[01) This application claims priority of U.S. Provisional Application No. 61/447076 filed February 27, 20 U, the contents of each of which are hereby incorporated by reference into the present disclosure.

1. FIELD OF THE INVENTION

[02] This invention relates to methods for the selection of DNA Iigands for molecular targets. The present invention relates also to DNA Iigands selected with the method of the present invention and to DNA Iigands capable of binding a wheat glutenin protein.

2. BACKGROUND

[03] It has been previously shown that it is possible to select oligonucleotide sequences (either RNA or DNA) called aptamers that bind with high affinity and specificity to specific desired target molecules (U.S. Pat. Nos. 5,475,096 and 5,631,146). In general a random library of single stranded sequences is created whereby a region of between 20 and 80 nucleotides (nt) of random sequence is flanked on either side by regions of defined sequence (approximately 20 nt in length) that serve as primer recognition sites for polymerase chain reaction amplification. A portion of such libraries corresponding to 1013 to 1016 individual molecules is applied to the immobilized target molecule. Sequences that bind are partitioned from sequences that do not bind. In the case of DNA based oligonucleotide selection these selected sequences are then amplified using polymerase chain reaction (PCR) technology leading to the creation of double stranded molecules. The antisense strand is then removed through a variety of approaches known in the art including but not limited to the use of biotinylated reverse primer sequence, or the use of protection against nuclease digestion of the sense strand. An alternative approach is to use PCR technology in an asymmetric form with more forward primer than reverse primer, thus leading to an abundance of sense strands over antisense strands. The single stranded library is then combined with the target analyte once again and the partitioning process followed by amplification and strand separation is repeated.

[04] The requirement for the purification of the sense strand as a result of asymmetric PCR amplification, or as a result of the removal of the antisense strand represents a constraint to the process of DNA ligand selection. This process is time consuming, and subject to experimental variation in terms of the degree of purity achieved. PCR amplification of short fragments such as the libraries used for DNA ligand selection can easily be contaminated by artifactual products such as the dimerization of primers.

[05] The use of single stranded oligonucleotides for the selection of DNA ligands for any analyte is also constrained by the potential for the primer recognition sites to form complementary sequence duplexes with regions within the random sequence. Prior to a selection exercise it is not currently possible to predict what sequences will bind to any given analyte and what sequences will not. Therefore it is not possible to know prior to the initiation of a selection process whether the primer recognition sites used will interfere with the ability of certain sequences to bind to the target analyte. Moreover, the presence of foldback structures involving the primer recognition sites with the random region have the potential to affect the availability of sequences within the random region that are not complementary but are masked by the interaction between complementary sequences and the primer recognition sites. As such it is clear that single stranded DNA selection or SELEX is driven by two opposing selection forces. Selection for sequences that bind to a given analyte, and selection against sequences that interact with the primer recognition sites in such a way as to inhibit binding of the random region to any given analyte. The presence of this second selection force must implicitly reduce the effectiveness of selection for the DNA sequences that bind to any given analyte.

[06] To overcome these constraints the inventor has demonstrated that it is not necessary or even desirable to purify the selection library to enrich the proportion of sense strands versus antisense strands. PCR amplification of the library will result in the creation of antisense copies of the sense versions selected. Denaturation of these duplexes followed by a period of time wherein the single strands are allowed to reanneal with each other randomly will predominantly lead to the formation of molecules that are partially double stranded. All antisense copies will have random regions flanked by sequences that are perfect complements to the primer recognition sites of the sense strands. These complementary regions will drive annealing between molecules leading to the formation of double stranded oligonucleotides that contain perfect duplexes on both end, and varying degrees of openness in their random regions. In this document, these molecules are referred as "Dubbles" and retain the use of the term "duplex" herein for molecules wherein all nucleotides are annealed in Watson - Crick bonds.

[07] This invention represents an improvement over prior art in that the elimination of the need for the removal of antisense sequences accelerates the selection process. This invention also represents an improvement over prior art in that the primer recognition sites within the library are necessarily bound to antisense fragments and will therefore not be involved in interference with the selection for sequences that bind to any given analyte,

[08] U.S. Pat. No. 5670637 claims the use of double stranded DNA ligands where the target molecule is a protein. The inventors describe a method for the creation of random sequences using double stranded DNA amplification with the use of a terminal transferase enzyme and a DNA polymerase. This is not a process for the selection of DNA ligands that involves the use of double stranded DNA. This is only a method for the creation of random libraries which would then be used as contemplated and described by the inventors as a basis for single stranded DNA selection.

[09] The inventors of U.S. Pat. No. 5670637 also describe the use of double stranded DNA as a step in the amplification of RNA ligands. In this process, RNA is reverse transcribed into DNA, which is then amplified in a doubte stranded manner, and is then used as a template for the transcription of the next round of single stranded RNA molecules used within the selection process. This method does involve any investigation of the ability of the double stranded DNA to bind to a target molecule.

[10] In general, the inventors of U.S. Pat. No. 5670637 limit their description of double stranded DNA and of double stranded RNA to the potential for single stranded molecules to fold back on themselves and form double stranded regions. This differs from true double stranded molecules consisting of two single stranded molecules that have bound to each other through homologous base pairing. In my invention, double stranded molecules shall always be defined as two separate molecules that have annealed to each other due to complementary base pairing. AH teachings within this patent are limited to the selection of single stranded molecules, which may or may not necessarily contain regions of double stranded pairing within themselves.

