60/078,972, filed on March 23,1998. The 60/078,972 provisional patent application is herein incorporated by this reference in its entirety.

BACKGROUND OF INVENTION Field of the Invention This invention generally relates to genes, nucleic acids, and diagnostic methods regarding nucleic acids encoding human uncoupling protein 2 variants and human uncoupling protein 3, UCP2 and UCP3, respectively.

Background Art Obesity is a highly genetically determined condition (4) that results from an imbalance of caloric intake and energy expenditure (19). Energy expenditure in mammals is predominantly determined by the basal metabolic rate (24) as a consequence of non-shivering thermogenesis. In small mammals, an important mechanism for non-shivering thermogenesis occurs in brown adipose tissue and involves uncoupling protein 1 (UCP1) The UCP1 gene has been mapped to chromosome 4q31 and is comprised of sic coding exons (1). UCPI functions to dissipate the electrochemical gradient established by the electron transport system during mitochondrial respiration (24). The result is an uncoupling of respiration from oxidative phosphorylation and ATP synthesis that causes stored fuel to be converted into heat (32). In adult humans, there is little or no brown fat, and non-shivering thermogenesis occurs through an unknown mechanism primarily in skeletal muscle, which does not express UCP1.

Recently, two additional mitochondrial uncoupling proteins, UCP2 (15,2) and UCP3 (11,3), have been identified (31,15). Both genes are localized on chromosome

11 (1 lql3) within 75-150 kb of each other based on their co-localization on PI and BAC clones (26). Both UCP2 and UCP3 genes consist of six coding exons, each containing a putative transmembrane spanning region, and at least one upstream non- coding exon (11,31). UCP2 mRNA is expressed in a number of adult tissues including heart, placenta, lung, kidney, pancreas, and leukocytes, but is highest in skeletal muscle (15,2). UCP3 mRNA expression is limited to skeletal and cardiac muscle and white adipose tissue (11,26,3). UCP3 encodes two forms of transcripts, the full length message designated UCPL and UCPS that truncates the sixth coding exon via use of an alternative polyadenylation site (26). UCP3 also shows high amino acid similarities with UCP1 and UCP2 (57% and 73%, respectively) (11). Thus, UCP2 and UCP3 have play an important role in non-shivering thermogenesis and in the pathogenesis of obesity. These genes also contribute to Type II Diabetes Mellitus since obesity markedly enhances the risk for progressive glucose intolerance and/or insulin resistance (1,2,3,17).

The present invention overcomes previous limitations in the art by providing methods and compositions for determining gene variants of human UCP2 and UCP3 and for identifying a subject who is at risk of developing a UCP2 or UCP3 variant- related afflictions, such as obesity and Type II Diabetes Mellitus.

SUMMARY OF INVENTION The present invention provides a method for identifying a subject having a risk of developing obesity, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 2 from the subject, wherein the presence of the SNP is correlated with obesity, thereby identifying the subject as having a risk of developing obesity.

The present invention also provides a method for identifying a subject having a risk of developing diabetes, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 2 from the

subject, wherein the presence of the SNP is correlated with diabetes, thereby identifying the subject as having a risk of developing diabetes.

The present invention also provides a method for identifying a subject having a risk of developing obesity, comprising detecting the presence of an amino acid polymorphism in an uncoupling protein 2 from the subject, wherein the presence of the amino acid polymorphism is correlated with obesity, thereby identifying the subject as having a risk of developing obesity.

The present invention also provides a method for identifying a subject having a risk of developing diabetes, comprising detecting the presence of an amino acid polymorphism in an uncoupling protein 2 from the subject, wherein the presence of the amino acid polymorphism is correlated with diabetes, thereby identifying the subject as having a risk of developing diabetes.

The present invention also provides a method for identifying a subject having a risk of developing obesity, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 3 from the subject, wherein the presence of the SNP is correlated with obesity, thereby identifying the subject as having a risk of developing obesity.

The present invention also provides a method for identifying a subject having a risk of developing diabetes, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 3 from the subject, wherein the presence of the SNP is correlated with diabetes, thereby identifying the subject as having a risk of developing diabetes.

The present invention also provides a method for identifying a subject having a risk of developing obesity, comprising detecting the presence of an amino acid polymorphism in an uncoupling protein 3 from the subj ect, wherein the presence of the

amino acid polymorphism is correlated with obesity, thereby identifying the subject as having a risk of developing obesity.

The present invention also provides a method for identifying a subject having a risk of developing diabetes, comprising detecting the presence of an amino acid polymorphism in an uncoupling protein 3 from the subject, wherein the presence of the amino acid polymorphism is correlated with diabetes, thereby identifying the subject as having a risk of developing diabetes.

The present invention also provides a method for identifying a subject having a risk of developing obesity, comprising contacting a sample from the subject with an antibody to an antigen of an altered UCP2 protein, detecting the binding of the antibody with the antigen, wherein binding of antigen to the antibody indicates the presence of the altered UCP2 in the sample and wherein the presence of the altered UCP2 in the sample indicates a risk for developing obesity, thereby identifying a subject having a risk of developing obesity.

The present invention also provides a method for identifying a subject having a risk of developing diabetes, comprising contacting a sample from the subject with an antibody to an antigen of an altered UCP2 protein, detecting the binding of the antibody with the antigen, wherein binding of antigen to the antibody indicates the presence of the altered UCP2 in the sample and wherein the presence of the altered UCP2 in the sample indicates a risk for developing diabetes, thereby identifying a subject having a risk of developing diabetes.

The present invention also provides a method for identifying a subject having a risk of developing obesity, comprising contacting a sample from the subject with an antibody to an antigen of an altered UCP3 protein, detecting the binding of the antibody with the antigen, wherein binding of antigen to the antibody indicates the presence of the altered UCP3 in the sample and wherein the presence of the altered UCP3 in the sample indicates the risk for developing obesity, thereby identifying a subject having a risk of developing obesity.

The present invention also provides a method for identifying a subject having a risk of developing diabetes, comprising contacting a sample from the subject with an antibody to an antigen of an altered UCP3 protein, detecting the binding of the antibody with the antigen, wherein binding of antigen to the antibody indicates the presence of the altered UCP3 in the sample and wherein the presence of the altered UCP3 in the sample indicates a risk for developing diabetes, thereby identifying a subject having a risk of developing diabetes.

The present invention also provides a method for identifying an allele correlated with obesity, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 2 from a subject, wherein the presence of the SNP is correlated with obesity, thereby identifying the allele correlated with obesity.

The present invention also provides a method for identifying an allele correlated with diabetes, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 2 from a subject, wherein the presence of the SNP is correlated with diabetes, thereby identifying the allele correlated with diabetes.

The present invention also provides a method for identifying an allele correlated with obesity, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 3 from a subject, wherein the presence of the SNP is correlated with obesity, thereby identifying the allele correlated with obesity.

The present invention also provides a method for identifying an allele correlated with diabetes, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 3 from a subject, wherein the presence of the SNP is correlated with diabetes, thereby identifying the allele correlated with diabetes.

The present invention also provides nucleic acids, proteins, and antibodies related to the UCP2 and UCP3 variants disclosed herein.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic representation of the exon-intron structure of the Human Uncoupling Protein 2 Gene (UCP2). The sizes of the 6 coding exons and 5 intervening exons are indicated drawn to scale, together with the number of amino acids encoded by each exon below. The interrupted distance between the non-coding exon and the first coding exon represents an estimated 3kb. The figure assumes one non-coding exon, although genomic sequences were not determined 5'of nucleotide-171 based on cDNA nucleotide numbering (accession number U94592) and indicated by small arrow beneath the non-coding exon.

Figure 2 illustrates the association between Type II diabetes status and UCP2 genotype in Caucasians and African Americans. Panels A and B shows the percentage of diabetic individuals in the designated genotype categories are for Caucasians and African Americans, respectively. The homozygote CC genotype shows a significantly higher percentage of diabetics in Caucasians and the TT genotype shows a trend toward a higher percentage of diabetics in the African-American population. RR indicates Relative Risk.

Figure 3 demonstrates the association between Body Mass Index (BMI) and UCP2 genotype in Caucasian Females. Panel A shows mean s. e. m. for body mass index in Caucasian categorized according to designated UCP2 genotypes. The homozygote TT individuals are significantly less obese than the other genotypes. Panel B compares the mean values between homozygote TT individuals and all other subjects. P-values, shown above bars, indicate statistical significance for comparison with TT genotype.

Figure 4 illustrates the association between Percent Body Fat (PBF) and UCP2 <BR> <BR> <BR> genotype in African-Americans. Panel A shows mean s. e. m. for percent body fat in

African Americans categorized according to designated UCP2 genotypes. Panel B compares the mean values between homozygote CC individuals and all other subjects.

P-values indicate statistical significance for comparison with CC genotype.

Figure 5 shows the association between Type II diabetes status and UCP2 genotype in Caucasians and African Americans. Panels A and B demonstrate the percentage of diabetic individuals in the designated genotype categories for Caucasians and African Americans, respectively. Homozygote CC genotype shows a significantly higher percentage of diabetics in Caucasians and the TT genotype shows a trend toward a higher percentage of diabetics in the African-American population. RR indicates Relative Risk.

Figure 6 demonstrates the association between BMI and UCP2 genotype in Caucasian females. Panel A shows mean s. e. rn. for body mass index in Caucasian categorized according to designated UCP2 genotypes. The homozygote TT individuals are significantly less obese than the other genotypes. Panel B compares the mean values between homozygote TT individuals and all other subjects. P-values indicate statistical significance for comparison with TT genotype.

Figure 7 illustrates the Association between PBF and UCP2 genotype in African-Americans. Panel A shows mean s. e. m. for percent body fat in African Americans categorized according to designated UCP2 genotypes. Panel B compares the mean values between homozygote CC individuals and all other subjects. P-values indicate statistical significance for comparison with CC genotype.

DETAILED DESCRIPTION OF THE INVENTION Before the present compounds and methods are disclosed and described, it is to be understood that this invention is not limited to specific proteins, specific methods, or specific nucleic acids, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

It must be noted that, as used in the specification and the appended claims, the singular forms"a,""an,"and"the"include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to"a nucleic acid"includes multiple copies of the nucleic acid and can also include more than one particular species of molecule.

This invention provides a method for identifying a subject having a risk of developing obesity and/or diabetes, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 2 (UCP2) and uncoupling protein 3 (UCP3) from the subject, wherein the presence of the SNP is correlated with obesity and/or diabetes, thereby identifying the subject as having a risk of developing obesity and/or diabetes. The presence of an SNP is determined by determining the nucleic acid sequence of at least a region of a UCP2 and/or UCP3 gene according to standard molecular biology protocols well known in the art, for example as described in Sambrook et al. (1989) and as set forth in the Examples provided herein. One skilled in the art will appreciate that the gene or a region thereof can contain one or more SNP's associated with obesity and/or diabetes.

Examples of methods of nucleic acid detection known in the art such as nucleic acid sequencing, polymerase chain reaction (PCR) with or without restriction fragment length polymorphism (RFLP) analysis, Southern and Northern blot analysis, ligase chain reaction, and PCR reaction of specific alleles (PASA) can be utilized to enhance the subject assay and are described for example in Sambrook et al. Other techniques such as isothermal, single-cycle amplification technique, termed the self-sustained sequence replication (3SR) system, can discriminate between a wild-type or mutant sequence at any particular residue. Because this amplification method generates a predominance of one strand of single-stranded RNA, direct sequencing is possible.

A method for detecting a nucleic acid encoding a UCP protein variant can specifically comprise contacting the preselected portion of a whole blood sample with at least one detectable nucleic acid probe that is selective for the nucleic acid encoding a UCP protein variant under conditions favorable for promoting hybridization of the

probe and detecting the presence of the hybridization between the probe and the nucleic acid, thereby detecting the presence of the nucleic acid encoding a UCP protein variant.

Conditions which are favorable for promoting hybridization of a particular probe to a nucleic acid can vary depending upon the sequence of the nucleic acid being detected or the type of probe utilized. However, such conditions are generally known in the art and will be apparent to the skilled artisan. Thus, one can merely adapt the procedures set forth in the art to suit the present methods.

Similarly, the present invention provides a method for identifying an allele correlated with obesity and/or diabetes, comprising detecting the presence of a single nucleotide polymorphism (SNP) in a nucleic acid encoding a uncoupling protein 2 and/or a nucleic acid encoding a human uncoupling protein 3 from a subject, wherein the presence of the SNP is correlated with obesity and/or diabetes, thereby identifying the allele correlated with obesity and/or diabetes.

A subject or an allele in a UCP2 and/or UCP3 gene can be identified as correlated with, associated with, linked with, or otherwise related to with a risk of developing essential obesity and/or diabetes on the basis of statistical analyses of the incidence of a particular SNP in individuals diagnosed with obesity and/or diabetes, including any metabolic, phenotypic, and physiologic symptom or condition. The data provided for these parameters can be used to establish a correlation between a specific allele in a UCP gene (genotype) and a risk of developing obesity and/or diabetes, especially type II diabetes.

In addition, a subject or an allele with a SNP in a UCP2 and/or UCP3 gene can be identified as correlated with a risk of developing obesity and/or diabetes through molecular biology protocols which measure the activity of the UCP2 and/or UCP3 proteins.

In the methods described herein, the SNP in a nucleic acid encoding a UCP2 can comprise a change in the identity of the nucleotide at position 164 of the sequence

encoding the uncoupling protein 2 set forth in the Sequence Listing as SEQ ID NO: 2.

In a preferred embodiment, the single nucleotide polymorphism at position 164 comprises the substitution of a thymine (T) for a cytosine (C). As described below and as contemplated herein, any SNP can comprise ant nucleotide substitution for the wild- type nucleic acid, but preferably is one that results in an amino acid substitution in the protein encoded by the nucleic acid. However, the SNP can be located at a position outside the coding region; for example those located in an intron, in a promoter, in a polyadenylation signal region, in an enhancer, and in any other region that can affect the ultimate expression and/or activity of the protein encoded by the nucleic acid. An example of a SNP in an intron is described in the Example and the discussion below, wherein the SNP inhibits splicing of the intron and the resulting mRNA contains a premature stop codon, whereby the UCP protein encoded therein is atypical.

In another embodiment of the present invention, the single nucleotide polymorphism correlated with the risk of obesity and/or diabetes comprises a change in the identity of the nucleotide at position 208 of the sequence encoding the uncoupling protein 3 set forth in the Sequence Listing as SEQ ID NO: 4, such as the substitution of a thymine (T) for a cytosine (C).

In another embodiment of the present invention, the single nucleotide polymorphism correlated with the risk of obesity and/or diabetes comprises a change in the identity of the nucleotide at position 427 of the sequence encoding the uncoupling protein 3 set forth in the Sequence Listing as SEQ ID NO: 4, such as the substitution of a thymine (T) for a cytosine (C).

In another embodiment of the present invention, the single nucleotide polymorphism correlated with the risk of obesity and/or diabetes comprises a change in the identity of the nucleotide at position 304 of the sequence encoding the uncoupling protein 3 set forth in the Sequence Listing as SEQ ID NO: 4, such as the substitution of an adenine (A) for a guanine (G).

