010, V. 20 P:670-7) describe an alkaline pectinase. This pectinase however also retains less then 10 % activity after 30 min at 60 degrees Celsius.

Industrial processes for producing mechanical pulp from a biomass comprising lignocellulosic material are typically and advantageously performed at a high pH in order to facilitate fiber separation. We found that a polypeptide comprising an amino acid sequence according to SEQ ID NO: 1 was able to reduce the energy consumption of a commercial process for producing mechanical pulp by at least 17%, even when the process was performed at a pH between 9 and 12.

The term "high pH" as used herein indicates a strong alkalic

environment, such as a pH between 9 and 12, such as between 10 and 12 or between 1 1 and 12. It may also refer to a pH between 9 and 10, or 9 and 1 1 , such as between 10 and 1 1 . Pectate lyases are an important group of plant cell wall degrading enzymes. They cleave pectin using an eliminative cleavage of (1 ->4)-alpha-D- galacturonan yielding oligosaccharides with 4-deoxy-alpha-D-galact-4-enuronosyl groups at their non-reducing ends. They are mainly produced by plant pathogens and plant- associated organisms, and only rarely by animals. Pectate lyases are also commonly produced in bacteria, either by bacteria living in close proximity with plants or by gut bacteria that find plant material in the digestive tract of their hosts. [Hugouvieux-Cotte- Pattat et al., Environmental Microbiology reports (2014) doi 10, 1 1 1 1/1758-2229, 12166].

Pectate lyases favor pectate, the anion, over pectin, the methylated ester, which is the preferred substrate of pectin lyase E.C. 4.2.2.10. Pectate lyases are also known under different names, such as alpha-1 ,4-D-endopolygalacturonic acid lyase, endo-alpha-1 ,4-polygalacturonic acid lyase, endogalacturonate transeliminase, endopectin methyltranseliminase, pectate transeliminase, pectic acid lyase, pectic acid transeliminase, pectic lyase, pectin trans-eliminase, PGA lyase, polygalacturonate lyase, polygalacturonic acid lyase, polygalacturonic acid trans-eliminase, polygalacturonic transeliminase and PPase-N.

As described in the examples section, we were able to show that wood chips treated with such a pectate lyase were a superior substrate for the preparation of pulp for the paper making industry. The treatment with the pectate lyase resulted in a desirable decrease of the strength of the biomass, such that the energy requirement of the process decreased significantly. This was particularly the case in a thermo-mechanical pulping process.

Hence, the invention relates to a method for reducing the energy requirement of a mechanical pulping process, in particular a thermo-mechanical pulping (TMP) process wherein cellulose fibers are recovered from a biomass comprising lignocellulosic material, wherein the lignocellulosic material is treated with a pectate lyase comprising an amino acid sequence according to SEQ ID NO: 1 , before recovering the cellulose from the lignocellulosic material.

In other terms, the invention relates to a method for recovering cellulose fibers from a biomass comprising lignocellulosic material wherein the method comprises a step wherein the biomass is heated to a temperature above 100 degrees Celsius and subjected to mechanical defibration and wherein the biomass comprising lignocellulosic material is contacted with a pectate lyase comprising an amino acid sequence according to SEQ ID NO: 1 , before it is heated to a temperature above 100 degrees Celsius. In yet other terms, the invention relates to a method for producing mechanical pulp from a biomass comprising lignocellulosic material, the method comprising the steps of contacting the biomass with a pectate lyase at pH 9 -12 and refining the biomass to obtain a mechanical pulp, wherein the pectate lyase comprises an amino acid sequence according to SEQ ID NO: 1 .

We prepared homologous pectate lyases with an identity of 93% and 89% with SEQ ID NO: 1 (SEQ ID NO: 6 and SEQ ID NO: 1 1 respectively) and showed that they may be used for the same purpose, providing the same advantage of saving energy.

Hence, the invention also relates to a method for producing mechanical pulp from a biomass comprising lignocellulosic material, the method comprising the steps of contacting the biomass with a pectate lyase at pH 9 -12 and refining the biomass to obtain a mechanical pulp, wherein the pectate lyase comprises an amino acid sequence according to SEQ ID NO: 1 or an amino acid sequence at least 70% identical with SEQ ID NO: 1 .

In a preferred embodiment, the invention relates to a method as described herein wherein the pectate lyase comprises an amino acid sequence that is at least 89% such as 90%, 91 %, 92%, 93%, 94% or 95% identical to the sequence of SEQ ID NO:1 , preferably 96%, such as 97%, 98% or even at least 99%.

The skilled person will know how to obtain alternative or homologous pectate lyases for use in the present invention. The examples show random and directed mutagenesis methods suitable for that purpose. Homologous pectate lyases may be prepared by conventional recombinant DNA techniques. Dosage may easily be determined by trial and error methods for a given setting in a traditional pulp mill operation. The skilled person will be well aware of methods for optimizing the conditions for optimizing the use of the enzymes as disclosed and described herein.

A particularly preferred substrate in the method according to the invention is wood, a wood chip, a destructured wood chip, defibrated wood, hardwood, softwood, non-wood fiber material, bamboo, bagasse, reed or straw. Hence, in a preferred embodiment, the invention relates to a method as described above wherein the biomass comprising the lignocellulosic material comprises or consists of wood, a wood chip, a destructured wood chip, defibrated wood, hardwood, softwood, non-wood fiber material, bamboo, bagasse, reed, straw or a combination thereof.

In a further preferred embodiment, the invention relates to a method as described above, comprising an additional step of compressing the biomass comprising the lignocellulosic material before contacting it with the pectate lyase.

The method as described above not only decreased the energy consumption of the mechanical pulping or thermo-mechanical pulping process, it was also found to be advantageous in a particular embodiment of the TMP process, namely a chemo thermo-mechanical pulping (CTMP) process. Hence, the invention also relates to a method as described above, wherein the TMP is a chemo thermo-mechanical pulping (CTMP) process.

A chemo-thermo-mechanical pulping process differs from a TMP process in that at least one additional step is added and wherein the biomass containing the lignocellulosic material is impregnated with a composition such as a chemical composition in order to at least partially degrade lignin.

More in particular, in a preferred embodiment, the invention relates to a method as decribed above comprising an additional step of treating the biomass comprising the lignocellulosic materials with a chemical before the biomass is subjected to defibration. In a particularly preferred embodiment the chemical is able to degrade lignin.

The treatment with the pectate lyase may be employed at different stages in the process. First of all, the lignocellulosic material may be contacted with the enzyme after it has been provided in the appropriate dimensions, optionally after cleaning and steaming.

Hence, the invention relates to a method as described herein comprising an additional step of treating the biomass comprising the lignocellulosic material with heat, preferably by steaming, before contacting it with the pectate lyase. In a preferred embodiment, the biomass comprising the lignocellulosic material is heated to a

temperature below the inactivation temperature of the pectate lyase.

For a process wherein the lignocellulosic material is wood, this means that the wood is treated after it is debarked and chopped in pieces and selected for size. These pieces are usually referred to as wood chips. Such wood chips typically have a largest dimension of typically in the order of up to 5 cm, such as 2, 3, or 4 cm.

The biomass comprising the lignocellulosic material may preferably be contacted with the pectate lyase enzyme after washing and or steaming. This makes the material more accessible for the enzyme and increases the moisture content of the material. Hence, the invention relates to a method as described above, wherein the wood has a moisture content of at least 20% and is preheated to a temperature below 100 degrees Celsius before treating the wood with the pectate lyase.

The contacting of the biomass with an enzyme can be performed for a period of time up to one day. While longer enzymatic digestions are possible, a shorter period of time such as 15 minutes, 60 minutes, 1 hour, 2 hours, 3 hours or any time less than these values or any time between any of two of these values may be used for practical or economic reasons. In another preferred embodiment, the enzymatic digestions can take 50, 100, 150 or 200 hours or any time less than these values or any time between any of two of these values. In a further preferred embodiment, the invention relates to a method as described herein wherein the pectate lyase is contacted with the biomass comprising the lignocellulosic material for a duration of between 10 and 120 minutes. Another preferred period of enzyme contact is about 3 days or less.

In one embodiment, the enzyme pretreatment process may be performed at a specific temperature such as, for example at from 30 degrees C to about 80 degrees Celsius; 40 degrees C to 70 degrees C; or 45 degrees C to 65 degrees or 45 degrees C to 60 degrees C, such as at least 50 degrees C or 60 degrees Celsius or 65 degrees Celsius or at room temperature or lower.

As shown in examples 4 and 5, tables 7 and 8 and figures 1 - 3, the energy consumption of processes as described herein can be decreased substantially by using enzymes as disclosed herein in a mechanical pulping process. We have shown that up to 25% of energy saving is possible (Table 7, SEQ ID NO: 1 at CSF 100).

In preferred embodiments the biomass, such as wood chips are impregnated for better contact between the enzyme and the substrate. This is known to the skilled person. In a preferred embodiment, the wood chips are destructured such as defibrated before or after the enzyme treatment.

In certain processes, the temperature of the biomass or lignocellulosic material to be treated may be in excess of the optimum temperature or even above the enzyme inactivation temperature of the enzymes according to SEQ ID NO:s 1 - 3. Since a high temperature may inactivate enzymes by irreversibly denaturing its amino acid chain, the enzyme may advantageously be added to the biomass at a point below the enzyme inactivation temperature. The enzymes may be added within the functional temperature range(s) or at the optimal temperature(s) of the enzyme. In case of biomasses with a high temperature, the enzymes may be added after the biomass has cooled below the inactivation temperature. It is also advantageous if the enzymatic process is completed sufficiently before the temperature has dropped below the optimal functional temperature of the enzyme. Naturally, it is also an option to maintain a desired temperature by cooling or heating the biomass or lignocellulosic material. Adding a dilution liquid, such as water at a certain temperature, may be used to cool the biomass.

We observed that the pectate lyase enzymes as used herein were very stable at high pH values. When the experiments described herein were repeated at pH 9 or pH 12, that resulted in energy savings comparable to the ones detailed herein in the examples.

In an alternative method according to the invention, a more

thermostable pectate lyase may be used so that the process may be conducted at higher temperatures.

We also investigated if the process according to the invention would result in particularly advantageous properties of the pulp obtained. Surprisingly, we observed that paper sheets produced from the pulp obtained in a method according to the invention, had a 10-20% higher tensile index as compared to the reference pulp, obtained without the pectate lyase enzyme. Hence, the invention also relates to mechanical pulp, obtained by a method as described herein.

The present invention addresses this need in that it provides a pectate lyase with improved thermostable properties. More in particular, the invention provides a polypeptide with pectate lyase activity comprising an amino acid sequence that is at least 70% identical to the amino acid according to SEQ ID NO: 1 , wherein the polypeptide comprises a small, polar, non-charged amino acid residue at an amino acid position corresponding to position 235 in SEQ ID NO: 1 .