[11] The difference between what is taught in U.S. Pat. No. 5670637 and the nature of the present invention is very clear. U U.S. Pat. No. 5670637 teaches methods regarding the selection of single stranded oligonucleotides whereby such single stranded oligonucleotides may form double stranded regions within themselves. The present invention teaches a method that involves the use of complementary single stranded DNA molecules as double stranded entities. The high degree of homology at either end of the DNA molecules described in the enablements herein will lead to the formation of a pair of single stranded molecules annealed through homology at either end, but not covalently, and which may or may not have additional regions of homology in the central region of the molecules. To accentuate this difference we have named the molecules that we have invented "Dubbles".

[12] U.S. Pat. No. 5696249, and U S. Pat. No. 6380377 do not add to this distinction in regard to how the term double stranded DNA is used within the claims as it pertains to the teaching disclosed. U.S. Pat. No. 5958691 also claims the use of double stranded DNA Hgands with the same basis, but the novelty in this case is restricted to the inclusion of modified nucleotides in the oligonucleotides used. The present invention could also accommodate the use of modified nucleotides but does not require their use.

3. SUMMARY OF THE INVENTION

[13] In one embodiment, the present invention relates to a method for the selection of DNA ligands for an analyte. The method, in one embodiment, comprises: (a) exposing a random library of single stranded DNA molecules to the analyte, (b) partitioning single stranded DNA molecules which bind to the analyte from unbound DNA molecules, (c) amplifying the bound single stranded DNA molecules to obtain a population of double stranded DNA molecules, (d) denaturing and reannealing the population of double stranded DNA molecules to obtain a sub-population of reannealed DNA molecules, (e) optionally repeating steps (a) to (d) for said sub-population of reannealed DNA molecules, and (f obtaining from said sub-population a DNA ligand for the analyte.

[14] In one embodiment, prior to step (a) the random library of single stranded DNA molecules is amplified and the resulting double stranded DNA molecules denatured and reannealed, and wherein step (a) comprises exposing the reannealed DNA molecules to the analyte.

[15] In another embodiment the analyte is a protein.

[16] In another embodiment the analyte is a wheat glutenin protein.

[17] In another embodiment the analyte is a non-protein target. In aspects the nonprotein target includes a mycotoxin or an antibiotic.

[IS] In another embodiment the DNA ligand is a single stranded DNA molecule.

[19] In another embodiment the DNA ligand is a double stranded DNA molecule.

[20] In another embodiment the DNA ligand is a reannealed DNA molecule.

[21] In one embodiment, the present invention provides for a DNA ligand identified through the method for identifying DNA ligands of the present invention.

[22] In one embodiment, the present invention provides a diagnostic probe comprising a DNA ligand identified through the method for identifying DNA ligands of the present invention. In one aspect the DNA ligand of the probe is attached to a label.

[23] In one embodiment, the DNA ligand of the diagnostic probe is coupled with an anti-sense partner or is a single stranded DNA molecule.

[24] In one embodiment, the present invention provides for a pharmaceutical composition comprising a DNA ligand identified through the method of the present invention and a pharmaceutically acceptable vehicle or carrier thereof. In aspects of the present invention, the DNA ligand is coupled with an anti-sense partner or is a single stranded DNA molecule.

[25] In another embodiment, the present invention provides for a DNA ligand that is capable of binding to wheat glutenin.

[26] In one embodiment, the DNA ligand that is capable of binding to wheat glutenin comprises a nucleotide sequence selected from SEQ ID NOs: 1 to 26, or a functional analogue or variant thereof. [27] In another embodiment, the DNA ligand that is capable of binding to wheat glutenin comprises a coefficient of disassociation (Kd) for wheat glutenin of less than 1 mM.

[28] In another embodiment the DNA ligand that is capable of binding to wheat gluenin comprises a nucleotide sequence that is at least 90% identical to the full length of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-26.

[29] In one embodiment the present disclosure provides for a diagnostic probe for the integrity of a glutenin protein as a predictive tool for end-use performance of a grain or flour. The diagnostic probe, in one embodiment, comprises a nucleotide sequence selected from SEQ ID NOs: 1 to 26, or a functional analogue or variant thereof.

[30] In another embodiment the present invention provides for a diagnostic probe for the integrity of a glutenin protein as a predictive tool for end-use performance of a grain or flour. The diagnostic probe, in one embodiment, comprises a DNA ligand having a coefficient of disassociation (Kd) for wheat glutenin of less than 1 mM.

[31] In another embodiment the present invention provides for a diagnostic probe for the integrity of a glutenin protein as a predictive tool for determining the level of pre-harvest sprouting damage that has occurred within a wheat grain sample. The diagnostic probe, in one embodiment, comprises a nucleotide sequence selected from SEQ ID NOs: 1 to 26, or a functional analogue or variant thereof.

[32] In another embodiment, the present invention provides for a diagnostic probe for the integrity of a glutenin protein as a predictive tool for determining the level of pre-harvest sprouting damage that has occurred within a wheat grain sample. The diagnostic probe, in one embodiment, comprises a DNA ligand having a coefficient of disassociation (Kd) for wheat glutenin of less than 1 mM.

[33] In aspects of the present invention, the diagnostic probe includes a label attached to the DNA ligand.

[34] In another embodiment, the present invention provides for a method to determine the number of possible partitions for each possible contiguous block of one DNA strand to another, and/or to determine the frequency of each partition within a library of DNA sequences, and/or to determine the expected the level of binding that would occur between a library of sequences and a given sequence. 4. BRIEF DESCRIPTION OF DRAWINGS

[35] The present invention will become more fully understood from the detailed description given herein and from the accompanying drawings, which are given by way of illustration only and do not limit the intended scope of the invention:

[36] Figure 1 illustrates the general structure of libraries for DNA ligand selection.

[37] Figure 2 is a graph illustrating the number of partitions possible for positive integers from 1 to 40.

