METHODS AND COMPOSITIONS FOR THE TREATMENT OF HUNTINGTON'S

DISEASE

FIELD OF INVENTION

[0001] The present invention relates to methods and compositions for the treatment of Huntington's disease.

BACKGROUND OF THE INVENTION

[0002] Huntington's disease (HD) is a progressive neurodegenerative disorder that is inherited in a dominant fashion and results from a mutation that expands the polymorphic trinucleotide (CAG) tract in the Huntingtin gene (HTT). The average CAG tract size in the general population is 17-26 repeats (wildtype allele), however, in HD patients the CAG tract has expanded to 36 repeats or more (mutant allele) (Huntington's Disease Collaborative Research Group 1993. Cell 72(6):971-83). The HTT gene encodes the HTT protein and the expanded CAG tract results in a pathological increase in the polyglutamine repeats near the N-terminal of the protein. Individuals carry two copies of the HTT gene and one mutant allele is sufficient to result in HD.

[0003] Selective reduction or elimination ("knockdown" or "silencing") of a defective gene product is a therapeutic approach that may be useful in many genetic diseases or disorders, however the HTT protein appears to have a role during development of the nervous system and a protective role in cells. In mouse models, constitutive knockout of the HTT gene is lethal during embryonic development (Nasir et al 1995. Cell 81(5):811-23), while adult inactivation of the HTT gene leads to progressive cell death in the brain and the testes (Dragatsis et al 2000. Nat. Genet 26:300-306). Reduction of huntingtin expression from the wildtype allele may, therefore, have negative consequences.

[0004] Sequence-based methods, such as antisense oligonucleotide (ASO), RNAinterference (RNAi) technology, microRNA (miRNA) or small hairpin interference RNA (shRNA), may be used for precise targeting of genes or nucleic-acid gene products . Some antisense (ASO), siRNA and ribozyme molecules have been developed that reduce huntingtin expression in vitro or in mouse models, (Handley et al 2006. CHn. Sci. (Lond). 110:73-88; Denovan- Wright et al., 2006. Gen Ther. 13:525-131; Koutsilieri et al 2007. J. Neural Trans. Suppl. 72:43-49).

[0005] Allele specific silencing has been demonstrated in cells expressing mutant genes in dominant human diseases - for example, spinocerebellar ataxia (SCA) type 3, SCA6, sickle cell anemia, frontotemporal dementia, amyotrophic lateral sclerosis, Familial amyloidotic

polyneuropathy (FAP), Alzheimer's disease, slow channel congenital myasthenic syndrome and inherited dystonia.

[0006] The trinucleotide expansion that causes neurodegenerative disease, such as the CAG expansion in HJTthat causes HD, is a clear allelic difference between the normal and mutated gene for these disorders (Bonini et al 2005. Neuron 48:715-718). However, the size of the disease-causing expansion mutation (in nucleotides) is frequently greater than the targeting capacity of siRNA or ASO molecules, and further, represents a highly repetitive element. This size may make the trinucleotide expansion difficult to target with siRNA or ASO methodologies..

[0007] PCT Publication WO 2008/005562 to Aronin et al. discloses several SNPs found in the Huntingtin gene, and discloses some specific nucleic acid sequences that may target one of the identified SNPs.

[0008] In order to effect an allele-specific reduction of expression of the mutant allele in a dominant gene disorder, such as those involving a polyglutamine expansion, greater detailed knowledge of the polymorphisms specific to a particular group of subjects, or an individual subject is required.

SUMMARY OF THE INVENTION

[0009] The present invention relates to methods and compositions for the treatment of Huntington's disease.

[0010] In accordance with one aspect of the invention, there is provided a method of reducing expression of a mutant huntingtin (mHTT) protein in a cell, comprising contacting the cell with an effective amount of a nucleic acid silencing agent targeting a differentiating polymorphism in RNA encoding the mHTT.

[001 1] In accordance with another aspect of the invention, there is provided a method of selecting a nucleic acid silencing agent targeting a differentiating polymorphism in RNA encoding an mHTT protein of a subject, comprising obtaining a nucleic acid sample from the subject; identifying one or more differentiating polymorphisms in the nucleic acid sample; selecting a nucleic acid silencing agent comprising a sequence that preferentially targets the differentiating polymorphism in the RNA encoding an mHTT protein.

[0012] In accordance with another aspect of the invention, there is provided a method of reducing expression of an mHTT protein in a subject, comprising obtaining a nucleic acid sample from the subject; identifying one or more than one differentiating polymorphisms in the nucleic acid sample; selecting one or more than one nucleic acid silencing agents comprising a sequence that preferentially targets the one or more than one differentiating polymorphism in the RNA encoding an mHTT protein; and administering to the subject an effective amount of the one or more than one nucleic acid silencing agent.

[0013] In accordance with another aspect of the invention, there is provided a method of screening for a nucleic acid silencing agent targeting a differentiating polymorphism in RNA encoding an mHTT protein in a subject, comprising providing a cell heterozygous for a differentiating polymorphism in a nucleic acid sequence encoding huntingtin (HTT); contacting the cell with one or more candidate nucleic acid silencing agents targeting the differentiating polymorphism; assaying the cell for HTT and mHTT RNA, protein or RNA and protein expression; and determining the one or more nucleic acid silencing agents from the candidate nucleic acid silencing agents.

[0014] The polymorphism may be found in an intron, a promoter, a 3' untranslated region (UTR) or an exon of an HTT gene.

[0015] In accordance with another aspect of the invention, the differentiating polymorphism is a single nucleotide polymorphism (SNP).

[0016] In accordance with another aspect of the invention, the nucleic acid silencing agent is an oligonucleotide. The oligonucleotide may be selected from the group comprising SEQ ID NO: 68-134, 207, 209, 210, 211, 213, 215, 216, 286, 219, 221, 222, 223,294,229, 223, 238, 242, 311, 249, 252, 256, 258, 259, 261, 263, 264, 265, 266, 267, 268, 270, 271, 274, 275, 277, 278, 335, 306 or 223, or a fragment thereof.

[0017] In accordance with another aspect of the invention, the SNP may be selected from the group consisting of polymorphisms identified by RefSNP rs 13114311 , rsl2506200, rs762855, rs363081, rs363075, rs3025849, rs363102, rs3025838, rs362322, rs2276881, rsl006798, rs3856973, rs2285086, rs7659144, rsl6843804, rs2024115, rsl0015979, rs7691627,rs4690072, rs6446723, rs363064, rsl 1731237, rs4690073, rs363099,rs363096, rs2298967, rs2298969, rs6844859, rs363092, rs7685686, rs363088, rs362331, rs916171, rs362275, rs3121419,

rs362272, rs362271, rs3775061, rs362310, rs362307, rs362306, rs362303 rs362296 and rsl 006798.

[0018] In accordance with another aspect of the invention, the expression is reduced from 1% to 90%.

[0019] This summary of the invention does not necessarily describe all features of the invention. Other aspects, features and advantages of the present invention will become apparent to those of ordinary skill in the art upon review of the following description of specific embodiments of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS [0020] These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:

[0021] Figure 1 shows a table of the sequence context, identity and frequency for each of the 190 polymorphisms initially considered for allele differentiation in Huntingdon's disease subjects. NCBI_ 36 - Chromosome 4 coordinates relative to genome assembly build 36 (Mar 2006); Distance CAG - distance (bp) between the SNP the CAG tract in the HTT gene; ALL Major - frequency of the major allele - all populations pooled; ALL Minor- frequency of the minor allele - all populations pooled; MAF - Minor allele frequency; MAF CEU - MAF of the CEU population; MAF YOR - MAF of the Yoruban population; MAF ASI - MAF of the Asian population. 23% of polymorphisms had an MAF > 0.20 ("common" SNPs); 45% of polymorphisms had an MAF <0.05 ("rare" polymorphisms).

[0022] Figure 2: Specific SNPs are highly associated with CAG-expanded chromosomes. (A) HD patient chromosomes were phased to allow comparison between the disease chromosome (>35 CAG) and control chromosome within each patient (total 65 individuals). tSNP is identified by number and its position indicated relative to the HTT gene. Alleles are either A/B (major/minor). Allele counts are indicated (middle) and the frequency graphed (bottom). Twelve out of 22 tSNPs have a significantly different allele distribution between HD and control chromosomes (*chi-square <0.0023). (B) Allelic frequency on 27-35 CAG chromosomes is similar to disease chromosomes. Allele counts are indicated for phased control chromosomes (n=l 16) and compared to 27-35 CAG chromosomes (n=66) that contain an intermediate CAG- tract size for the HTT gene and may result in new mutations for HD in future generations. Eleven

out of 22 tSNPs have significantly different allele distribution between 27-35 CAG and control chromosomes (*chi-square <0.0023). These eleven associated tSNPs were found in both HD and 27-35 CAG chromosomes and appear to be common on CAG expanded chromosomes. (C) There is no significant difference in the allele distribution between 27-35 CAG and HD chromosomes for any tSNPs.

[0023] Figure 3: CAG-expanded chromosomes are associated with haplogroup A. (A) Three major haplogroups (A, B, C) are defined using 22 tSNP positions. The nucleotide defining each haplogroup at each tSNP is shown. Variable tSNP positions are indicated (*). tSNPs with a gray box indicate nucleotide changes relative to haplogroup A. The amount of similarity between the haplogroups is indicated by a neighbour-joining tree (right). (B) Frequency distribution of haplogroups on HD (n=65), 27-35 CAG (n=66) and general population (n=l 16) chromosomes. CAG-expanded chromosomes (>27 CAG) are enriched for haplogroup A relative to the general population. Chromosomes from the general population with <27 CAG phased for CAG size (right) demonstrate that high-normal CAG chromosomes also have an enrichment for haplogroup A relative to low-normal CAG chromosomes. The mean CAG tract size for each group is indicated (C) CAG size distribution for all chromosomes on haplogroups A or C. In the chromosomes used in this study, the mean CAG sizes for haplogroup A are significantly larger (p<0.00001, t-test) than haplogroup C. The high odds ratio on haplogroup A is an indication that CAG expansion is much more likely to occur on haplogroup A chromosomes.

[0024] Figure 4 shows Specific haplogroup A variants are enriched on CAG-expanded chromosomes. (A) To determine if there are differences in haplogroup A chromosomes from CAG-expanded and normal chromosomes, haplogroup A was divided into 5 major variants by subtracting the common tSNPs (light gray text) and using differences at the 12 remaining tSNP positions (black text). The wildcard asterisk (*) is used for variable allele positions. Dark gray boxes indicate differences relative to the Al variant. The relationship between the variants is shown by a neighbour-joining tree (right). (B) CAG-expanded chromosomes (HD, N=62 and 27- 35 CAG carriers, n=55) have similar haplogroup A variant distributions and are specifically enriched for Al and A2 relative to chromosomes from the general population (n=61). Phased chromosomes from the general population (right) demonstrates that large normal chromosomes also have an enrichment for variant Al and A2 relative to low normal chromosomes. Variants A4 and A5 are almost absent from CAG-expanded chromosomes. (C) CAG size distribution of chromosomes in each of subgroup. Variant Al, A2 and A3 chromosomes have a broad CAG size

distribution that extends from low normal (<16 CAG) to high (>50). For the chromosomes used in this study, the mean CAG size and odds ratio of each variant is indicated. The highest HD risk variants, Al and A2, have significantly elevated mean CAG size and odds ratios >1. Variant A3 is a moderate HD risk haplotype, as it has a larger component of CAG sizes in the normal range and therefore a lower mean CAG size. Chromosomes with variant A4 or A5 are stable in the normal range.

[0025] Figure 5: Ethnic groups that have a low prevalence of HD do not have HD risk haplotypes in their general population. The prevalence of HD is much higher in Western European populations relative to Asia and Africa. Although the frequency of haplogroup A is similar between Europe and Asia (A), the frequencies of the high risk variants of haplotype A, Al and A2, are not found in the Asian populations (B). As expected, there is more genetic diversity in the Yoruba population, with a lower level of risk haplotypes and a relatively greater frequency of 'other' haplotypes. Number of chromosomes assessed in each ethnic group is indicated in brackets.

[0026] Figure 6: Disease-associated SNPs can be efficiently targeted for allele-specific silencing of the mutant HTT mRNA. In an HD patient whose genotype is known, specific heterozygous alleles can be used to distinguish the CAG expanded mRNA from non-expanded mRNA (ie alleles that are 100% sensitive of the disease allele and 100% specific). Because of the expense of clinically testing and validating each target, it is important to maximize the patient coverage with a minimum number of targets. A theoretical maximum number of targetable patients (89%) exists because in this cohort, seven of the 65 HD patients were not heterozygous at any tSNP and therefore could not be targeted. The maximum percent of the HD population in this study that could be treating using a single target (disease-associated allele) is 52%. The development of a therapy towards a second allele target would increase the patient coverage to 80%.

[0027] Figure 7: SNP Population Coverage Disease-associated SNPs can be efficiently targeted for allele-specific silencing of the mutant H7TmRNA. In an HD patient whose genotype is known, specific heterozygous alleles can be used to distinguish the CAG-expanded mRNA from non-expanded mRNA (i.e. alleles that are 100% sensitive of the disease allele and 100% specific). Because of the expense of clinically testing and validating each target, it may be important to maximize the patient coverage with a minimum number of targets. A theoretical maximum number of targetable patients (89%) exists because in this cohort, seven of the 65 HD

patients were not heterozygous at any tSNP and therefore could not be targeted. The maximum percent of the HD population in this study that could be treating using a single target (disease- associated allele) is 52%. The development of a therapy towards a second allele target would increase the patient coverage to 80%. Set # - the set of target(s) comprising 1, 2, 3 or 4 SNPs; Target (s) - Internal reference # for SNPs, RefSNP designation is provided in Table 1, disease- associated allele is indicated; % cover - % HD pop coverage: the percentage of HD population having at least one of the target SNPs indicated

DETAILED DESCRIPTION [0028] The invention provides, in part, methods and compositions for the treatment of

Huntington's disease. More particularly, single nucleotide polymorphisms (SNPs) that allow for differentiation between mutant and wild-type alleles of HTT nucleic acid sequences are provided; such polymorphisms may be useful for the design of diagnostic reagents and kits, and the development of therapeutic agents for use in the diagnosis and treatment of Huntington's disease.

[0029] In the description that follows, a number of terms are used extensively, the following definitions are provided to facilitate understanding of various aspects of the invention. Use of examples in the specification, including examples of terms, is for illustrative purposes only and is not intended to limit the scope and meaning of the embodiments of the invention herein.

