METSPALU ANDRES (EE)
KRJUTSKOV KAAREL (EE)
METSPALU ANDRES (EE)
US6448010B1 | 2002-09-10 |
KURG A ET AL: "ARRAYED PRIMER EXTENSION: SOLID-PHASE FOUR-COLOR DNA RESEQUENCING AND MUTATION DETECTION TECHNOLOGY", GENETIC TESTING, LARCHMONT, NY, US, vol. 4, no. 1, 21 March 2000 (2000-03-21), pages 1 - 7, XP009003695, ISSN: 1090-6576
TEBBUTT SCOTT J ET AL: "Microarray genotyping resource to determine population stratification in genetic association studies of complex disease", BIOTECHNIQUES, vol. 37, no. 6, December 2004 (2004-12-01), pages 977 - 985, XP001536623, ISSN: 0736-6205
TEBBUTT SCOTT J ET AL: "SNP Chart: an integrated platform for visualization and interpretation of microarray genotyping data", BIOINFORMATICS (OXFORD), vol. 21, no. 1, 1 January 2005 (2005-01-01), pages 124 - 127, XP002444657, ISSN: 1367-4803
PODDER MOHUA ET AL: "Dynamic variable selection in SNP genotype autocalling from APEX microarray data.", BMC BIOINFORMATICS 2006, vol. 7, 2006, pages 521, XP002444658, ISSN: 1471-2105
KRJUTSKOV, NUCLEIC ACID RESEARCH ADDED, 2008
MATSUZAKI, H. ET AL.: "Genotyping over 100,000 SNPs on a pair of oligonucleotide arrays", NAT. METHODS., no. 1, 2004, pages 109 - 111
MATSUZAKI, H. ET AL.: "Parallel genotyping of over 10,000 SNPs using a one-primer assay on a high-density oligonucleotide array", GENOME RES., no. 14, 2004, pages 414 - 425
BARRETT, J. C. ET AL.: "Evaluating coverage of genome-wide association studies", NAT GENET., vol. 38, no. 6, June 2006 (2006-06-01), pages 659 - 62
NILSSON, M. ET AL.: "Padlock probes: circularizing oligonucleotides for localized DNA detection", SCIENCE, no. 265, 1994, pages 2085 - 2088
HARDENBOL, P. ET AL.: "Multiplexed genotyping with sequence-tagged molecular inversion probes", NAT. BIOTECHNOL., no. 21, 2003, pages 673 - 678
HARDENBOL, P. ET AL.: "Highly multiplexed molecular inversion probe genotyping: Over 10,000 targeted SNPs genotyped in a single tube assay", GENOME RES., no. 15, 2005, pages 269 - 275
GUNDERSON, K. L. ET AL.: "A genome-wide scalable SNP genotyping assay using microarray technology", NAT. GENET., no. 37, 2005, pages 549 - 554
STEEMERS , F. J. ET AL.: "Whole-genome genotyping with the single- base extension assay", NAT METHODS., vol. 3, no. 1, January 2006 (2006-01-01), pages 31 - 3
KURG, A. ET AL.: "Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology", GENET TEST., vol. 4, no. 1, 2000, pages 1 - 7
Claims
1. A method to determine single nucleotide polymorphism (SNP) in a target nucleic acid sequence, said method comprising the steps of: a) providing a template nucleic acid, consisting of a first and a second strand and having one studied nucleotide pair; b) designing a first and a second APEX-2 oligonucleotide primer; said first APEX-2 primer consisting of a first specific oligonucleotide sequence in its 3'-end and a universal sequence in its 5'end, said universal sequence further having a modification in its 5'end , and said first specific oligonucleotide sequence being complementary to nucleotides before the unknown nucleotide in the first strand of the template nucleotide acid; said second APEX-2 primer consisting of a second specific oligonucleotide sequence in its 3'-end and a universal sequence in its 5'end, said universal sequence optionally having a modification in its 5'end and, said second specific oligonucleotide sequence being complementary to nucleotides before the unknown nucleotide in the second strand of the template nucleotide acid; c) amplifying the unknown nucleotide of the first and the second strand of the template nucleotide acid by running a multiplex PCR primer extension reaction with the first and the second APEX-2 primers as templates, thereby producing a first amplification product, said first amplification product consisting of a first and a second strand, said first strand consisting of sequence of the first APEX- 2 primer and a complementary sequence to the second APEX-2 primer and the unknown nucleotide between them, and the second strand consisting of complementary sequence to the APEX-2 first primer and the sequence of the second APEX-2 primer and the unknown nucleotide between them; d) amplifying the first amplification product in a PCR reaction with universal primer as template, thereby producing a second amplification product; e) providing a microarray of probes, where probes are identical to the first and the second APEX-2 primers of step b) and where the primers are immobilized on the array by attaching them to a solid surface from the modified 5'end; f) letting the second amplification products anneal with immobilized primers and providing labeled or modified terminator nucleotides for single base extension reaction; and g) identifying terminating nucleotide that has been added to the probes, said terminating nucleotides corresponding to the unknown nucleotides of the template nucleic acid.