The invention also relates to a composition comprising a polypeptide as described above, a nucleic acid encoding a polypeptide as described above, a vector comprising such a nucleic acid and a composition comprising such a nucleic acid or a vector.

The invention also provides a recombinant host cell comprising a nucleic acid, a vector or a composition as described above.

Moreover, the invention relates to a method for producing a polypeptide as described above, comprising the steps of: culturing a recombinant host cell as described above, under conditions suitable for the production of the polypeptide, and recovering the polypeptide obtained, and optionally purifying the polypeptide.

In addition, the invention relates to a polypeptide as described above in an application selected from the group consisting of pulp delignification, degrading or decreasing the structural integrity of lignocellulosic material, textile dye bleaching, wastewater detoxification, xenobiotic detoxification, production of a sugar from a lignocellulosic material and recovering cellulose from a biomass.

The invention also relates to a method for improving the thermostability of a polypeptide with pectate lyase activity comprising an amino acid sequence that is at least 70% identical to the amino acid according to SEQ ID NO: 1 , the method comprising the step of altering the amino acid at a position corresponding to position 235 in SEQ ID NO: 1 to a small, polar, non-charged amino acid residue.

The present invention is also partly based on our observation that a single amino acid substitution (K235 variant) in different pectate lyases improves their thermostability.

The term "amino acid substitution" is used herein the same way as it is commonly used, i.e. the term refers to a replacement of one or more amino acids in a protein with one or more other amino acids. Such an amino acid substitution may also be referred to as a mutation, a variation or a variant.

We observed that the thermostability of pectate lyases that were homologous to the polypeptide with an amino acid sequence according to SEQ ID NO: 1 could also be improved by mutation. When the same amino acid variations were introduced at position 235 in polypeptides that were 93% and 89% identical to the polypeptide according to SEQ ID NO: 1 , this also improved the thermostability of the homologous enzymes.

The invention thus relates to a polypeptide with pectate lyase activity comprising an amino acid sequence that is at least 70% identical to the amino acid according to SEQ ID NO: 1 , wherein the polypeptide comprises a small, polar, non- charged amino acid residue at an amino acid position corresponding to position 235 in SEQ ID NO: 1.

Polypeptides with pectate lyase activity are also referred herein as pectate lyases, or pectate lyase enzymes.

The term "pectate lyase activity" is used herein to indicate the ability of a polypeptide to cleave pectin using an eliminative cleavage of (1 ->4)-alpha-D-galacturonan yielding oligosaccharides with 4-deoxy-alpha-D-galact-4-enuronosyl groups at their non- reducing ends.

The term "at least 70%" is used herein to include at least 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 88%, 87%, 88%, 89%, 90% or more, such as 91 %, 92%, 93%, 94%, 95%, 99%, 97%, 98%, 99%, or even 100%.

As used herein, the degree of identity between two or more amino acid sequences is equivalent to a function of the number of identical positions shared by the sequences; i.e., % identity = number of identical positions divided by the total number of aligned positions x 100, excluding gaps, which need to be introduced for optimal alignment of the two sequences, and overhangs. The alignment of two sequences is to be performed over the full length of the polypeptides.

The comparison (aligning) of sequences is a routine task for the skilled person and can be accomplished using standard methods known in the art. For example, a freeware conventionally used for this purpose is "Align" tool at NCBI recourse http://blast.ncbi. nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=b last2s eq&LINK_LOC=align2seq, Other commercial and open software such as Vector NTI are also suitable for this purpose,

Introduction of a specific mutation in a recombinant gene is also among the routine skills of a molecular biologist. Specific guidance may be obtained from

Methods in Molecular Biology Vol 182, "In vitro mutagenesis protocols", Eds Jeff Braman, Humana Press 2002. There are commercially available kits for performing site-directed mutagenesis (for example, QuikChange II XL Site-Directed Mutagenesis kit Agilent Technologies cat No 200521 ).

SEQ ID NO: 1 provides the amino acid sequence of a known polypeptide

[Takao et al, Biosci. Biotechnol. Biochem. (2000) 64: 2360-2367, Takao et al., Biosci. Biotechnol. Biochem. (2001 ) 65: 322-329] with pectate lyase activity. We replaced the lysine residue at position 235 of SEQ ID NO: 1 with a small, polar, non-charged amino acid residue in order to obtain the K235 variants described herein. Exemplified herein are the variants K235T, K235C, K235S and K235N. This annotation is used herein to indicate a replacement of the amino acid residue corresponding to position 235 of SEQ ID NO: 1 with either one of the residues T (threonine), C (cysteine), S (serine) or N (asparagine), thereby obtaining the polypeptides according to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively. We found that the thermostability of the enzyme was thereby remarkably improved.

More specifically, in the thermostability assay, the polypeptides were heated to 70, 75 or 80 degrees Celsius for 10 minutes in 50 mM Tris-HCI at pH 8.0. The residual activity was measured at 60 degrees Celsius at pH 8.0 as described in example 3 and compared to the residual activity of the same polypeptides after preincubation at room temperature for 10 minutes. The results are shown in figures 4 - 6.

In more detail, we measured the residual relative pectate lyase activity after heat treatment of polypeptides with an amino acid sequence according to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 and compared this activity to that of a polypeptide with an amino acid sequence of SEQ ID NO: 1 after the same pre-treatment. We found that the introduction of the K235 mutation improved the thermostability of the pectate lyase enzyme.

This phenomenon appeared not to be restricted to the polypeptide with an amino acid sequence according to SEQ ID NO: 1 , but was also observed in polypeptides homologous to the polypeptide according to SEQ ID NO: 1. Accordingly, we found that this amino acid position 235 could be changed in polypeptides with an amino acid sequence homologous to the sequence according to SEQ ID NO: 1 with the same effect. We constructed two pectate lyases that were 93% (SEQ ID NO: 6) and 89% (SEQ ID NO: 1 1 ) identical with the amino acid sequence according to SEQ ID NO: 1 and found that these two homologous enzymes also had an improved thermostability when the amino acid corresponding to position 235 in SEQ ID NO: 1 was changed to small, polar, non- charged amino acid residue.

Whereas the wild type sequence (SEQ ID NO: 1 ) only displayed 60% of its activity when pre-incubated at 70 degrees Celsius for 10 minutes, the variant polypeptides with the 235 mutation (K235T, K235S, K235N and K235C) were all at least as active as when pre-incubated at room temperature (table 1 and figure 4).

Table 1 ; Thermostability of SEQ ID NO: 1 and its K235 variants

Moreover, whereas the wild-type enzyme (WT, SEQ ID NO: 1 ) was not active anymore after pre-incubation at 75 degrees Celsius for 10 minutes, the K235 variants where active, even up to a level of 50% of the activity of the same enzyme, pre-incubated at room temperature for 10 minutes (figure 4).

Even more surprisingly, we found that the K235 variants were all able to resist pre-incubation at 80 degrees Celsius for 10 minutes, even up to a level of 35% of the activity of the same enzyme, pre-incubated at room temperature for 10 minutes (figure 4).

The expression "the amino acid corresponding to position 235 in SEQ ID NO: 1 " is to be understood as follows. If such a position is to be determined in a given amino acid sequence that is at least 70% identical with the amino acid sequence according to SEQ ID NO: 1 , then the two sequences are first to be aligned. That may be done by routine methods and software available in the art. The amino acid in the given amino acid sequence corresponding to amino acid 235 in SEQ ID NO: 1 is then the amino acid aligning with the lysine residue at position 235 in SEQ ID NO: 1.

We performed a homology search for proteins homologous to SEQ ID NO: 1 using SEQ ID NO: 1 as the query sequence in the "Standard protein BLAST" software, available at

http://blast.ncbi. nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSear ch&LI NK_LOC=blasthome. More information on the software and database versions is available at the National Center for Biotechnology Information at National library of Medicine at National institute of Health internet site www.ncbi.nlm.nih.gov. Therein, a number of molecular biology tools including BLAST (Basic Logical Alignment Search Tool) is to be found. BLAST makes use of the following databases: All non-redundant GenBank CDS translations + PDB + SwissProt + PIR + PRF excluding environmental samples from WGS projects.

There were no polypeptides found comprising an amino acid sequence that is at least 70% identical to the amino acid according to SEQ ID NO: 1 .

The term "amino acid variant", "variant", "mutant" or "sequence variant" or equivalent has a meaning well recognized in the art and is accordingly used herein to indicate an amino acid sequence that has at least one amino acid difference as compared to another amino acid sequence, such as the amino acid sequence from which it was derived.

We also constructed homologous polypeptides, having 93% and 89% sequence identity to the wild type sequence according to SEQ ID NO: 1. These homologous polypeptides are referred to herein as polypeptides according to SEQ ID NO: 6 (93% identical) and SEQ ID NO: 1 1 (89% identical).

We found that K235 variants of these polypeptides also had an improved thermostability (tables 2 and 3 and figures 5 and 6). Table 2; Thermostability of SEQ ID NO: 6 and its K235 variants

Table 3; Thermostability of SEQ ID NO: 1 1 and its K235 variants

The term "improved thermostability" as used herein means that the K235 variant polypeptides exhibited more pectate lysase activity after preincubation at elevated temperatures as compared to the activity of the same polypeptides without the mutation at position 235, such as the wild type sequence (SEQ ID NO: 1 ) or the two homologous polypeptides according to SEQ ID NO: 6 and SEQ ID NO: 1 1 as described herein.

Thermostable pectate lyases have been described to be produced by bacteria of the genus Bacillus [Takao et al, Biosci. Biotechnol. Biochem. (2000) 64: 2360-2367, Takao et al., Biosci. Biotechnol. Biochem. (2001 ) 65: 322-329, Swarupa Rani Chiliveri et al., Carbohydrate Polymers (2014), 1 1 1 : 264-272, Zhou et al., Appl Environ Microbiol (2015) 81 : 5714-5723], hence in a preferred embodiment the invention relates to a polypeptide as described herein wherein the polypeptide is capable of being expressed in a bacterium, such as a Bacillus species, more preferably Bacillus subtilis.

We have shown that several polypeptides may be produced that are homologous to the wild-type sequence and still retain their pectate lyase activity. A BLAST search revealed that pectate lyases are available from bacterial origin, in particular from Bacillus species, with an identity as low as 52% or less as compared to SEQ ID NO: 1. The skilled person will therefore have no difficulty in constructing a polypeptide with pectate lyase activity that is at least 70% identical to the sequence of SEQ ID NO: 1 following the procedures and guidance provided herein. He will also be able to make the K235 variants as described herein, thereby obtaining a pectate lyase with an improved thermostability.

In a preferred embodiment, the invention relates to a polypeptide as described herein comprising an amino acid sequence that is at least 75% identical to the amino acid according to SEQ ID NO: 1 , such as 80%, 85%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100%.