[0030] The cellular machinery (enzymes, proteins, cofactors, nucleic acids etc.) required for transcription of a nucleic acid sequence to a pre-mRNA, the subsequent processing of the primary transcript or pre-mRNA to a mature mRNA, translocation of the mRNA to the cytoplasm, post-transcriptional modification, splicing, assembly of a ribosome and initiation of translation of the mRNA to obtain a polypeptide are well-studied processes. The cellular machinery for RNA interference (RISC, DICER and the like) and double-stranded RNA processing pathways are also well-studied processes. Comprehensive reviews of these processes may be found in textbooks and reviews of the literature; see, for example, The Cell: A Molecular Approach (3 ^rd edition) by GM Cooper and RE Hausman. ASM Press, 2006; Lehninger: Principles of Biochemistry (4 ^th edition) by DL Nelson and MM Cox, WH Freeman & Co., 2004.

[0031] A "nucleic acid silencing agent" or an "agent" refers to a composition that acts in a sequence specific manner to effect a reduction in the level of a product (a "gene product") of a given nucleic acid sequence (e.g. a 'gene')- The reduction may be effected by interference with any of the processing of a pre-mRNA following transcription from the DNA of a cell or subject

(e.g. splicing, 5' capping, 5' or 3' processing, or export of the processed mRNA to the cytoplasm) or by interference with translation of a mature mRNA, or by specific, directed destruction of the pre-mRNA or mature mRNA. Antisense (ASO) and RNA interference (RNAi - effected by short interfering RNA, or siRNA) are two examples of such methods; micro RNA (miRNA) is another.

[0032] An antisense oligonucleotide (ASO) is an oligonucleotide that is complementary to a specific RNA sequence, and when hybridized to this specific sequence, interfere with processing or translation of the RNA. The nucleosides comprising an ASO may be purine or pyrimidine nucleosides, or a combination of purine and pyrimidine nucleosides, connected by an internucleoside linkage. ASOs are described generally in, for example, Crooke 2004. Annu. Rev. Med 55:61-95; Chan et al., 2006. Clin Exp Pharmacol Physiol 33:533-40; and in Curr MoI Med 4:465-487.

[0033] An siRNA is a short (20-30 nucleotide) double-stranded RNA (or modified RNA) molecule that may effect a reduction in the level of a gene product by allowing for specific destruction of mRNA via the RNA interference pathway. The specific mRNA is degraded in the cytoplasm by the RNA-induced silencing complex (RISC).

[0034] An miRNA is a short (20-30 nucleotide) single-stranded RNA molecule that may effect a reduction in the level of a gene product. An miRNA is complementary to a part of an mRNA, either a coding region or a non-translated region (e.g. 5' untranslated region (UTR), 3' UTR). The miRNA may anneal to form a double-stranded complex and trigger degradation in a process similar to that of siRNA. Translation may also be disrupted by miRNA.

[0035] A "candidate nucleic acid silencing agent" or "candidate agent" is a nucleic acid silencing agent that may be screened or tested for its ability to effect a reduction in the level of a gene product.

[0036] "Silencing" refers to preferential reduction in the expression of a gene product of a specific allele. The specific allele may be referred to as the "target" or "target sequence". An agent may be described as targeting a specific allele where the agent comprises a sequence that hybridizes with a differentiating polymorphism found in a mutant HTT (mHTT) nucleic acid sequence. In some embodiments the gene product may be a polypeptide or a nucleic acid, such as a mRNA or an hn RNA.

[0037] "Hybridization" includes an interaction in which one or more polynucleotides and/or oligonucleotides interact in an ordered manner (sequence-specific) to form a complex that is stabilized by hydrogen bonding - also referred to as "Watson-Crick" base pairing. Variant base- pairing may also occur through non-canonical hydrogen bonding includes Hoogsteen base pairing. Under some thermodynamic, ionic or pH conditions, triple helices may occur, particularly with ribonucleic acids. These and other variant hydrogen bonding or base-pairing are known in the art, and may be found in, for example, Lehninger: Principles of Biochemistry (4 ^th edition) by DL Nelson and MM Cox, WH Freeman & Co., 2004.

[0038] Hybridization between two nucleic acids may occur in an antiparallel configuration - this is referred to as 'annealing', and the paired nucleic acids are described as complementary. A double- stranded polynucleotide may be "complementary", if hybridization can occur between one of the strands of the first polynucleotide and the second. The degree of which one polynucleotide is complementary with another is referred to as homology, and is quantifiable in terms of the proportion of bases in opposing strands that are expected to hydrogen bond with each other, according to generally accepted base-pairing rules. An oligonucleotide may self-hybridize, e.g. forming a hairpin or stem-loop structure, the sequences forming the double-stranded region may be referred to as 'complementary'.

[0039] Hybridization reactions can be performed under conditions of different "stringency". The stringency of a hybridization reaction includes the difficulty with which any two nucleic acid molecules will hybridize to one another. Stringency may be increased, for example, by increasing the temperature at which hybridization occurs, by decreasing the ionic concentration at which hybridization occurs, or a combination thereof. Under stringent conditions, nucleic acid molecules at least 60%, 65%, 70%, 75% or more identical to each other remain hybridized to each other, whereas molecules with low percent identity cannot remain hybridized. An example of stringent hybridization conditions are hybridization in 6x sodium chloride/sodium citrate

(SSC) at about 44-45°C, followed by one or more washes in 0.2xSSC, 0.1% SDS at 50°C, 55°C, 6O ⁰ C, 65°C, or at a temperature therebetween.

[0040] Probes used in hybridization may include double-stranded DNA, single-stranded DNA and RNA oligonucleotides, and peptide nucleic acids. Hybridization conditions and methods for identifying markers that hybridize to a specific probe are described in the art - for a general description, see, for example, Brown, T. "Hybridization Analysis of DNA Blots" in

Current Protocols in Molecular Biology. FM Ausubel et al, editors. Wiley & Sons, 2003. Suitable hybridization probes for use in accordance with the invention include oligonucleotides, polynucleotides or modified nucleic acids from about 10 to about 400 nucleotides, alternatively from about 20 to about 200 nucleotides, or from 5 about 30 to about 100 nucleotides in length. Specific sequences may be identified by hybridization with a primer or a probe, and this hybridization is subsequently detected by conventional methods e.g. radiograph, colourimetric detection, fluorescence and the like.

[0041] The term 'nucleoside' refers to a molecule of ribose or deoxyribose sugar bonded through carbon- 1 of the sugar ring to a nitrogenous base. Examples of nitrogenous bases include purines such as adenine, guanine, 6-thioguanine, hypoxanthine, xanthine, and pyrimidines such as cytosine, thymine and uracil. Examples of purine nucleosides include adenosine (A), guanosine (G), inosine (I), 2'-O-methyl-inosine, 2'-O-methyl-adenosine, 2'-O-methyl-guanine, 2- chlorodeoxyadenosine, 7-halo-7-deaza-adenosine, 7-halo-7-deaza-guanine, 7-propyne-7-deaza adenosine, 7-propyne-7-deaza-guanine, 2-amino-adenosine, 7-deazainosine, 7- thia-7,9- dideazainosine, formycin B, 8-Azainosine, 9-deazainosine, allopurinol riboside, 8-bromo- inosine, 8-chloroinosine, 7-deaza-2-deoxy-xanthosine, 7-Deaza-8-aza-adenosine, 7-deaza-8-aza- guanosine, 7-deaza-8-aza-deoxyadenosine, 7-deaza-8-aza-deoxyguanosine, 7-deaza-adenosine, 7- deaza-guanosine, 7-deaza-deoxyadenosine, 7-deaza-deoxyguanosine, 8-amino-adenosine, 8- amino-deoxyadenosine, 8-amino-guanosine, 8-amino-deoxyguanosine,3-deaza-deoxyadenosine, 3-deaza-adenosine, 6-thio-deoxyguanosine, and the like, and other purine nucleosides as described in Freier et al 1997 (Nucleic Acids Res. 25:4429-4443), incorporated herein by reference.

[0042] Examples of pyrimidine nucleosides include deoxyuridine (dU), undine (U), cytidine (C), deoxycytidine (dC), thymidine (T), deoxythymidine (dT), 5-fluoro-uracil, 5-bromouracil, T- O-methyl-uridine, 2'-O-methyl cytidine, 5-iodouracil, 5-methoxy-ethoxy-methyl-uracil, 5- propynyl deoxyuridine, pseudoisocytidine, 5-azacytidine, 5-(l-propynyl)cytidine, T- deoxypseudouridine, 4-thio-deoxythymidine, 4-thio-deoxyuridine, and the like, and other substituted pyrimidines as disclosed in Freier et al,1997 (Nucleic Acids Res. 25:4429-4443).

[0043] Purine or pyrimidine nucleosides also include phosphoramidite derivatives used in oligonucleotide synthesis using standard methods.

[0044] "Nucleoside" also includes nucleosides having substituted ribose sugars (bicyclic or otherwise). Some representative patents and publications that teach the preparation of non- bicyclic modified sugars include, but are not limited to, U.S. Patents: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; 5,700,920; and 6,600,032; and WO 2005/121371. Some representative patents and publications that teach the preparation of bicyclic modified sugars include, but are not limited to, 'locked nucleic acids', such as those described in WO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO 0148190, WO 02/28875, WO 03/006475, WO 03/09547, WO 2004/083430, US 6,268,490, US 6,794499, US 7,034,133. Other examples of substituted ribose sugars are described in, for example, Freier, 1997 (Nucleic Acids Res. 25:4429-4443) and Herdewijn et al., 2000. (Antisense Nucleic Acid Drug Dev 10:297-310) both of which are incorporated by reference herein.

[0045] A 'nucleotide' refers to a nucleoside having an internucleoside linkage group bonded through the carbon-5 of the sugar ring, usually a mono-, di- or tri-phosphate, and may be suitable for enzymatic polymerization. In other examples, the nucleotides may be phosphoramidites, suitable for non-enzymatic polymerization or synthesis of nucleic acid polymers.

[0046] An internucleoside linkage group refers to a group capable of coupling two nucleosides, as part of an oligonucleotide backbone. Examples of internucleoside linkage groups are described by Praseuth et al (Biochimica et Biophysica Acta 1489: 181 -206) and Summerton et al 1997. (Antisense and Nucleic Acid Drug Dev 7: 187-195), both of which are incorporated herein by reference. For example, phosphodi ester (PO ₄ -), phosphorothioate (PO3s-), phosphoramidate (N3'-P5') (PO ₃ NH) and methylphosphonate (PO ₃ CH ₃ ), peptidic linkages ("PNA"), and the like; see, for example, US Patent 5969118. Inclusion of such modified linkage groups, modified ribose sugars or nitrogenous bases in an oligonucleotide may reduce the rate of hydrolysis of the oligonucleotide in vitro or in vivo.

[0047] The term "gene" refers generally to an ordered sequence of nucleotides located at a specific position on a chromosome, encoding one or more specific functional products (e.g. an RNA molecule, a polypeptide). The region encoding the one or more specific functional products may be referred to as a 'coding region' or 'coding sequence'. Non-coding regions (e.g. introns) may be found in proximity to the coding region e.g. 5' or 3' to the coding region, and

- i i -

provide for regulatory sequences involved in transcription, modification, processing or translation of the functional product. Coding regions and some transcribed but untranslated sequences are found within exons and introns. An "exon" is a segment of a gene transcript that codes information for protein synthesis. An "intron" is a segment of a gene transcript situated between exons. Introns are removed by splicing of the pre-mRNA nuclear transcript resulting in a mature mRNA that may be subsequently translocated to the cytoplasm and translated.

[0048] An "allele" is one of a pair, or one of a series of different forms of a given locus or marker. In a diploid organism or cell, the members of an allelic pair occupy corresponding positions (loci) on a pair of homologous chromosomes. If these alleles are identical, the organism is said to be 'homozygous' for that allele; if they differ, the organism or cell is said to be 'heterozygous' for that allele.

[0049] A "haplotype" is a set of alleles of closely linked loci on a chromosome that are generally inherited together. For example, a polymorphic allele at a first site in a nucleic acid sequence on the chromosome may be found to be associated with another polymorphic allele at a second site on the same chromosome, at a frequency other than would be expected for a random association (e.g. "linkage equilibrium"). These two polymorphic alleles may be described as being in linkage disequilibrium (LD). A haplotype may comprise two, three, four or more alleles. The set of alleles in a haplotype along a given segment of a chromosome are generally transmitted to progeny together unless there has been a recombination event.

[0050] "Expression" refers to transcription of a specific allele or gene (yielding pre-mRNA, mRNA or other RNA molecule), or to the translation of an mRNA transcribed from the specific allele or gene (yielding a polypeptide). Expression may be absolute (e.g. the allele or gene is expressed, or it is not), or may be described as relative to the expression of another allele (e.g. the allele exhibits greater or lesser expression, relative to a control, or a heterozygous allele; or greater or lesser expression in response to interaction with a nucleic acid silencing agent).

Expression may be quantified using a variety of methods. For example, RNA expression may be detected, quantified, or detected and quantified by Northern blotting, RT-PCR, qPCR, DNA microarray, SAGE, SuperSAGE, dot-blot, primer extension, 5' RACE, 3'RACE or the like. Expression of polypeptides may be detected, quantified, or detected and quantified by Western blotting, ELISA, ELISPOT, or the like. Such methods, and others that may be suitable will be within the knowledge of a skilled worker in the art, and are described generally in, for example,

Current Protocols in Molecular Biology (2000-2008). Ausubel et al. Editors Wiley Interscience The exact amount or level of expression, or change in amount or level of expression, is not important as long as it is statistically significant as determined by standard techniques.

[0051] A human nucleic acid sequence for "normal" or "wild-type" HTT is exemplified by GenBank reference sequences NM 002111.6 (mRNA) and NC 000004.10 and NT 006081.18 (genomic). The human wild-type HTT protein is exemplified by GenPept reference sequence NP 002102.4. Other examples of such sequences will be available from these or similar databases, or as obtained by sequencing a sample comprising HTT nucleic acid or protein. As is known in the art, the expanded CAG tract of mutant HTT (mHTT) nucleic acid sequences is found in the region encoding exon 1. Subjects with HD are usually heterozygous for the mHTT allele of the sequence. Subjects that are at risk for HD may be heterozygous for the mHTT allele - identification of the expanded CAG tract in the exon 1 sequences may be, at least, predictive of HD in a subject, and may further confirm a clinical diagnosis.