2. The method according to claim 1 , wherein the template nucleic acid has a first and a second pair of unknown nucleotides in proximity of 2 to 25 bp to each other and wherein the first specific oligonucleotide sequence is complementary to nucleotides before unknown nucleotide of the first nucleotide pair on the first nucleic acid strand and the second specific oligonucleotide sequence is complementary to nucleotides before unknown nucleotide of the second nucleotide pair of the second nucleic acid strand.
3. The method according to claim 1 or 2, wherein the universal sequence of both the first and the second APEX-2 primers have a modification in its 5' end.
4. The method according to claim 1 or 2, wherein only two cycles of amplification are used to produce the first amplification product in step c).
5. The method according to claim 1 or 2, wherein the modifications in the 5'end of the first specific primer and/or the second specific primer are attached with a linker.
6. The method according to claim 5, wherein the linker is Amine-C6.
7. The method according to claim 1 or 2, wherein the template nucleic acid is selected from a group consisting of genomic DNA, cDNA and RNA.
8. The method according to claim 1 or 2, wherein the solid surface is made of a material selected from the group consisting of glass, plastic, beads, and paper.
9. The method according to claim 1 or 2, wherein the studied nucleotide pair is di,-tri or quatro allelic mutation or SNP.
10. The method according to claim 1 or 2, wherein the unknown nucleotide pair is an insertion and the identifying terminating nucleotide of step g) corresponds to first nucleotide of insertion sequence.
11. The method according to claim 1 or 2, wherein the unknown nucleotide pair is a deletion and the identifying terminating nucleotide of step g) corresponds to first nucleotide of opposite APEX-2 primer.
12. The method according to claim 1 or 2, wherein the universal sequence is according to SEQ ID NO:1. |
Description
A method to determine single nucleotide polymorphisms and mutations in nucleic acid sequence
Technical Field
[0001] This invention relates generally to genotyping technologies and mutation detection. More specifically this invention relates to methods to determine single nucleotide polymorphisms and mutations in genome. This invention is suitable for nucleic acid primary structure analyzes, for epigenetic effects and in molecular diagnostics.
Background Art
[0002] Genotyping technologies enable to construct high-resolution genetic maps for genomes of human and other organisms, resulting in LD blocks or r 2 bins dependent of the method used. These LD blocks (haplotypes) can be used in association studies to localize genes responsible for a particular phenotype (e.g. disease). In other words, the aim of genotyping is to find correlations between genome organization (haplotype) and a particular phenotype.
[0003] It is becoming increasingly evident, that hundred thousands single nucleotide polymorphisms (SNP-s) have to be analyzed simultaneously to get a complete picture of haploblocks' (or r 2 bin) arrangement. Thus, new methods are needed to accomplish this expansive and expensive task. Below is an overview of well-known genotyping methods that despite of their high throughput technology have also their limiting factors and therefore new cost-effective, flexible and focused genotyping methods are needed.