[38] Figure 3 is a graph illustrating the number of partitions possible for values of r

[39] Figure 4 is a graph illustrating the distribution of physically realizable sequences with varying amounts of complementary nucleotides with a given sequence.

[40] Figure 5 is a graph illustrating the distribution of physically realizable sequences with varying amounts of complementary nucleotides with a given sequence with the frequency being displayed on a logarithimic scale.

[41] Figure 6 is a graph illustrating the frequency distribution of the largest single contiguous block of complementary nucleotides for a given sequence considering all possible sequences.

[42] Figure 7 is a graph illustrating the proportion of Dubbles sequence 17F bound to varying concentrations of glutenin protein.

[43] Figure 8 is a graph illustrating measurements of fluorescence polarization of Dubbles ligand 57F at a concentration of 35 nM and various concentrations of glutenin protein.

[44] Figure 9 is a graph illustrating a comparison of the similarity among sequences sampled after different number of rounds of Dubbles selection.

5. DETADLED DESCRIPTION OF THE INVENTION

[45] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Also, unless indicated otherwise, except within the claims, the use of "or" includes "and" and vice versa. Non-limiting terms are not to be construed as limiting unless expressly stated or the context clearly indicates otherwise (for example "including", "having" and "comprising" typically indicate "including without limitation"). Singular forms including in the claims such as "a", "an" and "the" include the plural reference unless expressly stated otherwise.

[46] In this document, unless indicated otherwise, the use of "reanneal" includes "anneal" and vice versa.

[47] "Equivalent" refers to nucleotide sequences functionally equivalent to an original DNA ligand. Equivalent nucleotide sequences will include sequences with substantial sequence homology, or sequences that differ by one or more nucleotide substitution, addition or deletion. For example, equivalent nucleic acid sequences may include those produced by nucleotide substitutions, deletions, or additions. The substitutions, deletions, or additions may involve one or more nucleotides.

[48] A "functional fragment" of a DNA ligand as used herein is a nucleic acid fragment capable of operating as a DNA ligand. Thus, a "functional fragment" of a DNA ligand is intended to include nucleic acids capable of binding to an analyte of interest.

[49] The term "ligand" means a nucleic acid polymer that binds another molecule or target analyte. In a population of candidate nucleic acid polymers, a ligand is one which binds with greater affinity than that of the bulk population. In a candidate mixture there can exist more than one ligand for a given target. The ligands may differ from one another in their binding affinities for the target molecule. Target molecules or analytes may include, for example, proteins and non-protein molecules, mycotoxins and antibiotics.

[50] The term "nucleic acid" means either DNA, single-stranded, double-stranded or Dubbles, and any chemical modifications thereof.

[51] In this document, sequences having "substantial sequence homology" are intended to refer to nucleotide sequences that share at least about 90% identity with a DNA ligand of the present invention. It is recognized, however, that nucleic acids containing less than the above-described levels of homology are also encompassed within the scope of the present invention.

[52] DNA is composed of four nucleotides, adenine (A), thymine (T), guanine (G) and cytosine (C). DNA stands are composed of linear combinations of these nucleotides. One strand of DNA will bind to another strand based on very simple nucleotide pairing rules, A pairs with T, and G pairs with C, and vice versa. It should be noted here that A pairs with T through the interaction of two hydrogen bonds, while C pairs with G through the interaction of three hydrogen bonds. Thus, C-G pairs represent stronger bonds than A-T pairs.

[53] A standard library for the selection of nucleic acid sequences that bind to a target is based on the structure outlined in Figure 1.

[54] Where the two terminal portions 10a, 10b (coloured in black) represent primer recognition sites (approximately 20 nucleotides in length), and the internal portion \ 5 (coloured in grey) represents a random region of approximately 40 nucleotides in length. This is a single stranded molecule.

[55] Prior to the present disclosure, the removal of the antisense strand following PCR amplification was thought to be necessary to avoid the formation of duplexes, or more generally that only single stranded DNA would have the capacity to bind to an analyte. One embodiment disclosed herein includes the creation of a basis for expectations regarding the relative amount of homologous pairing to be expected following the double stranded amplification of a library for DNA ligand selection where such a library is generally described in Figure 1. This mathematical basis involves the following definitions.

[56] Let:

[57] n = the total number of nucleotides in a DNA molecule,

[58] r = the total number of nucleotides with homology between any two DNA motecules-

[59] Such that r can have any positive integer value from 1 to 40 or the value 0.

[60] "r" may be present in one contiguous block within n, or it may be distributed into contiguous blocks of various lengths. That is to say, that if we let r = 4, we must consider sequences that contain complementary regions consisting of four contiguous nucleotides and we must also consider sequences that contain multiple complementary regions wherein the sum of all complementary bases equals four. This is equivalent to the partion of a positive integer. This will be referred to herein as p(n) ₅ where p is the partition function.

[61] For p(4) the possibilities are; [62] 4

[63] 3, 1

[64] 2,2

[65] 2, 1,1

[66] 1,1,1,1

[67] Where the integer refers to the number of nucleotides found within r that are contiguous.

[68] For a total of five possibilities, thus p(4) = 5.

[69] Hansraj Gupta published a tabulation of partition values for integers up to 200 in the (Proceedings of the London Mathematical Society (1935) s2-39(l): 142-149). This is based on a formula I derived b Ramunajan and Hardy as follows:

[71] 1

[72] We present here the number of partitions possible for positive integers from 1 to 40.