Recovery of a polypeptide according to the invention as produced by a host cell may be performed by any technique known to those skilled in the art. Possible techniques include, but are not limited to secretion of the protein into the expression medium, and purification of the protein from cellular biomass. The production method may further comprise a step of purifying the polypeptide obtained. For thermostable

polypeptides, non-limiting examples of such methods include heating of the disintegrated cells and removing coagulated thermo labile proteins from the solution. For secreted proteins, non-limiting examples of such methods include ion exchange chromatography, and ultra-filtration of the expression medium. It is preferred that the purification method of choice is such that the purified protein retains its activity.

Accordingly, in a further preferred embodiment, the invention relates to a polypeptide as described herein wherein the polypeptide is an isolated polypeptide.

We have shown herein that the K235 variants as described herein have an improved thermostability.

The polypeptides as described herein may be used in compositions containing several additional components, such as stabilizers, fillers, cell debris, culture medium etcetera. Hence, the invention provides a composition comprising a polypeptide as described herein.

Polypeptides as described herein may be obtained by expressing a recombinant DNA in a heterologous expression system as exemplified in examples 9 and 10. The term "heterologous expression system" or equivalent means a system for expressing a DNA sequence from one host organism in a recipient organism from a different species or genus than the host organism. The most prevalent recipients, known as heterologous expression systems, are chosen usually because they are easy to transfer DNA into or because they allow for a simpler assessment of the protein's function. Heterologous expression systems are also preferably used because they allow the upscaling of the production of a protein encoded by the DNA sequence in an industrial process. Preferred recipient organisms for use as heterologous expression systems include bacterial, fungal and yeast organisms, such as for example Escherichia coli, Bacillus, Corynebacterium, Pseudomonas, Pichia pastoris, Saccharomyces cerevisiae, Yarrowia lipolytica, filamentous fungi and many more systems well known in the art.

The presently disclosed polypeptides or proteins may be fused to additional sequences, by attaching or inserting, including , but not limited to, affinity tags, facilitating protein purification (S-tag, maltose binding domain, chitin binding domain), domains or sequences assisting folding (such as thioredoxin domain, SUMO protein), sequences affecting protein localization (periplasmic localization signals etc), proteins bearing additional function, such as green fluorescent protein (GFP), or sequences representing another enzymatic activity. Other suitable fusion partners for the presently disclosed polypeptides are known to those skilled in the art.

The present invention also relates to polynucleotides encoding any of the pectate lyase variants disclosed herein. Means and methods for cloning and isolating such polynucleotides are well known in the art.

Furthermore, the present invention relates to a vector comprising a polynucleotide according to the invention, optionally operably linked to one or more control sequences. Suitable control sequences are readily available in the art and include, but are not limited to, promoter, leader, polyadenylation, and signal sequences.

Pectate lyase variants according to various embodiments of the present invention may be obtained by standard recombinant methods known in the art. Briefly, such a method may comprise the steps of: culturing a recombinant host cell as described above under conditions suitable for the production of the polypeptide, and recovering the polypeptide obtained. The polypeptide may then optionally be further purified.

A large number of vector-host systems known in the art may be used for recombinant production of the pectate lyases as described herein. Possible vectors include, but are not limited to, plasmids or modified viruses which are maintained in the host cell as autonomous DNA molecule or integrated in genomic DNA. The vector system must be compatible with the host cell used as is well known in the art. Non-limiting examples of suitable host cells include bacteria (e.g. E.coli, bacilli), yeast (e.g. Pichia Pastoris, Saccharomyces Cerevisiae), fungi (e.g. filamentous fungi) insect cells (e.g. Sf9).

In yet other terms, the invention relates to a method for improving the thermostability of a polypeptide with pectate lyase activity comprising an amino acid sequence that is at least 70% identical to the amino acid according to SEQ ID NO: 1 , the method comprising the step of altering the amino acid at a position corresponding to position 235 in SEQ ID NO: 1 to a small, polar, non-charged amino acid residue. Surprisingly, we found that the thermostability of the above described K235 variant polypeptides could be even further improved if another variation was introduced in addition to the K235 variation. We introduced an A231 L variant into SEQ ID NO: 1 and found that this variation on its own improved the thermostability of the polypeptide (table 4, figure 7).

As used herein, the term "A231 L variant" indicates that the amino acid corresponding to the residue at position 231 of SEQ ID NO: 1 (alanine) is replaced by a leucine residue.

Table 4: Thermostability of a polypeptide according to SEQ ID NO 1 and its variants.

Surprisingly, the polypeptides carrying both the A231 L variation and the K235 variations were more thermostable than each of the variant polypeptides alone. The effect was even found to be synergistic. Whereas the polypeptide according to SEQ ID NO: 1 did not have any significant residual activity after pre-incubation at 75 degrees C, the

A231 L variant as well as the K235T and K235S variants retained 20%, 50% and 50% of their activity relative to the activity after pre-incubation at room temperature (relative activity, table 4 and figure 4). When both the A231 L and K235T mutations were introduced into SEQ ID NO: 1 , the relative activity of this double mutant (after pre-incubation at 75 C) improved to 90%. The same effect was found for the A231 L and K235S double mutant of the polypeptide according to SEQ ID NO: 1. Therein the activity of the double mutant remained at 100% after pre-incubation at 75 degrees Celsius for 10 minutes.

Most remarkably, the double mutants were exceptionally active after preincubation at 80 degrees Celsius. Whereas the A231 L variant of SEQ ID NO: 1 was no longer active after pre-incubation at 80 degrees Celsius, in combination with the K235 variants, it improved the thermostability from K235T variant from 35% to 80% and the thermostability of the K235S variant from 35 to 70% (table 4, figure 7)

We further investigated if this phenomenon also occurred with polypeptides that were homologous to the polypeptide according to SEQ ID NO: 1. For that purpose we introduced the A231 L single and double mutations in polypeptides according to SEQ ID NO: 6 and 1 1 (93% and 89% identical with SEQ ID NO: 1 respectively). We observed that the thermostability of these polypeptides could also be improved in the same manner as described above for the polypeptide according to SEQ D NO: 1.

The single mutation A231 L in SEQ ID NO: 6 improved the thermostability as shown in table 5. The double mutant A231 L plus K235N improved the thermostability synergistically, i.e. more than the sum of the contributions of each of the mutations separately. After pre-incubation at 75 degrees Celsius, the relative activity of the A231 L and K235N variants still was 25% and 30% respectively, whereas the combination of both mutations resulted in 80% relative activity.

Most remarkably, the double mutants were exceptionally active after preincubation at 80 degrees Celsius. The A231 L variant of SEQ ID NO: 1 was not significantly active after pre-incubation at 80 degrees Celsius. However, in combination with the K235N variant, it improved the thermostability of the double mutant from 20% to 70% (table 5, figure 8).

Table 5: Thermostability of a polypeptide according to SEQ ID NO 6 and its variants.

The single mutation A231 L in SEQ ID NO: 1 1 improved the thermostability as shown in table 6. The double mutant A231 L plus K235C improved the thermostability synergistically, i.e. more than the sum of the contributions of each of the mutations separately. After pre-incubation at 75 degrees Celsius, the A231 L and K235C variants still had 18% and 35% relative activity respectively, whereas the combination of both mutations resulted in 90% relative activity.

Most remarkably, the double mutants were exceptionally active after pre- incubation at 80 degrees Celsius. The A231 L variant of SEQ ID NO: 1 1 was not significantly active after pre-incubation at 80 degrees Celsius. However, in combination with the K235C variant, it improved the thermostability of the double mutant from 10% to 80% (table 6, figure 9).

Table 6: Thermostability of a polypeptide according to SEQ ID NO 1 1 and its variants. Temp SEQ ID NO: 11 A231 L K235C A231 +K235C

RT 100 100 100 100

70C 50 100 105 100

75C 1 18 35 90

80C 1 1 10 80

Hence, the invention also relates to a K235 variant polypeptide and its use as described herein, additionally comprising a leucine residue at an amino acid position corresponding to position 231 in SEQ ID NO: 1.

The invention also relates to a method for improving the thermostability of a polypeptide with pectate lyase activity comprising an amino acid sequence that is at least 70% identical to the amino acid according to SEQ ID NO: 1 , the method comprising the step of altering the amino acid at a position corresponding to position 235 in SEQ ID NO: 1 to a small, polar, non-charged amino acid residue and altering the amino acid at a position corresponding to position 231 in SEQ ID NO: 1 to a leucine residue.

In a further preferred embodiment, the invention relates to any of the methods as described above, wherein the polypeptide with pectate lyase activity is capable of being expressed in a bacterium, such as a Bacillus species, more preferably Bacillus subtilis.

The polypeptides with pectate lyase activity according to the present invention may be used in a wide range of different industrial processes and applications, such as cellulose recovery from lignocellulosic biomass, decreasing the energy required for the refining of wood and production of a sugar from a lignocellulosic material. They may also be used in wood pulp preparation, in pulp delignification, textile dye bleaching, wastewater detoxifixation, xenobiotic detoxification, degrading or decreasing the structural integrity of lignocellulosic material and detergent manufacturing.

In another embodiment, the invention relates to a composition such as a fluidic composition comprising a biomass comprising a lignocellulosic material and a pectate lyase wherein the pectate lyase comprises an amino acid sequence according to SEQ ID NO: 1 or an amino acid sequence that is at least 70% identical with SEQ ID NO: 1 , wherein the composition has a pH between 9 and 12.

In a preferred embodiment, the pectate lyase has an amino acid sequence that is at least 89%, such as at least 93% or at least 95% identical to the sequence according to SEQ ID NO:1 , preferably 96%, such as 97%, 98% or at least 99%.

The invention also relates to a mechanical pulp, obtained by a method as described herein. In a preferred method, composition or mechanical pulp, the pectate lyase is obtained by heterologous expression in Escherichia coli.

The methods as described herein could even be further improved when an enzyme capable of degrading lignin was contacted with the biomass. The procedure outlined in examples 4 and 5 shows that energy consumption could be decreased up to 33% when a bacterial laccase comprising an amino acid sequence according to SEQ ID NO: 54 was used in addition to a pectate lyase.

Hence, the invention also relates to the methods and compositions as described herein wherein the enzyme capable of degrading lignin has an amino acid sequence according to SEQ ID NO: 54 or an amino acid sequence at least 90% identical with SEQ ID NO: 54.

In a preferred embodiment, the invention relates to a method as described herein wherein the enzyme capable of degrading lignin comprises an amino acid sequence that is at least 91 %, such as 92%, 93%, 94% or 95% identical to the sequence of SEQ ID NO: 54, preferably 96%, such as 97%, 98% or even at least 99%, such as 100%.

Examples

Example 1 : Preparation of a polypeptide according to SEQ ID NO: 1.

The DNA construct disclosed in Takao et al., Biosci. Biotechnol. Biochem.

(2001 ) 65: 322-329 encoding the polypeptide according to SEQ ID NO: 1 was optimized for expression in E. coli and commercially synthesized and cloned into a standard plasmid vector pET28a+ under the control of T7-RNA-polymerase promoter for expression in Escherichia coli BL21 (DE3). The nucleotide sequence of the construct is provided herein as SEQ ID NO: 16.