[0004] Genotyping and mutation detection is increasingly more substantial in clinical practice. Modern and reliable methods are alternative for RFLP, allele-specific PCR or sequencing in future. Flexible genotyping and mutation detection analyzes systems help to diagnose tens of candidate genetic markers in one reaction in short time as a routine procedure.
[0005] 1. Detection based hybridization methods such as Affymetrix GeneChip (Figure 1.) technology enables to analyze half a million SNP-s MATSUZAKI, H., et al. Parallel genotyping of over 10,000 SNPs using a
one-primer assay on a high-density oligonucleotide array. Genome Res. 2004, no.14, p.414-425. Studied loci in genomic DNA are amplified without PCR with specific primers. An alternative way to reduce complexity of the genome is to use the restriction enzyme cut of genomic DNA, ligation of the fragments produced in this way to a universal linker and amplification with universal primers in PCR. Amplified regions are fragmented, labeled and hybridized to complementary oligonucleotides synthesized on microarray. In case of a perfect match a duplex is formed and a signal from the perfect match pairings, which is higher than signals from the mismatched pairing, is detected. GeneChip microarray uses 25 base pairs (bp) long oligonucleotides containing a central nucleotide corresponding to the studied SNP. Hence, on both sides of a SNP, there are regions with 12 bp perfect match and in the middle, at the position of the SNP 1 a perfect match or a mismatch can occur.
[0006] The key step of the method is DNA restriction and addition of universal linker sequences to the ends of all created fragments. Subsequently 250- 2000 bp long fragments, containing the SNP(s) of interest are amplified with primers that anneal to the universal linker sequences (universal primer). With this approach a vast number of genomic sequences can be amplified with minimal cost. The limiting factor in this method is the number of restriction sites across the genome. Thus, SNP-s not located in the synthesized fragments (250-2000 bp), cannot be detected. Hence, this method in principle doesn't cover the whole genome and therefore the lllumina 300K array is as informative as Affymetrix 500K array in CEU population BARRETT, J. C 1 et al. Evaluating coverage of genome-wide association studies. Nat Genet. June 2006, vol.38, no.6, p.659-62.
[0007] 2. Affymetrix Molecular Inversion Probe (MIP) method uses MIP molecules, which are special "padlock" probes NILSSON, M., et al. Padlock probes: circularizing oligonucleotides for localized DNA detection.. Science. 1994, no.265, p.2085-2088. for genotyping. MIP molecule is a linear oligonucleotide that contains specific regions, universal sequences, restriction sites and a Tag (index) sequence (16-22 bp). MIP hybridizes directly around the genetic marker/SNP of interest (Figure 2).
[0008] MIP method uses 1500 "padlock" probe sets that hybridize to genomic DNA in parallel HARDENBOL, P., et al. Multiplexed genotyping with sequence-tagged molecular inversion probes. Nat. Biotechnol. 2003, no.21 , p.673-678. In case of a perfect match binding genomic homology regions are ligated by creating a circular molecule. After the first restriction all molecules are amplified with universal primers. Amplicons are restricted again to ensure short fragments for hybridization on microarray. Generated short fragments are labeled and through Tag sequence hybridized to cTag (complementary strand for index) on array. After the formation of Tag-cTag duplex a signal is detected.
[0009] Despite the complexity of experimental procedures, it is possible to amplify up to 10 000 SNP-containing sequences in one reaction. Thereby polymorphisms can theoretically be detected in any genomic region of interest HARDENBOL, P., et al. Highly multiplexed molecular inversion probe genotyping: Over 10,000 targeted SNPs genotyped in a single tube assay. Genome Res. 2005, no.15, p.269-275. There are two MIP probes for each allele, thus the method uses four probes (70 to 100 bp), a universal primer and a cTag sequence on array for a SNP detection in both strand.