[0052] A differentiating polymorphism is a variation in a nucleotide sequence that permits differentiation between a 'wild-type' and mutant allele of a nucleic acid sequence.

Differentiating polymorphisms may include insertions or deletions of one or a few nucleotides in a sequence, or changes in one or a few nucleotides in a sequence.

[0053] An agent 'preferentially targets' a differentiating polymorphism in an RNA encoding a mHTT by effecting a reduction in the level of mHTT in a cell that is greater than the reduction of normal HTT in the cell. The level of mHTT in the cell may be from about 1% to about 10%, from about 10% to about 20%, from about 20% to about 30%, from about 30% to about 40% , from about 40% to about 50%, from about 50% to about 60%, from about 60% to about 70%, from about 70% to about 80%, from about 80% to about 90% or from about 90% to about 100% or greater, or any amount therebetween. The exact amount or quantity of reduction in mHTT is not important as long as it is statistically significant as determined by standard techniques.

[0054] A "single nucleotide polymorphism" or "SNP" is a single nucleotide variation between the genomes of individuals of the same species. In some cases, a SNP may be a single nucleotide deletion or insertion. In general, SNPs occur relatively frequently in genomes and thus contribute to genetic diversity. The density of SNPs in the human genome is estimated to be approximately 1 per 1,000 base pairs. In addition, SNPs are thought to be spaced relatively uniformly throughout the genome. Furthermore, SNPs are thought to be mutationally more

stable than other polymorphisms, lending their use to association studies in which linkage disequilibrium between markers and an unknown variant is used to map disease-causing mutations. SNPs may have two, three or four alleles, or (although it may be possible to have three or four different forms of an SNP, corresponding to the different nucleotides), thus facilitating genotyping (by a simple plus/minus assay rather than a length measurement) and automation. The location of a SNP is generally flanked by highly conserved sequences. An individual may be homozygous or heterozygous for an allele at each SNP location ("the SNP allele") - a heterozygous SNP allele is an example of a differentiating polymorphism.

[0055] Those of ordinary skill in the art will recognize that nucleic acid molecules are double- stranded and therefore reference to a particular SNP site on a strand also refers to the corresponding site on the complementary strand. Thus, reference may be made to either strand to refer to a particular SNP site or position, SNP allele, or nucleotide sequence, such as those set forth herein. Probes and primers may be designed to hybridize to either strand and SNP genotyping methods may target either strand.

[0056] SNPs may occur in protein-coding nucleic acid sequences (a "cSNP"). Such a SNP may result in an amino acid change in the encoded protein which may have functional consequences i.e., result in a "variant" protein or polypeptide. Alternatively, such a SNP may be "silent" in that it does not result in an amino acid change. SNPs may also occur in introns and in intergenic regions but may result in a phenotypic change. For example, a SNP resulting in aberrant splicing may result in a non-functional protein. Alternatively, a SNP may have no phenotypic effect. A variant protein or polypeptide contains at least one amino acid residue that differs from the corresponding amino acid sequence of the polypeptide that is referred to as "wild-type" or "normal" in the art. Such variant polypeptides can result from a codon change or from a nonsense mutation, or from any SNP that results in altered structure, function, activity, regulation, or expression of a protein.

[0057] It will be appreciated by a person of skill in the art that any numerical designations of nucleotides within a sequence are relative to the specific sequence. Also, the same positions may be assigned different numerical designations depending on the way in which the sequence is numbered and the sequence chosen. Furthermore, sequence variations such as insertions or deletions, may change the relative position and subsequently the numerical designations of particular nucleotides at and around a mutational site. For example, the sequences represented by

accession numbers AL390059.10, CH471131.2, L27416.1, L34020.1, Y07983.1, Z49154.1, Z49155.1, Z49769.1 and Z69837.1 all represent genomic human HTT nucleotide sequences; and AB016794.1, AB209506.1, AK025918.1, AK290544.1, BC014028.2, L12392.1, L20431.1 all represent human HTT mRNA nucleotide sequences. However, there may be some sequence differences, numbering differences between them, or sequence and numbering differences between them. Other sequences representing human HTT sequences, mutant or normal, may be identified by sequencing nucleic acid samples, or using any of the above sequences, or a fragment of any of the above sequences in a BLAST search of a sequence database comprising one or more HTT sequences (mutant or normal, full, partial or fragments thereof). BLAST may also be used to identify HTT sequences, or HTT-like sequences in other species e.g. mouse, rat, primate or the like.

[0058] In sequences described or referenced herein, a nucleotide represented by the symbol M may be either an A or C, a nucleotide represented by the symbol W may be either an T/U or A, a nucleotide represented by the symbol Y may be either an C or T/U, a nucleotide represented by the symbol S may be either an G or C, while a nucleotide represented by the symbol R may be either an G or A, and a nucleotide represented by the symbol K may be either an G or T/U. Similarly, a nucleotide represented by the symbol V may be either A or G or C, a nucleotide represented by the symbol B may be either G or C or T/U, a nucleotide represented by the symbol D may be either A or G or T/U, a nucleotide represented by either H may be either A or C or T/U, and a nucleotide represented by the symbol N may be an A or G or C or T/U, or unknown, or other.

[0059] Table 1 : Selected differentiating polymorphisms found in HTT

P = promoter of HTT gene

[0060] Differentiating polymorphisms may be found throughout the RNA, corresponding to the promoter, 5' UTR (untranslated region), intron, exon, 3' UTR, or outside of the gene (3' or 5' to the HTT gene sequence.

[0061] PCT Publication WO 2008/005562 to Aronin discloses some polymorphisms (six) that are also listed in Table 1 - these are indicated by a "+" following the RefSNP designation. Aronin also describes some polymorphisms that were sequenced in the initial set of 190 (Figure l) - rslO65745, rs2276881, rs362303, rs2237008, rs 363125.

[0062] Polymorphisms found in exons may also be present in the mature mRNA, while polymorphisms found in introns may be present in mature mRNA where an aberrant splicing event occurred, or in the hnRNA when it is first translated. Polymorphisms in the 5' and 3' UTR may also be present in the mature mRNA.

[0063] Sequences comprising HTT polymorphisms are provided in Tables 2 and 3, such sequence information is known in the art and available through, for example dbSNP, a database maintained by the National Centre for Biotechnology Information. Examples of such sequences are provided herein, however one of skill in the art will be able to obtain the sequence information using the RefSNP references and the dbSNP database, for example,

[0064] Table 2: Nucleic acid sequences comprising HTT polymorphisms of Table 1.

[0065] The sequences (SEQ ID NOs: 1-67) provided in Table 2 provide genomic DNA sequences comprising and flanking the polymorphisms, illustrated in a 5' to 3' orientation.

[0066] The sequences (SEQ ID NO: 139-206) provided in Table 3 provide genomic DNA sequences comprising and flanking the polymorphisms, and illustrating the opposite strand as is provided in Table 2. Table 3 provides the sequence with the major allele indicated; the corresponding sequence comprising the minor allele will be apparent to one of skill in the art upon consideration of the information provided in Table 3.

[0067] Table 3: Nucleic acid sequences comprising HTT polymorphisms of the opposite strand of the the sequences of Table 1. The major allele of the polymorphism is shown in capital letters.

SEQ ID SNP Major/ Sequence

NO: Internal minor

Ref# allele

139 1 C/T ttaggcagatactgagggtaagaaagtcctcggtaaggttttcttttcaaTgaaaagcag c ccccaagcattttcttttctaacaaagagcagcctgtaaa

140 2 C/T gtgagcagaaggatgactttgaatggaatgggagcagttcctagcttgaaCttccccttt a gcttcagtgatttgggggctcaaggtatgttcctttcaca

141 3 A/G cgcctcagcctcccgaaatgctgggattacaggcatgagccagcatgcccGgcctagtc tacatttttataaattgctaattcaaagttccctctccaaaa

142 11 A/G tgggttcaggtgatcctcccacatcagcctcccaagaactgggaactaacAgctgtttct c tgctgtccttctcaagaaaagggaggctactgctacccca

143 14 G/A tggaggaacttcaaagcagggaaggggatagggaaatgtcagggttaatcGagtgttaa cttatttttatttttaaaaaaattgttaagggctttccagca

144 17 G/A tggggcattgactgtaggtcagctttccttgcttgatctttctcactgggAtgaactagc agc accttcttttgtagctgctttgcttttgactatctttc

145 18 C/G gaatatattataggaagataacctggaaaagcctcagatatgtggaaaaaCccatttcca c atggcccatgggtcagaagtgaagtcaaaagggaaatttg

146 19 A/G ctgtctcaaaaacaaaaacagttactagaagaatggacatcataaagataGgagcagaa gtcagtaaaatagaaaacaaaaatacataggaaatcaataaa

147 21 C/T cacaagttttacgaagaccatctcagtccacttacatcaactgcccatgcCacggttaaa g agatcatcgactgatgtttggcacagcttcctccctcttg

148 22 G/A cttgagaagcccttctctaatgtggactttgtgccgttagcatcgttactAgcttgaagt tga ccatctggacgtactttctggtttagcctcacaagtga

149 24 A/G caaaatatccatttgtctgttacatgagttaaaaatatggttgttgcactGtgaatagtt tggtt tagtcaaaacagttgtatcttaacggattgagaaac

150 26 A/G ggcatttttccagagcagatttgttttcggcgtactagagtgactctttaAcctagctgc ggg aagatgactgtgccaagactgcaggtaggagaaagctc

151 29 A/G tgcctaagtaaatagtcatggttgcttacgtattatatttctttgattgtGtttcttatt tgatgag aaagctgtgttttttgctctgggttgaaactgga

152 31 C/G gatgtatgtggcgcctccaaagcccgagctcttcttggcgtctgtggcttCaataagctt gc tttttgctggtatccctcctaccctcccctgtccccagc

153 43 G/T tggaaaaattgtctcccatgaaaccagtctctggtgccagaaaggttgggTagcactgtg atatagtattaaaagtgctaataaatatggcatactgcctt

154 45 C/T atccttccagatcatataatgcttaagttctgattgttaatcataaagtcTagaaaatta aaag

ataataaaatgaaagtgacttttaggtattagagttt

155 65 T/C agtgttgatggcagatatgaacccttttgtttttgtaggaaaatgttaccCgtattctcc atttg aattcagtttagatttgttaggaatcgcagcttaag

156 71 T/C ttggctttttggaaaaatatctgatggaatacttgtttctgctatattagCtgtgtgaga ctagt gacaggagctgtgggaaatgaatgccaaatgttctt

157 76 A/G gctgtctcatctccagttcagcagaaccattgtcatatgccctagtaaaaGcattccttc att ggacacttaggccccaatactttcattcagatctacta

158 84 C/T gggtgttcccttacccacttgccactccccagtcactgggttcagtccttCctgcccacc a gcacatgctttctaggctctgtcctaggccgtcttctctc

159 86 A/G tgcctccagctgcaggcagccactaacctgccttctgtctctgtgactctAcgtcttctg ga cattactgtggatgggctcatacagtcagtgagcttgtg

160 88 T/C attagaaactaatgactgatgtacacagaccaccttttggtctgaagcatTtctaagtgc ca ctggctgacatgcagcccctacagcctccaggcttccag

161 89 A/G tttattgattttgggatgtgaacaatagaatcaacttctacttgtagattGatttaggga gaac ttatacctcagatgttaagtcaccctgtccagaatgt

162 90 G/A ttaaaggattttaaaaaaaacttaaagattatttcacatagctcttgcacAtttcttgat aaatg aatcctcaggtattcctctgtttttgttactaatag

163 92 A/G tcatatcatcttgaatttcagggcacctttccatgctcctagtgcttgctAtctgtttat tattttc cttcctgaataccctgaactccagcatgttctgc

164 96 T/C gagtagtttttgtatagctatctgaaaggaatttctttccaaaatattttTccagtgctg acaac aaacacgcagacacaccctgcaaggtgagtgtacgg

165 97 T/C aaggtcacgctggatcttcagaacagcacggaaaagtttggagggtttctCcgctcagcc ttggatgttctttctcagatactagagctggccacactgca

166 98 A/T taaaccactgtgcttaataagtagtttttagtggccagcagtctccatgtAtaacacatt ttag caaaatggaaaatactatatgttttaaatttgaacgt

167 103 A/G ggtacttgataacagtttattgaattaatgagtgaatgaacagatacataAatgcatgaa ag aatggttgtaatgtatataacttggatttcaagactttt

168 104 T/C ctgttggcataatcagctgggaggattgtggggtccagcgcagcacttttTggctcagtc c atgattgagccaagaggccatccttcccttcactccccag

169 109 G/A aattattaccataattgatcatctgcagtttcaagctatctaacaggttcActtacctct ttaaa aaggaatggaatttagcaggacagtaactgagaccc

170 112 T/C tgatatgtatcttaattttaaaagaaaggtctaaatggatgtttttgtttTtagggaatc agag gcaatcattccaaacatctttttcttcttggtattac

171 113 G/A ttttcatatacccactttgaacgttgtcagtggcagccatgtgcttctcaGgctctgcat gtgt gtctgtgtatgtgaaggtactggttagagacgtttca

172 117 G/A aatgttagccaaacagcaggtttgtccccgcagccttggcttgttgttgcAtagtgatgg ta gcttaaggtccttgtgaaaggtgggtggctggaatcagc

173 118 C/T gcctggcctattcatcactaatcagaatttctatgatcaaatgacatgaaTcattgtttc cac aactgcagtggaaggaaatggcctggcagtgccagttt

174 119 C/T gccttcttggagtgaagattttgttgggatgcgggtaaggggacagacaaTagaaaagc aagtgagtgaagtctataccatggcggctgatcaggaacacc

175 120 A/G agcagggccacccatgtgagacccggcactggagtggaatggcccaagtcAgcatcc cttggcagcatgaaagcaaaaccagcaaggtttgctggtggctt

176 121 A/G gcagaagcaacagggaggatcagttcatgacacaggagacacaaatcgccGttgtggt gttcacagacatgggttaggattggctgcatggatgacagagc

177 122 T/C gacgatgagatgattatgatgatttgcccttgagttacatagctggtgtaCaggaagctg tc gtttcttttggcttacgtagaaatgtttgtggtgtctaa

178 123 C/A gtatttaatctcctgtacagtaattaataggttaagagatggggacagtaCttcaacgct ag aagaacacagtgaagggaaacaaataaagaatttgccag