In another embodiment of the present invention, the single nucleotide polymorphism correlated with the risk of obesity and/or diabetes comprises a change in the identity of the nucleotide at position 1377 of the sequence set forth in the Sequence Listing as SEQ ID NO: 6, such as the substitution of a adenine (A) for a guanine (G).

This invention provides a method for identifying a subject having a risk of developing obesity and/or diabetes, comprising detecting the presence of an amino acid polymorphism in a UCP2 and/or UCP3 from the subject, wherein the presence of the amino acid polymorphism is correlated with obesity and/or diabetes, thereby identifying the subject as having a risk of developing obesity and/or diabetes.

In one embodiment, the amino acid polymorphism correlated with the risk of obesity and/or diabetes comprises a change in the identity of the amino acid at position 55 of the uncoupling protein 2 sequence set forth in the Sequence Listing as SEQ ID NO: 3, such as the substitution of valine for alanine at amino acid position 55.

In another embodiment, the amino acid polymorphism correlated with the risk of obesity and/or diabetes comprises a change in the identity of the amino acid at position 70 of the uncoupling protein 3 sequence set forth in the Sequence Listing as SEQ ID NO: 4, such as the substitution of tryptophan for arginine.

In another embodiment, the amino acid polymorphism correlated with the risk of obesity and/or diabetes comprises a change in the identity of the amino acid at position 143 of the uncoupling protein 3 sequence set forth in the Sequence Listing as SEQ ID NO: 4, which results in the generation of a stop codon.

In another embodiment, the amino acid polymorphism correlated with the risk of obesity comprises a change in the identity of the amino acid at position 102 of the uncoupling protein 3 sequence set forth in the Sequence Listing as SEQ ID NO: 4 such as the substitution of valine for isoleucine.

One skilled in the art will recognize that there are many well known and characterized procedures for detecting an amino acid polymorphism. For example, protein sequencing can yield very precise information of the identity of the individual amino acids in a particular protein. Additionally, proteins can be characterized by their molecular weight, isoelectric point, pH optimum, etc. One skilled in the art will also appreciate that the procedure used to identify an amino acid polymorphism can vary and is not limiting to the instant invention.

The present invention also provides a method for identifying a subject having a risk of developing obesity and/or diabetes and/or an allele associated with obesity and/or diabetes, comprising contacting a sample from the subject with an antibody to an antigen of an altered UCP2 and/or UCP3 protein, detecting the binding of the antibody with the antigen, wherein binding of antigen to the antibody indicates the presence of the altered UCP2 and/or UCP3in the sample and wherein the presence of the altered UCP2 and/or UCP3in the sample indicates a risk for developing obesity and/or diabetes and/or an allele associated with obesity and/or obesity, thereby identifying a subject having a risk of developing obesity and/or diabetes.

One example of the method of detecting the antigen is performed by contacting a fluid or tissue sample from the subject with an amount of a purified antibody specifically reactive with the antigen, cells containing the antigen, or fragments of the antigen, and detecting the reaction of the ligand with the antigen. The fluid sample of this method can comprise any body fluid which would contain the antigen or a cell containing the antigen, such as blood, plasma, serum, feces, saliva and urine. Other possible examples of body fluids include sputum, mucus and the like.

In the present invention, the step of detecting the reaction of the antibody with the receptor can be further aided, in appropriate instances, by the use of a secondary antibody or other ligand which is reactive, either specifically with a different epitope or nonspecifically with the ligand or reacted antibody.

Enzyme immunoassays such as immunofluorescence assays (IFA), enzyme linked immunosorbent assays (ELISA) and immunoblotting can be readily adapted to accomplish the detection of the antigen. An ELISA method effective for the detection of the antigen can, for example, be as follows: (1) bind the antibody to a substrate; (2) contact the bound antibody with a fluid or tissue sample containing the antigen; (3) contact the above with a secondary antibody bound to a detectable moiety (e. g., horseradish peroxidase enzyme or alkaline phosphatase enzyme); (4) contact the above with the substrate for the enzyme; (5) contact the above with a color reagent; (6) observe color change.

A purified antibody specifically reactive with an immunoreactive epitope specific to the receptor is also provided. The term"reactive"means capable of binding or otherwise associating nonrandomly with the receptor."Specific"immunoreactivity as used herein denotes an antigen or epitope (amino acid, protein, peptide or fragment) that does not cross react substantially with an antibody that is immunoreactive with other antigens. Antibodies can be made by the procedure set forth by standard procedures (Harlow and Lane,"Antibodies; A Laboratory Manual"Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1988). Briefly, purified antigen can be injected into an animal in an amount and in intervals sufficient to elicit an immune response. Antibodies can either be purified directly, or spleen cells can be obtained from the animal. The cells are then fused with an immortal cell line and screened for antibody secretion. The antibodies can be used to screen DNA clone libraries for cells secreting the antigen. Those positive clones can then be sequenced as described in, for example, Kelly et al., Bio/Technology 10: 163-167 (1992) and Bebbington et al., Bio/Technology 10: 169-175 (1992).

One skilled in the art will recognize that the antigen being detected and/or used to generate a particular antibody include those described herein wherein the UCP2 and UCP3 nucleic acids encoding the variant UCP2 and/or UCP3 proteins contain one or more nucleotide variations. For example, the UCP3 variants having a premature stop codon can readily be detected in the presence of a wild-type copy of the same nucleic acid, such as in a heterozygote cell or subject.

One skilled in the art will also appreciate that the immunoassay methods can be modified wherein an antibody from a sample that indicates the presence of an altered UCP2 and/or UCP3 protein or protein fragment can be detected.

The present invention further provides a kit for detecting the binding of an antibody to a UCP2 and/or UCP3 variant. Particularly, the kit can detect the presence of a receptor specifically reactive with the antibody or an immunoreactive fragment thereof. The kit can include an antibody bound to a substrate, a secondary antibody reactive with the antigen and a reagent for detecting a reaction of the secondary antibody with the antigen. Such a kit can be an ELISA kit and can comprise the substrate, primary and secondary antibodies when appropriate, and any other necessary reagents such as detectable moieties, enzyme substrates and color reagents as described above. The diagnostic kit can, alternatively, be an immunoblot kit generally comprising the components and reagents described herein.

The particular reagents and other components included in the diagnostic kits of the present invention can be selected from those available in the art in accord with the specific diagnostic method practiced in the kit. Such kits can be used to detect the binding of the antibody with a receptor in tissue and fluid samples from a subject.

An isolated immunogenically specific epitope or fragment of the antibody is also provided. A specific immunogenic epitope of the antibody can be isolated from the whole antibody by chemical or mechanical disruption of the molecule. The purified fragments thus obtained can be tested to determine their immunogenicity and specificity by the methods taught herein. Immunoreactive epitopes of the antibody can also be synthesized directly. An immunoreactive fragment is defined as an amino acid sequence of at least about 5 consecutive amino acids derived from the antibody amino acid sequence.

In one aspect, the invention relates to a nucleic acid comprising the nucleic acid set forth in the Sequence Listing as SEQ ID NO: 1, wherein nucleotide 164 in the region coding for UCP2 is altered. In one embodiment, the alteration comprises the

substitution of a thymine for a cytosine at position 164. The nucleic acid encodes a human gene for UCP2, which includes sequences both 5'and 3'to the coding regions of the genes. The nucleic acid set forth in SEQ ID NO: 1 represents the sequence of a genomic clone and therefore includes introns of the encoded genes.

In another aspect, the invention relates to a nucleic acid comprising the nucleic acid set forth in the Sequence Listing as SEQ ID NO: 4, wherein nucleotide 208 is altered. The nucleic acid encodes a human gene for UCP3. In one embodiment, the alteration comprises the substitution of a thymine for a cytosine at position 208. In another embodiment, the alteration comprises the substitution of a thymine for a cytosine at position 427. In another embodiment, the alteration comprises the substitution of a adenine for a guanine at position 304.

In another aspect, the invention relates to a nucleic acid comprising the nucleic acid set forth in the Sequence Listing as SEQ ID NO: 6, wherein nucleotide 1377 is altered. The nucleic acid encodes a region comprising exon 6 of human gene for UCP3. The alteration of the nucleotide at position 1377 results in-the mutation of the splice-donor site of exon 6, whereby splicing at that site is inhibited, and the messenger RNA contains a premature stop codon and whereby the RNA encodes a truncate polypeptide. In one embodiment, the alteration comprises the substitution of an adenine for a guanine at position 1377.

One skilled in the art will appreciate that the specific nucleotide alteration, substitution, change, deletion, insertion, or any other modification at the disclosed positions can comprise other variations of the disclosed alterations and still result in a nucleic acid associated with obesity and/or diabetes. For example, nucleotide 164 of the UCP2 mRNA can be changed to a base other than thymine and still result in an altered sequence that is associated with obesity and/or diabetes. One skilled in the art will appreciate that the specific amino acid alteration, substitution, change, deletion, insertion, or any other modification at the disclosed positions can comprise other variations of the disclosed alterations and still result in an altered UCP2 and/or UCP3 that is associated with obesity and/or diabetes.

As used herein, the term"nucleic acid"refers to single-or multiple stranded molecules which may be DNA or RNA, or any combination thereof, including modifications to those nucleic acids. The nucleic acid may represent a coding strand or its complement, or any combination thereof. Nucleic acids may be identical in sequence to the sequences which are naturally occurring for any of the novel genes discussed herein or may include alternative codons which encode the same amino acid as that which is found in the naturally occurring sequence or the novel sequence. These nucleic acids can also be modified from their typical structure. Such modifications include, but are not limited to, methylated nucleic acids, the substitution of a non- bridging oxygen on the phosphate residue with either a sulfur (yielding phophorothioate deoxynucleotides), selenium (yielding phosphorselenoate deoxynucleotides), or methyl groups (yielding methylphosphonate deoxynucleotides).

Similarly, one skilled in the art will recognize that compounds comprising the genes, nucleic acids, and fragments of the genes and nucleic acids as disclosed and contemplated herein are also provided. For example, a compound comprising a nucleic acid can be a derivative of a typical nucleic acid such as nucleic acids which are modified to contain a terminal or internal reporter molecule and/or those nucleic acids containing non-typical bases or sugars. These reporter molecules include, but are not limited to, isotopic and non-isotopic reporters. Therefore any molecule which may aid in detection, amplification, replication, expression, purification, uptake, etc. may be added to the nucleic acid construct.

The term"gene"as used herein means a unit of heredity that occupies a specific locus on a chromosome as well as any sequences associated with the expression of that nucleic acid. For example, the gene includes any introns normally present within the coding region as well as regions preceding and following the coding region. Examples of these non-coding regions include, but are not limited to transcription termination regions, promoter regions, enhancer regions and modulation regions.

The genes and nucleic acids provided for by the present invention may be obtained in any number of ways. For example, a DNA molecule encoding UCP2 or

UCP3 can be isolated from the organism in which it is normally found. For example, a genomic DNA or cDNA library can be constructed and screened for the presence of the gene or nucleic acid of interest. Methods of constructing and screening such libraries are well known in the art and kits for performing the construction and screening steps are commercially available (for example, Stratagene Cloning Systems, La Jolla, CA).

Once isolated, the gene or nucleic acid can be directly cloned into an appropriate vector, or if necessary, be modified to facilitate the subsequent cloning steps. Such modification steps are routine, an example of which is the addition of oligonucleotide linkers which contain restriction sites to the termini of the nucleic acid. General methods are set forth in Sambrook et al."Molecular Cloning, a Laboratory Manual," Cold Spring Harbor Laboratory Press (1989).

Another example of a method of obtaining a DNA molecule encoding a specific gene, CDS, mRNA or protein of the present invention is to synthesize a recombinant DNA molecule which encodes that protein. For example, oligonucleotide synthesis procedures are routine in the art and oligonucleotides coding for a particular protein region are readily obtainable through automated DNA synthesis. A nucleic acid for one strand of a double-stranded molecule can be synthesized and hybridized to its complementary strand. One can design these oligonucleotides such that the resulting double-stranded molecule has either internal restriction sites or appropriate 5'or 3' overhangs at the termini for cloning into an appropriate vector. Double-stranded molecules coding for relatively large proteins can readily be synthesized by first constructing several different double-stranded molecules that code for particular regions of the protein, followed by ligating these DNA molecules together. For example, Cunningham, et al."Receptor and Antibody Epitopes in Human Growth Hormone Identified by Homolog-Scanning Mutagenesis,"Science, 243: 1330-1336 (1989), have constructed a synthetic gene encoding the human growth hormone gene by first constructing overlapping and complementary synthetic oligonucleotides and ligating these fragments together. See also, Ferretti, et al. Proc. Nat. Acad. Sci.

82: 599-603 (1986), wherein synthesis of a 1057 base pair synthetic bovine rhodopsin gene from synthetic oligonucleotides is disclosed. By constructing the desired sequence in this manner, one skilled in the art can readily obtain any particular protein

such as clk2, propinl, or cotel, with desired amino acids at any particular position or positions within the protein. See also, U. S. Patent No. 5,503,995 which describes an enzyme template reaction method of making synthetic genes. Techniques such as this are routine in the art and are well documented. These nucleic acids can then be expressed in vivo or in vitro as discussed below.

Once the gene or nucleic acid sequence of the desired gene or region is obtained, the sequence encoding specific amino acids can be modified or changed at any particular amino acid position by techniques well known in the art. For example, PCR primers can be designed which span the amino acid position or positions and which can substitute any amino acid for another amino acid. Then a nucleic acid can be amplified and inserted into the wild-type coding sequence in order to obtain any of a number of possible combinations of amino acids at any position of the gene.

Alternatively, one skilled in the art can introduce specific mutations at any point in a particular nucleic acid sequence through techniques for point mutagenesis. General methods are set forth in Smith,"In vitro mutagenesis"Ann. Rev. Gen., 19: 423-462 (1985) and Zoller,"New molecular biology methods for protein engineering"Curr.

Opin. Struct. Biol., 1: 605-610 (1991). Techniques such as these can also be used to modify the genes or nucleic acids in regions other than the coding regions, such as the promoter regions or any regulatory or noncoding region.

As used herein, the term"isolated"refers to a nucleic acid separated or significantly free from at least some of the other components of the naturally occurring organism, for example, the cell structural components commonly found associated with nucleic acids in a cellular environment and/or other nucleic acids. The isolation of the native nucleic acids can be accomplished, for example, by techniques such as cell lysis followed by phenol plus chloroform extraction, followed by ethanol precipitation of the nucleic acids. The nucleic acids of this invention can be isolated from cells according to any of many methods well known in the art.

An isolated nucleic acid comprising a unique fragment of at least 10 nucleotides of the variant nucleic acids disclosed herein comprising at least one of the nucleic acid

alterations is also provided. Unique fragments, as used herein means a nucleic acid of at least 10 nucleotides that is not identical to any other known nucleic acid sequence.