[0010] 3. lllumina GoldenGate genotyping platform outstands primarily with an original solution of the gene chip, but the molecular approach amplifying genomic regions is similar to MIP probes. Genomic DNA fragments are attached to specific particles, followed by hybridization with specific probe molecules (Figure 3).
[0011] Probe molecules are supplied with three different universal sequences and a Tag sequence, situated between the specific region and universal primer GUNDERSON, K. L., et al. A genome-wide scalable SNP genotyping assay using microarray technology. Nat. Genet. 2005, no.37, p.549-554. Specific primers are hybridized to genomic DNA and designed to be allele specific, meaning that in order to identify a SNP, an oligonucleotide must be synthesized in a way that its 3' end binds to the SNP under study.
[0012] Hence, to determine a SNP two probe molecules, each supplied with a different universal primer sequence, are needed. In case of a 3' perfect
base-pairing at the 3'-end one primer is elongated by primer extension reaction up to the other oligonucleotide, followed thereafter by ligation and generation of a linear molecule. The formed molecule includes two universal primer-binding sites and a resequence.
[0013] The formation of a linear molecule enables the PCR amplification with universal primers, which in turn are supplied with two different fluorescence labels to detect homo- or heterozygosity at the studied position. GoldenGate method uses hybridization-based signal detection through formation of Tag-cTag complex.
[0014] 4. The lnfinium 1 method of lllumina (Figure 4) enables similarly to
Affymetrix GeneChip technology a genome-wide analysis and to test up to half a million SNPs on a gene chip so far. The method doesn't use PCR to amplify the studied loci. Instead genomic DNA is amplified using the WGA method {Whole Genome Amplification) GUNDERSON, K. L., et al. A genome-wide scalable SNP genotyping assay using microarray technology. Nat. Genet. 2005, no.37, p.549-554.
[0015] Amplified genomic DNA is fragmented and hybridized to oligonucleotides (75 bp) on the gene chip. After hybridization from 16 to 18 hours unbound or mismatched fragments are removed during a specific wash step.
[0016] The studied genotype on the gene chip is determined by using allele- specific oligonucleotides (InfiniumT), where the 3'- terminal nucleotide is complementary to the SNP and which are primer extended away from the marker. In case of a perfect match primer sequence is elongated by DNA polymerase with fluorescence-labeled desoxynucleotides, which in case of the switch in the chain give a fluorescence signal. In order to detect a SNP two oligonucleotides are used on a gene chip.
[0017] lnfinium 2 platform incorporates two-color single base extension to detect a single nucleotide polymorphism with lOOKBeadChip, using only one oligonucleotide per SNP STEEMERS , F. J., et al. Whole-genome genotyping with the single-base extension assay. Nat Methods. Januar 2006, vol.3, no.1 , p.31-3.
[0018] Compared to GeneChip technology lnfinium 1 and daren't defined by the restriction sites in genomic DNA and therefore has a good potential to solve the genotyping of all SNPs.
Disclosure of Invention
[0019] The method according to this description is a genotyping and mutation analysis method that enables a robust, flexible, cost-effective SNP and mutation analysis accompanied with high fidelity. The method is hereinafter called APEX-2 (Arrayed Primer Extension using Universal primer). APEX-2 is very well suited for a focused study with 15 to 1500 SNPs or mutations. In principle all SNP-containing sequences can be amplified in one reaction tube and further genotyped on a microarray by single base extension.
Brief Description of Drawings
[0020] Fig. 1 schematically shows the known method of Affymetrix GeneChip.
[0021] Fig. 2 schematically shows the principle of Affymetrix MIP method.
[0022] Fig. 3 schematically shows that principle of lllumina Bead Chip method.
[0023] Fig. 4 schematically shows the principle of lllumina lnfinum 1 and 2 method.
[0024] Fig. 5 schematically shows the principle of APEX-2 and three main phases (preferred embodiment).
[0025] Fig. 6 schematically shows the principle of APEX-2, second embodiment.