Example 2: Preparation of variants of a polypeptide according to SEQ ID NO: 1 with pectate lyase activity.

Homologous protein sequences (according to SEQ ID NO: 6 and SEQ ID NO: 1 1 ) were generated by random mutagenesis of SEQ ID NO:s 16 and SEQ ID NO: 21 using error-prone PCR essentially as described (Curr Protoc Mol Biol. 2001 May; Chapter 8: Unit 8.3. doi: 10.1002/0471 142727. mb0803s51 , Random mutagenesis by PCR. Wilson DS1 , Keefe AD) using a commercial random PCR mutagenesis kit (QuikChange® II XL Site-Directed Mutagenesis kit by Agilent Technologies). More in particular, the DNA sequence of SEQ ID NO: 21 was obtained from SEQ ID NO: 16 encoding the polypeptide according to SEQ ID NO: 1. The DNA sequence of SEQ ID NO: 26 was obtained by random mutagenesis of SEQ ID NO: 21 encoding the polypeptide according to SEQ ID NO: 6. SEQ ID NO: 26 is the DNA sequence encoding the polypeptide according to SEQ ID NO: 1 1.

PCR fragments resulting from error-prone PCR were cloned into the plasmid vector pET28a+ under the control of T7-RNA-polymerase promoter for expression in Escherichia coli BL21 (DE3), and screened for pectate lyase activity of the recombinant proteins.

Active clones were subjected to further rounds of randomization using the same protocol. The polypeptide according to SEQ ID NO: 6 exhibited pectate lyase activity and was found to be 93% identical with SEQ ID NO: 1 . The polypeptide according to SEQ ID NO: 1 1 also exhibited pectate lyase activity and was found to be 89% identical with SEQ ID NO: 1 .

Example 3: Pectate lyase activity assay.

Pectate lyase activity assay was carried out essentially as described in Takao M, Nakaniwa T, Yoshikawa K, Terashita T, Sakai T., "Purification and characterization of thermostable pectate lyase with protopectinase activity from thermophilic Bacillus sp. TS 47". Biosci Biotechnol Biochem. 2000 64:2360-7. In more detail, pectate lyase activity was assayed by measuring the increase in absorbance at 235 nm of the reaction mixture. Polygalacturonic acid (PGA) sodium salt from de-methylated citrus pectin (purchased from MegaZyme) was used as substrate. A reaction mixture containing 1 ml of 0.1 % PGA in 10 mM Tris-HCI buffer, pH 8.0 and 0.5 mM CaCI2 (pre-warmed to 60 C), and an appropriate amount of enzyme solution was incubated for 30 min at 60 C.

The reaction was stopped by placing the mixture in 100 degrees C (boiling water bath) for 5 minutes.

Relative pectate lyase activity was calculated from the difference in absorption of the reaction mixture at 235 nm at the start and at the end of the reaction.

One unit of pectate lyase activity was defined as the enzyme amount oxidizing

1 micro mole of substrate per min. Using absorption coefficient of the unsaturated bond at the 4-5 position of the uronic acid residue at 235 nm 4 600 mol-1 x cm-1 .

Example 4 Mechanical pulping procedure with enzyme impregnation Mechanical pulp was manufactured at a high-yield pulp pilot plant at the facilities of CTP I nTech Fibres, Grenoble, France. Wood chips were pre-steamed at 90- 100°C during 10 minutes at atmospheric pressure in a bin, in which the chips were introduced and the steam diffused at the bottom with a steam feeding system.

After steaming, the chips were fed to a 6" MSD RT-Pressafiner

(MSD=modular screw device, R=retention, T=temperature) with a pressurised inlet at a compression ratio of 5:1 . The compression zone of the MSD RT-Pressafiner is a screw press with an increasing shaft diameter where the chips are compressed as they are fed forward through the narrowing gap between the shaft and the outer casing. During this process, water and extractives are pressed out of the chips through holes in the outer casing.

At the output of the MSD Pressafiner, the chips were directly fed into an impregnation tank containing an impregnation fluid. The impregnation fluid was heated by passing into a hot water heat exchanger and re-circulated continuously during the reaction time.

For each trial, a quantity of spruce chips was used, corresponding to 7 kilograms of dry weight. The impregnation tank was filled with 65 liter of impregnation fluid, in which the chips were introduced in totality. The impregnation was followed by incubation for 60 minutes at 65 degrees Celsius at atmospheric pressure.

Two reference runs using impregnation fluid without the enzyme were performed - one at the beginning and one at the end of the series. These are referred to herein as reference 1 and reference 2.

Impregnation fluid contained 2% NaOH, the pH was adjusted to 1 1 .0 with Succinic acid and 10,000,000 units of pectate lyase (standard activity measured at pH 8.0, see example 3) added per ton of dry wood. After the reaction with wood chips, the pH was measured again and was found to be between 10.0 and 10.5.

At the end of the reaction time, the impregnation fluid was drained from the impregnation tank and the chips were collected to be defibrated using Sprout Waldron D2A507 Ni Hard refiner plates.

After this defibration step, the fibers were refined into mechanical pulp using

12SA001 refiner discs. Pulps were refined to four different freeness levels. The freeness level (Canadian Standard Freeness, CSF) was determined for each sample according to the international standard.

Power in kW was measured on the motors by the pilot plant automation every 15 seconds and the average power was determined that was consumed for the period during which the pulp flow was measured. The pulp flow was evaluated by sampling pulps during an exact period of time, by weighting this sample and by determining the dry matter of this sample. The energy consumption in kWh/t was calculated by dividing the average power in kW by the pulp flow in t/h:

Energy consumption = Power (kW)/o.d. pulp flow (t/h).

Defibration energy was added to refining energy to give the full energy consumption. A representative example of energy curves is given in figure 1 .

The results obtained with the different enzymes as described herein are shown in table 7 and figure 2.

Table 7. Specific energy consumption (SEC, kWh/t) corresponding to SCF 100 ml and 300 ml (interpolated from energy curves as shown on figure 1 ) and energy saving figures for different enzyme compositions disclosed herein.

Example 5: Mechanical pulping procedure: enzymatic treatment of wood biomass after defibration.

Mechanical pulp was manufactured at a high-yield pulp pilot plant at the facilities of CTP I nTech Fibres, Grenoble, France. Wood chips were pre-steamed at 90- 100°C during 10 minutes at atmospheric pressure in a bin, in which the chips were introduced and the steam diffused at the bottom with a steam feeding system.

After steaming, the chips were defibrated using Sprout Waldron D2A507 Ni Hard refiner plates. Subsequently, the defibrated material was subjected to enzymatic treatment.

For each trial, a quantity of defibrated spruce was used, corresponding to 7 kilograms of dry weight. A reaction tank was filled with 65 liter of fluid containing the enzyme having the same composition as the impregnation fluid in Example 4 in which the wood biomass was introduced in totality. The wood material was contacted with the fluid containing the enzyme for the duration of 60 minutes at 65 degrees Celsius at

atmospheric pressure. The fluid was heated by passing into a hot water heat exchanger and re-circulated continuously during the reaction time.

Two reference runs using the same procedure and compositions without the enzyme were performed - one at the beginning and one at the end of the series. These are referred to herein as reference 3 and reference 4

At the end of the reaction time, the fluid was drained from the tank and the material was collected to be refined into mechanical pulp using 12SA001 refiner discs. Pulps were refined to four different freeness levels. The freeness level (Canadian

Standard Freeness, CSF) was determined for each sample according to the international standard.

Power in kW was measured on the motors by the pilot plant automation every 15 seconds and the average power was determined that was consumed for the period during which the pulp flow was measured. The pulp flow was evaluated by sampling pulps during an exact period of time, by weighting this sample and by determining the dry matter of this sample. The energy consumption in kWh/t was calculated by dividing the average power in kW by the pulp flow in t/h:

Energy consumption = Power (kW)/o.d. pulp flow (t/h).

Defibration energy consumption was added to refining energy to give the full specific energy consumption (SEC).

The results obtained with the different enzymes as described herein are shown in table 8 and figure 3.

Table 8. Specific energy consumption (SEC, kWh/t) corresponding to SCF 100 ml and 300 ml (interpolated from energy curves as shown on figure 1 ) and energy saving figures for different enzyme compositions disclosed herein.

Enzyme preparation SEC at SEC at % SEC saving at % SEC saving

CSF 100 CSF 300 CSF 100 at CSF 300

Ref (average of 2) 2500 1950 0.0 0

Seq ID No: 1 1905 1560 23.8 20

Seq ID No: 6 2000 1619 20.0 17

Seq ID No: 1 1 1964 1599 21.4 18

Seq ID No: 2 1905 1560 23.8 20 Enzyme preparation SEC at SEC at % SEC saving at % SEC saving CSF 100 CSF 300 CSF 100 at CSF 300

Seq ID No: 40 1881 1541 24.8 21

Seq ID No: 40 and

1725 1404 31 28 SEQ ID NO: 54

Example 6: Preparation of a polypeptide according to SEQ ID NO: 54.

The DNA construct encoding the polypeptide according to SEQ ID NO: 54 was optimized for expression in E. coli and the DNA sequence of SEQ ID NO: 55 was obtained. This sequence was commercially synthesized and cloned into a standard plasmid vector pET28a+ under the control of T7-RNA-polymerase promoter for expression in Escherichia coli BL21 (DE3).

Example 7: Laccase activity measurement.

The term "laccase activity" is used herein to mean the capability to act as a laccase enzyme, which may be expressed as the maximal initial rate of the specific oxidation reaction. Relative activity was measured by oxidation of syringaldazine.

Reaction course was monitored by change in absorbance at 526 nM (extinction coefficient of syringaldazine at 526 nm is 65 000 M-1 cm-1 ). The appropriate reaction time was determined to provide initial rates of oxidation when color development is linear in time.

Syringaldazine concentration in the reaction mixture was 1 mM to provide maximum initial rates (substrate saturation conditions).

Typically, reactions were carried out in 1 ml volume of 50 mM Tris-HCI buffer pH 8, the substrate was preheated to the desired temperature (60 degrees Celsius) and reaction was initiated by the addition of the enzyme. After the reaction time has elapsed, absorbance at 526 nm of the reaction mixtures was determined by a

spectrophotometer, and the absorbence of the blank sample (containing no enzyme) was subtracted.

One unit of laccase activity was defined as the enzyme amount oxidising 1 micro mole of substrate per minute.

Example 8: Preparation of A231 L and K235 variant polypeptides.

In order to prepare polypeptide according to SEQ ID NO:s 2 - 5, mutations were inserted into the DNA coding for polypeptide according to SEQ ID NO: 1 at position 235. As a result, the lysine residue from that position in SEQ ID NO: 1 was replaced with either one of the residues T (threonine), C (cysteine), S (serine) or N (asparagine), thereby resulting in the polypeptides according to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

These variants are referred to herein as K235T, K235S, K235N and K235C respectively.