Examples of the sequences of at least 10 nucleotides that are unique to the variant UCP2 and UCP3 nucleic acids can be readily ascertained by comparing the sequence of the nucleic acid in question to sequences catalogued in GenBank, or any other sequence database, using the computer programs such as DNASIS (Hitachi Engineering, Inc.) or Word Search or FASTA of the Genetics Computer Group (GCG) (Madison, WI), which search the catalogued nucleotide sequences for similarities to the nucleic acid in question. If the sequence does not match any of the known sequences, it is unique. For example, the sequence of nucleotides 1-10 can be used to search the databases for an identical match. If no matches are found, then nucleotides 1-10 represent a unique fragment. Next, the sequence of nucleotides 2-11 can be used to search the databases, then the sequence of nucleotides 3-13, and so on up to the full length of the particular sequence. The same type of search can be performed for sequences of 11 nucleotides, 12 nucleotides, 13 nucleotides, etc. These unique nucleic acids, as well as degenerate nucleic acids can be used, for example, as primers for amplifying nucleic acids in order to isolate allelic variants of the UCP2 or UCP3 proteins or as primers for reverse transcription of UCP2 or UCP3 mRNA, or as probes for use in detection techniques such as nucleic acid hybridization. One skilled in the art will appreciate that even though a nucleic acid of at least 10 nucleotides is unique to a specific gene, that nucleic acid fragment can still hybridize to many other nucleic acids and therefore be used in techniques such as amplification and nucleic acid detection.

Also provided are allelic variants of the nucleic acids encoding the variant UCP2 or UCP3 proteins disclosed herein. As used herein, the term"allelic variations" or"allelic variants"is used to describe the same, or similar proteins that are diverged from the variant UCP2 or UCP3 proteins by less than 20% in their corresponding amino acid identity. In another embodiment, these allelic variants are less than 18% divergent in their corresponding amino acid identity. In another embodiment, these allelic variants are less than 15% divergent in their corresponding amino acid identity.

In another embodiment, these allelic variants are less than 12% divergent in their corresponding amino acid identity. In another embodiment, these allelic variants are

less than 10% divergent in their corresponding amino acid identity. In another embodiment, these allelic variants are less than 7% divergent in their corresponding amino acid identity. In another embodiment, these allelic variants are less than 5% divergent in their corresponding amino acid identity. In another embodiment, these allelic variants are less than 3% divergent in their corresponding amino acid identity.

In another embodiment, these allelic variants are less than 2% divergent in their corresponding amino acid identity. In yet another embodiment, these allelic variants are less than 1% divergent in their corresponding amino acid identity. These amino acids can be substitutions, they can be deletions, and they can be additions to the amino acid sequence of the variant UCP2 or UCP3 proteins.

The homology between the protein coding regions of the nucleic acids encoding the allelic variants of the variant UCP2 or UCP3 proteins is preferably less than 20% divergent from the nucleic acids encoding the variant UCP2 or UCP3 proteins. In another embodiment, the corresponding nucleic acids are less than 18% divergent in their sequence identity. In another embodiment, the corresponding nucleic acids are less than 15% divergent in their sequence identity. In another embodiment, the corresponding nucleic acids are less than 12% divergent in their sequence identity. In another embodiment, the corresponding nucleic acids are less than 10% divergent in their sequence identity. In another embodiment, corresponding nucleic acids are less than 7% divergent in their sequence identity. In another embodiment, the corresponding nucleic acids are less than 5% divergent in their sequence identity. In another embodiment, the corresponding nucleic acids are less than 3% divergent in their sequence identity. In another embodiment, the corresponding nucleic acids are less than 2% divergent in their corresponding sequence identity. In yet another embodiment, the corresponding nucleic acids are less than 1% divergent in their sequence identity The present invention also contemplates any unique fragment of the nucleic acids encoding the variant UCP2 or UCP3 proteins. To be unique, the fragment must be of sufficient size to distinguish it from other known sequences, most readily determined by comparing any nucleic acid fragment to the nucleotide sequences in

computer databases, such as GenBank. Such comparative searches are standard in the art. Typically, a unique fragment useful as a primer or probe will be at least 20 to about 25 nucleotides in length depending upon the specific nucleotide content of the sequence. Additionally, fragments can be, for example, at least about 30,40,50,75, 100,200 or 500 nucleotides in length. All of the genes, nucleic acids, and fragments of the genes and nucleic acids disclosed and contemplated herein can be single or multiple stranded, depending on the purpose for which it is intended.

Once a nucleic acid encoding a particular protein of interest, or a region of that nucleic acid, is constructed, modified, or isolated, that nucleic acid can then be cloned into an appropriate vector, which can direct the in vivo or in vitro synthesis of that wild- type and/or modified protein. The vector is contemplated to have the necessary functional elements that direct and regulate transcription of the inserted gene, or nucleic acid. These functional elements include, but are not limited to, a promoter, regions upstream or downstream of the promoter, such as enhancers that may regulate the transcriptional activity of the promoter, an origin of replication, appropriate restriction sites to facilitate cloning of inserts adjacent to the promoter, antibiotic resistance genes or other markers which can serve to select for cells containing the vector or the vector containing the insert, RNA splice junctions, a transcription termination region, or any other region which may serve to facilitate the expression of the inserted gene or hybrid gene. (See generally, Sambrook et al.).

There are numerous E. coli (Escherichia coli) expression vectors known to one of ordinary skill in the art which are useful for the expression of the nucleic acid insert.

Other microbial hosts suitable for use include bacilli, such as Bacillus subtilis, and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species. In these prokaryotic hosts one can also make expression vectors, which will typically contain expression control sequences compatible with the host cell (e. g., an origin of replication). In addition, any number of a variety of well-known promoters will be present, such as the lactose promoter system, a tryptophan (Trp) promoter system, a beta-lactamase promoter system, or a promoter system from phage lambda.

The promoters will typically control expression, optionally with an operator sequence,

and have ribosome binding site sequences for example, for initiating and completing transcription and translation. If necessary, an amino terminal methionine can be provided by insertion of a Met codon 5'and in-frame with the downstream nucleic acid insert. Also, the carboxy-terminal extension of the nucleic acid insert can be removed using standard oligonucleotide mutagenesis procedures.

Additionally, yeast expression can be used. There are several advantages to yeast expression systems. First, evidence exists that proteins produced in a yeast secretion systems exhibit correct disulfide pairing. Second, post-translational glycosylation is efficiently carried out by yeast secretory systems. The Saccharomyces cerevisiae pre-pro-alpha-factor leader region (encoded by the MF"-1 gene) is routinely used to direct protein secretion from yeast. (Brake, et al."«-Factor-Directed Synthesis and Secretion of Mature Foreign Proteins in Saccharomyces cerevisiae."Proc. Nat.

Acad. Sci., 81: 4642-4646 (1984)). The leader region of pre-pro-alpha-factor contains a signal peptide and a pro-segment which includes a recognition sequence for a yeast protease encoded by the KEX2 gene: this enzyme cleaves the precursor protein on the carboxyl side of a Lys-Arg dipeptide cleavage signal sequence. The nucleic acid coding sequence can be fused in-frame to the pre-pro-alpha-factor leader region. This construct is then put under the control of a strong transcription promoter, such as the alcohol dehydrogenase I promoter or a glycolytic promoter. The nucleic acid coding sequence is followed by a translation termination codon which is followed by transcription termination signals. Alternatively, the nucleic acid coding sequences can be fused to a second protein coding sequence, such as Sj26 or p-galactosidase, used to facilitate purification of the fusion protein by affinity chromatography. The insertion of protease cleavage sites to separate the components of the fusion protein is applicable to constructs used for expression in yeast. Efficient post translational glycosylation and expression of recombinant proteins can also be achieved in Baculovirus systems.

Mammalian cells permit the expression of proteins in an environment that favors important post-translational modifications such as folding and cysteine pairing, addition of complex carbohydrate structures, and secretion of active protein. Vectors useful for the expression of active proteins in mammalian cells are characterized by

insertion of the protein coding sequence between a strong viral promoter and a polyadenylation signal. The vectors can contain genes conferring hygromycin resistance, gentamicin resistance, or other genes or phenotypes suitable for use as selectable markers, or methotrexate resistance for gene amplification. The chimeric protein coding sequence can be introduced into a Chinese hamster ovary (CHO) cell line using a methotrexate resistance-encoding vector, or other cell lines using suitable selection markers. Presence of the vector DNA in transformed cells can be confirmed by Southern blot analysis. Production of RNA corresponding to the insert coding sequence can be confirmed by Northern blot analysis. A number of other suitable host cell lines capable of secreting intact human proteins have been developed in the art, and include the CHO cell lines, HeLa cells, myeloma cell lines, Jurkat cells, etc.

Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer, and necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences. Preferred expression control sequences are promoters derived from immunoglobulin genes, SV40, Adenovirus, Bovine Papilloma Virus, etc. The vectors containing the nucleic acid segments of interest can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transformation is commonly utilized for prokaryotic cells, whereas calcium phosphate, DEAE dextran, or lipofectin mediated transfection or electroporation may be used for other cellular hosts.

Alternative vectors for the expression of genes or nucleic acids in mammalian cells, those similar to those developed for the expression of human gamma-interferon, tissue plasminogen activator, clotting Factor VIII, hepatitis B virus surface antigen, protease Nexinl, and eosinophil major basic protein, can be employed. Further, the vector can include CMV promoter sequences and a polyadenylation signal available for expression of inserted nucleic acids in mammalian cells (such as COS-7).

Insect cells also permit the expression of mammalian proteins. Recombinant proteins produced in insect cells with baculovirus vectors undergo post-translational modifications similar to that of wild-type proteins. Briefly, baculovirus vectors useful

for the expression of active proteins in insect cells are characterized by insertion of the protein coding sequence downstream of the Autographica californica nuclear polyhedrosis virus (AcNPV) promoter for the gene encoding polyhedrin, the major occlusion protein. Cultured insect cells such as Spodoptera frugiperda cell lines are transfected with a mixture of viral and plasmid DNAs and the viral progeny are plated.

Deletion or insertional inactivation of the polyhedrin gene results in the production of occlusion negative viruses which form plaques that are distinctively different from those of wild-type occlusion positive viruses. These distinctive plaque morphologies allow visual screening for recombinant viruses in which the AcNPV gene has been replaced with a hybrid gene of choice.

Alternatively, the genes or nucleic acids of the present invention can be operatively linked to one or more of the functional elements that direct and regulate transcription of the inserted gene as discussed above and the gene or nucleic acid can be expressed. For example, a gene or nucleic acid can be operatively linked to a bacterial or phage promoter and used to direct the transcription of the gene or nucleic acid in vitro. A further example includes using a gene or nucleic acid provided herein in a coupled transcription-translation system where the gene directs transcription and the RNA thereby produced is used as a template for translation to produce a polypeptide.

One skilled in the art will appreciate that the products of these reactions can be used in many applications such as using labeled RNAs as probes and using polypeptides to generate antibodies or in a procedure where the polypeptides are being administered to a cell or a subject.

Expression of the gene or nucleic acid, either in combination with a vector or operatively linked to an appropriate sequence, can be by either in vivo or in vitro. In vivo synthesis comprises transforming prokaryotic or eukaryotic cells that can serve as host cells for the vector. Alternatively, expression of the gene or nucleic acid can occur in an in vitro expression system. For example, in vitro transcription systems are commercially available which are routinely used to synthesize relatively large amounts of mRNA. In such in vitro transcription systems, the nucleic acid encoding the desired gene would be cloned into an expression vector adjacent to a transcription promoter.

For example, the Bluescript II cloning and expression vectors contain multiple cloning sites which are flanked by strong prokaryotic transcription promoters. (Stratagene Cloning Systems, La Jolla, CA). Kits are available which contain all the necessary reagents for in vitro synthesis of an RNA from a DNA template such as the Bluescript vectors. (Stratagene Cloning Systems, La Jolla, CA). RNA produced in vitro by a system such as this can then be translated in vitro to produce the desired protein.

(Stratagene Cloning Systems, La Jolla, CA).

If ex vivo methods are employed, cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art. The nucleic acids of this invention can be introduced into the cells via any gene transfer mechanism, such as, for example, virus-mediated gene delivery, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes. The transduced cells can then be infused (e. g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into a subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.

The nucleic acids of this invention can also be utilized for in vivo gene therapy techniques. With regard to gene therapy applications, the nucleic acid can comprise a nucleotide sequence which encodes a gene product which is meant to function in the place of a defective gene product and restore normal function to a cell which functioned abnormally due to the defective gene product. Alternatively, the nucleic acid may encode a gene product which was not previously present in a cell or was not previously present in the cell at a therapeutic concentration, whereby the presence of the exogenous gene product or increased concentration of the exogenous gene product imparts a therapeutic benefit to the cell and/or to a subject. For example, the nucleic acid of this invention can include but is not limited to, a gene encoding a gene product involved in obesity and/or diabetes.

For in vivo administration, the cells can be in a subject and the nucleic acid can be administered in a pharmaceutically acceptable carrier. The subject can be any animal

in which it is desirable to selectively express a nucleic acid in a cell. In a preferred embodiment, the animal of the present invention is a human. In addition, non-human animals which can be treated by the method of this invention can include, but are not limited to, cats, dogs, birds, horses, cows, goats, sheep, guinea pigs, hamsters, gerbils and rabbits, as well as any other animal in which selective expression of a nucleic acid in a cell can be carried out according to the methods described herein.

In the method described above which includes the introduction of exogenous DNA into the cells of a subject (i. e., gene transduction or transfection), the nucleic acids of the present invention can be in the form of naked DNA or the nucleic acids can be in a vector for delivering the nucleic acids to the cells for expression of the nucleic acid inside the cell. The vector can be a commercially available preparation, such as an adenovirus vector (Quantum Biotechnologies, Inc. (Laval, Quebec, Canada). Delivery of the nucleic acid or vector to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as Lipofectin, Lipofectaminew (GIBCO-BRL, Inc., Gaithersburg, MD), Superfect (Qiagen, Inc. Hilden, Germany) and Transfectamw (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art. In addition, the nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a Sonoporation machine (ImaRx Pharmaceutical Corp., Tucson, AZ).

As one example, vector delivery can be via a viral system, such as a retroviral vector system which can package a recombinant retroviral genome. The recombinant retrovirus can then be used to infect and thereby deliver nucleic acid to the infected cells. The exact method of introducing the nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors. Other techniques are widely available for this procedure including the use of adenoviral vectors, adeno-associated viral (AAV) vectors, lentiviral vectors, pseudotyped retroviral vectors, and pox virus vectors, such as vaccinia virus vectors. Physical transduction techniques can also be used, such as liposome delivery and receptor-mediated and other endocytosis

mechanism. This invention can be used in conjunction with any of these or other commonly used gene transfer methods.

The nucleic acid and the nucleic acid delivery vehicles of this invention, (e. g., viruses; liposomes, plasmids, vectors) can be in a pharmaceutically acceptable carrier for in vivo administration to a subject. By"pharmaceutically acceptable"is meant a material that is not biologically or otherwise undesirable, i. e., the material may be administered to a subject, along with the nucleic acid or vehicle, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained. The carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.

The nucleic acid or vehicle may be administered orally, parenterally (e. g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like. The exact amount of the nucleic acid or vector required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity or mechanism of any disorder being treated, the particular nucleic acid or vehicle used, its mode of administration and the like.

The invention further comprises a polypeptide, peptides, or proteins encoded by any of the UCP2 and UCP3 variants disclosed herein. One skilled in the art will also appreciate that the polypeptides can contain alterations other than those specifically disclosed herein and still be associated with obesity and/or obesity. For example, an amino acid other than valine can be substituted for alanine at position 55 of the UCP2 protein. One skilled in the art will also appreciate that the present invention further comprises those nucleic acids encoding the UCP2 and UCP3 protein variants disclosed and contemplated herein. Further provided by the present invention are genomic sequences corresponding to the nucleic acid encoding the altered UCP2 and UCP3 proteins.