[73] In consideration of the double stranded amplification of the library of Figure 1 a physical constraint is introduced that was not considered by Ramunajan and Hardy in their formulation. Given that r denotes only nucleotides that are homologous between two DNA strands, there must be a gap consisting of at least one nonhomologous nucleotide between homologous regions. As the number of complementary regions or blocks within any given partition increases then the number of gaps must also increase. Given that the random region of the DNA library of Figure 1 is of fixed length, this physical reality results in a reduction of the number of partitions of integers once the value of r exceeds half the value of n. To allow for this consideration an additional formulation is required.

[74] Let:

[75] . s = the number of contiguous complementary nucleotide blocks comprising any given r, [76] then,

[77] g = the number of gaps = s - 1.

[78] For n = 40, r =21, the partition where the largest contiguous block is one nucleotide would not fit in the defined sequence space (s = 21 thus g - 20, thus, r + g ^ 41). The actual number of partitions possible was tabulated through the use of the spreadsheet program Micrsoft Excel. A summary of the total number of partitions possible for values of r from I to 40 with n = 40, is provided in Figure 3. Tables comprising all possible partitions for all possible values of r were prepared in Microsoft™ Excel™.

[79] Figure 3 provides a determination of all the types of antisense complementary sequences possible for a given sense strand of the random region within the library outlined in Figure 1 with n = 40 when such a library is PCR amplified. This does not however provide a determination of the probability distribution of these sequences. To determine this there are four factors that required consideration:

[80] 1 ) The position of the contiguous block of complementary nucleotides within the random region.

[81] 2) The size of the gaps between contiguous blocks of complementary nucleotides

[82] 3) The possibility of symmetry between arrangements of contiguous blocks of different lengths

[83] 4) The number of possible non-complementary nucleotides.

[84] Lets start by considering a single contiguous block of nucleotides that are complementary to a contiguous block of nucleotides within a given sequence. The number of positions that this single contiguous block could exist within the random region is given by the formula II:

[85] p = n - r + l Π

[86] Where p = the number of positions.

[87] The minimal space occupied by more than one contiguous block is equal to r + g.

Let this equal h, and we are able to generalize the formula to:

[88] p = n - h + l ΠΙ [89] With two blocks of contiguous complementary nucleotides the sum of all possible sizes of h as a Junction of g is given by the formula VI:

h

P = Y ( _n - h + + (n - h + 1)> » Co - h + (n - ¾))

[90] f=S VI

[91 ] Where P = the grand total of positions.

[92] We increase the number of dimensions that this calculation is performed within for each contiguous block that is added.

[93] For example, if n - h + 1 = 4, for two contiguous blocks, the answer is found in the sum of

[94] (3+2+1) + (2 + l) + (l) +

[95] (2 + l) + (l) +

[96] (1)

[97] Where one dimension is comprised by the first row, and the second dimension by the rows beneath it. The number of dimensions that require summing increase in a manner equivalent to the number of contiguous blocks considered. A table containing all the values for r given different values of g was prepared and referred to within Microsoft™ Excel™ to determine the appropriate multiplier for this factor (termed "Position" or "p") for all physically realizable sequence partitions.

[98] Where contiguous blocks of complementary sequences are of different lengths from each other their order within the random region represents different sequences. Where contiguous blocks are of the same length a rearrangement of their order does not represent a different sequence in regard to our considerations herein. We refer to the number of sequences possible in this case as symmetries and determined their frequency within this model according to the following formula V:

[99] m - s!/(s-d-l)! V

[100] Where d = the number of contiguous blocks of complementary sequence that are different in length from each other.

[101] Finally, the total number of possible sequences for any partition value of r is equal to the formula VI: [102] (m)(p)(3(n-r)) VI

[103] Where the last value corresponds to the number of possible non-complementary nucleotides in any position within the random region that is not occupied by a complementary nucleotide for a given sequence.

[104] Based on these formulations Microsoft™ Excel™ formulations were created to determine the number of sequences for each partition of r for every value of r with n = 40. The number of sequences physically possible for any value of r with these constraints is provided in Figure 4.

[ 05] It can be seen that the majority of the sequences within a random library will have approximately ten complementary nucleotides with any given sequence. Figure 5 illustrates the same summary analysis with the y axis being charted on a logarithmic basis,

[106] It is noted that the distribution of sequences describe an arc in their descent as r increases above 10.

[107] Another way to consider the potential of the library of sequences to interfere with the openness of the random region is to determine the distribution of the largest single contiguous block within all possible sequences (see Figure 6).

[108] Where c' = the largest contiguous block of complementary sequences.

[109] By far the preponderance of possible sequences will not have contiguous blocks of complementary sequence for a given sequence that are large enough to form stable duplex structures. The strength of the hybridization between DNA strands which are only complementary within the primer recognition regions is sufficient to stably maintain such structures at room temperature. This means that the annealing of sequences to each other will entirely be a function of their relative concentration in solution. All sequences will exhibit more than the threshold capacity to bind stably with each other. Therefore the probability that any two sequences will be found together is simply a function of the product of their concentrations.

[1 10] Given this consideration it is clear that in the initial library the random regions between almost all PCR amplified sequences will be sufficiently open to enable interaction with target analytes. Moreover, as selection proceeds over rounds of library amplification the probability that a selected sequence will pair with its' duplex will remain a function of their relative concentration. In by far the majority of results published using the SELEX method, selected libraries remain fairly complex following the completion of selection. In certain instances it has been reported that a consensus motif is present in a large number of the selected sequences but this does not imply that the remainder of the random region exhibits any level of consensus across selected sequences. It has been the experience of the inventor, however with the use of Dubbles to select DNA ligands that at a certain point a reduction in complexity in the library eventually leads to a decrease in the proportion of sequences selected in succeeding rounds of selection.