This was achieved by standard site-directed mutagenesis essentially as described in WO 2013/038062. In more detail: To introduce mutation A231 L into the genes encoding SEQ ID NO: 1 , SEQ ID NO: 6 and SEQ ID NO: 1 1 , we carried out two separate PCR reactions:

(1 ) with primers Primer 1 gaaattaatacgactcactatagg (SEQ ID NO: 31 ) and

Primer 2(A231 L) GCCATCATGCTGCTGAAACGGACGACCAAAATAGGTG (SEQ

ID NO: 38),

(2) with Primer3(A231 L) GGTCGTCCGTTTCAGCAGCATGATGGCctgCTGGATATC (SEQ ID NO: 39) and Primer 4 ggttatgctagttattgctcagcggtg (SEQ ID NO: 32).

In both reactions, recombinant gene without the mutation was used as the template. Primers 1 and 4 bind inside the vector sequence and are not specific to the recombinant gene. Primers 2 and 3 bind inside the recombinant gene and their binding sites overlap. Primer 3 binding site contains the mutation site. Primer 3 represents the mutated (desired) sequence, which is not 100% matching the template (lower case type font in the primer sequence indicates the mismatched nucleotides). However, the primer has enough affinity and specificity to the binding site to produce the desired PCR product. Purified PCR products from reactions (1 ) and (2) were combined and used as template for PCR reaction with Primer 1 and Primer 4. The products of this reaction, containing the A231 L variant sequence of the genes encoding the polypeptides according to SEQ ID NO:s 48 - 50 was cloned in a plasmid vector for expression in E. coli.

The same protocol and the same primers 1 and 4 were used for introducing the K235 mutations into the genes encoding the polypeptide according to SEQ ID NO: 1 , SEQ ID NO: 6 and SEQ ID NO: 1 1 . Primer 3 used for introducing the K235 mutations was AATAGCAGCGATTTTATCACCATCAGCTACAACGTGTTTA (SEQ ID NO: 37). The specific Primers 2 used for the mutations K235T, K235S, K235N and K235C are listed in table 9.

Table 9; primers used for introducing the 231 and 235 mutations.

Seq ID Primer name Sequence (5'-3')

NO: Seq ID Primer name Sequence (5'-3')

NO:

31 Primer 1 G AAATTAATAC GACTCACTATAG G

32 Primer 4 G GTTATG CTAGTTATTG CTCAG CG GTG

33 Primer 2 GCTGATGGTGATAAAATCGCTGCTATTggTGATATCCAG

K235T

34 Primer 2 GCTGATGGTGATAAAATCGCTGCTATTgcTGATATCCAG

K235S

35 Primer 2 GCTGATGGTGATAAAATCGCTGCTATTgTTGATATCCAG

K235N

36 Primer 2 GCTGATGGTGATAAAATCGCTGCTATTgcaGATATCCAG

K235C

37 Primer 3 K235 AATAGCAGCGATTTTATCACCATCAGCTACAACGTGTTTA

38 Primer 2 A231 GCCATCATGCTGCTGAAACGGACGACCAAAATAGGTG

39 Primer 3 GGTCGTCCGTTTCAGCAGCATGATGGCctgCTGGATATCA

A231 L

Double mutants were prepared by introducing the mutation into the DNA encoding a polypeptide carrying a single mutation. Example 9: Heterologous expression of polypeptides with pectate lyase activity.

For recombinant expression in E. coli, recombinant genes were cloned into pET-28 commercial expression vector under the control of T7 bacteriophage promoter.

Protein production was carried out in E.coli BL21 (DE3) strain according to the plasmid manufacturer protocol available at

http://richsingiser.com/4402/Novagen%20pET%20system%20man ual.pdf. The incubation temperature for protein production was 30 degrees C, which was found optimal for maximum yield of the active protein. Cells were lysed using PL lysis buffer (20 mM Sodium Citrate pH7.4, 1 % Triton X100, 0.5 mM CaCI) and heated at 60 degrees C for 20 minutes. Coagulated cell debris was removed by centrifugation. The thermostable recombinant pectate lyases were detected in the soluble fraction only, consistent with the notion that they are thermostable enzymes.

Example 10: Heterologous expression of polypeptides with laccase activity. For recombinant expression in E. coli, recombinant genes were cloned into pET-28 commercial expression vector under the control of T7 bacteriophage promoter.

Protein production was carried out in E.coli BL21 (DE3) strain according to the plasmid manufacturer protocol available at

http://richsingiser.com/4402/Novagen%20pET%20system%20man ual.pdf . The incubation temperature for protein production was 30 degrees C, which was found optimal for maximum yield of the active protein. Cells were lysed using laccase lysis buffer (20 mM Sodium Citrate pH7.4, 1 % Triton X100, 1 mM CuCI2) and heated at 70 degrees C for 20 min. Coagulated cell debris was removed by centrifugation. The thermostable

recombinant laccases were detected in the soluble fraction only, consistent with the notion that they are thermostable enzymes.

Example 1 1 : Thermostability of polypeptides with pectate lyase activity.

Thermostability of the polypeptides with pectate lyase activity was determined by pre-incubation for 10 minutes in 50 mM Tris-HCI pH 8.0, either at room temperature (control) or at 70 degrees C, 75 degrees C and 80 degrees C before measuring their activity according to example 3.

After pre-incubation, the samples were brought to 60 degrees C, substrate (PGA) was added and samples were assayed for activity as described in Example 3 at 60 degrees C pH 8.0. Residual activities for each sample were calculated as % of the activity of the corresponding sample pre-incubated at room temperature (control sample).

Example 12: Sequences provided herein

Amino acid sequence and nucleotide sequences are provided herewith in the WIPO ST_25 standard. For convenience the sequences are also provided in table 10.

SEQ ID NO: 1 is derived from the prior art and has been disclosed in Takao et al, Biosci. Biotechnol. Biochem. (2000) 64: 2360-2367 and in Takao et al., Biosci.

Biotechnol. Biochem. (2001 ) 65: 322-329.

Amino acids corresponding to positions 231 and 235 in SEQ ID NO: 1 are shown in bold and underlined type face.

SEQ ID NO: 6 was obtained by random mutagenesis of the DNA encoding SEQ ID NO: 1 (shown herein as SEQ ID NO: 16) as described in example 2.

SEQ ID NO: 1 1 was obtained by random mutagenesis of the DNA encoding SEQ ID NO: 6 (shown herein as SEQ ID NO: 21 ). The DNA encoding the polypeptide according to SEQ ID NO: 1 1 is shown herein as SEQ ID NO: 26.

The amino acids deviating from the wild type sequence of SEQ ID NO: 1 are shown in capital letters.

The polypeptide according to SEQ ID NO: 6 is a homologue of the polypeptide according to SEQ ID NO: 1 . These two polypeptides have 385 of the 416 amino acids in common, in other words they are 93% identical.

The polypeptide according to SEQ ID NO: 1 1 is also a homologue of the polypeptide according to SEQ ID NO: 1 . These two polypeptides have 369 of the 416 amino acids in common, in other words they are 89% identical.

The polypeptides according to SEQ ID NO:s 2 - 5 correspond to the polypeptide according to SEQ ID NO: 1 with variations K235T, K235S, K235N and K235C respectively.

The polypeptides according to SEQ ID NO:s 7 - 10 correspond to the polypeptide according to SEQ ID NO: 6 with variations K235T, K235S, K235N and K235C respectively.

The polypeptides according to SEQ ID NO:s 12 - 15 correspond to the polypeptide according to SEQ ID NO: 1 1 with variations K235T, K235S, K235N and K235C respectively.

The nucleotide sequences according to SEQ ID NO:s 16 - 30 encode the polypeptides with amino acid sequences according to SEQ ID NO:s 1 - 15 respectively.

SEQ ID NO:s 31 - 39 correspond to the primers used for producing the variant polypeptides as detailed in example 2.

Polypeptides carrying the double mutations A231 L with K235T, K235S, K235N and K235C double mutations are shown in SEQ ID NO: 40 - 43 respectively.

DNA encoding the polypeptides according to SEQ ID NO: 40 - 43 are shown in SEQ ID NO: 44 - 47.

SEQ ID NO:s 48, 49 and 50 correspond to variants A231 L in polypeptides according to SEQ ID NO: 1 , 6 and 1 1 respectively. SEQ ID NO:s 51 - 53 are the DNA sequences encoding the polypeptides according to SEQ ID NO:s 48 - 50.

SEQ ID NO: 54 and 55 are the protein and DNA sequence respectively from a thermostable and alkaline COT A laccase. Table 10: Amino acid and nucleotide sequences disclosed herein.

SEQ ID NO: Sequence

1 1 kelghevlkp ydgwaaygeg ttggamaspq nvfvvtnrte liqalggnnh tnqynsvpki

61 iyvkgtidln vddnnqpvgp dfykdphfdf eaylreydpa twgkkevegp leearvrsqk

121 kqkdrimvyv gsntsiigvg kdakikgggf liknvdnvii rniefeapld yfpewdptdg

181 tlgewnseyd sisiegsshi widhntftdg dhpdrslgty fgrpfqqhdg aldiknssdf

241 itisynvftn hdkvtligas dsrmadsghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvf sqiyaqnnyf sfdwdidpsl iikvwsknee smyetgtivd

361 Ipngrryidl vasynesntl qlkkevtwkp mfyhvihptp svpalvkaka gagnlh

2 1 kelghevlkp ydgwaaygeg ttggamaspq nvfvvtnrte liqalggnnh tnqynsvpki

61 iyvkgtidln vddnnqpvgp dfykdphfdf eaylreydpa twgkkevegp leearvrsqk

121 kqkdrimvyv gsntsiigvg kdakikgggf liknvdnvii rniefeapld yfpewdptdg

181 tlgewnseyd sisiegsshi widhntftdg dhpdrslgty fgrpfqqhdg alditnssdf

241 itisynvftn hdkvtligas dsrmadsghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvf sqiyaqnnyf sfdwdidpsl iikvwsknee smyetgtivd

361 Ipngrryidl vasynesntl qlkkevtwkp mfyhvihptp svpalvkaka gagnlh

3 1 kelghevlkp ydgwaaygeg ttggamaspq nvfvvtnrte liqalggnnh tnqynsvpki

61 iyvkgtidln vddnnqpvgp dfykdphfdf eaylreydpa twgkkevegp leearvrsqk

121 kqkdrimvyv gsntsiigvg kdakikgggf liknvdnvii rniefeapld yfpewdptdg

181 tlgewnseyd sisiegsshi widhntftdg dhpdrslgty fgrpfqqhdg aldisnssdf

241 itisynvftn hdkvtligas dsrmadsghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvf sqiyaqnnyf sfdwdidpsl iikvwsknee smyetgtivd