These polypeptides can also be obtained in any of a number of procedures well known in the art. One method of producing a polypeptide is to link two peptides or polypeptides together by protein chemistry techniques. For example, peptides or polypeptides can be chemically synthesized using currently available laboratory equipment using either Fmoc (9-fluorenylmethyloxycarbonyl) or Boc (tert -butyloxycarbonoyl) chemistry. (Applied Biosystems, Inc., Foster City, CA). One skilled in the art can readily appreciate that a peptide or polypeptide corresponding to a particular protein can be synthesized by standard chemical reactions. For example, a peptide or polypeptide can be synthesized and not cleaved from its synthesis resin whereas the other fragment of a hybrid peptide can be synthesized and subsequently cleaved from the resin, thereby exposing a terminal group which is functionally blocked on the other fragment. By peptide condensation reactions, these two fragments can be covalently joined via a peptide bond at their carboxyl and amino termini, respectively, to form a larger polypeptide. (Grant,"Synthetic Peptides: A User Guide,"W. H. Freeman and Co., N. Y. (1992) and Bodansky and Trost, Ed.,"Principles of Peptide Synthesis,"Springer-Verlag Inc., N. Y. (1993)). Alternatively, the peptide or polypeptide can be independently synthesized in vivo as described above. Once isolated, these independent peptides or polypeptides may be linked to form a larger protein via similar peptide condensation reactions.

For example, enzymatic ligation of cloned or synthetic peptide segments can allow relatively short peptide fragments to be joined to produce larger peptide fragments, polypeptides or whole protein domains (Abrahmsen et al. Biochemistry, 30: 4151 (1991)). Alternatively, native chemical ligation of synthetic peptides can be utilized to synthetically construct large peptides or polypeptides from shorter peptide fragments. This method consists of a two step chemical reaction (Dawson et al.

"Synthesis of Proteins by Native Chemical Ligation,"Science, 266: 776-779 (1994)).

The first step is the chemoselective reaction of an unprotected synthetic peptide-o-thioester with another unprotected peptide segment containing an amino-terminal Cys residue to give a thioester-linked intermediate as the initial covalent product. Without a change in the reaction conditions, this intermediate undergoes spontaneous, rapid intramolecular reaction to form a native peptide bond at

the ligation site. Application of this native chemical ligation method to the total synthesis of a protein molecule is illustrated by the preparation of human interleukin 8 (IL-8) (Clark-Lewis et al. FEBS Lett., 307: 97 (1987), Clark-Lewis et al., J. Biol. Chem., 269: 16075 (1994), Clark-Lewis et al. Biochemistry, 30: 3128 (1991), and Rajarathnam et al. Biochemistry, 29: 1689 (1994)).

Alternatively, unprotected peptide segments can be chemically linked where the bond formed between the peptide segments as a result of the chemical ligation is an unnatural (non-peptide) bond (Schnolzer et al. Science, 256: 221 (1992)). This technique has been used to synthesize analogs of protein domains as well as large amounts of relatively pure proteins with full biological activity (deLisle Milton et al.

"Techniques in Protein Chemistry IV,"Academic Press, New York, pp. 257-267 (1992)).

The present invention also contemplates DNA probes for detecting nucleic acids encoding the variant UCP proteins disclosed and contemplated herein. As used herein, the term"DNA probe"refers to a nucleic acid fragment that selectively hybridizes under stringent conditions with a nucleic acid comprising a nucleic acid set forth in a sequence listed herein. This hybridization must be specific. The degree of complementarity between the hybridizing nucleic acid and the sequence to which it hybridizes should be at least enough to exclude hybridization with a nucleic acid encoding an unrelated protein.

Allelic variants of the nucleic acids encoding the disclosed variant UCP2 and/or UCP3 proteins can be identified and isolated by nucleic acid hybridization techniques.

Probes selective to a nucleic acid encoding a variant UCP2 and/or UCP3 proteins can be synthesized and used to probe the nucleic acid from various cells, tissues, libraries etc. High sequence complementarity and stringent hybridization conditions can be selected such that the probe selectively hybridizes to allelic variants of the nucleic acid encoding a variant UCP2 and/or UCP3 proteins. For example, The selectively hybridizing nucleic acids of the invention can have at least 70%, 80%, 85%, 90%, 95%, 97%, 98% and 99% complementarity with the segment of the sequence to which it

hybridizes. The nucleic acids can be at least 12,50,100,150,200,300,500,750, or 1000 nucleotides in length. Thus, the nucleic acid can be a coding sequence for the UCP2 and/or UCP3 proteins or fragments thereof that can be used as a probe or primer for detecting the presence of these genes. If used as primers, the invention provides compositions including at least two nucleic acids which hybridize with different regions so as to amplify a desired region. Depending on the length of the probe or primer, target region can range between 70% complementary bases and full complementarity and still hybridize under stringent conditions. For example, for the purpose of diagnosing the presence of an allelic variant of the nucleic acid encoding a variant UCP2 and/or UCP3 proteins, the degree of complementarity between the hybridizing nucleic acid (probe or primer) and the sequence to which it hybridizes is at least enough to distinguish hybridization with a nucleic acid from other bacteria.

"Stringent conditions"refers to the washing conditions used in a hybridization protocol. In general, the washing conditions should be a combination of temperature and salt concentration chosen so that the denaturation temperature is approximately 5-20°C below the calculated T,, of the nucleic acid hybrid under study. The temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to the probe or protein coding nucleic acid of interest and then washed under conditions of different stringencies. The T. of such an oligonucleotide can be estimated by allowing 2°C for each A or T nucleotide, and 4°C for each G or C. For example, an 18 nucleotide probe of 50% G+C would, therefore, have an approximate Tm of 54°C.

Also provided herein are purified antibodies that selectively bind to the polypeptides encoded by a nucleic acid encoding a variant UCP2 and/or UCP3 proteins. The antibody (either polyclonal or monoclonal) can be raised to any of the polypeptides provided and contemplated herein, in its naturally occurring form and in its recombinant form. The antibody can be used in techniques or procedures such as diagnostics, treatment, or vaccination.

Antibodies can be made by many well-known methods (See, e. g. Harlow and Lane,"Antibodies; A Laboratory Manual"Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1988)). Briefly, purified antigen can be injected into an animal in an amount and in intervals sufficient to elicit an immune response. Antibodies can either be purified directly, or spleen cells can be obtained from the animal. The cells can then fused with an immortal cell line and screened for antibody secretion. The antibodies can be used to screen nucleic acid clone libraries for cells secreting the antigen. Those positive clones can then be sequenced. (See, for example, Kelly et al.

BiolTechnology, 10: 163-167 (1992); Bebbington et al. BiolTechnology, 10: 169-175 (1992)).

The phrase"specifically binds"with the polypeptide refers to a binding reaction which is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bound to a particular protein do not bind in a significant amount to other proteins present in the sample. Selective binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. A variety of immunoassay formats may be used to select antibodies that selectively bind with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies selectively immunoreactive with a protein. See Harlow and Lane"Antibodies, A Laboratory Manual"Cold Spring Harbor Publications, New York, (1988), for a description of immunoassay formats and conditions that could be used to determine selective binding.

This invention also contemplates producing a selected cell line or a non-human transgenic animal model for the analysis of a wild-type or variant UCP gene comprising introducing into an embryonic stem cell a vector having a selectable marker which, when the vector is inserted within a gene, the inserted vector can inhibit the expression of the gene, selecting embryonic stem cells expressing the selectable marker, excising the vector from the embryonic stem cells expressing the selectable marker such that host DNA from the gene is linked to the excised vector, sequencing the host DNA in the excised vector, comparing the sequence of the host DNA to known

gene sequences to determine which host DNA is from a gene for which a model for the analysis of the function the gene is desired, selecting the embryonic stem cell containing the inhibited gene for which a model for the analysis of gene function is desired, and forming a cell line or a non-human transgenic animal from the selected embryonic stem cell.

It is also contemplated in this invention that transgenic animals can be produced which either overproduce the polypeptides of this invention or fail to produce the polypeptides of this invention in a functional form. For example, a transgenic animal which overproduces a variant UCP2 protein of this invention can be produced according to methods well known in the art whereby nucleic acid encoding the UCP2 protein is introduced into embryonic stem cells, at which stage it is incorporated into the germline of the animal, resulting in the production of the variant UCP2 in the transgenic animal in increased amounts relative to a normal animal of the same species.

A transgenic animal in which the expression of a variant UCP2 and/or UCP3 protein, for example, is tissue specific is also contemplated for this invention. For example, transgenic animals that express or overexpress these genes at specific sites such as the brain can be produced by introducing a nucleic acid into the embryonic stem cells of the animal, wherein the nucleic acid is under the control of a specific promoter which allows expression of the nucleic acid in specific types of cells (e. g., a neuronal promoter which allows expression only in neuronal cells. One skilled in the art can determine if a tissue-specific alteration in UCP2 and/or UCP3 expression results in altered metabolism and/or phenotype the transgenic animal.

Alternatively, the transgenic animal of this invention can be a"knock out" animal (see, e. g., Willnow et al., 1996), which can be an animal that, for example, normally produces UCP2 but has been altered to express a variant UCP2, thereby resulting in an animal which produces UCP2 in a variant functional form.

For example, the transgenic"knock out"animal of this invention can have the expression of a gene or genes knocked out in specific tissues. This approach obviates

viability problems that can be encountered if the expression of a widely expressed gene is completely abolished in all tissues. One skilled in the art could determine whether or not the"knock out"has influenced obesity or diabetes by methods well known in the art and by comparing the non-transgenic to the transgenic animal. The knock-out mice can also be utilized to correlate particular genotypes with clinical presentation of obesity and/or diabetes.

The invention also provides fragments of antibodies which have bioactivity.

The polypeptide fragments of the present invention can be recombinant proteins obtained by cloning nucleic acids encoding the polypeptide in an expression system capable of producing the polypeptide fragments thereof, such as the adenovirus system.

For example, one can determine the active domain of the antibody which can cause a biological effect associated with the interaction of the antibody with the UCP variants.

In one example, amino acids found to not contribute to either the activity or the binding specificity or affinity of the antibody can be deleted without a loss in the respective activity.

For example, amino or carboxy-terminal amino acids can be sequentially removed from either the native or the modified non-immunoglobulin molecule or the immunoglobulin molecule and the respective activity assayed in one of many available assays. In another example, a fragment of an antibody can comprise a modified antibody wherein at least one amino acid has been substituted for the naturally occurring amino acid at a specific position, and a portion of either amino terminal or carboxy terminal amino acids, or even an internal region of the antibody, has been replaced with a polypeptide fragment or other moiety, such as biotin, which can facilitate in the purification of the modified antibody. For example, a modified antibody can be fused to a maltose binding protein, through either peptide chemistry of cloning the respective nucleic acids encoding the two polypeptide fragments into an expression vector such that the expression of the coding region results in a hybrid polypeptide. The hybrid polypeptide can be affinity purified by passing it over an amylose affinity column, and the modified antibody receptor can then be separated from the maltose binding region by cleaving the hybrid polypeptide with the specific

protease factor Xa. (See, for example, New England Biolabs Product Catalog, 1996, pg. 164.). Similar purification procedures are available for isolating hybrid proteins from eukaryotic cells as well.

The fragments, whether attached to other sequences or not, can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the peptide is not significantly altered or impaired compared to the nonmodified antibody or antibody fragment.

These modifications can provide for some additional property, such as to remove/add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the peptide must possess a bioactive property, such as binding activity, regulation of binding at the binding domain, etc.

Functional or active regions of the antibody may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide. Such methods are readily apparent to a skilled practitioner in the art and can include site-specific mutagenesis of the nucleic acid encoding the receptor. (Zoller, M. J. etal.).

The antagonistic antibodies of the invention may further comprise humanized antibodies or human antibodies. Humanized forms of non-human (e. g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab'or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond

to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature, 321: 522-525 (1986), Reichmann et al., Nature, 332: 323-327 (1988), and Presta, Curr. Op. Struct.

Biol., 2: 593-596 (1992)).

Methods for humanizing non-human antibodies are well known in the art.

Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as"import"residues, which are typically taken from an"import"variable domain. Humanization can be essentially performed following the method of Winter and co-workers (Jones et al., Nature, 321: 522-525 (1986), Riechmann et al., Nature, 332: 323-327 (1988), Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.

Accordingly, such"humanized"antibodies are chimeric antibodies (U. S. Pat. No.

4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

The choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is very important in order to reduce antigenicity.

According to the"best-fit"method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol., 151: 2296 (1993) and Chothia et al, J. Mol. Biol., 196: 901 (1987)). Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may

be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci.

USA, 89: 4285 (1992); Presta et al., J. Immunol., 151: 2623 (1993)).

It is further important that antibodies be humanized with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i. e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the consensus and import sequence so that the desired antibody characteristic, such as increased affinity for the target antigen (s), is achieved. In general, the CDR residues are directly and most substantially involved in influencing antigen binding (see, WO 94/04679 published 3 Mar. 1994).

This invention provides a method for treating obesity and/or diabetes in a subject who is obese and/or diabetic, comprising administering to the subject a nucleic acid encoding wild type UCP2 or UCP3 under conditions whereby the nucleic acid encoding wild type UCP2 or UCP3 is expressed in a cell in the subject, thereby treating the obesity and/or diabetes. Fore example, a subject having a missense mutation causing the introduction of a premature stop codon at residue 143 would be a candidate for gene therapy employing wild type UCP3.

The cell in the subject in which the nucleic acid encoding wild type UCP2 or UCP3 is expressed to treat obesity and/or diabetes can be any cell which can take up and express exogenous DNA, including, but not limited to, a heart cell, kidney cell,

liver cell, lung cell, adrenal gland cell, endothelial cell, neuronal cell, myoblast and hematopoietic stem cell.

This invention further provides a nucleic acid comprising both an isolated nucleic acid encoding wild type UCP2 and an isolated nucleic acid encoding wild type UCP3. As used herein, the term"isolated"means a nucleic acid separated or substantially free from at least some of the other components of the naturally occurring organism, for example, the cell structural components commonly found associated with nucleic acids in a cellular environment and/or other nucleic acids. The isolation of nucleic acids can therefore be accomplished by techniques such as cell lysis followed by phenol plus chloroform extraction, followed by ethanol precipitation of the nucleic acids. The nucleic acids of this invention can be isolated from cells according to methods well known in the art for isolating nucleic acids. Alternatively, the nucleic acids of the present invention can be synthesized according to standard protocols well described in the literature for synthesizing nucleic acids.

It is understood that, where desired, modification and changes may be made in the structure of the wild type UCP2 and/or wild type UCP3 of the present invention and still obtain a protein having like or otherwise desirable characteristics. Such changes may occur in natural isolates or may be synthetically introduced using site-specific mutagenesis, the procedures for which, such as mis-match polymerase chain reaction (PCR), are well known in the art.