179 124 T/C tcctgcattatctatggctcttggttcatacctgtcttgaagttctgtcaTgttctgtct cttgtc

ctcagtagagatgctacagcagtggctcgcctcag

180 125 A/T tcagattgtcaccatgtgctggcagttttacacgctgtcagtaataaaagTcttctccct gca gggcagcctgcctccaataaatacgtgtagtatcaaat

181 127 C/T tgtacagttcacaaagcttaaaaaaatgctacctgccatttcatcctcagTgaggaaggt g atacacagagagaccaagtgactgtgtccacggcgacggc

182 128 C/T cagtgaggaaggtgatacacagagagaccaagtgactgtgtccacggcgaCggcgctc tgcatttcactttagcggttaatgtactctacctatattttta

183 130 A/G cttgcctttgtgggataagggtggtgtgttctgtgtccttctacatgtccGagcgatctc tgt gcagctcaaatgtggtcactgtcttattgcgctgattt

184 131 C/A tttttgtttcctgcttttcctcttgttgggagaggagggtattcatcccaAagtggtttg cctatt tcacattccatctaggataagcagaatagccaaga

185 139 G/A acctcttggaaatgttattttaccattcaaaaaggcttactaaggttctcGttatgggtg gcc ctctttttgcaaaaggttttcaggcttaagctccattt

186 140 A/T aaagagggcaggtgctgccgtgcctctctgctcagtatggatactggaccTtgtgctgcc agggctcccagtagggccagttcatggcactcagctggaaa

187 146 A/G cgactctccaactgaaagaggtgttatcctagagactttttctggtgatgAcaatttatt aat agtcactttttgctttactttctctattgaagtagttt

188 151 A/T aaactagggcctgcatttgtatcatgacctgtttgagtattgatgagaagAtagctgtga ag aaaaaggtttaaacaagtgtattttcctttaagaagcca

189 153 G/A atgttatcatctaagctccatggccaagacagaatggaagtcaaggttgcGtatttgccg t agacttcaacacagtgtcgtaatgcgtgacgtcaataact

190 157 C/T ggagcgtggtctcctccacagagtttgtgacccacgcctgctccctcatcTactgtgtgc a cttcatcctggaggccggtgagtccccgtccatgaacggt

191 161 G/C tgtaaaatgttgaataaaaagcactgatggaagtgtgtagaaattcttctCtttgttctg ttgt aattttagttgcagtgcagcctggagagcagcttctt

192 170 G/C gtggagagaagtcgggcttcctgcttcctcacagtatgtctgtcctgactCaactcggat g atgtcacttccttttcatcttctcaggtgtggaagcttgg

193 172 T/C ccatgagtagtacctggtttcatttttctaatgtcttgcagagattttatCaggcttctt gaagt gttcacgtacattacgctaacacgatattaataata

194 174 G/A agttgtgtggggatttgggatgcacgtttttcactcaaaagtattttagcGtagagctct gtg attccgtagctatttaggagtttaagcaccttgaaggc

195 177 T/C ggggccgttttgtcacagtgaccctgtgtttctagtcccaaatctgggtgCtatagtctc tttt tagcgtggtggttgtcttagtcttttttggctgctac

196 178 G/A gcacgctcaggagcagccacctgcccagcagggttggagccctgcacggcGtcctcta tgtgctggagtgcgacctgctggacgacactgccaagcagctc

197 179 G/A actgtgattccgacctcaccttatcttaaagctgctggacggcaggttctGtacacacgt gt ccttgacaaagcacggctggtgccgcaacccctcagcga

198 180 G/A tcaagagcatactcaggtggaccttgctccactgtttgaccagatgaggcAttctgaaca g ccaagcctgtgctggtctgttttcatgttgattttttttt

199 182 T/C gtgggagagactgtgaggcggcagctggggccggagcctttggaagtctgCgcccttg tgccctgcctccaccgagccagcttggtccctatgggcttccg

200 183 G/A ggtgaccaggtcctttctcctgatagtcacctgctggttgttgccaggttGcagctgctc ttg catctgggccagaagtcctccctcctgcaggctggctg

201 184 C/A ggtggggtgtgcatgccacgccccgtgtctggatgcacagatgccatggcCtgtgctgg gccagtggctgggggtgctagacacccggcaccattctccct

202 185 T/C cacagatgccatggcctgtgctgggccagtggctgggggtgctagacaccCggcacca ttctcccttctctcttttcttctcaggatttaaaatttaatta

203 187 C/A cggcagagctgccctcaacacagccttcctcttcctcatcggagagcacaCcctgtcccc ttgccgagctgtgccctgtgccttcggtggtatttgatttt

204 188 G/A gcaaggccccggacagaccgccagcctgtgaggtctccgctttcagttgcGttgatttga

ttttttctgagccttgaaggaggggtccggggcctggccct

205 189 T/C gctggcttgcgacgtgagggctgaggtgtgagcctgggtatcttcagaggTtcggtgga cacaggcagctgcccgcggccccactgttcccgtggcctcct

206 190 A/G aacacctgttcacatgcacagccctgttgagtgttctgggtgctggagatAtcatggtgg a tgacacaaaggccctggcctcttggagcttatgctcccat

[0068] A strand of a double-stranded DNA molecule (such as genomic DNA) is referred to as the "positive" strand or "positive sense" strand if the same RNA sequence (replacing T with U for RNA) is translatable into protein (e.g. for a coding region) or is on the same strand as sequence translatable into protein (e.g. for a non-coding region, such as may be found in an intron or exon).

[0069] The sequences provided in Table 2 and 4 may be useful to a person skilled in the art, to design further primers, probes or other oligonucleotides for identification of HTT polymorphisms as described herein, or for obtaining further sequence information flanking a polymorphism. Further, the sequences provided in Tables 2 and 4 may be useful to a person skilled in the art to design one or more nucleic acid silencing agents that specifically hybridize to a differentiating polymorphism found in the mHTT nucleic acid sequence. Such agents may comprise any one or more than one of SEQ ID NO: 1-67,139-206, , or fragment thereof, the agent comprising a specific polymorphism. For example, SEQ ID NO: 1 illustrates the genomic sequence flanking and including rs2857936, the actual genomic sequence obtained when sequencing this region would have either an A or a G in the 27 ^th position of SEQ ID NO: 1.

[0070] Examples of nucleic acid silencing agents that preferentially target a differentiating polymorphism are provided in Table 4, in a 5 '-3' orientation. Such agents may, under suitable conditions, hybridize with a complementary sequence, such as those exemplified in Table 2. Other agents comprising one or more than one of SEQ ID NOs: 68-134, 207-274, or 275-342, or fragments thereof, will also be apparent to those skilled in the art.

[0071] The sequences illustrated in Tables 2, 3 and 4 include a polymorphism. It will be apparent to one of skill in the art, upon consideration of the one or more polymorphism identified in the subject's sample, which is the appropriate nucleotide to include in the silencing agent comprising the polymorphism. For example, the polymorphism illustrated in SEQ ID NO: 1 is described as "R". As indicated, R may be a G or an A. If the subject's sample has a G at the polymorphic position, the nucleic acid silencing agent would comprise

a C at the equivalent position - SEQ ID NO: 68 is an sequence of an exemplary silencing agent, with a "Y" describing the polymorphism. As indicated, Y may be C or T. Thus Tables 2, 3 or 4, taken in combination with the information set out herein, provides one of skill in the art with sufficient information to select a useful sequence for a nucleic acid silencing agent that hybridizes to one allele of a differentiating polymorphism.

[0072] Table 4: Exemplary nucleic acid silencing agents for sequences comprising polymorphisms according to Table 1

[0073] It will be apparent that a nucleic acid silencing agent that is complementary to those illustrated may also be useful. When a DNA polymorphism, or a sequence flanking the DNA polymorphism, comprises thymine (T), it will also be apparent that an RNA sequence comprising the same polymorphism and/or flanking sequence may comprise a uracil (U) in place of the T.

[0074] As illustrated in Table 1, a subset of the polymorphisms are found in exonic sequences, including rs 363099, rs362272, rs362307, rs362304, rs363125, rs362306, rs362331. Sequences comprising these polymorphisms are found in Tables 2 and 3, and sequences that may be used in whole or in part for a nucleic acid silencing agent for these polymorphisms are illustrated in Tables 4 and 5.

[0075] Without wishing to be bound by theory, RNA transcripts (either mature mRNA or pre- mRNA) comprising a polymorphism listed in Table 1 that allows for differentiation between a normal and mutant allele of HTT may be targeted by an antisense nucleic acid targeting agent comprising a corresponding sequence as listed in Table 4, or a fragment thereof. Again, without wishing to be bound by theory, mature RNA transcripts (e.g. mRNA) comprising a polymorphism found in an exonic sequence (e.g. rs363099, rs362272, rs362307, rs362304, rs363125, rs362306, rs362331 ) may be targeted by an siRNA nucleic acid silencing agent, comprising a corresponding sequence as listed in Table 4, or a portion or fragment thereof.

[0076] ASO are examples of nucleic acid silencing agents according to some embodiments of the present invention. Generally, ASOs may be about 20 nucleotides, but may range from about 12 to about 25 nucleotides, or any length in between. For example, an ASO may be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length, with the proviso that the ASO selectively differentiate the nucleic acid molecules at the polymorphism. While Table 5 exemplifies ASOs for the major or minor allele that are 20 nucleotides in length, with the polymorphism at the centre, it is known that the position corresponding to the polymorphism may range away from the centre of the sequence, from about 1, 2, 3,4, 5,6, 7 or 8 nucleotides 5' or 3' to the position correpsponding to the polymorphism.

[0077] Table 5: Exemplary ASO for major and minor alleles of the polymorphisms illustrated in Table 3. The specific allele is indicated in upper case font.

Internal SNP Major allele Minor allele

SEQ ID NO: ASO SEQ ID NO: ASO reference #

1 207 gctgcttttcGttgaaaaga 275 gctgcttttcAttgaaaaga

2 208 taaaggggaaGttcaagcta 276 taaaggggaaAttcaagcta

3 209 tagactaggcCgggcatgct 277 tagactaggcTgggcatgct

11 210 gagaaacagcCgttagttcc 278 gagaaacagcTgttagttcc

14 211 agttaacactCgattaaccc 279 agttaacactTgattaaccc

17 212 tgctagttcaTcccagtgag 280 tgctagttcaCcccagtgag

18 213 gtggaaatggGtttttccac 281 gtggaaatggCtttttccac

19 214 acttctgctcCtatctttat 282 acttctgctcTtatctttat

21 215 ctttaaccgtGgcatgggca 283 ctttaaccgtAgcatgggca

22 216 aacttcaagcTagtaacgat 284 aacttcaagcCagtaacgat

24 217 aaactattcaCagtgcaaca 285 aaactattcaTagtgcaaca

26 218 cgcagctaggTtaaagagtc 286 cgcagctaggCtaaagagtc

29 219 aaataagaaaCacaatcaaa 287 aaataagaaaTacaatcaaa

31 220 caagcttattGaagccacag 288 caagcttattCaagccacag

221 tcacagtgctAcccaacctt 289 tcacagtgctCcccaacctt

222 ttaattttctAgactttatg 290 ttaattttctGgactttatg

223 tggagaatacGggtaacatt 291 tggagaatacAggtaacatt

224 gtctcacacaGctaatatag 292 gtctcacacaActaatatag

225 tgaaggaatgCttttactag 293 tgaaggaatgTttttactag

226 tggtgggcagGaaggactga 294 tggtgggcagAaaggactga

227 ccagaagacgTagagtcaca 295 ccagaagacgCagagtcaca

228 ggcacttagaAatgcttcag 296 ggcacttagaGatgcttcag

229 ctccctaaatCaatctacaa 297 ctccctaaatTaatctacaa

230 tatcaagaaaTgtgcaagag 298 tatcaagaaaCgtgcaagag

231 aataaacagaTagcaagcac 299 aataaacagaCagcaagcac

232 tcagcactggAaaaatattt 300 tcagcactggGaaaatattt

233 aggctgagcgGagaaaccct 301 aggctgagcgAagaaaccct

234 aaatgtgttaTacatggaga 302 aaatgtgttaAacatggaga

235 tttcatgcatTtatgtatct 303 tttcatgcatCtatgtatct

236 ggactgagccAaaaagtgct 304 ggactgagccGaaaagtgct

237 aagaggtaagTgaacctgtt 305 aagaggtaagCgaacctgtt

238 tgattccctaAaaacaaaaa 306 tgattccctaGaaacaaaaa

239 catgcagagcCtgagaagca 307 catgcagagcTtgagaagca

240 accatcactaTgcaacaaca 308 accatcactaCgcaacaaca

241 ggaaacaatgAttcatgtca 309 ggaaacaatgGttcatgtca

242 ttgcttttctAttgtctgtc 310 ttgcttttctGttgtctgtc

243 caagggatgcCgacttgggc 311 caagggatgcTgacttgggc

244 aacaccacaaCggcgatttg 312 aacaccacaaTggcgatttg

245 acagcttcctGtacaccagc 313 acagcttcctAtacaccagc

246 tagcgttgaaGtactgtccc 314 tagcgttgaaTtactgtccc

247 gagacagaacAtgacagaac 315 gagacagaacGtgacagaac

248 cagggagaagActtttatta 316 cagggagaagTcttttatta

249 caccttcctcActgaggatg 317 caccttcctcGctgaggatg

250 gcagagcgccGtcgccgtgg 318 gcagagcgccAtcgccgtgg

251 agagatcgctCggacatgta 319 agagatcgctTggacatgta

252 gcaaaccactGtgggatgaa 320 gcaaaccactTtgggatgaa

253 ccacccataaCgagaacctt 321 ccacccataaTgagaacctt

254 tggcagcacaAggtccagta 322 tggcagcacaTggtccagta

255 taataaattgTcatcaccag 323 taataaattgCcatcaccag

256 ttcacagctaTcttctcatc 324 ttcacagctaActtctcatc

257 acggcaaataCgcaaccttg 325 acggcaaataTgcaaccttg

258 tgcacacagtAgatgaggga 326 tgcacacagtGgatgaggga

259 acagaacaaaGagaagaatt 327 acagaacaaaCagaagaatt

260 catccgagttGagtcaggac 328 catccgagttCagtcaggac

261 caagaagcctGataaaatct 329 caagaagcctAataaaatct

262 cagagctctaCgctaaaata 330 cagagctctaTgctaaaata

263 agagactataGcacccagat 331 agagactataAcacccagat

264 acatagaggaCgccgtgcag 332 acatagaggaTgccgtgcag

265 cacgtgtgtaCagaacctgc 333 cacgtgtgtaTagaacctgc

266 ctgttcagaaTgcctcatct 334 ctgttcagaaCgcctcatct

267 gcacaagggcGcagacttcc 335 gcacaagggcAcagacttcc

268 agagcagctgCaacctggca 336 agagcagctgTaacctggca

269 gcccagcacaGgccatggca 337 gcccagcacaTgccatggca

270 gaatggtgccGggtgtctag 338 gaatggtgccAggtgtctag

187 271 aggggacaggGtgtgctctc 339 aggggacaggTtgtgctctc

188 272 atcaaatcaaCgcaactgaa 340 atcaaatcaaTgcaactgaa

189 273 tgtccaccgaAcctctgaag 341 tgtccaccgaGcctctgaag

190 274 tccaccatgaTatctccagc 342 tccaccatgaCatctccagc

[0078] The invention, therefore provides, for nucleic acids and nucleic acid silencing agents comprising one or more than one of SEQ ID NO:68-134, or one or more of SEQ ID NO: 207- 342, or portions or fragments thereof.