361 Ipngrryidl vasynesntl qlkkevtwkp mfyhvihptp svpalvkaka gagnlh

SEQ ID NO: Sequence

4 1 kelghevlkp ydgwaaygeg ttggamaspq nvfvvtnrte liqalggnnh tnqynsvpki

61 iyvkgtidln vddnnqpvgp dfykdphfdf eaylreydpa twgkkevegp leearvrsqk

121 kqkdrimvyv gsntsiigvg kdakikgggf liknvdnvii rniefeapld yfpewdptdg

181 tlgewnseyd sisiegsshi widhntftdg dhpdrslgty fgrpfqqhdg aldinnssdf

241 itisynvftn hdkvtligas dsrmadsghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvf sqiyaqnnyf sfdwdidpsl iikvwsknee smyetgtivd

361 lpngrryidl vasynesntl qlkkevtwkp mfyhvihptp svpalvkaka gagnlh

5 1 kelghevlkp ydgwaaygeg ttggamaspq nvfvvtnrte liqalggnnh tnqynsvpki

61 iyvkgtidln vddnnqpvgp dfykdphfdf eaylreydpa twgkkevegp leearvrsqk

121 kqkdrimvyv gsntsiigvg kdakikgggf liknvdnvii rniefeapld yfpewdptdg

181 tlgewnseyd sisiegsshi widhntftdg dhpdrslgty fgrpfqqhdg aldicnssdf

241 itisynvftn hdkvtligas dsrmadsghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvf sqiyaqnnyf sfdwdidpsl iikvwsknee smyetgtivd

361 lpngrryidl vasynesntl qlkkevtwkp mfyhvihptp svpalvkaka gagnlh

6 1 kelghDvlkp ydgwaSygeg ttggSmaspq nvYTvtnKte IVqalggnnh tnqynsvpki

61 iyvkgtiEln vddnnqpvgp EfykdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd yfpewdptdg

181 tlgewnseyd siTiegsHhi widhntftdg dhpdKslgty fgrpfqqhdg aldiknssdf

241 itisynvfKD hdkvtligas dsrmadEghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 lpngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

7 1 kelghDvlkp ydgwaSygeg ttggSmaspq nvYTvtnKte IVqalggnnh tnqynsvpki

SEQ ID NO: Sequence

61 iyvkgtiEln vddnnqpvgp EfykdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd yfpewdptdg

181 tlgewnseyd siTiegsHhi widhntftdg dhpdKslgty fgrpfqqhdg alditnssdf

241 itisynvfKD hdkvtligas dsrmadEghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 Ipngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

8 1 kelghDvlkp ydgwaSygeg ttggSmaspq nvYTvtnKte IVqalggnnh tnqynsvpki

61 iyvkgtiEln vddnnqpvgp EfykdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd yfpewdptdg

181 tlgewnseyd siTiegsHhi widhntftdg dhpdKslgty fgrpfqqhdg aldisnssdf

241 itisynvfKD hdkvtligas dsrmadEghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 Ipngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

9 1 kelghDvlkp ydgwaSygeg ttggSmaspq nvYTvtnKte IVqalggnnh tnqynsvpki

61 iyvkgtiEln vddnnqpvgp EfykdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd yfpewdptdg

181 tlgewnseyd siTiegsHhi widhntftdg dhpdKslgty fgrpfqqhdg aldinnssdf

241 itisynvfKD hdkvtligas dsrmadEghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 Ipngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

10 1 kelghDvlkp ydgwaSygeg ttggSmaspq nvYTvtnKte IVqalggnnh tnqynsvpki

SEQ ID NO: Sequence

61 iyvkgtiEln vddnnqpvgp EfykdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd yfpewdptdg

181 tlgewnseyd siTiegsHhi widhntftdg dhpdKslgty fgrpfqqhdg aldicnssdf

241 itisynvfKD hdkvtligas dsrmadEghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 Ipngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

11 1 kelghDvlkp NdgwaSygeg ttggSEaspD nvYTvtnKSe IVqalggnnh tnqynsTpki

61 iyvkgtiEln vddnnqpvgp EYyDdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd Ffpewdptdg

181 EYgewnseyd siTieSsHhi widhntftdg dhpdKslgty fgrpfqqhdg aldiknssdf

241 itisynvfKD hdkvSligSs dsrKTdEghl Kvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 Ipngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

12 1 kelghDvlkp NdgwaSygeg ttggSEaspD nvYTvtnKSe IVqalggnnh tnqynsTpki

61 iyvkgtiEln vddnnqpvgp EYyDdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd Ffpewdptdg

181 EYgewnseyd siTieSsHhi widhntftdg dhpdKslgty fgrpfqqhdg alditnssdf

241 itisynvfKD hdkvSligSs dsrKTdEghl Kvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 Ipngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

13 1 kelghDvlkp NdgwaSygeg ttggSEaspD nvYTvtnKSe IVqalggnnh tnqynsTpki

SEQ ID NO: Sequence

61 iyvkgtiEln vddnnqpvgp EYyDdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd Ffpewdptdg

181 EYgewnseyd siTieSsHhi widhntftdg dhpdKslgty fgrpfqqhdg aldisnssdf

241 itisynvfKD hdkvSligSs dsrKTdEghl Kvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 lpngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

14 1 kelghDvlkp NdgwaSygeg ttggSEaspD nvYTvtnKSe IVqalggnnh tnqynsTpki

61 iyvkgtiEln vddnnqpvgp EYyDdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd Ffpewdptdg

181 EYgewnseyd siTieSsHhi widhntftdg dhpdKslgty fgrpfqqhdg aldinnssdf

241 itisynvfKD hdkvSligSs dsrKTdEghl Kvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 lpngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

15 1 kelghDvlkp NdgwaSygeg ttggSEaspD nvYTvtnKSe IVqalggnnh tnqynsTpki

61 iyvkgtiEln vddnnqpvgp EYyDdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd Ffpewdptdg

181 EYgewnseyd siTieSsHhi widhntftdg dhpdKslgty fgrpfqqhdg aldicnssdf

241 itisynvfKD hdkvSligSs dsrKTdEghl Kvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 lpngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

16 aaagaactgg gtcatgaagt tctgaaaccg tatgatggtt gggcagcgta tggtgaaggt 60 acaaccggtg gtgcaatggc aagtccgcag aatgtttttg ttgttaccaa tcgtaccgaa 120

SEQ ID NO: Sequence

ctgattcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgatctgaac gtggatgata ataatcagcc ggttggtccg 240 gatttctata aagatccgca ttttgatttt gaggcctatc tgcgtgaata tgatccggca 300 acctggggta aaaaagaagt tgaaggtccg ctggaagaag cacgcgttcg tagccagaaa 360 aaacagaaag atcgtatcat ggtttatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagacgcga aaatcaaagg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accgctggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattagca ttgaaggcag cagccatatt 600 tggattgatc acaatacctt taccgatggc gatcatccgg atcgtagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaaaaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaccaac cacgataaag ttaccctgat tggtgcaagc 780 gatagccgta tggcagatag cggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgat tttcagtatg catggggtgt tggtgtgttt 960 agccagattt atgcacagaa caactatttc agcttcgatt gggatattga tccgagcctg 1020 attatcaaag tttggagcaa aaatgaagaa agcatgtatg aaaccggcac catcgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttac ctggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

17 aaagaactgg gtcatgaagt tctgaaaccg tatgatggtt gggcagcgta tggtgaaggt 60 acaaccggtg gtgcaatggc aagtccgcag aatgtttttg ttgttaccaa tcgtaccgaa 120 ctgattcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgatctgaac gtggatgata ataatcagcc ggttggtccg 240 gatttctata aagatccgca ttttgatttt gaggcctatc tgcgtgaata tgatccggca 300 acctggggta aaaaagaagt tgaaggtccg ctggaagaag cacgcgttcg tagccagaaa 360 aaacagaaag atcgtatcat ggtttatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagacgcga aaatcaaagg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accgctggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattagca ttgaaggcag cagccatatt 600 tggattgatc acaatacctt taccgatggc gatcatccgg atcgtagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaccaatag cagcgatttt 720

SEQ ID NO: Sequence

atcaccatca gctacaacgt gtttaccaac cacgataaag ttaccctgat tggtgcaagc 780 gatagccgta tggcagatag cggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgat tttcagtatg catggggtgt tggtgtgttt 960 agccagattt atgcacagaa caactatttc agcttcgatt gggatattga tccgagcctg 1020 attatcaaag tttggagcaa aaatgaagaa agcatgtatg aaaccggcac catcgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttac ctggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248 aaagaactgg gtcatgaagt tctgaaaccg tatgatggtt gggcagcgta tggtgaaggt 60 acaaccggtg gtgcaatggc aagtccgcag aatgtttttg ttgttaccaa tcgtaccgaa 120 ctgattcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgatctgaac gtggatgata ataatcagcc ggttggtccg 240 gatttctata aagatccgca ttttgatttt gaggcctatc tgcgtgaata tgatccggca 300 acctggggta aaaaagaagt tgaaggtccg ctggaagaag cacgcgttcg tagccagaaa 360 aaacagaaag atcgtatcat ggtttatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagacgcga aaatcaaagg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accgctggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattagca ttgaaggcag cagccatatt 600 tggattgatc acaatacctt taccgatggc gatcatccgg atcgtagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcagcaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaccaac cacgataaag ttaccctgat tggtgcaagc 780 gatagccgta tggcagatag cggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgat tttcagtatg catggggtgt tggtgtgttt 960 agccagattt atgcacagaa caactatttc agcttcgatt gggatattga tccgagcctg 1020 attatcaaag tttggagcaa aaatgaagaa agcatgtatg aaaccggcac catcgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttac ctggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

SEQ ID NO: Sequence

19 aaagaactgg gtcatgaagt tctgaaaccg tatgatggtt gggcagcgta tggtgaaggt 60 acaaccggtg gtgcaatggc aagtccgcag aatgtttttg ttgttaccaa tcgtaccgaa 120 ctgattcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgatctgaac gtggatgata ataatcagcc ggttggtccg 240 gatttctata aagatccgca ttttgatttt gaggcctatc tgcgtgaata tgatccggca 300 acctggggta aaaaagaagt tgaaggtccg ctggaagaag cacgcgttcg tagccagaaa 360 aaacagaaag atcgtatcat ggtttatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagacgcga aaatcaaagg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accgctggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattagca ttgaaggcag cagccatatt 600 tggattgatc acaatacctt taccgatggc gatcatccgg atcgtagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaacaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaccaac cacgataaag ttaccctgat tggtgcaagc 780 gatagccgta tggcagatag cggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgat tttcagtatg catggggtgt tggtgtgttt 960 agccagattt atgcacagaa caactatttc agcttcgatt gggatattga tccgagcctg 1020 attatcaaag tttggagcaa aaatgaagaa agcatgtatg aaaccggcac catcgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttac ctggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