For example, certain amino acids may be substituted for other amino acids in a wild type UCP2 and/or wild type UCP3 protein without appreciable loss of functional activity of the wild type UCP2 and/or wild type UCP3. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a wild type UCP2 and/or wild type UCP3 amino acid sequence (or, of course, the underlying nucleic acid sequence) and nevertheless obtain wild type UCP2 and/or wild type UCP3 with like properties. It is thus contemplated by the inventors that various changes may be made in the sequence of the wild type UCP2 and/or wild type UCP3 amino acid sequence (or

underlying nucleic acid sequence) without appreciable loss of biological utility or activity and possibly with an increase in such utility or activity.

This invention further provides a composition comprising a vector comprising a nucleic acid encoding wild type UCP2 and a vector comprising a nucleic acid encoding wild type UCP3. The composition can be in a pharmaceutically acceptable carrier.

The vector can be an expression vector which contains all of the genetic components required for expression of the nucleic acid encoding wild type UCP2 and the nucleic acid encoding wild type UCP3 in cells into which the vector has been introduced, as are well known in the art. The expression vector can be a commercial expression vector or it can be constructed in the laboratory according to standard molecular biology protocols. The expression vector can comprise viral nucleic acid including, but not limited to, adenovirus, retrovirus and or adeno-associated virus nucleic acid. The nucleic acid or vector of this invention can also be in a liposome or a delivery vehicle which can be taken up by a cell via receptor-mediated or other type of endocytosis.

For example, the nucleic acid comprising an isolated nucleic acid encoding wild type UCP2 and an isolated nucleic acid encoding wild type UCP3 can be inserted into an adenoviral nucleic acid according to methods well known in the art wherein the nucleic acids of this invention can be packaged in an adenovirus particle and wherein expression of the nucleic acid encoding the wild type UCP2 and the nucleic acid encoding the wild type UCP3 results in production of wild type UCP2 and wild type UCP3. Thus, the present invention also provides an adenovirus comprising a nucleic acid comprising an isolated nucleic acid encoding wild type UCP2 and an isolated nucleic acid encoding wild type UCP3.

Furthermore, the present invention provides a method for delivering wild type UCP2 and wild type UCP3 to a cell comprising administering to the cell a nucleic acid encoding wild type UCP2 and wild type UCP3 under conditions whereby the nucleic acid is expressed, thereby delivering wild type UCP2 and wild type UCP3 to the cell.

The nucleic acid can be delivered as naked DNA or in a vector (which can be a viral vector) or other delivery vehicles and can be delivered to the subject's cells in vivo

and/or ex vivo by a variety of mechanisms well known in the art (e. g., uptake of naked DNA, viral infection, liposome fusion, endocytosis and the like). The cell can be any cell which can take up and express exogenous DNA, including, but not limited to, a heart cell, kidney cell, liver cell, lung cell, adrenal gland cell, endothelial cell, neuronal cell, myoblast and hematopoietic stem cell.

Additionally provided is a method for treating obesity and/or diabetes in a subject who is obese and/or diabetic, comprising administering to the subject a nucleic acid encoding wild type UCP2 and a nucleic acid encoding wild type UCP3 under conditions whereby the nucleic acid encoding wild type UCP2 and the nucleic acid encoding wild type UCP3 are expressed in a cell in the subject, thereby treating the obesity and/or diabetes.

This present invention provides a method for treating and/or preventing and/or inhibiting obesity and/or diabetes in a subject who is obese and/or has diabetes and/or is at risk of obesity and/or having diabetes, comprising administering to the subject a nucleic acid encoding wild type UCP2 and/or a nucleic acid encoding wild type UCP3 under conditions whereby the nucleic acid encoding wild type UCP2 and/or the nucleic acid encoding wild type UCP3 is expressed in a cell of the subject, thereby treating and/or preventing and/or inhibiting the obesity and/or diabetes.

In the present invention, the wild type UCP2 and/or UCP3 gene can be inserted within an adenoviral genome and the wild type UCP2 and/or UCP3 encoding sequence can be positioned such that an adenovirus promoter is operatively linked to the wild type UCP2 and/or UCP3 insert such that the adenoviral promoter can then direct transcription of the wild type UCP2 and/or UCP3 nucleic acid, or the wild type UCP2 and/or UCP3 insert may contain its own adenoviral promoter. Similarly, the wild type UCP2 and/or UCP3 insert may be positioned such that the nucleic acid encoding wild type UCP2 and/or UCP3 may use other adenoviral regulatory regions or sites such as splice junctions and polyadenylation signals and/or sites. Alternatively, the nucleic acid encoding wild type UCP2 and/or UCP3 may contain a different enhancer/promoter or other regulatory sequences, such as splice sites and polyadenylation sequences, such

that the nucleic acid encoding wild type UCP2 and/or UCP3 may contain those sequences necessary for expression of wild type UCP2 and/or UCP3 and not partially or totally require these regulatory regions and/or sites of the adenovirus genome. These regulatory sites may also be derived from another source, such as a virus other than adenovirus. The wild type UCP2 and/or UCP3 nucleic acid insert may, alternatively, contain some sequences necessary for expression of wild type UCP2 and/or UCP3 and derive other sequences necessary for the expression of the wild type UCP2 and/or UCP3 from the adenovirus genome, or even from the host in which the recombinant adenovirus is introduced.

As another example, for administration of wild type UCP2 and/or wild type UCP3 genes to an individual in an AAV vector, the AAV particle can be directly injected intravenously. The AAV has a broad host range, so the vector can be used to transduce any of several cell types, but preferably cells in those organs that are well perfused with blood vessels. To more specifically administer the vector, the AAV particle can be directly injected into the target organ, such as muscle, liver or kidney.

Furthermore, the vector can be administered intraarterially, directly into a body cavity, such as intraperitoneally, or directly into the central nervous system (CNS).

An AAV vector can also be administered in gene therapy procedures in various other formulations in which the vector plasmid is administered after incorporation into other delivery systems such as liposomes or systems designed to target cells by receptor-mediated or other endocytosis procedures. The AAV vector can also be incorporated into an adenovirus, retrovirus or other virus which can be used as the delivery vehicle.

The present invention is more particularly described in the following examples which are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art.

EXAMPLES Example 1 The genomic organization and structure of the gene encoding the human uncoupling protein 2 (UCP2) was determined and used to study sequence variations.

A biallelic variant was identified and allele frequency is determined in populations of Caucasians and African Americans.

The PCR was employed to amplify genomic DNA with primers designed from the cDNA with GenBank accession number, U94592. Human genomic DNA was purified from whole blood and was amplified using the Expand Long Template PCR System as described by the manufacturer (Boehringer-Manheim, Indianapolis, IN). A DNA fragment containing all coding exons was amplified using primers 5'UTRf 5'- AGCTTTGAAGAACGGGACAC-3' (SEQ ID NO: 7) and hucp2lr (5'- CAGAGGTGATCAGGTC AGCA-3') (SEQ ID NO: 8). A 6.5 kb PCR product was generated and the DNA sequence was determined using additional sequencing primers and an ABI Prism 373 sequencer (Perkin Elmer, Foster City, CA). The sequence was determined bidirectionally with primers designed from the cDNA and from newly generated intronic sequences. All sequence manipulations, assembly and analyses were performed using GeneWorks software (IntelliGenetics, Mountain View, CA) and the BCM Search Launcher of the Human Genome Center, Baylor College of Medicine.

PCR primers, mixtures and cycling conditions are found by accessing the Diabetes Web pages (Appendices 1 &2).

Determination of the sequence comprising all coding and intronic regions resulted in a contig of a continuous DNA sequence of approximately 4 kb. A schematic of the exon-intron structure is shown in Figure 1. The"ATG"translation initiator was found to be within what is termed coding exon 1. The entire sequence of the determined coding and noncoding regions is available (GenBank accession number: AF019409). No canonical TATA box was identified and it became apparent that additional non-coding exonic sequences were located upstream. In an attempt to obtain additional 5'sequence, a 2.5 kb genomic DNA fragment (primer 492r: 5'-CTC

AGAGCCCTTGGTGTAGA-3' (SEQ ID NO: 9) and the Genome Walker kit, Clontech, Palo Alto, CA) was generated. The sequence of the 2.5 kb fragment diverged from that of the cDNA at position-99 indicating the possible presence of an intronic sequence.

Accordingly, a splice junction consensus sequence was also identified at this site.

Sequence determinations within the 6.5 kb fragment were indicative of a-3 kb intron upstream of the first coding exon, and that cDNA base pairs 5'of position-99 represented an additional noncoding exon (Figure 1). Partial sequencing of the 6.5 kb fragment using the upstream primer (5'UTRf) yielded an 840 bp sequence which was identical to published cDNA sequence up to position-99 at which point the sequence diverged (data not shown). At this point of divergence, a consensus sequence for a 5' splice site ("GG/gtaaga") is observed. By way of comparison, the UCP1 and UCP2 genes have six exons of similar size each encoding a putative transmembrane domain (3,6). However, the UCPI gene is less compact (-13 kb) due to expanded introns and does not have a non-coding exon (1).

The UCP2 coding sequence was also examined for the presence of mutations and/or polymorphisms. PCR products (6.5 kb) from patient DNA were generated and alignments of coding sequences demonstrated identity except for a mismatch at cDNA nucleotide position 164 (counting from'A'in the ATG translation initiator) where a cytosine was present in contrast to a thymidine at this position in a previous publication (GenBank accession number U94592). This polymorphism (C164T) results in a conservative substitution of a valine instead of an alanine at codon 55 (A55V). The allele frequency for C164T was established by manual sequencing of DNA fragments amplified from genomic DNA (primers hucp2lf and hucp2lr and sequenced with primer 492r) in populations of unrelated Caucasian-Americans (n=61) and African-Americans (n=25). However, a quicker and reliable method of restriction digest of a PCR product could also be applied. Specifically, primers huscp2lf and 492r can amplify genomic DNA (PCR conditions in Appendix 2) and provide a 514 bp fragment. The TT homozygous polymorphism renders the loss of a restriction site (four sites versus five in CC homozygous) for the restriction endonuclease Cac8 I (New England Biolabs, Beverly, MA) and the zygocity (CC, CT, TT) can be identified and scored by gel electrophoresis.

Shown in Table 1, genotype frequency distributions (CC: CT: TT) and allele frequencies were similar in both racial groups with C at cDNA position 164 (62%) occurring more commonly than T (38%). It is unclear whether the conservative substitution of valine for alanine would alter the conformational structure or function of UCP2. This amino acid substitution is predicted to occur in the cytosol-oriented extra- membranous loop between the first and second transmembrane domains based on the hydrophilicity model (3,6). Alanine is conserved at this position in the murine UCP2 gene, but is replaced by tyrosine and leucine in UCP1 and UCP3 genes, respectively.

The allele frequencies indicate that C164T is a common gene variant for UCP2 and, thus, has the potential to play a role in large numbers of patients with common polygenic disorders.

The entire coding region of UCP2 was sequenced in 5 obese and 4 lean adults as well as in 3 morbidly obese children (all unrelated) and no sequence variation was detected, other than the C164T polymorphism. However, sequence variation affecting the 5'untranslated region and upstream regulatory elements have not been addressed.

Identification of the common C 164T polymorphism will, however, facilitate analyses of the genetic contributions of UCP2 to the development of obesity and diabetes in both Caucasians and African-Americans. By way of illustration, a common restriction fragment length polymorphism for the UCP1 gene is associated with high weight gain during adult life (7,8) and resistance to weight loss on a low calorie diet (9).

Table 1. Allele and Genotype Frequencies for UCP2 Gene Polymorphism. at Position 164.

African-Americans Caucasian-Americans All subjects (Observed) * Genotvpe<BR> <BR> <BR> Frequencies CC 10 (40%) 31 (51%) 41 (48%) CT 10 (40%) 23 (38%) 33 (38%) TT 5 (20%) 7 (11%) 12 (14%) <BR> <BR> <BR> <BR> <BR> Genotvpe<BR> <BR> <BR> Frequencies C 60% 70% 62% T 40% 30% 38% * Expected Hardy-Weinberg Distribution which was established at p = 0.92 compared with observed. f Frequency distributions are similar between African-Americans and Caucasian-Americans (p=NS).

Example 2 Materials and Methods A sequence variant (C 164T) in the UCP2 gene that results in a conservative amino acid change (A55V) was recently identified (10). The allele frequencies were determined in populations of Caucasians and African-Americans and were found to be similar in both racial groups with C at position 164 (62%) occurring more commonly than T (38%). The objective of the present study was to examine possible associations between the UCP2 variant (C 164T) and phenotypic traits related to obesity, diabetes, and insulin resistance in populations of Caucasians and African-Americans.

Subjects. The sample consisted of 149 individuals. All subjects were solicited by newspaper ads and posted notices calling for volunteers to participate in studies of diabetes and obesity whether or not they were diabetic or obese. All volunteers free of thyroid, kidney, liver, and coronary artery diseases were sequentially studied. The Medical University of South Carolina Institutional Review Board approved the study and participating individuals gave informed consent. Subjects were stratified by race and gender, and the sample sizes for each of the four strata are shown in Table 2. In the 97 Caucasian subjects, 41 were men and 56 were women of which 15 men (37%) and 18 women (32%) were Type 2 diabetics. There were 52 African-American individuals of whom 15 were men and 37 were women. Among the African-Americans, 6 out of 15 men (40%) and 12 out of 36 females (33%) were classified as having Type 2 diabetes. The diagnosis of Type 2 Diabetes was made according to criteria of the National Diabetes Data Group (1979). Subjects ranged in age from 18 to 72 years with a mean age of 40.7 years and there was no significant difference in mean ages among the strata.

Clinical Measurements. Percent body fat was measured in all subjects by use of a Lange skinfold caliper (Beta Technology, Inc., Santa Cruz, CA). The equivalent fat content as a percentage of body weight was determined using tables from the Mayo Clinic Diet Manual (21). Body fat distribution was assessed by waist to hip ratio with waist and hip circumferences measured to the nearest 0.5 cm. The waist circumference was taken as the largest standing horizontal circumference between the ribs and the

iliac crest; the hip circumference was taken as the largest standing horizontal circumference of the buttocks. Oral glucose tolerance tests were performed as advocated by the National Diabetes Data Group (22). Plasma glucose concentrations were measured using the glucose oxidase method and a glucose analyzer (Yellow Springs Instruments, Co., Yellow Springs, OH). Fasting serum free insulin levels were measured in all subjects using a double antibody RIA (Abbott Laboratories, Diagnostic Division, Chicago, IL). Fasting lipid profile was assessed after an overnight fast using the Kodak Ektachem Clinical Chemistry Slide (Johnson and Johnson, Rochester, NY).

All blood pressure measurements were taken in the dominant arm with the patient having been in the supine position for 30 minutes. Measurements were made using a calibrated, automated cuff device (DynaMap 8 100, Johnson and Johnson, New Brunswick, NJ); diastolic and systolic values represent the mean of the last two of three readings.

Screening of the C164T variant. Genomic DNA was isolated from leukocytes of each individual, and a 514 bp fragment containing the C 164T polymorphism was amplified using the following primer pair: hucp2Lf (5'-ggacgtagcaggaaatcagc-3') and 492r (5'-ctcagagcccttggtgtaga-3'). PCR reactions were performed in a 20 p. I volume using a GenAmp 9600 temperature cycler (Perkin-Elmer, Foster City, CA) using 20 pmoles of each primer, 250 aM of each of the four dNTPs, 1.5 mM of MgCl2,0.15 units of Taq DNA polymerase (GIBCO-BRL, Gaithersburg, MD), and 1 x PCR buffer provided with the polymerase. After an initial denaturation step (95 °C for 5 minutes), PCR was carried out for 40 cycles, each cycle consisting of 3 steps ouf 95 C for 45 seconds, S 5 ° C for 45 seconds, and 72°C for 45 seconds. An extension step of 72 °C for 5 minutes was done upon completion of the 40 cycles. The single PCR product of 514 bp was electrophoresed in 1 % low melting point agarose, excised, and sequenced directly using the Amplicycle DNA Sequencing kit according to the manufacturer's instructions (Perkin-Elmer, Foster City, CA).