[0079] In some embodiments, the one or more nucleic acid silencing agents comprise one or more than one of SEQ ID NO: 207, 209, 210, 211, 213, 215, 216, 286, 219, 221, 222, 223,294,229, 223, 238, 242, 311, 249, 252, 256, 258, 259, 261, 263, 264, 265, 266, 267, 268, 270, 271, 274, 275, 277, 278, 335, 306 or 223.

[0080] A cell heterozygous for a differentiating polymorphism may be used to screen for nucleic acid silencing agents that preferentially target a differentiating polymorphism in an RNA encoding an mHTT protein.

[0081] Any cell comprising both an mHTT and a normal HTT expressed nucleic acid sequence may be useful for screening and identification of nucleic acid silencing agents. The cell may be a primary cell or cell line isolated from a subject affected with Huntington's disease, e.g. a lymphoblastic cell or cell line obtained from a sample of a living subject (the subject may be currently living, or may be deceased) (Gutekunst et al. 1995 Proc Natl Acad Sci U S A. Sep 12;92(19):8710-4. Primary cells or cell lines isolated from a subject may also be immortalized using standard transformation techniques.

[0082] A cell may be an immortalized cell or cell line, for example a HEK293 cell, that expresses both a mHTT and normal HTTThe mHTT and normal HTT nucleic acids may be provided to the cell by stable or transient transfection or transformation methods, as are known in the art. The mHTT and/or normal HTT may be constitutively expressed, or may be conditionally expressed. Expression of the mHTT and/or normal HTT may be suppressed by inclusion of a drug or other reagent in the culture medium that downregulates expression. An example of a system that allows for induction or suppression of expression in this manner is the "Tet-On/Off system (Bujard et al 1992. Proceedings of the National Academy of Sciences 89:5547-5551). Other examples of conditional expression systems include Cre (e.g. US 4959317), and FLP-FRT recombination. Other systems that allow for inducible or conditional expression, and their

suitability for use with a cell line or screening method will be within the knowledge of a skilled worker.

[0083] The cell may be contacted with one or more than one candidate nucleic acid silencing agents (e.g. those listed in Table 4 or 5, or others that may be designed comprising one or more of the sequences of Table 4 or 5, or a fragment thereof). Following contact, the cell may be assayed for the expression of HTT and mHTT protein, mRNA or protein and mRNA. For example, RT-PCR may be used to examine the level of HTT and mHTT mRNA. Primers flanking the expanded CAG tract may be useful to distinguish between the two amplification products obtained from the HTT and mHTT mRNA (Graham et al 2005. Neurobiology of Disease 21(2):444-55). An example of primer sequences useful for this purpose is 5'GAAAGTCAGTCCGGGTAGAACTTC 3' (SEQ ID NO: 137) and 5' CAGATACCCGCTCCATAGCAA (SEQ ID NO: 138) 3". Alternately, or in addition, cells contacted with candidate nucleic acid silencing agents may be screened using anti HTT antibodies and immunologic techniques (e.g. Western blotting, ELISA and the like). If, following contact of the cell with an agent, the level of mHTT protein and/or mRNA is decreased in the cell, the agent may be said to 'preferentially target' the allele found on the mutation-containing chromosome.

[0084] "Contacting" a cell with an agent according to some embodiments of the invention includes, without limitation, any and all methods of delivery of an agent to a cell. For example, an agent may be provided in a delivery vehicle and the cell induced to phagocytose the vehicle comprising the agent, the agent may be provided in a solution or suspension of culture medium or buffer, the culture medium or buffer combined with the cells.

[0085] Therefore, the invention provides for a method of screening for a nucleic acid silencing agent targeting a differentiating polymorphism in RNA encoding an mHTT protein in a subject, comprising providing a cell heterozygous for a differentiating polymorphism in a nucleic acid sequence encoding huntingtin (HTT); contacting the cell with one or more candidate nucleic acid silencing agents targeting the differentiating polymorphism; assaying the cell for HTT and mHTT RNA, protein or RNA and protein expression; and determining the one or more nucleic acid silencing agents from the candidate nucleic acid silencing agents.

[0086] Not all polymorphisms may be found in all subjects, and not all subjects may be heterozygous for any given polymorphism. In order to use a nucleic acid silencing agent to

reduce expression of a mutant allele of HTT in a cell or a subject, according to some embodiments of the invention, suitable polymorphisms will need to be identified. If allele- specifϊc silencing is to be performed in a cell or cell line, the heterozygous polymorphism may already be known (e.g. if the cell has been genetically altered to express a particular allele, or if it has been previously characterized). The complement of allelic polymorphisms in a subject may not be as well-known, and therefore, before providing a nucleic acid silencing agent to a subject, it may be preferable to determine not only the identity of the heterozygous allele, but also its chromosomal association. If the subject is a transgenic or otherwise genetically modified animal, the heterozygous polymorphism may be known.

[0087] The term "subject" or "patient" generally refers to mammals and other animals including humans and other primates, companion animals, zoo, and farm animals, including, but not limited to, cats, dogs, rodents, rats, mice, hamsters, rabbits, horses, cows, sheep, pigs, goats, poultry, etc. A subject includes one who is to be tested, or has been tested for prediction, assessment or diagnosis of allograft rejection. The subject may have been previously assessed or diagnosed using other methods, such as those described herein or those in current clinical practice, or may be selected as part of a general population (a control subject). A subject may be a transgenic animal, e.g. a rodent, such as a mouse, that comprises a normal or mutant allele of nucleic acid sequence of interest. For example, the subject may a transgenic mouse comprising a wild-type or mutant form of HTT.

[0088] A subject at risk for Huntingdon's disease may be tested for the CAG expansion. A sample is obtained from the subject and the size of the CAG tract (number of repeats) is determined by any suitable method. Molecular diagnosis of an expanded CAG tract is necessary for the described allele specific knockdown. Laboratory guidelines for Huntington disease genetic testing (Anonymous. ACMG/ASHG statement. The American College of Medical Genetics/ American Society of Human Genetics Huntington Disease Genetic Testing Working Group. Am J Hum Genet 1998; 62:1243-7) indicate that 26 or fewer CAG repeats are considered 'normal'; 27-35 CAG repeats are considered a mutable normal allele; and 36 or greater CAG repeats are considered a disease-causing allele. A subject receiving a molecular diagnosis of 36 or greater CAG repeats may be a suitable subject for screening for differentiating polymorphisms and treatment with one or more than one nucleic acid silencing agents.

[0089] Identification of polymorphisms in a subject may be performed by any of several methods familiar in the art. In addition to identification of the differentiating polymorphisms, their affiliation with the mHTT allele will also need to be determined - the sequence of the nucleic acid silencing agent will need to preferentially target the polymorphic allele of the mHTT RNA, relative to the normal HTT RNA.

[0090] For example, once a subject has had a confirmed molecular diagnosis of Huntington's disease, the subject may be screened for some or all of the polymorphisms listed in Table 1. A sample comprising nucleic acid is obtained from the subject; any of several methods that identify a polymorphism may be used to identify differentiating polymorphisms in the subject's nucleic acid sample. Following identification of that subject's complement of differentiating polymorphisms (e.g. a subset of the screened polymorphisms), the identification of the specific polymorphism present on the mutant chromosome is determined (chromosome phasing). Genotypes from other family members (usually a 'trio' within the pedigree - e.g. mother, father and child, but may include any immediate family members) are used to 'phase' the alleles and determine which SNP allele is being inherited on the chromosome also carrying the HD mutation. Phasing may be determined empirically from the genotyping of the trios. Alternatively, or in addition, phasing may be deduced by collecting lymphblasts or other primary cells from the subject in question and testing agents for the selective silencing of the mutant allele as described.

[0091] Following determination of the phasing of the one or more than one differentiating polymorphisms, one or more than one nucleic acid silencing agents may be synthesized. The nucleic acid silencing agents may be subsequently tested on a cell comprising one or more of the same polymorphisms identified in the subject, to determine the magnitude of reduction of expression for each agent alone or in combination with another agent, or to determine an effective amount of the agent.

[0092] Alternately, an effective amount of the agent may be administered to the subject without prior testing of magnitude of reduction of expression.

[0093] As an illustrative example, a subject having received a molecular diagnosis of an expanded CAG tract is subsequently screened, and a polymorphism corresponding to rs362272 (Internal SNP reference #178) is found. Two relatives (e.g. both parents) are also tested for this allele, to determine which specific nucleotide of the polymorphism is present on the mutant and

normal chromosomes. As an example, the mutant chromosome is found to have the G allele, and the normal chromosome is found to have the A allele. A nucleic acid silencing agent comprising the polymorphism and some or all of SEQ ID NO: 78, and having a C in the position equivalent to the 33 ^rd nucleotide of SEQ ID NO: 78 is synthesized. As SNP #178 is found in an exon, an siRNA agent may be suitable. An example of one strand of such an siRNA agent is shown (in a 5'-3' orientation) in SEQ ID NO: 135:

SEQ ID NO: 135 ACAUAGAGGACGCCGUGCAGGG.

[0094] If desired, the siRNA agent may be tested on a cell comprising the same polymorphism as present in the subject, e.g. to test the magnitude of reduction of expression, or to provide an estimate of dosing, or the like, before administering to the subject. Following administration of the agent either as a single dose, or in a series of doses, the subject may be tested for levels of HTT and mHTT protein.

[0095] As another illustrative example, a subject having received a molecular diagnosis of an expanded CAG tract is subsequently screened, and a polymorphism corresponding to rs6855981 (Internal SNP reference #84) is found. Two relatives (e.g. both parents) are also tested for this allele, to determine which specific nucleotide of the polymorphism is present on the mutant and normal chromosomes. As an example, the mutant chromosome is found to have the C allele, and the normal chromosome is found to have the T allele. A nucleic acid silencing agent comprising the polymorphism and some or all of SEQ ID NO: 134, and having a G in the position equivalent to the 32 ^rd nucleotide of SEQ ID NO: 134 is synthesized. As SNP #178 is found in an intron, an antisense agent may be suitable. An example of one strand of such an antisense agent is shown (in a 5 '-3' orientation) in SEQ ID NO: 136:

SEQ ID NO: 136:

CUAGAAAGCAUGUGCUGGUGGGCAGGAAGGACUGAACCCAGUGACUGGGGAG

[0096] If desired, the antisense agent may be tested on a cell comprising the same polymorphism as present in the subject, e.g. to test the magnitude of reduction of expression, or to provide an estimate of dosing, or the like, before administering to the subject. Following administration of the agent either as a single dose, or in a series of doses, the subject may be tested for levels of HTT and mHTT protein

[0097] The invention, therefore, provides for a method of selecting a nucleic acid silencing agent targeting a differentiating polymorphism in RNA encoding an mHTT protein of a subject, comprising: obtaining a nucleic acid sample from the subject; identifying one or more differentiating polymorphisms in the nucleic acid sample; selecting a nucleic acid silencing agent comprising a sequence that preferentially targets the differentiating polymorphism in the RNA encoding an mHTT protein.

[0098] The invention also provides for a method of reducing expression of an mHTT protein in a subject, comprising obtaining a nucleic acid sample from the subject, identifying one or more than one differentiating polymorphism in the nucleic acid sample, selecting one or more than one nucleic acid silencing agents comprising a sequence that preferentially targets the one or more than one differentiating polymorphism in the RNA of the subject encoding the mHTT protein and administering to the subject an effective amount of the one or more than one nucleic acid silencing agent.

[0099] A "sample" may be any organ, tissue, cell, or cell extract isolated from a subject, such as a sample isolated from a subject having HD, or at risk for HD or with a family history of HD or having one of the risk factors for HD, or the like. A sample may include, without limitation, tissue (e.g., from a biopsy or autopsy), cells, blood, serum, milk, urine, stool, saliva, feces, mammalian cell culture or culture medium, or any other specimen, or any extract thereof, obtained from a patient (human or animal), subject, or experimental animal. A sample may also include, without limitation, products produced in cell culture by normal or transformed cells

(e.g., via recombinant DNA or monoclonal antibody technology). A sample may also be a cell or cell line created under experimental conditions, that are not directly isolated from a subject. A sample can also be cell-free, artificially derived or synthesized. A "control" includes a sample or standard obtained for use in determining the baseline e.g., expression or activity or occurrence. Accordingly, a control may be obtained by a number of means including from non-HD cells or tissue e.g., from a subject not having HD; from a subject not suspected of being at risk for HD; or from cells or cell lines derived from such subjects, or extracts thereof. A control may also be a standard, e.g., previously established standard. Accordingly, any test or assay conducted according to the invention may be compared with the standard and it may not be necessary to obtain a control sample for comparison each time.

[00100] Tables 1 and 2 list candidate polymorphisms. The genomic nucleic acid of a subject may comprise one or more candidate polymorphisms as a heterozygous allele.

[00101] Identification of polymorphisms

[00102] SNPs can be assayed using techniques such as TaqMan assays, molecular beacon assays, nucleic acid arrays, allele-specific primer extension, allele-specific PCR, arrayed primer extension, homogeneous primer extension assays, restriction fragment length polymorphism, direct sequencing, single strand conformational polymorphism (SSCP), denaturing gradient gel electrophoresis, etc.

[00103] Probes or primers may be used to detect SNPs - such probes and primers need not contain a SNP but may be directed to, for example, flanking sequences such that, when used together with amplification techniques, e.g., primer extension techniques, they generate a SNP- containing amplified nucleic acid molecule. SNPs can be assayed using allele-specific hybridization probes or primers. SNP allele-specific probes or primers may be used in pairs that are identical except for a single mismatch representing the allelic variant at the SNP position. For techniques that rely on hybridization, the stringency should be high enough to distinguish between the SNP alleles, but not so high that no hybridization occurs. In general, the high stringency conditions described herein are suitable.