[11 1] Given that the probability that a given sequence will pair with its' duplex is largely a function of the relative proportions of such sequences in the overall library then even if a selected sequence should reach a frequency of 10% of the entire library, only 10% of such sequences would find each other. The remaining 90% would be bound by sequences which may only have the primer recognition sites in common. In practice however, selection is driven by the presence of consensus motifs around which sequence identity is less important. The convergence of a Dubbles library towards such consensus motifs leads to a decrease in their ability to bind. This doe ^' s not diminish the capacity of the system for selection, as this diminished capacity for binding represents only a proportion of those sequences that predominate.

(1 12) It would be clear to a person of ordinary skill in the art that the argument put forward as the basis for the selection method of this invention shows that the removal of the antisense strand as taught by the inventors of SELEX is not necessary. Moreover, the inclusion of a step that involves the removal of the sense strand requires an unnecessary delay and introduces the potential for primer recognition sites to interfere with sequences that may exhibit binding to targeted analytes. This last point is not trivial. Given the presence of single stranded sequences within SELEX the primer sequences are not prevented from binding to complementary sequences within the random region. This complementary binding by the primer sequences reduces the effective solution space that can be sampled.

[113] It should also be clear that the insight provided by this invention is non-obvious given the continuing large number of reports of the use of the SELEX method in current scientific literature. The calculations required to prove the disclosure presented herein were not trivial in that total number of possible partitions for every value of r were formulated manually, rather than through the application of an algorithm.

[1 14] One embodiment of the present invention is a method for the selection of DNA Iigands for an analyte or target molecule. The method, in one embodiment, may include exposing a random library of single stranded DNA molecules to an analyte, partitioning of DNA molecules bound to the analyte from unbound molecules, which may be done through a variety of approaches, including but not limited to the immobilization of the analyte, such as to an affinity column or resin, amplifying the recovered bound DNA molecules, for example through the use of PCR amplification technology to obtain a population of double stranded DNA molecules, denaturating and reannealing of the double stranded population to obtain a sub-population of reannealed DNA molecules or Dubbles. These steps may optionally be repeated as necessary using the Dubbles instead of single stranded DNAs (i.e. exposing the analyte to the Dubbles) until DNA Iigands with a desired level of affinity and/or specificity for the target analyte are identified.

[115] In another embodiment, the present invention provides for a method for the selection of DNA Iigands for an analyte or target molecule. The method, in one embodiment, may include amplifying a random library of single stranded DNA molecules through, for example, a polymerase chain reaction technology, denaturing and annealing of the amplified library to obtain a population of Dubbles, exposing this library of Dubbles to an analyte, partitioning of DNA Dubbles bound to the analyte from unbound Dubbles through a variety of approaches, including but not limited to the immobilization of the analyte, amplifying recovered bound Dubbles through the use techniques such as PCR amplification technology to obtain a population of double stranded DNA molecules, denaturing and reannealing of the double stranded population to obtain a sub-population of Dubbles. These steps may optionally be repeated as necessary using the sub-population of Dubbles until DNA Iigands with a desired level of affinity and/or specificity for the analyte or target molecule are identified,

[1 16] Advantages of the methods for the selection of DNA Iigands of the present invention include: 1. Primer sequences do not interfere with the binding properties of the random region. This increases the size of the solution space that can be searched with the same size of starting library between Dubbles and SELEX.

2. The removal of the requirement for the separation of sense strands from antisense strands greatly increases the speed with which a round of selection can be performed. This removal of a step also greatly enhances the ease with which Dubbles based selection could be automated in comparison to SELEX.

3. The separation of the sense strand from the antisense strand leads to random losses of certain sequences during selection during SELEX based selection. The best binding sequences could be randomly lost early on in the selection process.

4. In practice SELEX often leads to the amplification of PCR artifacts as a result of the concatemerization of single stranded fragments. In practice Dubbles leads to consistent amplification.

5. Given that the primer sequence is not involved in the ltgand binding activity of a selected Dubbles molecule it is not necessary to synthesize this portion of the DNA sequence that is selected when screening for individual sequence binding activity. This saves money as shorter DNA molecules are less expensive to synthesize.

Π 171 Applications

[1 18] One enablement of the present invention includes the use of the DNA ligands identified through the method described herein as diagnostic probes, either in coupling with anti-sense partners or as single stranded molecules.

[1 1 ] Another embodiment of the present invention relates to the use of the DNA ligands identified through any of the methods described herein as therapeutic agents either in coupling with anti-sense partners or as single stranded molecules. DNA ligands identified through a method of the present invention, may be used in the prevention, treatment of a variety of disorders, including, without limitation, cancer, autoimmune diseases, diabetes, macular degeneration and so forth. The DNA ligands identified through any of the methods of the present disclosure may be used in a pharmaceutical composition comprising a DNA ligand capable of treating or preventing a disorder in an amount effective therefore, and a pharmaceutically acceptable vehicle, carrier or diluent. The pharmaceutical composition may contain other therapeutic agents and may be formulated, for example, by employing conventional vehicles or diluents, as well as additives of a type appropriate to the mode of desired administration, according to techniques such as those well known in the art of pharmaceutical formulation.

[120] Another embodiment of the present invention includes the use of the DNA Hgands identified through the use of the method described herein as Hgands for the determination of the concentration of an analyte, for example a target protein, in a sample. In one embodiment, a method for determining the concentration of an analyte in a sample may comprise: (a) exposing the sample to a DNA ligand capable of binding to the analyte to form a mixture, such that an analyte DNA ligand complex is formed in the mixture if the analyte is present in the sample; and (b) determining the concentration of the analyte in the sample by measuring the amount of analyte/DNA ligand complex formed in the mixture. In aspects, the DNA ligand may be immobilized on a resin, and the sample may be passed through the resin. In aspects, the resin may be washed with a solution free of analyte. The analyte bound to the DNA ligand may be released by adding a solvent that removes the ability for the DNA ligand to bind to the analyte thereby creating elution fractions. The concentration of the analyte present in the elution fractions may be determined by any appropriate method, such as, for example, fluorescence, high performance liquid chromatography, and so forth.