[0026] Fig. 7 schematically shows an example of the APEX-2 primer structure. In this example the universal sequence has sequence gatcaggcgtctgtcgtgctc (SEQ ID NO:1); the first APEX-2 primer has sequence gattgagctgctgcttttctctcctt (SEQ ID NO:2) and the second APEX-2 primer has sequence ccctgcctcacacctgatagcac SEQ ID NO:3)
[0027] Fig. 8 schematically shows binding of the specifically designed primers to genomic DNA and their location with respect to the studied SNP or mutation in the APEX-2 system.
[0028] Fig. 9 schematically shows detection of mutations (insertion and deletion) in the APEX-2 system.
[0029] Fig. 10 illustrates visualization of the proof of principle for APEX-2 genotyping method using 621 genetic loci
Mode(s) for Carrying Out the Invention
[0030] APEX-2 method, according to preferred embodiment, enables template amplification through high levels of multiplexing PCR in two phases: primer extension (First phase) and PCR with universal primers (Second phase) (Figure 5). That means, in the first step a specific primer extension product (APEX-2 pre-product) will be obtained where studied nucleotide (e.g. SNP or mutation) has been analyzed, in the second step we just increase the amount of this product using universal primer in order to have enough molecules to be detected in signal detector. Only new information in this amplicon is the studied nucleotide itself. In detail, in the first phase, the method uses two specific oligonucleotide primers for determination of one studied nucleotide. These primers are called APEX-2 primers. First APEX- 2 primer binds to the coding DNA strand and the second APEX-2 primer to its complementary DNA strand. As a result of primer extension in the first phase, the APEX-2 pre-product is formed. The Pre-product contains two APEX-2 primer sequences, complementary sequences for APEX-2 primers and studied nucleotide pair in the middle of the two APEX-2 primers (see Fig. 5). In this case only one new non primer studied nucleotide will be amplified. The second phase (universal primer PCR) is essential for amplification of the pre-products. The universal primer PCR amplification step is only for completely synthesized pre-products. Universal primer is identical to the universal part of APEX-2 primers and thus can bind to synthesized complementary sequences of APEX-2 primers.
[0031] According to another preferred embodiment (Figure 6) the method uses two specific APEX-2 primers for detection of two studied nucleotides in close proximity to each other. In this case more than one studied nucleotides (2-25) are amplified in the first phase primer extension depending on the distance between the studied nucleotides. The principles of second- and third phase are same for the embodiment described above and this embodiment.
[0032] Each APEX-2 primer consists of two specific sequence regions: 3' complementary sequence for template nucleic acid (genomic DNA, cDNA,
RNA), and a universal sequence (for example SEQ ID N0:1) for large- scale amplification and an optional modification in the 5 ' end (attached via linker, for example Amine-C6) (Figure 7) to enable APEX-2 primer immobilization on solid surface as microarray (glass, plastic, beads, and paper). Therefore, determination of one studied nucleotide or determination of two studied nucleotides locating close to each other requires two APEX-2 primers and one universal sequence in amplification and in detection on microarray.
[0033] The APEX-2 primers according to this invention are designed in the way that the 3 ' end of the primer terminates at the nucleotide before the studied nucleotide. As according to one preferred embodiment (Figure 8), only one nucleotide from target nucleic acid is being amplified after the first and the second phase on APEX-2 reaction. According to another preferred embodiment (Figure 6) the APEX-2 primers are designed so that APEX-2 primer 1 for coding DNA strand terminates at the nucleotide before the studied allele 2 position and APEX-2 primer 2 for complementary DNA strand terminates at the nucleotide before the studied allele 1 position.
[0034] In the third phase (detection) the studied nucleotides are detected through single base extension on an microarray where the primers have same design as the primers of the first phase. In other words detection on microarray uses the same APEX-2 oligonucleotides (attached to solid phase) as used in APEX-2 amplification (in liquid phase).
[0035] Primer extension in the first APEX-2 phase and single-base extension in detection phase enable to detect di, -tri or quatro allelic mutations or SNPs. APEX-2 primer ends one nucleotide before the studied position and all four nucleotides (A, T, C, G) which are complementary to template nucleic acid are possible in primer extension. In the detection step, APEX- 2 uses four labeled nucleotides (A, U, C, G) as in published APEX method KL ) RG, A., et al. Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology. Genet Test. 2000, vol.4, no.1 , p.1-7.
[0036] APEX-2 method is suitable for SNP- as well as for single nucleotide mutation (i.e. one nucleotide substitutions, insertions, deletions) analysis.
APEX-2 method also enables detection of 2-25 nucleotide long deletions or insertions by using APEX-2 primers which are designed in a way that the primer 3 ' ends terminates one nucleotide before the studied region and the first nucleotide of the insertion sequence or one nucleotide substitution is detected (Figure 9A). In case of a deleted region or single nucleotide deletion, APEX-2 primer 3 ' ends terminates one nucleotide before the studied deletion and the first nucleotide of the opposite APEX-2 primer is detected (deletion) (Figure 9B). As comparison a wild type sequence is used, where no deletion has taken place. In this case the first nucleotides of both ends of the deletion region is detected (Fig. 9A). [0037] APEX-2 method differs from Affymetrix MIP probe and lllumina GoldenGate techniques as follows: a) ligation reaction is not needed; b) highly multiplex PCR (in principle 15 to 1500-plex) is used; c) APEX-2 primers are used for PCR and for single base extension on the microarray; d) index sequences {tag and ctag) are not needed.
[0038] Another difference between the method according to this invention and any prior art disclosures is the primer-target architecture - the APEX-2 primer ends one nucleotide before the studied nucleotidein first and second phase amplification and also in detection phase on microarray (single base extension). Thus, no allele-specific primers are needed for studied nucleotide detection and only two APEX-2 primer sequences are essential for amplification and detection of both the alleles of the nucleic acid.
[0039] APEX-2 primers used in the first phase of APEX-2 and detection step have a modification at their 5 ' end (attached via linker, for example Amine-C6), which enables to spot the same primers (or primer) on a microarray and to detect the appropriate studied nucleotide by single base extension with fluorescently labeled ddNTP-s. EXAMPLE 1
[0040] The first example describes amplification of the SNPs or mutations under study (Figure 10).
[0041] To amplify all SNPs in highly multiplex PCR reaction, genomic DNA was diluted in TE buffer (10 mM Tris (pH 8.0), 1 mM EDTA) to 100 ng/μl, denaturized for 5 minutes at 98 0 C and cooled down to room temperature just before PCR. Multiplex PCR was carried out in 20 μl volume that contained PCR buffer (60 mM Tris-HCI (pH 8.3), 60 mM KCI, 15 mM (NH-OaSO 4 ) (Fermentas), 0.2 mM each desoxynucleotide (G, C, A, T), 5 mM MgCb, 2 U TrueStart DNA polymerase (Fermentas), 30 nM each specific primer (Metabion) and 200 ng genomic DNA. Twenty-four cycles of PCR were run on GeneAmp PCR System 9700 (Applied Biosystems) thermocycler: initial denaturation and TrueStart DNA polymerase activation 5 minutes at 98 0 C, denaturation at 95 0 C for 30 sec, annealing at 56 0 C for 20 sec, extension at 72 0 C for 20 sec and final extension for 5 minutes at 72 0 C. Time between annealing and extension step is 6.5 minutes (ensured by 3% ramp speed). First, PCR products created using specific primers are the templates for universal primer amplification in phase two. Universal primer amplification is carried