Statistical Methods. To assess genotype-phenotype associations, the populations were stratified by race and by gender. Chi-square analysis was used to test for Hardy-Weinberg equilibrium and for significant differences in allele frequencies

among strata and between diabetes status within strata. Differences in means between the genotypes for continuous variable clinical characteristics were analyzed by ANOVA with post-hoc comparisons conducted by the Least Square Difference (LSD) <BR> <BR> <BR> <BR> test using contrast matrices. Data are expressed as means s. e. m. Statistical analyses were conducted using STATISTICA for Windows release 5.1 ('97 Edition, StatSoft, Inc., Tulsa, OK).

Results The genotype frequencies by strata are shown in Table 2. The homozygote CC genotype was more common than the TT genotype; the frequency distribution of the CC genotype was 53% in Caucasians and 48% in African-Americans. The resulting frequencies for the C allele were 71% in Caucasians and 63% in African-Americans (p=NS). The genotype frequencies are in Hardy-Weinberg equilibrium.

There are significant associations between the C164T polymorphism and diabetes and obesity related traits in both Caucasians and African-Americans. With respect to Type 2 Diabetes Mellitus in the Caucasian population, CC homozygotes (47%) were 2.4 times more likely to be diabetic than individuals with CT or TT genotypes (20%) (p=0.004) (Figure 2A). Conversely, TT homozygotes in the African- American population were 1.9 times more likely to be diabetic than were heterozygotes or CC homozygotes (p=O. 118) (Figure 2B). Data in Tables 3 and 4 delineate ANOVA and post-hoc comparisons, respectively, for quantitative traits in subjects stratified by race and gender, and further support an association between glucose intolerance and the UCP2 genotype. In Caucasians, there was an apparent trend for an increase in the 2- hour glucose value in homozygote CC subjects which did not reach statistical significance (ANOVA p=0.072, post-hoc p=0.086). In African-Americans, both fasting plasma glucose and the 2-hour glucose value during oral glucose tolerance tests were significantly higher in association with the TT genotype (p=0.031 and p=0.036, respectively, in post-hoc comparisons).

There are also associations between UCP2 genotype and measures of adiposity.

In Figure 3A, a significant difference in mean body mass index (BMI) was found to

exist among Caucasian females categorized by genotype (p = 0.042). This difference was attributed to higher BMI values in CC and CT genotype subjects (mean value <BR> <BR> <BR> <BR> 29.30 0.87 kg/m2 in the combined subgroups) compared with TT genotype<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> individuals (23.11 1.96 kg/m2) (p = 0.015) (Figure 3B). An apparent trend for differences in mean percent body fat was also found to exist in Caucasian females categorized by genotype (p= 0.103). This trend can be attributed to a higher mean in the CC and CT genotypes (24.6 3.6%) over the-TT genotype (30.1 0.9%; p = 0.055). Likewise, in the African-American population, a significant difference among the three genotypes for the mean percent body fat (p = 0.024) was observed (Figure 4A). This difference is attributable to the higher mean (p=0.007) in homozygous CC <BR> <BR> <BR> <BR> <BR> individuals (29.6 1.7 %) over the other two genotypes (23.3 1.5 %) (Figure 4B).

ANOVA and post-hoc comparisons were performed for a number of other quantitative traits shown in Tables 3 and 4. UCP2 genotype significantly influenced diastolic blood pressure in Caucasian females with CC homozygotes showing a higher <BR> <BR> <BR> <BR> mean value (CC: 72.6 1.9 mmHg, CT+TT: 66.0 1.6 mmHg) (p=0.017) (Table 4).

In the African-American population, mean HDL levels tended to be higher in CC <BR> <BR> <BR> <BR> <BR> individuals (49.4 3.0 mg/dl) compared with the other genotypes (41.9 2.8 mg/dl)<BR> <BR> <BR> <BR> <BR> <BR> <BR> (p=0.058) (Table 4) and lower in TT individuals (36.4 2.6 mg/dl) compared with the<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> other genotypes (48.3 i 2.4 mg/dl) (p=0.056) (Table 4), although these differences did not achieve statistical significance.

Discussion The UCP2 gene (15,2) was recently identified as a homologue of UCP1, the key biochemical mediator of thermogenesis in brown fat. The observations that UCP2 is expressed in skeletal muscle and other tissues in adult humans and functions as an uncoupler of mitochondrial respiration when expressed in yeast (15,2) establish UCP2 as an exciting new candidate gene for susceptibility to obesity and Type 2 Diabetes.

This hypothesis was tested by examining association between a recently described UCP2 gene variant (10) and obesity/diabetes related phenotypes in 149 Caucasians and African-Americans. The UCP2 gene polymorphism is a common biallelic variant where a thymidine is substituted for a cytosine at cDNA position 164 (C 164T) leading

to a conservative amino acid substitution of valine for alanine at codon 55 (A55V).

Since genotype-phenotype association studies can be problematic in genetically heterogeneous populations, the population studied was stratified along racial lines for these analyses. In particular, the African-American population in the"low-country"of South Carolina appears to be relatively genetically homogeneous (13,23). Many are descendants from rice-cultivating tribes on the grain coast of west Africa according to the cultural and historical record, and they speak a creole language referred to as Gullah that is similar to modem day Krio spoken in Sierra Leone. Also, the data were stratified by gender within each racial group. The rationale is that diabetes is more highly prevalent among African-American females, and obesity is more common among Caucasian and African-American females, than their male counterparts (18,27), indicating that autosomal genes influence disease susceptibility differently as a function of gender.

The UCP2 gene polymorphism was found to be associated with Type 2 Diabetes with a relative risk of 1.9-2.4 in both Caucasians and African-Americans. In Caucasians, the association with diabetes status was highly significant (p=0.004) in individuals homozygous for the C allele. In African-Americans, an association between diabetes and the TT genotype was not significant (p=0.118) despite the moderate relative risk, however, statistical significance was achieved for quantitative measures of glucose intolerance including fasting (p=0.031) and 2-hour plasma glucose levels during oral glucose tolerance tests (p=0.036).

The UCP2 polymorphism per se may not represent the causal mutation at this locus for two reasons. The resulting amino acid substitution is conservative and is localized to the first of 3 extramembranous loops oriented towards the mitochondrial matrix as predicted by hydrophilicity plots (11). The amino acid that occupies this position (codon 55) is variable among members of the UCP gene family (alanine or valine for UCP2, tyrosine for UCP 1, and leucine for UCP3). Thus, this alteration in primary sequence may not alter UCP protein function. An additional consideration is that homozygosity for CC is associated with diabetes in Caucasians while the TT genotype is associated with glucose intolerance in African-Americans. The possibility

that differences in racial genetic background could cause one allele to be diabetogenic in Caucasians and the alternative allele to be diabetogenic in African-Americans is unlikely. It is possible that a distinct diabetogenic mutation arose in linkage disequilibrium with the C allele in Caucasians and with the T allele in African- Americans. An analogy would be a VNTR polymorphism at the insulin gene which marks a major susceptibility locus for Type 1 Diabetes, however, susceptibility appears to be conferred by an unidentified gene at this locus and not the candidate insulin gene per se (20). Even so, a causal role for UCP2 (C 164T) cannot currently be excluded.

Both UCP2 and UCP3 are localized to a gene-rich locus on chromosome 11 (1 lql3). This region also contains a susceptibility locus for Type 1 Diabetes (16) and is linked to fasting and 2-hour post-glucose challenge serum insulin levels in Pima Indians (Pratley et al. unpublished data). The corresponding syntenic region (including the UCP2 gene) in the mouse located on chromosome 7 has been mapped to quantitative trait loci for obesity in both the EI/Suz strain (28) and in congenic strains of BSB mice (30), and for glucose-stimulated insulin secretion and diabetes in C57BL/6J (B/6J) mice (25). The high relative risk, the achievement of statistical significance for the association despite relatively small sample populations, and the fact that the association was independently observed in 2 racial groups indicate that the UCP2 polymorphism. may mark an important diabetes gene at this locus.

In addition, association was observed between UCP2 genotype and measures of obesity in both Caucasians and African-Americans. Specifically, homozygosity for the C allele was associated with higher BMI (p=0.015) in female Caucasians, and higher percent body fat (P=0.007) in African-Americans. The association, however, did not achieve statistical significance for percent body fat in Caucasians (males and females) and for BMI in African-Americans. It is not clear why UCP2 is associated with only one measure of obesity in Caucasians and the other measure in African-Americans except that BMI and percent body fat are different anthropometric parameters; BMI reflects the sum of fat and lean body mass as a function of height while percent body fat quantifies only fat mass as a component of body composition. For example, the quantitative impact of gender is much greater for percent body fat than BMI. It is

possible, therefore, that a single gene mutation could influence these measures differently in different racial groups. Interestingly, the UCP2 polymorphism (CC genotype) was also associated with higher diastolic blood pressure (p=0.023), an obesity-related trait, in Caucasian females.

Linkage for polymorphic markers in the vicinity of UCP2 with energy expenditure in Caucasian sib-pairs has recently reported (12). Specifically, linkage was found between resting metabolic rate and markers Dl 1S911 (p=0.000002), D1 lS916 (p=0.006), and D lS1321 (p=0.02), and, in addition, marker Dl 1 S 1321 was linked to both percent body fat (p=0.04) and fat mass (p=0.02). Therefore, it is likely that UCP2 or another gene in this region contributes to the maintenance of energy balance and obesity. The present data supports this contention in both Caucasians and African- Americans. However, recently reported lack of linkage between obesity and polymorphic markers in the region containing UCP2 on chromosome 11 ql3 in 42 families of Northern European descent (14). Furthermore, no associations with diabetes or obesity were found in a recent study of Danish Caucasians (29). However, upon close examination of these latter data, trends can be noted between CC homozygotes and heterozygotes and fat mass (p=0.07), fasting plasma glucose (p=0.08), and serum insulin (p=0.07). Also, a trend between fasting serum triglyceride (p=0.08) and TT homozygotes can be seen. Perhaps larger numbers of subjects and stratification of the population by gender would have resulted in significant differences.

It is conceivable that this UCP2 gene variant is not associated with diabetes or obesity in the Northern European population while it is associated with a Caucasian population of a different origin and African-American populations; therefore conflicting linkage and association studies are possible.

Obesity is an important risk factor for the development of Type II Diabetes (17) and, therefore, association with both diabetes and obesity would not be unexpected for any single diabetogenic gene. Linkage with both diabetes and BMI has been observed at a more telomeric locus on chromosome 11 (1 lq23-25) in the Pima Indians (Hanson et al. unpublished data). In the current study, homozygosity for the CC UCP2 genotype was associated with both diabetes and obesity in Caucasian females. However, this

relationship does not apply to African-Americans; while the CC genotype was correlated with higher percent body fat, it was the TT genotype that was associated with a greater risk of glucose intolerance. Among several possible explanations are that there may be separate diabetes and obesity causal mutations at this locus or that a single mutation exerts different metabolic effects in different racial groups or in different genders. Further research is necessary at this locus to elucidate the basis for these associations involving the UCP2 polymorphism.

Table 2: Sample Sizes for Stratified Analysis Between the Two Populations Studied (Caucasian, African-Americans) and Gender.

Caucasian African-American Males Females Males Females Genotype CC CT TT CC CT TT CC CT TT CC CT TT Frequency 49 44 7% 55 32 13 33 40 27 54 27 19 SampleSize 20 18 3 31 18 7 5 6 4 20 10 7 Totals 41 56 15 37 Note-Genotype frequency distributions are not significantly different between strata, p=0.254.

Table 3: ANOVA p-values Comparing Quantitative Traits Among CC, CT, and TT Genotypes in Caucasians and African Americans.

Caucasians African Americans All Males Females All Males Females Measures of Obesity: Body. Mass Index 0.190 0.685 0.04212 0.461 0.447 0.729 Percent Body Fat 0.401 0.739 0.103l2 0.081' I-lip 0.913 0.124 0.353 0.142 0.794 0.131 Waist 0.536 0.543 0.279 0.233 0.551 0.142 Waist to Hip Ratio 0.396 0.601 0.575 0.688 0.267 0.506 Blood Pressure: Systolic 0.247 0.219 0.281 0.683 0.223 0.884 Diastolic 0.192 0.676 0.068 0.491 Mean Arterial 0.153 0.478 0.111 0.689 Lipids: Triglycerides 0.439 0.431 0.616 0.141 0.242 0.651 Total Cholesterol 0.512 0.894 0.170 0.741 0.883 0.680 LDL 0.856 0.770 0.378 0.308 0.889 0.317 HDL 0.487 0.267 0.107 0.299 Oral Glucose Tolerance Test: Fasting Plasma Glucose 0.131 0.177 0.510 0.0783 0.428 0.174 2hr Glucose (OGTT) 0.072 0.127 0.442 0. oD23 0.303 0.285 Fasting Serum Insulin 0.407 0.890 0.477 0.502 0.392 0.807 2hr Insulin (OGTT) 0.616 0.758 0.472 0.120 0.843 0.089' 'Genotype CC exhibits a higher mean than the other genotypes in post hoc planned comparison test.

2Genotype TT exhibits a lower mean than the other genotypes in post hoc planned comparison test.

3 Genotype TT exhibits a higher mean than the other genotypes in post hoc planned comparison rest.

Table 4: Post Hoc Comparisons for ANOVA Differences and Trends at p < 0.10 Among CC, CT and TT Genotypes. p-values Variable CC vs others TT vs others Caucasians All Subjects 2hr Glucose (OGTT) 0.086 0.895 Females Body Mass Index 0.038 0.015 Percent Body Fat 0.053 0.055 Diastolic BP 0.017 0.305 Mean Arterial Pressure 0.047 0.639 African-American All Subjects Percent Body Fat 0.007 0.242 HDL 0.058 0.056 Fasting Plasma Glucose 0.576 0.031 2hr Glucose (OGTT) 0.554 0.036 Males Diastolic BP 0.102 0.842 Females Percent Body Fat 0.032 0.519 2hr Insulin (OGTT) 0.891 0.062

Example 3 Background The six coding exons of UCP3 were examined for mutations in families with early-onset severe obesity and Type II Diabetes Mellitus. A missense mutation was identified in a fifteen-year-old morbidly obese and diabetic proband of Chinese descent.

Another 3 mutations were detected in African-American families with severe obesity and diabetes including missense, stop-codon, and splice donor mutations. All mutations were unique except for a missense variant in exon 3 (G304A) that was found to have an allele frequency of 18% in African-Americans. This latter variant was not detected in Caucasian-Americans and was found to have a similar allele frequency in the Mende Tribe of Sierra Leone.

As an uncoupler of oxidative phosphorylation in skeletal muscle, UCP3 has the potential to play an important role in energy balance and determination of body weight.