[121] Another embodiment of the present invention includes a DNA ligand capable of binding a wheat glutenin protein. In aspects, the DNA lignad capble of binding wheat glutenin may comprise a nucleotide sequence selected from SEQ ID NOs.:l- 26 or analogues or the functional equivalents of such sequences. In aspects of the present invention, the functional equivalents may be defined as a DNA molecule having a binding capacity to glutenin protein as demonstrated by a coefficient of disassoctation less than 1 mM.

[122] In another embodiment, the present invention includes a DNA ligand capable of binding a wheat glutenin protein. The DNA ligand may have a binding capacity to a wheat glutenin as demonstrated by a coefficient of disassociation less than 1 mM. [123] In embodiments, the DNA ligands of the present invention or the functional equivalents of said ligands may be used detecting the presence of, or determining the concentration of wheat glutenin proteins in a sample by the methods described herein.

[124] In other embodiments of the present invention the DNA ligands of the present invention for wehat glutenin proteins or the analogues or functional equivalents of such ligands may be used in predicting the baking quality of wheat flour or grain.

[125] The DNA ligands for a wheat glutenin protein of the present invention may be used, in one embodiment, as a diagnostic probe for the integrity of the wheat glutenin protein. This diagnostic probe may be useful, in one embodiment, as a predictive tool for end-use performance of a grain or flour.

[126] In another embodiment of the present invention, the DNA ligands for a wheat glutenin protein may be used as a diagnostic probe for the integrity of a glutenin protein as a predictive tool for determining the level of pre-harvest sprouting damage that has occurred within a wheat grain sample.

[127] In aspects, the DNA ligand for wheat glutenin of the diagnostic probes of the present invention may, in one embodiment, comprises a nucleotide sequence selected from SEQ ID NOs: 1 to 26, or a functional analogue or variant thereof. In aspects, the DNA ligand for wheat glutenin protein of the diagnostic probe may have a coefficient of disassociation (Kd) for wheat glutenin of less than 1 mM

[128] Another embodiment of the present invention includes a process that may be used to determine the number of partitions possible for each possible contiguous block of one DNA strand to another, and/or to determine the frequency of each partition within a library of DNA sequences, and/or to determine the expected the level of binding that would occur between a library of sequences and a given sequence.

[129] The DNA ligands of the present invention may also encompass "functionally equivalent variants", "functional fragments" or "analogues" of the DNA ligands of the present invention. As such, this would include but not be limited to oligonucleotides with substantial sequence homology, oligonucleotides having one or more specific conservative and/or non-conservative base changes which do not alter the biological or structural properties of the DNA ligand (i.e. the ability to bind to a target). [130] In terms of "functional analogues", it is well understood by those of ordinary skill in the art, that inherent in the definition of a biologically functional analogue is the concept that there is a limit to the number of changes that may be made within a defined portion of a molecule and still result in a molecule with an acceptable level of equivalent biological activity, which, in this case, would include the ability to bind to a an analyte or target molecule of interest, such as a protein, including a wheat glutenin protein, or a non-protein target, such as a mycotoxin or an antibiotic or any other non-protein molecule. A plurality of distinct nucleic acid polymers with different substitutions may easily be made and used in accordance with the invention. It is also understood that certain bases are particularly important to the biological or structural properties of the DNA ligand in the target analyte recognition region, such bases of which may not generally be exchanged.

[131] The DNA Hgand analogues of the instant invention also encompass nucleic acid polymers that have been modified by the inclusion of non-natural nucleotides including but not limited to, 2,6-Diaminopurine-2'-deoxyriboside, 2-Aminopurine- 2'-deoxyriboside, 6-Thio-2'-deoxyguanosine, 7~Deaza-2'-deoxyadenosine, 7- Deaza-2'-deoxyguanosine, 7-Deaza~8-aza-2'-deoxyadenosine, 8-Amino-2'- deoxyadenosine, 8-Amino-2'-deoxyguanosine, 8-Bromo-2'-deoxyadenosine, 8- Bromo-2'-deoxyguanosine, 8-Oxo-2'-deoxyadenosine, 8-Oxo-2'-deoxyguanosine, Etheno-2'-deoxyadenosine, N6-Methyl-2'-deoxyadenosine, 06-Methyl-2'- deoxyguanosine, 06-Phenyl-2'-deoxyinosine, 2'-Deoxypseudouridine, 2'- Deoxyuridine, 2,4-Difluorotoluyl, 2-Thiothymidine, 4-Thio-2'-deoxyuridine, 4- Thiothymidine, 5'-Aminothymidine, 5 -Iodothymidine, 5'-0-Methylthymidine, 5,6- Dihydro-2'-deoxyuridine, 5,6-Dihydrothymidine, 5-(C2-EDTA)-2'-deoxyuridine, 5-(Carboxy)vinyl-2'-deoxyuridine, 5-Bromo-2'-deoxycytidine, 5-Bromo-2'- deoxyuridine, 5-Fluoro-2'-deoxyuridine, 5-Hydroxy-2*-deoxycytidine, 5-Hydroxy- 2'-deoxyuridine, 5-Hydroxymethyl-2'-deoxyuridine, 5-Iodo-2'-deoxycytidine, 5- Jodo-2'-deoxyuridine, 5-Methyl-2'-deoxycytidine, 5-Propynyl-2'-deoxycytidine, 5- Propynyl-2'-deoxyuridine, 6-0-(TMP)-5-F-2'-deoxyuridine,

yl)-2'-deoxyuridine, N4-Ethyl-2'-deoxycytidine, 04-Methylthymidine, Pyrrolo-2'- deoxycytidine, and Thymidine Glycol.