20 aaagaactgg gtcatgaagt tctgaaaccg tatgatggtt gggcagcgta tggtgaaggt 60 acaaccggtg gtgcaatggc aagtccgcag aatgtttttg ttgttaccaa tcgtaccgaa 120 ctgattcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgatctgaac gtggatgata ataatcagcc ggttggtccg 240 gatttctata aagatccgca ttttgatttt gaggcctatc tgcgtgaata tgatccggca 300 acctggggta aaaaagaagt tgaaggtccg ctggaagaag cacgcgttcg tagccagaaa 360 aaacagaaag atcgtatcat ggtttatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagacgcga aaatcaaagg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accgctggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattagca ttgaaggcag cagccatatt 600

SEQ ID NO: Sequence

tggattgatc acaatacctt taccgatggc gatcatccgg atcgtagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tctgcaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaccaac cacgataaag ttaccctgat tggtgcaagc 780 gatagccgta tggcagatag cggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgat tttcagtatg catggggtgt tggtgtgttt 960 agccagattt atgcacagaa caactatttc agcttcgatt gggatattga tccgagcctg 1020 attatcaaag tttggagcaa aaatgaagaa agcatgtatg aaaccggcac catcgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttac ctggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

21 aaagaactgg gtcatgatgt gctgaaaccg tatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcatggc aagtccgcag aatgtttata ccgttaccaa taaaaccgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaattctata aagatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggtggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattacca ttgaaggcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaaaaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgaccctgat tggtgcaagc 780 gatagccgta tggcagatga aggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200

SEQ ID NO: Sequence

agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 124i

22 aaagaactgg gtcatgatgt gctgaaaccg tatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcatggc aagtccgcag aatgtttata ccgttaccaa taaaaccgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaattctata aagatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggtggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattacca ttgaaggcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaccaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgaccctgat tggtgcaagc 780 gatagccgta tggcagatga aggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

23 aaagaactgg gtcatgatgt gctgaaaccg tatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcatggc aagtccgcag aatgtttata ccgttaccaa taaaaccgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaattctata aagatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480

SEQ ID NO: Sequence

cgcaacatcg aatttgaagc accggtggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattacca ttgaaggcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcagcaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgaccctgat tggtgcaagc 780 gatagccgta tggcagatga aggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

24 aaagaactgg gtcatgatgt gctgaaaccg tatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcatggc aagtccgcag aatgtttata ccgttaccaa taaaaccgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaattctata aagatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggtggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattacca ttgaaggcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaacaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgaccctgat tggtgcaagc 780 gatagccgta tggcagatga aggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080

SEQ ID NO: Sequence

ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

25 aaagaactgg gtcatgatgt gctgaaaccg tatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcatggc aagtccgcag aatgtttata ccgttaccaa taaaaccgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaattctata aagatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggtggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattacca ttgaaggcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tctgcaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgaccctgat tggtgcaagc 780 gatagccgta tggcagatga aggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

26 aaagaactgg gtcatgatgt gctgaaaccg aatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcgaagc aagtccggat aatgtttata ccgttaccaa taaaagcgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccac cccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaatattatg atgatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360

SEQ ID NO: Sequence

aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggttgat ttttttccgg aatgggatcc gaccgatggt 540 gaatatggcg aatggaatag cgaatatgat agcattacca tcgaaagcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaaaaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgagcctgat tggttcaagc 780 gatagccgta aaaccgatga aggtcatctg aaagttaccc tgcatcacaa ctattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

27 aaagaactgg gtcatgatgt gctgaaaccg aatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcgaagc aagtccggat aatgtttata ccgttaccaa taaaagcgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccac cccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaatattatg atgatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggttgat ttttttccgg aatgggatcc gaccgatggt 540 gaatatggcg aatggaatag cgaatatgat agcattacca tcgaaagcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaccaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgagcctgat tggttcaagc 780 gatagccgta aaaccgatga aggtcatctg aaagttaccc tgcatcacaa ctattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960

SEQ ID NO: Sequence

agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

28 aaagaactgg gtcatgatgt gctgaaaccg aatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcgaagc aagtccggat aatgtttata ccgttaccaa taaaagcgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccac cccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaatattatg atgatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggttgat ttttttccgg aatgggatcc gaccgatggt 540 gaatatggcg aatggaatag cgaatatgat agcattacca tcgaaagcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcagcaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgagcctgat tggttcaagc 780 gatagccgta aaaccgatga aggtcatctg aaagttaccc tgcatcacaa ctattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

29 aaagaactgg gtcatgatgt gctgaaaccg aatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcgaagc aagtccggat aatgtttata ccgttaccaa taaaagcgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccac cccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240

SEQ ID NO: Sequence

gaatattatg atgatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggttgat ttttttccgg aatgggatcc gaccgatggt 540 gaatatggcg aatggaatag cgaatatgat agcattacca tcgaaagcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaacaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgagcctgat tggttcaagc 780 gatagccgta aaaccgatga aggtcatctg aaagttaccc tgcatcacaa ctattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

30 aaagaactgg gtcatgatgt gctgaaaccg aatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcgaagc aagtccggat aatgtttata ccgttaccaa taaaagcgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccac cccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaatattatg atgatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggttgat ttttttccgg aatgggatcc gaccgatggt 540 gaatatggcg aatggaatag cgaatatgat agcattacca tcgaaagcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tctgcaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgagcctgat tggttcaagc 780 gatagccgta aaaccgatga aggtcatctg aaagttaccc tgcatcacaa ctattacaaa 840

SEQ ID NO: Sequence

aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

31 GAAATTAATACGACTCACTATAGG

32 GGTTATGCTAGTTATTGCTCAGCGGTG

33 GCTGATGGTGATAAAATCGCTGCTATTggTGATATCCAG

34 GCTGATGGTGATAAAATCGCTGCTATTgcTGATATCCAG

35 GCTGATGGTGATAAAATCGCTGCTATTgTTGATATCCAG

36 GCTGATGGTGATAAAATCGCTGCTATTgcaGATATCCAG

37 AATAGCAGCGATTTTATCACCATCAGCTACAACGTGTTTA

GCCATCATGCTGCTGAAACGGACGACCAAAATAGGTG

39 GGTCGTCCGTTTCAGCAGCATGATGGCctgCTGGATATCA

40 1 kelghevlkp ydgwaaygeg ttggamaspq nvfvvtnrte liqalggnnh tnqynsvpki

61 iyvkgtidln vddnnqpvgp dfykdphfdf eaylreydpa twgkkevegp leearvrsqk

121 kqkdrimvyv gsntsiigvg kdakikgggf liknvdnvii rniefeapld yfpewdptdg

181 tlgewnseyd sisiegsshi widhntftdg dhpdrslgty fgrpfqqhdg lldi nssdf

241 itisynvftn hdkvtligas dsrmadsghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvf sqiyaqnnyf sfdwdidpsl iikvwsknee smyetgtivd

361 lpngrryidl vasynesntl qlkkevtwkp mfyhvihptp svpalvkaka gagnlh

SEQ ID NO: Sequence

41 1 kelghevlkp ydgwaaygeg ttggamaspq nvfvvtnrte liqalggnnh tnqynsvpki

61 iyvkgtidln vddnnqpvgp dfykdphfdf eaylreydpa twgkkevegp leearvrsqk

121 kqkdrimvyv gsntsiigvg kdakikgggf liknvdnvii rniefeapld yfpewdptdg

181 tlge nseyd sisiegsshi widhntftdg dhpdrslgty fgrpfqqhdg lldisnssdf

241 itisynvftn hdkvtligas dsrmadsghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvf sqiyaqnnyf sfdwdidpsl iikvwsknee smyetgtivd

361 Ipngrryidl vasynesntl qlkkevtwkp mfyhvihptp svpalvkaka gagnlh

42 1 kelghDvlkp ydgwaSygeg ttggSmaspq nvYTvtnKte IVqalggnnh tnqynsvpki

61 iyvkgtiEln vddnnqpvgp EfykdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd yfpewdptdg

181 tlgewnseyd siTiegsHhi widhntftdg dhpdKslgty fgrpfqqhdg lldinnssdf

241 itisynvfKD hdkvtligas dsrmadEghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 Ipngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

43 1 kelghDvlkp NdgwaSygeg ttggSEaspD nvYTvtnKSe IVqalggnnh tnqynsTpki

61 iyvkgtiEln vddnnqpvgp EYyDdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd Ffpewdptdg

181 EYgewnseyd siTieSsHhi widhntftdg dhpdKslgty fgrpfqqhdg lldicnssdf

241 itisynvfKD hdkvSligSs dsrKTdEghl Kvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 Ipngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

SEQ ID NO: Sequence

44 aaagaactgg gtcatgaagt tctgaaaccg tatgatggtt gggcagcgta tggtgaaggt 60 acaaccggtg gtgcaatggc aagtccgcag aatgtttttg ttgttaccaa tcgtaccgaa 120 ctgattcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgatctgaac gtggatgata ataatcagcc ggttggtccg 240 gatttctata aagatccgca ttttgatttt gaggcctatc tgcgtgaata tgatccggca 300 acctggggta aaaaagaagt tgaaggtccg ctggaagaag cacgcgttcg tagccagaaa 360 aaacagaaag atcgtatcat ggtttatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagacgcga aaatcaaagg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accgctggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattagca ttgaaggcag cagccatatt 600 tggattgatc acaatacctt taccgatggc gatcatccgg atcgtagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc ctgctggata tcaccaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaccaac cacgataaag ttaccctgat tggtgcaagc 780 gatagccgta tggcagatag cggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgat tttcagtatg catggggtgt tggtgtgttt 960 agccagattt atgcacagaa caactatttc agcttcgatt gggatattga tccgagcctg 1020 attatcaaag tttggagcaa aaatgaagaa agcatgtatg aaaccggcac catcgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttac ctggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

45 aaagaactgg gtcatgaagt tctgaaaccg tatgatggtt gggcagcgta tggtgaaggt 60 acaaccggtg gtgcaatggc aagtccgcag aatgtttttg ttgttaccaa tcgtaccgaa 120 ctgattcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgatctgaac gtggatgata ataatcagcc ggttggtccg 240 gatttctata aagatccgca ttttgatttt gaggcctatc tgcgtgaata tgatccggca 300 acctggggta aaaaagaagt tgaaggtccg ctggaagaag cacgcgttcg tagccagaaa 360 aaacagaaag atcgtatcat ggtttatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagacgcga aaatcaaagg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accgctggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattagca ttgaaggcag cagccatatt 600

SEQ ID NO: Sequence

tggattgatc acaatacctt taccgatggc gatcatccgg atcgtagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc ctgctggata tcagcaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaccaac cacgataaag ttaccctgat tggtgcaagc 780 gatagccgta tggcagatag cggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgat tttcagtatg catggggtgt tggtgtgttt 960 agccagattt atgcacagaa caactatttc agcttcgatt gggatattga tccgagcctg 1020 attatcaaag tttggagcaa aaatgaagaa agcatgtatg aaaccggcac catcgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttac ctggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

46 aaagaactgg gtcatgatgt gctgaaaccg tatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcatggc aagtccgcag aatgtttata ccgttaccaa taaaaccgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaattctata aagatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggtggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattacca ttgaaggcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc ctgctggata tcaacaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgaccctgat tggtgcaagc 780 gatagccgta tggcagatga aggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200