Accordingly, UCP3 has been shown to be regulated by thyroid hormone, p3-adrenergic agonists, leptin, and fat-feeding in rodents (31,33). Furthermore, rats fed high fat diet showed 2-fold increase of UCP3 expression in skeletal muscle possibly as a defense mechanism against obesity and impairment of glucose metabolism (34). In humans, significant linkage has been reported between markers at the UCP2/UCP3 gene locus with resting metabolic rate (Dl 1S911, p=0.000002) (12). This region is syntenic to a region of mouse chromosome 7 that has been linked to hyperinsulinemia and obesity (15). Thus, UCP3 is a new compelling candidate gene for human obesity. To date, the only reported genetic defects, directly associated with human obesity, were congenital leptin (35,36) deficiency caused by a frameshift mutation in two related children"and mutations found in the human prohormone convertase 1 gene (38). To determine whether UCP3 mutations could contribute to human obesity, the gene was sequenced in children and young adults with severe obesity and Type 2 Diabetes Mellitus (DM).

The nucleotide sequence of all six coding exons was determined in 40 individuals. This revealed four mutations in three young probands with morbid obesity and diabetes and Figure 5 delineates the mode of transmission in nuclear families. For sequence analyses, a 6.5 Kb fragment containing all six coding exons of the gene was

generated by long PCR. Bi-directional sequences from each exon were aligned and compared with the coding regions and splice junctions of the UCP3 gene (GenBank Accession numbers: U84763 and AF011449, AF012202). All mutations detected were confirmed by manual sequencing (Figure 6). A heterozygous missense mutation, C208T in exon 3 of the gene, was detected in the first proband, a fifteen-year-old patient with Type 2 DM and Body Mass Index (BMI) of 51.0 (Figures 5A and 6A).

The mutation results in a non-conservative amino acid substitution of the arginine residue in position 70 by tryptophan (Arg70Trp). This diabetic and morbidly obese patient is of Chinese descent but follows western dietary habits. The same mutation was identified in the father who is also diabetic but with a much lower BMI of 24.1.

Both parents of the proband were born in the Republic of China and they strictly adhere to dietary habits of their native country with emphasis on vegetables and low fat foods.

While the precise role of UCP3 in obesity and Type 2 DM has not been elucidated, mRNA levels for both UCP2 and UCP3 have been shown to increase 2.5- fold during fasting in obese and lean humans suggesting a role for the two genes in metabolic adaptation to fasting (39). In rodent skeletal muscle, UCP3 expression decreased by 81 % after one week of 50% food reduction and, paradoxically, increased 5.5-fold by fasting in association with maintenance of thermogenesis measured in muscle in vitro (40). It is, therefore, feasible that inactive individuals with genetic defects in UCP3 might be unable to normally regulate UCP3 and energy expenditure in response to a high fat diet, leading to weight gain as evident in the proband above. An additional 200 individuals comprising both genders (63 African-Americans and 137 Caucasians) were examined for presence of the C208T mutation but no other individuals were detected.

Two different missense mutations were detected in the second proband, an African-American patient with morbid obesity and diabetes at the age of 16. A heterozygous missense mutation (C427T) was identified in exon 4 of UCP3 (Figure 6B) resulting in termination of translation of the gene caused by introduction of a premature stop codon at the residue 143 (Argl43stop). In addition, another heterozygous mutation (guanine to adenine) was identified in the same patient at the splice-donor site of exon 6 (Ggl-Gat) resulting in loss of the splice junction and premature termination of the protein product (Figure 6C). Coincidentally, any putative

protein resulting from this mutation would be analogous to that of the short form of the UCP3 gene (UCP3S) (26). Pedigree analysis (Figure 5B) and DNA sequence determination of family members showed that the Argl43stop mutation was transmitted to the proband from the grandmother, through the mother, in typical Mendelian fashion. The other heterozygous mutation at the exon 6-splice donor site (Ggt-Gat) was not detected in the maternal lineage and must have been transmitted from the father or, less likely, have arisen spontaneously. Paternal DNA was not available for analyses. The patient is, therefore, compound heterozygous for two mutations that preclude transcription of the long form of UCP3 (UCP3L). Whether UCP3S mRNA in wild type individuals or the allele containing the exon 6 splice donor mutation, are able to direct the translation of a functional uncoupling protein is unknown. Muscle tissue was not available for mRNA and protein isolation. In both instances, the putative UCP3 protein product would be lacking one of six transmembrane domains and a portion of the protein that corresponds to an important functional domain in uncoupling proteins (1). An additional 168 individuals comprising both genders (60 African-Americans and 108 Caucasians) were examined for presence of the C427T mutation but no other individuals were detected.

A different missense polymorphism was detected in the third African-American family with early-onset obesity and Type 2 DM (Figures 5C and 6D). A heterozygous polymorphism, G304A, was identified in exon 3 of the diabetic and obese (BMI: 37.0) mother. The polymorphism resulted in a conservative amino acid substitution of a valine by an isoleucine at residue 102 (Vall02I1e). Sequence determination in the three obese children (BMIs of 44.7,29.2 and 26.1) showed that they were homozygous for the VaII02IIe polymorphism (Figure 5C: individuals 3,4 and 5). The fourth child was a 9-year-old male, had a BMI of 18.5 and was heterozygous for the Vall0211e polymorphism. No paternal sample was available and it is likely that the father was at least heterozygous for the Va1102I1e polymorphism. There is a characteristic trend of increasing BMI with increasing age in the children with the homozygous Val 102Ile polymorphism suggesting that it contributes to increasing obesity during adolescence.

To assess the frequency of the G304A polymorphism, exon 3 was amplified from genomic DNA in 128 American-Caucasians and digested with Tthl l l Irestriction endonuclease. The polymorphism was not detected in any individual in this population.

However, examination in 280 African-Americans revealed that 4% of the individuals were homozygous and 28% heterozygous for the polymorphism (Table 5A). This latter sample was comprised of Gullah-speaking Americans who reside on the Sea Islands off the coast of South Carolina (13,41). This population is characterized by high incidence of obesity and Type 2 DM2 (42) and relative genetic homogeneity with Caucasian admixture estimated at <5% (13). The cultural, historical and linguistic record links Gullah-speaking African-Americans with rice cultivating tribes on the West Coast of Africa, including the Mende Tribe in Sierra Leone. The G304A polymorphism was also assessed in 180 members of the Mende Tribe. 3% of the population was found to be homozygous for AIA, whereas, 21 % of the population was GIA heterozygous (Table 5). A Chi-square test of homogeneity (X2 =3.1577, v =2, P=0.1871) indicated that the genotype distribution and allele frequencies (Table 5) were similar in the African-American and Mende populations. This similarity and the absence of this polymorphism in Caucasian-Americans suggests that G304A may have arisen on the African continent.

Figure 7 shows schematic representations of the UCP3 gene structure (26), putative topology of the protein product in the inner mitochondrial membrane (11,43- 45) and relative position of the four mutations described (C208T, Arg70Trp; G304A, Va1102I1e; C427T, Argl43stop; Ggt-Gat, exon 6 splice donor-stop). The C427T and exon 6 splice-junction mutations introduce terminal changes to UCP3 and truncate the protein product at the corresponding amino acids. The other two mutations in exon 3 also have the potential to affect the secondary structure of the protein. In particular, based on hydrophobicity and the segment singlet and pair preferences for the-helix or-strand (46), the Arg70Trp amino acid change is predicted to cause elongation of the corresponding-strand segment. The Va1102I1e mutation, on the other hand, abolishes a predicted-strand segment and introduces a new helix. Moreover, the four mutations described correspond to conserved amino acids in UCP1, UCP2, UCP3S UCPL, except the Arg70Trp mutation where a lysine replaces an arginine in the wild type UCP1

sequence. Lysine and arginine residues have previously been shown to be critical for UCP function, as is the case for many other regulatory proteins. Specifically, three arginines in transmembrane domains 2,4 and 6 have been shown to be essential for nucleotide binding and inhibition in UCPI (43,47,48). Furthermore, a single mutation of Arg276 in rat UCP 1 has been shown to abolish GDP 27 sensitivity of H+ transport (49). It is, therefore, possible that the Arg70Trp mutation might abolish functional properties of UCP3 in a similar fashion.

In summary, of the four mutations detected in the UCP3 gene, two introduce signals for premature termination of translation and two are missense mutations. These mutations were found in individuals with early-onset severe obesity and type 2 DM and cosegregate with these traits in the respective pedigrees. These observations are consistent with previous reports regarding UCP3 gene regulation, protein function and homology to UCP1, that suggest a role for UCP3 in the regulation of energy expenditure and body weight, as well as linkage between this gene locus and obesity/diabetes traits demonstrated in mice and humans (12,15). The data further suggest that there could be an interaction between diet and the Arg70Trp mutation for the development of obesity in the Chinese-American family and between age, obesity and the Va1102I1e gene variant in the African-American family. The detection of multiple mutations in African-American patients indicates that the UCP3 gene could constitute an important obesity/diabetes gene in this racial group. This particularly applies to the Vall0211e variant in both the African-American and Sierra Leonese sample populations, which presents an opportunity to study potential interactions between environment and gene variants to explain any differences in the prevalence of obesity and diabetes.

Methods Subjects and clinical characteristics. The study was approved by the Institutional Review Boards at the Medical University of South Carolina and the University of Sierra Leone and all participating individuals gave informed consent.

Type 2 diabetes mellitus status was established according to the National Diabetes Data Group (22) or by measuring glycosylated hemoglobin levels (50). Body Mass Index

(BMI) is the body weight (Kg) divided by height (M2). DNA was isolated from 3 ml of peripheral blood collected locally from volunteers residing in the District of Kenema in Sierra Leone who were members of the Mende tribe.

Amplification of genomic DNA and sequence determination. For UCP3 gene sequence determination, genomic DNA was isolated from peripheral blood using a standardized DNA isolation kit (Gentra Systems, Minneapolis, MN). DNA was also isolated from filter-dot-blotted blood drops also using a standardized DNA isolation kit (Gentra Systems, Minneapolis, MN). The polymerase chain reaction (PCR) was employed to generate sequencing templates comprising the entire coding region of the UCP3 gene. PCR and sequencing primers were designed, as previously described (10), using the UCP3 cDNA sequence with GenBank Accession No.: U84763. A 6.5 kb PCR product was generated by long PCR (Boehringer Mannheim, Indianapolis, IN) using the following primer pair: 94f 5'-AGCAGCCTCTCTCCTTGGACCTC-3' (SEQ ID NO: 10) and 1161r : 5'-GATGCACCGTTTTCTTCCAT-3' (SEQ ID NO: 11). The following primers were used to obtain bi-directional DNA sequences: exon 2: 94f and ucp3e2r: 5'-TGTCAGGGTTCTGAGGAAGG-3 (SEQ ID NO: 12); exon 3: ucp3e3f 5'- TGACCAGCATGGTTGTTCTA-3' (SEQ ID NO: 13) and ucp3e3r: 5'- CCTGGTCTGCCTCTGAGTCT-3' (SEQ ID NO: 14); exon 4: ucp3e4f 5'- ATGAGGAGGCTCTGAGTGGA-3' (SEQ ID NO: 15) and ucp3e4r: 5'- TCAGAATCACTGGAACACGC-3' (SEQ ID NO: 16); exon 5: ucp3e5f 5'-GCAC TATGGCCCCAAAACT-3' (SEQ ID NO: 17) and ucp3e5r: 5'- CTTTCCTGCTTGTCACCACA-3' (SEQ ID NO: 18); exon 6: ucp3e6f 5'- GGGCACTGTGAGAGATATGGA-3' (SEQ ID NO: 19) and ucp3e6r: 5'- CAGCTGACCCACGG TAG-3' (SEQ ID NO: 20); exon 7: ucp3e7f 5'- AAAGGATTCAGAAAATGCTTGTG-3' (SEQ ID NO: 21) and 1161 r. All DNA sequence determinations were performed using an ABI 373 automated sequencer.

Mutations and polymorphisms were confirmed by manual sequencing using a standardized commercial kit (Perkin Elmer, Foster City, CA). All sequence assembly and manipulations were conducted using the GeneWorks software (IntelliGenetics Inc, Mountain View, CA) and the Baylor College BCM Search Launcher at: http: Hgc. bcm. tmc. edu: 8088/search-launcher/launcher. html.

Mutation screening: amplification & restriction digest of exons 3,4 and 6.

The following primers were used to amplify genomic DNA and generate a 376 bp PCR product containing the G304A polymorphism: ucp3e3jb: 5'- CCAGCAGGGTTCCTGTGC-3'and ucp3e3r. Taq DNA polymerase was purchased from GIBCO-BRL (Gaithersburg, MD) or QIAGEN (Santa Clarita, CA) and PCR conditions were set as prescribed by the manufacturers (at 1.5MM MgCI2). Rection samples (151 each) were denatured for 3 minutes at 95 °C and PCR was carried out for 35 cycles, each cycle consisting of three segments; 95 °C for 30 sec, 55 °C for 45 sec and 72°C for 60 sec. An additional extension period of 5 minutes at 72°C was applied upon completion of the 35 cycles. All PCR reactions were carried out in a 9600 thermal cycler (Perkin Elmer, Foster City, CA). To determine the G304A polymorphism, the above PCR products were directly digested with Tthl l l I restriction endonuclease, as prescribed by the manufacturer (New England Biolabs, Beverly, MA), in 20 1 volumes, for two hours at 65 °C.

Digested PCR products were loaded on to 4% agarose gels and visualized with ethidium. bromide (0.5 1/mol) under UV light. Restriction digestion of the 376 bp PCR product with Tth I I I I results in the following fragments: G/G homozygotes, 249 bp, 81 bp and 46 bp; A/A homozygotes, 295 bp and 81 bp. To detect the C208T mutation, exon three was amplified as above and digested with Pfl MI restriction endonuclease at 37°C for two hours resulting in the following fragments: C/C homozygotes, 376 bp; 777"homozygotes, 222 bp and 154 bp. To detect the C427T mutation, exon four was amplified with primers ucp3e4f and ucp3e4r and the 436 bp PCR product was digested with Ava II enzyme at 37 °C for two hours resulting in the following fragments: C/C homozygotes, 202 bp, 184 bp and 50 bp; 7/F homozygotes, 386 bp and 50 bp.

Table 5: Genotype and Allele Frequencies for the G304A Polymorphism in UCP31, Gullah-Speaking African Americans and in the Mende Tribe of Sierra Leone.

Genotype Frequencies* Gullah African-American Mende Tribe A/A 4% (11) 3% (5) G/A 28% (78) 21% (38) G/G 68% 191 76% 137 Total 100% (280) 100% (180) Allele Frequencies Gullah African-American Mende Tribe+ A-18% 13% G 82% 87% * Sample sizes for genotype frequencies are shown in parenthesis.

+ The genotype frequencies conform to Hardy-Weinberg equilibrium and are similar (p=NS) in the Gullah-Speaking African-American and the Mende populations.

REFERENCES 1) Cassard A-M, Bouillaud F, Mattei M-G, Hentz E, Raimbault S, Thimas M, Ricquier D: Human uncoupling protein gene: structure, comparison with rat gene and assignent to long arm of chromosome 4. J Cell Biochem 43: 255-264,1990.

2) Gimeno RE, Dembski M, Weng X, Deng N, Shyjan AM, Gimeno CJ, Iris F, Ellis SJ, Woolf EA, Tartaglia LA: Cloning and characterization of an uncoupling protein homologue: a potential molecular regulator of thermogenesis. Diabetes 46: 900-906,1997.

3) Vidal-Puig A, Solanes G, Grujic D, Flier JS, Lowell BB: UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and brown adipose tissue. Biochem Biophy Res Comm 23 5: 79-82,1997.

4) Chagnon YC, Peruse L, Bouchard D: Familial aggregation of obesity, candidate genes and quantitative trait loci. Curr Opin Lipidol 8 : 205- 211,1997.

5) Dong Z, Guitierrez-Ramos J-C, Coxon A, Mayadas T, Wagner D: A new class of obesity genes encodes leukocyte adhesion receptors. Proc Natl Acad Sci USA 94 : 7526-7530,1997.

6) Klaus S, Casteilla L, Bouillaud F, Ricquier D: The uncoupling protein UCP: a membranous mitochondrial ion carrier exclusively expressed in brown adipose tissue. Int JBiochem 23: 791-801 (1991).

7) Oppert J-M, Vohl M-C, Chagnon M, Dionne FT, Cassard-Doulcier A- M, Ricquier D, Perusse L, Bouchard C: DNA polymorphism in the uncoupling protein (UCP) gene and human body fat. Int J Obesity 18:526-531,1994.

8) Clement K, Ruiz J, Cassard-Doulcier A-M, Bouillaud F, Ricquier D, Basdevant A, GuyGrant B, Froguel P: Additive effect ofA-G (-3826) variant of the uncoupling protein gene and the trp64arg mutation of the ß3-adrenergic receptor gene on weight gain in morbid obesity. New Engl JMed 333: 352-354,1995.

9) Fumeron F, Durack-Brown 1, Betoulle D, Cassard-Doulcier A-M, Tuzet S, Bouillaoud F, Melchior J-C, Ricquier D, Apfelbaum M: Polymorphisms of uncoupling protein (UCP) and p3 adrenoreceptor genes in obese people submitted to a low calorie diet. Int J Obesity 20: 1051-1054,1996.

10) Argyropoulos G, Brown AM, Peterson R, Likes CE, Watson DK, Garvey WT Structure and organization of the human uncoupling protein 2 gene and identification of a common biallelic variant in Caucasians and African-Americans. Diabetes (in press).

11) Boss O, Samec S, Paoloni-Giacobino, A, Rossier C, Dulloo A, Seydoux J, Muzzin P, Giacobino J-P (1997) Uncoupling protein-3: a new member of the mitochondrial carrier family with tissue-specific expression.

FEBS Lett 408: 39-42.

12) Bouchard C, Perusse L, Chagnon YC, Warden C, Ricquier D (1997) Linkage between markers in the vicinity of the uncoupling protein 2 gene and resting metabolic rate in humans. Hum Mol Gen 6: 1887-1889.

13) Chakrabarty R, Kamboh MI, Nwankwo N, Ferrell RE (1995) Caucasian genes in American Blacks: new data. Am JHum Genet 50: 145-155.

14) Elbein SC, Leppert M, Hasstedt (1997) Uncoupling Protein 2 region on chromosome 11 qu 3 is not linked to markers of obesity in familial Type II diabetes.

15) Fleury C, Neverova M, Collins S, Raimbault S, Champigny 0, Levi- Meyrueis C, Bouillaud F, Selden MF, Surwit RS, Ricquier D, Warden CH (1997) Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nature Genet 15: 269-272.

16) Hashimoto L, Habita C, Beressi JP, Delepine M, Besse C, Cambon- Thomsen A, Deschamps I, Otter JI, Djoulah S, James MR, et al. (1994) Genetic mapping of a susceptibility locus for insulin-dependent Diabetes Mellitus on Chromosome llq. Nature 371: 161-164.

17) Knowler WC, Pettitt DJ, Saad MF, Charles MA, Nelson RG, Howard BV, Bogardus C, Bennett PH (1991) Obesity in the Pima Indians: its magnitude and relationship with diabetes. Am J Clin Nutr 53 (6 Suppl): 1543S-1551S.

18) Lackland DT, Orchard TJ, Keil JE, Saunders DE, Wheeler FC, Adams- Cambell LL, McDonald RH, Knapp RG (1992) Are race differences in the prevalence of hypertension explained by body mass and fat distribution? A survey in a biracial population. Int JEpid 21: 236-241.

19) Levin BE and Routh VH (1996) Role of the brain in energy balance and obesity. Am JPhysiol 271: R491-R500.

20) Lucassen AM, Julier C, Beressi J-P, Boitard C, Froguel P, Lathrop M, Bell JI (1993) Susceptibility to insulin dependent diabetes mellitus maps to a 4.1 kb segment of DNA spanning the insulin gene and associated VNTR. Nature Genet 4: 305-310.

21) The Mayo Foundation (1981) Mayo Clinic Diet Manual, 5th edition. WB Saunders Co., Philadelphia PA page 279.

22) National Diabetes Data Group (1979) Classification and diagnosis of diabetes and other categories of glucose intolerance. Diabetes 28: 1039- 1057.

23) Pollitzer WS (1958) The negroes of Charleston (SQ: a study of hemoglobin types, serology, and morphology. Am JPhysical Anthropol 16: 241-263.

24) Ravussin E, Swinburn BA (1992) Pathophysiology of obesity. Lancet 340: 404-408.

25) Seldin MF, Mott D, Bhat D, Petro A, Kuhn CM, Kingsmore SF, Bogardus C, Opara E, Feinglos MN, Surwit RS (1994) Glycogen synthase: a putative locus for diet-induced hyperglycemia. J Clin Invest 94: 269-276.

26) Solanes G, Vidal-Puig A, Grujic D, Flier JS, Lowell BB (1997) The human uncoupling protein-3 gene: genomic structure, chromosome localization, and genetic basis for short and long form transcripts. JBiol Chem 272: 25433-25436.

27) Solomon CG and Manson JE (1997) Obesity and mortality: a review of the epidemiologic data. Am J Clin Nutr 66 (4 Suppl): 1044S-1050S.

28) Taylor BA and Phillips SJ (1996) Detection of obesity QTLs on mouse chromosomes 1 and 7 by selective DNA pooling. Genomics 34: 389-398.

29) Urhammer SA, Dalgaard LT, Sorensen TIA, Moller AM, Andersen T, TybjXrg-Hansen A, Hansen T, Clausen JO, Vestergaard H, Pedersen 0 (1997) Mutational analysis of the coding region of the uncoupling protein 2 gene in obese NIDDM patients: impact of a common amino acid polymorphism on juvenile and maturity onset forms of obesity and insulin resistance. Diabetologia 40: 1227-1230.

30) Warden CH, Fisler JS, Shoemaker SM, Wen PZ, Svenson KL, Pace MJ, Lusis AJ (1995) Identification of four chromosomal loci determining obesity in a multifactorial mouse model. J Clin Invest 95: 1545-1552.

31) Gong, D-W., He, Y., Karas, M. & Reitman, M. Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, 3-adrenergic agonists and leptin. J. Biol. Chem. 272,24129-24131 (1997).

32) Silva, J. E. & Rabelo, R. Regulation of the uncoupling protein gene expression. Eur. J. Endocrinol. 136,251-264 (1997).

33) Larkin, S., Mull, E., Mia, W., Pittner, R., Albrandt, K., Moore, C., Young, A., Denaro, M & Beaumont, K. Regulation of the third member of the uncoupling protein family, UCP3, by cold and thyroid hormone.

Biochem. Biophys. Res. Commun. 240,222-227 (1997).

34) Matsuda, J., Hosoda, K., Itoh, H., Son, C., Doi, K., Tanaka, T., Fukunaga, Y., Inoue, G., Nishimura, H., Yoshimasa, Y., Yamori, Y. & Nakao, K. Cloning of rat uncoupling protein-3 and uncoupling protein-2 cDNAs: their gene expression in rats fed high-fat diet. FEBS 418,200- 204 (1997).

35) Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L. & Friedman, J. M. Positional cloning of the mouse obese gene and its human homologue. Nature 372,425-432 (1994).

36) Friedman, J. M. The alphabet of weight control. Nature 385,119-120 (1997).

37) Montague, C. T., Farooqi, S., Whitehead, J. P., Soos, M. A., Rau, H., Wareham, N. J., Sewter, C. P., Digby, J. E., Mohammed, S. N., Hurst, J. A., Cheetham, C. H., Earley, A. B., Barnett, A. H., Prins, J. B. & O'Rahilly, S.

Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387,903-908 (1997).

38) Jackson, R. S., Creemers, J. W. M., Ohagi, S., Raffin-Sanson, M-L., Sanders, L, Montague, C. T., Hutton, J. C. & O'Rahilly, S. Obesity and impaired prohormone processing associated with mutations in the human prohormone convertase I gene. Nature Genet 16,303-306 (1997).

39) Millet, L., Vidal, H., Andrenelli, F., Larrouy, D., Riou, J-P., Ricquier, D., Laville, M. & Langin, D. Increased uncoupling protein-2 and-3 mRNA expression during fasting in obese and lean humans. J Clin.

Invest. 100,2665-2670 (1997).

40) Boss, O., Samec, S., Kuhne, F., Bijlenga, P., Assimacopoulos-Jeannet, F., Seydoux, J., Giacobino, J-P., & Muzzin, P. Uncoupling protein-3 expression in rodent skeletal muscle is modulated by food intake but not by changes in environinental temperature. JBiol. Chem. 273,5-8 (1998).

41) Pollitzer, W. S., Boyle Jr, E., Cornoni, J. & Namboodiri, K. K. Physical anthropology of the Negroes of Charleston, S. C. Hum. Biol. 42,265-279 (1970).

42) Eberhardt, M. S., Lackland, D. T., Wheeler, F. C., German, R. R. & Teutsch, S. M. Is race related to glycemic control? An assessment of glycosylated hemoglobin in two South Carolina communities. J. Clin.

Epiderniol. 47,1181-1189 (1994).

43) Modriansky, M., Murdza-Inglis, D., Patel, H. V., Freeman, K. B. & Garlid, K. D. Identification by site-directed mutagenesis of three arginines in uncoupling protein that are essential for nucleotide binding and inhibition. JBiol. Chem. 272,24759-24762 (1997).

44) Winkler, E., Wachtel, E. & Klingenberg, M. Identification of the pH sensor for nucleotide binding in the uncoupling protein from adipose tissue. Biochemistry 36,148-155 (1997).

45) Klingenberg, M. Mechanisms and evolution of the uncoupling protein of brown adipose tissue. Trends. Biochem. Sci. 15,108-112 (1990).

46) Solovyev, V. V. & Salamov, A. A. Predicting-helix and-strand segments of globular proteins. CABIOS 10,661-669 (1994).

47) Jezek, P., Hanus, J., Semrad, C. & Garlid, K. D. Photoactivated azido fatty acid irreversibly inhibits anion and proton transport through the mitochondrial uncoupling protein. JBiol. Chem. 271,6199-6205 (1996).

48) Jezek, P., Orosz, D. E., Modriansky, M. & Garlid, K. D. Transport of anions and protons by mitochondrial uncoupling protein and its regulation by nucleotides and fatty acids. A new look at old hypotheses.

JBiol. Chem. 269,26184-26190 (1994).

49) Murdza-Inglis, D. L., Modriansky, M., Patel, H. V., Woldegiorgis, G., Freeman, K. B. & Garlid, K. D. A single mutation in uncoupling protein of rat brown adipose tissue mitochondria abolishes GDP sensitivity of H' transport. JBiol. Chem. 269,7435-7438 (1994).

50) Peters, A. L., Davidson, M. B., Schriger, D. L. & Hasselblad, V. A clinical approach for the diagnosis of diabetes mellitus: an analysis using glycosylated hemoglobin levels. Meta-analysis research group on the diagnosis of diabetes using glycated hemoglobin levels. JAMA 276, 1246-1252 (1996).

Table 6. Primers were designed using the Primer 3 program (Steve Rozen, Helen J. Skaletsky, 1996,1997: code available at: http://www- genome. wi. mit. edu/ genome software/other/primer3. html) and were used to amplify'genomic fragments and to determine the sequence2 of the UCP2 gene.

Primer name Sequence (5'-3') hucp21f: GGACGTAGCAGGAAATCAGC (SEQ ID NO: 23) hucp21r: CAGAGGTGATCAGGTCAGCA (SEQ ID NO: 8) 48f GTTTCTTGGGGCTGGCACAG (SEQ ID NO: 24) 377f GCCCCCGAAGCCTCTACAAT (SEQ ID NO: 25) 443f GCATCGGCCTGTATGATTCT (SEQ ID NO: 26) 473f TCTACACCAAGGGCTCTGAG (SEQ ID NO: 27) 1510f ACAAGACCATTGCCCGAGAG (SEQ ID NO: 28) 1637f GACCTCTCCCAATGTTGCTC (SEQ ID NO: 29) 1709f TGCCCTCCTGAAAGCCAACC (SEQ ID NO: 30) 2462f GCACCACTGTCATCGCCTCC (SEQ ID NO: 31) 2978f TCCTTTCTCCGCTTGGGTTC (SEQ ID NO: 32) 3179f TCCTTCCCTCTTTCCCCACC (SEQ ID NO: 33) 5'UTRf AGCTTTGAAGAACGGGACAC (SEQ ID NO: 7) 19r TGGCCTTGAACCCAACCATGA (SEQ ID NO: 34) 492r CTCAGAGCCCTTGGTGTAGA (SEQ ID NO: 9) 1535r CCTTCCTCTCGGGCAATGGT (SEQ ID NO: 35) 1728r GGTTGGCTTTCAGGAGGGCA (SEQ ID NO: 36) 2481r GGAGGCGATGACAGTGGTGC (SEQ ID NO: 37) 2981r GAGGGCATGAACCCTTTGTA (SEQ ID NO: 38) 2997r GAACCCAAGCGGAGAAAGGA (SEQ ID NO: 39) 1449r GACCTTTACCACATCCGTGG (SEQ ID NO: 40) 2565r GAGCATGGTAAGGGCACAGT (SEQ ID NO: 41) 'PCR reactions to amplify cDNAs were performed using 20 pmoles of each primer, 250 pM of each of the four dNTPs, 1.5 mM MgCl2,0.15 units of Taq DNA polymerase (Gibco-BRL, Gaithersburg, MD), and Ix PCR buffer provided by the manufacturer (Gibco-BRL, Gaithersburg, MD). After an initial denaturation step (94°C, 3 minutes), PCR was carried out for 35 cycles, each cycle consisting of 3 steps ouf 95 C for 45 sec., 56°C for 60 sec., and 72°C for 90 sec. An extension step of 72°C for 5 minutes was performed upon completion of the 35 cycles.

2Automated sequencing was performed on an ABI Prism 373 sequencer (Perkin-Elmer, Foster City, CA) using the Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin- Elmer, Foster City, CA), with the following modifications; a denaturation step ouf 94'C for 2 min. was followed by 30 amplification cycles consisting of 94 ° C for 15 sec., 55 ° C for 20 sec., and 62 °C for 4 min. Manual sequencing was performed using the Amplicycle DNA sequencing kit as specified by the manufacturer (Perkin-Elmer, Foster City, CA).