[132] The DNA Hgands of the present invention may be made by any of the methods known to those of ordinary skill in the art most notably, preferably by chemical synthesis. A common method of synthesis involves the use of phosphoramidite monomers and the use of tetrazole catalysis (McBride and Caruthers, Tetrahedron Lett. (1983) 24:245-248). Synthesis of an oligonucleotide starts with the 3' nucleotide and proceeds through the steps of deprotection, coupling, capping, and stabilization, repeated for each nucleotide added.

[133] The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific Examples. These Examples are described solely for purposes of illustration and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.

[134] EXAMPLES

[135] The examples are described for the purposes of illustration and are not intended to limit the scope of the invention.

[136] Example 1: Use of the Dubbles strategy to identify DNA lisands for wheat proteins

[137] A Dubbles library was created with:

[138] cgctctcgtc catgtgttgg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnrmnnnnn ccacacgatg cgtagttccg (SEQ ID NO: 27).

[139] Glutenin protein was extracted according to the protocol of DuPont et al, J. Agric.

Food Chem., 2005, 53, 1575-1584. lOg of seed was ground to a powder per extraction with the use of liquid nitrogen. The ground powder was transferred to a 50 ml conical tube and extracted twice with 25 mL of a 50% 1-propanol for 1 hour at room temperature, with shaking. After each extraction the supernatant was discarded, and the pellet resuspended. The pellet was then suspended in 25 mL of 50% 1-propanol, 25 mM Tris, 25 mM DTT, at pH 8.0 for I hour at room temperature, with shaking. The suspension was tranferred to 1.5 mL eppendorf tubes and cleared by centrifugation at 12,000 g for 20 min at 40C. The cleared supernatants were transfered to 1.5 mL eppendorf tubes and dried down using the speedvac to complete dryness. These pellets constituted the purified glutenin protein fraction and were stored at -200C until use. [140] Three tubes of the dried down glutenin protein fraction were thawed at room temperature and resuspended in 300 ul of Selection Buffer (10 mM Hepes, 120 mM NaCl, 5 mM Cl _: 5 mM MgCl2, pH 7.0) per tube for one hour with shaking at room temperature. The suspensions were cleared by centrifugation at 12,000 g for 20 min at 4 degrees and the cleared supernatants were pooled and transferred to a fresh 1.5 mL eppendorf tube. The amount of protein present at this point was estimated through the use of a Bradford assay.

[141] ImmobiHzaton was performed using 500 uL of Ultralink beads. The 900 μΐ, of resuspended glutenin were mixed with 450 of lx Ultralink immobilization buffer and the total volume was added to the Ultralink beads (that had been previously equilibrated with Ix Ultralink immobilization buffer). Coupling was performed overnight at 4 degrees, with shaking. Following the coupling step, the supernatant was removed after centrifugation at 4,000 g for 5 min and the beads were resuspended in 1 mL of 1M Tris, pH 8.0. Blocking was performed overnight at 40 °C, with shaking. The supernatant was again removed after centrifugation at 1,000 g at 40 °C and the beads were washed three times with 1 mL of lx PBS pH 7.4. They were stored at 40 °C until use. We estimated that the concentration of immobilized protein on resin was 1.08 pmoles of glutenin protein immobilized per 500 μΐ of beads following this process.

[142] This single stranded DNA library was exposed to 100 μΐ of immobilized wheat glutenin proteins and resin, in a total volume of 300 μΐ. The fraction of DNA sequences that bound to this immobilized protein was eluted through the addition of free glutenin proteins. This fraction was amplified with PCR technology. The double stranded products of this amplification were denatured by heat treatment at 95 °C for five minutes and allowed to reanneal by letting them cool to room temperature. These Dubbles were then re-exposed to the immobilized glutenin protein. This process was repeated four times using the Dubbles for a total of five rounds ofselection.

[143] Following the final round of Dubbles selection, the Dubbles that were eluted were amplified again but this time they were not denatured and reannealed. They were simply cloned as duplex molecules into a pT vector and transformed into E. coli. The plasmids were purified and each strand of the Dubbles was then sequenced separately. Fifteen fragments were sequenced and listed in Table 1. [144] Clones were PCR amplified and labeled with the Hex fluorophore by attachment of this fluorophore to the forward primer used. One clone, 17F (SEQ ID NO: 2) exhibited a significant level of binding to glutenin proteins in a 10% DMSO sotution when added in a double stranded form (see Figure 7).

[145] The apparent d for the binding of this DNA sequence to glutenin proteins is approximately 300 nM. It should be noted that the DNA ligand in this example was tested in the double stranded form. This means that this DNA ligand exhibited a significant level of binding to glutenin proteins even in the presence of a completely complementary anti-sense sequence. It is presumed that this occurred due to at least partial melting of the double stranded DNA as a result of the presence of 10% DMSO. The presence of the DMSO was also necessary as a co- solvent for glutenin protein and the DNA ligands.

[146] Through the results of this example it is clear that the inventor has demonstrated that the concept articulated, namely the "Dubbles Selection Process" has been reduced to practice.