on in 150 μl volume that includes 20 μl of first phase PCR product. Mixture (130 μl) contains PCR buffer (80 mM Tris (pH 9.5) 20 mM (NH 4 ) 2 SO 4 , 0.2% w/v Tween-20) (Solis Biodyne), 3.5 mM each nucleotide, 3.5 mM MgCb, 15 HotFire DNA polymerase (Solis Biodyne) and 40 μM universal primer (gatcaggcgtctgtcgtgctc) (SEQ ID NO:1). Initial enzyme activation and denaturation last for 15 minutes at 95 0 C, denaturation at 95 0 C for 30 sec, annealing at 54 0 C for 30 sec, extension at 72 0 C for 5 sec and after twenty cycles final extension for five minutes at 72 0 C. As a check, 1 μl of PCR product is visualized on 2.5% TBE agarose gel to confirm the size range of amplicons (Figure 9). PCR products from universal primer amplification are purified using the MinElute Purification kit (Qiagen) under modified protocol. 600 μl binding buffer is mixed with 150 μl of PCR product. 5 μl 5.4 M (pH 5.0) of sodium-acetate is added to guarantee the optimum pH for the spin column. Products are eluated with 23 μl EB buffer (Qiagen). EXAMPLE 2
[0042] This second example describes the single base extension on microarray (Figure 10, detection and analyze)
[0043] Alkaline phosphatase (SAP) treatment is essential before primer extension with didesoxynucleotides to eliminate active desoxynucleotides in this reaction. 3 μl of 10X ThermoSequenase™ (Amersham Bioscience) reaction buffer and 0.5 U SAP (Fermentas) is added to purify the PCR / product. Mixture is incubated for 15 minutes at 37 0 C and SAP is inactivated during heating for 10 minutes at 95 0 C. This incubation is also as template denaturation phase before primer extension on array. After 10 minutes of denaturation at 95 0 C 1.25 μM didesoxynucleotide mixture (Cy3- ddATP; Cy5-ddGTP; Texas Red ® -ddCTP and Fluoresceine-12-ddUTP (Perkin Elmer Life Science)), 5 U of ThermoSequenase™ DNA polymerase (Amersham Biosciences) and 3 mM MgCb in the final volume of 30 μl are added. Mixture is applied to the pre-warmed arrays on a heat- plate and the arrays are covered with LifterSlip™ ((22 x 25 mm) Erie Science Company). The hybridization and APEX reaction is performed at 58 0 C for 20 minutes and terminated by washing at 95°C for 1 min in MiIIi-Q water, followed by washing for 3 min in 0.3% Alconox ® solution (Alconox). Alconox is removed by washing the arrays two times for 1 min with 95°C MiIIi-Q water. To reduce bleaching, 12 μl SlowFade ® antifade reagent (Invitrogen) is applied to the slide. The arrays are scanned with the Genorama ® imaging system (Asper Biotech) at 20 μm resolution.
References
[0044]
• MATSUZAKI, H., et al. Genotyping over 100,000 SNPs on a pair of oligonucleotide arrays. Nat. Methods. 2004, no.1 , p.109-111.
• MATSUZAKI, H., et al. Parallel genotyping of over 10,000 SNPs using a one-primer assay on a high-density oligonucleotide array. Genome Res. 2004, no.14, p.414-425.
• BARRETT, J. C, et al. Evaluating coverage of genome-wide association studies. Nat Genet. June 2006, vol.38, no.6, p.659-62. NILSSON, M., et al. Padlock probes: circularizing oligonucleotides for localized DNA detection.. Science. 1994, no.265, p.2085-2088.
• HARDENBOL 1 P., et al. Multiplexed genotyping with sequence-tagged molecular inversion probes. Nat. Biotechnol. 2003, no.21 , p.673-678.
HARDENBOL 1 P., et al. Highly multiplexed molecular inversion probe genotyping: Over 10,000 targeted SNPs genotyped in a single tube assay. Genome Res. 2005, no.15, p.269-275. GUNDERSON, K. L., et al. A genome-wide scalable SNP genotyping assay using microarray technology. Nat. Genet. 2005, no.37, p.549- 554.
STEEMERS , F. J., et al. Whole-genome genotyping with the single- base extension assay. Nat Methods. Januar 2006, vol.3, no.1 , p.31-3. KURG, A., et al. Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology. Genet Test 2000, vol.4, no.1, p.1-7.