[00104] Probes or primers may be attached to a solid support, e.g., bead or microarray, or may be provided in solution, e.g., with a buffer or enzyme. An array refers to an ordered arrangement of two or more nucleic acid molecules, polypeptides or proteins on a substrate. A substrate may be any rigid or semi-rigid support to which the two or more nucleic acid molecules, polypeptides or proteins may be attached. In some embodiments, a substrate may be a liquid medium. Substrates include membranes, filters, chips, slides, wafers, fibers, beads, gels, capillaries, plates, polymers, and microparticles and the like.

[00105] High density nucleic acid or polypeptide arrays are also referred to as

"microarrays," and may for example be used to monitor the presence or level of expression of a large number of genes or polypeptides or for detecting SNPs and variants. Arrays and microarrays generally require a solid support (for example, nylon, glass, ceramic, plastic, silica, aluminosilicates, borosilicates, metal oxides such as aluminum and nickel oxide, various clays, nitrocellulose, etc.) to which the nucleic acid molecules or polypeptides are attached in a

specified 2-dimensional arrangement, such that the pattern of hybridization or binding to a probe is easily determinable. In some embodiments, at least one of the nucleic acid molecules or polypeptides is a control, standard, or reference molecule, such as a housekeeping gene or portion thereof that may assist in the normalization of expression levels or assist in the determining of nucleic acid quality and binding characteristics; reagent quality and effectiveness; hybridization success; analysis thresholds and success, etc.

[00106] Polypeptide variants encoded by a SNP-containing molecule may be identified by for example antibodies capable of specifically binding to the variant polypeptide but not to the wild type polypeptide.

[00107] Detection of a SNP or polypeptide variant associated with an HD mutant allele may be combined with traditional methods of diagnosis and analysis known in the art.

[00108] Statistical analyses such as those described herein or known in the art may be carried out to determine the level of significance of the results. The particular method by which a differentiating polymorphism is identified is not important, only that it is identified.

[00109] Once a differentiating polymorphism is identified, software tools may be useful to aid in design of nucleic acid silencing agents. Such software tools may consider melting temperature (Tm), G/C content of the sequence surrounding the polymorphism, length, nature of the polymorphism (purine/pyrimidine), and the like. Algorithms that employ some of these sequence-based characteristics include that of Reynolds et al (Nature Biotechnology 22:326-33), OligoCalculator, Cenix Biosciences (Echeverri et al., Ambion TechNotes 11(3)

URL:www.ambion.com/techlib/tn/l 13/14.html) and the like. Examples of software tools include, but are not limited to, SDS (siRNA Design Software) (URL: www.i.cs.hku.hk/~sirna/software/sirna.php), siRNA DNA designer 1.5 (URL: www.irisgenetics.com/siRNAdesigner.htm) . Use and knowledge of other software tools that may be useful for design of the nucleic acid silencing agents as described herein will be within the knowledge of a skilled worker.

[00110] A fragment or portion of a nucleic acid sequence includes a nucleic acid sequence comprising a subset of the nucleotide complement of a designated nucleic acid sequence. The fragment may, for example, comprise an intronic region, and exonic region, a coding region, a non-coding region, a 5' untranslated region, a 3' untranslated region, or the like. In some

embodiments of the invention, the fragment may comprise a sequence encoding a region or domain common to proteins of the same general family. In some embodiments of the invention, the fragment may include sufficient nucleic acid sequence amino acid sequence to specifically identify the sequence from which it is derived, e.g. a gene.

[00111] A nucleic acid sequence, or fragment or portion of a nucleic acid sequence may range in size from as small as 5-10 nucleotides, to almost the "full-length" of the nucleic acid sequence from which it is derived. For example, a fragment or portion may be from about 0.001% to 0.1%, from about 0.1% to about 1%, from about 1% to about 10%, from about 10% to about 20%, from about 20% to about 30%, from about 30% to about 40% , from about 40% to about 50%, from about 50% to about 60%, from about 60% to about 70%, from about 70% to about 80%, from about 80% to about 90% or from about 90% to about 100% of the full-length nucleic acid sequence. Alternately, a fragment or portion may be from about 4 to about 10 nucleotides, or any amount therebetween; from 10 to about 50 nucleotides, or any amount therebetween; from about 50 to about 100 nucleotides, or any amount therebetween; from about 100 to about 150 nucleotides, or any amount therebetween; from about 150 to about 250 nucleotides or any amount therebetween; from about 250 to about 500 nucleotides or any amount therebetween. Alternately, a fragment or portion may be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides long.

[001 12] Sequence identity or sequence similarity may be determined using a nucleotide sequence comparison program, such as that provided within DNASIS (for example, using, but not limited to, the following parameters: GAP penalty 5, #of top diagonals 5, fixed GAP penalty 10, k-tuple 2, floating gap 10, and window size 5). However, other methods for alignment of sequences for comparison are well-known in the art for example the algorithms of Smith & Waterman (1981, Adv. Appl. Math. 2:482), Needleman & Wunsch (J. MoI. Biol. 48:443, 1970), Pearson & Lipman (1988, Proc. Nat'l. Acad. Sci. USA 85:2444), and by computerized implementations of these algorithms (e.g. GAP, BESTFIT, FASTA, and BLAST - Altschul et al. 1009. J. MoI Biol 215:403-410), or by manual alignment and visual inspection.

[001 13] A nucleic acid sequence, or fragment or portion of a nucleic acid sequence may be specifically identified when its sequence may be differentiated from others found in the same phylogenetic Species, Genus, Family or Order. Such differentiation may be identified by

comparison of sequences. A BLAST search allows for comparison of a query sequence with a specific sequence or group of sequences, or with a larger library or database (e.g. GenBank) of sequences, and identify not only sequences that exhibit 100% identity, but also those with lesser degrees of identity.

[00114] In some embodiments of the invention, a subset of the polymorphisms shown in

Tables 1 and 2 may be preferred for use in screening a subject for differentiating polymorphisms. As an example, a subject may be screened for the presence and identity of one or more polymorphisms described herein as internal reference number 1, 3, 11, 14, 22, 55, 63, 65, 69, 80, 89, 95, 97, 112, 119, 169, 176, 178, 181, 182, 185 and 190. In another embodiment, the one or more polymorphisms may be selected from the group comprising 14, 22, 63, 80, 89, 97, 112, 1 19, 178, 182 and 190. As illustrated in Figures 7 and 8, in yet other embodiments of the invention, a subject may be screened for the presence and identity of 1, 2, 3 or 4 polymorphisms, to provide for maximum coverage of the population being tested, with a minimum of sites.

[00115] Polymorphism #182, is one of group shown to be significantly associated with disease chromosomes (comprising the mHTT sequence). Two alleles are found at this position - nucleotides C or T. Data from 65 HD-affected subjects is shown in Figure 2A, and a significantly different allele distribution is observed in the disease chromosome compared to the control chromosome. Looking at Figure 3 A, the distribution shows that haplogroup A (an average of 44 CAG repeats) demonstrates variability (T or C) at position 182, while haplogroups B and C are predominantly a C at this position. When haplogroup A is broken down in to subgroups (Figure 4A, B), it can be seen that the frequency of the Al allele T occurs in -55% of the chromosomes, while the ~44% of subgroups A2-A5 are the C allele.

[00116] As is illustrated in Figure 7, polymorphism 182 may be useful differentiating polymorphism. A nucleic acids silencing agent (e.g. an ASO) that specifically hybridizes with the "T" allele may be useful as a therapeutic agent for a subject with HD and exhibiting this polymorphism. For an HD patient, the data provided herein illustrates that >50% of the time, an HD subject is heterozygous at SNP 182, (using the internal reference numbers of Table 1) and the 'T' allele found on the disease chromosome. In a subject not heterozygous at SNPl 82, or if the 'T' allele is not associated with the disease chromosome, then SNPl 82 would not be suitable for treatment (as it would not differentiate between the disease and normal gene product or transcript), and an alternate target site would be selected, (e.g. An ASO that targets the T

polymorphism if provided to a subject homozygous for the T allele would be expected to hybridize equally to both the transcript of the disease chromosome and that of the normal chromosome - this may be detrimental, in that the normal HTT protein may be reduced or not produced. Therefore, genotyping of an HD affected subject provides important information for selection of one or more suitable ASO.

[00117] As illustrated in Figure 7, the inventors have identified several polymorphisms that are predominantly associated with the disease chromosome, thus it may not be necessary to genotype an HD patient for all polymorphisms that may be found within the HD gene sequence and surrounding region. A subset of 8 polymorphisms individually demonstrate >40% coverage of the subject population. When two polymorphisms are combined, 12 different combinations may each provide >60% coverage. In other words, 60% of HD patients could be treated with one of the two SNP targets in this 2 SNP panel. 22 different combinations of 3 polymorphisms provide >80% coverage, and 17 sets of 4 different polymorphisms provide >85% coverage.

[00118] Design of nucleic acid silencing agents

[00119] General methods of chemical and enzymatic synthesis of nucleic acid molecules comprising a variety of bases and intemucleoside linkages are known, as are methods comprising a combination of chemical and enzymatic syntheses. The selection of a particular method of synthesis may not be critical, and a skilled worker will be able to select an expedient method of synthesizing one or more nucleic acid silencing agents as is desired. Such methods are generally described in the art - see, for example, Cobb AJ 2007. Org. Biomol Chem 5:3620-75; Gait MJ 1991. Curr.Opin Biotechnol 2:61-8. (both of which are herein incorporated by reference). As an example, synthesis reagents are available from several suppliers e.g. Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL , USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Additionally, some commercial sources offer synthesis services for siRNA reagents e.g. Dharmacon, Qiagen, Genset Oligos, Glen Research, Xeragon, Proligo, Ambion and the like.

[00120] Methods for synthesizing oligonucleotides for individual use or as part of an insoluble support (e.g. array) are also known: Bernfield et al., 1967. J. Biol. Chem. 242(18):4134-43; Sulston et al 1968 PNAS 60(2):409-415; Gillam et al., 1975. Nucleic Acid Res. 2(5):613-624; Bonora et al., 1990. Nucleic Acid Res. 18(1 1):3155-9; Laskkari et al 1995.

PNAS 92(17):7912-5; McGaIl et al 1996. PNAS 93(24): 13555-60; Albert et al, 2003. Nucleic Acid Res. 31(7):e35; Gao et al 2004. Biopolymers 73(5):579-96; and Moorcroft et al 2005. Nucleic Acid Res. 33(8):e75.

[00121 ] Selection of the nucleotide complement of the agent will generally be dependent on the sequence surrounding the differentiating polymorphism, but may be varied to enhance hybridization, improve cell-penetrating or nucleus-penetrating properties, prevent undesired cross-hybridization, or otherwise improve the selectivity of the agent for the differentiating polymorphism. Pei et al (Nature Methods 2006 3:670-6) discusses methods and considerations that may be useful. For example, 3' end structures of the agent may comprise a TT or UU terminal dinucleotide. The agent may comprise a G/C content in the range of about 30-50%, but this may be decreased, or increased to achieve the desired selectivity of the agent. The nucleotide complement may be selected to accommodate, or avoid including, a series of identical or similar nucleotides adjacent to each other - e.g. a plurality of purines or pyrimidines in sequence.

[00122] Use of an siRNA expression vector to generate an agent may necessitate the design of a sequence within the vector comprising a pair of inverted repeats separated by a short spacer or 'hairpin loop' sequence. An RNA transcript produced from such a sequence may subsequently fold to form a short hairpin structure, which may be subsequently cleaved to remove the single-stranded loop, providing the paired sense/antisense siRNA structure. Selection of target sequence, length of the inverted repeats that encode the stem of the 'hairpin' structure, nucleotide composition and order of the spacer sequence and the presence or absence of 5' overhangs may be varied, depending on the nature of the polymorphism and the surrounding sequence, desired selectivity and nature of the nucleotides and/or internucleoside linkages. See, for example of methods, vector design and like; Elbashir et al., EMBO J. 2001 20:6877-6888); Sui et al., 2002. Proc. Natl. Acad. Sci. US A 99(8): 5515-5520; Lee et al., 2002. Nature Biotechnology 20 : 500-505; Yu et al., 2002. Proc. Natl. Acad. Sci. USA 99(9) : 6047- 6052; Paul et al., 2002. Nature Biotechnology 20 : 505-508; Brummelkamp et al., 2002. Science 296 : 550-553; Jacque et al., 2002. Nature 418 : 435-438; Miyagishi et al., 2002. Nature Biotechnology 20 : 497-500; Paddison et al., 2002. Genes Devel. 16: 948-958.

[00123] Examples of expression vectors suitable for use with the present application include but are not limited to the standard transient expression vectors, adenoviruses,

retroviruses, lentivirus-based vectors, as well as other traditional expression vectors. Any vector that has an adequate siRNA expression and procession module may be used.

[00124] Therapeutic regimens

[00125] Therapeutic regimens for Huntington's disease may include administration of one or more nucleic acid silencing agent by itself, or in combination with another treatment.

Examples of treatments that may be combined with admininstration of the one or more nucleic acid silencing agent may include but are not limited to, antidepressants, antipsychotics, sedatives, nutrition therapy, administration of some fatty acids, or other pharmaceutical or reparative therapy. Some examples of pharmaceutical therapies for Huntington's disease may include neuroprotective agents, for example minocycline, lamotrigine, creatine, remacemide (alone or in combination with Coenzyme Q), riluzole, LAX- 101, and the like. Reparative therapeutic approaches, such as transplantation with primary cells or tissue may include neural grafts, embryonic or fetal tissue transplants, and the like. Some extant therapeutic regimens, and experimental therapeutic regimens are described by Handley et al 2006. Clinical Science 110:73- 88.

[00126] An "effective amount" of a nucleic acid silencing agent refers to the amount of agent required to reduce the expression of an mHTT nucleic acid or mHTT protein. The effective amount may be calculated on a mass/mass basis (e.g. micrograms or milligrams per kilogram of subject), or may be calculated on a mass/volume basis (e.g. concentration, micrograms or milligrams per milliliter). An effective amount may be extrapolated based on animal testing, or from experimental results obtained using cultured cells. A skilled worker will have familiarity with other expressions of mass, volume and/or concentration that may be suitable.