[147] Example 2: Replication of the use of the Dubbles strategy for identification of DNA ligands for wheat storage proteins

[148] In this example an alternative method for the solubilization of glutenin proteins from wheat was used. The glutenin protein was extracted from wheat grain using a sodium bicarbonate extraction (100 mM NaHC03, 100 raM dithiothreiotol, 10% (v/v) DMSO, 1 mM CaCI2 1 mM MgC12). This resulted in higher stability of the protein. This process also resulted in a cleaner fraction of high molecular weight glutenin with less low molecular weight proteins contaminating it. All other experimental details were performed as described for Example 1 except that selection was performed for 17 rounds rather than the 5 rounds used for Example 1.

[149] The sequences identified by Dubbles analysis are provided in table 2.

[150] In binding tests with these sequences, the sequence 57F (SEQ ID NO: 26) exhibited significant binding to high molecular weight (HMW) glutenin subunits. Binding was determined through the labelling of the putative DNA ligand with the fluorophore Hex through the use of fluorescence polarization. Varying amounts of protein were combined with a 35 nM concentration of the labelled DNA in 170 μΐ, total volume per sample. A binding curve was plotted as shown in Figure 8 and a coefficient of disassocjation was calculated as 8 μΜ.

[151] Example 3: Demonstration that Dubbles selection, has an effect on the population of sequences under selection

[152] It would be expected over rounds of Dubbles selection the level of similarity among sequences would increase. Most existing analytical approaches to evaluating the level of similarity among sequences is founded on the assumption that the sequences are genes or portions of genes, and as such the position and identity of each nucleotide within the sequence is important. With DNA ligands, the motifs that are involved in binding to any given target molecule may be equally effective regardless of their position within the overall sequence. Therefore, analytical programs such as Clustal W which assume that the position of similar sequences is important may not provide an adequate evaluation of the similarity among sequences following selection,

[153] To circumvent this difficulty, I computed the antisense sequences of each of the selected sequences for examples 1 and 2, following Dubbles based selection for DNA ligands for glutenin proteins. I then used the program DINAMelt (Two state melting (hybridization module) (Markham, N. R. & Zuker, M. (2005) DINAMelt web server for nucleic acid melting prediction. Nucleic Acids Res., 33, W577-W581.) to determine the relative free energy (AG) of each possible pairwise comparison between a selected sequence within an example, and the antisense sequence for each other characterized sense sequence from the same example. The hybridization values ((AG) were not tabulated for the hybridization products between sense and antisense sequences from the same original sequence.

[154] In addition, I generated twenty random sequences and performed the same exercise with this random sample. The random sample would be equivalent to the state of the DNA library prior to any Dubbles selection.

[155] This analysis is a comparison of the sequence similarity among sequences. Where sequences are similar, their antisense sequences will anneal with each other at low levels of AG. For the purposes of analysis, the negative AG values were transposed to their absolute values, thus in our analysis a higher value indicates a higher degree of similarity.

[156] The results of this analysis are presented in Figure 9. In the case of Example 1, Dubbles selection was performed for five rounds of selection, while in the case of Example 2, Dubbles selection was performed for seventeen rounds. It is clear in Figure 9, that five rounds of Dubbles selection led to increased similarity among sequences as compared to the random sequences. It is also clear that the further selection applied in Example 2 led to higher levels of sequence similarity among sequences than was observed in Example 1.

[157] Tables

Π58) Table 1

Clone DNA Sequence SEQ ID NO:

7F gtctgttggtgttgatttattttgtttatagttgtgattt 1

17F tgtgtgttttaggctttattagttgtgtttatggggtggg 2

25F gtgggttgggttgtgtcggtagggtaggggttaacattgg 3

1 1 F gcttatttggcaggttggtggtggggatggatggggttgg 4

14F gcggagtgggaggggtgtagaggtagtggggggttgtgg 5

12F gcaagtaacattagagagatatcggggcgaattattgcgt 6

1 F aacaaaaacaaacagaaaaaaaataaaaaagggaagca 7

2F gaccgcctcgaaagggcaatgctaagggggaagaagagga 8

28F cccgccccccccgcaccgacgcacccatctagcgacttgg 9

10F cccttcgccgaccccagccccgctcggccctccccactaacaactaccgcaccc 10

21F tcctcttcttcccccttagcattgccctttcgaggcggtc 11

18F ttateccttcgtcgtaggctacttgcggtattcttttttt 12

IF tggctggtctttgtcgtgctgtatgtgttgttggtggggg 13

23F ggtgcggaaggggatctagagggggtagagtaggaggggg 14 [1591 Table 2

Clone DNA Sequence SEQ ID NO

40F ctggatgtggtcgggtgtgggcactggggtgtagttgggg 15

41F gcagattggtgggtggcgtgggggcgtatgcggttgctgg 16

42F ggtggtcgttggttgttgtggcgcgtgtgggggggttggg 17

43F gcgaagggtaggcggtaagaaggtgagggatagggcgggc 18

44F gcccggcgggaaagggtttggcagcccagggacgtggccg 19

45F gccgaaacctacaccgcacacgccatccccccactcctcc 20

46F gcatggagagggttgatcggaggtccgaatggcggttggg 21

47F ggctgtgggtgtgtgtggtgttctgcgggtctgtgggggg 22

48F cgggggggctggtagtgtggattagtgacatgtctggttg 23

63F gcagggggggcaggaggagggtgtgtctcactgggtcggc 24

64F ggcagaatgtgcgggtggtggtttgggttgtgtcgcgggg 25

57F gtgtgggtttttggttggttggtggcgtgttggattgggg 26

[160] The above disclosure generally describes the present invention. Changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation. Other variations and modifications of the invention are possible. As such modifications or variations are believed to be within the sphere and scope of the invention as defined by the claims appended hereto.