PUTTA MALLIKARJUNA REDDY (US)
JARPE MATTHEW (US)
WO2019060746A1 | 2019-03-28 |
US20190070213A1 | 2019-03-07 | |||
US10113163B2 | 2018-10-30 |
We claim: 1. A method of editing an ABCA4 polynucleotide comprising a single nucleotide polymorphism (SNP) associated with Stargardt Disease, type 1, the method comprising contacting the ABCA4 polynucleotide with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration of the SNP associated with Stargardt Disease, type 1, thereby editing the ABCA4 polynucleotide. 2. The method of claim 1, wherein the ABCA4 polynucleotide is contacted with the guide oligonucleotide in a cell. 3. The method of claim 2, wherein the cell endogenously expresses ADAR. 4. The method of claim 3, wherein the ADAR is a human ADAR. 5. The method of claim 4, wherein the ADAR is human ADAR1. 6. The method of claim 4, wherein the ADAR is human ADAR2. 7. The method of any one of claims 2-6, wherein the cell is selected from eukaryotic cell, a mammalian cell, and a human cell. 8. The method of any one of claims 2-7, wherein the cell is in vivo. 9. The method of any one of claims 2-7, wherein the cell is ex vivo. 10. A method of treating Stargardt Disease, type 1, in a subject in need thereof, the method comprising: identifying a subject with a single nucleotide polymorphism (SNP) associated with Stargardt Disease, type 1, in an ABCA4 polynucleotide; contacting the ABCA4 polynucleotide in a cell of the subject with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)- mediated adenosine to inosine alteration of the SNP associated with Stargardt Disease, type 1, thereby treating the subject. 11. A method of treating Stargardt Disease, type 1, in a subject in need thereof, the method comprising: identifying a subject with a single nucleotide polymorphism (SNP) associated with Stargardt Disease, type 1, in an ABCA4 polynucleotide; contacting the ABCA4 polynucleotide in a cell with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration of the SNP associated with Stargardt Disease, type 1, and administering the cell to the subject, thereby treating the subject. 12. The method of claim 11, wherein the cell is autologous, allogenic, or xenogenic to the subject. 13. The method of any one of claims 10-12, wherein the subject is a human subject. 14. The method of any one of claims 1-13, wherein the guide oligonucleotide comprises a nucleic acid sequence complementary to an ABCA4 mRNA sequence comprising the SNP associated with Stargardt Disease, type 1. 15. The method of any one of claims 1-14, wherein the oligonucleotide further comprises one or more adenosine deaminase acting on RNA (ADAR)-recruiting domains. 16. The method of any one of claims 1-15, wherein the ABCA4 polynucleotide encodes an ABCA4 protein comprising a pathogenic amino acid comprising a glutamic acid at position 1961 resulting from the SNP. 17. The method of claim 16, wherein the adenosine to inosine alteration substitutes the pathogenic amino acid with a wild type amino acid. 18. The method of claim 17, wherein the wild type amino acid at position 1961 comprises a glycine. 19. The method of any one of claims 1-18, wherein the guide oligonucleotide comprises the structure: [Am]-X1-X2-X3-[Bn] wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 1 to 50; X1, X2, and X3 are each, independently, a nucleotide, wherein at least one of X1, X2, or X3 is an alternative nucleotide. 20. The method of any one of claims 1-19, wherein the guide oligonucleotide comprises the structure: [Am]-X1-X2-X3-[Bn] wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 1 to 50; X1, X2, and X3 are each, independently, a nucleotide, wherein at least one of X1, X2, or X3 has the structure of any one of Formula I-V: wherein N1 is hydrogen or a nucleobase; R1 is hydroxy, halogen, or C1-C6 alkoxy; R2 is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R3 is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R4 is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; and R5 is hydrogen, hydroxy, halogen, or C1-C6 alkoxy. 21. The method of claim 20, wherein R4 is hydrogen and R5 is not hydrogen or hydroxy, R5 is hydrogen and R4 is not hydrogen, or R5 is hydroxy and R4 is not hydrogen. 22. The method of claim 20 or claim 21, wherein at least 80% of the nucleotides of [Am] and/or [Bn] include a nucleobase, a sugar, and an internucleoside linkage. 23. The method of any one of claims 20 to 22, wherein R1 is hydroxy, halogen, or OCH3. 24. The method of any one of claims 20 to 23, wherein R2 is hydrogen. 25. The method of any one of claims 20 to 24, wherein at least one of X1, X2, or X3 has the structure of Formula I, Formula II, or Formula V; and none of X1, X2, or X3 has the structure of Formula IV or Formula III. 26. The method of any one of claims 20 to 25, wherein at least one of X1, X2, or X3 has the structure of Formula I or Formula II; and none of X1, X2, or X3 has the structure of Formula III, Formula IV, or Formula V. 27. The method of any one of claims 20 to 26, wherein the halogen is fluoro. 28. The method of any one of claims 20 to 27, wherein at least one of X1, X2, and X3 has the structure of Formula I, wherein R1 is fluoro and N1 is a nucleobase. 29. The method of claim 28, wherein X1 has the structure of Formula I, wherein R1 is fluoro and N1 is a nucleobase. 30. The method of claim 28 or 29, wherein X2 has the structure of Formula I, wherein R1 is fluoro and N1 is a nucleobase. 31. The method of any one of claims 28 to30, wherein X3 has the structure of Formula I, wherein R1 is fluoro and N1 is a nucleobase. 32. The method of any one of claims 20 to 27, wherein at least one of X1, X2, and X3 has the structure of Formula I, wherein R1 is hydroxy and N1 is a nucleobase. 33. The method of claim 32, wherein X1 has the structure of Formula I, wherein R1 is hydroxy and N1 is a nucleobase. 34. The method of claim 32or 33, wherein X2 has the structure of Formula I, wherein R1 is hydroxy and N1 is a nucleobase. 35. The method of any one of claims 32 to 34, wherein X3 has the structure of Formula I, wherein R1 is hydroxy and N1 is a nucleobase. 36. The method of any one of claims 20 to 27, wherein at least one of X1, X2, and X3 has the structure of Formula I, wherein R1 is methoxy and N1 is a nucleobase. 37. The method of claim 36, wherein X1 has the structure of Formula I, wherein R1 is methoxy and N1 is a nucleobase; and each of X2 and X3 is a ribonucleotide. 38. The method of claim 36 or 37, wherein X2 has the structure of Formula I, wherein R1 is methoxy and N1 is a nucleobase. 39. The method of any one of claims 36 to 38, wherein X3 has the structure of Formula I, wherein R1 is methoxy and N1 is a nucleobase. 40. The method of any one of claims 20 to 27, wherein at least one of X1, X2, and X3 has the structure of Formula II, wherein R2 is hydrogen and N1 is a nucleobase. 41. The method of claim 40, wherein X2 has the structure of Formula II, wherein R2 is hydrogen and N1 is a nucleobase. 42. The method of any one of claims 20 to 25, wherein at least one of X1 and X2 has the structure of Formula V. 43. The method of claim 42, wherein X2 has the structure of Formula V, wherein R4 is hydrogen and R5 is hydrogen. 44. The method of claim 42, wherein X2 has the structure of Formula V, wherein R4 is hydrogen and R5 is hydroxy. 45. The method of claim 42, wherein X1 has the structure of Formula V, wherein R4 is hydrogen and R5 is hydrogen. 46. The method of claim 42, wherein X1 has the structure of Formula V, wherein R4 is hydrogen and R5 is hydroxy. 47. The method of claim 42, wherein X2 has the structure of Formula V, wherein R4 is hydrogen and R5 is methoxy. 48. The method of any one of claims 20 to 47, wherein when X1 has the structure of any one of Formulas I to V, each of X2 and X3 is, independently, a ribonucleotide, a 2′-O-C1-C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X2 has the structure of any one of Formulas I to V, each of X1 and X3 is, independently, a ribonucleotide, a 2′-O-C1- C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X3 has the structure of any one of Formulas I to V, each of X1 and X2 is, independently, a ribonucleotide, a 2′-O-C1- C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1 and X2 each have the structure of any one of Formulas I to V, X3 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1 and X3 each have the structure of any one of Formulas I to V, X2 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; and when X2 and X3 each have the structure of any one of Formulas I to V, X1 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide. 49. The method of claim 48, wherein when X1 has the structure of any one of Formulas I to V, each of X2 and X3 is, independently, a ribonucleotide, a 2’-F-nucleotide, 2’-O- methoxyethyl-nucleotide, or a DNA-nucleotide; when X2 has the structure of any one of Formulas I to V, each of X1 and X3 is, independently, a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X3 has the structure of any one of Formulas I to V, each of X1 and X2 is, independently, a ribonucleotide, a 2’-F- nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1 and X2 each have the structure of any one of Formulas I to V, X3 is a ribonucleotide, a 2’-F- nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1 and X3 each have the structure of any one of Formulas I to V, X2 is a ribonucleotide, a 2’-F- nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; and when X2 and X3 each have the structure of any one of Formulas I to V, X1 is a ribonucleotide, a 2’-F- nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide. 50. The method of claim 49, wherein when X1 has the structure of any one of Formulas I to V, each of X2 and X3 is a ribonucleotide; when X2 has the structure of any one of Formulas I to V, each of X1 and X3 is a ribonucleotide; when X3 has the structure of any one of Formulas I to V, each of X1 and X2 is a ribonucleotide; when X1 and X2 each have the structure of any one of Formulas I to V, X3 is a ribonucleotide; when X1 and X3 each have the structure of any one of Formulas I to V, X2 is a ribonucleotide; and when X2 and X3 each have the structure of any one of Formulas I to V, X1 is a ribonucleotide. 51. The method of any one of claims 20 to 40 and 42 to 50, wherein none of X1, X2, and X3 has the structure of Formula II, wherein N1 is a nucleobase. 52. The method of claim 51, wherein none of X1, X2, and X3 has the structure of Formula II, wherein N1 is a cytosine nucleobase. 53. The method of any one of claims 20 to 44 and 47 to 52, wherein X1 comprises a uracil or thymine nucleobase. 54. The method of claim 53, wherein X1 comprises a uracil nucleobase. 55. The method of any one of 20 to 44 and 47 to 52, wherein X1 comprises a hypoxanthine nucleobase. 56. The method of any one of claims 20 to 44 and 47 to 52, wherein X1 comprises a cytosine nucleobase. 57. The method of any one of claims 20 to 56, wherein X3 comprises a guanine nucleobase. 58. The method of any one of claims 20 to 56, wherein X3 comprises a hypoxanthine nucleobase. 59. The method of any one of claims 20 to 56, wherein X3 comprises an adenine nucleobase. 60. The method of any one of claims 20 to 42, 46, 47, and 48 to 59, wherein X2 comprises a cytosine or 5-methylcytosine nucleobase. 61. The method of claim 60, wherein X2 comprises a cytosine nucleobase. 62. The method of any one of claims 20 to 24, wherein X2 has the structure of any one of Formula I-V. 63. The method of any one of claims 20 to 62, wherein X2 is not a 2’-O-methyl-nucleotide. 64. The method of claim 63, wherein X1, X2, and X3 are not 2’-O-methyl-nucleotides. 65. The method of any one of claims 1-19, wherein the guide oligonucleotide comprises the structure: [Am]-X1-X2-X3-[Bn] wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 1 to 50; X1, X2, and X3 are each, independently, a nucleotide, wherein at least one of X1, X2, or X3 has the structure of any one of Formula VI-XI: wherein N1 is hydrogen or a nucleobase; R12 is hydrogen, hydroxy, fluoro, halogen, C1-C6 alkyl, C1-C6 heteroalkyl, or C1-C6 alkoxy; R13 is hydrogen or C1-C6 alkyl, wherein at least one of X1, X2, or X3 has the structure of any one of Formula VI-IX. 66. The method of claim 65, wherein at least 80% of the nucleotides of [Am] and/or [Bn] include a nucleobase, a sugar, and an internucleoside linkage. 67. The method of claim 65 or 66, wherein R12 is hydrogen, halogen, C1-C6 alkyl, or C1-C6 heteroalkyl. 68. The method of any one of claims 65 to 67, wherein the halogen is fluoro. 69. The method of any one of claims 65 to 68, wherein R12 is hydrogen or C1-C6 alkyl; 70. The method of any one of claims 65 to 69, wherein R12 is hydrogen. 71. The method of any one of claims 65 to 70, wherein at least one of X1, X2, and X3 has the structure of Formula VI, and N1 is a nucleobase. 72. The method of claim 71, wherein X1 has the structure of Formula VI, and N1 is a nucleobase. 73. The method of claim 71 or 72, wherein X2 has the structure of Formula VI, and N1 is a nucleobase. 74. The method of any one of claims 65 to 70, wherein at least one of X1, X2, and X3 has the structure of Formula VII, and N1 is a nucleobase. 75. The method of claim 74, wherein X1 has the structure of Formula VII, and N1 is a nucleobase. 76. The method of claim 74 or 75, wherein X2 has the structure of Formula VII, and N1 is a nucleobase. 77. The method of any one of claims 65 to 70, wherein at least one of X1, X2, and X3 has the structure of Formula IX, and N1 is a nucleobase. 78. The method of claim 77, wherein X1 has the structure of Formula IX, and N1 is a nucleobase. 79. The method of claim 77 or 78, wherein X2 has the structure of Formula IX, and N1 is a nucleobase. 80. The method of any one of claims 65 to 70, wherein at least one of X1, X2, and X3 has the structure of Formula VIII, and N1 is a nucleobase. 81. The method of claim 80, wherein X1 has the structure of Formula VIII, and N1 is a nucleobase. 82. The method of claim 80 or 81, wherein X2 has the structure of Formula VIII, and N1 is a nucleobase. 83. The method of any one of claims 65 to 72 and 74 to 82, wherein X2 does not have the structure of Formula VI. 84. The method of any one of claims 65 to 83, wherein X3 does not have the structure of Formula VI. 85. The method of any one of claims 65 to 75 and 77 to 84, wherein X2 does not have the structure of Formula VII. 86. The method of any one of claims 65 to 85, wherein X3 does not have the structure of Formula VII. 87. The method of any one of claims 65 to 78 and 80 to 86, wherein X2 does not have the structure of Formula IX. 88. The method of any one of claims 65 to 70, wherein X2 has the structure of Formula VI or Formula VII. 89. The method of any one of claims 65 to 88, wherein when X1 has the structure of any one of Formulas VI to XI, each of X2 and X3 is, independently, a ribonucleotide, a 2′-O-C1- C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X2 has the structure of any one of Formulas VI to XI, each of X1 and X3 is, independently, a ribonucleotide, a 2′-O- C1-C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X3 has the structure of any one of Formulas VI to XI, each of X1 and X2 is, independently, a ribonucleotide, a 2′-O-C1-C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1 and X2 each have the structure of any one of Formulas VI to XI, X3 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1 and X3 each have the structure of any one of Formulas VI to XI, X2 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; and when X2 and X3 each have the structure of any one of Formulas VI to XI, X1 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide. 90. The method of claim 89, wherein when X1 has the structure of any one of Formulas VI to XI, each of X2 and X3 is, independently, a ribonucleotide, a 2’-F-nucleotide, 2’-O- methoxyethyl-nucleotide, or a DNA-nucleotide; when X2 has the structure of any one of Formulas VI to XI, each of X1 and X3 is, independently, a ribonucleotide, a 2’-F- nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X3 has the structure of any one of Formulas VI to XI, each of X1 and X2 is, independently, a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1 and X2 each have the structure of any one of Formulas VI to XI, X3 is a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1 and X3 each have the structure of any one of Formulas VI to XI, X2 is a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; and when X2 and X3 each have the structure of any one of Formulas VI to XI, X1 is a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide. 91. The method of claim 90, wherein when X1 has the structure of any one of Formulas VI to XI, each of X2 and X3 is a ribonucleotide; when X2 has the structure of any one of Formulas VI to XI, each of X1 and X3 is a ribonucleotide; when X3 has the structure of any one of Formulas VI to XI, each of X1 and X2 is a ribonucleotide; when X1 and X2 each have the structure of any one of Formulas VI to XI, X3 is a ribonucleotide; when X1 and X3 each have the structure of any one of Formulas VI to XI, X2 is a ribonucleotide; and when X2 and X3 each have the structure of any one of Formulas VI to XI, X1 is a ribonucleotide. 92. The method of any one of claims 65 to 91, wherein X1 comprises a hypoxanthine nucleobase. 93. The method of any one of claims 65 to 91, wherein X1 comprises a uracil nucleobase. 94. The method of any one of claims 65 to 91, wherein X1 comprises a cytosine nucleobase. 95. The method of any one of claims 65 to 94, wherein X3 comprises a hypoxanthine nucleobase. 96. The method of any one of claims 65 to 94, wherein X3 comprises a guanine nucleobase. 97. The method of any one of claims 65 to 94, wherein X3 comprises a adenine nucleobase. 98. The method of any one of claims 65 to 97, wherein X2 comprises a cytosine nucleobase. 99. The method of any one of claims 65 to 97, wherein X2 comprises a uracil nucleobase. 100. The method of any one of claims 65 to 97, wherein X2 does not include a nucleobase. 101. The method of any one of claims 65 to 100, wherein X2 is not a 2’-O-methyl-nucleotide. 102. The method of any one of claims 65 to 101, wherein X1, X2, and X3 are not 2’-O-methyl- nucleotides. 103. The method of any one of claims 1-19, wherein the guide oligonucleotide comprises the structure: [Am]-X1-X2-X3-[Bn] wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 1 to 50; X1, X2, and X3 are each, independently, a nucleotide, wherein at least one of X1, X2, and X3 has the structure of any one of Formula XII-XV: wherein N1 is hydrogen or a nucleobase; R6 is hydrogen, hydroxy, or halogen; R7 is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R8 is hydrogen or halogen; R9 is hydrogen or hydroxy, halogen, or C1-C6 alkoxy; R10 Is hydrogen or halogen; and R11 is hydrogen or hydroxy, halogen, or C1-C6 alkoxy. 104. The method of claim 103, wherein at least 80% of the nucleotides of [Am] and/or [Bn] include a nucleobase, a sugar, and an internucleoside linkage. 105. The method of claim 103 or 104, wherein halogen is fluoro. 106. The method of any one of claims 103 to 105, wherein C1-C6 alkoxy is OCH3. 107. The method of any one of claims 103 to 106, wherein at least one of X1, X2, and X3 has the structure of Formula XIII, in which each of R8 and R9 is hydrogen. 108. The method of claim 107, wherein X1 has the structure of Formula XIII, in which each of R8 and R9 is hydrogen. 109. The method of claim 107 or 108, wherein X2 has the structure of Formula XIII, in which each of R8 and R9 is hydrogen. 110. The method of any one of claims 103 to 106, wherein X2 has the structure of any one of Formula XII-XV. 111. The method of any one of claims 103 to 110, wherein when X1 has the structure of any one of Formulas XII-XV, each of X2 and X3 is, independently, a ribonucleotide, a 2′-O- C1-C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X2 has the structure of any one of Formulas XII-XV, each of X1 and X3 is, independently, a ribonucleotide, a 2′- O-C1-C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X3 has the structure of any one of Formulas XII-XV, each of X1 and X2 is, independently, a ribonucleotide, a 2′- O-C1-C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1 and X2 each have the structure of any one of Formulas XII-XV, X3 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1 and X3 each have the structure of any one of Formulas XII-XV, X2 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide; and when X2 and X3 each have the structure of any one of Formulas XII-XV, X1 is a ribonucleotide, a 2′-O-C1-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic- nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide. 112. The method of claim 111, wherein when X1 has the structure of any one of Formulas XII-XV, each of X2 and X3 is, independently, a ribonucleotide, a 2’-F-nucleotide, 2’-O- methoxyethyl-nucleotide, or a DNA-nucleotide; when X2 has the structure of any one of Formulas XII-XV, each of X1 and X3 is, independently, a ribonucleotide, a 2’-F- nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X3 has the structure of any one of Formulas XII-XV, each of X1 and X2 is, independently, a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1 and X2 each have the structure of any one of Formulas XII-XV, X3 is a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1 and X3 each have the structure of any one of Formulas XII-XV, X2 is a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; and when X2 and X3 each have the structure of any one of Formulas XII-XV, X1 is a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide. 113. The method of claim 112, wherein when X1 has the structure of any one of Formulas XII-XV, each of X2 and X3 is a ribonucleotide; when X2 has the structure of any one of Formulas XII-XV, each of X1 and X3 is a ribonucleotide; when X3 has the structure of any one of Formulas XII-XV, each of X1 and X2 is a ribonucleotide; when X1 and X2 each have the structure of any one of Formulas XII-XV, X3 is a ribonucleotide; when X1 and X3 each have the structure of any one of Formulas XII-XV, X2 is a ribonucleotide; and when X2 and X3 each have the structure of any one of Formulas XII-XV, X1 is a ribonucleotide. 114. The method of any one of claims 103 to 113, wherein X1 includes a hypoxanthine nucleobase. 115. The method of any one of claims 103 to 113, wherein X1 includes a uracil nucleobase. 116. The method of any one of claims 103 to 113, wherein X1 includes a cytosine nucleobase. 117. The method of any one of claims 103 to 116, wherein X3 includes a hypoxanthine nucleobase. 118. The method of any one of claims 103 to 116, wherein X3 includes an adenine nucleobase. 119. The method of any one of claims 103 to 118, wherein X2 includes a cytosine nucleobase. 120. The method of any one of claims 103 to 118, wherein X2 includes a uracil nucleobase. 121. The method of any one of claims 103 to 118, wherein X2 does not include a nucleobase. 122. The method of any one of claims 103 to 121, wherein X2 is not a 2’-O-methyl-nucleotide. 123. The method of any one claims 103 to 122, wherein X1, X2, and X3 are not 2’-O-methyl- nucleotides. 124. The method of any one of claims 19 to 123, wherein [Am] comprises at least one nuclease resistant nucleotide. 125. The method of any one of claims 19 to 124, wherein [Am] comprises at least one 2′-O- C1-C6 alkyl-nucleotide, at least one 2’-amino-nucleotide, at least one arabino nucleic acid-nucleotide, at least one bicyclic-nucleotide, at least one 2’-F-nucleotide, at least one 2’-O-methoxyethyl-nucleotide, at least one constrained ethyl (cEt)-nucleotide, at least one LNA-nucleotide, and/or at least one DNA-nucleotide. 126. The method of claim 125, wherein [Am] comprises at least one 2’-O-methyl-nucleotide, at least one 2’-F-nucleotide, at least one 2’-O-methoxyethyl-nucleotide, at least one cEt- nucleotide, at least one LNA-nucleotide, and/or at least one DNA-nucleotide. 127. The method of any one of claims 20 to 126, wherein [Am] comprises at least five terminal 2’-O-methyl-nucleotides. 128. The method of any one of claims 20 to 127, wherein [Am] comprises at least one phosphorothioate linkage. 129. The method of any one of claims 20 to 128, wherein [Am] comprises at least four terminal phosphorothioate linkages. 130. The method of claim 128 or 129, wherein at least one phosphorothioate linkage is stereopure. 131. The method of any one of claims 20 to 130, wherein [Bn] comprises at least one nuclease resistant nucleotide. 132. The method of any one of claims 20 to 131, wherein [Bn] comprises at least one at least one 2′-O-C1-C6 alkyl-nucleotide, at least one 2’-amino-nucleotide, at least one arabino nucleic acid-nucleotide, at least one bicyclic-nucleotide, at least one 2’-F-nucleotide, at least one 2’-O-methoxyethyl-nucleotide, at least one cEt-nucleotide, at least one LNA- nucleotide, and/or at least one DNA-nucleotide. 133. The method of claim 132, wherein [Bn] comprises at least one 2’-O-methyl-nucleotide, at least one 2’-F-nucleotide, at least one 2’-O-methoxyethyl-nucleotide, at least one cEt- nucleotide, at least one LNA-nucleotide, and/or at least one DNA-nucleotide. 134. The method of any one of claims 20 to 132, wherein [Bn] comprises at least five terminal 2’-O-methyl-nucleotides. 135. The method of any one of claims 20 to 134, wherein [Bn] comprises at least one phosphorothioate linkage. 136. The method of any one of claims 20 to 135, wherein [Bn] comprises at least four terminal phosphorothioate linkages. 137. The method of claim 135 or claim 136, wherein at least one phosphorothioate linkage is stereopure. 138. The method of any one of claims 20 to 137, wherein at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl-nucleotides. 139. The method of any one of claims 20 to 138, wherein the oligonucleotide further comprises a 5’-cap structure. 140. The method of any one of claims 20 to 139, wherein the oligonucleotide comprises at least one alternative nucleobase. 141. The method of any one of claims 20 to 140, wherein the 5’-terminal nucleotide is a 2’- amino-nucleotide. 142. The method of any one of claims 20 to 141, wherein A and B combined consist of 18 to 80 nucleotides. 143. The method of any one of claims 20 to 142, wherein m is 5 to 40. 144. The method of any one of claims 20 to 143, wherein n is 5 to 40. 145. The method of claim 20, wherein m and n are each, independently, an integer from 5 to 40; at least one of X1, X2, and X3 has the structure of Formula I, wherein R1 is fluoro, hydroxy, or methoxy and N1 is a nucleobase, or the structure of Formula V, wherein R4 is hydrogen and R5 is hydrogen; each of X1, X2, and X3 that does not have the structure of Formula I or Formula V is a ribonucleotide; [Am] and [Bn] each comprise at least five terminal 2’-O-methyl-nucleotides and at least four terminal phosphorothioate linkages; and at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl- nucleotides. 146. The method of claim 65, wherein m and n are each, independently, an integer from 5 to 40; at least one of X1, X2, and X3 has the structure of Formula VI, Formula VII, Formula VIII, or Formula IX, wherein N1 is a nucleobase and each of X1, X2, and X3 that does not have the structure of Formula VI, Formula VII, Formula VIII, or Formula IX is a ribonucleotide; [Am] and [Bn] each include at least five terminal 2’-O-methyl-nucleotides and at least four terminal phosphorothioate linkages; and at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl-nucleotides. 147. The method of claim 103, wherein m and n are each, independently, an integer from 5 to 40; at least of X1, X2, and X3 has the structure of Formula XIII, wherein R8 and R9 are each hydrogen, and each of X1, X2 and X3 that does not have the structure of Formula XII is a ribonucleotide; [Am] and [Bn] each include at least five terminal 2’-O-methyl- nucleotides and at least four terminal phosphorothioate linkages; and at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl-nucleotides. |
[0188] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula VI. [0189] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula VII. [0190] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula VIII. [0191] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula IX, e.g., has the structure: [0192] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula X, e.g., has the structure: [0193] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula XI, e.g., has the structure: [0194] In certain embodiments of the invention, substantially all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. In other embodiments of the invention, all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. Oligonucleotides of the invention in which "substantially all of the nucleotides are alternative nucleotides" are largely but not wholly modified and can include no more than 5, 4, 3, 2, or 1 naturally-occurring nucleotides. In still other embodiments of the invention, oligonucleotides of the invention can include no more than 5, 4, 3, 2, or 1 alternative nucleotides. [0195] In some embodiments of the invention, the oligonucleotides of the instant invention include the structure: [A m ]-X 1 -X 2 -X 3 -[B n ] wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 5 to 40; at least one of X 1 , X 2 , and X 3 has the structure of Formula VI, Formula VII, Formula VIII, or Formula IX, wherein N 1 is a nucleobase and each of X 1 , X 2 , and X 3 that does not have the structure of Formula VI, Formula VII, Formula VIII, or Formula IX is a ribonucleotide; [A m ] and [B n ] each include at least five terminal 2’-O-methyl-nucleotides and at least four terminal phosphorothioate linkages; and at least 20% of the nucleotides of [A m ] and [B n ] combined are 2’-O-methyl-nucleotides. In some embodiments, X 1 includes an adenine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes an adenine nucleobase; X 1 includes an adenine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a guanine or hypoxanthine nucleobase; X 1 includes an adenine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a uracil or thymine nucleobase; X 1 includes an adenine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a cytosine or 5-methylcytosine nucleobase; X 1 includes a guanine or hypoxanthine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes an adenine nucleobase; X 1 includes a guanine or hypoxanthine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a guanine or hypoxanthine nucleobase; X 1 includes a guanine or hypoxanthine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a uracil or thymine nucleobase; X 1 includes a guanine or hypoxanthine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a cytosine or 5-methylcytosine nucleobase; X 1 includes a uracil or thymine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes an adenine nucleobase; X 1 includes a uracil or thymine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a guanine or hypoxanthine nucleobase; X 1 includes a uracil or thymine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a uracil or thymine nucleobase; X 1 includes a uracil or thymine nucleobase, X 2 includes a cytosine, 5- methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a cytosine or 5-methylcytosine nucleobase; X 1 includes a cytosine or 5-methylcytosine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes an adenine nucleobase; X 1 includes a cytosine or 5- methylcytosine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a guanine or hypoxanthine nucleobase; X 1 includes a cytosine or 5-methylcytosine nucleobase, X 2 includes a cytosine, 5- methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a uracil or thymine nucleobase; or X 1 includes a cytosine or 5-methylcytosine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a cytosine or 5-methylcytosine nucleobase. [0196] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula XII-XV: [0197] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula XII, e.g., has the structure: [0198] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula XIII, e.g., has the structure: [0199] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula XIV, e.g., has the structure: [0200] In some embodiments, one or more of the nucleotides of the oligonucleotide of the invention has the structure of any one of Formula XV. [0201] In certain embodiments of the invention, substantially all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. In other embodiments of the invention, all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. Oligonucleotides of the invention in which "substantially all of the nucleotides are alternative nucleotides" are largely but not wholly modified and can include no more than 5, 4, 3, 2, or 1 naturally-occurring nucleotides. In still other embodiments of the invention, oligonucleotides of the invention can include no more than 5, 4, 3, 2, or 1 alternative nucleotides. [0202] In some embodiments, the oligonucleotides of the instant invention include the structure: [A m ]-X 1 -X 2 -X 3 -[B n ] wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 5 to 40; at least of X 1 , X 2 , and X 3 has the structure of Formula XIII, wherein R 8 and R 9 are each hydrogen, and each of X 1 , X 2 and X 3 that does not have the structure of Formula XIII is a ribonucleotide; [A m ] and [B n ] each include at least five terminal 2’-O-methyl-nucleotides and at least four terminal phosphorothioate linkages; and at least 20% of the nucleotides of [A m ] and [B n ] combined are 2’-O-methyl-nucleotides. In some embodiments, X 1 includes an adenine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes an adenine nucleobase; X 1 includes an adenine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a guanine or hypoxanthine nucleobase; X 1 includes an adenine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a uracil or thymine nucleobase; X 1 includes an adenine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a cytosine or 5-methylcytosine nucleobase; X 1 includes a guanine or hypoxanthine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes an adenine nucleobase; X 1 includes a guanine or hypoxanthine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a guanine or hypoxanthine nucleobase; X 1 includes a guanine or hypoxanthine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a uracil or thymine nucleobase; X 1 includes a guanine or hypoxanthine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a cytosine or 5-methylcytosine nucleobase; X 1 includes a uracil or thymine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes an adenine nucleobase; X 1 includes a uracil or thymine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a guanine or hypoxanthine nucleobase; X 1 includes a uracil or thymine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a uracil or thymine nucleobase; X 1 includes a uracil or thymine nucleobase, X 2 includes a cytosine, 5- methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a cytosine or 5-methylcytosine nucleobase; X 1 includes a cytosine or 5-methylcytosine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes an adenine nucleobase; X 1 includes a cytosine or 5- methylcytosine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a guanine or hypoxanthine nucleobase; X 1 includes a cytosine or 5-methylcytosine nucleobase, X 2 includes a cytosine, 5- methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a uracil or thymine nucleobase; or X 1 includes a cytosine or 5-methylcytosine nucleobase, X 2 includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X 3 includes a cytosine or 5-methylcytosine nucleobase. [0203] In some embodiments, the oligonucleotides for use in the methods of the instant invention include a recruitment domain for the ADAR enzyme (e.g., an ADAR-recruiting domain). In some embodiments, the ADAR-recruiting domain is a stem-loop structure. Such oligonucleotides may be referred to as “axiomer AONs” or “self-looping AONs.” The recruitment portion acts in recruiting a natural ADAR enzyme present in the cell to the dsRNA formed by hybridization of the target sequence with the targeting portion. The recruitment portion may be a stem-loop structure mimicking either a natural substrate (e.g. the glutamate ionotropic receptor AMPA type subunit 2 (GluR2) receptor; such as a GluR2 ADAR-recruiting domain) or a Z-DNA structure known to be recognized by the dsRNA binding regions of ADAR enzymes (e.g., a Z-DNA ADAR-recruiting domain). As GluR2 and Z-DNA ADAR-recruiting domains are high affinity binding partners to ADAR, there is no need for conjugated entities or presence of modified recombinant ADAR enzymes. A stem-loop structure can be an intermolecular stem-loop structure, formed by two separate nucleic acid strands, or an intramolecular stem loop structure, formed within a single nucleic acid strand. The stem-loop structure of the recruitment portion may be a step loop structure described in WO 2016/097212, US 2018/0208924, Merkle et al. Nature Biotechnology, 37: 133-8 (2019), Katrekar et al. Nature Methods, 16(3): 239-42 (2019), Fukuda et al. Scientific Reports, 7: 41478 (2017), the stem-loop structures of the ADAR recruitment portion of which are herein incorporated by reference. In some embodiments, the oligonucleotides include one or more ADAR-recruiting domains (e.g., 1 or 2 ADAR-recruiting domains). In some embodiments, the ADAR-recruiting domain is at the 5’ end of the oligonucleotide. In other embodiments, the ADAR-recruiting domain is at the 3’ end of said oligonucleotide. In some embodiments, the oligonucleotide includes a first ADAR- recruiting domain and a second ADAR-recruiting domain. the first ADAR-recruiting domain is at the 5’ end of said oligonucleotide, and the second ADAR-recruiting domain is at the 3’ end of said oligonucleotide. [0204] In some embodiments, the oligonucleotide includes the structure of Formula XVI: C-L1-D-L2-[A m ]-X 1 -X 2 -X 3 -[B n ] Formula XVI, wherein [A m ]-X 1 -X 2 -X 3 -[B n ] is the oligonucleotide of any one of formulas I-XV; C is a single- stranded oligonucleotide of 10-50 linked nucleosides in length; L 1 is a loop region; and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; L2 is an optional linker; wherein the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length, wherein the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D, and wherein C or D includes at least one alternative nucleobase. [0205] In some embodiments, C and D include at least one alternative nucleobase. In other embodiments, L1 includes linked nucleosides. In yet another embodiment, L1 consists of linked nucleosides. In some embodiments, L 1 includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. In some embodiments, C or D includes at least one alternative internucleoside linkage and/or at least one alternative sugar moiety. In some embodiments, C and D each independently includes at least one alternative internucleoside linkage and/or at least one alternative sugar moiety. [0206] In some embodiments, the oligonucleotide includes the structure of Formula XVII: C-L 1 -D-L 2 -[A m ]-X 1 -X 2 -X 3 -[B n ] Formula XVII, wherein [A m ]-X 1 -X 2 -X 3 -[B n ] is the oligonucleotide of any one of Formulas I-XV; C is a single- stranded oligonucleotide of 10-50 linked nucleosides in length; L 1 is a loop region that does not consist of linked nucleosides; and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; L2 is an optional linker, wherein the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length, and wherein the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D. [0207] In some embodiments, L1 has the structure of Formula XVIII: F 1 -(G 1 ) j -(H 1 ) k -(G 2 ) m -(I)-(G 3 ) n -(H 2 ) p -(G 4 ) q –F 2 Formula XVIII, wherein F 1 is a bond between the loop region and C; F 2 is a bond between D and [A m ] or between D and, optionally, the linker; G 1 , G 2 , G 3 , and G 4 each, independently, is selected from optionally substituted C 1 -C 2 alkyl, optionally substituted C1-C3 heteroalkyl, O, S, and NR N ; R N is hydrogen, optionally substituted C1–4 alkyl, optionally substituted C2–4 alkenyl, optionally substituted C2–4 alkynyl, optionally substituted C2–6 heterocyclyl, optionally substituted C6–12 aryl, or optionally substituted C 1–7 heteroalkyl; C 1 and C 2 are each, independently, selected from carbonyl, thiocarbonyl, sulphonyl, or phosphoryl; j, k, m, n, p, and q are each, independently, 0 or 1; and I is optionally substituted C1–10 alkyl, optionally substituted C2–10 alkenyl, optionally substituted C 2–10 alkynyl, optionally substituted C 2–6 heterocyclyl, optionally substituted C 6–12 aryl, optionally substituted C 2 -C 10 polyethylene glycol, or optionally substituted C 1–10 heteroalkyl, or a chemical bond linking F 1 -(G 1 ) j -(H 1 ) k -(G 2 ) m -(I)-(G 3 ) n -(H 2 ) p -(G 4 ) q – F 2 . [0208] In some embodiments, L 1 includes a carbohydrate-containing linking moiety. [0209] In some embodiments, C or D each includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. In some embodiments, C and D each includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. [0210] In some embodiments, the oligonucleotide includes the structure of Formula XIX: C-L 1 -D-L 2 -[A m ]-X 1 -X 2 -X 3 -[B n ] Formula XIX, wherein [A m ]-X 1 -X 2 -X 3 -[B n ] is the oligonucleotide of any one of formulas I to XV; C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; L1 is a loop region including at least one alternative nucleobase or at least one alternative internucleoside linkage; and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; L 2 is an optional linker, wherein the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length, and wherein the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D. [0211] In some embodiments, L 1 includes at least one alternative nucleobase and at least one alternative internucleoside linkage. [0212] In some embodiments, the oligonucleotide includes the structure of Formula XX: C-L 1 -D-L 2 -[A m ]-X 1 -X 2 -X 3 -[B n ] Formula XX, wherein [A m ]-X 1 -X 2 -X 3 -[B n ] is the oligonucleotide of any one of formulas I to XV; C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; L1 is a loop region including at least one alternative sugar moiety, wherein the alternative sugar moiety is selected from the group consisting of a 2′-O-C 1 -C 6 alkyl-sugar moiety, a 2′-amino-sugar moiety, a 2′- fluoro-sugar moiety, a 2’-O-MOE sugar moiety, an arabino nucleic acid (ANA) sugar moiety, a deoxyribose sugar moiety, and a bicyclic nucleic acid; D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; and L 2 is an optional linker, wherein the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length, and wherein the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D. [0213] In some embodiments, the bicyclic sugar moiety is selected from an oxy-LNA sugar moiety (also referred to as an “LNA sugar moiety”), a thio-LNA sugar moiety, an amino- LNA sugar moiety, a cEt sugar moiety, and an ethylene-bridged (ENA) sugar moiety. In some embodiments, the ANA sugar moiety is a 2’-fluoro-ANA sugar moiety. [0214] In some embodiments, C or D includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. In some embodiments, C and D each includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D. In some embodiments, at least 80% (e.g., at least 85%, at least 90%, at least 95%) of the nucleobases of C are complementary to the nucleobases of D. [0215] In some embodiments, C includes a nucleobase sequence having at least 80% sequence identity to a nucleobase sequence set forth in any one of SEQ ID NO.1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, and 34. [0216] In some embodiments, D includes a nucleobase sequence having at least 80% sequence identity to a nucleobase sequence set forth in any one of SEQ ID NOs.2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, and 35. [0217] In some embodiments, C-L1-D includes a nucleobase sequence having at least 80% sequence identity to a nucleobase sequence set forth in any one of SEQ ID NOs.3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36. [0218] In some embodiments, the at least one alternative nucleobase is selected from the group consisting of 5-methylcytosine, 5-hydroxycytosine, 5-methoxycytosine, N4- methylcytosine, N3-Methylcytosine, N4-ethylcytosine, pseudoisocytosine, 5-fluorocytosine, 5- bromocytosine, 5-iodocytosine, 5-aminocytosine, 5-ethynylcytosine, 5-propynylcytosine, pyrrolocytosine, 5-aminomethylcytosine, 5-hydroxymethylcytosine, naphthyridine, 5- methoxyuracil, pseudouracil, dihydrouracil, 2-thiouracil, 4-thiouracil, 2-thiothymine, 4- thiothymine, 5,6-dihydrothymine, 5-halouracil, 5-propynyluracil, 5-aminomethyluracil, 5- hydroxymethyluracil, hypoxanthine, 7-deazaguanine, 8-aza-7-deazaguanine, 7-aza-2,6- diaminopurine, thienoguanine, N1-methylguanine, N2-methylguanine, 6-thioguanine, 8- methoxyguanine, 8-allyloxyguanine, 7-aminomethyl-7-deazaguanine, 7-methylguanine, imidazopyridopyrimidine, 7-deazaadenine, 3-deazaadenine, 8-aza-7-deazaadenine, 8-aza-7- deazaadenine, N1-methyladenine, 2-methyladenine, N6-methyladenine, 7-methyladenine, 8- methyladenine, or 8-azidoadenine. [0219] In some embodiments, the at least one alternative nucleobase is selected from the group consisting of 2-amino-purine, 2,6-diamino-purine, 3-deaza-adenine, 7-deaza-adenine, 7- methyl-adenine, 8-azido-adenine, 8-methyl-adenine, 5-hydroxymethyl-cytosine, 5-methyl- cytosine, pyrrolo-cytosine, 7-aminomethyl-7-deaza-guanine, 7-deaza-guanine, 7-methyl- guanine, 8-aza-7-deaza-guanine, thieno-guanine, hypoxanthine, 4-thio-uracil, 5-methoxy-uracil, dihydro-uracil, or pseudouracil. [0220] In some embodiments, the at least one alternative internucleoside linkage is selected from the group consisting of a phosphorothioate internucleoside linkage, a 2’-alkoxy internucleoside linkage, and an alkyl phosphate internucleoside linkage. In some embodiments, the at least one alternative internucleoside linkage is at least one phosphorothioate internucleoside linkage. [0221] In some embodiments, the at least one alternative sugar moiety is selected from the group consisting of a 2′-O-alkyl-sugar moiety, a 2′-O-methyl-sugar moiety, a 2′-amino-sugar moiety, a 2′-fluoro-sugar moiety, a 2’-O-MOE sugar moiety, an ANA sugar moiety deoxyribose sugar moiety, and a bicyclic nucleic acid. In some embodiments, the bicyclic sugar moiety is selected from an oxy-LNA sugar moiety, a thio-LNA sugar moiety, an amino-LNA sugar moiety, a cEt sugar moiety, and an ethylene-bridged (ENA) sugar moiety. In some embodiments, the ANA sugar moiety is a 2’-fluoro-ANA sugar moiety. In some embodiments, the at least one alternative sugar moiety is a 2′-O-methyl-sugar moiety, a 2′-fluoro-sugar moiety, or a 2’-O-MOE sugar moiety. [0222] In some embodiments, the at least one mismatch is a paired A to C mismatch, a paired G to G mismatch, or a paired C to A mismatch. In some embodiments, the oligonucleotide includes at least two mismatches between nucleotides of C and nucleotides of D. [0223] In some embodiments, the at least two mismatches are separated by at least three linked nucleosides. In some embodiments, the at least two mismatches are separated by three linked nucleosides. [0224] In some embodiments, the at least one mismatch includes a nucleoside having an alternative nucleobase. In some embodiments, the alternative nucleobase has the structure: wherein R 1 is hydrogen, trifluoromethyl, optionally substituted amino, hydroxyl, or optionally substituted C 1 -C 6 alkoxy; R 2 is hydrogen, optionally substituted amino, or optionally substituted C 1 -C 6 alkyl; and R 3 and R 4 are, independently, hydrogen, halogen, or optionally substituted C 1 - C 6 alkyl, or a salt thereof. [0225] In one embodiment, the oligonucleotides of the invention include those including an ADAR-recruiting domain having a structure of Formula XXXIV: C-L 1 -D, Formula XXXIV, wherein C is a single-stranded oligonucleotide of about 10-50 linked nucleosides in length (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length), L 1 is a loop region, and D is a single-stranded oligonucleotide of about 10-50 linked nucleosides in length (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length). [0226] In some embodiments, C includes a region that is complementary to D such that the two strands hybridize and form a duplex under suitable conditions. Generally, the duplex structure is between 5 and 50 linked nucleosides in length, e.g., between, 5-49, 5-45, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 5-10, 5-6, 8-50, 8-45, 8-40, 8-35, 8-30, 8-25, 8-20, 8-15, 8-10, 15-50, 15- 45, 15-40, 15-35, 15-30, 15-25, 15-20, 15-16, 20-50, 20-45, 20-40, 20-35, 20-30, 20-25, 25-50, 25-45, 25-40, 25-35, or 25-30 linked nucleosides in length. Ranges and lengths intermediate to the above-recited ranges and lengths are also contemplated to be part of the invention. In some embodiments, C is complementary to at least 5 contiguous nucleobases (e.g., 5, 10, 15, 20, 25, 30, or more contiguous nucleobases) of D, and the oligonucleotide forms a duplex structure of between 10-50 linked nucleosides in length (e.g., at least 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length). [0227] In some embodiments, the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D (e.g., at least 1, 2, 3, 4, or 5 mismatches). In some embodiments, the mismatch is a paired A to C mismatch. In some embodiments, the A nucleoside of the A to C mismatch is on the C strand and the C nucleoside of the A to C mismatch is on the D strand. In some embodiments, the A nucleoside of the A to C mismatch is on the D strand and the C nucleoside of the A to C mismatch is on the C strand. In other embodiments, the mismatch is a paired G-to-G mismatch. In still yet other embodiments, the mismatch is a paired C to A mismatch. In some embodiments, the C nucleoside of the C to A mismatch is on the C strand and the A nucleoside of the C to A mismatch is on the D strand. In some embodiments, the C nucleoside of the C to A mismatch is on the D strand and the A nucleoside of the C to A mismatch is on the C strand. In some embodiments, the mismatch is a paired I to I mismatch. In some embodiments, the mismatch is a paired I to G mismatch. In some embodiments, the I nucleoside of the I to G mismatch is on the C strand and the G nucleoside of the I to G mismatch is on the D strand. In some embodiments, the I nucleoside of the I to G mismatch is on the D strand and the G nucleoside of the I to G mismatch is on the C strand. In some embodiments, the mismatch is a paired G to I mismatch. In some embodiments, the G nucleoside of the G to I mismatch is on the C strand and the I nucleoside of the G to I mismatch is on the D strand. In some embodiments, the G nucleoside of the G to I mismatch is on the D strand and the I nucleoside of the G to I mismatch is on the C strand. In some embodiments, the mismatch includes a nucleoside having an alternative nucleobase. In some embodiments, the alternative nucleobase has the structure: wherein R 1 is hydrogen, trifluoromethyl, optionally substituted amino, hydroxyl, or optionally substituted C 1 -C 6 alkoxy; R 2 is hydrogen, optionally substituted amino, or optionally substituted C 1 -C 6 alkyl; and R 3 and R 4 are, independently, hydrogen, halogen, or optionally substituted C 1 -C 6 alkyl, or a salt thereof. In some embodiments, R 1 is a hydrogen bond donor group (e.g., a hydroxyl group, an amino group). In some embodiments, R 1 is a hydrogen bond accepting group (e.g., an alkoxy group). [0228] In some embodiments, the duplex structure includes two mismatches. In some embodiments, the mismatches are at least three linked nucleosides apart. For example, when mismatches are “separated by 3 nucleotides,” the oligonucleotide includes the structure M 1 -N 1 - N2-N3-M2, where M1 is the first mismatch, N1, N2, and N3 are paired nucleobases, and M2 is the second mismatch. In some embodiments M1 is a paired A to C mismatch and M2 is a paired G- to-G mismatch. [0229] In some embodiments, the loop region, L 1 , includes linked nucleosides. In some embodiments, L1 includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. [0230] In other embodiments, the loop region has the structure of Formula XVIII: F 1 -(G 1 ) j -(H 1 ) k -(G 2 ) m -(I)-(G 3 ) n -(H 2 ) p -(G 4 ) q –F 2 Formula XVIII, wherein F 1 is a bond between the loop region and C; F 2 is a bond between D and a nucleotide or between D and, optionally, a linker; G 1 , G 2 , G 3 , and G 4 each, independently, is selected from optionally substituted C1-C2 alkyl, optionally substituted C1-C3 heteroalkyl, O, S, and NR N ; R N is hydrogen, optionally substituted C 1–4 alkyl, optionally substituted C 2–4 alkenyl, optionally substituted C 2–4 alkynyl, optionally substituted C 2–6 heterocyclyl, optionally substituted C 6–12 aryl, or optionally substituted C 1–7 heteroalkyl; C 1 and C 2 are each, independently, selected from carbonyl, thiocarbonyl, sulphonyl, or phosphoryl; j, k, m, n, p, and q are each, independently, 0 or 1; and I is optionally substituted C 1–10 alkyl, optionally substituted C 2–10 alkenyl, optionally substituted C 2–10 alkynyl, optionally substituted C 2–6 heterocyclyl, optionally substituted C 6–12 aryl, optionally substituted C 2 -C 10 polyethylene glycol, or optionally substituted C 1–10 heteroalkyl, or a chemical bond linking F 1 -(G 1 ) j -(H 1 ) k -(G 2 ) m -(I)-(G 3 ) n -(H 2 ) p -(G 4 ) q –F 2 . In some embodiments, the linker is optional. [0231] In some embodiments, the loop region, L1 includes a carbohydrate-containing linking moiety. [0232] In one embodiment, one or more of the nucleotides of the oligonucleotides of the invention, is naturally-occurring, and does not include, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, one or more of the nucleotides of an oligonucleotide of the invention is chemically modified to enhance stability or other beneficial characteristics (e.g., alternative nucleotides). Without being bound by theory, it is believed that certain modification can increase nuclease resistance and/or serum stability, or decrease immunogenicity. For example, polynucleotides of the invention may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain nucleotides which have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or phospho-linker moiety). Oligonucleotides of the invention may be linked to one another through naturally-occurring phosphodiester bonds, or may be modified to be covalently linked through phosphorothiorate, 3’-methylenephosphonate, 5’-methylenephosphonate, 3’- phosphoamidate, 2’-5’ phosphodiester, guanidinium, S-methylthiourea, or peptide bonds. [0233] In some embodiments, C includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. In other embodiments, D includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. In some embodiments, both C and D each include at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. [0234] In certain embodiments of the invention, substantially all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. In other embodiments of the invention, all of the nucleotides of an oligonucleotide of the invention are alternative nucleotides. Oligonucleotides of the invention in which "substantially all of the nucleotides are alternative nucleotides" are largely but not wholly modified and can include no more than 5, 4, 3, 2, or 1 naturally-occurring nucleotides. In still other embodiments of the invention, an oligonucleotide of the invention can include no more than 5, 4, 3, 2, or 1 alternative nucleotides. [0235] In one embodiment, the oligonucleotides of the invention include an ADAR- recruiting domain having the structure of Formula XXXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L 1 is a loop region, and D is a single- stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, C or D includes at least one alternative nucleobase. In some embodiments, C and D each include at least one alternative nucleobase. In some embodiments, C and/or D, independently, further include at least one alternative internucleoside linkage and/or at least one alternative sugar moiety. In some embodiments, L 1 includes linked nucleotides. In other embodiments, L 1 consists of linked nucleosides. In some embodiments, L 1 includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. [0236] In another embodiment, the oligonucleotides of the invention include an ADAR- recruiting domain having the structure of Formula XXXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L 1 is a loop region that does not consist of linked nucleosides, and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, L 1 has the structure of Formula VIII, as described herein. In some embodiments, L 1 includes a carbohydrate-containing linking moiety. In some embodiments, C and/or D, independently, include at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. [0237] In another embodiment, the oligonucleotides of the invention include an ADAR- recruiting domain having the structure of Formula XXXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L 1 is a loop region including at least one alternative nucleobase or at least one alternative internucleoside linkage, and D is a single- stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, L 1 includes at least one alternative nucleobase and at least one alternative internucleoside linkage. [0238] In another embodiment, the oligonucleotides of the invention include an ADAR- recruiting domain having the structure of Formula XXXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, L 1 is a loop region including, at least one alternative sugar moiety that is not a 2’-O-methyl sugar moiety (e.g., the alternative sugar moiety is selected from the group consisting of a 2′-O-C 1 -C 6 alkyl-sugar moiety, a 2′-amino- sugar moiety, a 2′-fluoro-sugar moiety, a 2’-O-MOE sugar moiety, an LNA sugar moiety, an arabino nucleic acid (ANA) sugar moiety, a 2′-fluoro-ANA sugar moiety, a deoxyribose sugar moiety, and a bicyclic nucleic acid), and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, C and/or D, independently, include at least one alternative nucleobase, at least one alternative internucleoside linkage, and/or at least one alternative sugar moiety. [0239] In some embodiments, C includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs.1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, and 34, and D includes a nucleobase sequence complementary to the nucleobase sequence of C, wherein the sequence includes at least one mismatch as described herein. In other embodiments, D includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs.2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, and 35, and C includes a nucleobase sequence complementary to the nucleobase sequence of C, wherein the sequence includes at least one mismatch as described herein. In some embodiments, C-L 1 -D includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs.3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36, wherein the sequence includes at least one mismatch as described herein. Nucleobase sequences of SEQ ID NOs.1-36 are provided in Table 3: Table 3
[0240] It will be understood that, although the sequences in SEQ ID NOs.1-36 are described as unmodified and/or un-conjugated sequences, the RNA of the oligonucleotides of the invention may include any one of the sequences set forth in SEQ ID NOs.1-36 that is an alternative nucleoside and/or conjugated as described in detail below. [0241] In some embodiments, the oligonucleotide of the invention may further include a 5’ cap structure. In some embodiments, the 5’ cap structure is a 2,2,7-trimethylguanosine cap. [0242] An oligonucleotide of the invention can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. [0243] The oligonucleotide compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide including unnatural or alternative nucleotides can be easily prepared. Single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both. [0244] Further, it is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing linked nucleosides to generate longer or shorter sequences. Further still, such optimized sequences can be adjusted by, e.g., the introduction of alternative nucleosides, alternative sugar moieties, and/or alternative internucleosidic linkages as described herein or as known in the art, including alternative nucleosides, alternative sugar moieties, and/or alternative internucleosidic linkages as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, and/or increasing interaction with RNA editing enzymes (e.g., ADAR)). [0245] In some embodiments, the one or more ADAR-recruiting domains are GluR2 ADAR-recruiting domains. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 37, as shown below in the 5’ to 3’ direction: GGUGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCACC (SEQ ID NO. 37) [0246] In some embodiments, the oligonucleotide includes the structure of Formula XXI, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 38, as shown below in the 5’ to 3’ direction: GGUGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCACC (SEQ ID NO. 38) [0247] In some embodiments, the oligonucleotide includes the structure of Formula XXII, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 39, as shown below in the 5’ to 3’ direction: GGUGUCGAGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCUCGACACC (SEQ ID NO. 39) [0248] In some embodiments, the oligonucleotide includes the structure of Formula XXIII, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. [0249] In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 40, as shown below in the 5’ to 3’ direction: *s*s*G**GAGAAGAGGAGAA*AA*A*G**AAA*G**G*****G*******GA*A** (SEQ ID NO. 40) wherein * is a 2’-O-methyl nucleotide and s is a phosphorothioate internucleoside linkage between two linked nucleotides. In some embodiments, the oligonucleotide includes the structure of Formula XXIV, as shown below: wherein [ASO] includes any one of the oligonucleotides presented herein, wherein * is a 2’-O- methyl nucleotide, wherein s is a phosphorothioate internucleoside linkage, wherein m designates a mismatched nucleotide. In some embodiments, the ADAR-recruiting domains further include at least one nuclease-resistant nucleotide (e.g., 2’-O-methyl nucleotide). In some embodiments, the ADAR-recruiting domains include at least one alternative internucleoside linkage (e.g., a phosphorothioate internucleoside linkage). In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 41, as shown below in the 5’ to 3’ direction: GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU (SEQ ID NO. 41) [0250] In some embodiments, the oligonucleotide includes the structure of Formula XXV, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 42, as shown below in the 5’ to 3’ direction: GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO. 42) [0251] In some embodiments, the oligonucleotide includes the structure of Formula XXVI, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 43, as shown below in the 5’ to 3’ direction: GGUGUCGAGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCUCGACACC (SEQ ID NO. 43) [0252] In some embodiments, the oligonucleotide includes the structure of Formula XXVII, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 44, as shown below in the 5’ to 3’ direction: GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU (SEQ ID NO. 44) [0253] In some embodiments, the oligonucleotide includes the structure of Formula XXVIII, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 45, as shown below in the 5’ to 3’ direction: GGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCU (SEQ ID NO. 45) [0254] In some embodiments, the oligonucleotide includes the structure of Formula XXIX, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 46, as shown below in the 5’ to 3’ direction: GUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUAC (SEQ ID NO. 46) [0255] In some embodiments, the oligonucleotide includes the structure of Formula XXX, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 47, as shown below in the 5’ to 3’ direction: UGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUA (SEQ ID NO. 47) [0256] In some embodiments, the oligonucleotide includes the structure of Formula XXXI, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 48, as shown below in the 5’ to 3’ direction: GGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACC (SEQ ID NO. 48) [0257] In some embodiments, the oligonucleotide includes the structure of Formula XXXII, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 49, as shown below in the 5’ to 3’ direction: GUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCAC (SEQ ID NO. 49) [0258] In some embodiments, the oligonucleotide includes the structure of Formula XXXIII, as shown below: wherein [ASO] includes any of the oligonucleotides of the instant invention, wherein m designates a mismatched nucleotide. [0259] In some embodiments, the ADAR-recruiting domains are Z-DNA ADAR- recruiting domains. In some embodiments, the ADAR-recruiting domains are MS2 ADAR- recruiting domains. In some embodiments, an MS2 bacteriophage stem-loop structure may be used as an ADAR-recruiting domain (e.g., and MS2 ADAR-recruiting domain). MS2 stem- loops are known to bind the MS2 bacteriophage coat protein, which when fused to the deaminase domain of ADAR (e.g. an ADAR fusion protein) can be used for target-specific deamination. In some embodiments, the MS2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 50, as shown below in the 5’ to 3’ direction: ACATGAGGATCACCCATGT (SEQ ID NO. 50) [0260] In some embodiments, an ADAR fusion protein is administered to the cell or to the subject using an expression vector construct including a polynucleotide encoding an ADAR fusion protein. In some embodiments, the ADAR fusion protein includes a deaminase domain of ADAR fused to an MS2 bacteriophage coat protein. In some embodiments, the deaminase domain of ADAR is a deaminase domain of ADAR1. In some embodiments, the deaminase domain of ADAR is a deaminase domain of ADAR2. The ADAR fusion protein may be a fusion protein described in Katrekar et al. Nature Methods, 16(3): 239-42 (2019), the ADAR fusion protein of which is herein incorporated by reference [0261] The nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Alternative nucleotides and nucleosides include those with modifications including, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2'-position or 4'-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages. The nucleobase may also be an isonucleoside in which the nucleobase is moved from the C1 position of the sugar moiety to a different position (e.g. C2, C3, C4, or C5). Specific examples of oligonucleotide compounds useful in the embodiments described herein include, but are not limited to alternative nucleosides containing modified backbones or no natural internucleoside linkages. Nucleotides and nucleosides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, alternative RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, an oligonucleotide will have a phosphorus atom in its internucleoside backbone. [0262] Alternative internucleoside linkages include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boronophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. [0263] Representative U.S. patents that teach the preparation of the above phosphorus- containing linkages include, but are not limited to, U.S. Pat. Nos.3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference. [0264] Alternative internucleoside linkages that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH 2 component parts. [0265] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos.5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference. [0266] In other embodiments, suitable oligonucleotides include those in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, a mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar of a nucleoside is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500. [0267] Some embodiments featured in the invention include oligonucleotides with phosphorothioate backbones and oligonucleotides with heteroatom backbones, and in particular -CH 2 -NH-CH 2 -, -CH 2 -N(CH 3 )-O-CH 2 -[known as a methylene (methylimino) or MMI backbone], -CH 2 -O-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 - and -N(CH 3 )-CH 2 -CH 2 - [wherein the native phosphodiester backbone is represented as -O-P-O-CH 2 -] of the above- referenced U.S. Pat. No.5,489,677, and the amide backbones of the above-referenced U.S. Pat. No.5,602,240. In some embodiments, the oligonucleotides featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No.5,034,506. In other embodiments, the oligonucleotides described herein include phosphorodiamidate morpholino oligomers (PMO), in which the deoxyribose moiety is replaced by a morpholine ring, and the charged phosphodiester inter-subunit linkage is replaced by an uncharged phophorodiamidate linkage, as described in Summerton, et al., Antisense Nucleic Acid Drug Dev.1997, 7:63-70. [0268] Alternative nucleosides and nucleotides can also contain one or more substituted sugar moieties. The oligonucleotides, e.g., oligonucleotides, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N- alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C 1 to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl. Exemplary suitable modifications include -O[(CH 2 ) n O] m CH 3 , -O(CH 2 ) n OCH 3 , -O(CH 2 ) n -NH 2 , -O(CH 2 ) n CH 3 , -O(CH 2 ) n -ONH 2 , and -O(CH 2 ) n -ON[(CH 2 ) n CH 3 ] 2 , where n and m are from 1 to about 10. In other embodiments, oligonucleotides include one of the following at the 2' position: C 1 to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O- CH 2 CH 2 OCH 3 , also known as 2'-O-(2-methoxyethyl) or 2'-O-MOE) (Martin et al., Helv. Chin. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. 2’-O-MOE nucleosides confer several beneficial properties to oligonucleotides including, but not limited to, increased nuclease resistance, improved pharmacokinetics properties, reduced non-specific protein binding, reduced toxicity, reduced immunostimulatory properties, and enhanced target affinity as compared to unmodified oligonucleotides. [0269] Another exemplary alternative contains 2'-dimethylaminooxyethoxy, i.e., a - O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-(CH 2 ) 2 -O-(CH 2 ) 2 -N(CH 3 ) 2 . Further exemplary alternatives include: 5'- Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides, (both R and S isomers in these three families); 2'-alkoxyalkyl; and 2'-NMA (N-methylacetamide). [0270] Other alternatives include 2'-methoxy (2'-OCH 3 ), 2'-aminopropoxy (2'- OCH 2 CH 2 CH 2 NH 2 ) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the nucleosides and nucleotides of an oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos.4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920. The entire contents of each of the foregoing are hereby incorporated herein by reference. [0271] An oligonucleotide for use in the methods of the present invention can also include nucleobase (often referred to in the art simply as "base") alternatives (e.g., modifications or substitutions). Unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Alternative nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine, 5- hydroxymethylcytosine, 5-formylcytosine, 5-carboxycytosine, pyrrolocytosine, dideoxycytosine, uracil, 5-methoxyuracil, 5-hydroxydeoxyuracil, dihydrouracil, 4-thiouracil, pseudouracil, 1- methyl-pseudouracil, deoxyuracil, 5-hydroxybutynl-2’-deoxyuracil, xanthine, hypoxanthine, 7- deaza-xanthine, thienoguanine, 8-aza-7-deazaguanine, 7-methylguanine, 7-deazaguanine, 6- aminomethyl-7-deazaguanine, 8-aminoguanine, 2,2,7-trimethylguanine, 8-methyladenine, 8- azidoadenine, 7-methyladenine, 7-deazaadenine, 3-deazaadenine, 2,6-diaminopurine, 2- aminopurine, 7-deaza-8-aza-adenine, 8-amino-adenine, thymine, dideoxythymine, 5-nitroindole, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 8-azaguanine and 8-azaadenine, and 3-deazaguanine. Further nucleobases include those disclosed in U.S. Pat. No.3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5- substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp.276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications. [0272] Representative U.S. patents that teach the preparation of certain of the above noted alternative nucleobases as well as other alternative nucleobases include, but are not limited to, the above noted U.S. Pat. Nos.3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference. [0273] In other embodiments, the sugar moiety in the nucleotide may be a ribose molecule, optionally having a 2’-O-methyl, 2’-O-MOE, 2’-F, 2’-amino, 2’-O-propyl, 2’- aminopropyl, or 2’-OH modification. [0274] An oligonucleotide for use in the methods of the present invention can include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified by the bridging of two atoms. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety including a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some embodiments an agent of the invention may include one or more locked nucleosides. A locked nucleoside is a nucleoside having a modified ribose moiety in which the ribose moiety includes an extra bridge connecting the 2' and 4' carbons. In other words, a locked nucleoside is a nucleoside including a bicyclic sugar moiety including a 4'-CH 2 -O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleosides to oligonucleotides has been shown to increase oligonucleotide stability in serum, and to reduce off-target effects (Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides including a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the polynucleotide agents of the invention include one or more bicyclic nucleosides including a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'- (CH 2 ) 2 -O-2' (ENA); 4'-CH(CH 3 )-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'- CH(CH 2 OCH 3 )-O-2' (and analogs thereof; see, e.g., U.S. Pat. No.7,399,845); 4'-C(CH 3 )(CH 3 )- O-2' (and analogs thereof; see e.g., U.S. Pat. No.8,278,283); 4'-CH 2 -N(OCH 3 )-2' (and analogs thereof; see e.g., U.S. Pat. No.8,278,425); 4'-CH 2 -O-N(CH 3 ) 2 -2' (see, e.g., U.S. Patent Publication No.2004/0171570); 4'-CH 2 -N(R)-O-2', wherein R is H, C 1 -C 12 alkyl, or a protecting group (see, e.g., U.S. Pat. No.7,427,672); 4'-CH 2 -C(H)(CH 3 )-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH 2 -C(=CH 2 )-2' (and analogs thereof; see, e.g., U.S. Pat. No.8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference. [0275] Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos.6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference. [0276] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D- ribofuranose (see WO 99/14226). [0277] An oligonucleotide for use in the methods of the invention can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid including a bicyclic sugar moiety including a 4'- CH(CH3)-O-2' bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as "S-cEt." [0278] An oligonucleotide for use in the methods of the invention may also include one or more "conformationally restricted nucleotides" ("CRN"). CRN are nucleotide analogs with a linker connecting the C2' and C4' carbons of ribose or the C3 and --C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering. [0279] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No.2013/0190383; and PCT publication WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference. [0280] In some embodiments, an oligonucleotide for use in the methods of the invention includes one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between C1'-C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1' and C4' carbons). In another example, the C2'-C3' bond (i.e. the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference). [0281] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No.8,314,227; and US Patent Publication Nos.2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference. [0282] The ribose molecule may also be modified with a cyclopropane ring to produce a tricyclodeoxynucleic acid (tricyclo DNA). The ribose moiety may be substituted for another sugar such as 1,5,-anhydrohexitol, threose to produce a threose nucleoside (TNA), or arabinose to produce an arabino nucleoside. The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleoside or glycol to produce glycol nucleosides. [0283] The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleic acid (CeNA) or glycol to produce glycol nucleic acids (GNA).Potentially stabilizing modifications to the ends of nucleotide molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp- C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N- (aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3''-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861. [0284] Other alternatives chemistries of an oligonucleotide of the invention include a 5' phosphate or 5' phosphate mimic, e.g., a 5'-terminal phosphate or phosphate mimic of an oligonucleotide. Suitable phosphate mimics are disclosed in, for example US Patent Publication No.2012/0157511, the entire contents of which are incorporated herein by reference. [0285] Exemplary oligonucleotides for use in the methods of the invention include sugar- modified nucleosides and may also include DNA or RNA nucleosides. In some embodiments, the oligonucleotide includes sugar-modified nucleosides and DNA nucleosides. Incorporation of alternative nucleosides into the oligonucleotide of the invention may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the alternative nucleosides can be referred to as affinity enhancing alternative nucleotides. [0286] In some embodiments, the oligonucleotide includes at least 1 alternative nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 alternative nucleosides. In other embodiments, the oligonucleotides include from 1 to 10 alternative nucleosides, such as from 2 to 9 alternative nucleosides, such as from 3 to 8 alternative nucleosides, such as from 4 to 7 alternative nucleosides, such as 6 or 7 alternative nucleosides. In an embodiment, the oligonucleotide of the invention may include alternatives, which are independently selected from these three types of alternative (alternative sugar moiety, alternative nucleobase, and alternative internucleoside linkage), or a combination thereof. Preferably the oligonucleotide includes one or more nucleosides including alternative sugar moieties, e.g., 2′ sugar alternative nucleosides. In some embodiments, the oligonucleotide of the invention include the one or more 2′ sugar alternative nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O- methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, ANA, 2′-fluoro-ANA, and BNA (e.g., LNA) nucleosides. In some embodiments, the one or more alternative nucleoside is a BNA. [0287] In some embodiments, at least 1 of the alternative nucleosides is a BNA (e.g., an LNA), such as at least 2, such as at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 of the alternative nucleosides are BNAs. In a still further embodiment, all the alternative nucleosides are BNAs. [0288] In a further embodiment the oligonucleotide includes at least one alternative internucleoside linkage. In some embodiments, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boronophosphate internucleoside linkages. In some embodiments, all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages. In some embodiments the phosphorothioate linkages are stereochemically pure phosphorothioate linkages. In some embodiments, the phosphorothioate linkages are Sp phosphorothioate linkages. In other embodiments, the phosphorothioate linkages are Rp phosphorothioate linkages. [0289] In some embodiments, the oligonucleotide for use in the methods of the invention includes at least one alternative nucleoside which is a 2′-O-MOE-RNA, such as 2, 3, 4, 5, 6, 7, 8, 9, or 102′-O-MOE-RNA nucleoside units. In some embodiments, the 2’-O-MOE-RNA nucleoside units are connected by phosphorothioate linkages. In some embodiments, at least one of said alternative nucleoside is 2′-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9, or 102′-fluoro- DNA nucleoside units. In some embodiments, the oligonucleotide of the invention includes at least one BNA unit and at least one 2′ substituted alternative nucleoside. In some embodiments of the invention, the oligonucleotide includes both 2′ sugar modified nucleosides and DNA units. B. Oligonucleotide Conjugated to Ligands [0290] Oligonucleotides for use in the methods of the invention may be chemically linked to one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937). [0291] In one embodiment, a ligand alters the distribution, targeting, or lifetime of an oligonucleotide agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ, or region of the body, as, e.g., compared to a species absent such a ligand. [0292] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N- acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L- glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic ionizable lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide. [0293] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl- galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. [0294] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross- linkers (e.g. psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP. [0295] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. [0296] The ligand can be a substance, e.g., a drug, which can increase the uptake of the oligonucleotide agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. [0297] In some embodiments, a ligand attached to an oligonucleotide as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that include a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, including multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein. [0298] Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto. [0299] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives. [0300] In the ligand-conjugated oligonucleotides of the present invention, such as the ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks. [0301] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand- nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis. i. Lipid Conjugates [0302] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA. [0303] A lipid-based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney. [0304] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. Exemplary vitamins include vitamin A, E, and K. ii. Cell Permeation Agents [0305] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell- permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase. [0306] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three- dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to oligonucleotide agents can affect pharmacokinetic distribution of the oligonucleotide, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. [0307] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO.87). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO.88) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a "delivery" peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ; SEQ ID NO.89) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK; SEQ ID NO.90) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to an oligonucleotide agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized. [0308] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidomimetics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Some conjugates of this ligand target PECAM-1 or VEGF. [0309] A cell permeation peptide is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell- permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin, or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res.31:2717-2724, 2003). iii. Carbohydrate Conjugates [0310] In some embodiments of the compositions and methods of the invention, an oligonucleotide further includes a carbohydrate. The carbohydrate conjugated oligonucleotide is advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, "carbohydrate" refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8). [0311] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. [0312] In some embodiments, the carbohydrate conjugate further includes one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide. [0313] Additional carbohydrate conjugates (and linkers) suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference. iv. Linkers [0314] In some embodiments, the conjugate or ligand described herein can be attached to an oligonucleotide with various linkers that can be cleavable or non-cleavable. [0315] Linkers typically include a direct bond or an atom such as oxygen or sulfur, a unit such as NR 8 , C(O), C(O)NH, SO, SO 2 , SO 2 NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO 2 , N(R 8 ), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R 8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7- 17, 8-17, 6-16, 7-17, or 8-16 atoms. [0316] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum). [0317] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selective for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases. [0318] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell. [0319] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell- types rich in esterases include cells of the lung, renal cortex, and testis. [0320] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes. [0321] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissues. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions). a. Redox Cleavable Linking Groups [0322] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (--S--S--). To determine if a candidate cleavable linking group is a suitable "reductively cleavable linking group," or for example is suitable for use with a particular oligonucleotide moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one embodiment, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media. b. Phosphate-Based Cleavable Linking Groups [0323] In another embodiment, a cleavable linker includes a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -O- P(O)(OR k )-O-, -O-P(S)(OR k )-O-, -O-P(S)(SR k )-O-, -S-P(O)(OR k )-O-, -O-P(O)(OR k )-S-, -S- P(O)(OR k )-S-, -O-P(S)(OR k )-S-, -S-P(S)(OR k )-O-, -O-P(O)(R k )-O-, -O-P(S)(R k )-O-, -S- P(O)(R k )-O-, -S-P(S)(R k )-O-, -S-P(O)(R k )-S-, -O-P(S)(R k )-S-. These candidates can be evaluated using methods analogous to those described above. c. Acid Cleavable Linking Groups [0324] In another embodiment, a cleavable linker includes an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula –C=NN--, C(O)O, or -- OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above. d. Ester-Based Linking Groups [0325] In another embodiment, a cleavable linker includes an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula --C(O)O--, or --OC(O)--. These candidates can be evaluated using methods analogous to those described above. e. Peptide-Based Cleaving Groups [0326] In yet another embodiment, a cleavable linker includes a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (--C(O)NH--). The amide group can be formed between any alkylene, alkenylene, or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide-based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula -- NHCHRAC(O)NHCHRBC(O)--, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above. [0327] In one embodiment, an oligonucleotide of the invention is conjugated to a carbohydrate through a linker. Linkers include bivalent and trivalent branched linker groups. Exemplary oligonucleotide carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to, those described in formulas 24-35 of PCT Publication No. WO 2018/195165. [0328] Representative U.S. patents that teach the preparation of oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos.4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference. [0329] In certain instances, the nucleotides of an oligonucleotide can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to oligonucleotides in order to enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm, 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison- Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino- carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such oligonucleotide conjugates have been listed above. Typical conjugation protocols involve the synthesis of an oligonucleotide bearing an amino linker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the oligonucleotide still bound to the solid support or following cleavage of the oligonucleotide, in solution phase. Purification of the oligonucleotide conjugate by HPLC typically affords the pure conjugate. IV. Pharmaceutical Compositions [0330] The present disclosure also includes pharmaceutical compositions and formulations which include the oligonucleotides of the disclosure. In one embodiment, provided herein are pharmaceutical compositions containing an oligonucleotide, e.g., a guide oligonucleotide, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the oligonucleotide are useful for treating a subject who would benefit from editing a target gene, e.g., an ABCA4 polynucleotide with a SNP associated with Stargardt Disease. [0331] The pharmaceutical compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be oral, parental, topical (e.g., by a transdermal patch), intranasal, intratracheal, epidermal and transdermal. [0332] Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration. Parenteral administration may be by continuous infusion over a selected period of time. [0333] Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the oligonucleotides featured in the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). Oligonucleotides featured in the disclosure can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, Oligonucleotides can be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2- one, an acylcarnitine, an acylcholine, or a C1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in US 6,747,014, which is incorporated herein by reference. [0334] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients. [0335] Useful solutions for oral or parenteral administration can be prepared by any of the methods well known in the pharmaceutical art, described, for example; in Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990). The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Formulations also can include, for example, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, and hydrogenated naphthalenes. Other potentially useful parenteral carriers for these drugs include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. [0336] Formulations of the present disclosure suitable for oral administration may be in the form of: discrete units such as capsules, gelatin capsules, sachets, tablets, troches, or lozenges, each containing a predetermined amount of the drug; a powder or granular composition; a solution or a suspension in an aqueous liquid or non-aqueous liquid; or an oil-in- water emulsion or a water-in-oil emulsion. The drug may also be administered in the form of a bolus, electuary or paste. A tablet may be made by compressing or molding the drug optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing, in a suitable machine, the drug in a free-flowing form such as a powder or granules, optionally mixed by a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding; in a suitable machine; a mixture of the powdered drug and suitable carrier moistened with an inert liquid diluent. [0337] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose; a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. [0338] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water; ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and/or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. [0339] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions; methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. [0340] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug that may be in microcrystal line form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and ophthalmic administration. [0341] Systemic administration also can be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants generally are known in the art, and include, for example, for transmucosal administration, detergents and bile salts. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds typically are formulated into ointments, salves, gels, or creams as generally known in the art. [0342] The active compounds may be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used; such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No.4,522,811. [0343] Oral or parenteral compositions can be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals. Furthermore, administration can be by periodic injections of a bolus, or can be made more continuous by intravenous, intramuscular or intraperitoneal administration from an external reservoir (e.g., an intravenous bag). [0344] Where the active compound is to be used as part of a transplant procedure, it can be provided to the living tissue or organ to be transplanted prior to removal of tissue or organ from the donor. The compound can be provided to the donor host. Alternatively, or in addition, once removed from the donor, the organ or living tissue can be placed in a preservation solution containing the active compound. In all cases, the active compound can be administered directly to the desired tissue, as by injection to the tissue, or it can be provided systemically, either by oral or parenteral administration, using any of the methods and formulations described herein and/or known in the art. Where the drug comprises part of a tissue or organ preservation solution, any commercially available preservation solution can be used to advantage. For example, useful solutions known in the art include Collins solution, Wisconsin solution, Belzer solution, Eurocollins solution and lactated Ringer's solution. [0345] The pharmaceutical formulations of the present disclosure, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. [0346] The compositions of the present disclosure can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol or dextran. The suspension can also contain stabilizers. [0347] The compositions of the present disclosure can also be prepared and formulated in additional formulations, such as emulsions or microemulsions, or be incorporated into a particle, e.g., a microparticle, which can be produced by spray-drying, or other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques. Penetration enhancers, e.g., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants, may be added in order to effect the efficient delvery of the compositions of the present disclosure, e.g., the delivery of the oligonucleotides, to the subject. Agents that enhance uptake of oligonucletide agents at the cellular level can also be added to the pharmaceutical and other compositions of the present disclosure, such as, cationic lipids, e.g., lipofectin, cationic glycerol derivatives, and polycationic molecules, e.g.,polylysine. [0348] The pharmaceutical composition of the present disclosure may also include a pharmaceutical carrier or excipient. A pharmarceutical carrier or excipient is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc). [0349] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. [0350] Toxicity and therapeutic efficacy of the compositions can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population). Compounds that exhibit high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. [0351] The dosage of the compositions (e.g., a composition including an oligonucleotide) described herein, can vary depending on many factors, such as the pharmacodynamic properties of the compound; the mode of administration; the age, health, and weight of the recipient; the nature and extent of the symptoms; the frequency of the treatment, and the type of concurrent treatment, if any; and the clearance rate of the compound in the animal to be treated. One of skill in the art can determine whether to administer the composition and tailor the appropriate dosage and/or therapeutic regimen of treatment with the composition based on the above factors. The compositions described herein may be administered initially in a suitable dosage that may be adjusted as required, depending on the clinical response. In some embodiments, the dosage of a composition (e.g., a composition including an oligonucleotide) is a prophylactically or a therapeutically effective amount. In some embodiments, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. In addition, it is to be understood that the initial dosage administered may be increased beyond the above upper level in order to rapidly achieve the desired blood-level or tissue level, or the initial dosage may be smaller than the optimum and the daily dosage may be progressively increased during the course of treatment depending on the particular situation. If desired, the daily dose may also be divided into multiple doses for administration, for example, two to four times per day. [0352] The pharmaceutical compositions of the disclosure may be administered in dosages sufficient to edit a target gene, e.g., an ABCA4 polynucleotide, and/or treat Stargardt Disease. In therapeutic use for treating, preventing, or combating, Stargardt Disease, in subjects, the compounds or pharmaceutical compositions thereof will be administered orally or parenterally at a dosage to obtain and maintain a concentration, that is, an amount, or blood-level or tissue level of active component in the animal undergoing treatment which will be effective. The term “effective amount” is understood to mean that the compound of the disclosure is present in or on the recipient in an amount sufficient to elicit biological activity. Generally, an effective amount of dosage of active component will be in the range of from about 1 μg/kg to about 100 mg/kg, preferably from about 10 μg/kg to about 10 mg/kg, more preferably from about 100 μg/kg to about 1 mg/kg of body weight per day. V. Kits [0353] In cetain aspects, the instant disclosure provides kits that include a pharmaceutical formulation including an oligonucleotide agent capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration of a SNP associated with a disease, e.g., Stargardt Disease, and a package insert with instructions to perform any of the methods described herein. [0354] In some embodiments, the kits include instructions for using the kit to edit an ABCA4 polynucleotide comprising a SNP associated with Stargardt Disease. In other embodiments, the kits include instructions for using the kit to edit an ABCA4 polynucleotide comprising a SNP associated with Stargardt Disease and to treat Stargardt Disease. The instructions will generally include information about the use of the kit for editing nucleic acid molecules. In other embodiments, the instructions include at least one of the following: precautions; warnings; clinical studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. In a further embodiment, a kit can comprise instructions in the form of a label or separate insert (package insert) for suitable operational parameters. [0355] In some embodiments, the kit includes a pharmaceutical formulation including an oligonucleotide agent capable of effecting an ADAR-mediated adenosine to inosine alteration of a SNP associated with a disease, e.g., Stargardt Disease, an additional therapeutic agent, and a package insert with instructions to perform any of the methods described herein. [0356] The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. [0357] In some embodiments, the kit can comprise one or more containers with appropriate positive and negative controls or control samples, to be used as standard(s) for detection, calibration, or normalization. [0358] The kit can further comprise a second container comprising a pharmaceutically- acceptable buffer, such as (sterile) phosphate-buffered saline, Ringer's solution, or dextrose solution; and other suitable additives such as penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients, as described herein.It can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, and package inserts with instructions for use. The kit can also include a drug delivery system such as liposomes, micelles, nanoparticles, and microspheres, as described herein. The kit can further include a delivery device, e.g., for delivery to the [central nervous system], such as needles, syringes, pumps, and package inserts with instructions for use. [0359] This invention is further illustrated by the following examples which should not be construed as limiting. The entire contents of all references, patents and published patent applications cited throughout this application, as well as the Figures and the Sequence Listing, are hereby incorporated herein by reference. Examples Example 1. Reversing an amino acid substitution mutation G1961E in the ABCA4 transcript by targeted A to I editing for the treatment of Stargardt Disease [0360] Human ADAR2 sequence (NM_001112.4), Human ADAR1p110 (NM_001111.5) and ABCA4-G1961E sequences (ORF only) were cloned into pcDNA3.1 plasmid under the control of the CMV promoter using BamHI and XbaI restriction sites (Quintara Bio, Berkeley, CA) and the correct insert was sequence verified. The plasmids as referred to as ADAR2/pcDNA3.1, ADAR1p110/pcDNA3.1, or ABCA4/pcDNA3.1. For editing experiments, 2 µg of ADAR2/pcDNA3.1 or ADAR1p110/pcDNA3.1 plasmid and 10µg of ABCA4/pcDNA3.1 plasmid were transfected into 5x10 6 HEK293T cells (ATCC) using 25 µL of Lipofectamine 3000 and 24 µL of P3000 (Life Technologies) per 10 cm dish. After 4 hours, the culture media was replenished with fresh warmed media (DMEM High Glucose; Life Technologies). [0361] 12-16 hours after transfection, the transfected HEK293T cells were transfected with guide oligonucleotides such that the final concentration in the each well was 100 nM. All transfections were carried out with Lipofectamine 3000 (0.4 µL/per well) in a 96-well format according to manufacturer’s instructions. 12-16 hours after the second transfection, the cells were washed once with ice cold PBS and total mRNA isolation was performed using Dyna Beads mRNA Direct Kit (Life Technologies) adapted for KingFisher Flex Purification (Life Technologies) according to manufacturer’s instructions. The samples were treated with TURBO DNase (Life Technologies) prior to elution. The resulting isolated mRNA was used for cDNA synthesis using SuperScript IV Vilo according to the manufacturer’s instructions (Life Technologies). One µl of the cDNA was used as template for PCR (Platinum II Hot-Start PCR Master Mix; Life Technologies) using gene specific primers to generate an amplicon for Sanger sequencing (Table 4). Sanger sequencing was performed by Quintara Biosciences (Berkeley, CA). Adenosine to inosine editing yields were quantified by measuring the peak height of adenosine and guanosine and dividing the guanosine peak height by the total peak height measurements of adenosine and guanosine combined. [0362] The guide oligonucleotide sequences tested are shown in Table 5. Table 5 also shows the editing results for each guide oligonucleotide co-transfected with either ADAR1 or ADAR2. Table 4: Primer List Table 5: Guide RNA Sequences for ABCA4 - G1961E Antisense-gRNA
EQUIVALENTS [0363] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.
Next Patent: DISTRIBUTED ENERGY RESOURCE SYSTEM DESIGN AND OPERATION