[00127] For example, compositions comprising one or more agents according to various embodiments of the invention, may be provided as one or more doses, expressed as a mass/volume unit. The dose may comprise from about 0.1 ug/ml to about 20 mg/ml, or any amount therebetween, for example 0.1, 0.5, 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160 180, 200, 250, 500, 750, 1000, 1500, 2000, 5000, 10000, 20000 ug/ml, or any amount therebetween; or from about 1 ug/ml to about 2000 ug/ml, or any amount therebetween, for example 1.0, 2.0, 5.0, 10.0, 15.0, 20.0, 25.0, 30.0, 35.0, 40.0, 50.0 60.0, 70.0, 80.0, 90.0, 100, 120, 140, 160 180, 200, 250, 500, 750, 1000, 1500, 2000, ug/ml or any amount therebetween; or

from about lOug/ml to about 1000ug/ml or any amount therebetween, for example 10.0, 15.0, 20.0, 25.0, 30.0, 35.0, 40.0, 50.0 60.0, 70.0, 80.0, 90.0, 100, 120, 140, 160 180, 200, 250, 500, 750, 1000 ug/ml, or any amount therebetween; or from about 30ug/ml to about lOOOug/ml or any amount therebetween, for example 30.0, 35.0, 40.0, 50.0 60.0, 70.0, 80.0, 90.0, 100, 120, 140, 160 180, 200, 250, 500, 750, 1000 ug/ml.

[00128] As another example, compositions comprising one or more agents according to various embodiments of the invention, may be provided as one or more doses, expressed a mass/mass unit. The dose may comprise from about 0.1 ug/kg to about 20mg/kg (based on the mass of the subject), for example 0.1, 0.5, 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160 180, 200, 250, 500, 750, 1000, 1500, 2000, 5000, 10000, 20000 ug/kg, or any amount therebetween; or from about lug/kg to about 2000ug/kg or any amount therebetween, for example 1.0, 2.0, 5.0, 10.0, 15.0, 20.0, 25.0, 30.0, 35.0, 40.0, 50.0 60.0, 70.0, 80.0, 90.0, 100, 120, 140, 160 180, 200, 250, 500, 750, 1000, 1500, 2000 ug/kg, or any amount therebetween; or from about lOug/kg to about lOOOug/kg or any amount therebetween, for example 10.0, 15.0, 20.0, 25.0, 30.0, 35.0, 40.0, 50.0 60.0, 70.0, 80.0, 90.0, 100, 120, 140, 160 180, 200, 250, 500, 750, 1000 ug/kg, or any amount therebetween; or from about 30ug/kg to about 1000ug/kg or any amount therebetween, for example 30.0, 35.0, 40.0, 50.0 60.0, 70.0, 80.0, 90.0, 100, 120, 140, 160 180, 200, 250, 500, 750, 1000 ug/kg.

[00129] One of skill in the art will be readily able to interconvert the units as necessary, given the mass of the subject, the concentration of the adjuvant composition, individual components or combinations thereof, or volume of the adjuvant composition, individual components or combinations thereof, into a format suitable for the desired application.

[00130] The amount of a nucleic acid silencing agent administered, where it is administered, the method of administration and the timeframe over which it is administered may all contribute to the observed effect of the agent. As an example, a composition comprising an agent may be administered systemically e.g. intravenous administration and have a toxic or undesirable effect, while the same composition administered subcutaneously may not yield the same undesirable effect.

[00131] Compositions comprising one or more than one agents according to various embodiments of the invention may be formulated with any of a variety of pharmaceutically acceptable excipients, frequently in an aqueous vehicle such as Water for Injection, Ringer's

lactate, isotonic saline or the like. Pharmaceutically acceptable excipients may include, but are not limited to, for example, salts, buffers, antioxidants, complexing agents, tonicity agents, cryoprotectants, lyoprotectants, suspending agents, emulsifying agents, antimicrobial agents, preservatives, chelating agents, binding agents, surfactants, wetting agents, anti-adherents agents, disintegrants, coatings, glidants, deflocculating agents, anti-nucleating agents, surfactants, stabilizing agents, non-aqueous vehicles such as fixed oils, or polymers for sustained or controlled release. See, for example, Berge et al. (1977. J. Pharm Sci. 66:1-19). Other examples of such excipients may be generally described in Remington- The Science and Practice of Pharmacy, 21 ^st edition. Gennaro et al editors. Lippincott Williams & Wilkins Philadelphia (both of which are herein incorporated by reference).

[00132] Compositions comprising one or more than one agents according to various embodiments of the invention may be administered by any of several routes, including, for example, subcutaneous injection, intraperitoneal injection, intramuscular injection, intravenous injection, epidermal or transdermal administration, mucosal membrane administration, orally, nasally, rectally, or vaginally. Targeting of the compositions to the tissues of the central nervous system may involve delivery to the CSF and brain by intrathecal, intracerebroventricular or intraparenchymal administration. Carrier formulations may be selected or modified according to the route of administration . As a general reference, see, for example, Remington- The Science and Practice of Pharmacy, 21 ^st edition. Gennaro et al editors. Lippincott Williams & Wilkins Philadelphia.

[00133] Compositions comprising one or more than one agents according to various embodiments of the invention may be provided in a unit dosage form, or in a bulk form suitable for formulation or dilution at the point of use.

[00134] Compositions comprising one or more than one agents according to various embodiments of the invention may be administered to a subject in a single-dose, or in several doses administered over time. Dosage schedules may be dependent on, for example, the subject's condition, age, gender, weight, route of administration, formulation, or general health. Dosage schedules may be calculated from measurements of adsorption, distribution, metabolism, excretion and toxicity in a subject, or may be extrapolated from measurements on an experimental animal, such as a rat or mouse, for use in a human subject. Optimization of dosage and treatment regimens are will be within the scope of knowledge of one of skilled in the art, as

exemplified in Goodman & Gilman's The Pharmacological Basis of Therapeutics 11 ^th edition. 2006. LL Brunton, editor. McGraw-Hill, New York.

[00135] In the context of the present invention, the terms "treatment" , "treating",

"therapeutic use," or "treatment regimen" as used herein may be used interchangeably are meant to encompass prophylactic, palliative, and therapeutic modalities of administration of the compositions of the present invention, and include any and all uses of the presently claimed compounds that remedy, alleviate or reduce in severity one or more symptoms or pathologies associated with Huntingdon's disease, or which prevents, hinders, retards, or reverses the progression of symptoms, signs, conditions, or disorders associated therewith. Thus, any prevention, amelioration, alleviation, reversal, or complete elimination of an undesirable disease state, symptom, condition, sign, or disorder associated with Huntington's disease, is encompassed by the present invention. A treatment may comprise administration of an effective amount of a composition comprising one or more than one agent as described herein.

[00136] The delivery of nucleic acid silencing agents of the invention may be facilitated by a delivery vehicle or vector. For example, a short cationic peptide (Jones et al 2005. British Journal of Pharmacology 145:1093-1102) that facilitates cellular uptake ("cell penetrating peptides") may be covalently linked to one or more nucleic acid silencing agents, or covalently linked to a vehicle comprising one or more nucleic acid silencing agents. As another example, a nucleic acid silencing agent may be complexed with a carrier, including but not limited to, liposomes, nanoparticulate carrier (Torchilin, VP. March 31,2008. Biopolymers), virosome, magnetic beads, microbeads, charged polymers, or virus-like particles. A sequence encoding a nucleic acid silencing agent may be contained in a vector, and the vector delivered to a cell or administered to a subject; alternately such a vector may be complexed with a liposome, nanoparticulate carrier, virosome, virus-like particle, etc as described above. Agents may also be delivered to a cell by transfection, nucleofection, electroporation, biolistic methods (e.g. 'gene gun'), magnetofection, or other nucleic acid delivery methods (see, for example Bonetta et al 2005. Nature Methods 2:875-883). Reagents and instructions for their use are available from commercial suppliers e.g. OLIGOFECT AMINE™ Reagent (Invitrogen), TransIT-TKO™ transfection reagent (Minis), jetSI™ (Polyplus-transfection SAS), Silencer™ siRNA Transfection Kit (Ambion), FuGENE 6 (Roche) and silMPORTER™ (Upstate). Use and knowledge of other reagents, kits and the like that may be used for delivery of the nucleic acid silencing agents as described herein will be within the knowledge of a skilled worker.

[00137] Kits

[00138] The invention also provides for a kit for use in identification of one or more than one of a subject's differentiating polymorphisms in a normal and mHTT allele. The kit may comprise reagents for specific and quantitative detection of one or more than one of the differentiating polymorphisms as indicated in SEQ ID NO: 1-67, along with instructions for the use of such reagents and methods for analyzing the resulting data. The kit may include, for example, one or more than one labelled oligonucleotides capable of selectively hybridizing to one or more of the differentiating polymorphisms as indicated in SEQ ID NO: 1-67. The kit may further include, for example, an oligonucleotide operable to amplify a region of the marker (e.g. by PCR). Instructions or other information useful to combine the kit results with those of other assays the prediction or diagnosis of Huntington's disease in a subject may also be provided. The kit may further include tubes for blood collection, buffers and the like, along with instructions for their use.

[00139] The kit may further comprise one or more nucleic acid silencing agents such as those described herein, for selectively hybridizing to a differentiating polymorphism.

[00140] Embodiments of the invention are illustrated, in part, by the following non- limiting examples:

Example 1: Identification of target SNPs

[00141] SNPs were identified using preliminary sequencing of the Hapmap cohort,and information available from the dbSNP database maintained by the National Centre for

Biotechnology Information (Sherry et al. Nucleic Acids Res. 2001 Jan l;29(l):308-l 1 URL: ncbi.nlm.nih.gov/projects/SNP/). Sequence data at the 190 SNP positions (Figure 1) was obtained from sequencing of the Hapmap population (Gibbs et al., 2003. Nature 426 789- 796(URL: hapmap.org/) conducted at the McGill/Genome Quebec Innovation Centre. Nucleic acid samples from 65 Huntington's disease-affected subjects were genotyped for these SNPs, each subject having a mutant and normal chromosome. Phasing of the polymorphisms (which allele is associated with the normal and mutant chromosomes) in the 65 HD subjects was established using genotyping information obtained from mother-father-child trios, or was computed using statistical algorithms using software such as PHASEv2.1 (Marchini J et al 2006. American Journal of Human Genetics 8(3):437-50), or a combination of both methods.

Phylogenetic and Linkage Analysis Phylogenetic analysis of genotypes was performed using the Mega3 software 34. Each individual from the Hapmap cohort was compared based on sequence similarity at the 190 SNP positions to construct a neighbour-joining tree rooted on the chimpanzee sequence. Linkage disequilibrium (LD) analysis was performed using Haploview software

[00142] Haplogroups Individual haplotypes were combined into haplogroups using specific tSNPs to define the groupings. Haplogroup A was defined using tSNPs that had allele distributions that were significantly associated with disease chromosomes (chi-square disease vs control) and had high sensitivity (>0.95). Haplogroup B and C were defined manually to classify the remaining haplotypes. The remaining unclassified haplotypes were singleton or rare haplotypes were put into an 'other' haplogroup but are not necessarily related to each other. Analysis of the haplogroup variants was performed only on chromosomes that were defined as haplogroup A. Variants A1-A4 were defined and distinguished from each other using the remaining tSNPs not used in the definition of haplogroup A.

[00143] Statistics The association of SNPs to specific alleles was performed using chi- square, odds ratio, sensitivity, specificity, and positive/negative predictive values. [Ad = disease- associated allele; An = non disease]. Odds ratio is the fold increase of having the disease if the specific allele is present ((Ad/Ancase) / (Ad/ An )). Sensitivity is a measure of how well a SNP allele correctly identifies the disease state (proportion of cases with the disease-associated allele (Ad/ Ad+ An case)). Specificity is a measure of how well a SNP allele correctly identifies the control state (An/ Ad+ An control). Positive predicted value (PPV) is the proportion of subjects with the disease-associated allele who have the disease (Ad case / Ad case + Ad control). Negative predicted value (NPV) is the proportion of subjects who do not have the disease- associated allele and do not have the disease (An control / An case + An control). When indicated, a student's t-test was performed for comparison between two groups One-way ANOVA performed for more than 2 groups with Tukey's post-hoc comparison.

[00144] SNPs that are in linkage disequilibrium co-segregate as haplotypes. A subset of

SNPs may therefore be sampled and the haplotype inferred. Haplotypes were established and tagging SNPS (tSNPs) representing each haplotype were identified using this information (Tagger software; de Bakker ett al., 2006. Pac. Symp. Bicomput: 476-486. 22 non-redundant tSNPs were found sufficient to assess the genetic diversity in the region The HD patient and

control populations were genotyped at each of the 22 tSNP loci using the SNPstream platform (Bell et al., 2002. Biotechniques Suppl:70-77). The tSNPs are listed in Table 6.

[00145] Table 6. Tagging SNPs (tSNPs)

Example 2: Identification differentiating polymorphisms - target SNPs

[00146] Candidate target SNPs were identified by comparison of the frequency distribution, by chi-square and odds ratio, in CAG-expanded chromosomes vs control chromosomes within the 65 HD patient cohort. Target-candidate tSNPs were selected based on the selective enrichment of one allele on CAG-expanded alleles (as evidenced by an Odd ratio (OR) >3) (Table 7) and a degree of high heterozygosity in HD patients (Table 8). tSNPs with a significant p-value (alpha=0.00025 after bonnferroni correction) are observed for tSNPS 1, 11, 14, 22, 65, 89, 97, 119, 178, 182 and 190; indicating that the distribution of the alleles are significantly different between the mutant and wild-type HD chromosomes. The phased allelic analysis of the 65 HD patients is also shown in Table 8. Additional SNPs exhibiting a correlation (r ² <0.5) with the tSNPs were also identified as targets. A total of 67 SNPs were

therefore considered as target SNPs due to strong linkage disequilibrium with CAG expansion in the studied population of HD patients (Table 1).

[00147] Table 7: Allelelic analysis of tagging SNPs (tSNPs) in the HD gene region in 65 HD patients. tSNP is identified by number. Allele is either A/B (major/minor) sorted for highest risk. The observed allele counts (total of 65 for each) for the HD chromosome (mutant CAG size) and control (wildtype CAG size) are indicated. Odds ratio (OR) is the fold increase of having the disease if the specific allele is present. P-value is indicated from chi-test comparing the count distribution between the HD allele vs Control allele. Significant p- values (*) indicates that the distribution of the alleles are significantly different between HD and control chromosomes (alpha = 0.00025 after bonferroni correction). Sensitivity is a measure of how well a SNP allele correctly identifies the disease state. Specificity is a measure of how well a SNP allele correctly identifies the control state. Positive predicted value (PPV) is the proportion of patients with the specific risk allele who have CAG expansion in the HD gene. Negative predicted value (NPV) is the proportion of patients who do not have the specific risk allele and do not have CAG expansion. Odds ratio (OR) or equal to or greater than 3 and significant p-values are the best indication of disease association.