SEQ ID NO : Sequence

agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 124 i

47 aaagaactgg gtcatgatgt gctgaaaccg aatgatggtt gggcaagcta tggtgaaggt 60

acaaccggtg gtagcgaagc aagtccggat aatgtttata ccgttaccaa taaaagcgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccac cccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaatattatg atgatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggttgat ttttttccgg aatgggatcc gaccgatggt 540 gaatatggcg aatggaatag cgaatatgat agcattacca tcgaaagcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc ctgctggata tctgcaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgagcctgat tggttcaagc 780 gatagccgta aaaccgatga aggtcatctg aaagttaccc tgcatcacaa ctattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

1 kelghevlkp ydgwaaygeg ttggamaspq nvfvvtnrte liqalggnnh tnqynsvpki

61 iyvkgtidln vddnnqpvgp dfykdphfdf eaylreydpa twgkkevegp leearvrsqk

121 kqkdrimvyv gsntsiigvg kdakikgggf liknvdnvii rniefeapld yfpewdptdg

181 tlgewnseyd sisiegsshi widhntftdg dhpdrslgty fgrpfqqhdg lldiknssdf

241 itisynvftn hdkvtligas dsrmadsghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvf sqiyaqnnyf sfdwdidpsl iikvwsknee smyetgtivd

SEQ ID NO: Sequence

361 lpngrryidl vasynesntl qlkkevt kp mfyhvihptp svpalvkaka gagnlh

49 1 kelghDvlkp ydgwaSygeg ttggSmaspq nvYTvtnKte IVqalggnnh tnqynsvpki

61 iyvkgtiEln vddnnqpvgp EfykdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd yfpewdptdg

181 tlgewnseyd siTiegsHhi widhntftdg dhpdKslgty fgrpfqqhdg lldiknssdf

241 itisynvfKD hdkvtligas dsrmadEghl rvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 lpngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

50 1 kelghDvlkp NdgwaSygeg ttggSEaspD nvYTvtnKSe IVqalggnnh tnqynsTpki

61 iyvkgtiEln vddnnqpvgp EYyDdphYdf eaylKeydpK KwgkkevSgp leearArsqk

121 kqkEriVvNv gsntsiigvg kdakiVgggf liknvdnvii rniefeapVd Ffpewdptdg

181 EYgewnseyd siTieSsHhi widhntftdg dhpdKslgty fgrpfqqhdg lldiknssdf

241 itisynvfKD hdkvSligSs dsrKTdEghl Kvtlhhnyyk nvtqrlprvr fgqvhiynny

301 yefsnladyd fqyawgvgvE sKiyaqnnyf sfdwdidpsK iikvwsknee smyeSgtivd

361 lpngrryidl vasynesntl qlkkevGwkp mfyhvihptp svpalvkaka gagnlh

51 aaagaactgg gtcatgaagt tctgaaaccg tatgatggtt gggcagcgta tggtgaaggt 60

acaaccggtg gtgcaatggc aagtccgcag aatgtttttg ttgttaccaa tcgtaccgaa 120 ctgattcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgatctgaac gtggatgata ataatcagcc ggttggtccg 240 gatttctata aagatccgca ttttgatttt gaggcctatc tgcgtgaata tgatccggca 300 acctggggta aaaaagaagt tgaaggtccg ctggaagaag cacgcgttcg tagccagaaa 360 aaacagaaag atcgtatcat ggtttatgtg ggtagcaaca ccagcattat tggtgttggt 420

SEQ ID NO: Sequence

aaagacgcga aaatcaaagg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accgctggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattagca ttgaaggcag cagccatatt 600 tggattgatc acaatacctt taccgatggc gatcatccgg atcgtagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaaaaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaccaac cacgataaag ttaccctgat tggtgcaagc 780 gatagccgta tggcagatag cggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgat tttcagtatg catggggtgt tggtgtgttt 960 agccagattt atgcacagaa caactatttc agcttcgatt gggatattga tccgagcctg 1020 attatcaaag tttggagcaa aaatgaagaa agcatgtatg aaaccggcac catcgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttac ctggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

52 aaagaactgg gtcatgatgt gctgaaaccg tatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcatggc aagtccgcag aatgtttata ccgttaccaa taaaaccgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccgt gccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaattctata aagatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggtggat tattttccgg aatgggatcc gaccgatggc 540 accctgggtg aatggaatag cgaatatgat agcattacca ttgaaggcag ccatcatatt 600

SEQ ID NO: Sequence

tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaaaaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgaccctgat tggtgcaagc 780 gatagccgta tggcagatga aggtcatctg cgtgttaccc tgcatcacaa ttattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

53 aaagaactgg gtcatgatgt gctgaaaccg aatgatggtt gggcaagcta tggtgaaggt 60 acaaccggtg gtagcgaagc aagtccggat aatgtttata ccgttaccaa taaaagcgaa 120 ctggttcagg cactgggtgg taataatcat accaatcagt ataattccac cccgaaaatc 180 atctatgtga aaggcaccat tgaactgaac gtggatgata ataatcagcc ggttggtccg 240 gaatattatg atgatccgca ttatgatttt gaagcctatc tgaaagagta tgatccgaaa 300 aaatggggca aaaaagaagt tagcggtccg ctggaagaag cacgcgcacg tagccagaaa 360 aaacagaaag aacgtattgt tgtgaatgtg ggtagcaaca ccagcattat tggtgttggt 420 aaagatgcca aaattgtggg tggtggtttc ctgattaaaa acgtggataa tgtgatcatc 480 cgcaacatcg aatttgaagc accggttgat ttttttccgg aatgggatcc gaccgatggt 540 gaatatggcg aatggaatag cgaatatgat agcattacca tcgaaagcag ccatcatatt 600 tggatcgatc acaatacctt taccgatggc gatcatccgg ataaaagcct gggcacctat 660 tttggtcgtc cgtttcagca gcatgatggc gcactggata tcaaaaatag cagcgatttt 720 atcaccatca gctacaacgt gtttaaagac catgataaag tgagcctgat tggttcaagc 780

SEQ ID NO: Sequence

gatagccgta aaaccgatga aggtcatctg aaagttaccc tgcatcacaa ctattacaaa 840 aatgttaccc agcgtctgcc tcgtgttcgt tttggtcagg ttcatatcta taacaactac 900 tatgagttta gcaacctggc cgattatgac tttcagtatg catggggtgt tggtgttgaa 960 agcaaaatct atgcccagaa caactatttc agcttcgatt gggatattga cccgagcaaa 1020 attatcaaag tttggagcaa aaacgaagaa agcatgtatg aaagcggtac gattgttgat 1080 ctgccgaatg gtcgtcgtta tattgatctg gttgcaagct ataatgaaag caataccctg 1140 cagctgaaaa aagaggttgg ttggaaaccg atgttctatc atgttattca tccgaccccg 1200 agcgttccgg cactggttaa agcaaaagcc ggtgcaggta atctgcat 1248

54 1 mrrklekfvd slpimetlqp ktkgknyyev kiqefkkklh rdlppttlwg ynaqfpgpti

61 eansnepvev k inelpnkh flpvd simn kdlpevrhvt hlhggrtpsv sdgypeawyt

121 kdykevgsff keevyrylne qramml yhd htmgitrlnn yaglagayii rdkhekslnl

181 pegeyevpli iqdrtfnedg slfyptgped ggedlpnpsi vpaflgdtvl vngkvwpyle

241 veprkyrfri lngsnarsyq lhldsnqevy qigsdgglle kpvqmnkipi esseridvii

301 dfsqcdgdei vlkndlgpda daedetneim kfkvskplke kdtsvipkrl stirslrnnk

361 isthrnlklv gstddfgrpl lllnnkk ad pttekpkvgd tevwsfintt dfahpmhihl

421 ihfqvldrqp fdlerynhdg tiiytgppra pepnerg kd tvsapagqit rvigtfapyt

481 gnyv hchil ehedhdmmrp mkvidpkqrk dks

55 atgcgtcgca aactggaaaa atttgttgat agcctgccga ttatggaaac cctgcagccg 60 aaaaccaaag gcaaaaacta ttatgaggtg aaaatccaag agtttaaaaa aaaactgcac 120 cgtgatctgc ctccgaccac cctgtggggt tataatgcac agtttccggg tccgaccatt 180 gaagcaaata gcaatgaacc ggttgaagtg aaatggatta atgagctgcc gaacaaacat 240 tttctgccgg ttgattggag catcatgaat aaagatctgc cggaagttcg tcatgttacc 300 catctgcatg gtggtcgtac cccgagtgtt agtgatggtt atccggaagc atggtatacg 360 aaagattata aagaagtggg cagcttcttc aaagaagagg tttatcgtta tctgaatgaa 420 cagcgtgcaa tgatgctgtg gtatcatgat cataccatgg gtattacccg tctgaataac 480

SEQ ID NO: Sequence

tatgcaggtc tggcaggcgc atatatcatt cgtgataaac atgaaaaaag cctgaatctg 540 cctgaaggcg aatatgaagt tccgctgatt attcaggatc gcacctttaa tgaagatggc 600 agcctgtttt atccgaccgg tccggaagat ggcggtgagg atctgccgaa tccgagcatt 660 gttccggcat ttctgggtga taccgttctg gttaatggta aagtttggcc gtatctggaa 720 gttgaaccgc gtaaatatcg ttttcgtatt ctgaatggta gcaacgcccg tagctatcag 780 ctgcatctgg atagcaatca agaagtgtat cagattggtt cagatggtgg tctgctggaa 840 aaaccggtgc agatgaacaa aattccgatt gaaagcagcg aacgcattga tgtgattatc 900 gattttagcc agtgtgatgg tgatgagatt gtgctgaaaa atgatctggg tccggatgca 960 gatgccgaag atgaaaccaa tgaaatcatg aaattcaaag tgagcaaacc gctgaaagag 1020 aaagatacca gcgttattcc gaaacgtctg agcaccattc gtagcctgcg taataacaaa 1080 attagcaccc atcgtaatct gaaactggtt ggtagcaccg atgattttgg tcgtcctctg 1140 ctgctgctga acaacaaaaa atgggcagat ccgaccacag aaaaaccgaa agttggcgat 1200 accgaagttt ggagctttat taacaccacc gattttgcac atccgatgca tattcatctg 1260 atccattttc aggttctgga tcgtcagccg tttgatctgg aacgttataa tcatgatggc 1320 accattatct ataccggtcc gcctcgtgca ccggaaccga atgaacgtgg ttggaaagat 1380 acagttagcg caccggcagg tcagattacc cgtgttattg gcacctttgc accgtatacc 1440 ggtaattatg tttggcattg tcatatcctg gaacacgaag atcacgatat gatgcgtccg 1500 atgaaagtta ttgatccgaa acagcgtaaa gataaa 1536