[00148] Table 8: SNP heterozygosity in 65 HD patients and provides candidate targets for the selective knockdown of CAG -expanded alleles. Heterozygosity is required for selective targeting of the polyglutamine-expanded allele at any one SNP position. The count of each genotype (AA, AB or BB) and heterozygosity (Het. = frequency of AB) is indicated (top) at each tSNP position. Phased alleles on the CAG-expanded chromosomes and minor allele frequency (MAF) for each of the 65 HD patients is also shown (middle). Target quality is [heterozygosity]/[minor allele frequency] and provides a relative estimate of the suitability of the major allele for targeting (higher number is a better knockdown target).

[00149] Example 3: SNP frequency distribution on HD chromosomes. Using the patterns of linkage disequilibrium in the 190 validated SNPs, a panel of 22 non redundant tagging SNPS (tSNPs) was designed to efficiently assess genotypes and construct haplotypes in the HTT gene region. In order to determine which genotypes came from each chromosome within each individual, chromosomes were phased by CAG-tract size. This allowed grouping of chromosomes by CAG-tract size, and comparison of genotypes between the groups. HD patients (n=65) of European ancestry were genotyped at the 22 tSNP positions. Genotype information for disease chromosomes (>35 CAG) and control chromosomes (<36 CAG) from these HD patients is shown in Figure 2A. Allele counts for the major (A) and minor (B) alleles are given at each of the 22 tSNP positions.

[00150] HD chromosomes demonstrated a dramatically different allele distribution compared to control chromosomes. Of the 22 tSNPs, over half (12 SNPs) were significantly associated with disease chromosomes (p <0.0023, chi-square test; alpha = 0.0023 after

bonferroni correction). For example, at tSNP # 11 , the allele distribution on the control chromosome (A-32, B-33) is significantly different compared to the disease chromosome (A-I, B-64) (p = 1.7x10 ¹⁰ , chi-square). This significant association is matched with an extremely high odds ratio (OR=66) at this and other SNP positions. In addition to many tSNPs being significantly associated with disease chromosomes, some tSNPs have a single allele that is a highly sensitive marker of disease chromosomes (Figure 2). Sensitivity is a measure of how frequently a specific allele occurs on a disease chromosome and for 19 tSNPs the sensitivity is >0.85. It is important to note that not all significantly associated SNPs are highly sensitive markers of disease chromosomes. For example, tSNP #11 is a highly sensitive marker of disease chromosomes (64/65 = 0.98) while tSNP #182 is less so (34/65 = 0.52). tSNP #182 is however, a specific marker (specificity 0.94) due to its low minor allele frequency on general population chromosomes.

[00151] This data was confirmed in a replication cohort of 203 HD patients. The same tSNPs were significantly associated with the disease chromosome. Surprisingly, some tSNPs are not associated with disease chromosomes, even in the combined cohort of 268 HD patients. For example, at tSNP #63 the allele distributions between disease (A-29, B-239) and control (A- 14, B-254) chromosomes remain similar despite the fact that surrounding tSNPs have extremely strong associations. The incomplete allelic association and variable marker sensitivity is therefore not consistent with a simple single founder hypothesis for the origin of HD chromosomes. This unusual pattern across the gene region would require an unlikely series of recombination events or significantly different mutation rates at different SNP positions.

[00152] Example 4: SNP frequency distribution on 27-35 CAG chromosomes.

Individuals with increased CAG tract size (27-35 CAG) relative to the general population are not at risk for developing the signs and symptoms of HD. However, children of parents with 27-35 CAG may be at risk for inheriting a CAG-allele that has expanded in the disease ranges. In total, 66 chromosomes in the 27-35 CAG range were phased and compared to 116 control chromosomes from the general population (<27 CAG) at each of the 22 tSNP positions (Figure 2B). The frequency of alleles on 27-35 CAG chromosomes was significantly different from control chromosomes at 11 tSNP positions (p<0.0023, chi-square test). The odds of these specific tSNPs being associated with CAG-expansion is high (odds ratio >3). Notably, these 11 out of 12 tSNP positions are also significantly associated with HD chromosomes. Many tSNPs are also sensitive markers of 27-35 CAG chromosomes. Eighteen tSNPs have a sensitivity ratio

>0.85. Notably, these are 18 out of 19 tSNP positions were also sensitive markers of disease chromosomes. Furthermore, similar to HD chromosomes, not all tSNPs with significant associations have a single allele that is a sensitive marker of 27-35 CAG. Again, tSNP #182 is significantly associated with 27-35 CAG chromosomes (p=1.7xlθ ^~ ° ⁷ , chi-square) but not a sensitive marker (30/66 = 0.45). Control chromosomes all had similar allele frequency distributions, regardless of the source of the control chromosome. There were also no significant differences in the allele frequencies (p>0.0023, chi-square test) on control chromosomes (<27 CAG) whether they came from the general population or the control chromosome (lower CAG) from HD patients or control chromosomes of 27- 35 CAG carriers. The allele frequencies on 27- 35 CAG chromosomes were not significantly different at any tSNP positions (p>0.0023, chi- square test) from HD chromosomes (Figure 2C). Taken together, this data suggests that as a group, 27-35 CAG chromosomes and HD chromosomes are genotypically similar across the HTT gene region.

[00153] Example 5: Haplogroup frequencies on CAG-expanded chromosomes

Haplogroups were defined manually using tSNPs that are significantly associated (p<0.0023) and are highly sensitive markers (>0.95) of disease chromosomes (Figure 3A). Three major haplogroups, A, B and C could be used to describe >96% of all chromosomes in our study cohort of HD patients, 27-35 CAG individuals, and controls from the general population. A neighbour- joining phylogeny demonstrates that haplogroup A and B are much more closely related than either are to haplogroup C (Figure 3A). The 'other' haplogroup comprised singletons that could not be easily classified into the defined haplogroups and total only 4% of the chromosomes.

[00154] HD chromosomes are almost exclusively (95%) haplogroup A (Figure 3B). In contrast, haplogroup A accounts for only 53% of chromosomes from the general population (<27 CAG). Haplogroup C was also very common on control chromosomes (41%) but completely absent from disease chromosomes. Similar to the HD chromosomes, 27-35 CAG chromosomes are enriched (83%) for haplogroup A relative to controls. It is also notable that each individual from the general population (<27 CAG) could be phased for high CAG and low CAG within the normal range, the higher CAG (mean CAG=19.8+2.7) chromosome was also statistically enriched (p=0.041, chi-square) for haplogroup A (62%) relative to the low CAG (mean CAG=I 7.3+2.1) chromosome (43%).

[00155] The CAG sizes for all chromosomes from 10-50 CAG containing haplogroup A or

C are plotted in Figure 3C. For the chromosomes used in this study, the mean CAG size for haplogroup A (33.9+11.7) is significantly (p<0.00001, t-test) greater than haplogroup C (18.9+5.9). Although haplogroup A and C are both found on control chromosomes (<27 CAG), haplogroup A is uniquely enriched on chromosomes with an expanded CAG-tract. Even when considering only control chromosomes (<27 CAG), the mean CAG of haplogroup A (18.8+3.0) has a small but significant increase (p<0.00001, t-test) compared to haplogroup C (mean= 17.5+2.3). The odds ratio of haplogroup A is 8.4, meaning that CAG chromosomes >26 CAG are 8.4 fold more likely to occur on haplogroup A than any other haplogroup.

[00156] Example 6:Variants of Haplogroup A on CAG-expanded chromosomes

Haplogroup A is present on almost all CAG-expanded chromosomes but only -50% of control chromosomes. To determine whether there were differences between haplogroup A when found on disease and control chromosomes, haplogroup A was subdivided into variants by subtracting the core elements that define haplogroup A, and assessing the tSNPs that remain. Since haplogroup A was defined by 10 tSNPs (3, 11, 14, 22, 65, 89, 97, 119, 169, and 178) the haplogroup variants are defined by tSNPs at the remaining positions (tSNP 1, 55, 63, 69, 80, 95, 1 12, 176, 181, 182, 185 and 190). Haplogroup variants A1-A5 capture 98% of all haplogroup A chromosomes (Figure 4A). The remaining 2% of haplogroup A chromosomes were classified as 'other', as they were singletons difficult to classify into variant groupings.

[00157] Of all of the HD chromosomes on haplogroup A, the majority (55%) can be classified as variant Al (Figure 4A). Chromosomes with 27-35 CAG are also enriched for variant Al (53%). In contrast, variant A4 and A5 are almost absent from expanded CAG chromosomes. Control chromosomes from the general population (<27 CAG) have a more even mixture of variants A1-A5. It is notable that in the general population (<27 CAG), variant Al occurs more than 3 times more frequently on chromosomes with high-normal CAG vs low- normal CAG (Figure 4B).

[00158] The distribution of CAG sizes for all chromosomes carrying each haplogroup A variant is plotted in Figure 4C. Variant Al occurs on chromosomes that range from 12 to 50 CAG, with the distribution shifted towards CAG-expansion (mean CAG=38.8+9.5). Variant A2 also occurs on a range of CAG sizes extending from low normal (CAG 15) to high expanded (CAG 49) with an upward shift in mean CAG size (35+11). Variant A3 has a bimodal

distribution around normal and CAG expanded chromosomes (mean CAG+28 12). Variant A4 (mean CAG=20+8) and A5 (mean CAG=I 7+5) are predominantly found on chromosomes with <27 CAG. The mean CAG is significantly different in all variants, with the exception of A4 vs A5 (p<0.001, one way anova, tukey posthoc).

[00159] Variant Al confers the greatest odds ratio of CAG-expansion (ie chromosomes with variant Al are 6.4 times more likely to carry a CAG-expansion). Variant A2 chromosomes are almost equally likely to carry a normal or expanded CAG (odds ratio 1.1). Variant A3 is almost twice as likely to contain a normal CAG vs expanded (odds ratio 0.5), whereas variant A4 and A5 are unlikely to carry a CAG-expansion (odds ratio is close to 0). Taken together, these data suggest that there is an enrichment of specific haplotype variants on CAG-expanded chromosomes. Variant Al and A2 confer the highest risk for having a CAG-expanded chromosome, while A4 and A5 variants are extensively protected from CAG expansion.

[00160] Example 7: Haplogroups in the HapMap cohort Using the same haplogroup definitions (Figure 3 and 4), the frequency of haplogroups in each ethnic group (CEU, ASI, YOR) is shown in Figure 5. Interestingly, the frequency of haplogroup A is similar in Europe (46%), China (44%) and Japan (49%), even though the prevalence of HD in Asian populations is reported to be much lower than in Europe. However, further analysis reveals that the Chinese and Japanese general population cohorts lack the presence of variants Al and A2, the two variants with the highest odds ratio for CAG expanded chromosomes. They also have a very high frequency of A5, a variant that is protected from CAG expansion. The Yoruba population also has a very high proportion of 'other' haplogroups, composed of non-matching haplotypes, which reflects the greater genetic diversity in this population. The frequency of the haplogroup A variants appears to be significantly associated with differences in HD prevalence. Risk haplogroup variants for CAG-expansion (Al and A2) are absent and protected haplogroup variants (A4 and A5) are much more frequent in ethnic populations with a low prevalence of HD.

[00161 ] Example 8 Identiffication of target SNPs and target SNP panels for allele specific silencing of mutant htt: To facilitate allele-specific gene silencing technologies for HD patients it may be useful to maximize coverage of the HD population with a minimal number of allele targets for silencing (e.g. select an allele, or set of alleles that are found in the majority of the population).

[00162] Sets 1-59 comprising from 1-4 SNP targets with multiple SNP combinations are illustrated in Figure 7. Percent 'coverage' is defined as the percent of the population of known genotypes that would be eligible for treatment. Seven of the 65 HD patients were not heterozygous at any SNP position, and therefore the maximum theoretical coverage is 89% (58/65). The maximum coverage by any single SNP was 52% (tSNP 182). As illustrated in Figure 6, panels that included 4 or 5 target SNPs only provided a small increase the coverage compared to the 3 SNP panel, which targeted all but 3% of the theoretically targetable HD patients in the cohort.

[00163] An HD patient may be assessed for differentiating polymorphisms correspoinding to one or more SNPs using one or more of the sets illustrated in Figure 7. For each SNP (identified using the internal reference numbers provided in Table 1), the allele of the differentiaitng polymorphism is shown - about 52% of the HD population tested would be expected to have the T allele at this site. For the balance of the HD population, another set or sets of SNPs would need to be genotyped. Use of set # 43 for example, would identify at leat one differentiating polymorphism in 88% of the HD population tested. Other differentiating polymorphisms may also be identified by assssing the genotype of more, or alternate SNPs.

[00164] In addition to the tSNP targets reported here, further SNPs in linkage disequilibrium with these SNPs may also serve as useful targets, providing further flexibility to the selection of nucleic acid silencing agents that may be used.

[00165] Example 9: Nucleic acid silencing agents for selected differentiating polymorphisms. Once a differentiating polymorphism is identified, either by assessing for one or more of the sets of polymorphisms of Figure 7, or other polymorphisms disclosed herein, a silencing agent may be selected for administration to the subject. As described herein, some polymorphisms are predominantly, or exclusively one allele on the HD affected chromosome, with the other allele found predominantly, or exclusively on the normal chromosome.

[00166] Table 9 provides target alleles for selected differentiating polymorphisms (SNPs).

An ASO corresponding to one or more target alleles found in the subject may be administered to the subject to decrease or reduce expression of mHTT protein in the cells of the subject.

[00167] In some examples, a cell comprising the differentiating polymorphism may be contacted with an effective amount of the ASO and the level of mHTT protein expressed by the

cell, relative to a control cell not contacted with the ASO. For example, to target rs3852673 (also known as internal reference 14) which has a G in the differentiating polymorphism ("14G") an ASO comprising a nucleotide sequence according to SEQ ID:211 would be used.

[00168] Table 9: target alleles for exemplary differentiating polymorphisms, rs number -

RefSNP designation as per the dbSNP database, maintained by the National Center for Biotechnology Information (NCBI).

[00169] All citations are herein incorporated by reference.

[00170] One or more currently preferred embodiments have been described by way of example. It will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims.