METHODS AND MATERIALS FOR ASSESSING AND TREATING CANCER

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Patent Application Serial No. 62/745,935, filed on October 15, 2018. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application.

STATEMENT REGARDING FEDERAL FUNDING

This invention was made with government support under CA121113, CA006973, and CA180950 awarded by National Institutes of Health. The government has certain rights in the invention.

BACKGROUND

1. Technical Field

This document relates to methods and materials for assessing and/or treating mammals (e.g., humans) having cancer. For example, this document provides methods and materials for identifying a mammal as being likely to respond to a particular cancer treatment, and, optionally, the mammal can be treated.

2. Background Information

Ovarian cancer is the most common cause of death among gynecological cancers. Despite significant advances in therapies for other solid tumor malignancies, the overall survival of patients with late-stage ovarian cancer has remained dismal with few new options for treatment. The standard therapy involves debulking surgery followed by chemotherapy. Part of the reason for the lack of novel therapies for ovarian cancer has been an inadequate understanding of the underlying molecular characteristics of this disease, especially in the context of cancer cell models than can facilitate the development of various cancer treatments.

Recent studies have highlighted the genomic complexity and heterogeneity of ovarian cancer. These have included a catalog of sequence mutations, focal changes in DNA copy number, gene expression, and methylation alterations in high grade serous ovarian cancer (Network, 2011 Nature 474:609-615), as well as whole exome analyses of ovarian clear cell carcinoma and low grade serous carcinoma (Jones et ak, 2012./. Pathol. 226:413- 420; and Jones et ak, 2015 Science Translational Medicine 7:283ra53). Genome-wide sequence analyses of high grade serous ovarian cancer identified drivers associated with primary and acquired resistance to chemotherapy (Patch et ak, 2015 Nature 521 :489-494; Labidi-Galy et ak, 2017 Nature communications 8: 1093). More recently, a catalog of proteomic alterations in high grade serous TCGA samples has been integrated with structural alterations and correlated with clinical outcomes (Zhang et ak, 2016 Cell 166:755-765). Hypothesis-generating pharmacogenomic studies involving cancer cell lines, some of which were ovarian, have revealed genetic- and expression-based alterations associated with resistance or sensitivity to a panel of drugs (Garnett et ak, 2012 Nature 483:570-575; and Barretina et ak, 2012 Nature 483:603-607). More recent cell line studies have evaluated high grade serous, clear cell and other cancers using targeted genomic and other molecular analyses (Domcke et ak, 2013 Nature Communications 4:2126; Anglesio et ak, 2013 PloS one 8:e72l62; and Ince et ak, 2015 Nature communications 6:7419). These initial efforts were extended to demonstrate the similarity of molecular alterations in cell lines to those in corresponding tissues, to develop approaches for incorporating multiple data types to model sensitivity, and to apply these models to larger drug panels (Iorio et ak, 2016 Cell 166:740- 754). Despite these advances, a comprehensive analysis of genome-wide structural alterations, including intra- and interchromosomal translocations and gene fusions, and integration of these data with whole-exome sequence, epigenetic and expression information are not available for many histological subtypes of ovarian cancer. Furthermore, the therapeutic response of these ovarian cancer subtypes to common targeted therapies is not well understood. SUMMARY

This document provides methods and materials for assessing and/or treating mammals (e.g., humans) having cancer. For example, a sample (e.g., a sample obtained from a mammal having or suspected of having a cancer) can be assessed for the presence or absence of one or more structural alterations. For example, this document provides methods and materials for identifying a mammal as being likely to respond to a particular cancer treatment, and, optionally, the mammal can be treated. In some cases, a mammal can be identified as having a cancer that is likely to respond to one or more poly(ADP-ribose) polymerase (PARP) inhibitors, based at least in part, on the mammal having one or more cancer cells having a MFC amplification (e.g., a focal MYC amplification), and, optionally, the mammal can be treated by administering one or more PARP inhibitors to the mammal. In some cases, a mammal can be identified as having a cancer that is likely to respond to one or more PARP inhibitors, based at least in part, on the mammal having one or more cancer cells having one or more genome-wide rearrangements, and, optionally, the mammal can be treated by administering one or more PARP inhibitors to the mammal. In some cases, a mammal can be identified as having a cancer that is likely to respond to one or more mitogen-activated protein kinase (MEK) inhibitors, based at least in part, on the mammal having one or more cancer cells having one or more modifications (e.g., one or more loss-of- function modifications) in SMAD3 and/or SMAD4 , and, optionally, the mammal can be treated by administering one or more MEK inhibitors to the mammal. In some cases, a mammal can be identified as having a cancer that is likely to respond to one or more phosphatidylinositol 3-kinase (PI3K) inhibitors, based at least in part, on the mammal having one or more cancer cells having one or more modifications (e.g., one or more loss-of- function modifications) in PI3K CATALYTIC, ALPHA (PIK3CA) and/or protein phosphatase 2 scaffold subunit alpha (PPP2R1A), and, optionally, the mammal can be treated by administering one or more PI3K inhibitors to the mammal.

As demonstrated herein, a novel approach (e.g., Trellis) can be used for genomic analyses (e.g., detection of somatic sequence and structural changes) of tumors lacking matched normal samples. For example, genome-wide sequencing analyses of 45 ovarian cancer cell lines of varying subtypes was performed, Trellis was used for detection of somatic sequence and structural changes, and the detected somatic sequence and structural changes were integrated with epigenetic and expression alterations. Genetic modifications not previously implicated in ovarian cancer that are biologically and clinically relevant included amplification or overexpression of ASXL1 and H3F3B , deletion or underexpression of CDC73 and TGF beta receptor pathway members, and rearrangements of YAP1-MAML2 and IKZF2-ERBB4. Dose-response analyses to targeted therapies revealed novel molecular dependencies, including increased sensitivity of tumors with PIK3CA and PPP2R1A alterations to PI3K inhibitor GNE-493, MYC amplifications to PARP inhibitor BMN673, and SMAD3/4 alterations to MEK inhibitor MEK162. Also as demonstrated herein, genome- wide rearrangements provided an improved measure of sensitivity to PARP inhibition rather than the currently used homologous recombination deficiency (HRD) score.

The ability to identify genetic modifications not previously implicated in particular cancers provides clinicians with opportunities to detect cancers at earlier stages, to treat subjects more effectively, and/or to develop new therapeutics.

In some embodiments, provided herein are methods for assessing therapeutic benefit of a therapeutic regimen that includes a PARP inhibitor in a subject that include: detecting the presence of a MYC amplification in a tumor sample obtained from the subject, and identifying that the subject will have a predicted therapeutic benefit from the PARP inhibitor when the presence of the MYC amplification is detected in the tumor sample, wherein the therapeutic benefit for the subject is improved relative to the therapeutic benefit of the PARP inhibitor for a reference subject having a corresponding reference tumor sample that does not exhibit the MYC amplification. In some embodiments, provided herein are methods for assessing therapeutic benefit of a therapeutic regimen that includes a PARP inhibitor in a subject that include: detecting the presence of a plurality of genome-wide rearrangements in a tumor sample obtained from the subject, and identifying that the subject will have a predicted therapeutic benefit from the PARP inhibitor when the presence of the plurality of genome-wide rearrangements is detected in the tumor sample, wherein the therapeutic benefit for the subject is improved relative to the therapeutic benefit of the PARP inhibitor for a reference subject having a corresponding reference tumor sample that does not exhibit the plurality of genome-wide rearrangements. In some embodiments, provided herein are methods for assessing therapeutic benefit of a therapeutic regimen comprising a PARP inhibitor in a subject determined to have a MYC amplification in a tumor sample obtained from the subject that include: identifying that the subject will have a predicted therapeutic benefit from the PARP inhibitor when the presence of the MYC amplification is detected in the tumor sample, wherein the therapeutic benefit for the subject is improved relative to the therapeutic benefit of the PARP inhibitor for a reference subject having a corresponding reference tumor sample that does not exhibit the MYC amplification. In some embodiments, provided herein are methods for assessing therapeutic benefit of a therapeutic regimen comprising a PARP inhibitor in a subject determined to have a plurality of genome-wide rearrangements in a tumor sample obtained from the subject that include: identifying that the subject will have a predicted therapeutic benefit from the PARP inhibitor when the presence of the plurality of genome-wide rearrangements is detected in the tumor sample, wherein the therapeutic benefit for the subject is improved relative to the therapeutic benefit of the PARP inhibitor for a reference subject having a corresponding reference tumor sample that does not exhibit the plurality of genome-wide rearrangements. In some embodiments, the PARP inhibitor is one or more of talazoparib (BMN-673), olaparib (AZD-2281), rucaparib (PF- 01367338), niraparib (MK-4827), veliparib (ABT-888), CEP 9722, E7016, BGB-290, iniparib (BSI 201), 3-aminobenzamide, and combinations thereof.

In some embodiments, provided herein are methods for assessing therapeutic benefit of a therapeutic regimen that includes a MEK inhibitor in a subject that include: detecting the presence of a SMAD3 or SMAD4 mutation in a tumor sample obtained from the subject, and identifying that the subject will have a predicted therapeutic benefit from the MEK inhibitor when the presence of the SMAD3 or SMAD4 mutation is detected in the tumor sample, wherein the therapeutic benefit for the subject is improved relative to the therapeutic benefit of the MEK inhibitor for a reference subject having a corresponding reference tumor sample that does not exhibit the SMAD3 or SMAD4 mutation. In some embodiments, provided herein are methods for assessing therapeutic benefit of a therapeutic regimen that includes a MEK inhibitor in a subject determined to have a SMAD3 or SMAD4 mutation in a tumor sample obtained from the subject that include: identifying that the subject will have a predicted therapeutic benefit from the MEK inhibitor identifying that the subject will have a when the presence of the SMAD3 or SMAD4 mutation is detected in the tumor sample, wherein the therapeutic benefit for the subject is improved relative to the therapeutic benefit of the MEK inhibitor for a reference subject having a corresponding reference tumor sample that does not exhibit the SMAD3 or SMAD4 mutation. In some embodiments, the MEK inhibitor is one or more of binimetinib (MEK 162), trametinib (GSK1120212), cobimetinib (XL518), selumetinib, PD-325901, CI-1040, PD035901, TAK-733, and combinations thereof.

In some embodiments, provided herein are methods for assessing therapeutic benefit of a therapeutic regimen that includes a PI3K inhibitor in a subject that include: detecting the presence of a PIK3CA or PPP2R1 A mutation in a tumor sample obtained from the subject, and identifying that the subject will have a predicted therapeutic benefit from the PI3K inhibitor identifying that the subject will have a when the presence of the PIK3CA or PPP2R1 A mutation is detected in the tumor sample, wherein the therapeutic benefit for the subject is improved relative to the therapeutic benefit of the PI3K inhibitor for a reference subject having a corresponding reference tumor sample that does not exhibit the PIK3CA or PPP2R1 A mutation. In some embodiments, provided herein are methods for assessing therapeutic benefit of a therapeutic regimen that includes a PI3K inhibitor in a subject determined to have a PIK3CA or PPP2R1 A mutation in a tumor sample obtained from the subject that include: identifying that the subject will have a predicted therapeutic benefit from the PI3K inhibitor identifying that the subject will have a when the presence of the PIK3CA or PPP2R1 A mutation is detected in the tumor sample, wherein the therapeutic benefit for the subject is improved relative to the therapeutic benefit of the PI3K inhibitor for a reference subject having a corresponding reference tumor sample that does not exhibit the PIK3CA or PPP2R1 A mutation. In some embodiments, the PI3K inhibitor is one or more of GNE-493, wortmannin, demethoxyviridin, LY294002, hibiscone C, idelalisib, copanlisib, duvelisib, taselisib, perifosine, buparlisib, alpelisib (BYL719), umbralisib (TGR 1202), PX- 866, dactolisib, CUDC-907, voxtalisib (SAR245409, XL765), ME-401, IPI-549, SF1126, RP6530, INK1117, pictilisib, XL147 (also known as SAR245408), palomid 529,

GSK1059615, ZSTK474, PWT33597, IC87114, TG100-115, CAL263, RP6503, PI- 103,

GNE-477, AEZS-136, and combinations thereof.

In some embodiments of assessing therapeutic benefit of a therapeutic regimen in a subject, the tumor sample is an ovarian tumor sample. In some embodiments, the methods further include administering a therapeutic regimen to the subject. In some embodiments, the therapeutic regimen is one or more of: adoptive T cell therapy, radiation therapy, surgery, administration of a chemotherapeutic agent, administration of an immune checkpoint inhibitor, administration of a targeted therapy, administration of a kinase inhibitor, administration of a signal transduction inhibitor, administration of a bispecific antibody, administration of a monoclonal antibody, and combinations thereof.

In some embodiments, provided herein are methods of identifying a cancer-associated alteration in a sample obtained from a subject in the absence of a matched normal sample from the subject that include: (a) detection of germline changes, artifactual changes, or both, wherein the detected germline changes and detected artifactual changes are identified as not being a cancer-associated alteration; (b) detecting the presence of focal homozygous deletions, focal homozygous amplifications, or both, wherein the focal homozygous deletions and focal homozygous amplifications are distinguishable from larger structural changes; (c) associating one or more copy number regions; (d) detecting homozygous and hemizygous deletions; (e) detecting rearrangements using a stringent local re-alignment to detect and remove spurious paired read and split alignments; and (f) identifying in-frame

rearrangements. In some embodiments, the step of detecting germline changes, artifactual changes, or both includes applying sequence and germline filters to flag regions prone to alignment artifacts, germline structural variations, or both. In some embodiments, the step of associating one or more copy number regions includes generating a plurality of amplicons and comparing paired sequences in the amplicons. In some embodiments, the step of comparing paired sequences in amplicons includes generating an undirected graph in which amplicons as nodes and in which edges between amplicons are generated by multiple paired sequencing reads aligned genomic locations associated with the amplicons. In some embodiments, the step of detecting homozygous and hemizygous deletions includes detecting copy number changes and rearrangements. In some embodiments, the identified in-frame rearrangements result in gene fusions.

In some embodiments, methods of identifying a cancer-associated alteration in a sample obtained from a subject in the absence of a matched normal sample from the subject indicates the presence of cancer in the subject. In some embodiments, methods of identifying a cancer-associated alteration in a sample obtained from a subject in the absence of a matched normal sample from the subject further include detecting methylation status of one or more genetic loci, which genetic loci are associated with the presence of cancer. In some embodiments, the methods further include administering a therapeutic regimen to the subject. In some embodiments, the therapeutic regimen is one or more of: adoptive T cell therapy, radiation therapy, surgery, administration of a chemotherapeutic agent, administration of an immune checkpoint inhibitor, administration of a targeted therapy, administration of a kinase inhibitor, administration of a signal transduction inhibitor, administration of a bispecific antibody, administration of a monoclonal antibody, and combinations thereof. In some embodiments, the sample is a tumor sample. In some embodiments, the sample is a liquid biopsy sample.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

DESCRIPTION OF THE DRAWINGS

Figure 1 shows and overview of genomic, epigenetic, and therapeutic analyses of ovarian cancer cell lines.

Figures 2A and 2B show a number of false positive somatic structural variant identifications in the lymphoblastoid cell lines. Assuming that nearly all of the

rearrangements and copy number alterations in the lymphoblastoid cell lines are germline, the specificity of structural variant methods for identifying somatic structural variants were assessed by leave one out cross validation. Figure 2A contains graphs showing the number of false positive somatic deletions and duplications / amplifications identified in each test sample stratified by size. Figure 2B contains graphs showing the number of false positive somatic intra-chromosomal and inter-chromosomal rearrangements.

Figures 3 A - 3D show a Trellis approach for characterization of genomic structural alterations. Figure 3 A contains a circos plot displaying focal deletions (green),

amplifications (), and intra- and inter-chromosomal rearrangements identified by rearranged read pairs and split reads. Figure 3B contains a graph showing improperly paired established connections between distant amplicons, creating amplicon groups. Each amplicon group was visualized by a graph. The nodes of the graph are amplicons and the edges indicate multiple paired reads supporting the link. The size of the plotting symbols is proportional to the number of sites in which the amplicon was inserted and the triangle shape indicates an amplicon involving a known driver. For cell line FU-OV-l, there is only one amplicon group that involves 4 potential drivers ( FGFR4 , MYC, H3F3B, and CCNE1). Figure 3C contains graphs showing the average maximum copy number of amplicon groups containing drivers was 18.3 compared to 7.8 in amplicon groups without any known drivers (top graph; t=3.3, 95% Cl for mean difference: 4.0 - 17.0, p=0.003), and the mean number of amplicon links was 62 for amplicon groups containing drivers compared to 3.5 for amplicon groups without known drivers (bottom graph; t=5.3, p < 0.001). Figure 3D contains graphs showing segmented normalized coverage identified a homozygous deletion (top graph; shaded), and rearranged read pairs improved the precision of the deletion breakpoints. Lines connecting the read pairs indicate whether the positive or negative strand was sequenced (bottom graph; blue positive, green negative).

Figures 4A - 4C show methylation of CpG sites in ovarian cancers and normal fallopian tissue. Figure 4A shows the proportion of methylated CpG sites (mean b > 0.3) in the lymphoblastoid cell lines, ovarian cell lines, TCGA ovarian cancers, and TCGA normal fallopian tissues. Figure 4B shows 96 probes identified as being differentially methylated between normal TCGA fallopian tissue and 100 randomly selected (blue points, Figure 4A) TCGA ovarian tumors. The lymphoblastoid and ovarian cancer cell lines were excluded from the probe selection procedure. As expected, this probe selection drives two major clusters separating TCGA fallopian tissue (left) from a large fraction of the TCGA ovarian tumors (right). Interestingly the lymphoblastoid cell lines were most correlated with normal fallopian tissue and the ovarian cell lines were most correlated with TCGA ovarian tumors, suggesting that the cell line effect does not dominate among probes that were differentially methylated in these tissues. Among probes that were methylated in TCGA ovarian and unmethylated in TCGA fallopian, the ovarian cell lines were predominantly methylated and have quantitatively higher b values. While copy number analyses suggested that the purity in the ovarian cell lines was ~ 100%, the median tumor purity of TCGA ovarian tumors was 85% (interquartile range 78% - 88%). Figure 4C shows that genes CDKN2A and ESR1 exhibit bimodal gene expression explained by homozygous copy number deletions (blue points in x-axis margin) or methylation levels above 0.2. As the magnitude and heterogeneity of expression is gene-specific, a gene-specific threshold (dashed line) was used to determine under-expression.

Figure 5 shows sequence, structural, and expression alterations in 10 clinically relevant pathways. Cell lines were grouped by tumor subtype (E=Endometrioid,

Ernd=ETndifferentiated, M=Mixed). For each pathway, genes were ordered by the frequency of a genomic alteration across 45 ovarian cell lines. For many of the pathways, mutual exclusivity of genomic alterations within the pathway is evident (e.g., cell cycle, TK receptors, TGFBR, BRCA, and WNT). The group indicated as Other contains genes that are clinically relevant for ovarian cancer but cannot be easily categorized by a single molecular process. Methylation and expression were not evaluated for the Large Gene group.

Figures 6A and 6B show sensitivity and resistance to pathway inhibitors. To identify genetic, epigenetic, and/or expression alterations influencing sensitivity to inhibitors of PARP (BMN673), PI3K (GNE-493), and MEK (MEK162) we used Bayesian model averaging. Candidate features for these models included genes with alterations in three or more ovarian tumors, as well as indicators for whether the square-root transformed number of rearrangements or square-root transformed HRD score was higher than the average of these statistics across all tumors. Figure 6A shows features selected in fewer than half of the multi -variate models in the Monte Carlo simulations have a posterior probability of being non-zero < 0.5 (vertical dashed line, left) and a posterior median of zero (right). Figure 6B contains boxplots of inhibitor concentrations for features selected by Bayesian model averaging, as well as HRD, PARP R and BRCA1/2 (left). The two cell lines with BRCA1/2 mutations are indicated by triangles in the PARP pathway. Right: The difference in mean logIC o concentrations by alteration status and the 90% highest posterior density (HPD) interval for the difference. For example, mutations in PIK3CA or PPP2R1A were associated with a -0.63 decrease in the average logICso, corresponding to a 48% increased sensitivity to the inhibitor GNE-493 (90% HPD: 5 - 72).

Figures 7A - 7B show mutation signature analyses. Figure 7A shows the frequency of mutations in each of the 96 possible trinucleotide contexts aggregated to the level of ovarian cancer subtype. The endometrial, mixed, undifferentiated, and unclassified tumors were collapsed into the Other category. Figure 7B shows the contribution of each mutation signature to each ovarian cancer subtype. The serous cell lines have signatures 1A and 15, corresponding to aging and defective DNA mismatch repair.

Figure 8 shows a re-alignment of putative lymphoblastoid inter-chromosomal translocations. DELLY identified 435 inter-chromosomal rearrangements that were private to lymphoblastoid cell line CGH10N. Of these, 53 (12%) were supported by one or more split reads and a consensus sequence in the tumor genome for the rearrangement was reported by DELLY. It was found that 13 (25%) of the consensus sequences had a GC composition less than 20%, indicating low sequence complexity (AT repeats). To further investigate, each consensus sequence was re-aligned to the hgl9 reference genome using the local alignment algorithm BLAT. In each panel, a point corresponds to a single BLAT alignment. For several sequences, it was not possible to identify BLAT records at the two regions reported by DELLY (e.g, sequences 1-5). Among sequences that overlap both regions reported by DELLY, multiple high quality alignments at other locations in the genome were often found (e.g., sequences 7, 13, 14, and 18). Similarly, sequences with a very high BLAT alignment score to both DELLY regions suggests that the two regions have a similar sequence composition (e.g., sequence 9, 23, 43, and 44). With these considerations, only three of the 53 sequences (sequences 6, 15, and 27) have a split read BLAT alignment consistent with the rearrangement reported by DELLY and are less likely to be explained by alignment artifacts. Because all of these regions have five or more paired end alignments reported by DELLY, it was determined whether a similar number of discordantly read pairs could be identified from the ELAND alignments. Only 14 of the 53 regions had improperly paired reads supported by ELAND. Of these, half have fewer than five discordantly paired reads and two have more than 100 discordantly paired reads.

Figure 9 shows structural variants in ovarian cancer cell lines. Circos plots (left) depict copy number alterations as well as intra- and inter-chromosomal rearrangements.

Many ovarian cell lines have amplicons that can be genomically linked. For example, CGOV2T (cell line Caov-3) had multiple amplicons that were linked by rearranged read pairs. The linked amplicons were visualized by a graph. Amplicons comprising the nodes and edges indicate amplicons that were linked by 5 or more read pairs. The size of each node is proportional to the number of edges that connect to other amplicons. Triangles denote amplicons spanning potential drivers. Figure 10 shows whole genome sequencing analysis identified a YAP1-MAML2 fusion in ovarian cell line ES-2. The locations of YAP1 (blue rectangle, positive strand) and MAML2 (beige rectangle, negative strand) are indicated as rectangles on the q-arm ideogram of chrl 1. Rearranged read pairs and split reads indicate an inversion where the 3’ end of YAP1 is fused to the 5’ end of MAML2 such that MAML2 is now under control of the YAP1 promoter. The full transcripts with shading indicating the spliced regions (between exons 6 and 7 of YAP 1 and exons 1 and 2 of MAML2), and grey regions indicating the parts of the complete transcript missing in the fused transcript. The amino acid sequence of YAP 1 fused to MAML2 at the locations indicated by the dashed lines is the same as the amino acid sequence in the full protein, indicating that the fusion is in-frame. Note, the breakpoint in MAML2 amino acid sequence (aa 172) is the exact same breakpoint previously reported in MECT1-MAML2 and MAML2-MECT1 fusions. Finally, the fused protein with acidic and Q-rich domains of MAML2 (not drawn) remain intact.

Figures 11 A - 11B show whole genome sequencing analyses identified a fusion of IKZF2 and ERBB4 in ovarian cell line ES-2.Figure 11 A shows support by rearranged read pairs and split reads for the gene fusion. The fusion involved the promoter and first three exons of IKZF2 and exons 2-27 of ERBB4. Figure 11B shows that three probes on the Agilent 44k microarray interrogate the first three exons of IKZF2 and two probes interrogate exons 2-27 of ERBB4. The average expression for probes hybridizing to these regions (y- axis) are similarly elevated in cell line ES-2 (black), suggesting that the fusion transcript is over-expressed. For cell lines without IKZF2-ERBB4 fusion (gray), ERBB4 is expressed at lower levels and the relationship between expression of ERBB4 and IKZF2 appears random.

Figures 12A - 12B show copy number and rearrangement analyses identified a fusion of SFLANK2-CCND1 that involves amplification of CCND1 Figure 12A shows rearranged read pairs and split reads support an in-frame SHANK2-CCND1 fusion.Figure 12B shows that CCND1 was amplified in cell line ES-2 and this amplification also participated in a fusion with SFLANK2 (black). Expression of CCND1 in tumor ES-2 is high relative to its expression in other cell lines without this fusion.

Figure 13 shows under-expression of genes with homozygous and/or hemizygous deletions. The probability that a gene was under-expressed was estimated by a two- component hierarchical mixture model implemented in the R package CNPBayes. The horizontal dashed line is the maximum observed expression value for which a gene was under-expressed with posterior probability 0.5 or greater. The strip labels indicate the gene expression probe and, if methylation was detected, the probe from the methylation platform. Triangles indicate methylated CpG sites (_ > 0:2).

Figure 14 shows gene amplifications were often over-expressed. The probability that a gene was over-expressed was estimated by a two-component hierarchical mixture model implemented in the R package CNPBayes. The horizontal dashed line is the minimum observed expression value for which a gene was over-expressed with posterior probability 0.5 or greater. The strip labels indicate the gene expression probe. DETAILED DESCRIPTION

This document provides methods and materials for identifying one or more structural alterations (e.g., cancer-specific structural alterations) in a sample. For example, a sample (e.g., a sample obtained from a mammal having, or suspected of having, a cancer) can be assessed for the presence or absence of one or more structural alterations. In some cases, this document provides methods and materials for using Trellis to detect the presence or absence of one or more structural alterations. In some cases, the methods and materials described herein can be used to detect the presence or absence of one or more structural alterations in a sample obtained from a mammal, where the presence of one or more structural alterations can be used to identify the mammal as having a disease (e.g., a cancer) associated with one or more structural alterations. For example, the methods and materials described herein can be used to detect the presence or absence of one or more structural alterations in a sample obtained from a mammal, where the presence of one or more structural alterations can be used to identify the mammal as having a disease (e.g., a cancer) associated with one or more structural alterations, and as being likely to respond to a particular cancer treatment.

This document also provides methods and materials for assessing and/or treating mammals (e.g., humans) having, or suspected of having, a cancer. For example, methods and materials described herein can be used for identifying a mammal as being likely to respond to a particular cancer treatment, based at least in part in the presence or absence of one or more structural alterations, and, optionally, the mammal can be treated. In some cases, a mammal can be identified as having a cancer that is likely to respond to one or PARP inhibitors, based at least in part, on the mammal having one or more cancer cells having a MYC amplification (e.g., a focal MYC amplification), and, optionally, the mammal can be treated by

administering one or more PARP inhibitors to the mammal. In some cases, a mammal can be identified as having a cancer that is likely to respond to one or more PARP inhibitors, based at least in part, on the mammal having one or more cancer cells having one or more genome- wide rearrangements, and, optionally, can be treated by administering one or more PARP inhibitors to the mammal. In some cases, a mammal can be identified as having a cancer that is likely to respond to one or more MEK inhibitors, based at least in part, on the mammal having one or more cancer cells having one or more modifications (e.g., one or more loss-of- function modifications) in SMA 1)3 and/or SMAD4 , and, optionally, the mammal can be treated by administering one or more MEK inhibitors to the mammal. In some cases, a mammal can be identified as having a cancer that is likely to respond to one or more PI3K inhibitors, based at least in part, on the mammal having one or more cancer cells having one or more modifications (e.g., one or more loss-of-function modifications) in PIK3CA and/or PPP2R1A , and, optionally, the mammal can be treated by administering one or more PI3K inhibitors to the mammal.

Any type of mammal can be assessed and/or treated as described herein. A mammal can be a mammal having, or suspected of having, a cancer. A mammal can be a mammal suspected of having cancer. Examples of mammals that can be assessed and/or treated as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, mice, and rats. In some cases, a mammal can be a human. For example, a human can be assessed for the presence or absence of one or more structural alterations as described herein and, based, at least in part on presence of one or more structural alterations described herein, can be identified as being likely to respond to a particular cancer treatment and, optionally, the mammal can be treated with one or more cancer particular treatments as described herein. For example, a human can be identified as being likely to respond to a particular cancer treatment based, at least in part on presence of one or more structural alterations described herein, and, optionally, the mammal can be treated with one or more cancer particular treatments as described herein.

Any appropriate sample from a mammal can be assessed as described herein (e.g., assessed for the presence of one or more structural alterations). For example, a sample can be obtained from a mammal (e.g., a mammal having, or suspected of having, a cancer), and can be assessed as described herein (e.g., assessed for the presence or absence of one or more structural alterations). In some cases, a sample can include one or more cancer cells. In some cases, a sample can be fluid sample. In some cases, a sample can be a tissue sample. In some cases, a sample can include DNA (e.g., genomic DNA). In some cases, a sample can include cell-free DNA (e.g., circulating tumor DNA (ctDNA)). A sample can be a fresh sample or a fixed sample. Examples of samples that can be assessed for one or more structural alterations (e.g., cancer-specific structural alterations) as described herein include, without limitation, ovarian tissue, pap smears, skin tissue, brain tissue, liver tissue, tumor tissue, spleen tissue, kidney tissue, heart tissue, lung tissue, blood (e.g., whole blood, serum, or plasma), amnion, tissue, urine, cerebrospinal fluid, synovial fluid, saliva, sputum, broncho-alveolar lavage, bile, lymphatic fluid, cyst fluid, stool, and ascites. For example, an ovarian tissue sample can be assessed for the presence or absence of one or more structural alterations (e.g., cancer-specific structural alterations) as described herein.

In some cases, a sample can be processed (e.g., to isolate and/or purify DNA and/or peptides from the sample). In some cases, a processed sample can be an embedded sample (e.g., a paraffin-embedded sample). For example, DNA isolation and/or purification can include cell lysis (e.g., using detergents and/or surfactants), protein removal (e.g., using a protease), and/or RNA removal (e.g., using an RNase). As another example, peptide isolation and/or purification can include cell lysis (e.g., using detergents and/or surfactants), DNA removal (e.g., using a DNase), and/or RNA removal (e.g., using an RNase).

Methods and materials for identifying one or more structural alterations (e.g., cancer- specific structural alterations) can include assessing a genome (e.g., a genome of a mammal) for the presence or absence of one or more structural alterations (e.g., cancer-specific structural alterations). In some cases, methods and materials for identifying one or more structural alterations as described herein also can be referred to as Trellis. The presence or absence of one or more structural alterations in the genome of a mammal can, for example, be determined using whole-genome sequence data (e.g., to characterize structural alterations such as amplifications and rearrangements). In some cases, one or more structural alterations in a genome (e.g., a genome of a mammal) can be identified in a sample obtained from a mammal (e.g., a mammal having, or suspected of having, a cancer). In some cases, methods and materials for identifying one or more structural alterations in a genome (e.g., a genome of a mammal) do not include a normal sample (e.g., a sample from a healthy mammal such as a mammal that does not have cancer). For example, when a sample is obtained from a mammal having a cancer, methods and materials described herein do not include a matched normal sample from the mammal (e.g, a sample including one or more healthy cells from the same mammal from which a sample including one or more cancer cells was obtained).

In some cases, methods and materials described herein can be used for identifying structural alterations that are linked (e.g., genomically linked). For example, methods and materials described herein can be used for identifying an amplification that includes both a copy number change and a rearrangement.

In some cases, methods and materials described herein can be used for identifying one or more structural alterations in a genome can include detecting cancer-specific structural alterations (e.g., through removal of germline and artifactual changes), distinguishing focal deletions and amplifications from larger structural changes, connecting apparently disparate copy number regions (e.g., using paired sequences in the same amplicons), detecting deletions (e.g., through copy number and rearrangement data), detecting rearrangements (e.g., using a stringent local re-alignment to detect and remove spurious paired read and split alignments), and identifying rearrangements that result in gene fusions (e.g., in-frame rearrangements). In some cases, identifying one or more structural alterations in a genome can be as described in Example 1.

In some cases, methods and materials for identifying one or more structural alterations as described herein can include using one or more germline filters and/or one or more sequence filters. A germline filter and/or a sequence filter can include a pool of one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or more) immortalized cell lines (e.g., lymphoblastoid cell lines) and one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or more) normal cells (e.g, cells from a sample obtained from a healthy mammal such as a mammal that does not have cancer). Examples of immortalized cells lines that can be used in a germline filter described herein include, without limitation, lymphoblastoid cell lines. An example of normal cells that can be used in a germline filter described herein include, without limitation, normal ovarian cells. For example, a pool of about 10 lymphoblastoid cell lines and cells from about 8 normal ovarian samples can be used to generate a germline filter and/or a sequence filter. In some cases, a germline filter and/or a sequence filter can be as described in Example 1.

A germline filter and/or a sequence filter can include any appropriate length of a genome. In some cases, a germline filter and/or a sequence filter can include from about 200 megabases (Mb) to about 500 Mb of a genome. For example, a germline filter and/or a sequence filter can include about 326.4 Mb of a genome. In some cases, the length of a germline filter and/or a sequence filter can be divided into intervals (bins). A length of a germline filter and/or a sequence filter can include any appropriate number of bins. In some cases, the length of a germline filter and/or a sequence filter can be divided into non- overlapping bins. A bin can be any appropriate size. In some cases, a bin can be from about 0.5 kilobases (kb) to about 5 kb. For example, a bin can be about 1 kb. A bin can have any appropriate mappability. For example, a bin can have a mappability of from about 0.25 to about 2. In some cases, a bin can have a mappability of less than about 0.75. A bin can have any appropriate GC percentage. For example, a bin can have a GC percentage of from about 5% to about 20%. In some cases, a bin can have a GC percentage of less than about 10%.

A germline filter and/or a sequence filter can be used to filter a reference genome to obtain a filtered reference genome. A reference genome can be any appropriate genome. In some cases, a reference genome can be as described elsewhere (see, e.g., the Genome Reference Consortium, the European Bioinformatics Institute, the National Center for Biotechnology Information, the Sanger Institute, and McDonnell Genome Institute). In some cases, a reference genome can be a human reference genome. Examples of reference genomes include, without limitation, hg38, hgl9, hgl8, hgl7, and hgl6. For example, a sequence filter can used to filter a hgl9 reference genome. In some cases, using a germline filter and/or a sequence filter to filter a reference genome can identify regions of the genome that are prone to alignment artifacts and/or germline structural variation. In some cases, a sequence filter (e.g., a sequence filter for a hgl9 reference genome) can be masked.

In some cases, a GC-adjusted and/or log2 -transformed count of aligned reads for each bin of a read depth of a filtered reference genome can be computed. For example, a read depth of a filtered reference genome can be normalized for the remaining bins. In some cases, a read depth of a filtered reference genome can include from about 1 million to about 4 million bins. For example, a read depth of a filtered reference genome can include about 2,680,222 bins. In some cases, normalizing a read depth of a filtered reference genome can include GC-normalization. For example, GC -normalization can include using a loess smoother with span 1/3 fitted to a scatterplot of the bin-level GC and log2 count to obtain GC-adjusted log2 ratios (the residuals from the loess correction). For example, when the GC-adjusted log2 ratios are denoted by R, the mean R for a genomic region is //, and the median absolute deviation of the autosomal Rs is S. In some cases, when a bin had a high or low number of aligned reads in multiple controls, the bin i was defined in normal control j as an outlier if | Ri\ > (3 x Sj). In some cases, somatic copy number alterations can be identified by segmenting the Rs (e.g., using circular binary segmentation). In some cases, copy number altered in the lymphoblastoid cell lines and/or segments that span difficult regions (e.g., segments having \R\ > 1) can be excluded.

In some cases, methods and materials described herein can be used for identifying one or more deletions (e.g., somatic deletions). A deletion can be a homozygous deletion. A deletion can be a hemizygous deletion. A deletion can be any appropriate size. For example a deletion can be from about 2 kb to about 3 Mb (e.g., from about 2 kb to about 2.5 Mb, from about 2 kb to about 2 Mb, from about 2 kb to about 1.5 Mb, from about 2 kb to about 1 Mb, from about 2 kb to about 0.5 Mb, from about 2.5 kb to about 3 Mb, from about 3 kb to about 3 Mb, from about 3.5 kb to about 3 Mb, from about 4 kb to about 3 Mb, from about 5 kb to about 3 Mb, from about 6 kb to about 3 Mb, from about 7 kb to about 3 Mb, or from about 8 kb to about 3 Mb). In some cases, a deletion that includes greater than about 75% (e.g., about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or greater) can be excluded. For example, a deletion greater than about 2 kb can be identified using the formula R < -3. For example, a deletion less than about 3 Mb can be identified using the formula A e (-3; -0:75). In some cases, each deletion can be assessed for improperly paired reads (e.g., reads aligned within 5kb of the segmentation boundaries). In cases where five or more read pairs are improperly paired, the distribution of the improper read pair alignments can be used to further resolve the genomic coordinates of the deletion boundaries. In some cases, resolution of deletion breakpoints can depends on the intra-mate distance of the improperly paired reads. For example, the intra-mate distance can be from about 100 bp to about 300 bp (e.g., about 262 bp). In some cases, deletion breakpoints can be less than about 100 bp. In some cases, a deletion can be confirmed (e.g., by visual inspection). In some cases, identifying one or more deletions can be as described in Example 1.

In some cases, methods and materials described herein can be used for identifying one or more amplifications (e.g., somatic amplifications). In some cases, methods and materials for identifying one or more amplifications also can determine whether or not two or more amplicons are linked. In some cases, amplifications can be identified using the formula R > 1:46 and/or or a 2.75-fold increase from the mean ploidy of the cell line, and between 2kb and 3Mb in length. In some cases, properly paired reads can be used to link seed amplicons to adjacent low-copy duplications. For example, segments with R > 0:81 or fold- change of 1.75 can be used to link seed amplicons to adjacent low-copy duplications. In some cases, identifying one or more amplifications can be as described in Example 1.

In some cases, methods and materials described herein can be used for identifying rearrangements (e.g., somatic rearrangements). A rearrangement can be a copy-neutral rearrangement. In some cases, rearrangements identified in one or more controls samples can be excluded. In some cases, a rearrangement can include one or more improperly paired reads (e.g., reads aligned within 5kb of the segmentation boundaries). In cases where five or more read pairs are improperly paired, the distribution of the improper read pair alignments can be used to further resolve the genomic coordinates of the rearrangement boundaries. In some cases, a rearrangement can include one or more split reads. For example, a split read alignment can be identified by extracting all read pairs for which only one read in the pair was aligned within 5 kb of the candidate rearrangement. For all such read pairs, the unmapped mate can be re-aligned using BLAT (see, e.g., Kent, 2002 Genome Res 12:656- 664). As used herein, a split read can include any BLAT alignment where the realigned read aligned to both ends of the candidate sequence junction with a combined score of the two alignments > 90% constituted a split read. In some cases, identifying rearrangements can be as described in Example 1.

In some cases, methods and materials described herein can be used for identifying one or more gene fusions (e.g., in-frame gene fusions). A gene fusion can include a coding sequence of the genome. A gene fusion can include a promoter sequence (e.g., a sequence within 5kb of a transcription start site). In some cases, two orientations of a fusion gene can be evaluated. For example, for each orientation the full amino acid sequence of both the 5 ' and 3 ' transcripts can be extracted as well as the candidate amino acid sequence that would be encoded by the fusion gene. In some cases, a fusion gene can be an in-frame fusion gene (e.g., a fusion gene that encodes a fusion polypeptide). In some cases, identifying one or more gene fusions can be as described in Example 1.

In some cases, methods and materials described herein can be used for identifying nucleic acid methylation. For example, processed (e.g., pre-processed) and normalized raw ID AT files from the Infmimum Methyl ationEPIC array can be assessed for genome-wide methylation using the funnorm function in the R package minfi (see, e.g., Aryee et al. 2014 Bioinformatics 30: 1363-1369). In some cases, one or more (e.g., probes on chromosomes X or Y, probes with detection p-value greater than 0.5, and/or probes overlapping a SNP with dbSNP minor allele frequency greater than 10%) can be excluded. For example, methylation can be assessed using Infmium HumanMethylation27 BeadChip array (27,578 probes). In some cases, the number of probes in common between the HumanMethylation27 platforms and the Methyl ationEPIC platform can be from about 10,000 to about 30,000. For example, the number of probes in common between the HumanMethylation27 platforms and the MethylationEPIC platform can be about 18,016. On a common set of probes, overall methylation can be quantified as the fraction of CpG sites with b > 0:3, and differentially methylated CpG sites can be identified as hyper-methylated (average b > 0:4) or

unmethylated (average b < 0:2). In addition, probes were also selected that were hypo- methylated in TCGA ovarian cancer (average b < 0:1) and hyper-methylated in normal fallopian (average b > 0:3). In some cases, identifying methylation can be as described in Example 1.

The methods and materials described herein can be used to identify any appropriate structural alterations. In some cases, a structural alteration can be a cancer-specific structural alteration. For example, a cancer-specific structural alteration can affect one or more driver genes. A structural alteration can be a genomic alteration. A structural alteration can be an epigenomic alteration. A structural alteration can be a transcriptomic alteration. A structural alteration can be a proteomic alteration. A structural alteration can be a metabolomic alteration. A structural alteration can be a carbohydrate alteration. Examples of structural alterations can include, without limitation, modifications, deletions, amplifications, rearrangements, epigenetic alterations, and post-translational modification alterations. In some cases, the presence or absence of one or more structural alterations a cancer cell within a mammal having, or suspected of having, a cancer can be used to identify the mammal as being likely to respond to a particular cancer treatment.

In some cases, a structural alteration can result in elevated levels (e.g., increased expression) of one or more polypeptides (e.g., one or more polypeptides encoded by a nucleic acid sequence having a structural alteration). The term“elevated level” as used herein with respect to a level of a polypeptide refers to any level that is greater than a reference level of the polypeptide, respectively. The term“reference level” as used herein with respect to one or more polypeptides refers to the level of a polypeptide typically observed in a sample (e.g., a control sample) from one or more mammals (e.g, humans) without cancer. Control samples can include, without limitation, matched normal samples from the same mammal from which a sample was obtained, samples from normal mammals (e.g, healthy mammals such as mammals that do not have cancer), and cell lines (e.g, non tumor forming cells lines). In some cases, for example, when using a Trellis method as described herein, a control sample is not a matched normal sample. In some cases, an increased level of a polypeptide can be a level that is at least 2-fold (e.g, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least lO-fold) greater than a reference level of the polypeptide. In some cases, when control samples have undetectable levels of a polypeptide, an elevated level can be a detectable level of the polypeptide. It will be appreciated that levels from comparable samples are used when determining whether or not a particular polypeptide is present at an elevated level.

In some cases, a structural alteration can result in decreased levels (e.g., decreased expression) of one or more polypeptides (e.g., one or more polypeptides encoded by a nucleic acid sequence having a structural alteration). The term“decreased levels” as used herein with respect to a level of a polypeptide refers to any level that is less than a reference level of the polypeptide, respectively. The term“reference level” as used herein with respect to one or more polypeptides refers to the level of a polypeptide typically observed in a sample (e.g, a control sample) from one or more mammals (e.g, humans) without cancer. Control samples can include, without limitation, matched normal samples from the same mammal from which a sample was obtained, samples from normal mammals (e.g, healthy mammals such as mammals that do not have cancer), and cell lines (e.g, non-tumor forming cells lines). In some cases, for example, when using a Trellis method as described herein, a control sample is not a matched normal sample. In some cases, a decreased level of a polypeptide can be a level that is at least 2-fold ( e.g ., at least 3-fold, at least 4-fold, at least 5- fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least lO-fold) less than a reference level of the polypeptide. In some cases, when control samples have detectable levels of a polypeptide, a decreased level can be an undetectable level of the polypeptide. It will be appreciated that levels from comparable samples are used when determining whether or not a particular polypeptide is present at a decreased level.

In some cases, a structural alteration can be an amplification of a nucleic acid sequence (e.g., a coding sequence such as a gene amplification). An amplification can be a cancer-specific amplification. An amplification can result in a copy number change of a coding sequence (e.g., a gene). In some cases, a gene amplification can result in increased expression (e.g., increased levels) of a polypeptide encoded by the amplified gene. For example, a cancer cell within a mammal having, or suspected of having, a cancer can include one or more cancer-specific gene amplifications. An amplification can include amplification of any appropriate coding sequence (e.g., any appropriate gene). Examples of nucleic acid sequences that can be amplified in a cancer-specific amplification include, without limitation, a MYC nucleic acid sequence, a ASX1A nucleic acid sequence, a H3F3B nucleic acid sequence, a ERBB2 nucleic acid sequence, a CCND1 nucleic acid sequence, a CCNE1 nucleic acid sequence, a FGFR4 nucleic acid sequence, a KRAS nucleic acid sequence, a

NOTCH4 nucleic acid sequence, a RAD51C nucleic acid sequence, and a RNF43 nucleic acid sequence. In some cases, a coding sequence that can be amplified in a cancer-specific amplification can be as set forth in Table 7. For example, a cancer-specific amplification can be a MYC amplification (e.g., a focal MYC amplification).

In some cases, a structural alteration can be a rearrangement (e.g., a genome-wide rearrangement). A rearrangement can be a cancer-specific rearrangement. A rearrangement can be any appropriate type of rearrangement (e.g., deletions, duplications, inversions, and translocations). A rearrangement can be an intra-chromosomal rearrangement or inter- chromosomal rearrangement. When a rearrangement is an intra-chromosomal

rearrangement, the rearrangement can include any appropriate chromosome. An intra- chromosomal rearrangement can include any chromosome pair (e.g., chromosome 1, chromosome 2, chromosome 3, chromosome 4, chromosome 5, chromosome 6, chromosome 7, chromosome 8, chromosome 9, chromosome 10, chromosome 11, chromosome 12, chromosome 13, chromosome 14, chromosome 15, chromosome 16, chromosome 17, chromosome 18, chromosome 19, chromosome 20, chromosome 21, chromosome 22, and/or one of the sex chromosomes (e.g., an X chromosome or a Y chromosome). When a rearrangement is an inter-chromosomal rearrangement, the rearrangement can include any appropriate type of nucleic acid sequence (e.g., a coding sequence such as a gene, a regulatory element such as a promoter and/or enhancer, or a splice site sequence). In some cases, a rearrangement can include a coding sequence (e.g., a gene). In some cases, a rearrangement can include a regulatory sequence (e.g., a promoter and/or enhancer).

Examples of nucleic acid sequences that can be rearranged in a cancer-specific

rearrangement include, without limitation, a MYC nucleic acid sequence, a YAP l nucleic acid sequence, MAML2 nucleic acid sequence, a IKZF2 nucleic acid sequence, a ERBB4 nucleic acid sequence, a CCND1 nucleic acid sequence, a SHANK2 nucleic acid sequence, a

CCND II nucleic acid sequence, a NFl nucleic acid sequence, a TSC2 nucleic acid sequence, a FBXW7 nucleic acid sequence, a MLST8 nucleic acid sequence, and a IΆM 160 A I nucleic acid sequence. In some cases, a cancer-specific rearrangement can be as set forth in Table S9.

In some cases, a rearrangement can result in one or more fusion genes (e.g., a fusion gene encoding a fusion polypeptide). For example, a fusion gene can include a promoter that drives expression of a coding sequence (e.g., a first coding sequence) fused to a coding sequence of a different (e.g., a second) coding sequence. Examples of fusion genes that can result from a cancer-specific rearrangement include, without limitation, YAP1-MAML2 , IKZF2-ERBB4 , SHANK2-CCND1 , NFI-MYOID , MLST8-TSC2 , and FBXW7-FAM160 Al. For example, a cancer-specific fusion gene can be a YAP1-MAML2. In some cases, a cancer- specific fusion gene can be as set forth in Table 10. For example, a cancer-specific fusion gene can be a IKZF2-ERBB4.

In some cases, a structural alteration can be a modification (e.g., a nucleic acid sequence modification). A modification can be a cancer-specific modification. A

modification can be a homozygous modification. A modification can be a hemizygous modification. In some cases, a modification can be an activating modification. For example, an activating modification can include one or more modifications (e.g., insertions, substitutions, deletions, indels, and truncations) to a regulatory sequence (e.g., a promoter and/or enhancer) such that the regulatory sequence encodes an elevated level of a

polypeptide. For example, an activating modification can include one or more modifications (e.g., insertions, substitutions, deletions, indels, and truncations) to a coding sequence (e.g., a gene) such that the coding sequence encodes a polypeptide having increased activity (e.g., constitutive activity). In some cases, a modification can be an inactivating modification. For example, an inactivating modification can include one or more modifications (e.g., insertions, substitutions, deletions, indels, and truncations) to a coding sequence (e.g., a gene) such that the coding sequence does not encode any polypeptide. For example, an inactivating modification can include one or more modifications (e.g., insertions, substitutions, deletions, indels, and truncations) to a coding sequence (e.g., a gene) such that the coding sequence encodes a non-functional polypeptide. In some cases, a modification can include

modification of any appropriate regulatory element (e.g., a promoter and/or enhancer). In some cases, a modification can include modification of any appropriate coding sequence (e.g., a gene). A coding sequence can encode a cell cycle regulator. A coding sequence can encode a tyrosine kinase receptor. A coding sequence can encode a neurofibromin. A coding sequence can encode a transcriptional regulator. A coding sequence can encode a polycomb- group repressor. A coding sequence can encode a serine/threonine kinase. A coding sequence can encode a TGF beta pathway members. A coding sequence can encode a hormone receptor such as an estrogen receptor. A coding sequence can encode a cell cycle kinase. A coding sequence can encode a notch receptor. A coding sequence can encode a cohesin member. A coding sequence can encode an epigenetic regulator. Examples of nucleic acid sequences that can be modified in a cancer-specific modification include, without limitation, a PPP2R1A nucleic acid sequence, a PIK3CA nucleic acid sequence, a CDC73 nucleic acid sequence, a ERBB4 nucleic acid sequence, a EZH2 nucleic acid sequence, a M H I nucleic acid sequence, a TGFBR2 nucleic acid sequence, a SMAD3 nucleic acid sequence, a SMAD4 nucleic acid sequence, a ESR1 nucleic acid sequence, a CDK6 nucleic acid sequence, a NOTCH1 nucleic acid sequence, a STAG2 nucleic acid sequence, a ATRX nucleic acid sequence, a CDKN2A nucleic acid sequence, a CDKN2B nucleic acid sequence, a NF1 nucleic acid sequence, a NF2 nucleic acid sequence, a EZH2 nucleic acid sequence, a STK11 nucleic acid sequence, a TP53 nucleic acid sequence, a ARID 1 A nucleic acid sequence, a KRAS nucleic acid sequence, a APC nucleic acid sequence, and a CREBBP nucleic acid sequence. In some cases, a cancer-specific modification can be as set forth in Table S8. For example, a cancer-specific modification can be a modification in SMAD3 and/or SMAD4.

When assessing and/or treating a mammal having, or suspected of having, a cancer as described herein, the cancer can be any type of cancer. A cancer can be a primary cancer or a metastatic cancer. A cancer can be a hormone receptor positive cancer or a hormone receptor negative cancer. In some cases, a cancer can include one or more solid tumors. In some cases, a cancer can be a cancer in remission. In some cases, a cancer can include quiescent ( e.g ., dormant or non-dividing) cancer cells. In some cases, a cancer can be cancer that has escaped chemotherapy and/or has been non-responsive to chemotherapy. Examples of cancers that can be assessed and/or treated as described herein include, without limitation, ovarian cancers, breast cancers, pancreatic cancers, prostate cancers, lung cancer (e.g., small cell lung carcinoma or non-small cell lung carcinoma), papillary thyroid cancer, medullary thyroid cancer, differentiated thyroid cancer, recurrent thyroid cancer, refractory

differentiated thyroid cancer, lung adenocarcinoma, bronchioles lung cell carcinoma, multiple endocrine neoplasia type 2A or 2B (MEN2A or MEN2B, respectively),

pheochromocytoma, parathyroid hyperplasia, colorectal cancer (e.g., metastatic colorectal cancer), papillary renal cell carcinoma, ganglioneuromatosis of the gastroenteric mucosa, inflammatory myofibroblastic tumor, cervical cancer, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), cancer in adolescents, adrenal cancer, adrenocortical carcinoma, anal cancer, appendix cancer, astrocytoma, atypical teratoid/rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain stem glioma, brain tumor, bronchial tumor, Burkitt lymphoma, carcinoid tumor, unknown primary carcinoma, cardiac tumors, cervical cancer, childhood cancers, chordoma, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), chronic myeloproliferative neoplasms, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, bile duct cancer, ductal carcinoma in situ, embryonal tumors, endometrial cancer, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, fallopian tube cancer, fibrous histiocytoma of bone, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumors (GIST), germ cell tumor, gestational trophoblastic disease, glioma, hairy cell tumor, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular cancer, histiocytosis, Hodgkin’s lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumors, pancreatic neuroendocrine tumors, Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lymphoma, macroglobulinemia, malignant fibrous histiocytoma of bone, osteocarcinoma, melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer, midline tract carcinoma, mouth cancer, multiple endocrine neoplasia syndromes, multiple myeloma, mycosis fungoides, myelodysplastic syndromes, myelodysplastic/myeloproliferative neoplasms, myelogenous leukemia, myeloid leukemia, multiple myeloma, myeloproliferative neoplasms, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin’s lymphoma, oral cancer, oral cavity cancer, lip cancer, oropharyngeal cancer, osteosarcoma, hepatobiliary cancer, upper urinary tract cancer, papillomatosis,

paraganglioma, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromosytoma, pituitary cancer, plasma cell neoplasm,

pleuropulmonary blastoma, primary central nervous system lymphoma, primary peritoneal cancer, rectal cancer, renal cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, Sezary syndrome, skin cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, stomach cancer, T-cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer of the renal pelvis and ureter, unknown primary carcinoma, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom and

Macroglobulinemia. In some cases, a mammal (e.g., a human) having ovarian cancer can be assessed and/or treated as described herein. For example, a human having ovarian cancer can be assessed for the presence or absence of one or more structural alterations as described herein and, based, at least in part, on the presence of one or more structural alterations described herein, can be identified as being likely to respond to a particular cancer treatment and, optionally, the mammal can be treated with one or more cancer particular treatments as described herein. For example, a human having ovarian cancer can be identified as being likely to respond to a particular cancer treatment based, at least in part, on the presence of one or more structural alterations described herein, and, optionally, the mammal can be treated with one or more cancer particular treatments as described herein.

In some cases, a mammal can be identified as having a cancer. Any appropriate method can be used to identify a mammal as having a cancer. As non-limiting examples, imaging techniques, biopsy techniques, and/or liquid biopsy techniques can be used to identify mammals (e.g., humans) having cancer.

In some cases, a mammal having, or suspected of having, a cancer can be assessed to determine whether or not a cancer will or is likely to respond to a particular cancer treatment. For example, a sample obtained from the mammal can be assessed the presence or absence of one or more structural alterations (e.g., cancer-specific structural alterations), and the presence or absence of one or more structural alterations (e.g., cancer-specific structural alterations) can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment.

In some cases, the presence of absence of one or more amplifications (e.g., amplifications of a coding sequence such as a gene amplification) described herein can be detected in a sample obtained from a mammal having a cancer, and can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment. For example, amplification of any appropriate nucleic acid sequence (e.g., a MFC nucleic acid sequence, a ASXL1 nucleic acid sequence, a H3F3B nucleic acid sequence, a ERBB2 nucleic acid sequence, a CCND1 nucleic acid sequence, a CCNE1 nucleic acid sequence, a FGFR4 nucleic acid sequence, a KRAS nucleic acid sequence, a NOTCH4 nucleic acid sequence, a RAD51C nucleic acid sequence, and/or a RNF43 nucleic acid sequence)in a sample obtained from a mammal having a cancer, and can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment. In some cases, the presence or absence of a gene amplification described herein in a cancer cell within a mammal having, or suspected of having, a cancer can be used to identify the mammal as being likely to respond to a particular cancer treatment (e.g., one or more PARP inhibitors). For example, a sample obtained from a mammal (e.g., a mammal having, or suspected of having, a cancer) can be assessed for the presence or absence of a MFC amplification. In some cases, the presence of a MFC amplification can be used to determine that the mammal will or is likely to respond to one or more PARP inhibitors to the mammal. In some cases, the absence of a MYC amplification can be used to determine that the mammal will not or is not likely to respond to one or more PARP inhibitors to the mammal.

In some cases, the presence of absence of one or more rearrangements (e.g., genome- wide rearrangements) described herein can be detected in a sample obtained from a mammal having a cancer, and can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment. For example, rearrangement of any appropriate nucleic acid sequence (e.g., &MYC nucleic acid sequence, a YAP1 nucleic acid sequence, a MAML2 nucleic acid sequence, a IKZF2 nucleic acid sequence, a ERBB4 nucleic acid sequence, a CCND1 nucleic acid sequence, a SHANK2 nucleic acid sequence, a CCND1I nucleic acid sequence, a NF1 nucleic acid sequence, a TSC2 nucleic acid sequence, a FBXW7 nucleic acid sequence, aMLST8 nucleic acid sequence, and/or a F AM 160 A 1 nucleic acid sequence) in a sample obtained from a mammal having a cancer, and can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment. In some cases, the presence or absence of a fusion gene (e.g., YAP1-MAML2 , IKZF2-ERBB4 , SHANK2-CCND1 , NF1-APY01D, MLST8-TSC2 , and/or FBXW7-FAM160A I) in a sample obtained from a mammal having a cancer can be assessed, and can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment. In some cases, the presence or absence of a gene amplification described herein in a cancer cell within a mammal having, or suspected of having, a cancer can be used to identify the mammal as being likely to respond to a particular cancer treatment (e.g., one or more PARP inhibitors). For example, a sample obtained from a mammal (e.g., a mammal having, or suspected of having, a cancer) can be assessed for the presence or absence of one or more gene genome-wide rearrangements (e.g., rearrangements resulting a YAP1-MAML2 fusion gene and/or a IKZF2-ERBB4 fusion gene). In some cases, the presence of a YAP1- MAML2 fusion gene can be used to determine that the mammal will or is likely to respond to one or more PARP inhibitors to the mammal. In some cases, the absence of a YAP1-MAML2 fusion gene can be used to determine that the mammal will note or is not likely to respond to one or more PARP inhibitors to the mammal. In some cases, the presence of a IKZF2- ERBB4 fusion gene can be used to determine that the mammal will or is likely to respond to one or more PARP inhibitors to the mammal. In some cases, the absence of a IKZF2-ERBB4 fusion gene can be used to determine that the mammal will not or is not likely to respond to one or more PARP inhibitors to the mammal.

In some cases, the presence of absence of one or more modifications (e.g., activating modifications or inactivating modifications) described herein can be detected in a sample obtained from a mammal having a cancer, and can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment. For example, a modification in any appropriate nucleic acid sequence (e.g., a PPP2R1A nucleic acid sequence, a PIK3CA nucleic acid sequence, a CDC73 nucleic acid sequence, a ERBB4 nucleic acid sequence, a EZH2 nucleic acid sequence, a M H I nucleic acid sequence, a TGFBR2 nucleic acid sequence, a SMAD3 nucleic acid sequence, a SMAD4 nucleic acid sequence, a ESR1 nucleic acid sequence, a CDK6 nucleic acid sequence, a NOTCH1 nucleic acid sequence, a STAG2 nucleic acid sequence, a A ZRX nucleic acid sequence, a CDKN2A nucleic acid sequence, a CDKN2B nucleic acid sequence, a NF1 nucleic acid sequence, a NF2 nucleic acid sequence, a EZH2 nucleic acid sequence, a STK11 nucleic acid sequence, a TP53 nucleic acid sequence, a ARID 1 A nucleic acid sequence, a KRAS nucleic acid sequence, a APC nucleic acid sequence, and/or a CREBBP nucleic acid sequence) in a sample obtained from a mammal having a cancer, and can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment. In some cases, the presence or absence of a gene amplification described herein in a cancer cell within a mammal having, or suspected of having, a cancer can be used to identify the mammal as being likely to respond to a particular cancer treatment (e.g., one or more MEK inhibitors and/or one or more PI3K inhibitors). For example, a sample obtained from a mammal (e.g., a mammal having, or suspected of having, a cancer) can be assessed for the presence or absence of one or more modifications in SMAD3 and/or SMAD4. In some cases, the presence of one or more inactivating modifications in SMAD3 and/or SMAD4 can be used to determine that the mammal will or is likely to respond to one or more MEK inhibitors to the mammal. In some cases, the absence of one or more inactivating modifications in SMAD3 and/or SMAD4 can be used to determine that the mammal will not or is not likely to respond to one or more MEK inhibitors to the mammal. For example, a sample obtained from a mammal (e.g., a mammal having, or suspected of having, a cancer) can be assessed for the presence or absence of one or more modifications in PPP2R1A. In some cases, the presence of one or more inactivating modifications in PPP2R1A can be used to determine that the mammal will or is likely to respond to one or more PI3K inhibitors to the mammal. In some cases, the absence of one or more inactivating modifications in PPP2R1A can be used to determine that the mammal will not or is not likely to respond to one or more PI3K inhibitors to the mammal. For example, a sample obtained from a mammal (e.g., a mammal having, or suspected of having, a cancer) can be assessed for the presence or absence of one or more modifications in PIK3CA. In some cases, the presence of one or more activating

modifications in PIK3CA can be used to determine that the mammal will or is likely to respond to one or more PI3K inhibitors to the mammal. In some cases, the absence of one or more activating modifications in PIK3CA can be used to determine that the mammal will not or is not likely to respond to one or more PI3K inhibitors to the mammal.

A mammal having, or suspected of having, a cancer can be administered, or instructed to self-administer, one or more cancer treatments. For example, one or more cancer treatments can be administered to a mammal in need thereof. In some cases, a cancer treatment for a mammal having, or suspected of having, a cancer can be selected based, at least in part, on the presence or absence of one or more structural alterations described herein in one or more cancer cells within the mammal. For example, a sample obtained from a mammal having, or suspected of having, a cancer can be assessed for the presence or absence of one or more structural alterations described herein, and the presence or absence of one or more structural alterations described herein can be used to determine whether or not the mammal will or is likely to respond to a particular cancer treatment. For example, the presence or absence of one or more structural alterations described herein can be used to determine the responsiveness of a mammal having cancer to a particular cancer treatment, and a treatment option for the mammal (e.g., an individualized cancer treatment) can be selected, and, optionally, administered to the mammal. Individualized cancer treatments for the treatment of a mammal having a cancer (e.g., based, at least in part, on the presence or absence of one or more structural alterations described herein in one or more cancer cells within the cancer) can include any one or more (e.g., 1, 2, 3, 4, 5, 6, or more) cancer treatments. A cancer treatment can include any appropriate cancer treatment. In some cases, a cancer treatment can include administering one or more anti -cancer agents. An anti -cancer agent can be a chemotherapeutics such as an alkylating agent, a plant alkaloid, an antitumor antibiotic, an antimetabolite, a topoisomerase inhibitor, or an antineoplastic. An anti-cancer agent can be an immunotherapy such as a checkpoint inhibitor, an adoptive cell transfer, a monoclonal antibody, a treatment vaccine, or a cytokine. An anti-cancer agent can be a targeted therapy such as a small-molecule or a monoclonal antibody. An anti -cancer agent can be a hormone therapy such as an anti-antigen or an anti-estrogen. An anti-cancer agent can be a cellular therapy such as a stem cell transplant or an adoptive cell transfer. In some cases, a cancer treatment can include administering one or more PARP inhibitors to a mammal having cancer. For example, one or more PARP inhibitors can be administered to a mammal having cancer and identified as being likely to respond to one or more PARP inhibitors based, at least in part, on the presence or absence of one or more structural alterations described herein in one or more cancer cells within the cancer. Examples of PARP inhibitors include, without limitation, talazoparib (BMN-673), olaparib (AZD-2281), rucaparib (PF-01367338), niraparib (MK-4827), veliparib (ABT-888), CEP 9722, E7016, BGB-290, iniparib (BSI 201), and 3-aminobenzamide. Those of ordinary skill in the art will be aware of other suitable PARP inhibitors. In some cases, a cancer treatment can include administering one or more PI3K inhibitors to a mammal having cancer. For example, one or more PI3K inhibitors can be administered to a mammal having cancer and identified as being likely to respond to one or more PI3K inhibitors based, at least in part, on the presence or absence of one or more structural alterations described herein in one or more cancer cells within the cancer. Examples of PI3K inhibitors include, without limitation, GNE-493, wortmannin, demethoxyviridin, LY294002, hibiscone C, idelalisib, copanlisib, duvelisib, taselisib, perifosine, buparlisib, alpelisib (BYL719), umbralisib (TGR 1202), PX-866, dactolisib, CUDC-907, voxtalisib (SAR245409, XL765), ME-401, IPI-549, SF1126,

RP6530, INK1117, pictilisib, XL147 (also known as SAR245408), palomid 529,

GSK1059615, ZSTK474, PWT33597, IC87114, TG100-115, CAL263, RP6503, PI-103,

GNE-477, and AEZS-136. Those of ordinary skill in the art will be aware of other suitable PI3K inhibitors. In some cases, a cancer treatment can include administering one or more MEK inhibitors to a mammal having cancer. For example, one or more MEK inhibitors can be administered to a mammal having cancer and identified as being likely to respond to one or more MEK inhibitors based, at least in part, on the presence or absence of one or more structural alterations described herein in one or more cancer cells within the cancer. Examples of MEK inhibitors include, without limitation, binimetinib (MEK162), trametinib (GSK1120212), cobimetinib (XL518), selumetinib, PD-325901, CI-1040, PD035901, and TAK-733. Those of ordinary skill in the art will be aware of other suitable MEK inhibitors. In some cases, a cancer treatment can include surgery. In some cases, a cancer treatment can include radiation treatment. In cases where two or more cancer treatments are administered, the two or more cancer treatments can be administered at the same time or independently.

As used herein, treating cancer includes reducing the number, frequency, or severity of one or more (e.g., two, three, four, or five) signs or symptoms of a cancer in a patient having a cancer. For example, treatment can reduce the severity of a cancer (e.g., can reduce the number of cancer cells or reduce the size of a tumor), reduce cancer progression (e.g., can reduce or prevent tumor growth and/or metastasis or can reduce the proliferative, migratory, and/or invasive potential of cancer cells), and/or reduce the risk of re-occurrence of a cancer in a subject having the cancer. In some cases, methods and materials provided herein can be used to reduce the number of cancer cells or reduce the size of a tumor in a mammal.

In some cases, when treating a mammal having a cancer as described herein, the treatment can increase survival of the mammal. For example, the treatment can increase progression-free survival of the mammal. For example, the treatment can increase overall survival of the mammal.

In some cases, when treating a mammal (e.g., human) having a cancer and identified as being likely to respond to one or more PARP inhibitors (e.g., based, at least in part, on the presence or absence of one or more structural alterations described herein) as described herein, the mammal can be administered, or instructed to self-administer, one or more PARP inhibitors to treat the mammal. For example, one or more one or more PARP inhibitors can be administered to a mammal in need thereof. For example, one or more PARP inhibitors (e.g., talazoparib (BMN-673), olaparib (AZD-2281), rucaparib (PF-01367338), niraparib

(MK-4827), veliparib (ABT-888), CEP 9722, E7016, BGB-290, iniparib (BSI 201), and/or 3- aminobenzamide) can be administered to a mammal having cancer and identified as being likely to respond to one or more PARP inhibitors based, at least in part, on the presence of a MYC amplification in a cancer cell within the mammal. For example, BMN-673 can be administered to a mammal having an ovarian cancer including one or more cancer cells with the presence of a MYC amplification. In some cases, one or more PARP inhibitors (e.g., talazoparib (BMN-673), olaparib (AZD-2281), rucaparib (PF-01367338), niraparib (MK- 4827), veliparib (ABT-888), CEP 9722, E7016, BGB-290, iniparib (BSI 201), and/or 3- aminobenzamide) can be administered as the sole active ingredient used to treat cancer. In some cases, one or more PARP inhibitors can be administered together with one or more additional agents/therapies other than PARP inhibitors used to treat cancer.

In some cases, when treating a mammal (e.g., human) having a cancer and identified as being likely to respond to one or more PI3K inhibitors (e.g., based, at least in part, on the presence or absence of one or more structural alterations described herein) as described herein, the mammal can be administered, or instructed to self-administer, one or more PI3K inhibitors to treat the mammal. For example, one or more one or more PI3K inhibitors (e.g., GNE-493, wortmannin, demethoxyviridin, LY294002, hibiscone C, idelalisib, copanlisib, duvelisib, taselisib, perifosine, buparlisib, alpelisib (BYL719), umbralisib (TGR 1202), PX- 866, dactolisib, CUDC-907, voxtalisib (SAR245409, XL765), ME-401, IPI-549, SF1126, RP6530, INK1117, pictilisib, XL147 (also known as SAR245408), palomid 529,

GSK1059615, ZSTK474, PWT33597, IC87114, TG100-115, CAL263, RP6503, PI-103, GNE-477, and/or AEZS-136) can be administered to a mammal in need thereof. For example, GNE-493 can be administered to a mammal having an ovarian cancer including one or more cancer cells with the presence of an inactivating modification in PPP2R1A in a cancer cell within the mammal. For example, GNE-493 can be administered to a mammal having an ovarian cancer including one or more cancer cells with the presence of an activating modification in PIK3CA in a cancer cell within the mammal. In some cases, one or more PI3K inhibitors (e.g., GNE-493, wortmannin, demethoxyviridin, LY294002, hibiscone C, idelalisib, copanlisib, duvelisib, taselisib, perifosine, buparlisib, alpelisib (BYL719), umbralisib (TGR 1202), PX-866, dactolisib, CUDC-907, voxtalisib (SAR245409, XL765), ME-401, IPI-549, SF1126, RP6530, INK1117, pictilisib, XL147 (also known as SAR245408), palomid 529, GSK1059615, ZSTK474, PWT33597, IC87114, TG100-115, CAL263, RP6503, PI-103, GNE-477, and/or AEZS-136) can be administered as the sole active ingredient used to treat cancer. In some cases, one or more PI3K inhibitors can be administered together with one or more additional agents/therapies other than PI3K inhibitors used to treat cancer.

In some cases, when treating a mammal (e.g., human) having a cancer and identified as being likely to respond to one or more MEK inhibitors (e.g., based, at least in part, on the presence or absence of one or more structural alterations described herein) as described herein, the mammal can be administered, or instructed to self-administer, one or more MEK inhibitors to treat the mammal. For example, one or more one or more MEK inhibitors (e.g., binimetinib (MEK162), trametinib (GSK1120212), cobimetinib (XL518), selumetinib, PD- 325901, CI-1040, PD035901, and/or TAK-733) can be administered to a mammal in need thereof. For example, MEK162 can be administered to a mammal having an ovarian cancer including one or more cancer cells with the presence of an inactivating modification in SMAD3/4 in a cancer cell within the mammal. In some cases, one or more MEK inhibitors (e.g., binimetinib (MEK162), trametinib (GSK1120212), cobimetinib (XL518), selumetinib,

PD-325901, CI-1040, PD035901, and/or TAK-733) can be administered as the sole active ingredient used to treat cancer. In some cases, one or more MEK inhibitors can be administered together with one or more additional agents/therapies other than MEK inhibitors used to treat cancer.

The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

EXAMPLES

Example 1: Integrated Genomic, Epigenetic, and Expression Analyses of Ovarian Cancer Cell Lines

Overall approach

It was aimed to assemble a collection of ovarian cancer cell lines that would be representative of the different histological subtypes. These encompassed both publicly available as well as newly generated cell lines, ultimately comprising 19 serous, 9 clear cell, 3 mucinous, 2 undifferentiated, 2 endometrioid, 1 mixed, and 9 of unclassified subtypes

(Table 1). The origin of the lines was confirmed using unique short tandem repeat (STR) analyses (Table 2). To identify sequence and structural changes in these ovarian cancer cell lines, next generation whole genome analyses were performed at an average coverage of 32x and 116.6 Gb per sample (Table 3). As matched normal DNA was not available for these samples, a set of 18 unmatched DNA samples from normal blood or lymphoblastoid cell lines from individuals of various ethnicities was also sequenced. Approaches were developed to focus on likely tumor-specific sequence and genome-wide structural changes, including amplifications, deletions and rearrangements. In parallel, genome-wide methylation analyses were performed and integrated with genomic and expression data in order to obtain a comprehensive molecular profile of these samples (Figure 1).

Sequence analyses

A high sensitivity analysis of sequence alterations, including single base substitutions and small insertions and deletions, was performed for the exomes of these samples. Given the challenges of characterizing tumor-specific (somatic) changes in tumor samples without matched normal tissue, stringent bioinformatic approaches were developed to determine likely somatic mutations. Removal of common germline variants resulted in an average of 928 alterations per cell line exome, comprising 41,768 rare germline and somatic alterations. Six cell lines (two clear cell and one each of endometrioid, serous, unclassified, and mixed lineage) were hypermutated, having alterations in mismatch repair (MMR) genes MLH I, MSH2, MSH6, or PMS2 and six times as many sequence changes compared to those tumors that were MMR proficient (Table S4). To focus on likely somatic alterations involved in turn ori genesis, the sequence alterations in each cell line were analyzed and changes that have been previously detected in the coding genomes of other cancer patients were identified (see, e.g., Forbes et ak, 2010 Nucleic Acids Research 38:D652-D657). Nonsense or frameshift inactivating mutations in a panel of tumor suppressor genes were also identified (Table 5). Through these analyses, 672 putative driver somatic mutations across 45 ovarian cell lines were discovered (Table 6).

The most frequently mutated gene was the TP53 tumor suppressor gene (altered in 24 non-hypermutated and 3 hypermutated tumors). Excluding hypermutated samples, other genes frequently mutated included ARID 1A (14 cancer cell lines), PIK3CA (6), SMAD4 (4), KRAS (3), APC (3), CREBBP (3), and PPP2R1A (3). Mutations were predominantly CpG transitions C T or G A (48%) followed by non-CpG transitions A < G or C < T (25%) (Figure 7A). Analysis of mutation signatures aggregated by ovarian cancer subtypes revealed that serous, mucinous and undifferentiated tumor cell lines had an age-related signature. Clear cell and serous ovarian cancers also had a profile consistent with a mismatch repair associated mutation signature (Figure 7B). Overall, both the compendium of mutated genes as well as mutation-associated signatures were representative of previous ovarian cancer genome analyses (Table 6).

Structural variant analyses

Whole-genome sequence data were used to characterize copy number changes as well as rearrangements that may affect key driver genes. Existing approaches for whole genome analyses were first considered, including DELLY and LEIMPY, but these typically use matched normal sequences to accurately identify tumor-specific rearrangements (see, e.g., Rausch et al., 2012 Bioinformatics 28:i333-i339; and Layer et al., 2014 Genome Biol.

l5:R84). Given the multitude of tumor cell lines and other cancer specimens where matched normal DNA is not available, a framework was developed for structural variant detection called Trellis that could be used with tumor genome sequence data directly. Additionally, because many structural changes are linked genomically (i.e. an amplified gene has both copy number changes and rearrangements that can be located in multiple locations of the genome), it was aimed to connect the multiple changes that were related to individual genetic targets. The features of this approach include 1) detection of tumor-only structural changes through removal of germline and artifactual changes, 2) distinction of focal homozygous deletions and amplifications from larger structural changes, 3) connection of apparently disparate copy number regions using paired sequences in the same amplicons, 4) detection of homozygous and hemizygous deletions through copy number and rearrangement data, 5) confirmation of rearrangements using a stringent local re-alignment to detect and remove spurious paired read and split alignments, and 6) identification of in-frame rearrangements that would likely lead to gene fusions.

To implement the Trellis approach, low complexity sequences were excluded by mappability, as well as regions of germline copy number variants (CNVs) and

rearrangements detected in the genomes of eighteen samples derived from normal blood cells. The remaining 2.7 Gb of the genome were divided into lkb bins and examined areas of increased read density (>2.75 fold) to identify copy number gains, and regions of decreased read density (<0.6 fold) to detect hemizygous or homozygous deletions greater than 2 kb using approaches similar to Digital Karyotyping (see, e.g., Wang et al., 2002 Proc Natl Acad Sci USA 99:16156-16161; and Leary et al., 2008 Proc Natl Acad Sci USA 105: 16224-16229). Rearrangements were identified from atypical orientation or spacing of paired reads as well as split read alignments (see Methods).

To evaluate the specificity of this approach in a set of non-tumor samples where very few somatic structural changes were expected, a leave-one-out cross-validation analysis among the 10 unmatched normal blood samples was used. Using Trellis, these analyses identified no focal high copy gains. On average, 5 hemizygous deletions (interquartile range 2-15) and one homozygous deletion (interquartile range 0-8) were identified in the normal samples (Figure 2). Likewise, the average number of rearrangements observed per sample was three (interquartile range 0-6). These observations suggest a high specificity of our approach for detection of bona fide somatic alterations (mean specificity 0.97).

By contrast, analysis of normal samples with DELLY or LUMPY detected hundreds to thousands of structural changes in each normal DNA sample (Figure 2). With DELLY and LUMPY, the average number of focal high quality copy number alterations was 13 and 21, respectively. The average number of intra- and inter-chromosomal rearrangements identified by DELLY was 297 and 433, respectively, and for LUMPY these were higher, at 511 and 2203, respectively. The number of alterations observed by DELLY using low- stringency settings was higher yet (Figure 2). False positives for copy number changes appeared to largely be due to inclusion of single copy gains and losses, with neither DELLY nor LUMPY distinguishing hemizygous from homozygous losses or single copy gains from high copy amplifications. The source of the rearrangement false positives appeared to be largely the result of mapping artifacts due to low sequence complexity in putative rearrangements (Figure 8).

To assess the sensitivity of this approach, 16 cell lines were sequenced using high coverage next generation sequencing of 111 genes comprising 585,216 bp. Computing the fold-change of read depth at these targeted regions, four high-copy amplifications with fold- change > 6, nine low-copy amplifications with fold-change > 3 and < 6, and nine homozygous deletions were found. Trellis detected all four high-copy amplifications, including amplifications of AKT2, CCNE1, and KRAS. All nine regions identified as low copy amplifications by targeted sequencing were also determined to be low copy

amplifications by Trellis, corroborating quantitative and qualitative characteristics of the amplifications. Similarly, all nine deletions discovered by targeted sequencing, comprising CDKN2A (8) and NF1 (1), were also characterized as homozygous deletions by Trellis. Overall, these analyses established that the Trellis approach had both high specificity and sensitivity for detection of structural alterations that are currently not possible with tumor- only samples using existing approaches.

Linked amplicons: The analysis of amplifications was focused to regions smaller than 3 Mb that were present at >2.75 fold compared to the modal genome copy number. An analysis of the 45 ovarian cancer samples identified 538 focal amplicons, or an average of 12 amplicons per tumor (Table 7). As multiple amplicons within the same tumor may be derived from an amplification of a single target gene localized to different chromosomal regions, the possibility that amplicons may be linked was examined. Using our paired read whole genome analyses, it was found that reads at the edges of many amplicons were linked with aberrant spacing and/or orientation with respect to the reference genome. In order to identify links between apparently distant amplicons, these were visualized as undirected graphs where the nodes were amplicons and edges between amplicons were defined by multiple paired reads aligned to both genomic locations (e.g., Figures 3A and 3B). The analyses discovered 57 amplicon groups from the 538 amplicons across the ovarian tumor cell lines. Among tumors with at least one amplicon, the median number of amplicon groups was two and the median number of amplicons within an amplicon group was four

(interquartile range 2 - 9). The majority of cell lines (15/28) with an amplicon group contained known driver genes. As an example, cell line ES-2 had 41 apparent amplicons, but through this approach it was determined that 38 of the amplicons were linked to a single group that contained the CCND1 driver gene (Figure 9). Both the copy number and number of connections between amplicons was significantly higher for amplicon groups containing known drivers compared to amplicon groups without known drivers (Figure 3C). Driver genes that were amplified in two or more cell lines as part of amplicon groups that have previously been observed in ovarian cancer included well known oncogenes such as MYC (4), ERBB2 (2), CCND1 (2), CCNE1 (2), FGFR4 (2), and KRAS (2). Interestingly, amplifications of cancer driver genes were identified that have not been previously appreciated in ovarian cancer, including epigenetic regulator ASXL 1 (2), H3 histone family member H3F3B (2), NOTCH family receptor NOTCH4 (1), repair and recombination paralog RAD51C (1), and ubiquitin ligase RNF43 (1). Several of these genes have been observed as being part of larger structural alterations in recent TCGA high grade serous ovarian carcinoma analyses (see, e.g., Network, 2011 Nature 474:609-615) but have not been identified as target genes in those cases of these alterations.

Overall, these analyses greatly simplified the observed amplification events and revealed that many focal amplicons would not have been associated with driver genes had they not been linked in specific amplicon groups. The observed amplicons were consistent with previously detected genes in ovarian cancer, but genes not previously implicated in this disease were also detected.

Deletions: A combination of stringent analyses of segmented read depth and aberrant read pair spacing to was used identify homozygous and hemizygous deletions. As deletions may occur in the germline, we removed deletions that were in or near structural alterations observed in the normal lymphoblastoid controls in order to identify those deletions that were most likely to be somatic. These analyses revealed 674 hemizygous+, 41 overlapping hemizygous+, 286 homozygous, and 263 homozygous+ deletions, where’+’ denotes evidence for deletion supported by rearranged read pairs in addition to read depth (Figure 3D and Table S8). Deletion breakpoints with rearranged read pairs were more precise (typically within 100 bp), while deletions without rearranged read pairs had a resolution of l-5kb. Homozygous deletions from segmentation analyses were included even if these were without rearranged read pairs as these could have been missed in read pair analyses due to the limited mappability at one or both deletion breakpoints. The median number of homozygous and hemizygous deletions per tumor was 10.5 (interquartile range 8-16) and 11.0 (interquartile range 6-18), respectively. Genes that were recurrently deleted included cell cycle regulators CDKN2A (9) and CDKN2B (8), tyrosine kinase receptor ERBB4 (5), neurofibromin genes NF1 (3) and NF2 (3), transcriptional regulator CDC73 (2), polycomb-group repressor EZH2 (2), and serine/threonine kinase STK11 (2) (Table S8), of which CDKN2A, NF1, NF2, and STK11 have been previously reported to be altered in high grade serous ovarian carcinomas (see, e.g., Network, 2011 Nature 474:609-615; and Huang et ah, 2012 BMC Medical Genomics 5:47). Genes that have been implicated through somatic deletion in other tumors but that had not been previously implicated in ovarian cancer include CDC73 , ERBB4,

EZH2 , MLH1 as well as TGF beta pathway members TGFBR2 , SMAD3, and SMAD4, estrogen receptor ESR1, cell cycle kinase CDK6 , notch receptor NOTCH 1, cohesin member STAG2 , and epigenetic regulator A JRX (Table S8). In a fashion similar to amplifications, several of these genes have been observed as being part of larger structural alterations in recent TCGA high grade serous ovarian carcinoma analyses (Network, 2011 Nature

474:609-615) but have not been identified as target genes in those cases or other histologic subtypes. The absence or low frequency of such alterations in previous studies may in part reflect the challenges of identifying bona fide deletions through existing approaches in primary tumors.

Other recurrent deletions included genes encompassing large genomic regions (> lMb) that were more likely to be affected by structural alterations, including a member of the low density lipoprotein receptor family LRP1B (7), fragile histidine triad involved in purine metabolism FHIT (11), a member of the short-chain dehydrogenases/reductases protein family WWOX (15), and the deacetyl ase MACRO 1)2 (7). FHIT and WWOX occur in fragile sites, are often deleted in cancers, and some evidence suggests they encode putative tumor suppressors (Ohta et ah, 1996; Zochbauer-Muller et ah, 2000; Roy et al., 2011; Aldaz et ah, 2014). LRP1B deletion has been associated with chemotherapy resistance in high grade serous ovarian cancers and is a putative tumor suppressor (Cowin et al., 2012). Because of their proximity to CDKN2A , the methylthioadenosine phosphorylase MΊAR and the transcription factor DMRTI are commonly co-deleted with CDKN2A (Zhang et al., 1996), and use of compounds exploiting the loss of MTAP has been proposed as a potential therapeutic avenue (Marjon et al., 2016) for tumors with CDKN2A deletions.

Rearrangements and fusions: We next examined structural rearrangements that were not associated with segmental copy number changes. 850 inter-chromosomal and 2339 intra- chromosomal rearrangements were detected (Table S9). The median per sample of inter- and intra-chromosomal rearrangements was 16 (interquartile range 5 - 31) and 39 (interquartile range 17 - 63), respectively, with many of these rearrangements involving inversions (median of 8 and 7, respectively).

Among rearrangements for which the sequence junction was within the intron or exon of a gene, 290 in-frame fusions of two genes were detected (Table 10). Several of these in- frame fusions have not been observed in ovarian cancer but have been previously reported in other cancers. For example, YAP1-MAML2 has been reported in nasopharyngeal carcinoma and salivary cancers (Tonon et al., 2003; Coxon et al., 2005; Valouev et al., 2014), IKZF2- ERBB4 has been reported in T cell lymphomas (Boddicker et al., 2016), and fusions involving CCND1 were identified in a patient with leukemic mantle cell lymphoma

(Gruszka-Westwood et al., 2002). This study discovered the YAP1-MAML2 fusion in cell line ES-2 after exon 6 of YAP l and before exon 2 of MAML2 , preserving the transactivation domain of MAML2 and its likely role in Notch signaling (Figure 10). The breakpoint in the amino acid sequence of MAML2 is the same as reported in nasopharyngeal carcinoma and salivary gland cancers (amino acid 172) (Tonon et al., 2003; Coxon et al., 2005; Valouev et al., 2014).

The IKZF2-ERBB4 fusion identified in ovarian tumor KK involves the first 3 exons of IKZF2 and exons 2-27 of ERBB4 , a member of the epidermal growth factor receptor (EGFR) family. This IKZF2-ERBB4 junction is nearly identical to that reported by

Boddicker et al. in T-cell lymphoma and mucinous lung adenocarcinoma, involving the same exons of ERBB4 and leaving the ERBB4 kinase domain intact (Boddicker et al., 2016). Gene expression analyses indicated that the ERBB4 transcript, including the fusion transcript, was over-expressed (Figure 11). ERBB4 over-expression has been associated with resistance to platinum-based therapy in ovarian serous carcinomas (Saglam et al., 2017), suggesting a potentially important role for this translocation event for therapeutic selection. In ovarian tumor ES-2, CCND1 was amplified and also participated in a fusion where the promoter of SHANK2 was linked to the coding region of CCND1 (Figure 12). An amplification and fusion involving CCND1 has been previously identified in a patient with leukemic mantle cell lymphoma (Gruszka-Westwood et al., 2002). Additional gene fusions not previously observed in ovarian cancer involved the negative regulator of the RAS pathway AW, the tumor suppressor regulating mTORCl signaling TSC2 , and the member of the F-box protein family FBXW7. The fusion of NF1 ( NFI-MYOID ) occurred after the first exon of this gene and would be expected to disrupt its function, consistent with its tumor suppressive role Network (2011). Similarly, the fusion of MLST8-TSC2 would be expect to result in a TSC2 protein lacking the first 373 amino acids, disrupting the key region of interaction with TSC1 (Guertin and Sabatini, 2005). As detailed below, the fusion of full-length FBXW7 to the promoter of FAM160A1 was also likely deleterious, due to decreased expression under the new promoter. For all of the predicted nine fusions involving at least one gene previously identified in other cancer fusions, all novel sequence junctions were independently validated using PCR and Sanger sequencing and a recently developed droplet digital PCR approach (Cumbo et ah, 2018) (Figure 13). Epigenetic and expression analyses

Genome-wide methylation profiles were examined in order to evaluate the role of epigenetic alterations in these ovarian cancer cell lines. Analyses of over 850,000

methylation sites were performed using Infmium MethylationEPIC arrays. Methylation levels were evaluated at individual CpG sites within gene promoter regions (±1500 bp upstream of the transcription start site) or within individual genes. Methylation levels in the ovarian cell lines were compared to methylation levels in the normal lymphoblastoid cells, as well as to 8 TCGA normal fallopian tissue and 533 TCGA ovarian cancers. Among the 18,619 CpG probes shared by the Infmium HumanMethylation27 BeadChip array (27,578 probes) and the MethylationEPIC array, we estimated the proportion of methylated CpG sites as the fraction of CpG probes with b > 0:3. It was found that the overall proportion of methylated CpG sites in the lymphoblastoid (median 0.35) and ovarian cell lines (median 0.41) was higher than the proportion in fallopian tissues (median 0.30) and ovarian cancers (median 0.29) (Figure 4A). To examine methylation profiles of the cell lines at individual CpG sites in the broader context of ovarian cancer methylation profiles, 96 genes were identified that were differentially methylated between normal fallopian tissue and 100 randomly sampled TCGA ovarian tumors (Figure 4B). While both the lymphoblastoid cell lines and the ovarian cancer cell lines were excluded from the probe selection procedure, the normal lymphoblastoid cell lines were more highly correlated to the normal fallopian tissues while the ovarian cancer cell lines were more correlated to the TCGA ovarian cancers.

Taken together, these analyses indicate that the ovarian cell lines retain epigenetic profiles of genes commonly methylated in ovarian cancer and that the methylation of these genes is unlikely to be related to growth in culture.

The genomic and epigenetic analyses were integrated with expression data previously obtained for these cell lines through the Agilent 44K array (see, e.g., Konecny et al., 2011 Clinical Cancer Research 17: 1591-1602). It was assessed whether specific genes affected by deletions or other structural changes in some tumors may be silenced through methylation and low expression in others. Among genes that were methylated or deleted, expression analyses revealed lower expression for many of these genes. Cell lines RMG-I and IGROV- 1 both had hemizygous deletion and loss of expression of CDC73. Of the 13 drivers homozygously deleted in at least one tumor, five genes, including CDKN2A and ESR1 , displayed loss of expression and concomitant promoter methylation in additional ovarian cancers (Figures 4C and 14). When promoter methylation and underexpression were considered, the fraction of tumors with alterations in CDKN2A more than doubled from 23% to 55%, highlighting the multiple mechanisms by which CDKN2A function can be compromised. Similarly, MLH1 was mutated in a single case, but was mutated and/or underexpressed in an additional seven cancers. YorESRl, the inactivating methylation is thought to be associated with age and has been previously observed in both ovarian cancers and ovarian cancer cell lines (see, e.g., Imura et al., 2006 Cancer Letters 241 :213-220; and Wiley et al., 2006 Cancer 107:299-308). Lower expression also resulted from abnormal fusion of non-adjacent promoters to the full coding sequence of target genes. In OVCAR-8, the fusion of the promoter of FAM160A1 with the full length FBXW7 gene resulted in dramatically decreased expression of FBXW7 (Figure 11).

It was also examined the possibility of increased expression for genes with structural changes. 17 genes with focal amplification were identified in one or more cancer cell lines and evidence of bimodal expression across the samples analyzed. For these genes, 20 of the 22 tumors (91%) with focal amplification also had increased expression (Figure S9). Genes associated with amplification and fusion had particularly high expression, suggesting that the combination of genetic alterations led to increased overall transcription of these genes. The amplification of CCND1 and fusion in SHANK2-CCND1 fusion in sample ES-2 increased the expression of CCND1 relative to other ovarian cell lines without the amplification and fusion (Figure 12). The YAP1-MAML2 fusion which was also duplicated in the same sample resulted in expression of MAML2 that was higher than 85% of the other ovarian cancer cell lines (Figure 10). For driver genes that were amplified, it was examined whether additional tumors may be identified with increased expression of these genes. It was found increased expression of CCNE1, ERBB2, KRAS and AKT2 in eight additional cases without genomic alterations in these genes (Figures 5 and S9). These analyses indicate the importance of integrated genomic, epigenetic, and expression analyses and have resulted in an expansion of the number of tumors with alterations in key driver genes. These observations also highlight the functional consequences of genomic and epigenomic alterations in human cancer at the RNA level.

Combining sequence and structural variants with methylation and differential gene expression, it was found that nearly all ovarian cancer subtypes had alterations in cell cycle, chromatin remodeling, DNA repair, RAS, Notch, PI3K, or TGFB signaling pathways (Figure 5). Alterations in the cell cycle pathway genes, including CDKN2A , were the most common with one or more alterations in 60-70% of the three most represented subtypes (serous, adenocarcinoma, and clear cell). Chromatin modifications occur in (5/7) (71%) of the clear cell subtypes but in only 2/21 (11%) of the serous samples. Evidence of mutual exclusivity was see between CDKN2A , CCNE1, and RBI within the cell cycle pathway, but not mutual exclusivity between cell cycle and KRAS pathways, underscoring that clonal selection often involves multiple drivers regulating distinct molecular processes. Sensitivity and resistance to pathway inhibitors

To begin to understand the relationship between genomic, epigenetic and expression alterations and response to pathway inhibitors, a screening platform was developed for evaluating cellular proliferation in the presence of candidate therapeutic agents. As an example of the analyses that can be performed and the genotype-phenotype connections that can be obtained, IC20, IC50, and ICxo were measured after seven days of incubation for three inhibitors, GNE-493, BMN673, and MEK162, targeting PI3K, PARP, and MEK proteins, respectively (Table 11). Aggregating the molecular information from multiple platforms to the gene level, analyses was limited to genes that were altered in three or more of the 45 cell lines. Alterations that tend to be mutually exclusive between cell lines were combined, including genes in the PI3K pathway ( PIK3CA and PPP2R1A ) and the genes in the TGFBR pathway ( SMAD3 and SMAD4). As tumors with homologous recombination deficiencies (HRD) have been known to be sensitive to PARP inhibitors, covariates summarizing the extent of genome-wide structural alterations for the PARP inhibitor BMN673 were additionally added. A priori it was hypothesized that most alterations would not modulate response to the targeted inhibitors. Implementing a Bayesian model averaging approach to variable selection as has been considered for other biomarkers (see, e.g., Viallefont et ah, 2001 Statistics inMedicine 20:3215-3230; Neto et ah, 2014 Pacific Symposium on

Biocomputing. Pacific Symposium on Biocomputing:27-38; and Meisner et ah, 2018 Biomarker research 6:3), a positive prior probability that the coefficient for each gene is exactly zero was specified. Given the genes or combination of genes and structural variant summaries, the space of possible single- and multi-variate models for logICso was explored by Markov Chain Monte Carlo. Relevant posterior summaries available for each inhibitor include the probability that the regression coefficient is non-zero and the posterior distribution of the regression coefficients. This approach was used to focus on those features that were present in at least half of the models as these had a higher probability of being predictive for drug response (Figure 6A).

For PARP inhibition by BMN673, analyses revealed that the number of genome-wide rearrangements and amplification of MYC were important predictors of drug sensitivity (Figure 6). Importantly, the two cell lines with inactivating BRCA1/2 mutations as well as the HRD score were applied through our whole genome analyses, and PARP1 expression showed a trend towards increased sensitivity to PARP inhibition but were not statistically significant (Figure 6). It was found that amplification of MYC or an increase in the number of genome-wide rearrangements, including inversions and intra-chromosomal

rearrangements, were significantly associated with sensitivity to this therapy, appearing in 94% of the single and multi-variate models. It was estimated the difference of the mean log

IC50 between the group of tumors with alterations in these features and the group of tumors without such changes, revealing a 93% (90% Cl: 99%-64%) and 86% (90% Cl, 96%-43%) increased sensitivity to PARP inhibition for cell lines with MYC amplification and increased rearrangements, respectively (Figure 6). Although other genomic signatures and PARP1 expression have been suggested as biomarkers for PARP sensitivity (Nik-Zainal et ah, 2016 Nature 534:47-54), MYC amplification and rearrangements have not been previously identified as markers of PARP sensitivity in serous and endometrioid ovarian cancers. Taken together, these results suggest that alterations of common drivers along with large-scale structural alterations in ovarian cancer may identify tumors with high sensitivity to this therapy.

For inhibition of the PI3K pathway by GNE-493, mutations of PPP2R1A or PIK3CA appeared in more than 75% of the models evaluated. Cancer cell lines with mutations in PARP1 or PPP2R1A had a 66% increased sensitivity to GNE-493 (Figure 6). The results suggest that PI3K inhibitors counter the loss of PI3K pathway regulation from inactivating mutations of PPP2R1A and activating mutations of PIK3CA.

For the MEK pathway, mutations or deletions in SMAD3 or SMAD4 were predictive of IC50 levels in response to the inhibitor MEK-162. These were selected in more than 85% of the models and resulted in an increased sensitivity of 89% to this therapy. The results are show that loss of SMAD4 can lead to activation of Smad-independent MEK/ERK pathway signaling and that inhibition of this pathway with MEK inhibitors can reverse tumorigenic effects.

Experimental Procedures

Cell lines and growth analyses

Cell lines were obtained from multiple sources (Table 1). Cells were plated into 24- well tissue culture plates at a density of 2 x 10 ⁵ to 5 x 10 ⁵ cells per well and grown in cell- line-specific medium without or with increasing concentrations of their respective drugs (ranging between 0.001 and 10 pm/L).

Cells were counted on day 7 using an automated cell viability assay (Vi-CELL XR Cell Viability Analyzer, Beckman Coulter, Fullerton, CA, ETSA), a video imaging system that uses an automated trypan blue exclusion protocol. Both adherent and floating viable cells were counted for treatment and control wells. Growth inhibition (GI) was calculated as a percentage of untreated controls. The log of the fractional GI was then plotted against the log of the drug concentration and the IC ₅₀ values were interpolated from the resulting linear regression curve fit (CalcuSyn; Biosoft, Ferguson, MO, ETSA). Experiments were performed thrice in duplicate for each cell line. STR analyses

Genomic DNA from all cell lines was PCR amplified using a Geneprint 10 System (Promega, Madison, WI) that contains eight short tandem repeat loci plus Amelogenin, a gender determining marker. The PCR amplification was carried out in a GeneAmp PCR System 9700 following the manufacturer’s protocol. The PCR products were

electrophoresed on a ABI Prism 3730x1 Genetic Analyzer using Internal Lane Standard 600 (Promega) for sizing. Data was analyzed using GeneMapper v. 4.0 software (Applied Biosystems, Foster City, CA). STR profiles (JHU) for these cell lines were compared to external STR profiles, including those described elsewhere (see, e.g., Korch et al ., 2012 Gynecol. Oncol. 127:241-248; COSMIC (v83, cancer.sanger.ac.uk/cosmic); the RIKEN BioResource Center (jove.com/institutions/AS-asia/JP-japan/20278-riken-bioresou rce- center); and Yu et al. 2015 Nature 520:307-311) (Table 2). The average percent similarity between JHU STRs and external STRs was 98%. An external STR was not available for 5 cell lines. Whole genome next generation sequencing

DNA was extracted from cell lines using a QIAamp DNA Blood Mini QIAcube Kit (Qiagen Valencia, CA). In brief, the samples were incubated in proteinase K for 16 hours before DNA extraction. DNA purification was performed using the QIAamp DNA Blood Mini QIAcube kit following the manufacturer’s instructions (Qiagen, Valencia, CA).

Genomic DNA from tumor samples were used for Illumina TruSeq library construction (Illumina, San Diego, CA) according to the manufacturer’s instructions. Paired-end sequencing resulting in 100 bases from each end of the fragments was performed using Illumina HiSeq2000 instrumentation.

PCR and Sanger Sequencing

PCR and Sanger sequencing confirmed the presence of fusion candidates generated by Trellis. Primers were designed 200 bp on either side of the junction and are shown in Table 13. Primers were purchased from IDT (Coralville, IA, USA). Primers were purified by desalting and upon arrival, primers and probes were resuspended to IOOmM in IDTE (lOmM Tris, pH 8.0; O.lmM EDTA) buffer and stored at -20°C. Using the primers specific for each fusion, PCR amplification was performed in a 50 pL reaction volume in quadruplicate, consisting of 10 pL of 5X Phusion buffer, 1 pL of lOmM dNTP, 2.5 pL of each primer at 10 pM, 0.5 pL of HotStart Phusion and 10 ng of cell line DNA. PCR was performed using a Biorad S1000 Thermal Cycler. The thermal cycle was programmed for 30 seconds at 98°C for initial denaturation, followed by 34 cycles of 10 seconds at 98°C for denaturation, 30 seconds at 59°C for annealing, 30 seconds at 72°C for extension, and 5 minutes at 72°C for final extension. Human mixed genomic DNA (Promega, Madison, WI) and no template were used as negative controls. PCR products were purified using

Nucleospin Gel and PCR cleanup as per the manufacturer’s instructions (Macherey -Nagel, Duren, Germany). PCR products were then subjected to Sanger sequencing using the Applied Biosystems 3730x1 DNA Analyzer as per manufacturer’s instructions (Thermo Fisher, Waltham, MA). Output was compared to original candidate fusion sequence and confirmed.

Droplet digital PCR

The translocation-primers were designed on both sides of the translocation. One of these primers was used as a common primer for both the translocation and the control. A third primer was designed to be used in combination with the common primer to amplify the wild-type sequence of one of the two translocation partners. The hydrolysis probes labeled with the FAM-fluorochrome at the 5’ -end were designed to bind specifically to the translocation PCR-product, while the probes labeled with the HEX-fluorochrome were designed to bind specifically to the control PCR-product. As quenchers, a ZEN quencher was used as an internal quencher, while the Iowa Black FQ-quencher was added to the 3’-end of the probes. Probes were designed to have a higher melting temperature than the primers. The primers and hydrolysis probes were purchased from IDT (Coralville, IA, USA). The primers were purified by desalting, while the hydrolysis probes were purified using high- performance liquid chromatography. Upon arrival, primers and probes were resuspended to IOOmM in IDTE (lOmM Tris, pH 8.0; O.lmM EDTA) buffer and stored at -20°C. 20pL droplet digital PCR (ddPCR) reactions were prepared, using lOpL of 2x ddPCR SuperMix for Probes (No dUTP) (Bio-Rad, Hercules, CA, USA), 5-30ng of gDNA, as quantified by the Qubit dsDNA high sensitivity assay kit (Thermo Fisher Scientific, Waltham, MA, USA), primers (each at a final concentration of 900nM), probes (each at a final concentration of 250nM) and nuclease-free water. Human mixed genomic DNA (Promega) was used as negative control. Droplets were generated using the QX200 droplet generator (Bio-Rad) by loading the DG8 cartridge (Bio-Rad) with 20pL of the reaction mixture and 70pL of droplet generation oil for probes (Bio-Rad). 40pL of droplet/oil mixture was transferred to a ddPCR 96-well plate (Bio-Rad). The plate was heat-sealed with a pierceable foil heat seal (Bio- Rad). A S1000 Thermal Cycler (Bio-Rad) was used with the following amplification protocol: enzyme activation at 95°C for 10 minutes, followed by 6 cycles: denaturation at 54°C for 30 seconds; annealing/extension at 60°C for 1 minute, followed by 34 cycles: denaturation at 58°C for 30 seconds; annealing/extension at 60°C for 1 minute. Following cycling, the samples were held at 98°C for 10 minutes. Upon completion of the PCR protocol, the plate was read using the QX200 droplet reader (Bio-Rad). Droplet counts and amplitudes were analyzed with QuantaSoft software (vl.7)(Bio-Rad).

Alignment and identification of sequence alterations

Prior to mutation calling, primary processing of sequence data for samples was performed using Illumina CASAVA software (vl.8.2), including masking of adapter sequences. Sequence reads were aligned against the hgl9 human reference genome using ELAND. Candidate somatic mutations in the exome, consisting of point mutations, insertions, and deletions were identified using VariantDx (Jones et al., 2015). To detect mutations that were more likely to be somatic, mutations were excluded that appeared in >10% of the distinct reads and mutations tagged as COMMON or MULT in dbSNP VCF files. Additionally, mutations without a record in COSMIC were excluded as well as in- frame deletions (COSMIC v72). Exceptions to the COSMIC requirement were mutations that predicted truncations in relevant pathways or tumor suppressor genes (Table 5). Single nucleotide polymorphisms (SNPs) flagged as clinically associated or reported in more than 25 samples in COSMIC were not excluded regardless of heterozygosity or percentage of distinct reads. All candidate somatic mutations were confirmed by visual inspection.

Samples with more than 2000 alterations after dbSNP filtering were considered

hypermutators. Mutational signatures were based on the fraction of mutations in each of the 96 trinucleotide contexts (see, e.g., Alexandrov et al., 2013 Nature 500: 415-421). The contribution of each signature to each tumor sample was estimated using the deconstructSigs R package (Table 14 for R package versions).

Implementation ofDELLY and LUMPY

Identifying probable somatic structural variants in tumor-only experimental designs is a major challenge. False positives arise from germline variants incorrectly reported as somatic and spurious alignments misinterpreted as biological variation. We considered two established tools, DELLY and LUMPY, for detection of structural variants (Rausch et al., 2012; Layer et al., 2014). Reads were aligned to the hgl9 reference genome using BWA- MEM (version 0.7.10) (Li and Durbin, 2009) as recommended by these methods. DELLY (version 0.7.7) and LUMPY (version 0.2.13) were implemented using default parameters.

A simple leave-one out cross validation experiment was implemented using the 10 lymphoblastoid controls to evaluate the specificity of these methods for identifying somatic structural variants in a tumor-only experimental design. Specifically, the held out sample was treated as a tumor and identified germline structural alterations in the training set.

Excluding structural variants identified in the training set, any alteration identified in the held out sample was considered as a false positive.

Implementation of Trellis

Germline filters: Using 10 lymphoblastoid cell lines and 8 normal ovarian samples, sequence and germline filters were developed for the hgl9 reference genome to flag regions prone to alignment artifacts and/or germline structural variation. Sequence filters for the hgl9 reference genome that were masked prior to copy number analyses comprised 326.4 Mb of the genome and included non-overlapping lkb genomic intervals (bins) with average mappability less than 0.75 or GC percentage less than 10%, as well as the gaps track from the UCSC genome browser that includes heterochromatin, centromeric, and subtelomeric regions (see, e.g., Fujita et al., 2011 Nucleic Acids Res 39:D876-D882). After removing these sequence filters as well as chrY (all cell lines were derived from women), the read depth was normalized for the remaining 2,680,222 bins. For each bin, the GC-adjusted, log2- transformed count of aligned reads was computed. GC-normalization was implemented using a loess smoother with span 1/3 fitted to a scatterplot of the bin-level GC and log2 count. The GC-adjusted log2 ratios (the residuals from the loess correction) were denoted by R , the mean R for a genomic region by R, and the median absolute deviation of the autosomal Rs by S. Because some bins had an unusually high or low number of aligned reads in multiple controls, bin i was defined in normal control j as an outlier if Ri > (3 x Sj). Bins identified as an outlier in two or more normal controls were flagged. These analyses flagged 55,764 genomic regions totaling 75.9Mb of sequence. To identify somatic copy number alterations, the Rs was segmented using circular binary segmentation implemented in the R package DNAcopy with settings alpha=0.00l, undo.splits- sdundo', and undo.SD=2 (see, e.g., Olshen et al., 2004 Biostatistics 5:557-72; and Venkatraman and Olshen, 2007

Bioinformatics 23 :657-663). To exclude regions that were either copy number altered in the lymphoblastoid cell lines as well as segments that span difficult regions to genotype, segments having \R\ > 1 were flagged. A total of 919 segments (46.8Mb) were flagged across the 18 normal controls.

To characterize copy neutral rearrangements including inversions and translocations in the normal controls, all read pairs were extracted from the BAM file that were improperly paired and for which the intra-mate distance between paired reads was at least lOkb. A cluster of improper read pairs was defined as a genomic region where at least one base is spanned by five or more improper reads and for which the union of the aligned regions is at least 115 basepairs. Next, these clusters were linked by the mates of the constituent reads. Clusters that could not be linked by at least 5 read pairs were excluded from further analysis. For all linked clusters, at least 90% of the linking read pairs were required to support the same structural variant group (Table 12). Linked clusters for which the type of

rearrangement was not consistent among the linking read pairs were excluded from further analysis. For the remaining linked clusters, all the reads supporting the link were realigned using the local aligner BLAT (see, e.g., Kent, 2002 Genome Res 12:656-664). A command- line version of BLAT was utilized for this step (Standalone BLAT v. 35). Confirmation by BLAT required that the reads only align to one location with a BLAT score > 90% in the hgl9 reference genome. These germline rearrangements were used to screen candidate somatic rearrangements as described in greater detail below. Somatic deletions: Putative focal homozygous and hemizygous deletions greater than 2kb and less than 3Mb in the ovarian cell lines were identified by R < -3 and A e (-3; -0:75), respectively. Any deletion > 75% of the interval were flagged in the control samples were excluded. For each deletion, it was investigated whether any improperly paired reads were aligned within 5kb of the segmentation boundaries. When five or more rearranged read pairs were aligned near the segmentation boundaries, the distribution of the improper read pair alignments was used to further resolve the genomic coordinates of the deletion boundaries. Resolution of the deletion breakpoints using this approach depends on the intra-mate distance of the improperly paired reads. On average, the intra-mate distance in the ovarian tumors was 262bp (5th and 95th percentiles: 183 and 353). With multiple rearranged read pairs, it was expected that the resolution of the deletion breakpoints was generally less than lOObp.

As previously described, realignment by BLAT was used to confirm that the rearranged read pairs supporting the deletion mapped uniquely and with high fidelity to this region of the genome. Hemizygous and homozygous deletions supported by rearranged read pairs were indicated by hemizygous+ or homozygous+, respectively. Any deletion for which the outlier bins or germline CNVs occupied 75% or more of the width were excluded. Hemizygous deletions not supported by rearranged read pairs were also excluded. All deletions were confirmed by visual inspection.

Somatic amplifications: To identify focal amplicons and establish how these amplicons were linked in the tumor genome, a graph was seeded with high copy focal amplicons. Specifically, putative amplifications were identified as segments with R > 1:46, or a 2.75-fold increase from the mean ploidy of the cell line, and between 2kb and 3Mb in length. Properly paired reads were used to link seed amplicons to adjacent low-copy duplications (segments with R > 0:81 or fold-change of 1.75). When five or more links were established, the low copy segments were added as nodes to the graph with an edge indicating the connection between the high- and low-copy amplicons. Similarly, links were established between the low- and high-copy amplicons that were non-adjacent with respect to the reference genome by analysis of improperly paired reads as previously described.

Somatic copy-neutral intra- and inter-chromosomal translocations and inversions: Candidate somatic copy-neutral rearrangements were identified as previously described in the control samples. However, rearrangements in the ovarian tumor cell lines that overlapped any rearrangement identified in the controls samples were excluded. In addition to improperly paired reads, at least 1 split read supporting the rearrangement was required.

To identify split read alignments, all read pairs for which only one read in the pair was aligned within 5kb of the candidate rearrangement were extracted. For all such read pairs, the unmapped mate was re-aligned using BLAT (see, e.g., Kent, 2002 Genome Res 12:656- 664). For any BLAT alignment wherein the realigned read aligned to both ends of the candidate sequence junction with a combined score of the two alignments > 90% constituted a split read (e.g., Figure 10).

In-frame gene fusions: To report candidate gene fusions, all candidate somatic rearrangements were identified for which both ends of the novel adjacency in the tumor genome was in a coding region of the genome or a promoter of a gene defined as within 5kb of the transcription start site. Rearrangements in which both ends resided in the same gene were excluded as these may represent alternative isoforms. For each candidate fusion, two possible orientations of the regions joined in the tumor genome were evaluated and for each orientation the full amino acid sequence of both the 5 ' and 3 ' transcripts were extracted as well as the candidate amino acid sequence that would be created by the fusion. The fusion was considered to be in-frame if the amino acid sequence of the 3 ' partner was a subsequence of the reference amino acid sequence.

Genome-wide methylation analyses

We pre-processed and normalized raw ID AT files from the Infmimum

MethylationEPIC array using the funnorm function in the R package minfi (see, e.g., Aryee et al. 2014 Bioinformatics 30: 1363-1369). Probes on chromosomes X or Y, probes with detection p-value greater than 0.5, or probes overlapping a SNP with dbSNP minor allele frequency greater than 10% were excluded. In order to understand the similarity of ovarian cells lines with human ovarian cancer, the ovarian cells lines were compared with human ovarian cancer samples available from Genomic Data Commons (gdc.cancer.gov/). The Genomic Data Commons contained 533 human methylation profiles of ovarian cancer and eight normal fallopian tissue samples. Methylation of TCGA ovarian cancers was assessed using Infmium HumanMethylation27 BeadChip array (27,578 probes). The number of probes in common between the HumanMethylation27 platforms and the MethylationEPIC platform was 18,016. On the common set of 18,016 probes, overall methylation was quantified in the TCGA samples and the ovarian cell lines as the fraction of CpG sites with b > 0:3. To identify differentially methylated CpG sites comparing normal fallopian tissue to TCGA ovarian cancers, probes were selected from the common set of 18,016 that were hyper-methylated in TCGA ovarian cancer (average b > 0:4) and unmethylated in normal fallopian tissue (average b < 0:2). In addition, probes were also selected that were hypo- methylated in TCGA ovarian cancer (average b < 0:1) and hyper-methylated in normal fallopian (average b > 0:3).

Gene expression analyses

Pre-processing and normalization of the 44k Agilent microarray for the ovarian cell lines has been described elsewhere and normalized expression data was available for 44 of the 45 tumors (see, e.g., Konecny et al., 2011 Clinical Cancer Research 17: 1591-1602). For copy number altered genes with known clinical relevance to cancer, it was assessed whether amplified genes were over-expressed and whether deleted genes were under-expressed. The probability that a gene was over- or underexpressed was estimated by a two-component hierarchical mixture model implemented in the R package CNPBayes and compared to a single-component mixture model assuming no differential expression. A tumor for which the posterior probability of differential expression was greater than 0.5 was called over- or under-expressed. Dose response models

Bayesian model averaging: models of the form

were considered where Ci denotes the logICso and x, _;j is an indicator for the alteration status (0 not altered, 1 altered) of feature j in cell line i. The regression coefficient for feature j is the product of a binary indicator zj and a real number hj. A modified -prior was used for g such that Y _J was zero whenever z, was zero. For the vector of g’ s with non-zero z’s, a multivariate normal prior was used. The space of the possible 2 p models was explored using a Gibbs sampler. The binary features comprising the x’s included somatic mutations, somatic structural variants (deletions, amplifications, in-frame fusions), methylation, and under- or over-expression. For the PARP inhibitor, the number of intra-chromosomal rearrangements and the HRD score as potential markers for HRD were additionally considered. For rearrangements, the mean of the square-root transformed frequency across all cell lines was computed and a binary covariate was defined for whether the square-root transformed statistic was greater than the mean. The HRD score was used without transformation for Bayesian model averaging. For the univariate analyses described in the next section, a binary covariate for HRD was defined according to whether the score was larger than the mean. Qualitatively similar inferences were obtained using the continuous HRD score (data not shown). For the inhibitor of the MEK pathway, one of the logICso concentrations was missing. For this cell line, we used the posterior mean from the imputation described in greater detail below.

Univariate analysis of selected features: For a given feature, our sampling model for the length-3 vector of inhibitor concentrations inducing 20%, 50%, and 80% cell death is

for a cell line with an alteration in this feature and for a cell line without an alteration. With inhibitor concentrations on the log scale, the residuals are approximately multivariate-normal: Computationally convenient conjugate priors for the unknown parameters in this model are r m,d. å.) = r(m)r(d)r{å) .

For some cell lines, inhibitor concentrations were incomplete. As the logC were highly correlated across cell lines, missing observations were imputed from the observed data using a Gibbs sampler. Inference regarding differences in mean logC, given by the posterior distribution of 2ό, was based on the marginal probability of the observed data integrating over the missing data. 90% highest posterior density (HPD) intervals were reported for the difference in the mean logICso.

Data and software availability

Sequencing data will be made available upon publication through the European

Genome-phenome Archive at ENSEMBL-EBI (accession EGAS00001002998). The R package Trellis for identifying somatic structural variants in tumor-only analyses is available from github (github.com/cancer-genomics/trellis).

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Table S9 Rearrangements

Table S10 Predicted in-frame coding fusions

Table S11 Pathway inhibitors

Table S12 Rearrangement types identified from improperly paired reads

Table S13 Primers for Sanger sequencing and droplet digital PCR

Table S14 R package versions

Supplemental Tables for Integrated Genomic, Epigenetic, and Expression Analyses of Ovarian Cancer Cell Lines

Table S1 Summary of ovarian cancer cell lines analyzed

Related to Figure 1 and Experimental Procedures.

Primary

Lab ID Cell line Tissue Subtype Description Score References Source Media

CCOV16T OAW42 ovarian serous Unlikely high- 0.14 PMID: European Collection of Cell Cultures, Salisbury, DMEM grade serous 6583437 United Kingdom

CCOV17T OV167 ovarian serous Possibly high- NA PMID: Dr. V. Shridhar, Mayo Clinic, Rochester, MN MEM grade serous 9473353

CCOV18T OV177 ovarian serous Possibly high- NA PMID: Dr. V. Shridhar, Mayo Clinic, Rochester, MN MEM grade serous 9473353

CCOV21T OV-90 ovarian serous Possibly high- 1.19 PMID: ATCC, Rockville, MD MCDB 105 grade serous 9811467

CCOV23T OVCA429 ovarian serous Unlikely high- NA Dr. RC Bast Dr. B. Karlan, Cedars Sinai, Los Angeles, CA MEM grade serous Jr.; PMID:

7028788

CCOV2ST OVCAR3 ovarian serous Possibly high- NA PMID: ATCC, Rockville, MD DMEM grade serous 6604576

CCOV28T OVKATE ovarian serous Likely high- 1.39 PMID: Japanese Health Science Research Resources RPMI grade serous 9328139 Bank, Osaka, Japan

CCOV30T OVSAHO ovarian serous Likely high- 1.54 PMID: Japanese Health Science Research Resources RPMI grade serous 9328139 Bank, Osaka, Japan

CCOV32T PE014 ovarian serous Possibly high- NA PMID: Dr. S. P. Langdon, Edinburgh Cancer Research RPMI grade serous 3167863 Center, University of Edinburgh, Edinburgh,

United Kingdom

CCOV34T PE06 ovarian serous Possibly high- NA PMID: Dr. S. P. Langdon, Edinburgh Cancer Research DMEM/F12 grade serous 3167863 Center, University of Edinburgh, Edinburgh,

United Kingdom

CCOV44T FUOV1 ovarian serous Possibly high- 1.3 PMID: Dr. Simon Cayther, USC, Los Angeles, CA MEM grade serous 10337661

CCOV4ST COV318 ovarian serous Likely high- 1.46 PMID: Dr. Simon Cayther, USC, Los Angeles, CA DMEM grade serous 8436435

Tomioka Y. Establishment and characterization of human ovarian clear cell carcinoma cell lines KOC-4c, KOC-5c, and KOC-7c ( J. Kurume Med. Assoc. 61:323- 333(1998)). The original score of 0.33 reported by Domcke et al. was revised to reflect a frameshift TP53 mutation in this cell line. WO 2020/081549 Primary PCT/US2019/056299

Lab ID Cell line Tissue Subtype Description Score ReFerences Source Media

CGOV46T JHOS-2 ovarian serous Likely high- 1.34 PMID: RIKEN, Japan DMEM/F12 grade serous 10695020

CGOV47T JHOS-4 ovarian serous Likely high- 1.43 RIKEN RIKEN, Japan DMEM/F12 grade serous BioResource

Center

CGOV4T DOV13 ovarian serous Unlikely high- NA PMID: Dr. V. Shridhar, Mayo Clinic, Rochester, MN EMEM grade serous 1536252

CGOV5T EFO-21 ovarian serous Unlikely high- 0.34 PMID: German Tissue Repository, DSMZ, Braunschweig, RPMI grade serous 6405069 Germany

CGOV6T EFO-27 ovarian serous Hyper- -1.53 PMID: German Tissue Repository, DSMZ, Braunschweig, RPMI mutated 6405069 Germany

CGOV8T HEY ovarian serous Unlikely high- NA PMID: Dr. D. T. Curiel, University oF Alabama at RPMI grade serous 4016745; Birmingham, Birmingham, AL

PMID:

7362779

CCOV92T JHOS-3 ovarian serous Unlikely high- NA RIKEN RIKEN BioResource Center Cell Bank, Japan DMEM grade serous BioResource

Center

CCOV12T KOC-7C ovarian clear cell Hyper- NA Tomioka Y* Dr. Itamochi, Department oF Obstetrics and RPMI mutated Gynecology, Tottori University School oF

Medicine, Japan

CCOV20T OV207 ovarian clear cell Possibly high- NA PMID: Dr. V. Shridhar, Mayo Clinic, Rochester, MN MEM grade serous 9473353

CCOV27T OVISE ovarian clear cell Unlikely high- 0.15 PMID: Japanese Health Science Research Resources RPMI grade serous 7535723 Bank, Osaka, Japan

CCOV29T OVMANA ovarian clear cell Unlikely high- 0.06 PMID: Japanese Health Science Research Resources RPMI grade serous 9328139 Bank, Osaka, Japan

CCOV31T OVTOKO ovarian clear cell Unlikely high- 0.08 PMID: Japanese Health Science Research Resources RPMI grade serous 7535723; Bank, Osaka, Japan

PMID:

9328139

CCOV3ST RMG-1 ovarian clear cell Unlikely high- 0.03 PMID: Japanese Health Science Research Resources F-12K grade serous 3154025 Bank, Osaka, Japan

CGOV39T TOV-21 G ovarian clear cell Hyper- -2.66 PMID: ATCC, Rockville, MD MCDB 10S mutated 10949993

CGOV7T ES-2 ovarian clear cell Possibly high- 1.29 Dr. Branimir ATCC, Rockville, MD McCoy's grade serous Sikic; PMID:

2733045

CGOV11T_1 KK ovarian clear cell Unlikely high- NA PMID: Dr. Itamochi, Department oF Obstetrics and RPMI grade serous 8148309 Gynecology, Tottori University School oF

Medicine, Japan

CGOV14T MCAS ovarian mucinous Unlikely high- -0.03 PMID: Japanese Health Science Research Resources EMEM grade serous 4056530 Bank, Osaka, Japan

CGOV36T RMUG-S ovarian mucinous Unlikely high- 1. 5 PMID: Japanese Health Science Research Resources F-12K grade serous 2083224 Bank, Osaka, Japan

CGOV48T JHOM-1 ovarian mucinous Possibly high- 0.98 RIKEN RIKEN BioResource Center Cell Bank, Japan DMEM/F12 grade serous BioResource

Center

CGOV38T TOV-112D ovarian endometrioid Possibly high- NA PMID: ATCC, Rockville, MD MCDB 105 grade serous 10949993

CGOV49T OVK-18 ovarian endometrioid Hyper- -1.22 PMID: RIKEN BioResource Center Cell Bank, Japan MEM mutated 6584390

CGOV10T IGROV1 ovarian mixed Hyper- -1.2 PMID: Dr. Simon Gayther, USC, Los Angeles, CA DMEM mutated 3861241

CGOV13T Kuramochi ovarian undiFFerentiated Likely high- 1.58 PMID: Japanese Health Science Research Resources RPMI grade serous 6268719 Bank, Osaka, Japan

Tomioka Y. Establishment and characterization oF human ovarian clear cell carcinoma cell lines KOC-4c, KOC-5c, and KOC-7c ( J. Kurume Med. Assoc. 61:323- 333(1998)). The original score oF 0.33 reported by Domcke et al. was revised to reFlect a FrameshiFt TP53 mutation in this cell line. WO 2020/081549 Primary PCT/US2019/056299

Lab ID Cell line Tissue Subtype Description Score References Source Media

CCOV40T TYK-nu ovarian undifferentiated Likely high- 1.42 PMID: Japanese Health Science Research Resources EMEM grade serous 3782955 Bank, Osaka, Japan

CGOV1ST OAW28 ovarian unclassified Likely high- 1.38 PMID: European Collection of Cell Cultures, Salisbury, DMEM grade serous 2653399; United Kingdom

PMID:

8795574

CCOV1T A2780 ovarian unclassified Unlikely high- -0.37 Dr. Stuart European Collection of Cell Cultures, Salisbury, RPMI grade serous Aaronson; United Kingdom

PMID:

6173755

CCOV26T OVCAR5 ovarian unclassified Unlikely high- NA PMID: Dr. V. Shridhar, Mayo Clinic, Rochester, MN DMEM grade serous 6385258

CCOV2T CAOV-3 ovarian unclassified Likely high- 1.33 PMID: ATCC, Rockville, MD DMEM grade serous 3518877;

PMID:

4016745

CCOV33T PEA2 ovarian unclassified Possibly high- NA PMID: Dr. S. P. Langdon, Edinburgh Cancer Research RPMI grade serous 3167863 Center, University of Edinburgh, Edinburgh,

United Kingdom

CC0V3T COLO-704 ovarian unclassified Hyper- 0.2 Leibniz- German Tissue Repository, DSMZ, Braunschweig, RPMI mutated Institut Germany

DSMZ

CCOV42T OVCAR8 ovarian unclassified Possibly high- 0.76 PMID: Dr. Simon Gayther, USC, Los Angeles, CA RPMI grade serous 2307530

CCOVS3T OVCARS- ovarian unclassified Unlikely high- NA PMID: Dr. Oliver Dorigo, UCLA, Los Angeles, CA DMEM

CisR grade serous 6385258

CGOV37T_3 SKOV-3 ovarian unclassified Possibly high- 0.67 ^† PMID: Dr. B. Karlan, Cedars Sinai, Los Angeles, CA McCoy's grade serous 833871

CGH8N GM10847 lymphoblast NA Utah/Mormon NA Coriell Coriell Institute for Medical Research, Camden, N/A culture Institute NJ

CGH7N GM12878 lymphoblast NA Utah/Mormon NA Coriell Coriell Institute for Medical Research, Camden, N/A culture Institute NJ

CGH3N GM17981 lymphoblast NA Chinese in NA Coriell Coriell Institute for Medical Research, Camden, N/A culture Metropolitan Institute NJ

Denver,

Colorado,

USA

CGH4N GM17982 lymphoblast NA Chinese in NA Coriell Coriell Institute for Medical Research, Camden, N/A culture Metropolitan Institute NJ

Denver,

Colorado,

USA

CCH5N CM19573 lymphoblast NA Japanese in NA Coriell Coriell Institute for Medical Research, Camden, N/A culture Tokyo, Japan Institute NJ

CCH6N CM19574 lymphoblast NA Japanese in NA Coriell Coriell Institute for Medical Research, Camden, N/A culture Tokyo, Japan Institute NJ

CCH10N CM19734 lymphoblast NA Chinese in NA Coriell Coriell Institute for Medical Research, Camden, N/A culture Metropolitan Institute NJ

Denver,

Colorado,

USA

CGH9N GM19737 lymphoblast NA Chinese in NA Coriell Coriell Institute for Medical Research, Camden, N/A culture Metropolitan Institute NJ

Denver,

Colorado,

USA

Tomioka Y. Establishment and characterization of human ovarian clear cell carcinoma cell lines KOC-4c, KOC-Sc, and KOC-7c ( J. Kurume Med. Assoc. 61:323- 333(1998)). The original score of 0.33 reported by Domcke et al. was revised to reflect a frameshift TP53 mutation in this cell line. Primary

Lab ID WO 2020/081549 Subtype Description Score References Source PCT/US2019/056299ledia

CCH1 N GM19901 lymphoblast NA African NA Coriell Coriell Institute for Medical Research, Camden, N/A

culture Ancestry in Institute NJ

Southwest

USA

CCH2N GM19902 lymphoblast NA African NA Coriell Coriell Institute for Medical Research, Camden, N/A

culture Ancestry in Institute NJ

Southwest

USA

‘Tomioka Y. Establishment and characterization of human ovarian clear cell carcinoma cell lines KOC-4c, KOC-Sc, and KOC-7c ( J. Kurume Med. Assoc. 61:323- 333(1998)). ^† The original score of 0.33 reported by Domcke et al. was revised to reflect a frameshift TP53 mutation in this cell line.

Table S2 STR analyses of ovarian cell lines

Related to Figure 1 and Experimental Procedures. STR analyses for each cell line were performed and compared to external databases. The mean similarity between STR

JHU STR analysis

Matches % similar Mouse

known Matching to marker

Lab ID Cell line Subtype cell line cell line reference detected D5S818 D13S317 D7S820 D16S539 VWA TH01 AMEL TPOX C

Comparison to COSMIC external reference

Comparison to Yu et al., 2015 STR analysis. Matches % similar Mouse

known Matching bo marker

Lab ID Cell line Subtype cell line cell line reference detected D5S818 D13S317 D7S820 D16S539 VWA TH01 AMEL TPOX C

* Comparison to COSMIC external reference

† Comparison to Yu et al., 2015 STR analysis.

Table S3 Summary of genomic analyses

Related to Figure 1 and Experimental Procedures.

Mapped to

genome (# Mapped bo Mapped bo Bases in exome with \ Bases in exome with \ Average high

Lab ID Cell line bases) exome (# bases) exome (%) (\geq\) 10 reads (n) (\geq\) 10 reads (%) quality coverage

CCOV16T OAW-42 127,314,031 ,800 2,120,021,711 0.017 49,168,350 0.980 36.0

CCOV17T OV-167 126,889,722,400 2,082,988,874 0.016 48,979,569 0.976 33.1

CCOV18T OV177 120,683,161 ,500 2,007,052,935 0.017 49,010,826 0.976 32.3

CCOV21T OV-90 111 ,726,115,300 1 ,928,309,879 0.017 49,081,872 0.978 33.7

CCOV23T OVCA-429 99,277,561 ,900 1,612,676,165 0.016 48,989,824 0.976 29.3 WO 2020/081549 lapped to PCT/US2019/056299

genome (# Mapped to Mapped to Bases in exome with\ Bases in exome with \ Average high Lab ID Cell line bases) exome (# bases) exome (%) (\geq\) 10 reads (n) (\geq\) 10 reads (%) quality coverage

CCOV25T OVCAR-3 107,345,406,200 1 ,777,448,826 0.017 48,888,013 0.974 31.0

CCOV28T OVKATE 120,111,997,200 1 ,933,406,773 0.016 48,949,056 0.975 34.6

CCOV30T OVSAHO 109,589,203,500 1 ,837,664,083 0.017 48,903,147 0.974 32.9

CCOV32T PEO-14 104,155,218,200 1 ,757,681,426 0.017 48,919,576 0.975 31.7

CCOV34T PEO-6 118,543,121 ,800 1 ,985,859,928 0.017 49,010,953 0.976 35.6

CCOV44T FU-OV-1 120,329,213,000 2,014,874,040 0.017 48,882,417 0.974 34.5

CCOV45T COV-318 119,963,006,000 2,062,539,382 0.017 48,971,032 0.976 35.7

CCOV46T JHOS-2 114,896,903,700 1 ,856,445,593 0.016 48,788,543 0.972 32.2

CCOV47T JHOS-4 92,656,405,000 1,512,549,230 0.020 48,004,372 0.960 28.0

CCOV4T DOV-13 115,247,452,900 1 ,890,926,588 0.016 49,073,834 0.978 30.8

CCOV5T EFO-21 131 ,659,499,000 2,236,327,562 0.017 48,900,412 0.974 38.9

CCOV6T EFO-27 100,169,989,700 1 ,636,428,682 0.016 49,102,377 0.978 29.1

CCOV8T HEY 119,823,556,000 2,063,329,007 0.017 48,965,372 0.975 35.8

CCOV92T JHOS-3 130,481,536,800 1 ,799,381,383 0.016 48,578,398 0.965 30.9

CCOV12T KOC-7C 126,543,652,000 1 ,880,665,950 0.017 49,165,809 0.979 31.5

CCOV20T OV207 133,869,300,700 2,256,556,953 0.017 49,134,115 0.979 39.1

CCOV27T OVISE 93,368,716,800 1,663,322,332 0.018 49,030,750 0.977 29.4

CCOV29T OVMANA 102,777,959,400 1,744,487,916 0.020 49,003,540 0.980 31.0

CCOV31T OVTOKO 101 ,813,930,300 1,606,105,297 0.016 48,989,308 0.976 29.1

CCOV35T RMC-I 97,702,225,700 1,610,003,898 0.016 48,673,424 0.970 29.2

CCOV39T TOV-21 C 117,004,545,400 1,961,829,335 0.017 49,164,778 0.979 35.3

CCOV7T ES-2 111 ,500,740,800 1 ,851,794,498 0.017 49,130,882 0.979 30.7

CGOV11TJ KK 140,084,001 ,800 2,210,022,872 0.016 49,137,996 0.976 36.7

CCOV14T MCAS 124,679,677,000 1 ,992,307,537 0.016 49,107,761 0.978 34.8

CCOV36T RMUC-S 108,068,457,700 1,800,235,062 0.017 48,917,470 0.975 32.2

CCOV48T JHOM-1 135,333,315,800 2,076,589,350 0.020 49.113.248 0.980 34.0

CCOV38T TOV-112D 104,131,023,100 1,792,121,233 0.017 49,039,751 0.977 32.0

CCOV49T OVK-18 90,482,755,900 1,448,721,569 0.020 49,031,031 0.980 24.0

CCOV10T IGROV-1 121 ,519,271 ,300 2,045,216,061 0.017 49,188,973 0.980 34.5

CGOV13T Kuramochi 127,510,600,400 2,118,335,846 0.017 48.905.249 0.974 34.4

CGOV40T TYK-nu 112,725,891 ,000 1 ,852,556,701 0.016 48,971,872 0.976 32.5

CGOV15T OAW-28 124,074,985,900 2,048,299,245 0.017 48,915,450 0.975 35.8

CGOV1T A2780 117,451,750,500 1,944,777,962 0.017 49,153,512 0.976 34.1

CGOV26T OVCAR-5 99,897,404,200 1,619,448,579 0.016 48,604,429 0.968 28.3

CGOV2T Caov-3 131 ,306,959,000 2,270,780,071 0.017 49,054,357 0.977 38.5

CGOV33T PEA2 120,977,572,400 1 ,896,767,863 0.016 48,983,651 0.976 34.2

CGOV3T COLO-704 118,365,148,800 1,992,816,003 0.017 49,160,126 0.979 32.9 WO 2020/081549 lapped to

genome (# Mapped to Mapped to

Lab ID Cell line bases) exome (# bases) exome (%)

CCOV42T OVCAR-8 115,593,426,900 1 ,814,448,925 0.016 48,786,146 0.972 31.3

CCOV53T OVCAR-5- 97,823,176,800 1,558,538,741 0.020 48,769,705 0.970 25.0

CisR

CGOV37T_3 SK-OV-3 132,514,663,700 2,071,847,943 0.016 49,047,774 0.974 36.0

Table S4 Summary of sequence alterations

Related to Figure 5 and Experimental Procedures. Hypermutated cell lines have mutations in one or more MMR genes and more than 2000 alterations after excluding common germline variants.

MMR

MMR genes genes Total

Lab ID Cell line Subtype altered methylated alterations Putative somatic alterations Hypermutated

CCOV16T OAW42 serous 615 6 no

CCOV17T OV167 serous 489 4 no

CCOV18T OV177 serous 466 2 no

CCOV21T OV-90 serous PMS2 553 7 no

CCOV23T OVCA429 serous MSH6 667 4 no

CCOV25T OVCAR3 serous PMS2 419 6 no

CCOV28T OVKATE serous 539 10 no

CCOV30T OVSAHO serous PMS2 588 5 no

CCOV32T PE014 serous 503 2 no

CCOV34T PE06 serous 510 4 no

CCOV44T FUOV1 serous PMS2 1108 12 no

CCOV45T COV318 serous MSH6, PMS2 574 7 no

CCOV46T JHOS-2 serous 537 7 no

CCOV47T JHOS-4 serous 655 4 no

CCOV4T DOV13 serous 778 8 no

CCOV5T EFO-21 serous 744 5 no

CCOV6T EFO-27 serous MSH6. MSH2, 2417 45 yes

PMS2

CCOV8T HEY serous MLH1 638 6 no

CCOV92T JHOS-3 serous 367 35 no

CCOV12T KOC-7C clear cell MSH6, MSH2, 3930 68 yes

PMS2

CCOV20T OV207 clear cell 566 6 no

CCOV27T OVISE clear cell 596 8 no

CCOV29T OVMANA clear cell 644 4 no

CCOV31T OVTOKO clear cell 609 8 no

CCOV35T RMG-1 clear cell MLH1 516 4 no

CGOV39T TOV-21 G clear cell PMS2 2292 30 yes

CGOV7T ES-2 clear cell 1016 12 no

CGOV11TJ KK clear cell 423 62 no

CGOV14T MCAS mucinous PMS2 844 12 no

CGOV36T RMUG-S mucinous PMS2 584 3 no

CGOV48T JHOM-1 mucinous 564 7 no

CGOV38T TOV-112D endometrioid 404 4 no

CGOV49T OVK-18 endometrioid PMS2 2643 32 yes WO 2020/081549 MMR PCT/US2019/056299

MMR genes genes Total

Lab ID Cell line Subtype altered methylated alterations Putative somatic alterations Hypermutated

CGOV10T ICR0V1 mixed MLH1. MSH6, 4075 67 yes

MSH2, PMS2

CGOV13T Kuramochi undifferentiated 627 6 no

CGOV40T TYK-nu undifferentiated MSH6, MSH2 575 7 no

CGOV1ST OAW28 unclassified 507 4 no

CGOV1T A2780 unclassified 1225 8 no

CGOV26T OVCAR5 unclassified 483 6 no

CGOV2T CAOV-3 unclassified 606 2 no

CGOV33T PEA2 unclassified 511 5 no

CGOV3T COLO-704 unclassified MSH6, PMS2 2009 24 yes

CGOV42T OVCAR8 unclassified MSH6 619 5 no

CGOVS3T OVCAR5- unclassified 987 5 no

CisR

CGOV37T_3 SKOV-3 unclassified 746 77 no

Table S5 Tumor suppressor genes evaluated for inactivating mutations

Related to Figure 5 and Experimental Procedures.

Gene symbol Gene name

POLL polymerase (DNA directed), lambda

RPA1 replication protein A1 , 70kDa

NEIL1 nei endonuclease Vlll-like 1 (E. coli)

NEIL2 nei endonuclease Vlll-like 2 (E. coli)

NTHL1 nth endonuclease Ill-like 1 (E. coli)

PNKP polynucleotide kinase 3'-phosphatase

APTX aprataxin

TDP1 tyrosyl-DNA phosphodiesterase 1

OGG1 8-oxoguanine DNA glycosylase

AGPAT9 1 -acylglycerol-3-phosphate O-acyltransferase 9

UNG uracil-DNA glycosylase

APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1

APEX2 APEX nuclease (apurinic/apyrimidinic endonuclease) 2

POLB polymerase (DNA directed), beta

FEN1 flap structure-specific endonuclease 1

ALKBH2 alkB, alkylation repair homolog 2 (E. coli)

Gene symboWO 2020/081549 PCT/US2019/056299

DDB1 damage-specific DNA binding protein 1 , 127kDa

ERCC6 excision repair cross-complementation group 6

ERCC7 excision repair cross-complementation group 7

ERCC8 excision repair cross-complementation group 8

LIG1 ligase I, DNA, ATP-dependent

MNAT1 MNAT CDK-activating kinase assembly factor 1

MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae)

RAD23A RAD23 homolog A (S. cerevisiae)

RAD23B RAD23 homolog B (S. cerevisiae)

RPA2 replication protein A2, 32kDa

GTF2HS general transcription factor IIH, polypeptide 5

RADS1 B RAD51 paralog B

RADS1 D RAD51 paralog D

XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2

XRCC3 X-ray repair complementing defective repair in Chinese hamster cells 3

MUS81 MUS81 structure-specific endonuclease subunit

EME1 essential meiotic structure-specific endonuclease 1

ATR ATR serine/threonine kinase

BARD1 BRCA1 associated RING domain 1

MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae)

RADSO RAD50 homolog (S. cerevisiae)

RADS1 RAD51 recombinase

DCLRE1C DNA cross-link repair 1 C

XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6

XRCCS X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)

XRCC4 X-ray repair complementing defective repair in Chinese hamster cells 4

PRKDC protein kinase, DNA-activated, catalytic polypeptide

HELQ helicase, POLQ-like

POLG polymerase (DNA directed), gamma

POLI polymerase (DNA directed) iota

G„ene symboWl O 2 u0e2ne0/ n0am8e1549 PCT/US2019/056299

RECQL5 RecQ protein-like 5

MSH3 mutS homolog 3

MLH3 mutL homolog 3

EX01 exonuclease 1

CHEK1 checkpoint kinase 1

MDC1 mediator oF DNA-damage checkpoint 1

TPS3BP1 tumor protein p53 binding protein 1

C11 orF30 chromosome 11 open reading Frame 30

ERCC4 excision repair cross-complementation group 4

RADS1C RADS1 paralog C

RADS1C RADS1 homolog C (S. cerevisiae)

BRIP1 BRCA1 interacting protein C-terminal helicase 1

BRCA2 breast cancer 2, early onset

PALB2 partner and localizer oF BRCA2

PALB2 partner and localizer oF BRCA2

FANCL Fanconi anemia, complementation group L

XRCC1 X-ray repair complementing deFective repair in Chinese hamster cells 1

DDB2 damage-specific DNA binding protein 2, 48kDa

ERCC1 excision repair cross-complementation group 1

ERCC2 excision repair cross-complementation group 2

ERCC3 excision repair cross-complementation group 3

ERCC5 excision repair cross-complementation group 5

ATM ATM serine/threonine kinase

CHEK2 checkpoint kinase 2

TPS3 tumor protein p53

BRCA1 breast cancer 1 , early onset

NBN nibrin

POLE polymerase (DNA directed), epsilon, catalytic subunit

POLH polymerase (DNA directed), eta

FANCC Fanconi anemia, complementation group C

Gene symbol WO 2020/081549 PCT/US2019/056299

ATRX alpha thalassemia/mental retardation syndrome X-linked

RECQL4 RecQ protein-like 4

MSH2 mutS homolog 2

MSH6 mutS homolog 6

MLH1 mutL homolog 1

PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae)

PMS2 PMS2 postmeiotic segregation increased 2 (S. cerevisiae)

PTEN phosphatase and tensin homolog

PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha)

MAX MYC associated Factor X

ARID1A AT rich interactive domain 1 A (SWI-like)

ARID1 B AT rich interactive domain 1B (SWI1-like)

SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator oF chromatin, subfamily a, member 4

SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

NF1 neurofibromin 1

CREBBP CREB binding protein

mTOR mechanistic target of rapamycin (serine/threonine kinase)

MLL myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)

MLL2 myeloid/lymphoid or mixed-lineage leukemia 2

MLL3 myeloid/lymphoid or mixed-lineage leukemia 3

NBS1 Nijmegen Breakage Syndrome 1

ATXN1 ataxin 1

AR androgen receptor

ARMC4 armadillo repeat containing 4

DRD4 dopamine receptor D4

EP300 E1 A binding protein p300

ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)

ANK3 ankyrin 3, node of Ranvier (ankyrin G)

APC adenomatous polyposis coli

CACNA1S calcium channel, voltage-dependent, L type, alpha 1S subunit

Gene symbol ^WO 020/08 ¹⁵⁴ PCT/US2019/056299

OR52B4 olfactory receptor, family 52, subfamily B, member 4

PPP2R1A protein phosphatase 2, regulatory subunit A, alpha

RAB17 RAB17, member RAS oncogene family

RELN reelin

REST RE1 -silencing transcription factor

RET ret proto-oncogene

RIPK1 receptor (TNFRSF)-interacting serine-threonine kinase 1

SIGLEC10 sialic acid binding Ig-like lectin 10

SLC2A7 solute carrier family 2 (facilitated glucose transporter), member 7

SMAD4 SMAD family member 4

SPEF2 sperm flagellar 2

USH2A Usher syndrome 2A (autosomal recessive, mild)

VPS13A vacuolar protein sorting 13 homolog A (S. cerevisiae)

ZFHX4 zinc finger homeobox 4

ZNF426 zinc finger protein 426

ABL1 c-abl oncogene 1 , non-receptor tyrosine kinase

ACVR1 C activin A receptor, type IC

ACVR1B activin A receptor, type IB

ALK anaplastic lymphoma receptor tyrosine kinase

ASXL1 additional sex combs like 1 (Drosophila)

AURKA aurora kinase A

AXIN2 axin 2

BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)

BCL2 apoptosis regulator

BCR breakpoint cluster region

BLM Bloom syndrome, RecQ helicase-like

BMPR1A bone morphogenetic protein receptor, type IA

BTK Bruton agammaglobulinemia tyrosine kinase

CALR calreticulin

CBL Cbl proto-oncogene, E3 ubiquitin protein ligase

Genesymbol _wo 2020/081549 PCT/US2019/056299

CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)

CEBPA CCAAT/enhancer binding protein (C/EBP), alpha

CIC capicua homolog (Drosophila)

CSF1 R colony stimulating Factor 1 receptor

CYLD cylindromatosis (turban tumor syndrome)

DAXX death-domain associated protein

DDR2 discoidin domain receptor tyrosine kinase 2

DICER1 dicer 1 , ribonuclease type III

DNMT3A DNA (cytosine-S-)-methyltransferase 3 alpha

EGFR epidermal growth Factor receptor

ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)

ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)

ESR1 estrogen receptor 1

ETV1 ets variant 1

ETVS ETS variant 5

EWSR1 Ewing sarcoma breakpoint region 1

EXT1 exostosin 1

EXT2 exostosin 2

EZH2 enhancer oF zeste homolog 2 (Drosophila)

FGFR1 Fibroblast growth Factor receptor 1

FGFR2 Fibroblast growth Factor receptor 2

FGFR3 Fibroblast growth Factor receptor 3

FGFR4 Fibroblast growth Factor receptor 4

FH Fumarate hydra tase

FLCN Folliculin

FLT3 Fms-related tyrosine kinase 3

FLT4 Fms-related tyrosine kinase 4

FOXL2 Forkhead box L2

GATA1 GATA binding protein 1

GATA2 GATA binding protein 2

Genesymbol WO 2020/081549 PCT/US2019/056299

IDH2 isocitrate dehydrogenase 2 (NADP+), mitochondrial

IGF1R insulin-like growth Factor 1 receptor

IGF2R insulin-like growth Factor 2 receptor

IKZF1 IKAROS Family zinc Finger 1 (Ikaros)

JAK1 Janus kinase 1

JAK2 Janus kinase 2

JAK3 Janus kinase 3

KDR kinase insert domain receptor (a type III receptor tyrosine kinase)

KIT v-kit Hardy-Zuckerman 4 Feline sarcoma viral oncogene homolog

MAML1 mastermind-like 1 (Drosophila)

MAP2K1 mitogen-activated protein kinase kinase 1

MAP2K4 mitogen-activated protein kinase kinase 4

MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse)

MDM4 Mdm4 p53 binding protein homolog (mouse)

MED12 mediator complex subunit 12

MEN1 multiple endocrine neoplasia I

MET met proto-oncogene (hepatocyte growth Factor receptor)

MPL myeloproliFerative leukemia virus oncogene

MUTYH mutY DNA glycosylase

MYC v-myc myelocytomatosis viral oncogene homolog (avian)

MYCL1 v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian)

MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)

MYD88 myeloid diFFerentiation primary response 88

NCOA3 nuclear receptor coactivator 3

NF2 neuroFibromin 2 (merlin)

NKX2-1 NK2 homeobox 1

NOTCH1 notch 1

NOTCH3 notch 3

NOTCH4 notch 4

NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin)

Gene symbol Gene name

POT1 protection oF telomeres 1

PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha

PRSS1 serine protease 1

PTCH1 patched 1

PTPN11 protein tyrosine phosphatase, non-receptor type 11

RADS1C RAD51 paralog C

RADS1C RAD51 homolog C (S. cerevisiae)

RAF1 v-raF-1 murine leukemia viral oncogene homolog 1

RNF43 ring Finger protein 43

RUNX1 runt-related transcription Factor 1

SBDS SBDS, ribosome maturation Factor

SDHAF2 succinate dehydrogenase complex assembly Factor 2

SDHB succinate dehydrogenase complex, subunit B, iron sulFur (Ip)

SDHC succinate dehydrogenase complex subunit C

SDHD succinate dehydrogenase complex, subunit D, integral membrane protein

SF3B1 splicing Factor 3b, subunit 1, ISSkDa

SMAD2 SMAD Family member 2

SMAD3 SMAD Family member 3

SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator oF chromatin, subFamily b, member 1

SMO smoothened, Frizzled Family receptor

SRC SRC proto-oncogene, non-receptor tyrosine kinase

STAG2 stromal antigen 2

SUFU suppressor oF Fused homolog (Drosophila)

TERT telomerase reverse transcriptase

TET2 tet methylcytosine dioxygenase 2

TGFBR2 transForming growth Factor, beta receptor II (70/80kDa)

TNFAIP3 tumor necrosis Factor, alpha-induced protein 3

TOP1 topoisomerase (DNA) I

TSC1 tuberous sclerosis 1

TSC2 tuberous sclerosis 2

Gene symbol Gene name

ETV6 ETS variant 6

PDGFRB platelet-derived growth factor receptor, beta polypeptide

PRKACA protein kinase, cAMP-dependent, catalytic, alpha

RARA retinoic acid receptor, alpha

TACC3 transforming, acidic coiled-coil containing protein 3

TMPRSS2 transmembrane protease, serine 2

AKT2 AKT serine/threonine kinase 2

CTNNB1 catenin (cad her in-associated protein), beta 1, 88kDa

ACVR1 activin A receptor type 1

AKT1 v-akt murine thymoma viral oncogene homolog 1

BUB1 B BUB1 mitotic checkpoint serine/threonine kinase B

CDKN2B cyclin dependent kinase inhibitor 2B

VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase

SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1

SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2

SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1

FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase

NOTCH2 notch 2

AXIN1 axin 1

PARP1 poly (ADP-ribose) polymerase 1

STK11 serine/threonine kinase 11

ROS1 c-ros oncogene 1 , receptor tyrosine kinase

Table S6 Sequence alterations

Related to Figure 5 and Experimental Procedures.

Mutant

Gene CbloPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context* (%)

CCOV1T A2780 ARID1A AT rich interactive domain 1 A (SWI- chr1_27101006- 1430Q>X Nonsense ACAACNACTAT 0.62 like) 27101006_C_T

CCOV1T A2780 ARID1A AT rich interactive domain 1 A (SWI- chr1_2710SSS1- NA Frameshift TTTCCNACCAT 0.52 like) 27105551 _G_

CGOV1T A2780 DRD4 dopamine receptor D4 chr11_640109-640109_A_C 287Q>P Nonsynonymous CCCCCNGGACC 0.39 coding

CGOV1T A2780 FCGBP Fc fragment of IgG binding protein chr19_40412186- 1148G>S Nonsynonymous GCAGCNGTAGG 0.50

40412186_C_T coding

CGOV1T A2780 MAX MYC associated factor X chr14_65560514- 28H>R Nonsynonymous CATTANGATGA 0.51

65560514_T_C coding

CGOV1T A2780 PIK3CA phosphatidylinositol-4,5- chr3_178922324- 365E>K Nonsynonymous GAGGANAACCC 0.55 bisphosphate 3-kinase, catalytic 178922324_G_A coding

subunit alpha

CGOV1T A2780 SMARCA4 SWI/SNF related, matrix associated, chr19_11132513- 910T>M Nonsynonymous GCTGANGGGCA 0.47 actin dependent regulator of 11132513_C_T coding

chromatin, subfamily a, member 4

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV1T A2780 WRN Werner syndrome, RecQ helicase-like chr8_30958361- NA Splice site TTTTTNCAGGT 0.12

30958361 A C acceptor

CGOV10T IGROV-1 ABL1 c-abl oncogene 1, non-receptor chr9_133760024- NA FrameshiFt CGCCTNCCCCC 0.40 tyrosine kinase 133760024_C_

CGOV10T IGROV-1 AKAP6 A kinase (PRKA) anchor protein 6 chr14_33243087- 1192M>I Nonsynonymous AAGATNGGAAA 0.48

33243087_G_A coding

CGOV10T IGROV-1 AMBRA1 autophagy/beclin-1 regulator 1 chr11_46529825- 662R>H Nonsynonymous GGAGANGGTTC 0.58

46529825 C T coding

CGOV10T IGROV-1 ARHGAP27 Rho GTPase activating protein 27 chr17_43481872- 110S>N Nonsynonymous GGATGNTTCGA 0.50

43481872_C_T coding

CGOV10T IGROV-1 ARID1 A AT rich interactive domain 1A (SWI- chr1_27023716- NA FrameshiFt GCCATNGGGGG 0.60

Like) 27023716 G

CGOV10T IGROV-1 ARID1 A AT rich interactive domain 1A (SWI- chr1_27105931 - NA FrameshiFt TTGGTNGGGGG 0.50

Like) 27105931 _G

CGOV10T IGROV-1 ATXN1 ataxin 1 chr6_16307055- NA FrameshiFt AACACNAAAAA 0.52

16307055 A

CGOV10T IGROV-1 AXIN2 axin 2 chr17_63533094- NA FrameshiFt CCGCCNGGGGC 0.58

63533094_G_

CGOV10T IGROV-1 BRCA1 breast cancer 1 , early onset chr17_41245587- NA FrameshiFt TGTACNTTTTT 0.51

41245587 T

CGOV10T IGROV-1 CHEK1 checkpoint kinase 1 chr11_125505378- NA FrameshiFt GAAAGNAAAAA 0.36

125505378_A_

CGOV10T IGROV-1 DIABLO diablo, IAR-binding mitochondrial chr12_122709075- 56A>V Nonsynonymous GAACCNCACAC 0.43 protein 122709075 G A coding

CGOV10T IGROV-1 DICER1 dicer 1, ribonu lease type III chr14_95562651- NA FrameshiFt AACACNACAGT 0.44

95562652_CA_

CGOV10T IGROV-1 ERCC5 excision repair cross-complementing chr13_103524568- NA FrameshiFt AGCTCNAAAAA 0.45 rodent repair deficiency, 103524568_A_

complementation group 5

CGOV10T IGROV-1 FAM160A2 Family with sequence similarity 160, chr11_6239044- 605R>Q Nonsynonymous TAGTCNGGGAG 0.52 member A2 6239044 C T coding

CGOV10T IGROV-1 FAM46C Family with sequence similarity 46, chr1_118166184- 232A>T Nonsynonymous TGATCNCCACC 0.56 member C 118166184_G_A coding

CGOV10T IGROV-1 FBN2 Fibrillin 2 chr5_127702112- 754G>S Nonsynonymous AAGGCNGTGGA 0.46

127702112 C T coding

CGOV10T IGROV-1 FBXW7 F-box and WD repeat domain chr4_153259092- NA Splice site CTCTANCAAAG 0.49 containing 7, E3 ubiquitin protein 153259092_T_C acceptor ligase

CGOV10T IGROV-1 FLG Filaggrin chr1_152275546- 3939A>V Nonsynonymous GATACNCAGAA 0.36

152275546_G_A coding

CGOV10T IGROV-1 GLI3 GLI Family zinc Finger 3 chr7_42188023- 57A>T Nonsynonymous GATTGNGTTTC 0.47

42188023 C T coding

CGOV10T IGROV-1 GRB14 growth Factor receptor-bound chr2_165365362- 273E>K Nonsynonymous CGGTTNCTTAA 0.11 protein 14 165365362_C_T coding

CGOV10T IGROV-1 GRM8 glutamate receptor, metabotropic 8 chr7_126544156- NA FrameshiFt TTTAGNTTTTT 0.57

126544156 T

CGOV10T IGROV-1 IGHMBP2 immunoglobulin mu binding protein chr11_68682435- 286R>W Nonsynonymous TAGCGNGGAGC 0.73

2 68682435_C_T coding

CGOV10T IGROV-1 ITPR3 inositol 1 , 4, 5-trisphosphate receptor, chr6_33631599- 364A>T Nonsynonymous ACATCNCCTCT 0.55 type 3 33631599_G_A coding

CGOV10T IGROV-1 JAK1 Janus kinase 1 chr1_65306997- NA FrameshiFt GCTGGNTTTTT 1.03

65306997 T

CGOV10T IGROV-1 KIAA0100 uncharacterized protein chr17_26961787- 940R>C Nonsynonymous TTTGCNTTCCA 0.50

26961787 G A coding

Position oF mutation indicated by 'N' Mutant

Gene CbloPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV10T IGROV-1 KIAA1217 uncharacterized protein chr10_24833103- NA Frameshift CCCTGNAAACA 0.57

24833103_A_

CGOV10T IGROV-1 MED12 mediator complex subunit 12 chrX_70357603- 1952G>X Nonsense ATGTGNGATTG 0.53

70357603_G_T

CGOV10T IGROV-1 MLH1 mutL homolog 1, colon cancer, chr3_37070378- NA Frameshift TCACTNGTGTT 0.74 nonpolyposis type 2 (E. coli) 37070378_A_

CGOV10T IGROV-1 MLH3 mutL homolog 3 (E. coli) chr14_75514338- NA Frameshift TGCAANTTTTT 0.46

75514338_T_

CGOV10T IGROV-1 MLL myeloid/lymphoid or mixed-lineage chr11_118344186- NA Frameshift TCTCANCCCCC 0.55 leukemia (trithorax homolog, 118344186_C_

Drosophila)

CGOV10T IGROV-1 MLL2 myeloid/lymphoid or mixed-lineage chr12_49434492- NA Frameshift GGGCANGGGGT 0.41 leukemia 2 49434492_G_

CGOV10T IGROV-1 MLL3 myeloid/lymphoid or mixed-lineage chr7_151874148- NA Frameshift GTTCCNTTTTT 0.78 leukemia 3 151874148_T_

CGOV10T IGROV-1 MSH2 mutS homolog 2, colon cancer, chr2_47643457- 322G>D Nonsynonymous CACTGNCTCTC 0.44 nonpolyposis type 1 (E. coli) 47643457_G_A coding

CGOV10T IGROV-1 MSH3 mutS homolog 3 (E. coli) chr5_79970915- NA Frameshift GGGACNAAAAA 0.50

79970915_A_

CGOV10T IGROV-1 MSH6 mutS homolog 6 (E. coli) chr2_48030640- NA Frameshift AGATANCCCCC 1.03

48030640_C_

CGOV10T IGROV-1 NCOR2 nuclear receptor corepressor 2 chr12_124835175- 1275V>I Nonsynonymous GATGANGTGGC 0.49

124835175_C_T coding

CGOV10T IGROV-1 NOTCH3 notch 3 chr19_15288710- NA Frameshift AGACANGGGGC 0.46

15288710_G_

CGOV10T IGROV-1 OR1S2 olfactory receptor, family 1, chr11_57971190- 155T>I Nonsynonymous GCAAANTGCCG 0.39 subfamily S, member 2 57971190_G_A coding

CGOV10T IGROV-1 PDE4DIP phosphodiesterase 4D interacting chr1_144881600- 1199R>H Nonsynonymous GGTCANGAGGC 0.19 protein 144881600_C_T coding

CGOV10T IGROV-1 PDGFRB platelet-derived growth factor chr5_149515369- NA Frameshift GCCCCNGGGGT 0.48 receptor, beta polypeptide 149515369_G_

CGOV10T IGROV-1 PIK3CA phosphatidylinositol-4,5- chr3_178916725- 38R>C Nonsynonymous GCCTCNGTGAG 0.56 bisphosphate 3-kinase, catalytic 178916725_C_T coding

subunit alpha

CGOV10T IGROV-1 PIK3CA phosphatidylinositol-4,5- chr3_178952152- 1069*>W Nonsynonymous AACTGNAAAGA 0.57 bisphosphate 3-kinase, catalytic 178952152_A_G coding

subunit alpha

CGOV10T IGROV-1 PMS1 PMS1 postmeiotic segregation chr2_190670540- 160K>X Nonsense GGTTTNAAAAA 0.11 increased 1 (S. cerevisiae) 190670540_A_T

CGOV10T IGROV-1 PMS1 PMS1 postmeiotic segregation chr2_190670540- NA Frameshift GGTTTNAAAAA 0.60 increased 1 (S. cerevisiae) 190670541_AA_

CGOV10T IGROV-1 POLN polymerase (DNA directed) nu chr4_2194956-2194956_A NA Frameshift TTGCCNAAAAA 0.94

CGOV10T IGROV-1 POLQ polymerase (DNA directed), theta chr3_121207489- NA Frameshift TTTTTNAAAAA 0.46

121207489_A_

CGOV10T IGROV-1 PPP5C protein phosphatase 5, catalytic chr19_46893361- 470R>Q Nonsynonymous CCTACNGCCTC 0.59 subunit 46893361 _G_A coding

CGOV10T IGROV-1 PTEN phosphatase and tensin homolog chr10_89692980- 155Y>C Nonsynonymous TTTCTNTGGGG 0.39

89692980_A_G coding

CGOV10T IGROV-1 PTEN phosphatase and tensin homolog chr10_89720799- NA Frameshift TCTAGNACTTA 0.25

89720802_TACT_

CGOV10T IGROV-1 RAD50 RAD50 homolog (S. cerevisiae) chr5_131931452- NA Frameshift GAGCTNAAAAA 0.30

131931452_A_

CGOV10T IGROV-1 RSPH6A radial spoke head 6 homolog A chr19_46303792- 610R>C Nonsynonymous CAGGCNGGTGG 0.61

(Chlamydomonas) 46303792_G_A coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV10T IGROV-1 SCN8A sodium channel, voltage gated, type chr12_52099216- 384G>R Nonsynonymous CAGCCNGGAAA 0.51

VIII, alpha subunit 52099216_G_A coding

CGOV10T IGROV-1 SHPRH SNF2 histone linker PHD RING chr6_146240543- 1369R>C Nonsynonymous ATCACNCACTC 0.45 helicase, E3 ubiquitin protein ligase 146240543_G_A coding

CGOV10T IGROV-1 SIM1 single-minded homolog 1 chr6_100841491- 481 T>M Nonsynonymous GCGGCNTTCCC 0.40

(Drosophila) 100841491_G_A coding

CGOV10T IGROV-1 SLC43A3 solute carrier family 43, member 3 chr11_57191485- 111A>T Nonsynonymous TGTGGNGGTGG 0.51

S719148S_C_T coding

CGOV10T IGROV-1 SMAD4 SMAD family member 4 chr 18_48584514- NA Frameshift ATACTNGGGGG 0.42

48584514_G_

CGOV10T IGROV-1 SPEF2 sperm flagellar 2 chr5_35705894- NA Frameshift ATAGCNAAAAA 0.23

35705894_A_

CGOV10T IGROV-1 STAG2 stromal antigen 2 chrX I 23159772- NA Splice site donor AAGTANGTATC 0.24

123159773_TG_

CGOV10T IGROV-1 TASP1 taspase, threonine aspartase, 1 chr20_13561610- 141S>L Nonsynonymous CAACCNAGACT 0.59

13561610_G_A coding

CGOV10T IGROV-1 TOP1 topoisomerase (DNA) I chr20_39725983- NA Splice site donor AAAGGNACTGT 0.45

39725983_T_C

CGOV10T IGROV-1 VHL von Hippel-Lindau tumor suppressor, chr3_10183767- 79R>H Nonsynonymous CAATCNCAGTC 0.43

E3 ubiquitin protein ligase 10183767_G_A coding

CGOV10T IGROV-1 WDR62 WD repeat domain 62 chr19_36575580- 526E>K Nonsynonymous TGGACNAGCTG 0.43

36575580_G_A coding

CGOV10T IGROV-1 ZBTB4 zinc finger and BTB domain chr17_7365390- 971A>T Nonsynonymous CACTGNGTAGC 0.63 containing 4 7365390_C_T coding

CGOV10T IGROV-1 ZDHHC6 zinc finger, DHHC-type containing 6 chr10_114192134- 364R>Q Nonsynonymous CTTACNGTAAA 0.64

114192134_C_T coding

CGOV10T IGROV-1 ZFHX4 zinc finger homeobox 4 chr8_77620372- NA Frameshift TAAGGNAAAAA 0.34

77620372_A_

CGOV10T IGROV-1 ZFHX4 zinc finger homeobox 4 chr8_77763280- 1330Q>X Nonsense CACTGNAAGAT 0.54

77763280_C_T

CGOV10T IGROV-1 ZFHX4 zinc finger homeobox 4 chr8_77775799- NA Frameshift GTGCANGGGGG 0.43

77775799_G_

CGOV11TJ KK ACAA2 acetyl-CoA acyltransferase 2 chr18_47323921- 76R>H Nonsynonymous CCACANGCAAA 0.46

47323921 _C_T coding

CGOV11TJ KK ADAMTSL1 ADAMTS-like 1 chr9_18777226- 1000G>A Nonsynonymous GAACGNGATCT 0.48

18777226_G_C coding

CGOV11TJ KK AFF2 AF4/FMR2 family, member 2 chrXJ 48037142- 523P>T Nonsynonymous AGCCANCCTCA 0.40

148037142_C_A coding

CGOV11TJ KK ANKRD11 ankyrin repeat domain 11 chr16_89351107- 615A>T Nonsynonymous CTCCGNGCTGG 0.62

89351107_C_T coding

CGOV11TJ KK ANKRD13C ankyrin repeat domain 13C chr1_70736539- 499D>H Nonsynonymous CTTACNTAATT 1.00

70736539_C_G coding

CGOV11TJ KK ARID1A AT rich interactive domain 1 A (SWI- chr1_27107190- M2267lfs*1 S Frameshift TTGATNAACTC 1.05 like) 27107190_G_

CGOV11T_1 KK BAZ2A bromodomain adjacent to zinc finger chr12_56997420- 1037C>R Nonsynonymous CAGGCNTTCCT 0.34 domain, 2A 56997420_A_G coding

CGOV11TJ KK BBX bobby sox homolog (Drosophila) chr3_107510093- 767G>E Nonsynonymous AAGTGNGGATA 0.32

107510093_G_A coding

CGOV11TJ KK CLCN1 chloride channel, voltage-sensitive 1 chr7_143018895- 217V>A Nonsynonymous GGTTGNCGCCC 0.38

143018895_T_C coding

CGOV11TJ KK CLEC4E C-type lectin domain family 4, chr12_8688795- 127L>I Nonsynonymous GGAAANGAATT 0.30 member E 8688795_G_T coding

CGOV11TJ KK COL11A1 collagen, type XI, alpha 1 chr1_103345394- 1707R>W Nonsynonymous TTGCCNAGCAG 1.00

103345394_G_A coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV11T 1 KK COL4A6 collagen, type IV, alpha 6 chrXJ 07417735- 1026R>W Nonsynonymous GCCCCNGATTC 0.48

107417735 G A coding

CGOV11T 1 KK CRB1 crumbs homolog 1 (Drosophila) chr1_197404293- 1100I>M Nonsynonymous ACAATNGAAAT 0.84

197404293 A G coding

CGOV11T 1 KK CSTF1 cleavage stimulation Factor, 3' pre- chr20_54978728- 414T>M Nonsynonymous CATGANGTGCA 0.27

RNA, subunit 1 , 50kDa 54978728_C_T coding

CGOV11T 1 KK DDX39A DEAD (Asp-Glu-Ala-Asp) box chr19_14521894- 174R>S Nonsynonymous GATGCNGCCCG 0.26 polypeptide 39A 14521894_G_T coding

CGOV11T 1 KK DNAH1 dynein, axonemal, heavy chain 1 chr3_52387467- 1100G>R Nonsynonymous TCCAGNGGCTG 0.23

52387467_G_A coding

CGOV11T 1 KK DOCKS dedicator oF cytokinesis 5 chr8_25268755- 1852P>T Nonsynonymous CACCCNCTCCA 0.50

25268755 C A coding

CGOV11T 1 KK DSG1 desmoglein 1 chr18_28911746- 200R>S Nonsynonymous ATAAGNCAAGA 0.41

28911746_A_T coding

CGOV11T 1 KK DTNA dystrobrevin, alpha chr18_324S9S33- 584E>V Nonsynonymous AACAGNGAGTA 0.57

32459533 A T coding

CGOV11T 1 KK FBN2 Fibrillin 2 chrSJ 27727743- 524G>V Nonsynonymous TATAANCCATG 0.26

127727743_C_A coding

CGOV11T 1 KK FLG2 Filaggrin Family member 2 chr1_152324722- 1847T>N Nonsynonymous CATGANTAGTT 0.13

152324722 G T coding

CGOV11T 1 KK FTCD FormimidoyltransFerase chr21_47574137- 55P>L Nonsynonymous ACTCCNGCGGC 0.37 cyclodeaminase 47574137_G_A coding

CGOV11T 1 KK GAD2 glutamate decarboxylase 2 chr10_26508098- 138P>L Nonsynonymous TTATCNTAATG 0.27

(pancreatic islets and brain, 65kDa) 26508098_C_T coding

CGOV11T 1 KK GCSAML germinal center-associated, signaling chr1_247712521- 10S>C Nonsynonymous AACTCNGGTGA 0.35 and motility-like 247712521_A_T coding

CGOV11T 1 KK GRM3 glutamate receptor, metabotropic 3 chr7_86416207- 367R>C Nonsynonymous ACAAANGCAAC 0.32

86416207 C T coding

CGOV11TJ KK HOMEZ homeobox and leucine zipper chr14_23744826- 537E>D Nonsynonymous TCATCNTCCTC 0.20

encoding 23744826_T_A coding

CGOV11T 1 KK KRT3 keratin 3 chr12_53185087- 480R>W Nonsynonymous CAGCCNCGCCA 0.21

53185087 G A coding

CGOV11T 1 KK KRTAP12-2 keratin associated protein 12-2 chr21_46086404- 134L>I Nonsynonymous GCAGANGACGC 0.23

46086404 G T coding

CGOV11TJ KK LAIR2 leukocyte-associated chr19_55019211- 59R>H Nonsynonymous ATTCCNCCTGG 0.74 immunoglobulin-like receptor 2 55019211_G_A coding

CGOV11T_1 KK LAMPS lysosomal-associated membrane chr20_9S10312- 230R>W Nonsynonymous ATGAGNGGGAG 0.19 protein Family, member s 9510312_C_T coding

CGOV11TJ KK LRRC8E leucine rich repeat containing 8 chr19_7965443- 679R>H Nonsynonymous CCTCCNTCTGC 0.36

Family, member E 7965443_G_A coding

CGOV11T_1 KK LZTS1 leucine zipper, putative tumor chr8_20110462- 327A>V Nonsynonymous GCTGCNCGCGC 0.28 suppressor 1 20110462_G_A coding

CGOV11T 1 KK MEGF11 multiple EGF-like-domains 11 chr15_66223280- 430G>E Nonsynonymous CCTCTNCCTGG 0.62

66223280 C T coding

CGOV11T 1 KK MUC20 mucin 20, cell surFace associated chr3_195453120- 549A>V Nonsynonymous AGGAGNAGCTC 0.24

195453120 C T coding

CGOV11TJ KK MYH11 myosin, heavy chain 11 , smooth chr16_15811127- 1799R>W Nonsynonymous CTGCCNCTCGA 0.40 muscle 15811127 G A coding

CGOV11T 1 KK MYOM1 myomesin 1 chr18_3129295- 910P>L Nonsynonymous GTGGTNGCGGG 0.50

3129295 G A coding

CGOV11T 1 KK NCKAP5 NCK-associated protein 5 chr2_133539846- 1513R>Q Nonsynonymous TCTTCNGAAAA 0.33

133539846 C T coding

CGOV11TJ KK NPC1 L1 NPC1-like 1 chr7_44579661 - 112R>H Nonsynonymous GGCAGNGGGTG 0.60

44579661 C T coding

Position oF mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV11T 1 KK NR2C2AP nuclear receptor 2C2-associated chr19_19312777- 126R>P Nonsynonymous CCACANGGCCA 0.24 protein 19312777_C_G coding

CGOV11T 1 KK NUP153 nucleoporin 153kDa chr6_17640224- S98R>G Nonsynonymous AGGTCNAAAAG 0.73

17640224 T C coding

CGOV11T 1 KK OR10J1 olfactory receptor, family 10, chr1_159409946- 133R>H Nonsynonymous TGACCNCTATG 0.18 subfamily J, member 1 159409946_G_A coding

CGOV11T 1 KK PCMTD1 protein-L-isoaspartate (D-aspartate) chr8_52733242- 248R>H Nonsynonymous AAATANGAGCC 0.19

O-methyltransferase domain 52733242_C_T coding

containing 1

CGOV11T 1 KK PLXNB2 plexin B2 chr22_50719361- 1269E>K Nonsynonymous GGCCTNGTGCA 0.21

50719361 C T coding

CGOV11T 1 KK PNMA3 paraneoplastic Ma antigen 3 chrXJ 52226634- 408R>W Nonsynonymous GAAAANGGAAA 0.43

152226634 C T coding

CGOV11TJ KK PPP2R1A protein phosphatase 2, regulatory chr19_52715983- 183R>Q Nonsynonymous GCGGCNGGCCG 0.52 subunit A, alpha 52715983_G_A coding

CGOV11T 1 KK PRSS3 protease, serine, 3 chr9_33797828- 125R>C Nonsynonymous TCAGCNGCATC 0.11

33797828_C_T coding

CGOV11T 1 KK PRSS53 protease, serine, 53 chr16_31097798- 175R>C Nonsynonymous ATTGCNTAGGG 0.41

SI 097798 G A coding

CGOV11T 1 KK QRICH2 glutamine rich 2 chr17_74288577- 578R>P Nonsynonymous CTGCANGAGGT 0.39

74288577_C_G coding

CGOV11T 1 KK RHBDF2 rhomboid 5 homolog 2 (Drosophila) chr17_74475975- 67A>S Nonsynonymous GTGTGNAGCCC 0.60

74475975 C A coding

CGOV11T 1 KK RTFDC1 replication termination factor 2 chr20_55093209- 270A>D Nonsynonymous CATCGNTGACA 0.32 domain containing 1 55093209_C_A coding

CGOV11T 1 KK SELENBP1 selenium binding protein 1 chr1_151338283- 295P>S Nonsynonymous CTTGGNGGGCA 0.77

151338283 G A coding

CGOV11TJ KK SLC1A6 solute carrier family 1 (high affinity chr19_15073025- 242R>W Nonsynonymous GGCCCNAGTGA 0.32 aspartate/glutamate transporter), 15073025_G_A coding

member 6

CGOV11T 1 KK SLC22A8 solute carrier family 22 (organic chr11_62782279- 51 P>L Nonsynonymous GGGGCNGGCGA 0.68 anion transporter), member 8 62782279_G_A coding

CGOV11T 1 KK SLC39A14 solute carrier family 39 (zinc chr8_22273316- 262S>L Nonsynonymous TGAGTNGCTTC 0.38 transporter), member 14 22273316_C_T coding

CGOV11T 1 KK SLC4A10 solute carrier family 4, sodium chr2_162719441- 212R>T Nonsynonymous CCATANGGTCC 0.64 bicarbonate transporter, member 10 162719441_G_C coding

CGOV11T 1 KK SORCS1 sortilin-related VPS10 domain chr10_108923845- 147P>L Nonsynonymous TGTCCNGGTCC 0.74 containing receptor 1 108923845_G_A coding

CGOV11T 1 KK TBC1 D8B TBC1 domain family, member 8B chrXJ 06070473- 370R>H Nonsynonymous TTTTCNCTTCC 0.46

(with GRAM domain) 106070473_G_A coding

CGOV11T 1 KK TCF3 transcription factor 3 chr19 J 627410- 105R>Q Nonsynonymous CGCCCNGCTCA 0.18

1627410 C T coding

CGOV11T 1 KK UNC13C unc-13 homolog C (C. elegans) chr15_54307508- 803R>T Nonsynonymous GCAGANGGCTA 0.70

54307508_G_C coding

CGOV11T 1 KK USH2A Usher syndrome 2A (autosomal chr1_216595644- 12F>C Nonsynonymous ACAAGNAGCCA 0.21 recessive, mild) 216595644 A C coding

CGOV11T 1 KK WNK4 WNK lysine deficient protein kinase 4 chr17_40936446- 340P>L Nonsynonymous GACCCNGGAAT 0.27

40936446_C_T coding

CGOV11T 1 KK ZNF382 zinc finger protein 382 chr19_37118438- 547T>P Nonsynonymous AAACCNCGGGA 0.67

37118438 A C coding

CGOV12T KOC-7C ABCB11 ATP-binding cassette, sub-family B chr2_169789017- 1028A>V Nonsynonymous CTGTTNCACTC 0.35

(MDR/TAP), member 11 169789017 G A coding

CGOV12T KOC-7C ADAM20 ADAM metallopeptidase domain 20 chr14_70990475- 384V>F Nonsynonymous AACGANCAACC 0.38

70990475 C A coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV12T KOC-7C ANK2 ankyrin 2, neuronal chr4_114277290- 2506 R>W Nonsynonymous CTGTGNGGTCC 0.44

114277290_C_T coding

CGOV12T KOC-7C ARID1A AT rich interactive domain 1 A (SWI- chr1_27023716- NA Frameshift GCCATNGGGGG 0.39 like) 27023716_G_

CGOV12T KOC-7C ARID1A AT rich interactive domain 1 A (SWI- chr1_27100176- NA Frameshift CGCTANCCCCC 0.43 like) 27100176_C_

CGOV12T KOC-7C ARID1A AT rich interactive domain 1 A (SWI- chr1_27101268- NA Frameshift CTCTGNCCCCC 0.50 like) 27101268_C_

CGOV12T KOC-7C ARID1 B AT rich interactive domain 1 B (SWI1- chr6_157527742- NA Frameshift TCGGCNGGGGT 0.71 like) 157527742_G_

CGOV12T KOC-7C ATM ataxia telangiectasia mutated chr11_108114817- NA Frameshift TGGACNTTTTT 0.43

108114817_T_

CGOV12T KOC-7C BAP1 BRCA1 associated protein-1 chr3_52440912- NA Frameshift GTCCTNCCCCC 0.74

(ubiquitin carboxy-terminal 52440912_C_

hydrolase)

CGOV12T KOC-7C BCL9L B-cell CLL/lymphoma 9-like chr11_118773976- 240V>I Nonsynonymous ATATANGAACT 0.42

118773976_C_T coding

CGOV12T KOC-7C BLM Bloom syndrome, RecQ helicase-like chr15_91304139- NA Frameshift CTAGGNAAAAA 0.49

91304139_A_

CGOV12T KOC-7C CCDC93 coiled-coil domain containing 93 chr2_118715997- 317R>G Nonsynonymous TTTCCNGCGAT 0.68

118715997_G_C coding

CGOV12T KOC-7C CHIT1 chitinase l (chitotriosidase) chr1_203192655- 150V>I Nonsynonymous GTCTANGGCAG 0.61

203192655_C_T coding

CGOV12T KOC-7C CORIN corin, serine peptidase chr4_47602260- 973Y>H Nonsynonymous CTCATNGCCAG 0.46

47602260_A_G coding

CGOV12T KOC-7C COX10 cytochrome c oxidase assembly chr17_14095356- 249A>V Nonsynonymous AGTTGNCATTC 0.35 homolog 10 (yeast) 14095356_C_T coding

CGOV12T KOC-7C FAT1 FAT tumor suppressor homolog 1 chr4_187524362- 3773 R>H Nonsynonymous GGTGGNGGGGA 0.38

(Drosophila) 187524362_C_T coding

CGOV12T KOC-7C FBXW7 F-box and WD repeat domain chr4_153244092- 689R>W Nonsynonymous ATTCCNACTCC 0.65 containing 7, E3 ubiquitin protein 153244092_G_A coding

ligase

CGOV12T KOC-7C FLG filaggrin chr1_152275546- 3939A>V Nonsynonymous GATACNCAGAA 0.56

152275546_G_A coding

CGOV12T KOC-7C GRIK3 glutamate receptor, ionotropic, chr1_37337877- 215R>H Nonsynonymous AGGGGNGCGAG 0.39 kainate 3 37337877_C_T coding

CGOV12T KOC-7C HA01 hydroxyacid oxidase (glycolate chr20_7894842- 172R>C Nonsynonymous GTTACNCACAT 0.52 oxidase) 1 7894842_G_A coding

CGOV12T KOC-7C IDH2 isocitrate dehydrogenase 2 (NADP+), chr15_90633707- NA Splice site donor CCCTCNCACCT 0.45 mitochondrial 90633707_G_A

CGOV12T KOC-7C IGF2BP3 insulin-like growth factor 2 mRNA chr7_23387327- 237A>V Nonsynonymous CCCCCNCATTT 0.47 binding protein 3 23387327_G_A coding

CGOV12T KOC-7C KCND1 potassium voltage-gated channel, chrX_48825777- 301 R>H Nonsynonymous AGATGNGAAAC 0.45

Shal-related subfamily, member 1 48825777_C_T coding

CGOV12T KOC-7C KCNH7 potassium voltage-gated channel, chr2_163279904- 699R>H Nonsynonymous CAAGANGTTGC 0.56 subfamily H (eag-related), member 7 163279904_C_T coding

CGOV12T KOC-7C KRT34 keratin 34 chr17_39S34379- 41 SA>T Nonsynonymous GGTGGNGCATG 0.33

39534379_C_T coding

CGOV12T KOC-7C L1CAM L1 cell adhesion molecule chrX_153129362- 1145R>C Nonsynonymous GCTGCNCTTGA 0.46

153129362_G_A coding

CGOV12T KOC-7C MEN1 multiple endocrine neoplasia I chr11_64572093- NA Frameshift CTTCCNGGGGG 1.00

64572093_G_

CGOV12T KOC-7C MLL2 myeloid/lymphoid or mixed-lineage chr12_49432347- NA Frameshift TCTGTNGGGGA 0.52 leukemia 2 49432347_G_

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV12T KOC-7C MNS1 meiosis-specific nuclear structural 1 chr15_56726358- 416R>H Nonsynonymous GTTGGNGACGC 0.45

S67263S8_C_T coding

CGOV12T KOC-7C MSH2 mutS homolog 2, colon cancer, chr2_47637465- NA Frameshift ATGTGNTTTAC 0.34 nonpolyposis type 1 (E. coli) 47637465_T_

CGOV12T KOC-7C MSH2 mutS homolog 2, colon cancer, chr2_47702265- 621 R>X Nonsense ATGTANGACCA 0.56 nonpolyposis type 1 (E. coli) 47702265_C_T

CGOV12T KOC-7C MSH3 mutS homolog 3 (E. coli) chr5_79970915- NA Frameshift GGGACNAAAAA 0.32

7997091 S_A_

CGOV12T KOC-7C MYCN v-myc myelocytomatosis viral related chr2_16082198- 4C>X Nonsense AGCTGNTCCAC 0.55 oncogene, neuroblastoma derived 16082198_C_A

(avian)

CGOV12T KOC-7C MYOM1 myomesin 1 chr18_3168874- 427R>H Nonsynonymous CAACANGACAG 0.54

3168874_C_T coding

CGOV12T KOC-7C NAA16 N(alpha)-acetyltransferase 16, NatA chr13_41943362- 630E>D Nonsynonymous GATGANGAAGA 0.61 auxiliary subunit 41943362_A_T coding

CGOV12T KOC-7C NET02 neuropilin (NRP) and tolloid (TLL)-like chr16_47117434- 426R>W Nonsynonymous GCGCCNCATCT 0.59

2 47117434_G_A coding

CGOV12T KOC-7C NFE2L2 nuclear factor (erythroid-derived 2)- chr2_178098803- 81 G>V Nonsynonymous ATTCANCTGTC 0.50 like 2 178098803_C_A coding

CGOV12T KOC-7C NOTCH1 notch 1 chr9_139400023- NA Frameshift GCGGCNGGGGG 0.81

139400023_G_

CGOV12T KOC-7C NUTF2 nuclear transport factor 2 chr16_67902440- 70A>T Nonsynonymous TCACCNCGCAG 0.50

67902440_G_A coding

CGOV12T KOC-7C PCCA propionyl CoA carboxylase, alpha chr13_100915069- 268R>H Nonsynonymous TCCTCNTCATA 0.48 polypeptide 100915069_G_A coding

CGOV12T KOC-7C PIK3CA phosphatidylinositol-4,5- chr3_178916946- 111 K>N Nonsynonymous GAAAANATCCT 0.44 bisphosphate 3-kinase, catalytic 178916946_G_T coding

subunit alpha

CGOV12T KOC-7C PMS1 PMS1 postmeiotic segregation chr2_190670540- NA Frameshift GGTTTNAAAAA 0.39 increased 1 (S. cerevisiae) 190670540_A_

CGOV12T KOC-7C PREX2 phosphatidylinositol-3,4,5- chr8_68992729- 565S>L Nonsynonymous TTTTTNGGATG 0.48 trisphosphate-dependent Rac 68992729_C_T coding

exchange factor 2

CGOV12T KOC-7C PSMD6 proteasome (prosome, macropain) chr3_6400467S- 179R>H Nonsynonymous TTAGGNGGTTT 0.65

26S subunit, non-ATPase, 6 64004675_C_T coding

CGOV12T KOC-7C PTEN phosphatase and tensin homolog chr10_89717672- 233R>X Nonsense CCACANGACGG 0.43

89717672_C_T

CGOV12T KOC-7C PTEN phosphatase and tensin homolog chr10_89720812- NA Frameshift TTAACNAAAAA 0.44

89720812_A_

CGOV12T KOC-7C PTPRS protein tyrosine phosphatase, chr19_5221225- 1081T>A Nonsynonymous GGTGGNACGGC 0.64 receptor type, S 5221225_T_C coding

CGOV12T KOC-7C RAD23A RAD23 homolog A (S. cerevisiae) chr19_13059307- NA Splice site AATTTNCAGCT 0.55

13059307_G_A acceptor

CGOV12T KOC-7C RAD50 RAD50 homolog (S. cerevisiae) chr5_131931452- NA Frameshift GAGCTNAAAAA 0.34

131931452_A_

CGOV12T KOC-7C RPA1 replication protein A1 , 70kDa chr17_1782983- NA Frameshift ACTGTNGGGGG 0.48

1782983_G_

CGOV12T KOC-7C RSG1 REM2 and RAB-like small GTPase 1 chr1_16559053- 160R>H Nonsynonymous CTATGNGGGCC 0.58

16559053_C_T coding

CGOV12T KOC-7C SAMD9L sterile alpha motif domain containing chr7_92760745- 1514K>E Nonsynonymous TTTTTNCCACA 0.38

9-like 92760745_T_C coding

CGOV12T KOC-7C SDHAF2 succinate dehydrogenase complex chr11_61213475- NA Frameshift TTGCTNAAAAC 0.49 assembly factor 2 61213475_A_

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV12T KOC-7C SIGLEC10 sialic acid binding Ig-like lectin 10 chr19_51914441- 669T>M Nonsynonymous TGAGCNTGGCA 0.45

51914441 _G_A coding

CGOV12T KOC-7C SLC24A1 solute carrier family 24 chr15_65946296- 1060A>V Nonsynonymous AATTGNGTCAT 0.46

(sodium/potassium/calcium 65946296_C_T coding

exchanger), member 1

CGOV12T KOC-7C SLC7A8 solute carrier family 7 (amino acid chr14_23612381- 181 R>W Nonsynonymous CCACCNCACAC 0.41 transporter light chain, L system), 23612381_G_A coding

member 8

CGOV12T KOC-7C SLIT2 slit homolog 2 (Drosophila) chr4_20258327- 71T>M Nonsynonymous AATTANGAAGA 0.52

20258327_C_T coding

CGOV12T KOC-7C SMAD3 SMAD family member 3 chr15_67457269- NA Frameshift CGGAANGGGCT 0.86

67457269_G_

CGOV12T KOC-7C SNX13 sorting nexin 13 chr7_17841230- 760S>L Nonsynonymous GAGCCNAAACT 0.60

17841230_G_A coding

CGOV12T KOC-7C TBX18 T-box 18 chr6_85457774- 268P>L Nonsynonymous CTCGCNGTTGG 0.56

85457774_G_A coding

CGOV12T KOC-7C TGM2 transglutaminase 2 (C polypeptide, chr20_36789870- 48R>C Nonsynonymous GTTGCNGCCCT 0.54 protein-glutamine-gamma- 36789870_G_A coding

glutamyltransferase)

CGOV12T KOC-7C TMEM2 transmembrane protein 2 chr9_74305071- 1263T>M Nonsynonymous AAACCNTTTTT 0.38

74305071 _G_A coding

CGOV12T KOC-7C TMIGD1 transmembrane and immunoglobulin chr17_28652112- 121 F>S Nonsynonymous GAGGANCTGCA 0.59 domain containing 1 28652112_A_G coding

CGOV12T KOC-7C TP53 tumor protein p53 chr17_7579705- 31V>I Nonsynonymous CAGAANGTTGT 0.60

7579705_C_T coding

CGOV12T KOC-7C TUSC3 tumor suppressor candidate 3 chr8_15508247- 117R>H Nonsynonymous CTGGCNCTATT 0.51

15508247_G_A coding

CGOV12T KOC-7C VPS13A vacuolar protein sorting 13 homolog chr9_79829248- 234D>N Nonsynonymous AGGACNACTTG 0.45

A (S. cerevisiae) 79829248_G_A coding

CGOV12T KOC-7C VPS13A vacuolar protein sorting 13 homolog chr9_79836219- NA Frameshift TGTATNAAAAA 0.43

A (S. cerevisiae) 79836219_A_

CGOV12T KOC-7C ZNF415 zinc finger protein 415 chr19_53613108- 64P>S Nonsynonymous TCCTGNGTTAC 0.50

53613108_G_A coding

CGOV13T Kuramochi BRCA2 breast cancer 2, early onset chr13_32920978- 2318R>X Nonsense AAGATNGAAGA 0.67

32920978_C_T

CGOV13T Kuramochi CDH18 cadherin 18, type 2 chr5_19747146- 143S>F Nonsynonymous ACTCGNATTCA 0.28

19747146_G_A coding

CGOV13T Kuramochi EWSR1 Ewing sarcoma breakpoint region 1 chr22_29695716- NA Frameshift GGTGGNCGGGG 0.30

29695716_C_

CGOV13T Kuramochi SMAD4 SMAD family member 4 chr18_48S9192S- 363C>S Nonsynonymous CTTTTNTTTGG 0.69

48591925_G_C coding

CGOV13T Kuramochi SMO smoothened, frizzled family receptor chr7_128852004- NA Frameshift CTTCANCCCCC 0.12

128852004_C_

CGOV13T Kuramochi TP53 tumor protein p53 chr17_7577097- 281 D>Y Nonsynonymous CCGGTNTCTCC 1.00

7577097_C_A coding

CGOV14T MCAS C1orf168 chromosome 1 open reading frame chr1_57258182- 102V>I Nonsynonymous ACATANAGTAG 0.43

168 57258182_C_T coding

CGOV14T MCAS ENPP4 ectonucleotide chr6_46111285- 424L>F Nonsynonymous CATGCNTCATA 0.59 pyrophosphatase/phosphodiesterase 46111285_C_T coding

4 (putative)

CGOV14T MCAS KRAS v-Ki-ras2 Kirsten rat sarcoma viral chr12_25398284- 12G>D Nonsynonymous CGCCANCAGCT 0.89 oncogene homolog 25398284_C_T coding

CGOV14T MCAS PIK3CA phosphatidylinositol-4,5- chr3_178952085- 1047H>R Nonsynonymous TGCACNTCATG 0.56 bisphosphate 3-kinase, catalytic 178952085_A_G coding

subunit alpha

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV14T MCAS PPP3CA protein phosphatase 3, catalytic chr4_101947108- 494A>T Nonsynonymous GTTGGNGTCAG 0.30 subunit, alpha isozyme 101947108_C_T coding

CGOV14T MCAS RIMS1 regulating synaptic membrane chr6_72678745- 75N>T Nonsynonymous TGAAANCCAGC 0.77 exocytosis 1 72678745_A_C coding

CGOV14T MCAS RNF43 ring finger protein 43 chr17_56438166- NA Frameshift CCTCCNGACAG 1.14

56438167_AG_

CGOV14T MCAS SMAD4 SMAD family member 4 chr18_48604690- 504S>R Nonsynonymous ATGAGNTTTGT 1.00

48604690 T A coding

CGOV14T MCAS SPG11 spastic paraplegia 11 (autosomal chr15_44865757- 2065S>P Nonsynonymous CTGTGNTGAAG 0.38 recessive) 44865757_A_G coding

CGOV14T MCAS SYT16 synaptotagmin XVI chr14_62536371- 192E>K Nonsynonymous GTGACNAGGAG 0.11

62536371 G A coding

CGOV14T MCAS USH2A Usher syndrome 2A (autosomal chr1_216011364- 3114P>S Nonsynonymous TGTTGNTATAT 0.58 recessive, mild) 216011364_G_A coding

CGOV14T MCAS USP21 ubiquitin specific peptidase 21 chr1_161130594- SSR>Q Nonsynonymous TCCCCNGCCAG 0.32

161130594 G A coding

CGOV1ST OAW-28 ALDH16A1 aldehyde dehydrogenase 16 family, chr19_49969143- 573A>T Nonsynonymous AGGCCNCTCAC 0.58 member A1 49969143_G_A coding

CGOV1ST OAW-28 ERCC2 excision repair cross-complementing chr19_45855466- NA Splice site donor CCTCANCCGGT 0.45 rodent repair deficiency, 45855466_C_

complementation group 2

CGOV1ST OAW-28 TP53 tumor protein p53 chr17_7578475- NA Frameshift CGGGCNGGGGT 1.83

7578475 G

CGOV1ST OAW-28 TSC2 tuberous sclerosis 2 chr16_2127595- NA Splice site ACCCGNTAGTC 0.97

2127595_A_G acceptor

CGOV16T OAW-42 ARID1 A AT rich interactive domain 1A (SWI- chr1_27057967- NA Frameshift AGTCTNCTTAC 0.54 like) 27057968 CC

CGOV16T OAW-42 ARID1A AT rich interactive domain 1 A (SWI- chr1_27097763- NA Frameshift ACATCNTTGCA 0.31 like) 27097763 T

CGOV16T OAW-42 FAM129C family with sequence similarity 129, chr19_17643088- 99R>H Nonsynonymous AGTCCNTGAGC 0.38 member C 17643088 G A coding

CGOV16T OAW-42 FANCD2 Fanconi anemia, complementation chr3_10115050- NA Splice site donor AGGTANTGGAA 0.12 group D2 10115050_T_C

CGOV16T OAW-42 PIK3CA phosphatidylinositol-4,5- chr3_178952085- 1047H>L Nonsynonymous TGCACNTCATG 0.63 bisphosphate 3-kinase, catalytic 178952085_A_T coding

subunit alpha

CGOV16T OAW-42 SLC14A2 solute carrier family 14 (urea chr18_43247924- 615A>V Nonsynonymous GTGGGNGATCT 0.29 transporter), member 2 43247924_C_T coding

CGOV16T OAW-42 SUSD3 sushi domain containing 3 chr9_95846865- 202V>M Nonsynonymous GCAGCNTGGAC 0.37

95846865_G_A coding

CGOV17T OV-167 ARMC4 armadillo repeat containing 4 chr10_28257853- 413R>G Nonsynonymous ATACCNAAGTA 0.33

28257853 G C coding

CGOV17T OV-167 TP53 tumor protein p53 chr17_7577046- 298E>X Nonsense CAGCTNGTGGT 1.00

7577046_C_A

CGOV17T OV-167 USH2A Usher syndrome 2A (autosomal chr1_216040513- NA Splice site TAAACNTAAAA 0.22 recessive, mild) 216040513 C T acceptor

CGOV18T OV177 ASCC3 activating signal cointegrator 1 chr6_101214448- 577R>Q Nonsynonymous GAGTTNGTAAA 1.00 complex subunit 3 101214448_C_T coding

CGOV18T OV177 TP53 tumor protein p53 chr17_7578404- 176C>R Nonsynonymous GGGGCNGCGCC 1.00

7578404 A G coding

CGOV2T Caov-3 ARMC4 armadillo repeat containing 4 chr10_28257853- 413R>G Nonsynonymous ATACCNAAGTA 0.50

28257853 G C coding

CGOV2T Caov-3 TP53 tumor protein p53 chr17_7578524- 136Q>X Nonsense CAGTTNGCAAA 1.00

7578524 G A

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV20T OV207 ARID1A AT rich interactive domain 1 A (SWI- chr1_27101353- 1 S4SW>X Nonsense TCGTGNCCTTC 0.59 like) 27101353_G_A

CGOV20T OV207 KIF3A kinesin family member 3A chrSJ 32037825- 586R>Q Nonsynonymous GAAGTNGAAGC 0.60

13203782S_C_T coding

CGOV20T OV207 NID1 nidogen 1 chr1_236145041- 1033R>C Nonsynonymous GTTGCNGCCAA 0.81

23614S041_G_A coding

CGOV20T OV207 SLC2A7 solute carrier family 2 (facilitated chr1_9063541- 453G>R Nonsynonymous GATTCNGGCAA 0.62 glucose transporter), member 7 9063541_C_T coding

CGOV20T OV207 SPEF2 sperm flagellar 2 chr5_35793413- NA Frameshift CAGTTNGGCAC 0.46

35793413_G_

CGOV20T OV207 TP53 tumor protein p53 chr17_7577120- 273R>H Nonsynonymous AAACANGCACC 0.98

7577120_C_T coding

CGOV21T OV-90 CDKN2A cyclin-dependent kinase inhibitor 2A chr9_21971101- 141 C>X Nonsense CCCGGNCAGCG 1.00

21971101_G_T

CGOV21T OV-90 EPHA1 EPH receptor A1 chr7_143096020- 337R>Q Nonsynonymous GGTTTNGGGGG 0.68

143096020_C_T coding

CGOV21T OV-90 HNF1A HNF1 homeobox A chr12_121434726- NA Frameshift AGACCNAAATC 0.38

121434726 _ A

CGOV21T OV-90 IFIT1 interferon-induced protein with chr10_91162429- 133R>C Nonsynonymous CCTTCNGCTAT 0.57 tetratricopeptide repeats 1 91162429_C_T coding

CGOV21T OV-90 KIAA1958 uncharacterized protein chr9_115421642- 482R>C Nonsynonymous CTATTNGCCGA 0.47

115421642_C_T coding

CGOV21T OV-90 SMAD4 SMAD family member 4 chr18_48603032- 445R>X Nonsense GTCATNGACAG 1.00

48603032_C_T

CGOV21T OV-90 TP53 tumor protein p53 chr17_7578206- 21SS>R Nonsynonymous CACACNATGTC 1.00

7578206_T_G coding

CGOV23T OVCA-429 DAAM2 dishevelled associated activator of chr6_39846032- 4S2R>Q Nonsynonymous GTTCCNGAAAG 1.00 morphogenesis 2 39846032_G_A coding

CGOV23T OVCA-429 MSH6 mutS homolog 6 (E. coli) chr2_48010382- 4Q>X Nonsense CGCGANAGAGC 0.64

48010382_C_T

CGOV23T OVCA-429 PCDHA5 protocadherin alpha 5 chr5_140203515- 719A>T Nonsynonymous ACACCNCGCTG 0.38

140203515_G_A coding

CGOV23T OVCA-429 REST RE1 -silencing transcription factor chr4_57797265- 747I>M Nonsynonymous CAGATNGAGCT 0.57

57797265_A_G coding

CGOV2ST OVCAR-3 ADCY1 adenylate cyclase 1 (brain) chr7_45632443- 242A>V Nonsynonymous GAAGGNGTTCC 0.50

45632443_C_T coding

CGOV2ST OVCAR-3 MAMDC4 MAM domain containing 4 chr9_139752123- 780V>G Nonsynonymous CATGGNGGTGG 0.23

139752123_T_G coding

CGOV2ST OVCAR-3 PIK3R1 phosphoinositide-3-kinase, chrS_67S91246- NA Splice site TTTTCNGGTGG 0.67 regulatory subunit 1 (alpha) 67591246_A_T acceptor

CGOV2ST OVCAR-3 POLK polymerase (DNA directed) kappa chrS_748920S7- NA Frameshift CGGATNTCTAG 0.52

74892057_A_

CGOV2ST OVCAR-3 STAG2 stromal antigen 2 chrXJ 23159772- NA Splice site donor AAGTANGTATC 0.56

123159772_T_C

CGOV2ST OVCAR-3 TP53 tumor protein pS3 chr17_7577538- 248R>Q Nonsynonymous GCCTCNGGTTC 1.00

7577538_C_T coding

CGOV26T OVCAR-5 ANK3 ankyrin 3, node of Ranvier (ankyrin G) chr10_61832027- 2871 S>L Nonsynonymous CATGCNAAAGT 0.39

61832027_G_A coding

CGOV26T OVCAR-5 APC adenomatous polyposis coli chrSJ 12175240- 1317E>Q Nonsynonymous CAGCTNAAGAT 0.66

112175240_G_C coding

CGOV26T OVCAR-5 CREBBP CREB binding protein chr16_3817760- 1071A>T Nonsynonymous AGAGGNTGTGC 0.66

3817760_C_T coding

CGOV26T OVCAR-5 EP300 E1 A binding protein p300 chr22_41573061- 1782C>X Nonsense ATCTGNAAGCA 0.50

41573061 _C_A

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV26T OVCAR-S KRAS v-Ki-ras2 Kirsten rat sarcoma viral chr12_25398284- 12G>V Nonsynonymous CGCCANCAGCT 1.00 oncogene homolog 25398284 C A coding

CGOV26T OVCAR-S RIPK1 receptor (TNFRSF)-interacting serine- chr6_3111145- 562T>M Nonsynonymous AAATANGAACT 0.62 threonine kinase 1 3111145 C T coding

CGOV27T OVISE ARID1A AT rich interactive domain 1 A (SWI- chr1_27023502- NA FrameshiFt CTCTCNCGACC 0.64 like) 27023502 A

CGOV27T OVISE ARID1A AT rich interactive domain 1A (SWI- chr1_27057917- NA FrameshiFt GACACNGCAGC 0.54 like) 27057918_AG_

CGOV27T OVISE ARID1 B AT rich interactive domain 1 B (SWI1- chr6_157454310- 769Y>X Nonsense ACTTANGGTCC 0.37 like) 157454310_C_A

CGOV27T OVISE FCGBP Fc Fragment oF IgG binding protein chr19_403S4138- NA Splice site ATAACNGCAAG 0.12

40354138 T C acceptor

CGOV27T OVISE GRM8 glutamate receptor, metabotropic 8 chr7_126173379- 686A>V Nonsynonymous TGGGCNCTGTG 0.43

126173379_G_A coding

CGOV27T OVISE KIF1A kinesin Family member 1A chr2_241697823- 837G>R Nonsynonymous GTCTCNGCCGG 0.61

241697823 C T coding

CGOV27T OVISE NOTCH1 notch 1 chr9_139403413- 1027S>X Nonsense GCTGTNAGTCG 0.39

139403413_G_C

CGOV27T OVISE PIK3CA phosphatidylinositol-4,5- chr3_178927980- 420C>R Nonsynonymous AACACNGTCCA 0.64 bisphosphate 3-kinase, catalytic 178927980_T_C coding

subunit alpha

CGOV27T OVISE PPP2R1A protein phosphatase 2, regulatory chr19_52715982- 183R>W Nonsynonymous TGCGGNGGGCC 0.67 subunit A, alpha 52715982 C T coding

CGOV28T OVKATE CNTNAP2 contactin associated protein-like 2 chr7_147336243- 648T>M Nonsynonymous GCAGANGCCTG 0.26

147336243_C_T coding

CGOV28T OVKATE DNMT3A DNA (cytosine-5-)-methyltransFerase chr2_25467523- NA Splice site AGTTCNAGACA 1.00

3 alpha 25467523 T C acceptor

CGOV28T OVKATE DNMT3A DNA (cytosine-5-)-methyltransFerase chr2_25470030- NA Splice site CACCTNGGGGG 1.00

3 alpha 25470030_G_A acceptor

CGOV28T OVKATE GPR17 G protein-coupled receptor 17 chr2_128409097- 291 R>H Nonsynonymous CTACCNCAGCC 0.31

128409097 G A coding

CGOV28T OVKATE GXYLT1 glucoside xylosyltransFerase 1 chr12_42512938- 117H>L Nonsynonymous CTAGANGCATT 0.14

42512938_T_A coding

CGOV28T OVKATE PLA2G12B phospholipase A2, group XIIB chr10_74701011- 128R>C Nonsynonymous ACAGCNATATT 0.58

74701011 G A coding

CGOV28T OVKATE ROS1 c-ros oncogene 1 , receptor tyrosine chr6_117706977- 725D>N Nonsynonymous AACGTNGCCTT 1.00 kinase 117706977_C_T coding

CGOV28T OVKATE SMAD4 SMAD Family member 4 chr18_48575677- 146L>X Nonsense AGGATNAACAC 0.22

48575677 T G

CGOV28T OVKATE TM4SF4 transmembrane 4 L six Family chr3_149216547- 147R>Q Nonsynonymous GTGCCNAGAGC 0.53 member 4 149216547 G A coding

CGOV28T OVKATE TPS3 tumor protein p53 chr17_7577094- 282R>W Nonsynonymous GCGCCNGTCTC 1.00

7577094 G A coding

CGOV29T OVMANA ARID1A AT rich interactive domain 1 A (SWI- chr1_27100198- 1332Q>X Nonsense AGCAGNAGCAG 0.44 like) 27100198_C_T

CGOV29T OVMANA ARID1A AT rich interactive domain 1 A (SWI- chr1_27107180- 2264S>X Nonsense GGTATNACCGT 0.38 like) 27107180_C_G

CGOV29T OVMANA PIK3CA phosphatidylinositol-4,5- chr3_178936092- 545E>V Nonsynonymous CACTGNGCAGG 0.54 bisphosphate 3-kinase, catalytic 178936092_A_T coding

subunit alpha

CGOV3T COLO-704 ALKBH2 alkB, alkylation repair homolog 2 (E. chr12_109526014- NA FrameshiFt TTTTANTTTTT 0.55 coli) 109526014_T_

CGOV3T COLO-704 ALKBH2 alkB, alkylation repair homolog 2 (E. chr12_109526019- 260K>X Nonsense TTTTTNAGTAA 0.12 coli) 109526019_T_A

Position oF mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CCOV3T COLO-704 AR androgen receptor chrX_66766560- NA Frameshift CAAATNCCCCC 0.41

66766560_G_

CCOV3T COLO-704 AR androgen receptor chrX_66766560- NA Frameshift CAAATNCCCCC 0.41

66766560_G_

CCOV3T COLO-704 BLM Bloom syndrome, RecQ helicase-like chr15_91304139- NA Frameshift CTACCNAAAAA 0.27

91304139_A_

CCOV3T COLO-704 BMS1 BMS1 homolog, ribosome assembly chr10_43292197- 502A>V Nonsynonymous ATTTCNTCACA 0.42 protein (yeast) 43292197_C_T coding

CCOV3T COLO-704 BRCA2 breast cancer 2, early onset chr13_32907421- NA Frameshift AAACC N AAAAA 0.11

32907421 _A

CCOV3T COLO-704 COL1A1 collagen, type I, alpha 1 chr17_48273002- 361 R>G Nonsynonymous CCCTCNCCCCC 0.57

48273002_C_C coding

CCOV3T COLO-704 DBC1 deleted in bladder cancer 1 chr9_121971096- 349T>M Nonsynonymous CCTCCNTGGCA 0.47

121971096_C_A coding

CCOV3T COLO-704 EP300 E1 A binding protein p300 chr22_41566525- NA Frameshift CCTACNAAAAA 1.04

41566525_A_

CCOV3T COLO-704 GRM8 glutamate receptor, metabotropic 8 chr7_126544156- NA Frameshift TTTACNTTTTT 0.43

126544156_T_

CCOV3T COLO-704 HNF1A HNF1 homeobox A chr12_121432115- NA Frameshift ACACCNCCCCC 0.46

121432115_C_

CCOV3T COLO-704 INTS1 integrator complex subunit 1 chr7_1520938- 1464L>P Nonsynonymous CCCTCNCCCTC 0.35

1520938_A_G coding

CCOV3T COLO-704 MLL2 myeloid/lymphoid or mixed-lineage chr12_49443667- NA Frameshift AGCCANCCCCC 0.41 leukemia 2 49443667_C_

CCOV3T COLO-704 MSH3 mutS homolog 3 (E. coli) chr5_79970915- NA Frameshift CCCACNAAAAA 0.62

79970916_AA_

CCOV3T COLO-704 MSH6 mutS homolog 6 (E. coli) chr2_48030640- NA Frameshift CCCCCNTTCTT 0.09

48030640 _ C

CCOV3T COLO-704 MYCL1 v-myc myelocytomatosis viral chr1_40366579- NA Frameshift GGTGGNCCCCT 0.57 oncogene homolog 1 , lung carcinoma 40366579_C_

derived (avian)

CCOV3T COLO-704 NRP2 neuropilin 2 chr2_206641245- 906C>S Nonsynonymous CGCACNGCTGA 0.38

206641245_T_A coding

CCOV3T COLO-704 PTEN phosphatase and tensin homolog chr10_89692904- 130R>X Nonsense AGGGANGAACT 1.00

89692904_C_T

CCOV3T COLO-704 SHROOM4 shroom family member 4 chrX_50378013- 354G>S Nonsynonymous AGAGCNCTGTT 0.46

50378013_C_T coding

CCOV3T COLO-704 WRN Werner syndrome, RecQ helicase-like chr8_30958361- NA Splice site TTTTTNCAGGT 0.11

30958361 _A_C acceptor

CCOV3T COLO-704 WRN Werner syndrome, RecQ helicase-like chr8_30958362- NA Splice site TTTTANACCTA 0.12

30958362_C_A acceptor

CCOV3T COLO-704 ZFHX2 zinc finger homeobox 2 chr14_23999628- NA Frameshift TTATTNAGAGT 0.79

23999628_A_

CCOV3T COLO-704 ZFHX4 zinc finger homeobox 4 chr8_77620381- 1038R>K Nonsynonymous AAAAANAGAAA 0.12

77620381 _C_A coding

CCOV3T COLO-704 ZFHX4 zinc finger homeobox 4 chr8_77620372- NA Frameshift TAACCN AAAAA 0.67

77620372_A_

CCOV30T OVSAHO NSD1 nuclear receptor binding SET domain chr5_176665503- 1396T>M Nonsynonymous TAAAANCCCAC 0.57 protein 1 176665503_C_T coding

CCOV30T OVSAHO PIAS4 protein inhibitor of activated STAT, 4 chr19_4028591- 222S>F Nonsynonymous CTCCTNCCTCC 0.48

4028591_C_T coding

CCOV30T OVSAHO SH3PXD2B SH3 and PX domains 2B chr5_171766434- 559V>M Nonsynonymous AATCANGCCCG 0.37

171766434_C_T coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CCOV30T OVSAHO TP53 tumor protein p53 chr17_7574003- 342R>X Nonsense CTCTCNGAACA 1.00

7574003_G_A

CCOV30T OVSAHO ZNF556 zinc finger protein 556 chr19_2877696- 247R>H Nonsynonymous CTTTCNCGCAC 1.00

2877696_G_A coding

CCOV31T OVTOKO ARID1A AT rich interactive domain 1 A (SWI- chr1_27023183- 97E>X Nonsense GCGCGNAGCCG 0.50 like) 27023183_G_T

CCOV31T OVTOKO ARID1A AT rich interactive domain 1 A (SWI- chr1_27107013- NA Frameshift CAGTTNCAGCA 0.50 like) 27107013_C_

CCOV31T OVTOKO BCAS1 breast carcinoma amplified sequence chr20_52591931- 393E>D Nonsynonymous ACATTNTCCTC 0.50

1 52591931_C_G coding

CCOV31T OVTOKO EBF3 early B-cell factor 3 chr10_131671770- 243R>W Nonsynonymous CCCCCNCCTCC 0.53

131671770_G_A coding

CCOV31T OVTOKO PIK3R1 phosphoinositide-3-kinase, chrS_67S89S83- 449L>X Nonsense AAAATNACATC 0.31 regulatory subunit 1 (alpha) 67589583_T_A

CCOV31T OVTOKO PNPLA3 patatin-like phospholipase domain chr22_44322961- 112G>S Nonsynonymous TCTCCNGCAAA 0.37 containing 3 44322961 _G_A coding

CCOV31T OVTOKO PPP2R1A protein phosphatase 2, regulatory chr19_52715982- 183R>G Nonsynonymous TCCCCNCCCCC 0.61 subunit A, alpha 52715982_C_G coding

CCOV31T OVTOKO SYCP1 synaptonemal complex protein 1 chr1_115489931- 771 R>l Nonsynonymous ACAAANACAAC 0.35

115489931_G_T coding

CGOV32T PEO-14 SLC22A14 solute carrier family 22, member 14 chr3_38349170- 245S>L Nonsynonymous CATCTNCCACT 0.24

38349170_C_T coding

CGOV32T PEO-14 TPS3 tumor protein pS3 chr17_7577108- 277C>F Nonsynonymous CACCANACCCA 1.00

7577108_C_A coding

CGOV33T PEA2 BARD1 BRCA1 associated RING domain 1 chr2_215645945- 218W>X Nonsense AATTCNATTTT 0.41

215645945_C_T

CGOV33T PEA2 CACNA1S calcium channel, voltage-dependent, chr1_201019615- 1381M>I Nonsynonymous TTCTCNATCAT 0.40

L type, alpha 1S subunit 201019615_C_T coding

CGOV33T PEA2 RECQLS RecQ protein-like 5 chr17_73623774- NA Splice site ACTCCNCCAAC 1.00

73623774_T_C acceptor

CGOV33T PEA2 TLL2 tolloid-like 2 chr10_98146740- 608E>K Nonsynonymous CACCTNCTACC 0.25

98146740_C_T coding

CGOV33T PEA2 TPS3 tumor protein p53 chr17_7577558- NA Frameshift ATGCANGAACT 1.09

7577558_G_

CCOV34T PEO-6 LSS lanosterol synthase (2,3- chr21_47608519- 129R>Q Nonsynonymous GAAGCNGACGG 0.70 oxidosqualene-lanosterol cyclase) 47608519_C_T coding

CCOV34T PEO-6 NF1 neurofibromin 1 chr17_29546137- NA Splice site donor TGGAGNTAAGG 0.92

29546137_G_T

CCOV34T PEO-6 RELN reelin chr7_103183242- 2203L>I Nonsynonymous AAACANCTTCT 0.49

103183242_G_T coding

CCOV34T PEO-6 TPS3 tumor protein p53 chr17_7577550- 244C>D Nonsynonymous TGCCGNCCATG 1.00

7577550_C_T coding

CCOV35T RMG-I FAN CL Fanconi anemia, complementation chr2_58456995- 57W>X Nonsense CCTCCNAACTA 0.44 group L 58456995_C_T

CCOV35T RMC-I MORN3 MORN repeat containing 3 chr12_122092231 138E>K Nonsynonymous TCCCTNGTAGA 1.00

122092231_C_T coding

CCOV35T RMC-I TRIM37 tripartite motif containing 37 chr17_57093004- 848A>V Nonsynonymous CAACCNCAGGC 0.20

57093004_G_A coding

CCOV35T RMC-I TRUB1 TruB pseudouridine (psi) synthase chr10_116702491 125R>Q Nonsynonymous AGCCCNAGGAG 0.50 homolog 1 (E. coli) 116702491_G_A coding

CGOV36T RMUC-S BUB1 B BUB1 mitotic checkpoint chr15_40498525- 625I>M Nonsynonymous GAGATNATGTC 1.00 serine/threonine kinase B 40498525_A_G coding

CGOV36T RMUC-S CCDCS4 coiled-coil domain containing 54 chr3_107097085- 217M>I Nonsynonymous CAAATNAAAAC 0.13

107097085_G_C coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV36T RMUG-S SEMA5B sema domain, seven chr3_122632717- 707S>N Nonsynonymous CCCGGNTCTTG 0.47 thrombospondin repeats (type 1 and 122632717_C_T coding

type 1-like), transmembrane domain

(TM) and short cytoplasmic domain,

(semaphorin) 5B

CGOV37T_3 SK-OV-3 ABCD1 ATP-binding cassette, sub-family D chrX I 52994810- 342S>T Nonsynonymous GCGCCNCGGGC 0.59

(ALD), member 1 152994810_T_A coding

CGOV37T_3 SK-OV-3 ANK3 ankyrin 3, node of Ranvier (ankyrin G) chr10_61831290- 13117Sfs*2 Frameshift TATGANTTTTT 0.43

61831290_T_

CGOV37T_3 SK-OV-3 APC adenomatous polyposis coli chr5_112175952- T1556Lfs*9 Frameshift GGCAGNAAAAA 0.32

112175952_A_

CGOV37T_3 SK-OV-3 ARID1A AT rich interactive domain 1 A (SWI- chr1_27058048- 586Q>X Nonsense CTCAGNAGTCC 0.55 like) 27058048_C_T

CGOV37T_3 SK-OV-3 ATF6 activating transcription factor 6 chr1_161762091- 221 l>N Nonsynonymous AATTANCAGTT 0.72

161762091_T_A coding

CGOV37T_3 SK-OV-3 B4GALNT2 beta-1 ,4-N-acetyl-galactosaminyl chr17_47246917- 510V>M Nonsynonymous TACTCNTGGGG 0.55 transferase 2 47246917_G_A coding

CGOV37T_3 SK-OV-3 BCL11 B B-cellCLL/lymphoma 11 B (zinc finger chr14_99640519- 885D>V Nonsynonymous TGACGNCGTTA 0.40 protein) 99640519_T_A coding

CGOV37T_3 SK-OV-3 C11orF30 chromosome 11 open reading frame chr11_76255849- K1086Nfs*12 Frameshift CAGAGNAACAG 0.35

30 76255849_A_

CGOV37T_3 SK-OV-3 C1QTNF9 C1 q and tumor necrosis factor chr13_24895797- 298G>E Nonsynonymous GCTCGNGGATG 0.16 related protein 9 24895797_G_A coding

CGOV37T_3 SK-OV-3 C7orf26 chromosome 7 open reading frame chr7_6634211- 187A>V Nonsynonymous TACCGNGCTCT 1.00

26 6634211_C_T coding

CGOV37T_3 SK-OV-3 CCDC1S coiled-coil domain containing 15 chr11_124858023- 634K>R Nonsynonymous ACCAANATATC 0.53

124858023_A_G coding

CGOV37T_3 SK-OV-3 CDSL CD5 molecule-like chr1_157804487- 143G>D Nonsynonymous CAGGGNCGTCA 0.14

157804487_C_T coding

CGOV37T_3 SK-OV-3 CDAN1 codanin l chr15_43022941- 677R>W Nonsynonymous AGTCCNCACAT 0.40

43022941 _G_A coding

CGOV37T_3 SK-OV-3 CDC2SB cell division cycle 25B chr20_3778346- 93R>Q Nonsynonymous TCGACNGGCAT 0.24

3778346_G_A coding

CGOV37T_3 SK-OV-3 CHIA chitinase, acidic chr1_111862928- 424S>L Nonsynonymous CAGCTNGGGAG 0.42

111862928_C_T coding

CGOV37T_3 SK-OV-3 COL4AS collagen, type IV, alpha 5 chrXJ 07929326- 1428R>C Nonsynonymous GAGGGNGCAAA 0.44

107929326_C_T coding

CGOV37T_3 SK-OV-3 CSPP1 centrosome and spindle pole chr8_68044230- 576V>A Nonsynonymous TCAAGNGATAA 0.57 associated protein 1 68044230_T_C coding

CGOV37T_3 SK-OV-3 DOCK2 dedicator of cytokinesis 2 chr5_169423152- 1019T>R Nonsynonymous ACACANGAACT 0.47

169423152 C G coding

CGOV37T_3 SK-OV-3 EEF1A2 eukaryotic translation elongation chr20_62126324- 152V>A Nonsynonymous TGTTCNCGCCC 0.65 factor 1 alpha 2 62126324_A_G coding

CGOV37T_3 SK-OV-3 ELMSAN1 ELM2 and Myb/SANT-like domain chr14_74205906- 269P>L Nonsynonymous AGAGCNGCATC 0.34 containing 1 74205906_G_A coding

CGOV37T_3 SK-OV-3 FBXW7 F-box and WD repeat domain chr4_153247288- 505R>L Nonsynonymous CACAGNGGACT 0.44 containing 7, E3 ubiquitin protein 153247288_C_A coding

ligase

CGOV37T_3 SK-OV-3 FCRL1 Fc receptor-like 1 chr1_157765936- 415L>M Nonsynonymous CCTCANCCTGG 0.24

157765936_G_T coding

CGOV37T_3 SK-OV-3 FM03 flavin containing monooxygenase 3 chr1_171083448- 377A>T Nonsynonymous TTGGGNCTGCC 0.47

171083448_G_A coding

CGOV37T_3 SK-OV-3 GNMT glycine N-methyltransferase chr6_42930887- 177H>N Nonsynonymous TTGATNATCGC 0.56

42930887_C_A coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%) CCOV37T 3 SK-OV-3 GPR34 G protein-coupled receptor 34 chrX_41555358- 158R>W Nonsynonymous TTAATNGGTCT 0.44

41555358 C T coding

CGOV37T_3 SK-OV-3 GSDMA gasdermin A chr17_38122621- 108S>L Nonsynonymous GCTCTNGCAGA 0.28

38122621 C T coding

CGOV37T_3 SK-OV-3 GUCY2F guanylate cyclase 2F, retinal chrXJ 08708514- 297V>L Nonsynonymous TAGGANCCGGT 0.37

108708514_C_G coding

CGOV37T 3 SK-OV-3 ILVBL ilvB (bacterial acetolactate chr19_15233733- 192A>T Nonsynonymous CATCGNGGCCC 0.43 synthase)-like 15233733 C T coding

CGOV37T_3 SK-OV-3 IRS4 insulin receptor substrate 4 chrXJ 07977282- 765N>D Nonsynonymous TTTATNAGTAT 0.50

107977282_T_C coding

CGOV37T 3 SK-OV-3 KANSU KAT8 regulatory NSL complex chr17_44109032- 1043A>V Nonsynonymous TGTGCNCCAGG 0.23 subunit 1 44109032 G A coding

CGOV37T_3 SK-OV-3 KDM8 lysine (K)-specific demethylase 8 chr16_27227275- 308V>I Nonsynonymous GGGACNTCGGG 0.58

27227275_G_A coding

CGOV37T 3 SK-OV-3 LING04 leucine rich repeat and Ig domain chr1_151773722- 487S>G Nonsynonymous ATTGCNAACCA 0.43 containing 4 151773722 T C coding

CGOV37T_3 SK-OV-3 LOXHD1 lipoxygenase homology domains 1 chr18_44181209- 369G>S Nonsynonymous GACACNCACAT 0.33

44181209_C_T coding

CGOV37T_3 SK-OV-3 LRRN4 leucine rich repeat neuronal 4 chr20_6021996- 632T>M Nonsynonymous GGGCCNTGGCG 0.21

6021996 G A coding

CGOV37T_3 SK-OV-3 MEF2D myocyte enhancer factor 2D chr1_156452390- 33Y>H Nonsynonymous CTCATNCGCCT 0.55

156452390_A_G coding

CGOV37T 3 SK-OV-3 MEIS3 Meis homeobox 3 chr19_47919955- 117R>L Nonsynonymous CAGAGNGAACC 0.55

47919955 C A coding

CGOV37T_3 SK-OV-3 NADSYN1 NAD synthetase 1 chr11_71164426- 28K>N Nonsynonymous TTAAANAGTGA 0.44

71164426_G_T coding

CGOV37T 3 SK-OV-3 NDST4 N-deacetylase/N-sulfo transferase chr4_115898360- 350G>A Nonsynonymous ACTTCNCTGAA 0.47

(heparan glucosaminyl) 4 115898360 C G coding

CGOV37T 3 SK-OV-3 NEDD4 neural precursor cell expressed, chr15_56208645- 129D>N Nonsynonymous ATTATNGACCA 0.51 developmentally down-regulated 4, 56208645 C T coding

E3 ubiquitin protein ligase

CGOV37T 3 SK-OV-3 NOTCH2 notch 2 chr1_120466308- R1604Dfs*9 Frameshift TCATCNTCTGT 0.32

120466309_CT_

CGOV37T_3 SK-OV-3 NTSR2 neurotensin receptor 2 chr2_11810096- 54A>S Nonsynonymous GTGCGNGGACA 0.17

11810096 C A coding

CGOV37T 3 SK-OV-3 OR51 L1 olfactory receptor, family 51, chr11_5021018- 269H>P Nonsynonymous GAAGCNTCTGT 0.41 subfamily L, member 1 5021018_A_C coding

CGOV37T 3 SK-OV-3 PHEX phosphate regulating endopeptidase chrX_22231041- 556Q>K Nonsynonymous AGCTCNAGAAG 0.52 homolog, X-linked 22231041 _C_A coding

CGOV37T 3 SK-OV-3 PHIP pleckstrin homology domain chr6_79650825- 1684D>V Nonsynonymous CTTCANCTCTG 0.52 interacting protein 79650825 T A coding

CGOV37T 3 SK-OV-3 PI4KA phosphatidylinositol 4-kinase, chr22_21082105- 1577R>Q Nonsynonymous CCAACNGAACG 0.36 catalytic, alpha 21082105_C_T coding

CGOV37T 3 SK-OV-3 PIGN phosphatidylinositol glycan anchor chr18_59828573- 5F>C Nonsynonymous AAGTANAGAAC 0.34 biosynthesis, class N 59828573_A_C coding

CGOV37T 3 SK-OV-3 PIK3CA phosphatidylinositol-4,5- chr3_178952085- 1047H>R Nonsynonymous TGCACNTCATG 0.39 bisphosphate 3-kinase, catalytic 178952085_A_G coding

subunit alpha

CGOV37T 3 SK-OV-3 POLD1 polymerase (DNA directed), delta 1 , chr19_50918070- 2389-2A>T Splice site CTCCCNGGTCT 0.27 catalytic subunit 50918070 A T acceptor

CGOV37T 3 SK-OV-3 PPFIA2 protein tyrosine phosphatase, chr12_81733000- 836R>H Nonsynonymous ACAAANGTCCT 0.44 receptor type, f polypeptide (PTPRF), 81733000_C_T coding

interacting protein (liprin), alpha 2

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV37T_3 SK-OV-3 PPFIBP2 PTPRF interacting protein, binding chr11_7652195- 335P>L Nonsynonymous AGAACNGGAGG 0.41 protein 2 (liprin beta 2) 765219S_C_T coding

CGOV37T_3 SK-OV-3 PRLR prolactin receptor chrS_3S06SS13- 516N>I Nonsynonymous CTTTGNTGACC 0.33

35065513_T_A coding

CGOV37T_3 SK-OV-3 PSKH1 protein serine kinase H1 chr16_67943104- 151 R>H Nonsynonymous GGTGCNTCATG 0.33

67943104_G_A coding

CGOV37T_3 SK-OV-3 PTGER4 prostaglandin E receptor 4 (subtype chrS_40681634- 180A>V Nonsynonymous GACGGNGCACG 0.56

EP4) 40681634_C_T coding

CGOV37T_3 SK-OV-3 RASGEF1 A RasGEF domain Family, member 1A chr10_43701440- 42D>G Nonsynonymous GTCCANCTTGG 0.22

43701440_T_C coding

CGOV37T_3 SK-OV-3 RBM47 RNA binding motiF protein 47 chr4_40440159- 251 R>H Nonsynonymous GGTTGNGCACG 0.37

40440159_C_T coding

CGOV37T_3 SK-OV-3 RHBDF2 rhomboid 5 homolog 2 (Drosophila) chr17_74475975- 67A>S Nonsynonymous GTGTGNAGCCC 1.00

74475975_C_A coding

CGOV37T_3 SK-OV-3 RPTOR regulatory associated protein oF chr17_78897411- 916Y>H Nonsynonymous CGCAGNACACC 0.61

MTOR, complex 1 78897411_T_C coding

CGOV37T_3 SK-OV-3 SELENBP1 selenium binding protein 1 chr1_151337742- 354S>R Nonsynonymous AATGCNGCCTC 0.66

151337742_T_G coding

CGOV37T_3 SK-OV-3 SIK1 salt-inducible kinase 1 chr21_44838265- 540S>L Nonsynonymous AGGGCNAGGCC 0.57

44838265_G_A coding

CGOV37T_3 SK-OV-3 SLC12A9 solute carrier Family 12, member 9 chr7_100456716- 304V>I Nonsynonymous CGATCNTCGCC 1.00

100456716_G_A coding

CGOV37T_3 SK-OV-3 SLC2A6 solute carrier Family 2 (Facilitated chr9_136340625- 224R>Q Nonsynonymous TGCCCNGAGAG 0.34 glucose transporter), member 6 136340625_C_T coding

CGOV37T_3 SK-OV-3 SMARCC1 SWI/SNF related, matrix associated, chr3_47676782- R848KFs*9 FrameshiFt CTTTCNCTTTC 0.82 actin dependent regulator oF 47676785_TCTT_

chromatin, subFamily c, member 1

CGOV37T_3 SK-OV-3 SSC5D scavenger receptor cysteine rich chr19_56011672- 732S>N Nonsynonymous CAAGANTATCC 0.12

domain containing (5 domains) 56011672_G_A coding

CGOV37T_3 SK-OV-3 STRA6 stimulated by retinoic acid 6 chr15_74483787- 295C>R Nonsynonymous CCTGCNAAGGA 0.32

74483787_A_G coding

CGOV37T_3 SK-OV-3 TBC1 D2 TBC1 domain Family, member 2 chr9_100961731- 896R>W Nonsynonymous TGCCCNCCTCT 0.63

100961731_G_A coding

CGOV37T_3 SK-OV-3 TOX3 TOX high mobility group box Family chr16_52473331- 513R>C Nonsynonymous GAGGCNCTGCT 0.45 member 3 52473331 _G_A coding

CGOV37T_3 SK-OV-3 TPS3 tumor protein p53 chr17_7S79420- S90PFs*33 FrameshiFt CAGGANGGGGC 0.86

7S79420_G_

CGOV37T_3 SK-OV-3 TP63 tumor protein p63 chr3_189455563- 33E>Q Nonsynonymous GGAAANAAAGT 0.50

189455563_G_C coding

CGOV37T_3 SK-OV-3 TP63 tumor protein p63 chr3_189608603- 560S>A Nonsynonymous GTTCANCATGT 0.40

189608603_T_G coding

CGOV37T_3 SK-OV-3 TSHZ3 teashirt zinc Finger homeobox 3 chr19_31768208- 831V>L Nonsynonymous TGATANGACGG 0.55

31768208_C_A coding

CGOV37T_3 SK-OV-3 TYK2 tyrosine kinase 2 chr19_10475348- 437E>Q Nonsynonymous CACCTNGTGGC 0.58

10475348_C_G coding

CGOV37T_3 SK-OV-3 USP26 ubiquitin specific peptidase 26 chrXJ 32160638- 537Q>H Nonsynonymous ACTTCNTGGTC 0.32

132160638_C_A coding

CGOV37T_3 SK-OV-3 VWCE von Willebrand Factor C and EGF chr11_61048629- 289P>L Nonsynonymous CCTCANGAAGC 0.12

domains 61048629_G_A coding

CGOV37T_3 SK-OV-3 WNK1 WNK lysine deFicient protein kinase 1 chr12_990928-990928_C_A 1061 P>Q Nonsynonymous CCAGCNGACCA 0.54 coding

CGOV37T_3 SK-OV-3 WRNIP1 Werner helicase interacting protein 1 chr6_2779S26- 429V>A Nonsynonymous AGCAGNAGACA 0.53

2779S26_T_C coding

Position oF mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV37T_3 SK-OV-3 ZNF30 zinc Finger protein 30 chr19_35434905- 346E>D Nonsynonymous TTTGANTGTAA 0.59

3S43490S_A_T coding

CGOV37T_3 SK-OV-3 ZNF831 zinc Finger protein 831 chr20_57768677- 868G>D Nonsynonymous AGGGGNCTCAA 0.15

S7768677_G_A coding

CGOV38T TOV-112D CTNNB1 catenin (cadherin-associated chr3_41266112- 37S>A Nonsynonymous TCCATNCTGGT 1.00 protein), beta 1 , 88kDa 41266112_T_G coding

CGOV38T TOV-112D SMARCA4 SWI/SNF related, matrix associated, chr19_11113807- NA FrameshiFt GGCAGNTGGAG 0.89 actin dependent regulator oF 11113807_C_

chromatin, subFamily a, member 4

CGOV38T TOV-112D TP53 tumor protein p53 chr17_7578406- 175R>H Nonsynonymous GGCAGNGCCTC 1.00

7578406 C T coding

CGOV38T TOV-112D ZAN zonadhesin chr7_100350550- 941 L>P Nonsynonymous AAAACNCACCA 0.57

100350550_T_C coding

CGOV39T TOV-21 G ABCC1 ATP-binding cassette, sub-Family C chr16_16208886- 1115A>T Nonsynonymous CCATCNCCGCC 0.40

(CFTR/MRP), member 1 16208886_G_A coding

CGOV39T TOV-21 G ARID1A AT rich interactive domain 1 A (SWI- chr1_27057937- NA FrameshiFt GCCAGNCCCCC 0.45 like) 27057937 _ C

CGOV39T TOV-21 G ARID1A AT rich interactive domain 1 A (SWI- chr1_27088659- NA FrameshiFt AGGAANCCCCA 0.44

Like) 27088659_C_

CGOV39T TOV-21 G ARID1 B AT rich interactive domain 1 B (SWI1- chr6_157528200- NA FrameshiFt ATCCTNGGGAA 0.54 like) 157528200 _ G

CGOV39T TOV-21 G AXIN1 axin 1 chr16_348211 -348211 _G_ NA FrameshiFt GCCCTNGGGGC 0.38 CGOV39T TOV-21 G CCND1 cyclin D1 chr11_69457951- NA FrameshiFt ACCATNCCCCT 0.50

69457951 C

CGOV39T TOV-21 G CSF2RA colony stimulating Factor 2 receptor, chrX_1401670- 25S>L Nonsynonymous GAAATNGGGTA 0.38 alpha, low-aFFinity (granulocyte- 1401670_C_T coding

macrophage)

CGOV39T TOV-21 G ERBB3 v-erb-b2 erythroblastic leukemia viral chr12_56495715- NA FrameshiFt TCAGGNCCCCC 0.73 oncogene homolog 3 (avian) 5649571 S_C_

CGOV39T TOV-21 G FANCD2 Fanconi anemia, complementation chr3_10115050- NA Splice site donor AGGTANTGGAA 0.13 group D2 10115050_T_C

CGOV39T TOV-21 G FGFR3 Fibroblast growth Factor receptor 3 chr4_1806181-1806181_C NA FrameshiFt CGCAGNCCCCC 0.62

CGOV39T TOV-21 G JAK1 Janus kinase 1 chr1_65306997- NA FrameshiFt GCTGGNTTTTT 0.38

65306997_T_

CGOV39T TOV-21 G JAK1 Janus kinase 1 chr1_65330630- NA FrameshiFt GTTTANTTTTT 0.44

65330630_T_

CGOV39T TOV-21 G KIAA1161 uncharacterized protein chr9_34371740- 367R>H Nonsynonymous CGAAGNGCGAC 0.62

34371740_C_T coding

CGOV39T TOV-21 G KRAS v-Ki-ras2 Kirsten rat sarcoma viral chr12_25398282- 13G>C Nonsynonymous TACGCNACCAG 0.63 oncogene homolog 25398282_C_A coding

CGOV39T TOV-21 G MCCC1 methylcrotonoyl-CoA carboxylase 1 chr3_182756876- 439V>M Nonsynonymous CCACANGACCA 0.36

(alpha) 182756876_C_T coding

CGOV39T TOV-21 G MEN1 multiple endocrine neoplasia I chr11_64574680- 270W>X Nonsense AGCAGNCAGAG 0.54

64574680_C_T

CGOV39T TOV-21 G MLL3 myeloid/lymphoid or mixed-lineage chr7_151849939- 4126L>X Nonsense TGACCNAACCC 0.56 leukemia 3 151849939_A_T

CGOV39T TOV-21 G NBN nibrin chr8_90967512- NA FrameshiFt AGACCNTTTTT 0.46

90967512_T_

CGOV39T TOV-21 G NUP50 nucleoporin 50kDa chr22_45574145- 123T>A Nonsynonymous CTACCNCCTTG 0.10

45574145_A_G coding

CGOV39T TOV-21 G NXF5 nuclear RNA export Factor 5 chrX_101091715- 391A>T Nonsynonymous AATTGNGGCCA 0.71

101091715_C_T coding

CGOV39T TOV-21 G PDGFRB platelet-derived growth Factor chr5_149497245- NA FrameshiFt AGGCANGGGGA 0.25 receptor, beta polypeptide 149497245_G_

Position oF mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV39T TOV-21 G PIK3CA phosphatidylinositol-4,5- chr3_178952084- 1047H>Y Nonsynonymous ATGCANATCAT 0.47 bisphosphate 3-kinase, catalytic 178952084_C_T coding

subunit alpha

CGOV39T TOV-21 G PIK3R1 phosphoinositide-3-kinase, chr5_67586610- NA Frameshift AAGACNGATAT 0.49 regulatory subunit 1 (alpha) 67586611_AG_

CGOV39T TOV-21 G PTEN phosphatase and tensin homolog chr10_89692941- NA Frameshift ACATCNGGGCA 0.53

89692941 _G_

CGOV39T TOV-21 G PTEN phosphatase and tensin homolog chr10_89717770- NA Frameshift ATGCTNAAAAA 0.27

89717770_A_

CGOV39T TOV-21 G RNF43 ring finger protein 43 chr17_56435161- NA Frameshift AGGGANCCCCC 0.39

56435161 _C_

CGOV39T TOV-21 G SHMT2 serine hydroxymethyltransferase 2 chr12_57626348- 236R>H Nonsynonymous CGCCCNCATGA 0.13

(mitochondrial) 57626348_G_A coding

CGOV39T TOV-21 G SLC24A2 solute carrier family 24 chr9_19786464- 134A>V Nonsynonymous TGATCNCACCT 0.41

(sodium/potassium/calcium 19786464_G_A coding

exchanger), member 2

CGOV39T TOV-21 G STK11 serine/threonine kinase 11 chr19_1221314- NA Frameshift TGTGGNCCCCC 0.97

1221314_C_

CGOV39T TOV-21 G USH2A Usher syndrome 2A (autosomal chr1_216363589- 1458G>X Nonsense TGCTCNCGAAG 0.54 recessive, mild) 216363589_C_A

CGOV39T TOV-21 G VGLL4 vestigial like 4 (Drosophila) chr3_11744445- 22R>C Nonsynonymous CTTACNTTTTT 0.70

11744445_G_A coding

CGOV4T DOV-13 KRTAP12-1 keratin associated protein 12-1 chr21_46101960- 27P>S Nonsynonymous CACGGNGATGT 0.39

46101960_G_A coding

CGOV4T DOV-13 NF1 neurofibromin 1 chr17_29546086- 531Q>X Nonsense TCGTCNAACTG 0.69

29546086_C_T

CGOV4T DOV-13 NF1 neurofibromin 1 chr17_29563040- NA Splice site donor ACCAGNTTTGT 0.31

29563040_G_T

CGOV4T DOV-13 NOTCH3 notch 3 chr19_15297687- NA Splice site donor TGCCCNCCTGT 0.17

15297687_A_G

CGOV4T DOV-13 OGG1 8-oxoguanine DNA glycosylase chr3_9792402-9792402_C NA Frameshift CTCGANCCCCC 0.54

CGOV4T DOV-13 SLC22A10 solute carrier family 22, member 10 chr11_63065156- 263V>M Nonsynonymous TGCACNTGGTG 0.52

63065156_G_A coding

CGOV4T DOV-13 SPTA1 spectrin, alpha, erythrocytic 1 chr1_158622402- 1077R>H Nonsynonymous ATAGANGACGT 0.50

(elliptocytosis 2) 158622402_C_T coding

CGOV4T DOV-13 TRPM8 transient receptor potential cation chr2_234854620- 274E>K Nonsynonymous CTGTCNAAGCA 0.43 channel, subfamily M, member 8 234854620_G_A coding

CGOV40T TYK-nu ARID1A AT rich interactive domain 1 A (SWI- chr1_27023167- NA Frameshift AGCGGNGCGCG 1.00 like) 27023177_CGGCGGGCCCG_

CGOV40T TYK-nu MSH6 mutS homolog 6 (E. coli) chr2_48033982- NA Frameshift TGACTNTGATT 0.47

48033982 _ TTGA

CGOV40T TYK-nu NRAS neuroblastoma RAS viral (v-ras) chr1_115256530- 61Q>K Nonsynonymous TTCTTNTCCAG 0.52 oncogene homolog 115256530_G_T coding

CGOV40T TYK-nu NRAS neuroblastoma RAS viral (v-ras) chr1_115258747- 12G>D Nonsynonymous CACCANCTGCT 0.24 oncogene homolog 115258747_C_T coding

CGOV40T TYK-nu SIGLEC10 sialic acid binding Ig-like lectin 10 chr19_S1920617- 47R>Q Nonsynonymous CCTGTNGGGGG 0.97

51920617_C_T coding

CGOV40T TYK-nu TP53 tumor protein pS3 chr17_7578406- 17SR>H Nonsynonymous GGCAGNGCCTC 1.00

7578406_C_T coding

CGOV40T TYK-nu ZDHHC1 zinc finger, DHHC-type containing 1 chr16_67432126- 306R>W Nonsynonymous GGGCCNCATCT 0.28

67432126_G_A coding

CGOV42T OVCAR-8 CREBBP CREB binding protein chr16_3820773- 893S>X Nonsense AAGACNACACA 0.97

3820773_G_T

Position of mutation indicated by 'N' Mutant

Gene CbloPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CCOV42T OVCAR-8 EP300 E1A binding protein p300 chr22_41572902- NA Frameshift GGCGANTCTCG 0.59

41572902_T_

CCOV42T OVCAR-8 ERBB2 v-erb-b2 erythroblastic leukemia viral chr17_37880998- 776G>V Nonsynonymous GGCTGNTGTGG 0.31 oncogene homolog 2, 37880998_G_T coding

neuro/glioblastoma derived

oncogene homolog (avian)

CGOV42T OVCAR-8 NCOA2 nuclear receptor coactivator 2 chr8_71082492- 162I>M Nonsynonymous TGCAANATGCT 0.38

71082492_G_C coding

CGOV42T OVCAR-8 TP53 tumor protein p53 chr17_7578555- NA Splice site GAGTANTGTAG 1.00

7578555_C_T acceptor

CGOV44T FU-OV-1 ADCYAP1 adenylate cyclase activating chr18_908273-908273_G_A 84A>T Nonsynonymous ATGTCNCCCAC 0.24 polypeptide 1 (pituitary) coding

CGOV44T FU-OV-1 BTRC beta-transducin repeat containing E3 chr10_103310592- 598R>Q Nonsynonymous TTCTCNAACAT 0.41 ubiquitin protein ligase 103310592_G_A coding

CGOV44T FU-OV-1 DNER delta/notch-like EGF repeat chr2_230456445- 146E>K Nonsynonymous GGATTNGGTCC 0.40 containing 230456445_C_T coding

CGOV44T FU-OV-1 MLL myeloid/lymphoid or mixed-lineage chr11_118390716- 3786 R>H Nonsynonymous ACATCNTCAGC 0.39 leukemia (trithorax homolog, 118390716_G_A coding

Drosophila)

CGOV44T FU-OV-1 MYO10 myosin X chr5_16694613- 1223G>R Nonsynonymous CCCCCNTTTTT 0.24

16694613_C_T coding

CGOV44T FU-OV-1 POLG polymerase (DNA directed), gamma chr15_89868809- 607W>X Nonsense CCATCNCAGGT 0.15

89868809_C_T

CGOV44T FU-OV-1 PPM1 D protein phosphatase, Mg2+/Mn2+ chr17_58740438- 448N>S Nonsynonymous AGAGANTTTTT 1.00

dependent, 1 D 58740438_A_G coding

CGOV44T FU-OV-1 PRKDC protein kinase, DNA-activated, chr8_48715864- NA Splice site donor CAACTNACCCA 1.00

catalytic polypeptide 48715864_T_C

CGOV44T FU-OV-1 PROZ protein Z, vitamin K-dependent chr13_113826163- 316T>M Nonsynonymous GACCANGCGGC 1.00

plasma glycoprotein 113826163_C_T coding

CGOV44T FU-OV-1 SPEF2 sperm flagellar 2 chr5_35649490- 252E>K Nonsynonymous AGTTCNAAGCA 0.42

35649490_G_A coding

CGOV44T FU-OV-1 TP53 tumor protein p53 chr17_7577037- 301 P>S Nonsynonymous CCCTGNGGGCA 0.30

7577037_G_A coding

CGOV44T FU-OV-1 TP53 tumor protein p53 chr17_7578395- 179H>D Nonsynonymous CTCATNGTGGG 1.00

7578395_G_C coding

CGOV45T COV-318 CD209 CD209 molecule chr19_7809880- 283A>T Nonsynonymous GCAGGNGGTGA 0.36

7809880_C_T coding

CGOV45T COV-318 KBTBD6 kelch repeat and BTB (POZ) domain chr13_41705440- 403T>K Nonsynonymous GGTCTNTCCTG 0.14 containing 6 41705440_G_T coding

CGOV45T COV-318 KIF16B kinesin family member 16B chr20_16360363- 762V>M Nonsynonymous GGCCANGAGCA 0.13

16360363_C_T coding

CGOV45T COV-318 OGG1 8-oxoguanine DNA glycosylase chr3_9792402-9792402 _ C NA Frameshift CTCGANCCCCC 0.29

CGOV45T COV-318 REST RE1 -silencing transcription factor chr4_57797265- 747I>M Nonsynonymous CAGATNGAGCT 0.40

57797265_A_G coding

CGOV45T COV-318 TP53 tumor protein p53 chr17_7578266- 195I>F Nonsynonymous TCGGANAAGAT 1.00

7578266_T_A coding

CGOV45T COV-318 ZNF45 zinc finger protein 45 chr19_44418984- 202R>C Nonsynonymous CCGACNGAAGG 0.81

44418984_G_A coding

CGOV46T JHOS-2 AR androgen receptor chrX_66765158- 57L>Q Nonsynonymous GCTGCNGCAGC 0.15

66765158_T_A coding

CGOV46T JHOS-2 EPSTI1 epithelial stromal interaction 1 chr13_43462434- 395E>D Nonsynonymous ATGAGNTCAGG 0.11

(breast) 43462434_T_G coding

CGOV46T JHOS-2 GPR158 G protein-coupled receptor 158 chr10_25887907- 1118E>K Nonsynonymous AGAGCNAAGAA 1.00

25887907_G_A coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CCOV46T JHOS-2 HYDIN HYDIN, axonemal central pair chr16_71052028- NA Splice site donor TGGGGNTACCT 0.52 apparatus protein 71052028_G_A

CCOV46T JHOS-2 NLRP10 NLR family, pyrin domain containing chr11_7984973- 24D>N Nonsynonymous GAAATNGTTCT 0.55

10 7984973_C_T coding

CCOV46T JHOS-2 ZNF426 zinc finger protein 426 chr19_9639822- 300R>Q Nonsynonymous GGGTTNGCATG 0.59

9639822_C_T coding

CCOV47T JHOS-4 BRCA1 breast cancer 1, early onset chr17_41203135- NA Splice site AAGATNTGGAA 1.00

4120313S_C_T acceptor

CCOV47T JHOS-4 KCTD6 potassium channel tetramerisation chr3_58487329- 228F>L Nonsynonymous ACTTTNTGTAG 0.67 domain containing 6 58487329_C_A coding

CCOV47T JHOS-4 SLC2A7 solute carrier family 2 (facilitated chr1_9083095- 65A>T Nonsynonymous TGTTGNGTGTC 1.00 glucose transporter), member 7 9083095_C_T coding

CCOV47T JHOS-4 TP53 tumor protein p53 chr17_7578490- 147V>G Nonsynonymous AATCANCCCAC 1.00

7S78490_A_C coding

CCOV48T JHOM-1 ANKRD33 ankyrin repeat domain 33 chr12_52282866- 138A>T Nonsynonymous TGGTCNCATGC 0.33

S2282866_G_A coding

CGOV48T JHOM-1 PTEN phosphatase and tensin homolog chr10_89720802- NA Frameshift AGTACNTACTT 1.14

89720802 _ T

CGOV48T JHOM-1 RB1 retinoblastoma 1 chr13_49030386- 621 R>S Nonsynonymous CTACGNGTGTA 0.58

49030386_C_A coding

CCOV48T JHOM-1 STK11 serine/threonine kinase 11 chr19_1220629- 216S>F Nonsynonymous GGGCTNCCCGG 1.00

1220629_C_T coding

CCOV48T JHOM-1 STK11 serine/threonine kinase 11 chr19_1223125- 3S4F>L Nonsynonymous CTCTTNGACAT 1.00

122312S_C_G coding

CCOV48T JHOM-1 TPS3 tumor protein p53 chr17_7S78212- 213R>X Nonsense ATGTCNAAAAG 0.35

7578212_G_A

CCOV48T JHOM-1 TRIM6S tripartite motif containing 65 chr17_73888880- 156E>K Nonsynonymous GCCTTNGGCCT 0.58

73888880_C_T coding

CCOV49T OVK-18 ALDH1 L1 aldehyde dehydrogenase 1 family, chr3_125876304- 137A>V Nonsynonymous CATCCNCCCAG 0.24 member L1 125876304_G_A coding

CCOV49T OVK-18 ARID1A AT rich interactive domain 1 A (SWI- chr1_27023716- NA Frameshift GCCATNGGGGG 0.36 like) 27023716_G_

CCOV49T OVK-18 ARID1A AT rich interactive domain 1 A (SWI- chr1_27058064- NA Frameshift AACTGNCTATT 0.48 like) 27058064_C_

CCOV49T OVK-18 BLM Bloom syndrome, RecQ helicase-like chr1S_91304139- NA Frameshift CTAGGNAAAAA 0.32

91304139_A_

CCOV49T OVK-18 C2CD2L C2CD2-like chr11_118984833- 557A>V Nonsynonymous CTATGNGGCAT 0.58

118984833_C_T coding

CCOV49T OVK-18 FANCD2 Fanconi anemia, complementation chr3_10115050- NA Splice site donor AGGTANTGGAA 0.14 group D2 10115050_T_C

CCOV49T OVK-18 GBF1 golgi brefeldin A resistant guanine chr10_104140384- 1704R>H Nonsynonymous GGAACNCATTG 0.36 nucleotide exchange factor 1 104140384_G_A coding

CCOV49T OVK-18 GBP6 guanylate binding protein family, chr1_89850865- 580R>H Nonsynonymous TAAACNTATGA 0.48 member 6 89850865_G_A coding

CCOV49T OVK-18 IGF2R insulin-like growth factor 2 receptor chr6_160454141- NA Splice site donor TCCGGNACGTC 0.64

160454141_T_C

CCOV49T OVK-18 JAK2 Janus kinase 2 chr9_5066768-5066768_T_ NA Frameshift AAATANTTTTT 0.34

CCOV49T OVK-18 KIAA1109 uncharacterized protein chr4_123275094- 4743R>C Nonsynonymous CAAGGNGTCGC 0.44

123275094_C_T coding

CCOV49T OVK-18 KRAS v-Ki-ras2 Kirsten rat sarcoma viral chr12_25380282- S9A>G Nonsynonymous GACCTNCTGTG 0.42 oncogene homolog 25380282_G_C coding

CCOV49T OVK-18 MDC1 mediator of DNA-damage checkpoint chr6_30675232- NA Splice site GAGGCNTAGAC 0.58

1 30675232_C_A acceptor

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV49T OVK-18 MLL3 myeloid/lymphoid or mixed-lineage chr7_151845524- NA Frameshift TCCTTNAAAAA 0.50 leukemia 3 151845524_A_

CGOV49T OVK-18 MNAT1 menage a trois homolog 1 , cyclin H chr14_61278830- NA Frameshift CAGGCNTTTTT 0.48 assembly factor (Xenopus laevis) 61278830_T_

CGOV49T OVK-18 MYCL1 v-myc myelocytomatosis viral chr1_40366654- NA Frameshift GTCTTNGGTTC 0.68 oncogene homolog 1 , lung carcinoma 40366654_G_

derived (avian)

CGOV49T OVK-18 NEIL1 nei endonuclease Vlll-like 1 (E. coli) chr15_75646175- 272Q>X Nonsense CCCTGNAGGAC 0.48

75646175_C_T

CGOV49T OVK-18 NOTCH4 notch 4 chr6_32170147- NA Frameshift CTGGGNCCCCC 0.62

32170147_C_

CGOV49T OVK-18 PIK3R1 phosphoinositide-3-kinase, chr5_67589020- NA Frameshift CTCTTNCACTA 0.38 regulatory subunit 1 (alpha) 67589020 _ A

CGOV49T OVK-18 POLG polymerase (DNA directed), gamma chr15_89876519- 156L>X Nonsense ACAGCNAGTTG 0.68

89876519_A_T

CGOV49T OVK-18 POU4F1 POU class 4 homeobox 1 chr13_79175651- 387A>T Nonsynonymous GATGGNGGCGA 0.40

79175651 _C_T coding

CGOV49T OVK-18 PTEN phosphatase and tensin homolog chr10_89692982- NA Frameshift TCTATNGGGAA 0.64

89692982 _ G

CGOV49T OVK-18 PTEN phosphatase and tensin homolog chr10_89720712- NA Frameshift CTCAGNAAAAG 0.34

89720712_A_

CGOV49T OVK-18 RET ret proto-oncogene chr10_43597793- 114R>H Nonsynonymous AGACCNCGGCT 0.73

43597793_G_A coding

CGOV49T OVK-18 SMAD2 SMAD family member 2 chr18_45372073- NA Frameshift GCCATNTCTCT 0.53

4S372073_A_

CGOV49T OVK-18 SMARCA4 SWI/SNF related, matrix associated, chr19_11096048- NA Frameshift TGGGGNCCCCG 0.71 actin dependent regulator of 11096048_C_

chromatin, subfamily a, member 4

CGOV49T OVK-18 SMARCA4 SWI/SNF related, matrix associated, chr19_11141498- NA Frameshift GGGCTNGGGGG 0.68 actin dependent regulator of 11141498_G_

chromatin, subfamily a, member 4

CGOV49T OVK-18 TPS3 tumor protein p53 chr17_7S7847S- NA Frameshift CGGGCNGGGGT 0.71

7578475 G

CGOV49T OVK-18 TSC2 tuberous sclerosis 2 chr16_2121791 - NA Frameshift GAGCCNGAGAG 0.48

2121792_AG_

CGOV49T OVK-18 WRN Werner syndrome, RecQ helicase-like chr8_31001132- NA Frameshift TTTCTNAAAAA 0.35

31001132_A_

CGOV49T OVK-18 ZFHX4 zinc finger homeobox 4 chr8_77618197- 625S>L Nonsynonymous GTCTTNGAGGT 0.52

77618197_C_T coding

CGOV49T OVK-18 ZFHX4 zinc finger homeobox 4 chr8_77617547- NA Frameshift AATCTNGGGGG 0.36

77617547 _ G

CGOV49T OVK-18 ZFHX4 zinc finger homeobox 4 chr8_77620065- 933Q>X Nonsense ACTTCNAGCTA 0.52

77620065_C_T

CGOV5T EFO-21 ANK3 ankyrin 3, node of Ranvier (ankyrin G) chr10_61828623- 4006 E>X Nonsense GGTCTNACCAC 0.17

61828623_C_A

CGOV5T EFO-21 CYP11 B1 cytochrome P4S0, family 11 , chr8_143956537- 412R>C Nonsynonymous GTTGCNACCCA 0.16 subfamily B, polypeptide 1 143956537_G_A coding

CGOV5T EFO-21 FER1 L6 fer-1-like 6 (C. elegans) chr8_124989831- 349E>K Nonsynonymous CCAACNAACAG 0.74

124989831_G_A coding

CGOV5T EFO-21 NOTCH2 notch 2 chr1_120612013- 3A>V Nonsynonymous GCAGGNCGGGC 0.12

120612013_G_A coding

CGOV5T EFO-21 TPS3 tumor protein p53 chr17_7579317- 124C>R Nonsynonymous CGTGCNAGTCA 1.00

7579317_A_G coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOVS3T OVCAR-S- ANK3 ankyrin 3, node of Ranvier (ankyrin G) chr10_61832027- 2871 S>L Nonsynonymous CATGCNAAAGT 0.45

CisR 61832027 G A coding

CGOVS3T OVCAR-S- APC adenomatous polyposis coli chr5_112175240- 1317E>Q Nonsynonymous CAGCTNAAGAT 0.80

CisR 112175240 G C coding

CGOVS3T OVCAR-S- CREBBP CREB binding protein chr16_3817760- 1071A>T Nonsynonymous AGAGGNTGTGC 0.81

CisR 3817760_C_T coding

CGOVS3T OVCAR-S- KRAS v-Ki-ras2 Kirsten rat sarcoma viral chr12_2S398284- 12G>V Nonsynonymous CGCCANCAGCT 1.00

CisR oncogene homolog 25398284 C A coding

CGOVS3T OVCAR-S- RIPK1 receptor (TNFRSF)-interacting serine- chr6_3111145- 562T>M Nonsynonymous AAATANGAACT 0.62

CisR threonine kinase 1 3111145_C_T coding

CGOV6T EFO-27 ARID1A AT rich interactive domain 1 A (SWI- chr1_27023744- NA Frameshift CCGGCNGGGGA 0.50 like) 27023744_G_

CGOV6T EFO-27 ARID1A AT rich interactive domain 1 A (SWI- chr1_27105553- 1722R>X Nonsense TCCGANGATGC 0.69 like) 2710SSS3_C_T

CGOV6T EFO-27 ARID1 B AT rich interactive domain 1 B (SWI1- chr6_157405960- NA Frameshift GGGGGNCCATC 0.48 like) 157405960 C

CGOV6T EFO-27 ARID1 B AT rich interactive domain 1 B (SWI1- chr6_157525076- NA Frameshift GACACNATTAA 0.46 like) 157525077_TA_

CGOV6T EFO-27 AXIN1 axin 1 chr16 347093-347093 C NA Frameshift CTTTTNCCCCT 0.41

CGOV6T EFO-27 CNGA3 cyclic nucleotide gated channel alpha chr2_99013338- 569R>C Nonsynonymous ACATCNGCAGC 0.52

3 99013338 C T coding

CGOV6T EFO-27 CREBBP CREB binding protein chr16_3779755- NA Frameshift CTCCTNGGGGC 0.57

3779755 G

CGOV6T EFO-27 DCDCS doublecortin domain containing 5 chr11_30914435- 358R>Q Nonsynonymous ACACTNGTTTT 0.56

30914435 C T coding

CGOV6T EFO-27 DCP1 B DCP1 decapping enzyme homolog B chr12_2062350- 252Q>H Nonsynonymous TGCTGNTGGTG 0.21

(S. cerevisiae) 2062350_C_G coding

CGOV6T EFO-27 EIF2D eukaryotic translation initiation chr1_206767052- 534V>I Nonsynonymous ATTGANGGTGG 0.57 factor 2D 206767052 C T coding

CGOV6T EFO-27 ELM02 engulfment and cell motility 2 chr20_45002162- 431 R>H Nonsynonymous CATTGNGTCCT 0.33

45002162 C T coding

CGOV6T EFO-27 EPHX1 epoxide hydrolase 1 , microsomal chr1_226032963- 428R>H Nonsynonymous GGTTCNTGGGG 0.35

(xenobiotic) 226032963 G A coding

CGOV6T EFO-27 ERBB2 v-erb-b2 erythroblastic leukemia viral chr17_37881332- 842V>I Nonsynonymous GGCTCNTACAC 0.51 oncogene homolog 2, 37881332 G A coding

neuro/glioblastoma derived

oncogene homolog (avian)

CGOV6T EFO-27 ERCC2 excision repair cross-complementing chr19_45858112- NA Splice site CAGCTNCAAGG 0.56 rodent repair deficiency, 45858112_G_A acceptor complementation group 2

CGOV6T EFO-27 ERCC3 excision repair cross-complementing chr2_128047264- NA Splice site donor ACATANGGCAG 0.51 rodent repair deficiency, 128047264_C_T

complementation group 3

CGOV6T EFO-27 ERCC6 excision repair cross-complementing chr10_S0701164- NA Frameshift TTACCNTTTTG 0.50 rodent repair deficiency, 50701164 T

complementation group 6

CGOV6T EFO-27 EYA2 eyes absent homolog 2 (Drosophila) chr20_45801509- 398V>I Nonsynonymous ACAACNTTGGT 0.67

45801509 G A coding

CGOV6T EFO-27 FLCN folliculin chr17_17119709- NA Frameshift CACGTNGGGGG 0.34

17119709_G_

CGOV6T EFO-27 GDF6 growth differentiation factor 6 chr8_97156985- 392R>C Nonsynonymous CGAGCNCAGCG 0.52

97156985 G A coding

CGOV6T EFO-27 GPRSO G protein-coupled receptor 50 chrXJ 50345372- 60R>Q Nonsynonymous GCTCCNGAATT 0.43

150345372 G A coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV6T EFO-27 LACTB lactamase, beta chr15_63433525- 389V>M Nonsynonymous CTTACNTGGAT 0.45

63433525_G_A coding

CGOV6T EFO-27 MLL2 myeloid/lymphoid or mixed-lineage chr12_49447773- NA Frameshift TGCAGNCCCCT 0.59 leukemia 2 49447773_C_

CGOV6T EFO-27 MSH2 mutS homolog 2, colon cancer, chr2_47637247- NA Frameshift GGCAANCTCTC 0.28 nonpolyposis type 1 (E. coli) 47637248_TC_

CGOV6T EFO-27 MSH2 mutS homolog 2, colon cancer, chr2_47657081- NA Splice site donor TGAAGNTAACA 0.42 nonpolyposis type 1 (E. coli) 47657081_G_A

CGOV6T EFO-27 MSH6 mutS homolog 6 (E. coli) chr2_48030640- NA Frameshift AGATANCCCCC 0.41

48030640_C_

CGOV6T EFO-27 MTMR6 myotubularin related protein 6 chr13_25831942- 301 G>S Nonsynonymous CAAACNGGAGT 0.46

25831942_C_T coding

CGOV6T EFO-27 MUC6 mucin 6, oligomeric mucus/gel- chrVM 018764- 1346S>L Nonsynonymous TGGTCNATTTT 0.59 forming 1018764_G_A coding

CGOV6T EFO-27 NAA35 N(alpha)-acetyltransferase 35, NatC chr9_88631573- 563T>K Nonsynonymous AAAAANAAAGA 0.17 auxiliary subunit 88631573_C_A coding

CGOV6T EFO-27 NES nestin chr1_156640514- 1156E>K Nonsynonymous CAGCTNGGAGA 0.59

156640514_C_T coding

CGOV6T EFO-27 PER1 period circadian clock 1 chr17_8051031 - 450R>H Nonsynonymous CCTTGNGGCTC 0.54

8051031_C_T coding

CGOV6T EFO-27 PIK3R1 phosphoinositide-3-kinase, chr5_67592109- NA Frameshift GAAGCNAGATG 0.55 regulatory subunit 1 (alpha) 67592110_GA_

CGOV6T EFO-27 PMS1 PMS1 postmeiotic segregation chr2_190670540- NA Frameshift GGTTTNAAAAA 0.38 increased 1 (S. cerevisiae) 190670540_A_

CGOV6T EFO-27 POU3F4 POU class 3 homeobox 4 chrX_82763990- 220G>C Nonsynonymous CGCTGNGCACA 0.33

82763990_G_T coding

CGOV6T EFO-27 PTEN phosphatase and tensin homolog chr10_89717770- NA Frameshift ATGCTNAAAAA 0.85

89717770_A_

CGOV6T EFO-27 RAB17 RAB17, member RAS oncogene chr2_238485934- 134T>M Nonsynonymous GGTCCNTCTTG 0.31 family 238485934_G_A coding

CGOV6T EFO-27 RD3 retinal degeneration 3 chr1_211652487- 160S>L Nonsynonymous AGGGCNAGATG 0.42

211652487_G_A coding

CGOV6T EFO-27 RFX2 regulatory factor X, 2 (influences chr19_6004288- 475R>H Nonsynonymous AGTTANGGATG 0.57

HLA class II expression) 6004288_C_T coding

CGOV6T EFO-27 RFX5 regulatory factor X, 5 (influences chr1_151315500- 338R>H Nonsynonymous GTGAGNGAGGG 0.32

HLA class II expression) 151315500_C_T coding

CGOV6T EFO-27 ROB02 roundabout, axon guidance receptor, chr3_77666779- 1137V>M Nonsynonymous GAGGCNTGGCT 0.58 homolog 2 (Drosophila) 77666779_G_A coding

CGOV6T EFO-27 SEMA3D sema domain, immunoglobulin chr7_84628871- 740R>Q Nonsynonymous GTCTCNGCTTC 0.43 domain (Ig), short basic domain, 84628871 _C_T coding

secreted, (semaphorin) 3D

CGOV6T EFO-27 SLC7A14 solute carrier family 7 (orphan chr3_170198432- 547R>W Nonsynonymous CAGCCNGATTC 0.44 transporter), member 14 170198432_G_A coding

CGOV6T EFO-27 SMAD4 SMAD family member 4 chr18_48591978- NA Splice site donor CAAGGNATTGA 0.47

48591978_T_C

CGOV6T EFO-27 TP53 tumor protein p53 chr17_7577121- 273R>C Nonsynonymous AACACNCACCT 0.46

7577121_G_A coding

CGOV6T EFO-27 USH2A Usher syndrome 2A (autosomal chr1_216051107- 2892L>I Nonsynonymous GCTAANACCCT 0.60 recessive, mild) 216051107_G_T coding

CGOV6T EFO-27 VPS13A vacuolar protein sorting 13 homolog chr9_79836219- NA Frameshift TGTATNAAAAA 0.59

A (S. cerevisiae) 79836219_A_

CGOV7T ES-2 BRAF v-raf murine sarcoma viral oncogene chr7_140453136- 600V>E Nonsynonymous ATTTCNCTGTA 0.32 homolog B1 140453136_A_T coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CGOV7T ES-2 CYP11A1 cytochrome P4S0, family 11 , chr15_74635368- 314E>K Nonsynonymous GTCCTNGAAGG 0.36 subfamily A, polypeptide 1 74635368_C_T coding

CGOV7T ES-2 FANCD2 Fanconi anemia, complementation chr3_10115050- NA Splice site donor AGGTANTGGAA 0.14 group D2 10115050_T_C

CGOV7T ES-2 FANCM Fanconi anemia, complementation chr14_45645784- 1276S>L Nonsynonymous TGTTTNGAATC 0.69 group M 45645784_C_T coding

CGOV7T ES-2 FASTKD2 FAST kinase domains 2 chr2_207632019- 201 R>H Nonsynonymous GAAGCNCTTTG 0.15

207632019_G_A coding

CGOV7T ES-2 GRM8 glutamate receptor, metabotropic 8 chr7_126173490- 649S>F Nonsynonymous GGAAGNAGCAT 0.64

126173490_G_A coding

CGOV7T ES-2 HOXD12 homeobox D12 chr2_176964759- 77L>P Nonsynonymous CTACCNGGCTG 0.39

176964759_T_C coding

CGOV7T ES-2 HYDIN HYDIN, axonemal central pair chr16_71163675- NA Frameshift TCTTCNAAAAA 0.39 apparatus protein 71163675 _ A

CGOV7T ES-2 NRD1 nardilysin (N-arginine dibasic chr1_52306066- 154E>D Nonsynonymous TCATCNTCTTC 0.11 convertase) 52306066_T_A coding

CGOV7T ES-2 POLM polymerase (DNA directed), mu chr7_44120423- NA Frameshift GGGTGNAACCC 0.54

44120423_C_

CGOV7T ES-2 TEX14 testis expressed 14 chr17_56676845- 621 E>K Nonsynonymous GATTTNGAAAC 0.69

56676845_C_T coding

CGOV7T ES-2 TPS3 tumor protein p53 chr17_7577559- 241S>F Nonsynonymous TGCAGNAACTG 1.00

7577559_G_A coding

CGOV7T ES-2 TRRAP transformation/transcription chr7_98591358- 3306 E>K Nonsynonymous ATGAANAGGTA 0.24 domain-associated protein 985913S8_G_A coding

CGOV8T HEY ANKRD40 ankyrin repeat domain 40 chr17_48777241- 99D>E Nonsynonymous TCATCNTCTTC 0.75

48777241 _A_T coding

CGOV8T HEY ARMC4 armadillo repeat containing 4 chr10_28257853- 413R>G Nonsynonymous ATACCNAAGTA 0.40

28257853_G_C coding

CGOV8T HEY BRAF v-raf murine sarcoma viral oncogene chr7_140481417- 464G>E Nonsynonymous CAGATNCAATT 1.00 homolog B1 140481417_C_T coding

CGOV8T HEY KRAS v-Ki-ras2 Kirsten rat sarcoma viral chr12_25398284- 12G>D Nonsynonymous CGCCANCAGCT 0.59 oncogene homolog 2S398284_C_T coding

CGOV8T HEY STARD10 StAR-related lipid transfer (START) chr11 72470294- 114V>M Nonsynonymous GCCCANGTCAG 0.59 domain containing 10 72470294_C_T coding

CGOV8T HEY TP53BP1 tumor protein p53 binding protein 1 chr15_43713345- NA Frameshift GGCGTNCCTGT 0.57

43713345 _ C

CGOV92T JHOS-3 ACAT2 acetyl-CoA acetyltransferase 2 chr6_160199312- 341 K>N Nonsynonymous GAGAANGTAAA 1.00

160199312_G_T coding

CGOV92T JHOS-3 ADAM21 ADAM metallopeptidase domain 21 chr14_70924702- 162N>K Nonsynonymous ATAAANAGTAA 0.96

70924702_C_A coding

CGOV92T JHOS-3 CCDC141 coiled-coil domain containing 141 chr2_179720252- 961 M>T Nonsynonymous TTTCCNTTTTC 0.48

179720252_A_G coding

CGOV92T JHOS-3 CD96 CD96 molecule chr3_111304209- 280T>M Nonsynonymous CTCCANGGATG 0.51

111304209_C_T coding

CGOV92T JHOS-3 CPA4 carboxypeptidase A4 chr7_129962370- 374G>S Nonsynonymous ACAACNGCATC 1.00

129962370_G_A coding

CGOV92T JHOS-3 DCC deleted in colorectal carcinoma chr18_50976903- 1088G>D Nonsynonymous GCATGNCAGTG 1.00

50976903_G_A coding

CGOV92T JHOS-3 EXTL3 exostosin-like glycosyltransferase 3 chr8_28573652- 26R>C Nonsynonymous CCAACNGCATC 1.00

28S736S2_C_T coding

CGOV92T JHOS-3 FBX02 F-box protein 2 chr1_11708828- 272G>W Nonsynonymous CCCCCNGTGCT 0.28

11708828_C_A coding

CGOV92T JHOS-3 FNDC3B fibronectin type III domain chr3_172055122- 595P>A Nonsynonymous CAGATNCCCCT 0.37 containing 3B 172055122_C_G coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%) CCOV92T JHOS-3 IQCJ- IQCJ-SCHIP1 readthrough chr3_158980369- 63R>Q Nonsynonymous GCAGCNGCAGG 0.42

SCHIP1 158980369 G A coding

CGOV92T JHOS-3 LAIR1 leukocyte-associated chr19_54876393- 7A>T Nonsynonymous GAGGGNGGTGG 0.55 immunoglobulin-like receptor 1 54876393 C T coding

CGOV92T JHOS-3 MISP mitotic spindle positioning chr19_763549-763549_C_T 667R>C Nonsynonymous CAGAGNGCTGG 0.38 coding

CGOV92T JHOS-3 MMP12 matrix metallopeptidase 12 chr11_102742616- 139Q>H Nonsynonymous CATACNTGGAA 1.00

(macrophage elastase) 102742616 T A coding

CGOV92T JHOS-3 NCSTN nicastrin chr1_160323990- 421 P>L Nonsynonymous CCAGCNTCTCC 0.40

160323990_C_T coding

CGOV92T JHOS-3 OR6C6 olfactory receptor, family 6, chr12_55688322- 232R>T Nonsynonymous TGTTCNTTTGC 0.52 subfamily C, member 6 55688322 C G coding

CGOV92T JHOS-3 PIK3CG phosphatidylinositol-4,5- chr7_106508037- 11V>M Nonsynonymous CCGTGNTGCTG 0.46 bisphosphate 3-kinase, catalytic 106508037 G A coding

subunit gamma

CGOV92T JHOS-3 PPAPDC3 phosphatidic acid phosphatase type chr9_134183447- 197A>T Nonsynonymous GCCGCNCCGCC 0.43

2 domain containing 3 134183447_G_A coding

CGOV92T JHOS-3 RAD1 RAD1 homolog (S. pombe) chr5_34914880- 40A>T Nonsynonymous CGTGGNATGTT 0.50

34914880 C T coding

CGOV92T JHOS-3 RHBDF2 rhomboid 5 homolog 2 (Drosophila) chr17_74475975- 67A>S Nonsynonymous GTGTGNAGCCC 1.00

74475975_C_A coding

CGOV92T JHOS-3 RNF152 ring finger protein 152 chr18_59483479- 73P>L Nonsynonymous CCTCCNGGTCG 1.00

59483479 G A coding

CGOV92T JHOS-3 RNF175 ring finger protein 175 chr4_154649477- 95Y>H Nonsynonymous GAAATNTAAGG 1.00

154649477_A_G coding

CGOV92T JHOS-3 ROB02 roundabout, axon guidance receptor, chr3_77645847- 950P>A Nonsynonymous GCTTGNCAGTA 0.61 homolog 2 (Drosophila) 77645847 C G coding

CGOV92T JHOS-3 ROS1 c-ros oncogene 1 , receptor tyrosine chr6_117641091- 1960Y>X Nonsense CCTTCNTACAC 1.00 kinase 117641091_A_T

CGOV92T JHOS-3 RSBN1 round spermatid basic protein 1 chr1_114340451- 304L>H Nonsynonymous TATTANGTCCT 1.00

114340451 A T coding

CGOV92T JHOS-3 SLC4A10 solute carrier family 4, sodium chr2_162735758- 356V>I Nonsynonymous CAGCTNTATTG 0.45 bicarbonate transporter, member 10 162735758_G_A coding

CGOV92T JHOS-3 SON SON DNA binding protein chr21_34922649- 371 E>G Nonsynonymous GTTGGNGCTGC 0.52

34922649 A G coding

CGOV92T JHOS-3 TAS1 R2 taste receptor, type 1, member 2 chr1_19181014- 317R>P Nonsynonymous AGTGGNGCAGC 0.38

19181014_C_G coding

CGOV92T JHOS-3 TAS1 R2 taste receptor, type 1, member 2 chr1_19181095- 290R>H Nonsynonymous TCTGGNGCAGC 0.52

19181095 C T coding

CGOV92T JHOS-3 TENM1 teneurin transmembrane protein 1 chrXJ 23615650- 1294L>R Nonsynonymous AGGGANGGCAC 0.44

123615650 A C coding

CGOV92T JHOS-3 TP53 tumor protein p53 chr17_7577156- 783-1 G>T Splice site TACCANTACTC 1.00

7577156 C A acceptor

CGOV92T JHOS-3 USP34 ubiquitin specific peptidase 34 chr2_61575309- 661 M>L Nonsynonymous TGACANGCCTT 0.51

61575309 T G coding

CGOV92T JHOS-3 ZBTB7C zinc finger and BTB domain chr18_45555641- 617A>G Nonsynonymous TGTTGNCTTCG 1.00 containing 7C 45555641 G C coding

CGOV92T JHOS-3 ZIK1 zinc finger protein interacting with K chr19_58101690- 171 E>Q Nonsynonymous AATGGNAGGTT 0.55 protein 1 58101690_G_C coding

CGOV92T JHOS-3 ZNF229 zinc finger protein 229 chr19_44932857- 700R>H Nonsynonymous GGGTGNGAAGA 0.43

44932857 C T coding

CGOV92T JHOS-3 ZNF248 zinc finger protein 248 chr10_38126605- 60I>V Nonsynonymous CTCGANCTTAA 0.44

38126605 T C coding

Position of mutation indicated by 'N' Mutant

Gene CbioPortal Sequence tags

Lab ID Cell line symbol Gene description Nucleotide (genomic) nomenclature Consequence context (%)

CCOV92T JHOS-3 ZNF280A zinc finger protein 280A chr22_22868493- 488R>C Nonsynonymous TTCACNAGGGA 0.43

22868493_G_A coding

* Position of mutation indicated by 'N'

Table S7 Amplifications

Related to Figures 3B and 5 and Experimental Procedures. Each row in this table corresponds to a single amplicon identified by segmentation of the normalized read depth. As multiple amplicons within the same tumor may be derived from an amplification of a single target gene localized to different chromosomal regions, we examined the possibility that amplicons may be linked. The set of amplified genes that could be linked by rearranged read pairs comprise an amplicon group. Genes previously implicated in cancer are summarized to the level of the amplicon group. For a gene to be included in this table, the entire transcript must be inside the estimated boundaries of the amplicon.

Log\ Previously

L2\) implicated A plicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group CCOV16T OAW-42 chr17 73,535,001 73,768,001 233,001 1.47 MY015B, SMIM5, SMIM6, SAP30BP, ITGB4, RECQL5, NA 1

GALK1

CCOV17T OV-167 chr2 43,161 ,001 43,391 ,001 230,001 1.70 LOC102723854 NA 1

CCOV17T OV-167 chr2 58,679,001 58,714,001 35,001 1.64 NA NA 3

CCOV17T OV-167 chr2 64,133,001 64,263,001 130,001 1.60 NA NA 1

CCOV17T OV-167 chr2 64,411 ,001 64,656,001 245,001 1.63 LOC100507006, MIR4433A, LINC00309, MIR4433B NA 1

CCOV17T OV-167 chr2 86,027,001 86,209,001 182,001 1.72 LOC284950, ST3GAL5-AS1 , ST3GAL5 NA 4

CCOV17T OV-167 chr2 113,774,001 113,917,001 143,001 1.53 IL36RN, IL1 F10, IL1 RN, IL36B NA 5

CCOV17T OV-167 chr2 154,543,001 154,559,001 16,001 1.73 NA NA 6

CCOV17T OV-167 chr11 101 ,039,001 101 ,508,001 469,001 1.70 TRPC6, MIR3920 NA 1

CCOV17T OV-167 chr11 102,443,001 102,457,001 14,001 1.95 NA NA 1

CCOV17T OV-167 chr11 102,458,001 102,512,001 54,001 2.37 NA NA 1

CCOV17T OV-167 chr11 102,513,001 102,522,001 9,001 1.77 NA NA 1

CCOV17T OV-167 chr12 127,798,001 127,799,001 1,001 1.50 NA NA 2

CCOV17T OV-167 chr12 127,800,001 127,842,001 42,001 1.89 LOCI 01927616 NA 2

CCOV17T OV-167 chr12 127,843,001 127,982,001 139,001 1.53 NA NA 2

CCOV17T OV-167 chr18 889,001 3,693,001 2,804,001 2.07 ADCYAP1 , NDC80, SMCHD1 , EMILIN2, MYL12A, NA 1

MYL12B, TGIF1 , GAPLINC, DLGAP1 -AS1 , DLGAP1-AS2,

LINC00470, METTL4, CBX3P2, LPIN2, LOC727896,

MYOM1. LOC104968399

CGOV17T OV-167 chr18 3,701,001 7,965,001 4,264,001 2.06 DLGAP1-AS3, MIR6718, DLGAP1-AS4, DLGAP1-AS5, NA 1

LINC00667, MIR3976HG, MIR3976, L3MBTL4-AS1,

LINC01387, ARHGAP28, LOC101927188, LRRC30,

C18orf42, LINC00526, ZBTB14, EPB41 L3, TMEM200C,

L3MBTL4, MIR4317, LINC00668, LAMA1

CCOV17T OV-167 chr18 7,966,001 8,145,001 179,001 1.63 NA NA 1

CCOV17T OV-167 chr18 8,153,001 10,368,001 2,215,001 1.47 RAB12, MTCL1 , NDUFV2, ANKRD12, TWSG1 , RALBP1 , NA 1

PPP4R1-AS1, RAB31 , TXNDC2, VAPA, LOC100192426,

GACAT2, NDUFV2-AS1, PPP4R1

CGOV17T OV-167 chr18 10,369,001 10,990,001 621 ,001 1.76 APCDD1 , NAPG, LOC101927410, LINC01254, MIR6788 NA 1

CGOV17T OV-167 chr18 12,402,001 12,720,001 318,001 1.99 SLM01 , SPIRE1 , CEP76 NA 1

CGOV17T OV-167 chr18 12,721 ,001 13,012,001 291 ,001 2.33 SEH1 L, LOC100996324, PTPN2 NA 1

CGOV17T OV-167 chr18 13,013,001 13,273,001 260,001 1.93 NA NA 1

CGOV17T OV-167 chr18 13,274,001 13,717,001 443,001 1.65 LDLRAD4, MIR5190, MIR4526, LDLRAD4-AS1 NA 1

CGOV18T OV177 chr1 109,498,001 110,186,001 688,001 1.56 TMEM167B, SCARNA2, KIAA1324, SARS, CELSR2, MYC 1

SYPL2, ATXN7L2, CYB561 D1 , GPR61, GNAI3, MIR197,

AMPD2, WDR47, TAF13, C1 orf194, PSRC1 , MYBPHL,

SORT1, PSMA5, AMIG01, GNAT2 Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CC0V18T OV177 chr1 110,246,001 111 ,080,001 834,001 1.73 GSTM5, CSF1 , AHCYL1, STRIP1, LINC01397, UBL4B, MYC 1

SLC6A17, KCNC4, RBM15, LAMTOR5-AS1 , PROK1 ,

CYMP, GSTM3, EPS8L3, ALX3, KCNC4-AS1 , LOC440600,

SLC16A4, LAMTOR5, LOC440602, KCNA10

CGOV18T OV177 chr1 111 ,081,001 111 ,312,001 231 ,001 2.05 KCNA2, KCNA3 MYC 1

CGOV18T OV177 chr1 111 ,313,001 111 ,547,001 234,001 1.51 CD53, LRIF1 MYC 1

CGOV18T OV177 chr1 155,568,001 155,692,001 124,001 1.66 MST01, MST02P, YY1AP1 MYC 1

CGOV18T OV177 chr1 155,899,001 156,085,001 186,001 3.14 RXFP4, LAMTOR2, RAB25, ARHGEF2, MIR6738, SSR2, MYC 1

UBQLN4, MEX3A

CGOV18T OV177 chr1 156,086,001 156,122,001 36,001 2.80 LMNA MYC 1

CGOV18T OV177 chr1 156,123,001 156,225,001 102,001 1.99 SEMA4A, SLC25A44, PMF1, PMF1-BGLAP, BGLAP, MYC 1

PAQR6

CGOV18T OV177 chr1 156,589,001 156,649,001 60,001 1.64 HAPLN2, BCAN, NES MYC 1

CGOV18T OV177 chr1 202,911,001 203,176,001 265,001 1.49 TMEM183A, TMEM183B, PPFIA4, ADORA1 , CYB5R1 , MYC 1

LOC100506747, MYOG, MYBPH, CHI3L1

CGOV18T OV177 chr1 203,177,001 203,653,001 476,001 1.82 LINC01353, BTG2, PRELP, OPTC, CHIT1 , LINC01136, MYC 1

FMOD

CGOV18T OV177 chr1 209,386,001 210,077,001 691 ,001 1.70 MIR205HG, MIR205, CAMK1G, G0S2, HSD11 B1, MYC 1

TRAF3IP3, DIEXF, LAMB3, MIR4260, C1orf74, IRF6

CGOV18T OV177 chr1 210,086,001 212,789,001 2,703,001 1.71 SYT14, SERTAD4, HHAT, RCOR3, TRAF5, LINC00467, MYC 1

LOC105748977, DTL, MIR3122, PPP2R5A, SNORA16B,

NENF, LOC101929565, SERTAD4-AS1 , KCNH1 , RD3,

SLC30A1 , NEK2, LPGAT1 , INTS7, LOC101929541 ,

TMEM206

CC0V18T OV177 chr2 84,002,001 87,059,001 3,057,001 1.54 FUNDC2P2, DNAH6, TMSB10, KCMF1 , TCF7L1 , MYC 1

ELMOD3, SH2D6, MAT2A, VAMP8, VAMP5, RNF181,

USP39, GNLY, ATOH8, LOC284950, ST3GAL5-AS1 ,

PTCD3, SNORD94, MRPL35, KDM3A, RMND5A,

SUCLG1 , TRABD2A, TGOLN2, RETSAT, CAPG, PARTICL,

GGCX, TMEM150A, C2orf68, SFTPB, MIR6071,

ST3GAL5, LOC90784, POLR1A, IMMT, MIR4779, REEP1 ,

CHMP3, RNF103-CHMP3, RNF103, CD8A

CGOV18T OV177 chr3 169,138,001 169,575,001 437,001 2.05 MYNN, LRRIQ4, TERC, ACTRT3, LRRC34 MYC 1

CGOV18T OV177 chr7 29,016,001 29,097,001 81,001 2.75 LOC100506497 MYC 1

CGOV18T OV177 chr7 29,098,001 29,267,001 169,001 2.18 LOC101928168, LOC102724484 MYC 1

CGOV18T OV177 chr7 29,268,001 30,554,001 1,286,001 1.58 CHN2, PRR15, DPY19L2P3, WIPF3, PLEKHA8, MTURN, MYC 1

ZNRF2, MIR550A1, DKFZP586I1420, LINC01176,

LOC646762, MIR550A3, ZNRF2P2, SCRN1 , FKBP14,

MIR550B1 , NOD1 , GGCT

CC0V18T OV177 chr7 30,555,001 30,576,001 21,001 2.07 NA MYC 1 CC0V18T OV177 chr7 30,584,001 31,111 ,001 527,001 1.54 GARS, INMT, INMT-FAM188B, FAM188B, AQP1 , GHRHR, MYC 1

LOC401320, CRHR2

CC0V18T OV177 chr7 31,112,001 31,123,001 11,001 2.39 NA MYC 1 CC0V18T OV177 chr7 31,124,001 31,150,001 26,001 2.16 NA MYC 1 CC0V18T OV177 chr7 31,151 ,001 31,307,001 156,001 1.75 NA MYC 1 CC0V18T OV177 chr8 128,627,001 128,912,001 285,001 1.86 MYC, MIR1204, CASC11 MYC 1 CC0V18T OV177 chr10 11,432,001 12,075,001 643,001 1.54 ECHDC3, PROSER2, USP6NL, PROSER2-AS1 MYC 1 CC0V18T OV177 chr11 66,399,001 66,922,001 523,001 1.59 RBM4, C11 orf80, RCE1 , LRFN4, C11 orf86, SYT12, MYC 1

MIR6860, RHOD, RBM4B, SPTBN2, PC, MIR3163

CC0V18T OV177 chr16 70,232,001 70,728,001 496,001 1.55 DDX19B, DDX19A, FUK, SF3B3, SNORD111 B, MYC 1

SNORD111 , IL34, SMG1 P7, EXOSC6, AARS,

LOC100506083, ST3GAL2, COG4, MTSS1 L

CGOV18T OV177 chr18 23,265,001 23,517,001 252,001 1.69 NA MYC 1

CGOV18T OV177 chr18 23,518,001 24,217,001 699,001 1.99 PSMA8, TAF4B, LINC01543, SS18, KCTD1 , MIR8057 MYC 1 Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CCOV18T OV177 chr18 24,218,001 24,631 ,001 413,001 2.34 AQP4-AS1 , PCAT18, AQP4 MYC 1

CCOV18T OV177 chr18 24,632,001 24,839,001 207,001 1.98 NA MYC 1

CCOV18T OV177 chr18 25,339,001 26,915,001 1,576,001 2.21 CDH2 MYC 1

CCOV18T OV177 chr18 26,916,001 27,459,001 543,001 1.87 NA MYC 1

CCOV18T OV177 chr20 44,799,001 45,067,001 268,001 2.05 CDH22, SLC35C2, ELM02 MYC 1

CCOV18T OV177 chr20 45,068,001 45,644,001 576,001 2.47 SLC2A10, ZNF663P, MKRN7P, ZNF334, OCSTAMP, MYC 1

SLC13A3, TP53RK

CCOV18T OV177 chr20 48,700,001 48,778,001 78,001 1.50 UBE2V1, TMEM189 NA 2

CCOV18T OV177 chr20 48,779,001 48,890,001 111 ,001 1.90 LINC01273, CEBPB, CEBPB-AS1 NA 2

CCOV18T OV177 chr20 48,891 ,001 48,964,001 73,001 1.61 LINC01270, LINC01271 NA 2

CCOV18T OV177 chr20 51,439,001 52,472,001 1,033,001 1.65 TSHZ2, LOC101927770, ZNF217 MYC 1

CCOV18T OV177 chr20 52,485,001 52,646,001 161 ,001 1.79 SUM01 P1 MYC 1

CCOV18T OV177 chr20 52,658,001 52,848,001 190,001 1.85 PFDN4, MIR4756, CYP24A1 MYC 1

CCOV18T OV177 chr20 52,849,001 53,380,001 531 ,001 1.52 DOK5 MYC 1

CCOV18T OV177 chr20 59,819,001 60,213,001 394,001 1.82 NA NA 3

CCOV21T OV-90 chr7 105,083,001 108,666,001 3,583,001 1.49 RINT1, CDHR3, PIK3CG, PRKAR2B, HBP1, GPR22, NA 1

DUS4L, BCAP29, SLC26A4, CBLL1 , DLD, DNAJB9, PUS7,

EFCAB10, ATXN7L1 , SYPL1 , NAMPT, CCDC71 L, COG5,

SLC26A4-AS1 , SLC26A3, LAMB1 , LAMB4, NRCAM,

PNPLA8, THAP5, C7orf66

CCOV21T OV-90 chr18 19,504,001 19,505,001 1,001 1.65 NA NA 1

CCOV21T OV-90 chr18 19,506,001 20,448,001 942,001 2.40 GATA6, GATA6-AS1 , CTAGE1 , LOC101927571 NA 1

CCOV21T OV-90 chr18 20,449,001 21,669,001 1,220,001 1.50 RBBP8, MIR4741 , CABLES1, RIOK3, C18orf8, LAMA3, NA 1

TTC39C, TMEM241, NPC1, ANKRD29, TTC39C-AS1

CCOV21T OV-90 chr18 25,242,001 25,402,001 160,001 1.93 NA NA 1

CCOV21T OV-90 chr18 25,403,001 25,566,001 163,001 2.21 NA NA 1

CCOV21T OV-90 chr22 20,740,001 20,808,001 68,001 5.69 ZNF74, SCARF2 NA 1

CCOV21T OV-90 chr22 20,843,001 20,901 ,001 58,001 5.69 NA NA 1

CCOV21T OV-90 chr22 20,902,001 21,417,001 515,001 4.40 POM121 L4P, TMEM191A, SERPIND1 , SNAP29, CRKL, NA 1

LOC101928891 , AIFM3, LZTR1 , THAP7-AS1 , P2RX6,

PI4KA, THAP7, TUBA3FP, SLC7A4, MIR649, P2RX6P

CCOV21T OV-90 chr22 21,418,001 21,919,001 501 ,001 5.08 BCRP2, FAM230B, POM121 L8P, RIMBP3C, RIMBP3B, NA 1

HIC2, TMEM191 C, PI4KAP2

CCOV23T OVCA-429 chr3 102,447,001 104,763,001 2,316,001 2.16 MIR548AB, MIR548A3 NA 1

CCOV23T OVCA-429 chr3 104,764,001 105,383,001 619,001 1.89 ALCAM NA 1

CCOV23T OVCA-429 chr3 105,589,001 107,112,001 1,523,001 1.58 LINC00883, CCDC54, LINC00882, LOC101929579 NA 1

CCOV23T OVCA-429 chr3 114,817,001 115,954,001 1,137,001 2.42 ZBTB20-AS4, GAP43 NA 1

CCOV23T OVCA-429 chr3 115,955,001 116,231,001 276,001 2.01 LSAMP-AS1 NA 1

CCOV23T OVCA-429 chr3 178,259,001 178,294,001 35,001 1.50 NA NA 2

CCOV23T OVCA-429 chr3 178,300,001 178,474,001 174,001 1.53 NA NA 2

CCOV2ST OVCAR-3 chr1 206,248,001 206,281,001 33,001 1.49 NA NA 2

CCOV2ST OVCAR-3 chr3 107,591,001 110,716,001 3,125,001 1.60 LINC00636, LINC01215, HHLA2, DZIP3, TRAT1 , AKT2 1

FLJ22763, LINC00488, LINC01205, MIR4445, CD47,

IFT57, MYH15, KIAA1524, RETNLB, GUCA1C, MORC1,

DPPA2, DPPA4

CCOV2ST OVCAR-3 chr3 122,040,001 122,108,001 68,001 1.94 CSTA, CCDC58 AKT2 1

CCOV2ST OVCAR-3 chr3 122,109,001 122,369,001 260,001 2.33 LOC102723582, DTX3L, PARP15, WDR5B, KPNA1, AKT2 1

PARP9

CGOV25T OVCAR-3 chr3 122,370,001 122,728,001 358,001 1.92 PARP14, DIRC2, LOC100129550, HSPBAP1, SEMA5B AKT2 1 Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV25T OVCAR-3 chr3 124,065,001 125,086,001 1,021,001 1.52 MIR6083, KALRN, UMPS, MIR544B, ITGB5, MUC13, AKT2 1

HEG1, SLC12A8, MIR5092

CGOV25T OVCAR-3 chr3 133,717,001 134,158,001 441 ,001 1.90 MIR4788, RYK, AMOTL2, MIR6827 AKT2 1

CGOV25T OVCAR-3 chr3 154,014,001 154,943,001 929,001 1.80 MME, GPR149 AKT2 1

CGOV25T OVCAR-3 chr3 154,944,001 155,436,001 492,001 2.86 LINC01487, LOC100507537, PLCH1 AKT2 1

CGOV25T OVCAR-3 chr3 155,437,001 156,305,001 868,001 2.46 GMPS, KCNAB1 , C3orf33, SLC33A1, KCNAB1-AS2, AKT2 1

KCNAB1 -AS1 , SSR3

CGOV25T OVCAR-3 chr3 156,306,001 156,532,001 226,001 2.09 TIPARP, TIPARP-AS1, PA2G4P4 AKT2 1

CGOV25T OVCAR-3 chr3 156,533,001 156,854,001 321 ,001 1.79 LEKR1 , LINC00881 , LINC00880 AKT2 1

CGOV25T OVCAR-3 chr3 168,798,001 169,084,001 286,001 1.49 MECOM NA 3

CGOV25T OVCAR-3 chr3 177,221,001 177,462,001 241 ,001 1.53 NA NA 4

CGOV25T OVCAR-3 chr11 75,339,001 75,554,001 215,001 1.52 MOGAT2, DGAT2, LOC283214 AKT2 1

CGOV25T OVCAR-3 chr11 75,555,001 76,191 ,001 636,001 2.49 LOC100506127, WNT11 , PRKRIR AKT2 1

CGOV25T OVCAR-3 chr11 76,197,001 76,362,001 165,001 2.63 NA AKT2 1

CGOV25T OVCAR-3 chr11 76,363,001 77,045,001 682,001 3.04 TSKU, ACER3, B3GNT6, CAPN5, OMP, MY07A, LRRC32, AKT2 1

GUCY2EP, LOC101928837, GDPD4

CGOV25T OVCAR-3 chr11 77,046,001 77,103,001 57,001 3.31 NA AKT2 1

CGOV25T OVCAR-3 chr11 77,104,001 77,809,001 705,001 3.02 LOC646029, AQP11 , AAMDC, THRSP, CLNS1 A, RSF1 , AKT2 1

INTS4, KCTD14, NDUFC2-KCTD14, NDUFC2

CGOV25T OVCAR-3 chr11 77,828,001 77,925,001 97,001 3.13 KCTD21 -AS1 , KCTD21 AKT2 1

CGOV25T OVCAR-3 chr11 77,926,001 77,935,001 9,001 3.65 NA AKT2 1

CGOV25T OVCAR-3 chr11 77,936,001 77,946,001 10,001 3.91 NA AKT2 1

CGOV25T OVCAR-3 chr11 77,947,001 77,956,001 9,001 4.23 NA AKT2 1

CGOV25T OVCAR-3 chr11 77,957,001 78,073,001 116,001 3.20 NA AKT2 1

CGOV25T OVCAR-3 chr11 78,074,001 78,105,001 31,001 2.11 NA AKT2 1

CGOV25T OVCAR-3 chr12 26,333,001 27,186,001 853,001 1.75 SSPN, FGFR1 OP2, MED21 , ITPR2, ASUN, TM7SF3 AKT2 1

CGOV25T OVCAR-3 chr12 27,395,001 27,929,001 534,001 1.51 STK38L, ARNTL2, SMC02, PPFIBP1, REP15, MRPS35, AKT2 1

ARNTL2-AS1, MANSC4

CGOV25T OVCAR-3 chr19 29,756,001 29,811 ,001 55,001 2.92 NA AKT2 1

CGOV25T OVCAR-3 chr19 29,812,001 30,259,001 447,001 2.41 VSTM2B, POP4, PLEKHF1 , C19orf12 AKT2 1

CGOV25T OVCAR-3 chr19 30,444,001 30,652,001 208,001 2.01 NA AKT2 1

CGOV25T OVCAR-3 chr19 39,140,001 39,765,001 625,001 1.54 LGALS7B, NFKBIB, MRPS12, PAPL, PAK4, NCCRP1, AKT2 1

IFNL2, CAPN12, LGALS7, LGALS4, ECH1, HNRNPL, RINL,

SIRT2, CCER2, SARS2, FBX017, FBX027, SYCN, IFNL3,

IFNL4

CCOV2ST OVCAR-3 chr19 39,798,001 40,657,001 859,001 2.98 SAMD4B, MED29, ZFP36, PLEKHG2, SUPT5H, TIMM50, AKT2 1

DLL3, SELV, LGALS13, LOC100129935, LGALS16,

LGALS17 A, LGALS14, LEUTX, PSMC4, ZNF546, GMFG,

PAF1, MIR4530, RPS16, EID2B, EID2, CLC, DYRK1 B,

MIR6719, FBL, FCGBP, ZNF780B, ZNF780A

CGOV25T OVCAR-3 chr19 40,658,001 40,966,001 308,001 2.66 MAP3K10, PLD3, MIR6796, TTC9B, CNTD2, AKT2, AKT2 1

MIR641 , C19orf47, HIPK4, PRX, SERTAD1 , SERTAD3

CGOV25T OVCAR-3 chr19 54,030,001 54,276,001 246,001 2.54 ZNF331 , DPRX, MIR512-2, MIR512-1, MIR1323, MIR498, AKT2 1

MIR520E, MIR515-1, MIR515-2, MIR519E, MIR520F,

MIR519C, MIR1283-1, MIR520A, MIR526B, MIR519B,

MIR525, MIR523, MIR518F, MIR520B, MIR518B,

MIR526A1, MIR520C, MIR518C, MIR524, MIR517A,

MIR519D, MIR521-2, MIR520D, MIR517B, MIR520G,

MIR516B2, MIR526A2, MIR518E, MIR518A1, MIR518D,

MIR516B1 , MIR518A2, MIR517C, MIR520H, MIR521-1,

MIR522, MIR519A1, MIR527, MIR516A1, MIR1283-2,

MIR516A2, MIR519A2, LOC284379 Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV2ST OVCAR-3 chrX 49,511 ,001 50,143,001 632,001 1.58 PAGE4, USP27X, CLCN5, MIR532, MIR188, MIR500A, AKT2 1

MIR362, MIR501, MIR500B, MIR660, MIR502, CCNB3,

USP27X-AS1 , AKAP4

CGOV28T OVKATE chr1 147,389,001 147,730,001 341 ,001 1.50 GPR89B, PDZK1 P1, NBPF11, LOC101927468 NA 1

CGOV28T OVKATE chr9 107,832,001 108,899,001 1,067,001 1.58 SLC44A1 , FSD1 L, FKTN, TAL2, TMEM38B NA 2

CGOV30T OVSAHO chr1 244,059,001 244,669,001 610,001 1.49 LOC339529, ZBTB18, C1orf100, ADSS FGFR4, 1

SMO

CGOV30T OVSAHO chr2 139,606,001 139,635,001 29,001 1.48 NA FGFR4, 1

SMO

CGOV30T OVSAHO chr2 139,699,001 139,902,001 203,001 1.68 NA FGFR4, 1

SMO

CGOV30T OVSAHO chr3 124,290,001 124,665,001 375,001 1.51 KALRN, UMPS, MIR544B, ITGB5, MUC13 FGFR4, 1

SMO

CGOV30T OVSAHO chr3 124,666,001 125,086,001 420,001 1.79 HEG1, SLC12A8, MIR5092 FGFR4, 1

SMO

CGOV30T OVSAHO chr5 176,024,001 176,745,001 721 ,001 1.62 EIF4E1 B, TSPAN17, LINC01574, UNCSA, ZNF346, FGFR4, 1

FGFR4, NSD1 , PRELID1 , SNCB, MIR4281 , HK3, UIMC1 , SMO

RAB24, MXD3

CGOV30T OVSAHO chr6 46,356,001 46,928,001 572,001 1.71 LOC101926898, SLC25A27, TDRD6, ANKRD66, MEP1 A, FGFR4, 1

LOC101926962, CYP39A1 , PLA2G7, ADGRFS SMO

CGOV30T OVSAHO chr7 87,473,001 87,683,001 210,001 1.53 DBF4 NA 2

CGOV30T OVSAHO chr7 123,572,001 123,880,001 308,001 1.68 TMEM229A NA 3

CGOV30T OVSAHO chr7 128,312,001 134,004,001 5,692,001 1.53 FAM71 F2, FAM71 F1 , CALU, CCDC136, FLNC, ATP6V1 F, FGFR4, 1

LOC100130705, IRF5, TPI1 P2, LOC407835, TSPAN33, SMO

SMO, AHCYL2, STRIP2, SMKR1 , NRF1, KLHDC10,

SSMEM1 , CPA2, CPA4, CPAS, CPA1 , MEST, MIR335,

LOC100506860, MKLN1, LOC101928782, FLJ40288,

EXOC4, MIR6133, LRGUK, OPN1SW, KCP, TNP03,

MIR182, MIR96, MIR183, UBE2H, ZC3HC1 , TMEM209,

CEP41 , MESTIT1 , COPG2, TSGA13, KLF14, MIR29A,

MIR29B1, LINC-PINT, MKLN1-AS, PODXL, PLXNA4,

CHCHD3, MIR36S4, LOC101928861, SLC3SB4

CGOV30T OVSAHO chr7 143,438,001 143,548,001 110,001 1.84 TCAF2P1 , CTAGE6, LOC154761 NA 4 CGOV30T OVSAHO chr8 146,097,001 146,301,001 204,001 1.48 TMED10P1 , ZNF252P-AS1 , C8orf33, ZNF250, ZNF16, NA 5

ZNF252P

CGOV30T OVSAHO chr10 76,146,001 78,273,001 2,127,001 1.69 KAT6B, SAMD8, VDAC2, ZNF503-AS1 , ZNF503-AS2, FGFR4, 1

LOC101929234, MIR606, LOC102723439, DUPD1 , SMO

DUSP13, COMTD1 , ZNF503

WO 2020/081549 LogX PCT/US2019/056299

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV30T OVSAHO chr19 18,586,001 21,745,001 3,159,001 1.60 KXD1, UBA52, C19orf60, TMEM59L, KLHL26, CRTC1, FGFR4, 1

UPF1 , DDX49, ARMC6, SLC25A42, RFXANK, NCAN, SMO

MAU2, GATAD2A, MIR640, NDUFA13, YJEFN3, CILP2,

ZNF101 , ZNF253, ZNF93, ZNF90, ZNF486, ZNF85,

ZNF430, ZNF714, ZNF431 , ZNF738, ZNF493,

LINC00664, ZNF429, FKBP8, CRLF1 , COMP, GDF1 ,

CERS1 , COPE, HOMER3, SUGP2, TMEM161A, MEF2B,

MEF2BNB-MEF2B, BORCS8, NR2C2AP, HAPLN4,

TM6SF2, SUGP1 , TSSK6, PBX4, LPAR2, GMIP, ATP13A1 ,

ZNF14, LINC00663, ZNF506, ZNF682, MIR1270,

ZNF826P, ZNF737, ZNF626, ZNF708

CGOV30T OVSAHO chr20 26,248,001 26,369,568 121 ,568 1.48 NA NA 7

CGOV30T OVSAHO chr20 30,371 ,001 30,829,001 458,001 1.54 MYLK2, TTLL9, XKR7, MIR7641-2, CCM2L, HCK, FGFR4, 1

TM9SF4, POFUT1 , MIR1825, FOXS1 , DUSP15, PDRG1, SMO

TSPY26P, PLAGL2

CGOV30T OVSAHO chr20 32,535,001 32,767,001 232,001 1.47 RALY, MIR4755, RALY-AS1, EIF2S2 FGFR4, 1

SMO

CGOV30T OVSAHO chr20 32,768,001 33,625,001 857,001 1.72 ASIP, ITCH, MIR644A, DYNLRB1, MAPI LC3A, TP53INP2, FGFR4, 1

ACSS2, MYH7B, MIR499A, AHCY, PIGU, NCOA6, SMO

HMGB3P1 , GGT7, GSS, MIR499B

CGOV30T OVSAHO chr20 33,626,001 34,155,001 529,001 1.93 PROCR, MMP24, FAM83C-AS1, CEP250, ERGIC3, FGFR4, 1

EDEM2, MMP24-AS1 , EIF6, FAM83C, UQCC1, GDF5, SMO

MIR1289-1, C20orf173

CGOV30T OVSAHO chr20 34,156,001 34,320,001 164,001 1.71 SPAG4, ROM01, CPNE1, RBM12, NFS1 FGFR4, 1

SMO

CGOV30T OVSAHO chr20 41,298,001 42,573,001 1,275,001 1.52 LOCI 01927159, SRSF6, L3MBTL1 , SGK2, IFT52, MYBL2, FGFR4, 1

GTSF1 L SMO

CGOV30T OVSAHO chr20 48,125,001 48,800,001 675,001 1.86 SLC9A8, RNF114, SNAI1 , LINC01273, B4GALT5, SPATA2, FGFR4, 1

TRERNA1 , UBE2V1 , TMEM189-UBE2V1 , TMEM189 SMO

CGOV30T OVSAHO chr20 48,801 ,001 49,059,001 258,001 2.20 CEBPB, LINC01272, LINC01270, CEBPB-AS1 , LINC01271 FGFR4, 1

SMO

CGOV30T OVSAHO chr20 49,060,001 49,280,001 220,001 1.83 PTPN1, MIR645, LOC100506175, FAM65C, MIR1302-5 FGFR4, 1

SMO

CGOV30T OVSAHO chr20 55,290,001 55,580,001 290,001 1.51 NA NA 9

CGOV32T PEO-14 chr1 94,024,001 94,294,001 270,001 1.97 LOC100129046, BCAR3 NA 1

CGOV32T PEO-14 chr1 94,295,001 94,396,001 101 ,001 1.70 MIR760, DNTTIP2, GCLM NA 1

CGOV32T PEO-14 chr1 99,839,001 100,490,001 651 ,001 1.50 PALMD, MIR548AA1, AGL, LOC101928270, MIR548D1, NA 4

FRRS1

CGOV32T PEO-14 chr1 114,874,001 115,467,001 593,001 1.77 TRIM33, BCAS2, DENND2C, AMPD1 , NRAS, CSDE1 , NRAS 2

SIKE1

CGOV32T PEO-14 chr1 150,441,001 151 ,041,001 600,001 1.84 TARS2, MIR6878, ECM1 , FALEC, ADAMTSL4, MIR4257, NRAS 2

SETDB1 , ANXA9, PRUNE, BNIPL, C1orfS6, MLLT11,

ADAMTSL4-AS1 , MCL1 , ENSA, GOLPH3L, HORMAD1 ,

CTSS, CTSK, ARNT, CERS2, FAM63A, CDC42SE1

Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CCOV32T PEO-14 chr6 11,341 ,001 11,693,001 352,001 1.53 TMEM170B NA 6 CCOV32T PEO-14 chr8 129,420,001 129,611,001 191 ,001 1.60 LINC00824 NA 7 CCOV32T PEO-14 chr14 61,508,001 61,652,001 144,001 1.51 NA NA 8 CCOV32T PEO-14 chr17 41,443,001 41,605,001 162,001 1.95 ARL4D, MIR2117, DHX8, LINC00910 NA 9 CCOV32T PEO-14 chr20 30,147,001 30,969,001 822,001 2.28 ID1 , MIR3193, COX4I2, ABALON, TPX2, MYLK2, TTLL9, ASXL1 3

XKR7, MIR7641-2, CCM2L, HCK, TM9SF4, POFUT1,

MIR1825, KIF3B, ASXL1 , HM13-AS1 , BCL2L1 , FOXS1 ,

DUSP15, PDRG1, TSPY26P, PLAGL2

CGOV32T PEO-14 chr20 30,970,001 31,112,001 142,001 2.71 LOC101929698, NOL4L ASXL1 3

CGOV32T PEO-14 chr20 31,113,001 31,274,001 161 ,001 1.60 LOC149950, C20orf203 ASXL1 3

CGOV32T PEO-14 chr20 37,146,001 37,696,001 550,001 1.65 ADIG, ARHGAP40, SLC32A1 , ACTR5, PPP1 R16B, NA 10

FAM83D, DHX35

CGOV32T PEO-14 chr20 46,476,001 49,880,001 3,404,001 1.61 LINC01523, LINC00494, ARFGEF2, CSE1 L, DDX27, NRAS 2

ZFAS1 , SNORD12C, SNORD12B, SNORD12, SLC9A8,

RNF114, SNAI1, LINC01273, CEBPB, LINC01272,

LINC01270, PTPN1, MIR645, LOC100506175, PARD6B,

BCAS4, ADNP-AS1, MOCS3, LINC01522, PREX1 , CSE1 L- AS1, STAU1 , ZNFX1, KCNB1 , PTGIS, B4GALT5, SPATA2,

TRERNA1 , UBE2V1 , TMEM189-UBE2V1 , TMEM189,

CEBPB-AS1 , LINC01271, FAM65C, MIR1302-5, ADNP,

DPMI, KCNG1

CCOV32T PEO-14 chr20 49,881 ,001 49,997,001 116,001 2.03 NA NRAS 2 CCOV32T PEO-14 chr20 49,998,001 50,271 ,001 273,001 1.50 NFATC2, MIR3194 NRAS 2 CCOV34T PEO-6 chr4 69,001 569,001 500,001 2.25 ZNF718, ZNF876P, ZNF141 , MIR571 , PIGG, ZNF732, NA 2

ABCA11 P, ZNF721

CCOV34T PEO-6 chr8 137,001,001 137,159,001 158,001 1.54 NA NA 1 CCOV34T PEO-6 chr8 137,164,001 138,509,001 1,345,001 1.47 LOC101927915 NA 1 CCOV44T FU-OV-1 chr3 195,413,001 196,336,001 923,001 1.83 LINC00969, MIR570, MUC20, LINC00885, SLC51A, FGFR4, 1

TM4SF19-AS1 , FBX045, MUC4. TNK2, MIR6829, MYC,

SDHAP1, TFRC, ZDHHC19, PCYT1A, TCTEX1 D2, H3F3B,

TM4SF19-TCTEX1 D2, TM4SF19, UBXN7, RNF168, CCNE1

SMC01, WDR53

CGOV44T FU-OV-1 chr5 176,034,001 177,025,001 991 ,001 1.73 EIF4E1 B, TSPAN17, LINC01574, UNC5A, ZNF346, FGFR4, 1

FGFR4, NSD1 , PRELID1, RGS14, SLC34A1 , GRK6, PRR7, MYC,

TMED9, SNCB, MIR4281 , HK3, UIMC1 , RAB24, MXD3, H3F3B,

LMAN2, PFN3, F12, PRR7-AS1 , DBN1, PDLIM7, DOK3, CCNE1

DDX41 , FAM193B

CCOV44T FU-OV-1 chr8 128,692,001 129,163,001 471 ,001 1.90 MYC, MIR1204, PVT1, MIR1205, MIR1206, MIR1207, FGFR4, 1

MIR1208, CASC11 , TMEM75 MYC,

H3F3B,

CCNE1

CGOV44T FU-OV-1 chr8 129,164,001 129,322,001 158,001 2.25 NA FGFR4, 1

MYC,

H3F3B,

CCNE1

Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV44T FU-OV-1 chr17 73,418,001 74,069,001 651 ,001 2.08 KIAA0195, MIR6785, TSEN54, LLGL2, MY015B, SMIM5, FGFR4, 1

SMIM6, SAP30BP, ITGB4, UNK, TEN1 , TEN1 -CDK3, MYC,

CDK3, MIR4538, CASKIN2, RECQL5, GALK1 , H3F3B, H3F3B,

MIR4738, UNC13D, WBP2, TRIM47, TRIM65, MRPL38, CCNE1

FBF1 , ACOX1 , EVPL, SRP68

CCOV44T FU-OV-1 chr19 28,263,001 29,723,001 1,460,001 2.35 LOC101927151 , LINC00906, LOC102724958, FGFR4, 1

LINC01532, LINC00662, LOC100420587, UQCRFS1 MYC,

H3F3B,

CCNE1

CCOV44T FU-OV-1 chr19 29,747,001 29,814,001 67,001 2.69 NA FGFR4, 1

MYC,

H3F3B,

CCNE1

CCOV44T FU-OV-1 chr19 29,815,001 30,615,001 800,001 3.39 VSTM2B, POP4, PLEKHF1 , CCNE1, URI1 , C19orf12 FGFR4, 1

MYC,

H3F3B,

CCNE1

CCOV44T FU-OV-1 chr19 30,635,001 30,816,001 181 ,001 2.77 NA FGFR4, 1

MYC,

H3F3B,

CCNE1

CCOV44T FU-OV-1 chr19 30,817,001 30,845,001 28,001 2.23 NA FGFR4, 1

MYC,

H3F3B,

CCNE1

CCOV44T FU-OV-1 chr19 39,139,001 39,785,001 646,001 1.73 LGALS7B, NFKBIB, MRPS12, PAPL, PAK4, NCCRP1, FGFR4, 1

IFNL2, CAPN12, LGALS7, LGALS4, ECH1, HNRNPL, RINL, MYC,

SIRT2, CCER2, SARS2, FBX017, FBX027, SYCN, IFNL3, H3F3B,

IFNL4 CCNE1

CCOV44T FU-OV-1 chr20 32,416,001 33,774,001 1,358,001 1.57 RALY, MIR4755, ASIP, ITCH, MIR644A, DYNLRB1, FGFR4, 1

MAPI LC3A, TP53INP2, ACSS2, MYH7B, MIR499A, MYC,

PROCR, RALY-AS1 , EIF2S2, AHCY, PIGU, NCOA6, H3F3B,

HMGB3P1, GGT7, GSS, MIR499B, TRPC4AP, EDEM2 CCNE1

CGOV44T FU-OV-1 chr20 33,775,001 34,207,001 432,001 2.07 MMP24, FAM83C-AS1 , CEP250, ERGIC3, MMP24-AS1 , FGFR4, 1

EIF6, FAM83C, UQCC1 , GDF5, MIR1289-1 , C20orf173, MYC,

FER1 L4 H3F3B,

CCNE1

CCOV44T FU-OV-1 chr20 34,208,001 34,328,001 120,001 2.34 ROM01 , CPNE1 , RBM12, NFS1 FGFR4, 1

MYC,

H3F3B,

CCNE1

CCOV45T COV-318 chr11 62,754,001 63,095,001 341 ,001 1.66 SLC22A10, SLC22A8, SLC22A24, SLC22A25 CCNE1 1

CCOV45T COV-318 chr19 29,017,001 30,078,001 1,061,001 1.61 LINC00906, LOC102724958, LINC01532, VSTM2B, CCNE1 1

UQCRFS1, LOC284395

CCOV45T COV-318 chr19 30,079,001 30,176,001 97,001 2.50 POP4, PLEKHF1 CCNE1 1

Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CCOV4ST COV-318 chr20 48,427,001 49,230,001 803,001 1.89 SLC9A8, RNF114, SNAI1 , LINC01273, CEBPB, CCNE1 1

LINC01272, LINC01270, PTPN1 , MIR645, SPATA2,

TRERNA1 , UBE2V1 , TMEM189-UBE2V1 , TMEM189,

CEBPB-AS1, LINC01271

CGOV45T COV-318 chr20 49,231 ,001 49,554,001 323,001 1.60 LOC100506175, PARD6B, BCAS4, MIR1302-5, ADNP CCNE1 1

CGOV45T COV-318 chr20 51,895,001 52,067,001 172,001 1.49 NA NA 2

CGOV45T COV-318 chr20 57,615,001 58,407,001 792,001 2.12 ZNF831 , EDN3, LOC100506384 CCNE1 1

CGOV46T JHOS-2 chr3 176,138,001 176,155,001 17,001 1.65 NA NA 1

CGOV46T JHOS-2 chr17 76,790,001 77,233,001 443,001 1.48 C1 QTNF1 , ENGASE, USP36, TIMP2, CEP295NL, NA 2

LGALS3BP, CANT1 , C1QTNF1-AS1

CGOV47T JHOS-4 chr1 117,132,001 117,161,001 29,001 1.95 NA NA 1

CGOV47T JHOS-4 chr2 91,759,001 91,958,001 199,001 2.57 LOC654342 NA 1

CGOV47T JHOS-4 chr3 8,980,001 9,019,001 39,001 1.47 NA NA 2

CGOV47T JHOS-4 chr8 121 ,269,001 121 ,908,001 639,001 1.54 MTBP, LOCI 01927543, MRPL13, SNTB1 NA 3

CGOV47T JHOS-4 chr11 94,610,001 94,622,001 12,001 1.69 NA NA 4

CGOV47T JHOS-4 chr14 19,072,001 19,438,001 366,001 1.60 OR11 H12, LOC642426 NA 5

CGOV47T JHOS-4 chr14 21,353,001 21,412,001 59,001 1.57 RNASE3, ECRP NA 6

CGOV47T JHOS-4 chr15 93,410,001 93,444,001 34,001 1.48 LINC01578 NA 7

CGOV47T JHOS-4 chr17 78,410,001 78,509,001 99,001 1.84 NPTX1 NA 8

CGOV47T JHOS-4 chr22 18,718,001 18,889,001 171 ,001 1.67 GGT3P NA 9

CGOV5T EFO-21 chr3 188,741,001 195,342,001 6,601,001 1.63 TPRG1 , TP63, MIR944, P3H2-AS1 , CLDN16, IL1 RAP, NA 1

SNAR-I, OSTN, CCDC50, LINCR-0002, PYDC2, FGF12- AS1 , HRASLS, MGC2889, ATP13A5-AS1 , ATP13A4-AS1 ,

OPA1 , HES1, LOC101929337, LINC00884, TMEM44-AS1 ,

FAM43A, LOC100507391 , XXYLT1 -AS1 , XXYLT1 -AS2,

TPRG1 -AS2, P3H2, CLDN1 , TMEM207, GMNC, UTS2B,

FGF12, MB21 D2, ATP13A5, ATP13A4, OPA1 -AS1 ,

LOC647323, DPPA2P3, LOC100505920, LINC00887,

CPN2, LRRC15, GP5, ATP13A3, TMEM44, LSG1, XXYLT1 ,

MIR3137, ACAP2, MIR5692C1, PPP1 R2, APOD

CCOVST EFO-21 chr3 195,476,001 196,179,001 703,001 1.56 LINC00885, SLC51 A, TM4SF19-AS1 , TNK2, MIR6829, NA 1

SDHAP1 , TFRC, ZDHHC19, PCYT1 A, TCTEX1 D2,

TM4SF19-TCTEX1 D2, TM4SF19, UBXN7

CGOV5T EFO-21 chr3 196,198,001 197,900,001 1,702,001 1.67 FBX045, NRROS, PIGX, PAK2, SENP5, NCBP2-AS2, NA 1

MFI2-AS1, DLG1-AS1, FYTTD1 , LRCH3, RPL35A, LMLN,

SMC01 , WDR53, LINC01063, CEP19, NCBP2, PIGZ,

MFI2, DLG1, MIR4797, BDH1 , LOC220729, KIAA0226,

MIR922, IQCG, LMLN-AS1, ANKRD18DP

CCOV92T JHOS-3 chr1 147,389,001 147,730,001 341 ,001 1.67 GPR89B, PDZK1 P1 , NBPF11 , LOC101927468 NA 5

CCOV92T JHOS-3 chr3 178,120,001 178,130,001 10,001 1.82 NA NA 6

CCOV92T JHOS-3 chr8 37,426,001 37,535,001 109,001 1.58 NA FGFR1 1

CCOV92T JHOS-3 chr8 37,536,001 37,930,001 394,001 2.31 ZNF703, LOC101929622, ERLIN2, PROSC, ADGRA2, FGFR1 1

EIF4EBP1 , LOC102723701, LOC728024, BRF2,

RAB11 FIP1 , GOT1 L1 , ADRB3

CGOV92T JHOS-3 chr8 37,934,001 38,190,001 256,001 2.01 ASH2L, BAG4, DDHD2, STAR, LSM1 , PPAPDC1 B FGFR1 1

CGOV92T JHOS-3 chr8 38,191 ,001 38,348,001 157,001 1.67 LETM2, FGFR1 FGFR1 1

CGOV92T JHOS-3 chr8 117,836,001 117,985,001 149,001 1.66 RAD21 -AS1 , AARD, RAD21 , MIR3610 NA 7

CGOV92T JHOS-3 chr8 121 ,061,001 121 ,240,001 179,001 1.59 NA MYC 2

CGOV92T JHOS-3 chr8 121 ,252,001 121 ,869,001 617,001 1.64 MTBP, LOC101927543, MRPL13, SNTB1 MYC 2

CGOV92T JHOS-3 chr8 121 ,878,001 129,762,001 7,884,001 1.57 HAS2-AS1 , ZHX2, TBC1 D31 , FAM83A, WDYHV1 , MYC

FAM91 A1 , FER1 L6, TRMT12, RNF139, NDUFB9,

MIR4662A, LINC00964, ZNF572, SQLE, NSMCE2, TRIB1 ,

LOC101927657, PCAT1 , PRNCR1 , CASC21 , CCAT2,

POU5F1 B, MYC, MIR1204, PVT1 , MIR1205, MIR1206,

MIR1207, MIR1208, HAS2, LOC105375734, LINC01151 ,

DERL1, FAM83A-AS1, MIR4663, C8orf76, ZHX1- C8orf76, ZHX1 , ATAD2, FBX032, KLHL38, ANXA13,

FER1 L6-AS1 , FER1 L6-AS2, LOC101927588, TMEM65,

RNF139-AS1. TATDN1, MIR6844, MTSS1. MIR4662B,

KIAA0196, LINC00861, FAM84B, PCAT2, CASC19,

CCAT1, CASC8, CASC11, TMEM75, LINC00824

CCOV92T JHOS-3 chr8 129,766,001 132,082,001 2,316,001 1.74 LINC00977, CCDC26, MIR3686, GSDMC, FAM49B, MYC

MIR5194, ASAP1 , ASAP1-IT2, ASAP1-IT1 , ADCY8

CGOV92T JHOS-3 chr11 120,859,001 121 ,055,001 196,001 1.49 TBCEL NA 3

CGOV92T JHOS-3 chr11 121 ,056,001 121 ,358,001 302,001 1.77 SC5D NA 3

CGOV92T JHOS-3 chr11 121 ,359,001 121 ,533,001 174,001 2.08 NA NA 3

CGOV92T JHOS-3 chr11 121 ,534,001 121 ,839,001 305,001 2.41 NA NA 3

CGOV92T JHOS-3 chr11 121 ,840,001 121 ,960,001 120,001 2.79 NA NA 3

CGOV92T JHOS-3 chr11 123,156,001 123,526,001 370,001 1.49 GRAMD1 B, MIR4493, SCN3B NA 4

CGOV92T JHOS-3 chr11 123,527,001 123,694,001 167,001 1.92 ZNF202, OR6X1 , OR6M1 NA 4

CGOV92T JHOS-3 chr11 123,700,001 123,894,001 194,001 2.20 OR8D4, OR4D5, OR10G4, TMEM225, OR6T1 , OR10S1 NA 4

CGOV92T JHOS-3 chr11 123,895,001 124,063,001 168,001 2.47 OR10G8, VWA5A, OR10G7 NA 4

CGOV92T JHOS-3 chr11 124,064,001 124,306,001 242,001 2.80 OR8G2, OR8G1, OR8G5, OR8D1, OR8D2, OR8B2, NA 4

OR8B3, OR8B4

CGOV92T JHOS-3 chr14 50,418,001 50,435,001 17,001 2.11 MIR6076 NA 8

CGOV92T JHOS-3 chr14 76,121 ,001 76,175,001 54,001 1.50 NA NA 9

CGOV92T JHOS-3 chr17 61,017,001 61,027,001 10,001 1.84 MIR633 NA 10

CGOV92T JHOS-3 chr20 29,580,001 30,040,001 460,001 2.23 FRG1 BP, FRG1 DP, DEFB115, DEFB118, DEFB123, MYC 2

MLLT10P1 , DEFB116, DEFB119, DEFB121 , DEFB122

CCOV20T OV207 chr1 26,188,001 26,233,001 45,001 1.53 STMN1 , MIR3917 NA 6 CCOV20T OV207 chr1 151 ,921,001 151 ,939,001 18,001 1.83 NA NA 7 CCOV20T OV207 chr2 27,875,001 27,922,001 47,001 1.63 SLC4A1AP NA 1 CCOV20T OV207 chr2 28,010,001 28,067,001 57,001 2.49 NA NA 1 CCOV20T OV207 chr2 28,068,001 28,080,001 12,001 2.02 NA NA 1 CCOV20T OV207 chr2 28,081 ,001 28,236,001 155,001 1.66 MIR4263, BRE-AS1 NA 1 CCOV20T OV207 chr2 28,863,001 28,915,001 52,001 1.56 NA NA 8 CCOV20T OV207 chr2 204,445,001 204,502,001 57,001 1.99 NA NA 2 CCOV20T OV207 chr3 14,265,001 14,288,001 23,001 1.56 NA NA 9 CCOV20T OV207 chr3 101 ,783,001 101 ,833,001 50,001 1.59 NA NA 3 CCOV20T OV207 chr3 101 ,849,001 101 ,915,001 66,001 1.58 NA NA 3 CCOV20T OV207 chr6 106,577,001 106,605,001 28,001 1.58 NA NA 10 CCOV20T OV207 chr10 63,810,001 63,835,001 25,001 1.56 NA NA 11 CCOV20T OV207 chr11 71,792,001 71,874,001 82,001 1.52 FOLR3, LAMTOR1 , ANAPC15 NA 12 CCOV20T OV207 chr11 72,887,001 73,021 ,001 134,001 1.47 P2RY2, P2RY6 NA 4 CCOV20T OV207 chr11 73,022,001 73,143,001 121 ,001 1.97 RELT NA 4 CCOV20T OV207 chr11 73,144,001 73,178,001 34,001 1.65 NA NA 4 Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV20T OV207 chr11 87,207,001 88,942,001 1,735,001 1.66 MIR3166, GRM5-AS1 , RAB38, CTSC, GRM5 NA 1

CGOV20T OV207 chr11 88,948,001 89,361 ,001 413,001 1.61 NOX4 NA 1

CGOV20T OV207 chr11 120,880,001 121 ,357,001 477,001 1.86 TBCEL, TECTA, SC5D NA 13

CGOV20T OV207 chr15 62,374,001 62,434,001 60,001 1.73 NA NA 2

CGOV20T OV207 chr17 30,625,001 30,669,001 44,001 1.63 NA NA 14

CGOV20T OV207 chr17 35,818,001 36,220,001 402,001 1.87 DUSP14, SYNRG, DDX52, MIR378J, HNF1 B NA 15

CGOV20T OV207 chr17 62,949,001 62,976,001 27,001 1.59 AMZ2P1 NA 16

CGOV20T OV207 chr17 73,674,001 74,032,001 358,001 1.58 ITGB4, UNK, TEN1, TEN1-CDK3, CDK3, MIR4538, GALK1, H3F3B 17

H3F3B, MIR4738, UNC13D, WBP2, TRIM47, TRIM65,

MRPL38, FBF1 , ACOX1 , EVPL

CGOV20T OV207 chr20 3,345,001 3,435,001 90,001 1.49 NA NA 18

CGOV20T OV207 chr22 41,032,001 41,124,001 92,001 1.47 MCHR1 NA 19

CGOV20T OV207 chr22 41,650,001 41,708,001 58,001 1.54 NA NA 20

CGOV27T OVISE chr2 117,241,001 117,242,001 1,001 1.98 NA NA 1

CGOV27T OVISE chr2 117,243,001 120,376,001 3,133,001 2.92 DDX18, INSIG2, MARCO, STEAP3, DBI, TMEM37, NA 1

CCDC93, LOC101927709, EN1, C1 QL2, STEAP3-AS1 ,

C2or(76, SCTR

CCOV27T OVISE chr2 120,383,001 122,306,001 1,923,001 2.90 TMEM177, PTPN4, EPB41 L5, RALB, INHBB, GLI2, NA 1

RNU4ATAC, TMEM185B, LINC01101 , TFCP2L1

CCOV27T OVISE chr2 122,307,001 123,095,001 788,001 2.45 NIFK-AS1 , TSN, NIFK NA 1

CCOV27T OVISE chr2 123,103,001 123,241,001 138,001 2.53 NA NA 1

CCOV27T OVISE chr3 122,676,001 122,776,001 100,001 1.53 NA NA 2

CCOV27T OVISE chr16 32,180,001 32,857,001 677,001 1.57 TP53TG3D, HERC2P4, LOC390705, TP53TG3B, NA 1

TP53TG3, TP53TG3C

CCOV27T OVISE chr19 8,774,001 9,641,001 867,001 1.76 OR2Z1 , MBD3L1 , OR1 1 , ZNF317, OR7D2, OR7E24, NA 1

ZNF559, ZNF559-ZNF177, ZNF177, ACTL9, ZNF558,

MUC16, OR7G2, OR7G1 , OR7G3, OR7D4, ZNF699,

ZNF266, ZNF560

CCOV27T OVISE chr19 36,543,001 36,755,001 212,001 1.60 WDR62, OVOL3, TBCB, CAPNS1 , ZNF146, POLR2I, NA 1

COX7A1. ZNF565

CCOV27T OVISE chr19 37,819,001 37,939,001 120,001 1.47 HKR1. ZNF527 NA 1

CCOV27T OVISE chr19 37,940,001 39,217,001 1,277,001 2.04 ZNF570, ZNF793, ZNF571-AS1, ZNF540, LOC644554, NA 1

SIPA1 L3, SPINT2, C19orf33, KCNK6, CATSPERG, PSMD8,

SPRED3, FAM98C, RYR1, EIF3K, ZNF793-AS1 , ZNF571,

ZFP30, ZNF781, ZNF607, ZNF573, LOC100631378,

WDR87, DPF1 , PPP1 R14A, YIF1 B, GGN, RASGRP4,

MAP4K1

CGOV27T OVISE chr19 39,218,001 40,042,001 824,001 1.56 LGALS7B, NFKBIB, MRPS12, PAPL, PAK4, NCCRP1 , NA 1

IFNL2, IFNL1, SAMD4B, MED29, ZFP36, PLEKHG2,

SUPT5H, TIMM50, DLL3, SELV, CAPN12, LGALS7,

LGALS4, ECH1 , HNRNPL, RINL, SIRT2, CCER2, SARS2,

FBX017, FBX027, SYCN, IFNL3, IFNL4, LRFN1, GMFG,

PAF1, MIR4530, RPS16, EID2B, EID2

CCOV27T OVISE chr19 40,043,001 40,681 ,001 638,001 1.88 LGALS13, LOC100129935, LGALS16, LGALS17A, NA 1

LGALS14, LEUTX, PSMC4, ZNF546, CLC, DYRK1 B,

MIR6719, FBL, FCGBP, ZNF780B, ZNF780A

CCOV27T OVISE chr20 52,690,001 52,769,001 79,001 1.73 NA NA 3

CCOV29T OVMANA chr20 51,905,001 52,958,001 1,053,001 1.65 LOC101927770, PFDN4, ZNF217, SUM01 P1 , BCAS1 , NA 1

MIR4756, CYP24A1

CCOV31T OVTOKO chr14 61,955,001 62,148,001 193,001 1.68 FLJ22447, LOC101927780 NA 1

CCOV3ST RMG-I chr2 113,904,001 113,928,001 24,001 1.50 NA NA 1

CCOV3ST RMG-I chr2 113,929,001 114,040,001 111 ,001 1.78 PSD4, PAX8-AS1 , PAX8 NA 1

CCOV3ST RMG-I chr2 114,041,001 114,045,001 4,001 2.40 NA NA 1 Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV35T RMG-I chr2 114,047,001 114,137,001 90,001 1.70 NA NA 1

CGOV35T RMG-I chr2 238,759,001 238,770,001 11,001 1.50 NA NA 4

CGOV35T RMG-I chr4 159,444,001 159,532,001 88,001 1.83 NA NA 2

CGOV35T RMG-I chr4 159,533,001 159,554,001 21,001 1.60 NA NA 2

CGOV35T RMG-I chr17 37,901 ,001 38,231 ,001 330,001 1.91 ZPBP2, LRRC3C, GSDMA, PSMD3, CSF3, IKZF3, GSDMB, NA 5

ORMDL3, MED24, MIR6884, SNORD124

CGOV35T RMG-I chr17 49,706,001 50,731 ,001 1,025,001 1.57 CA10 RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 50,737,001 51,041 ,001 304,001 1.91 NA RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 51,042,001 51,733,001 691 ,001 2.28 C17orf112 RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 51,734,001 51,743,001 9,001 2.58 NA RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 51,744,001 51,851 ,001 107,001 2.10 NA RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 51,861 ,001 52,415,001 554,001 2.07 KIF2B RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 52,416,001 53,367,001 951 ,001 2.58 TOM1 L1 , STXBP4, COX11 RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 53,368,001 53,681 ,001 313,001 2.27 MMD RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 53,682,001 53,686,001 4,001 2.66 NA RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 53,687,001 53,779,001 92,001 2.99 NA RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 53,780,001 54,263,001 483,001 2.16 PCTP. TMEM100 RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 54,264,001 54,438,001 174,001 1.88 NA RAD51 C, 3

RNF43

CGOV35T RMG-I chr17 54,799,001 55,089,001 290,001 1.89 DGKE, SCPEP1, C17orf67, MTVR2, TRIM25, MIR3614, RAD51 C, 3

COIL RNF43

CGOV35T RMG-I chr17 55,093,001 55,920,001 827,001 2.13 RNF126P1, AKAP1, MSI2, LOC101927557, RAD51 C, 3

LOC101927539, CCDC182 RNF43

CGOV35T RMG-I chr17 55,921 ,001 57,719,001 1,798,001 1.72 DYNLL2, OR4D1, MSX2P1 , OR4D2, EPX, LPO, BZRAP1- RAD51 C, 3

AS1 , SEPT4-AS1 , RAD51 C, PPM1 E, PRR11 , SMG8, RNF43

GDPD1 , YPEL2, MIR4729, DHX40, CUEDC1 , VEZF1 ,

SRSF1 , LOC101927666, MKS1 , MPO, BZRAP1 , MIR142,

MIR4736, SUPT4H1, RNF43, HSF5, MTMR4, SEPT4,

C17orf47, TEX14, TRIM37, SKA2, MIR454, MIR301A,

LINC01476

CCOV3ST RMG-I chr17 57,982,001 58,415,001 433,001 1.55 LOC101927755, CA4, RNFT1 , TBC1 D3P1 -DHX40P1 , RAD51 C, 3

MIR4737, HEATR6, WFDC21 P, LOC653653, SCARNA20 RNF43

CGOV7T ES-2 chr4 1,681,001 1,751,001 70,001 1.53 TACC3, SLBP, TMEM129 CCND1 1

CGOV7T ES-2 chr6 161 ,478,001 161 ,899,001 421 ,001 1.89 AGPAT4, AGPAT4-IT1 NA 2

CGOV7T ES-2 chr6 161 ,900,001 162,016,001 116,001 1.60 NA NA 2

CGOV7T ES-2 chr11 68,862,001 69,053,001 191 ,001 2.99 LOC338694 CCND1 1

CGOV7T ES-2 chr11 69,054,001 69,294,001 240,001 2.71 MYEOV CCND1 1

CGOV7T ES-2 chr11 69,295,001 69,319,001 24,001 3.07 LINC01488 CCND1 1

CGOV7T ES-2 chr11 69,320,001 69,414,001 94,001 2.66 NA CCND1 1

CGOV7T ES-2 chr11 69,415,001 69,849,001 434,001 2.33 CCND1 , ORAOV1 , FCF19, FCF4, FCF3 CCND1 1

CGOV7T ES-2 chr11 69,850,001 70,136,001 286,001 2.07 AN01, FADD, MIR548K, LOC101928443, AN01-AS2 CCND1 1 Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV7T ES-2 chr11 70,137,001 70,398,001 261 ,001 1.78 CTTN CCND1 1

CGOV7T ES-2 chr11 70,447,001 71,124,001 677,001 2.40 SHANK2-AS1, SHANK2-AS3, MIR3664 CCND1 1

CGOV7T ES-2 chr11 71,125,001 71,161 ,001 36,001 3.16 DHCR7 CCND1 1

CGOV7T ES-2 chr11 71,162,001 71,296,001 134,001 2.35 NADSYN1, MIR6754, KRTAP5-7, KRTAP5-8, KRTAP5-9, CCND1 1

KRTAP5-10, KRTAP5-11

CGOV7T ES-2 chr11 75,577,001 75,770,001 193,001 1.75 NA CCND1 1

CGOV7T ES-2 chr11 90,387,001 90,404,001 17,001 2.13 NA CCND1 1

CGOV7T ES-2 chr11 90,409,001 90,584,001 175,001 2.08 NA CCND1 1

CGOV7T ES-2 chr11 90,605,001 90,711 ,001 106,001 2.28 NA CCND1 1

CGOV7T ES-2 chr11 90,712,001 90,863,001 151 ,001 2.63 NA CCND1 1

CGOV7T ES-2 chr11 90,864,001 91,699,001 835,001 2.38 NA CCND1 1

CGOV7T ES-2 chr11 91,700,001 91,716,001 16,001 1.84 NA CCND1 1

CGOV7T ES-2 chr11 99,097,001 99,502,001 405,001 2.33 NA CCND1 1

CGOV7T ES-2 chr11 99,503,001 99,657,001 154,001 1.86 NA CCND1 1

CGOV7T ES-2 chr11 99,658,001 99,756,001 98,001 2.23 NA CCND1 1

CGOV7T ES-2 chr11 99,757,001 99,768,001 11,001 1.81 NA CCND1 1

CGOV7T ES-2 chr11 99,769,001 99,873,001 104,001 2.21 NA CCND1 1

CGOV7T ES-2 chr11 99,912,001 99,953,001 41,001 3.08 NA CCND1 1

CGOV7T ES-2 chr11 99,954,001 100,028,001 74,001 2.51 NA CCND1 1

CGOV7T ES-2 chr11 100,029,001 100,033,001 4,001 3.34 NA CCND1 1

CGOV7T ES-2 chr11 100,034,001 100,523,001 489,001 2.64 NA CCND1 1

CGOV7T ES-2 chr11 100,529,001 100,557,001 28,001 2.16 NA CCND1 1

CGOV7T ES-2 chr11 100,558,001 100,938,001 380,001 2.75 ARHGAP42, TMEM133 CCND1 1

CGOV7T ES-2 chr11 100,947,001 101 ,149,001 202,001 2.81 LOC101054525 CCND1 1

CGOV7T ES-2 chr11 101 ,150,001 101 ,732,001 582,001 1.70 TRPC6, MIR3920 CCND1 1

CGOV7T ES-2 chr11 101 ,796,001 101 ,823,001 27,001 1.91 NA CCND1 1

CGOV7T ES-2 chr11 101 ,824,001 101 ,834,001 10,001 2.52 NA CCND1 1

CGOV7T ES-2 chr11 101 ,835,001 101 ,879,001 44,001 1.89 NA CCND1 1

CGOV7T ES-2 chr11 101 ,880,001 101 ,970,001 90,001 3.06 C11 or(70 CCND1 1

CGOV7T ES-2 chr11 101 ,992,001 102,083,001 91,001 2.22 NA CCND1 1

CGOV7T ES-2 chr11 102,084,001 102,089,001 5,001 1.90 NA CCND1 1

CGOV7T ES-2 chr11 102,378,001 102,423,001 45,001 1.97 MMP7 CCND1 1

CGOV7T ES-2 chr11 103,400,001 103,548,001 148,001 2.41 NA NA 3

CGOV36T RMUG-S chr15 84,155,001 84,540,001 385,001 1.68 NA NA 1

CGOV36T RMUG-S chr15 84,544,001 84,632,001 88,001 1.55 NA NA 1

CGOV36T RMUG-S chr15 84,638,001 84,709,001 71,001 1.46 NA NA 1

CGOV36T RMUG-S chr15 86,387,001 86,690,001 303,001 1.72 LINC01584 NA 2

CGOV36T RMUG-S chr15 86,697,001 87,068,001 371 ,001 1.75 AGBL1-AS1 NA 2

CGOV48T JHOM-1 chr2 176,966,001 178,365,001 1,399,001 1.62 HOXD11, HOXD10, HOXD9, HOXD8, MIR10B, HOXD4, NA 4

HOXD3, HAGLROS, HOXD1, MIR7704, MTX2,

LINC01117, HNRNPA3, MIR4444-1, MIR4444-2, HOXD- AS2, HAGLR, MIR1246, LINC01116, NFE2L2, MIR3128,

LOC100130691, MIR6512 WO 2020/081549 Log\ PCT/US2019/056299

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CCOV48T JHOM-1 chr11 70,167,001 70,532,001 365,001 2.26 CTTN, SHANK2-AS1 , SHANK2 CCND1 1

CCOV48T JHOM-1 chr11 70,533,001 7.1 e+07 467,001 2.48 SHANK2-AS3, MIR3664 CCND1 1

CCOV48T JHOM-1 chr11 72,748,001 73,079,001 331 ,001 2.01 P2RY2, P2RY6 NA 2

CCOV48T JHOM-1 chr11 73,080,001 73,884,001 804,001 2.27 RELT, PLEKHB1 , MRPL48, PAAF1 , DNAJB13, FAM168A, NA 2

RAB6A, COA4, UCP2, UCP3, C2CD3

CCOV48T JHOM-1 chr11 73,885,001 74,634,001 749,001 3.01 LOC101928580, POLD3, RNF169, P4HA3, PCM2L1 , NA 2

KCNE3, LIPT2, CHRDL2, MIR4696

CCOV48T JHOM-1 chr11 74,635,001 74,909,001 274,001 2.57 SPCS2, NEU3, OR2AT4 NA 2

CCOV48T JHOM-1 chr11 77,102,001 77,493,001 391 ,001 1.69 LOC646029, AQP11 , CLNS1 A NA 5

CCOV48T JHOM-1 chr11 79,454,001 79,660,001 206,001 1.58 NA NA 6

CCOV48T JHOM-1 chr11 81,065,001 81,488,001 423,001 1.66 NA NA 7

CCOV48T JHOM-1 chr11 82,708,001 82,750,001 42,001 1.74 NA NA 8

CCOV48T JHOM-1 chr11 94,951 ,001 95,195,001 244,001 1.51 LOC100129203 NA 9

CCOV48T JHOM-1 chr11 107,032,001 107,330,001 298,001 2.05 CWF19L2 ATM 3

CCOV48T JHOM-1 chr11 107,336,001 108,989,001 1,653,001 1.89 ELMOD1 , LOC643923, RAB39A, CUL5, ACAT1 , ATM, ATM 3

DDX10, ALKBH8, SLN, SLC35F2, NPAT, C11 orf65,

KDELC2, EXPH5

CCOV48T JHOM-1 chr11 108,990,001 109,268,001 278,001 2.11 NA ATM 3

CCOV48T JHOM-1 chr11 109,269,001 110,720,001 1,451,001 1.82 C11 orf87, ZC3H12C, FDX1 , RDX, ARHCAP20 ATM 3

CCOV38T TOV-112D chr8 49,453,001 49,542,001 89,001 1.50 LOC101929217 NA 1

CCOV38T TOV-112D chr14 21,509,001 21,957,001 448,001 1.63 RNASE7, RNASE8, ARHCEF40, TMEM253, RPCRIP1 , NA 2

ZNF219, OR5AU1, LINC00641 , HNRNPC, SUPT16H,

CHD8, SNORD9, SNORD8, RAB2B

CCOV49T OVK-18 chr1 147,389,001 147,730,001 341 ,001 1.48 CPR89B, PDZK1 P1 , NBPF11 , LOC101927468 NA 1

CCOV13T Kuramochi chr6 24,845,001 25,208,001 363,001 1.48 CMAHP MYC, 1

KRAS

CCOV13T Kuramochi chr8 50,430,001 50,541 ,001 111 ,001 2.02 NA NA 2

CCOV13T Kuramochi chr8 119,165,001 125,251,001 6,086,001 1.48 SAMD12-AS1 , COLEC10, MAL2, NOV, DEPTOR, MYC, 1

COL14A1 , MTBP, LOC101927543, HAS2-AS1 , ZHX2, KRAS

TBC1 D31, FAM83A, WDYHV1 , FAM91A1, FER1 L6,

SAMD12, TNFRSF11 B, ENPP2, TAF2, DSCC1 , MRPL13,

SNTB1 , HAS2, LOC105375734, LINC01151 , DERL1 ,

FAM83A-AS1, MIR4663, C8or(76, ZHX1-C8or(76, ZHX1 ,

ATAD2, FBX032, KLHL38, ANXA13, FER1 L6-AS1,

FER1 L6-AS2

CCOV13T Kuramochi chr8 125,261,001 128,755,001 3,494,001 1.77 TRMT12, RNF139, NDUFB9, MIR4662A, LINC00964, MYC, 1

ZNF572, SQLE, NSMCE2, TRIB1, LOC101927657, PCAT1 , KRAS

PRNCR1 , CASC21 , CCAT2, POUSF1 B, MYC, TMEM65,

RNF139-AS1. TATDN1, MIR6844, MTSS1. MIR4662B,

KIAA0196, LINC00861, FAM84B, PCAT2, CASC19,

CCAT1 , CASC8, CASC11

CCOV13T Kuramochi chr8 128,756,001 128,999,001 243,001 1.51 MIR1204, MIR1205, TMEM75 MYC, 1

KRAS

Log\

WO 2020/081549 (_2\) PCT/US2019/056299 Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV13T Kuramochi chr12 25,466,001 25,554,001 88,001 1.80 NA MYC, 1

KRAS

CGOV13T Kuramochi chr12 25,555,001 26,024,001 469,001 2.09 LMNTD1 MYC, 1

KRAS

CGOV13T Kuramochi chr12 26,025,001 26,424,001 399,001 2.37 RASSF8, SSPN, MIR4302, RASSF8-AS1 , BHLHE41 MYC, 1

KRAS

CGOV13T Kuramochi chr12 26,425,001 26,511 ,001 86,001 2.66 NA MYC, 1

KRAS

CGOV13T Kuramochi chr12 26,512,001 27,229,001 717,001 2.92 FCFR1 OP2, MED21 , ASUN, TM7SF3 MYC, 1

KRAS

CGOV13T Kuramochi chr12 27,230,001 27,647,001 417,001 3.28 STK38L, ARNTL2, C12or(71 , ARNTL2-AS1 MYC, 1

KRAS

CGOV13T Kuramochi chr12 27,655,001 27,755,001 100,001 3.12 NA MYC, 1

KRAS

CGOV13T Kuramochi chr12 27,756,001 27,760,001 4,001 2.13 NA MYC, 1

KRAS

CGOV15T OAW-28 chr1 203,420,001 203,539,001 119,001 1.55 PRELP, OPTC NA 2

CGOV15T OAW-28 chr2 153,619,001 153,795,001 176,001 2.60 NA ASXL1 1

CGOV15T OAW-28 chr2 153,800,001 153,915,001 115,001 2.50 NA ASXL1

CGOV15T OAW-28 chr2 153,916,001 154,034,001 118,001 3.38 NA ASXL1

CGOV15T OAW-28 chr2 154,035,001 154,038,001 3,001 2.37 NA ASXL1

CGOV15T OAW-28 chr2 160,833,001 161 ,490,001 657,001 1.51 ITCB6, LOC100505984, RBMS1 , MIR4785 ASXL1

CGOV15T OAW-28 chr2 161 ,491,001 161 ,536,001 45,001 2.15 NA ASXL1

CGOV15T OAW-28 chr2 161 ,537,001 161 ,963,001 426,001 1.56 NA ASXL1

CGOV15T OAW-28 chr3 159,533,001 159,682,001 149,001 1.81 SCHIP1 NA

CGOV15T OAW-28 chr4 92,581 ,001 92,590,001 9,001 2.01 NA NA

CGOV15T OAW-28 chr8 33,517,001 34,924,001 1,407,001 1.52 LINC01288 ASXL1

CGOV15T OAW-28 chr8 34,925,001 35,028,001 103,001 2.05 NA ASXL1

CGOV15T OAW-28 chr8 35,035,001 35,135,001 100,001 1.74 NA ASXL1

CGOV15T OAW-28 chr8 40,701 ,001 40,774,001 73,001 1.53 NA ASXL1 1

CGOV15T OAW-28 chr8 40,780,001 42,190,001 1,410,001 1.77 COLCA7, CINS4, CPAT4, MIR486-2, AP3M2, SFRP1 , ASXL1 1

LOC102723729, NKX6-3, ANK1, MIR486-1, KAT6A,

PLAT, LOC101929897

CGOV15T OAW-28 chr8 42,194,001 42,538,001 344,001 1.88 POLB, VDAC3, SMIM19, DKK4, SLC20A2 ASXL1 1

CGOV15T OAW-28 chr8 42,546,001 42,630,001 84,001 1.89 CHRNB3, CHRNA6 ASXL1 1

CGOV15T OAW-28 chr8 42,631 ,001 43,028,001 397,001 1.52 HOOK3, FNTA, POMK, THAP1 , RNF170, MIR4469 ASXL1 1

CGOV15T OAW-28 chr8 43,029,001 43,174,001 145,001 1.91 NA ASXL1 1

CGOV15T OAW-28 chr8 43,188,001 43,398,001 210,001 1.96 NA ASXL1 1

CGOV15T OAW-28 chr8 118,155,001 118,760,001 605,001 1.50 MED30 ASXL1 1

CGOV15T OAW-28 chr9 123,996,001 124,108,001 112,001 1.47 CSN, CSN-AS1 NA 5

CGOV15T OAW-28 chr12 14,983,001 15,613,001 630,001 4.40 PDE6H, LINC01489, RERC-AS1 , MCP, ERP27, ARHCDIB, ASXL1 1

RERC

CGOV15T OAW-28 chr12 15,614,001 16,304,001 690,001 3.94 PTPRO, STRAP, DERA, EPS8 ASXL1 1

CGOV15T OAW-28 chr12 16,305,001 16,580,001 275,001 3.66 MCST1 , SLC15A5 ASXL1 1

CGOV15T OAW-28 chr12 16,581 ,001 16,791 ,001 210,001 4.07 LM03 ASXL1

CGOV15T OAW-28 chr12 16,792,001 17,201 ,001 409,001 3.48 SKP1 P2 ASXL1

CGOV15T OAW-28 chr12 17,206,001 18,500,001 1,294,001 1.68 MIR3974, RERCL ASXL1

CGOV15T OAW-28 chr12 18,501 ,001 19,485,001 984,001 2.14 CAPZA3, PLEKHA5, PLCZ1 ASXL1 1

CGOV15T OAW-28 chr12 19,486,001 19,678,001 192,001 1.84 AEBP2 ASXL1 1 WO 2020/081549 Log\ PCT/US2019/05629?

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CCOV1ST OAW-28 chr12 19,679,001 20,006,001 327,001 2.05 NA ASXL1 1

CCOV1ST OAW-28 chr17 1,068,001 1,328,001 260,001 2.57 BHLHA9, TUSC5, YWHAE ASXL1 1

CCOV1ST OAW-28 chr17 1,329,001 1,406,001 77,001 2.13 MY01C ASXL1 1

CCOV1ST OAW-28 chr20 29,834,001 30,275,001 441 ,001 1.67 DEFB115, DEFB118, DEFB123, REM1 , LINC00028, ASXL1 1

HM13, MCTS2P, ID1 , MIR3193, COX4I2, DEFB116,

DEFB119, DEFB121 , DEFB122, DEFB124, HM13-AS1

CC0V1ST OAW-28 chr20 30,564,001 31,093,001 529,001 2.02 MIR7641-2, CCM2L, HCK, TM9SF4, POFUT1 , MIR1825, ASXL1 1

KIF3B, ASXL1 , TSPY26P, PLACL2, NOL4L

CCOV15T OAW-28 chr20 34,831 ,001 34,863,001 32,001 1.49 NA ASXL1 1

CCOV26T OVCAR-5 chr12 6,170,001 6,327,001 157,001 2.14 NA NA 3

CCOV26T OVCAR-5 chr12 24,607,001 24,852,001 245,001 1.56 LINC00477 KRAS 1

CCOV26T OVCAR-5 chr12 24,853,001 25,278,001 425,001 2.07 LRMP, BCAT1 , C12orf77 KRAS 1

CCOV26T OVCAR-5 chr12 25,279,001 25,291 ,001 12,001 2.46 NA KRAS 1

CCOV26T OVCAR-5 chr12 25,292,001 25,315,001 23,001 2.11 NA KRAS 1

CCOV26T OVCAR-5 chr12 25,330,001 25,617,001 287,001 2.08 LYRM5, KRAS KRAS 1

CCOV26T OVCAR-5 chr17 32,430,001 33,116,001 686,001 1.48 CCL2, CCL7, CCL11 , CCL8, CCL13, TMEM132E, NA 4

LOC101927239, CCL1 , C17orf 102

CCOV26T OVCAR-5 chr17 37,664,001 38,849,001 1,185,001 1.49 PPP1 R1 B, STARD3, TCAP, PNMT, ERBB2, MIR4728, ERBB2 5

CRB7, ZPBP2, LRRC3C, CSDMA, PSMD3, CSF3, THRA,

MSL1, CASC3, MIR6866, RAPCEFL1, MIR6867, WIPF2,

CDC6, RARA, IGFBP4, NEUROD2, PGAP3, MIEN1, IKZF3,

CSDMB, ORMDL3, MED24, MIR6884, SNORD124,

NR1 D1 , RARA-AS1 , GJD3, TOP2A, TNS4, CCR7,

SMARCE1, KRT222

CCOV26T OVCAR-5 chr17 55,048,001 56,004,001 956,001 1.62 SCPEP1 , RNF126P1 , AKAP1 , MSI2, LOC101927557, NA 6

LOC101927539, CCDC182, MRPS23, CUEDC1

CCOV26T OVCAR-5 chr22 21,006,001 21,421 ,001 415,001 1.58 POM121 L4P, TMEM191A, SERPIND1 , SNAP29, CRKL, NA 7

LOC101928891 , AIFM3, LZTR1 , THAP7-AS1 , P2RX6,

LRRC74B, PI4KA, THAP7, TUBA3FP, SLC7A4, MIR649,

P2RX6P

CGOV26T OVCAR-5 chr22 30,631 ,001 31,555,001 924,001 1.50 CCDC157, SEC14L2, MTFP1 , TCN2, SLC35E4, OSBP2, NA 2

MIR3200, MORC2-AS1 , TUC1, SMTN, INPP5J, LIF, OSM,

CATSL3, TBC1 D10A, SF3A1 , KIAA1656, RNF215,

SEC14L3, SDC4P, SEC14L4, SEC14L6, CAL3ST1 , PES1,

DUSP18, MORC2, SELM, PLA2C3

CCOV26T OVCAR-5 chr22 33,030,001 33,142,001 112,001 1.57 NA NA 2

CCOV2T Caov-3 chr1 84,469,001 84,506,001 37,001 1.68 NA NA 4

CCOV2T Caov-3 chr3 168,874,001 168,906,001 32,001 1.96 NA NA 5

CCOV2T Caov-3 chr3 171 ,199,001 171 ,583,001 384,001 2.03 TMEM212, PLD1 NA 6

CCOV2T Caov-3 chr5 98,685,001 98,701 ,001 16,001 1.59 NA NA 7

CCOV2T Caov-3 chr6 11,669,001 11,699,001 30,001 1.49 NA NA 8

WO 2020/081549 Log\ PCT/ JS2019/056299,

(_2\) impucaced Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CC0V2T Caov-3 chr17 48,073,001 48,239,001 166,001 1.86 ITCA3, PDK2, LOC284080. SAMD14, PPP1 R9B NA 3

CC0V2T Caov-3 chr17 48,240,001 48,440,001 200,001 1.56 SCCA, LOCI 01927230, TMEM92. XYLT2, HILS1 , NA 3

COL1A1, TMEM92-AS1

CC0V2T Caov-3 chr22 16,867,001 18,718,001 1,851,001 2.42 TPTEP1, HSFY1 P1 , CECR7, IL17RA, LOC100996342, NA 1

CECR5-AS1 , CECR2, SLC25A18, BCL2L13, LINC00528,

FLJ41941 , PEX26, TUBA8, USP18, CCT8L2,

ANKRD62P1 -PARP4P3, XKR3, CAB4, CECR6, CECR5,

CECR1 , CECR3, LOC101929372, ATP6V1 E1 , BID,

MIR3198-1, MICAL3, MIR648

CCOV2T Caov-3 chr22 18,875,001 19,738,001 863,001 1.47 DCCR6, DCCR5, DCCR9, DCCR10, TSSK2, LINC01311 , NA 1

MRPL40, CDC45, SEPT5, SEPT5-CP1 BB, CP1 BB, PRODH,

DCCR2, DCCR11, DCCR14, CSC2, SLC25A1 , CLTCL1 ,

HIRA, C22orf39, UFD1 L, CLDN5, LINC00895

CC0V2T Caov-3 chr22 19,739,001 19,786,001 47,001 2.22 TBX1 NA 1

CC0V2T Caov-3 chr22 48,590,001 48,630,001 40,001 1.51 NA NA 9

CCOV33T PEA2 chr6 58,140,001 58,744,001 604,001 1.64 CUSBP4 NA 1

CCOV33T PEA2 chr7 135,092,001 135,209,001 117,001 2.10 NA NA 1

CCOV33T PEA2 chr7 135,210,001 135,605,001 395,001 1.76 NUP205, C7orf73, SLC13A4, FAM180A NA

CCOV33T PEA2 chr7 135,606,001 136,131,001 525,001 2.01 LUZP6, MTPN NA

CCOV33T PEA2 chr7 136,132,001 136,906,001 774,001 2.64 CHRM2, MIR490, LOC349160 NA

CCOV33T PEA2 chr7 136,907,001 138,148,001 1,241,001 3.00 LOC100130880, AKR1 D1 , MIR4468, PTN, DCKI, NA

CREB3L2

CCOV33T PEA2 chr7 138,149,001 138,815,001 666,001 3.30 TMEM213, SVOPL, ATP6V0A4, KIAA1549, ZC3HAV1 L, NA

ZC3HAV1

CCOV33T PEA2 chr7 138,816,001 139,108,001 292,001 3.54 TTC26, UBN2, C7orf55 NA

CCOV33T PEA2 chr7 139,124,001 140,292,001 1,168,001 3.40 CLEC2L, TBXAS1, JHDM1 D-AS1, RAB19, KLRC2, HIPK2, NA

PARP12, KDM7A, SLC37A3, MKRN1

CCOV33T PEA2 chr7 140,293,001 140,603,001 310,001 3.70 ADCK2, NDUFB2, NDUFB2-AS1 NA

CCOV33T PEA2 chr7 140,604,001 140,682,001 78,001 2.54 NA NA

CCOV33T PEA2 chr7 140,683,001 140,823,001 140,001 2.22 MRPS33 NA

CCOV33T PEA2 chr7 147,293,001 147,387,001 94,001 1.46 NA NA

CCOV33T PEA2 chr7 147,388,001 147,757,001 369,001 1.93 NA NA

CCOV33T PEA2 chr8 134,331,001 134,533,001 202,001 1.67 NA NA

CCOV33T PEA2 chr8 134,534,001 134,646,001 112,001 1.96 NA NA

CCOV33T PEA2 chr8 134,647,001 134,774,001 127,001 2.21 NA NA

CCOV33T PEA2 chr8 134,775,001 134,905,001 130,001 2.50 LOC101927798 NA 3

CCOV33T PEA2 chr8 134,906,001 135,127,001 221 ,001 2.89 NA NA 3

CCOV33T PEA2 chr8 135,128,001 135,203,001 75,001 3.30 NA NA 3

CCOV33T PEA2 chr8 135,204,001 135,364,001 160,001 3.63 NA NA 3

CCOV33T PEA2 chr8 135,365,001 135,527,001 162,001 2.08 NA NA 3

CCOV33T PEA2 chr8 135,528,001 135,724,001 196,001 2.35 ZFAT-AS1 NA 3

CCOV33T PEA2 chr16 28,824,001 29,127,001 303,001 1.84 ATXN2L, SH2B1, ATP2A1, CD19, NFATC2IP, MIR4517, NA 4

SPNS1 , LAT, TUFM, MIR4721 , ATP2A1 -AS1 , RABEP2

CCOV33T PEA2 chr16 29,172,001 29,353,001 181 ,001 1.90 NA NA 4

CCOV33T PEA2 chr16 32,180,001 33,075,001 895,001 1.47 TP53TC3D, HERC2P4, LOC390705, TP53TC3B, NA

TP53TC3, TP53TC3C, SLC6A1 OP

CCOV33T PEA2 chr16 34,608,001 35,178,001 570,001 1.59 FLJ26245, FRC2DP, LOC100130700 NA Log\ Previously

(_2\) implicated Amplicon

Lab ID Cell line Chr Start End Width ratio Gene in cancer group

CGOV33T PEA2 chr18 33,487,001 34,889,001 1,402,001 1.55 C18orF21, ELP2, MOCOS, FHOD3, KIAA1328, MIR3929, NA 1

RPRD1A, SLC39A6, TPGS2

CGOV42T OVCAR-8 chr1 115,775,001 115,896,001 121 ,001 1.49 NGF NA 1

CGOV42T OVCAR-8 chr3 84,831 ,001 84,867,001 36,001 1.89 NA NA 2

CGOV42T OVCAR-8 chr5 15,213,001 15,229,001 16,001 1.88 NA NA 3

CGOV42T OVCAR-8 chr10 123,001 195,001 72,001 1.72 NA NA 4

CGOV42T OVCAR-8 chr10 42,606,001 43,048,001 442,001 1.49 LINC00839, LOC441666, CCNYL2 NA 5

CGOV42T OVCAR-8 chr16 64,350,001 64,360,001 10,001 1.64 NA NA 6

CGOV53T OVCAR-5- chr8 36,252,001 37,222,001 970,001 1.76 KCNU1 NA 2

CisR

CGOV53T OVCAR-5- chr9 73,001 229,001 156,001 2.72 FOXD4, CBWD1, C9orf66 NA 1

CisR

CGOV53T OVCAR-5- chr9 235,001 280,001 45,001 1.74 NA NA 1

CisR

CGOV53T OVCAR-5- chr9 72,258,001 72,357,001 99,001 1.59 NA NA 3

CisR

CGOV37TJ SK-OV-3 chr3 55,738,001 55,831 ,001 93,001 1.73 NA NA 1

CGOV37TJ SK-OV-3 chr3 55,832,001 55,891 ,001 59,001 1.47 MIR3938 NA 1

CGOV37TJ SK-OV-3 chr3 168,601,001 168,619,001 18,001 1.61 NA ERBB2 2

CGOV37TJ SK-OV-3 chr3 168,620,001 168,695,001 75,001 2.82 NA ERBB2 2

CGOV37TJ SK-OV-3 chr3 168,696,001 168,727,001 31,001 5.24 NA ERBB2 2

CGOV37TJ SK-OV-3 chr3 168,728,001 168,805,001 77,001 1.66 NA ERBB2 2

CGOV37TJ SK-OV-3 chr8 128,277,001 128,318,001 41,001 1.64 NA NA 3

CGOV37TJ SK-OV-3 chr17 37,673,001 37,806,001 133,001 1.65 PPP1 R1 B, NEUROD2 ERBB2 2

CGOV37TJ SK-OV-3 chr17 37,807,001 37,885,001 78,001 2.14 TCAP, PNMT, ERBB2, MIR4728, PGAP3 ERBB2 2

Table S8 Deletions

Related to Figures 3D and 5 and Experimental Procedures. Deletions were identified by segmentation of the normalized read depth. Deletions were called as hemizygous+ or homozygous† if 5 or more rearranged read pairs were identified that support the identification of a deletion. The boundaries of the deletion (Start, End) were refined based on the alignments of the rearranged read pairs. For annotation of affected coding regions, we included all genes that overlapped with the inferred genomic coordinates of the deletion.

Number Previously

Log2 paired Implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV16T chr2 g. 533,232 -0.80 hemizygous _† 10 VWC2L, LOC101928103, NA

(215426360_215426460)_(215959491 _215959591 ) BARD1 , ABCA12

CGOV16T chr5 g.(33324914_33325014)_(33330942_33331042) 6,129 -1.62 hemizygous _† 28 NA NA

CGOV16T chr5 g.(97047904_97048004)_(97095995_97096095) 48,192 -1.67 hemizygous _† 12 NA NA

CGOV16T chr6 g.(26343903_26344003)_(26351413_26351513) 7,611 -0.75 hemizygous _† 15 NA NA

CGOV16T chr9 g.(90817091_90817191 )_(90821828_90821928) 4,838 -7.79 homozygous _† 15 NA NA

CGOV16T chr12 g.(866873_866973)_(874651 _874751 ) 7,879 -1.69 hemizygous _† 9 WNK1 NA

CGOV16T chr13 g.(69244759_69244859)_(69268602_69268702) 23,944 -8.94 homozygous _† 12 NA NA

CGOV16T chr13 g.(71912501_71913501 )_(71920501_71921501) 8,001 -8.82 homozygous 0 NA NA

CGOV16T chr16 g.(73344503_73344603)_(73352006_73352106) 7,604 -9.06 homozygous _† 20 NA NA Number Previously

WO 2020/081549 ^ _paIred PCT/US2019/056299 _Implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV17T chr1 g. 13,114 -0.54 hemizygous _† 6 NA NA

(191661486_191661586)_(191674499J 91674599)

CCOV17T chr2 g. 5,228 -8.18 homozygous 4 NA NA

(109689949J 09690049)_(109695076J 09695176)

CCOV17T chr2 g. 5,145 -1.20 hemizygous _† 11 NA NA

(126814885J 26814985)_(126819929J 26820029)

CCOV17T chr2 g. 161 ,358 -0.44 hemizygous _† 7 LRP1 B, MIR7157 NA

(141314638J 41314738)_(141475895J 41475995)

CCOV17T chr2 g. 244,198 -1.44 overlapping 7 LRP1 B NA

(141782591 _141782691 )_(142026688J 42026788) hemizygous _†

CCOV17T chr2 g. 60,372 -8.80 homozygous 0 LRP1 B NA

(141965917_141966917)_(142026288J 42027288)

CCOV17T chr2 g. 175,807 -8.83 homozygous 0 MIR4776-1, MIR4776-2, NA

(213716368_213717368)_(213892174_213893174) IKZF2

CCOV17T chr2 g. 4,490 -8.54 homozygous _† 10 RHBDD1 NA

(227832551 _227832651 )_(227836940_227837040)

CCOV17T chr3 g.(20311501_20312501 )_(20315501_20316501) 4,001 -7.79 homozygous 0 NA NA

CCOV17T chr4 g.(20386477_20386577)_(20705675_20705775) 319,299 -8.86 homozygous _† 8 SLIT2, SLIT2-IT1 , MIR218-1 , NA

PACRCL

CCOV17T chr4 g. 189,733 -0.69 hemizygous _† 6 RPS3A, SNORD73A, SH3D19 NA

(151957497J 51957597)_(152147129_152147229)

CCOV17T chr4 g. 25,001 -8.97 homozygous 0 NA NA

(161046501J 61047501 )_(161071501_161072501 )

CCOV17T chr6 g.(54846454_54846554)_(54851295_54851395) 4,942 -8.39 homozygous _† 7 NA NA

CCOV17T chr6 g. (69687219_69688219)_(69691315_69692315) 4,097 -8.88 homozygous 0 ADCRB3 NA

CCOV17T chr6 g. 80,512 -8.78 homozygous _† 17 RPS6KA2 NA

(167142424J 67142524)_(167222835J 67222935)

CCOV17T chr8 g.(89809161_89809261)_(90083591_90083691) 274,531 -1.52 hemizygous _† 13 NA NA

CCOV17T chr9 g.(44232501_44233501)_(44264501_44265501) 32,001 -7.14 homozygous 0 NA NA

CCOV17T chr10 g.(90940586_90940686)_(90947863_90947963) 7,378 -1.29 hemizygous _† 18 NA NA

CCOV17T chr11 g.(23454678_23455678)_(23479800_23480800) 25,123 -8.83 homozygous 0 NA NA

CCOV17T chr11 g.(85234699_85234799)_(85542725_85542825) 308,127 -1.18 hemizygous _† 12 TMEM126B, TMEM126A, NA

DLC2, CREBZF, CCDC89,

SYTL2

CC0V17T chr13 g.(80343605_80343705)_(80346833_80346933) 3,329 -6.96 homozygous _† 17 NA NA

CC0V17T chr13 g.(85200001_85200101 )_(85260901_85261001) 61 ,001 -4.32 homozygous 4 NA NA

CC0V17T chr13 g. 13,022 -8.80 homozygous _† 7 COL4A1 NA

(110822820J 10822920)_(110835741 _110835841 )

CC0V17T chr13 g. 207,811 -8.83 homozygous 1 COL4A2, MIR8073, COL4A1 NA

(110838244J 10839244)_(111046054J 11047054)

CC0V17T chr14 g. (67389152_67389252)_(67395409_67395509) 6,358 -8.96 homozygous 4 CPHN NA

CC0V17T chr15 g.(24055436_24055536)_(24061479_24061579) 6,144 -0.48 hemizygous _† 25 NA NA

CC0V17T chr17 g. (29590319_29590419)_(29666366_29666466) 76,148 -8.85 homozygous _† 11 NF1, OMG, EVI2B, EVI2A NF1

CC0V17T chr19 g.(12039036_12040036)_(12045477_12046477) 6,442 -6.80 homozygous 0 ZNF700 NA

CC0V17T chr20 g.(15031714_15031814)_(15079252J 5079352) 47,639 -0.49 hemizygous _† 5 MACRO D2 NA

CC0V17T chr22 g. (46321088_46321188)_(46482539_46482639) 161 ,552 -8.79 homozygous _† 7 LOC730668, PRR34-AS1 , NA

MIRLET7BHC, MIR3619,

WNT7B, LINC00899, PRR34

CC0V17T chrX g. 105,521 -1.44 hemizygous _† 7 ACTRT1 NA

(127145414_127145514)_(127250834J 27250934)

CC0V17T chrX g. 1,038,911 -1.39 hemizygous _† 5 OCRL, SMARCA1 NA

(127630674J 27630774)_(128669484J 28669584) Number Previously

Log2 paired Implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV17T chrX g. 7,001 -5.81 homozygous 4 NA NA

(139495001 _139495101 )_(139501901 _139502001 )

CGOV18T chr1 g. 6,489 -0.69 hemizygous† 28 NA NA

(101774312_101774412)_(101780700J 01780800)

CGOV18T chr1 g. 17,257 -8.96 homozygous† 31 NA NA

(162575449J 62575549)_(162592605J 62592705)

CGOV18T chr2 g. 58,550 -0.48 hemizygous† 8 LRP1 B NA

(141923625J 41923725)_(141982074J 41982174)

CGOV18T chr2 g. 3,599 -1.00 hemizygous† 15 LRP1 B NA

(142325365J 42325465)_(142328863J 42328963)

CGOV18T chr2 g. 4,843 -8.76 homozygous 0 NA NA

(164640715_164641715)_(164645557J 64646557)

CGOV18T chr3 g.(75423501_75424501)_(75639501_75640501) 216,001 -6.74 homozygous 0 FAM86DP NA

CGOV18T chr3 g. 69,303 -8.80 homozygous† 5 NA NA

(116318845J 16318945)_(116388047J 16388147)

CGOV18T chr3 g. 104,482 -8.81 homozygous† 7 MIR4447 NA

(116483786J 16483886)_(116588167_116588267)

CGOV18T chr3 g. 3,655 -5.60 homozygous 4 RNF13 NA

(149585200J 49585300)_(149588754J 49588854)

CGOV18T chr3 g. 186,391 -8.89 homozygous† 60 MECOM NA

(168898366J 68898466)_(169084656J 69084756)

CGOV18T chr4 g.(90559345_90559445)_(90563418_90563518) 4,174 -8.78 homozygous† 16 NA NA

CGOV18T chr4 g. 183,784 -8.81 homozygous† 27 LINC00290 NA

(181992235J 81992335)_(182175918_182176018)

CGOV18T chr7 g. 120,819 -2.34 hemizygous† 19 MGAM, MGAM2 NA

(141744316_141744416)_(141865034J 41865134)

CGOV18T chr8 g.(94955418_94955518)_(94960757_94960857) 5,440 -1.16 hemizygous† 6 NA NA

CGOV18T chr8 g. 6,186 -1.05 hemizygous† 22 CSMD3 NA

(114040518_114040618)_(114046603J 14046703)

CGOV18T chr9 g.(9541307_9541407)_(9698897_9698997) 157,691 -1.00 hemizygous† 6 PTPRD NA

CGOV18T chr11 g.(3238797_3238897)_(3243910_3244010) 5,214 -8.61 homozygous† 11 MRGPRG-AS1 , MRGPRG NA

CGOV18T chr14 g.(84183968_84184068)_(84477397_84477497) 293,530 -0.97 hemizygous† 16 NA NA

CGOV18T chr18 g.(41976805_41976905)_(41981953_41982053) 5,249 -8.77 homozygous† 8 LINC01478 NA

CGOV18T chr20 g. (52647133_52647233)_(52657827_52657927) 10,795 -1.63 hemizygous† 55 BCAS1 NA

CGOV18T chrX g.(30470501_30471501)_(30480501_30481501) 10,001 -8.72 homozygous 0 NA NA

CGOV18T chrX g.(30728384_30728484)_(31382222_31382322) 653,939 -2.05 hemizygous† 11 GK, TAB3, FTHL17, DMD NA

CGOV18T chrX g.(53513501_53514501 )_(53518501_53519501) 5,001 -7.73 homozygous 0 NA NA

CGOV18T hrX g.(96345362_96345462)_(96491606_96491706) 146,345 -8.78 homozygous† 5 DIAPH2 NA

CGOV21T chr1 g.(26460207_26460307)_(26464652_26464752) 4,546 -7.12 homozygous† 5 NA NA

CGOV21T chr3 g.(60372339_60372439)_(60725881_60725981) 353,643 -8.77 homozygous† 12 FHIT, MIR548BB NA

CGOV21T chr7 g. 11 ,532 -0.68 hemizygous† 13 NA NA

(118292669J 18292769)_(118304100_118304200)

CGOV21T chr8 g.(97551060_97551160)_(97742085_97742185) 191 ,126 -0.83 hemizygous† 14 SDC2. CPQ NA

CGOV21T chr8 g. 303,636 -1.03 hemizygous† 21 ZFPM2, ZFPM2-AS1 NA

(106653250J 06653350)_(106956785J 06956885)

CGOV21T chr9 g.(44248501_44249501)_(44790501_44791501) 542,001 -8.74 homozygous 0 LOC101927827, NA

LOC103908605

CGOV21T chr14 g.(98030843_98030943)_(99417216_99417316) 1,386,474 -1.06 hemizygous† 7 LOC101929241, C14orf177, NA

LOC100129345, LINC01550

CGOV21T chr16 g.(83920397_83920497)_(84074537_84074637) 154,241 -1.11 hemizygous† 11 MLYCD, OSGIN1, NECAB2, NA

SLC38A8 Number Previously

WO 2020/081549 Log2 paired PCT/US2019/056299 implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV21T chr16 g.(8726S770_8726S870)_(87272S06_87272606) 6,837 -0.99 hemizygous† 5 NA NA

CCOV21T chr18 g.(400S4143_400S4243)_(400S7497_400S7S97) 3,455 -6.68 homozygous† 9 LINC00907 NA

CCOV21T chr20 g.(7398773_7398873)_(7403434_7403534) 4,762 -8.86 homozygous† 26 NA NA

CCOV23T chr3 g.(15049874_15049974)_(15135111_15135211) 85,338 -1.29 hemizygous† 8 NR2C2, MRPS25, RBSN NA

CCOV23T chr4 g.(3895501_3896501)_(4153501_4154501) 258,001 -6.91 homozygous 0 FAM86EP NA

CCOV23T chr4 g.(5615038_5615138)_(5644533_5644633) 29,596 -1.33 hemizygous† 7 EVC2 NA

CCOV23T chr4 g. 365,608 -1.34 hemizygous+ 5 PRSS48, FAM160A1 NA

(152204141 _152204241 )_(152569648J 52569748)

CCOV23T chr4 g. 6,282 -8.01 homozygous† 12 MARCH1 NA

(164612926J 64613026)_(164619107_164619207)

CCOV23T chr4 g. 182,747 -1.31 hemizygous† 6 MARCH1 NA

(164872420J 64872520)_(165055066J 65055166)

CCOV23T chr6 g.(2568234_2568334)_(2571823_2571923) 3,690 -6.59 homozygous† 9 NA NA

CCOV23T chr6 g. 480,202 -1.28 hemizygous† 7 PEX7, SLC35D3, MAP3K5, NA

(137069374J 37069474)_(137549475J 37549575) NHEG1 , IL20RA, IL22RA2,

IFNGR1

CCOV23T chr9 g.(21958656_21958756)_(22063510_22063610) 104,955 -1.41 overlapping 12 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A, hemizygous† CDKN2A, CDKN2B CDKN2B

CCOV23T chr9 g.(21958156_21959156)_(21992501_21993501) 34,346 -8.48 homozygous 0 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A

CDKN2A

CCOV23T chr9 g.(78004351_78004451)_(78011639_78011739) 7,389 -1.21 hemizygous† 16 NA NA

CCOV23T chr9 g.(97451386_97451486)_(97465908_97466008) 14,623 -0.36 hemizygous† 20 NA NA

CCOV23T chr10 g.(53665015_53665115)_(53863090_53863190) 198,176 -1.31 hemizygous† 6 PRKG1 NA

CCOV23T chr11 g.(49709850_49709950)_(49757566_49757666) 47,817 -2.12 hemizygous† 8 LOC440040 NA

CCOV23T chr11 g.(93020222_93020322)_(93029805_93029905) 9,684 -2.02 hemizygous† 5 NA NA

CCOV23T chr12 g.(866868_866968)_(874636_874736) 7,869 -1.41 hemizygous† 14 WNK1 NA

CCOV23T chr15 g.(74016851_74017851)_(74025774_74026774) 8,924 -8.39 homozygous 0 C15orf59 NA

CCOV23T chr16 g.(78686083_78686183)_(79072508_79072608) 386,526 -0.72 hemizygous† 5 WWOX NA

CCOV23T chr17 g.(75038653_75038753)_(75158148_75158248) 119,596 -0.40 hemizygous† 12 SNHG20, SEC14L1 , NA

SCARNA16, MIR6516

CGOV23T chr19 g.(4008434_4008534)_(4084764_4084864) 76,431 -8.29 homozygous† 8 PIAS4, ZBTB7A NA

CGOV23T chr20 g.(7398765_7398865)_(7403432_7403532) 4,768 -1.23 hemizygous† 14 NA NA

CGOV23T chr20 g.(14781484_14781584)_(14827331J 4827431) 45,948 -1.36 hemizygous† 9 MACRO D2 NA

CGOV25T chr1 g.(30479718_30479818)_(30489321_30489421) 9,704 -8.45 homozygous† 6 LOC101929406 NA

CGOV25T chr1 g.(72377134_72377234)_(72471536_72471636) 94,503 -1.58 hemizygous† 25 NEGR1 NA

CGOV25T chr2 g.(14704234J 4704334)_(14709948_14710048) 5,815 -1.54 hemizygous† 19 NA NA

CGOV25T chr2 g. 163,404 -0.78 overlapping 14 LRP1 B NA

(141878286J 41878386)_(142041589_142041689) hemizygous†

CGOV25T chr2 g. 165,217 -1.63 overlapping 19 LRP1 B NA

(141974556J 41974656)_(142139672J 42139772) hemizygous†

CGOV25T chr2 g. 67,134 -8.65 homozygous 0 LRP1 B NA

(141974056J 41975056)_(142041189_142042189)

CGOV25T chr3 g.(4385597_4385697)_(4455795_4455895) 70,299 -0.67 hemizygous† 5 SUMF1 NA

CGOV25T chr3 g. 96,696 -9.01 homozygous† 13 LSAMP NA

(116153523J 16153623)_(116250118_116250218)

CGOV25T chr3 g. 593,584 -9.03 homozygous† 13 TUSC7, LINC00901 , NA

(116376722J 16376822)_(116970205J 16970305) MIR4447 Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV2ST chr7 g.(42019946_42020046)_(42162089_42162189) 142,244 -0.67 hemizygous† 11 GLI3 NA

CCOV2ST chr7 g. 189,439 -0.69 hemizygous† 8 DPP6 NA

(153920400J S3920S00)_(154109738J 54109838)

CCOV25T chr8 g.(3662157_3662257)_(3730050_3730150) 67,994 -1.87 hemizygous† 17 CSMD1 NA

CCOV25T chr10 g.(56263776_56263876)_(56332079_56332179) 68,404 -0.56 hemizygous† 15 PCDH15 NA

CCOV25T chr10 g.(97027671_97027771)_(97044788_97044888) 17,218 -0.62 hemizygous† 10 PDLIM1 NA

CCOV25T chr12 g.(99695055_99695155)_(99927923_99928023) 232,969 -1.68 overlapping 20 ANKS1 B NA hemizygous†

CCOV25T chr12 g.(99694555_99695555)_(99727384_99728384) 32,830 -8.72 homozygous 0 ANKS1 B NA

CCOV25T chr12 g.(99793970_99794070)_(99802652_99802752) 8,783 -8.74 homozygous 4 ANKS1 B NA

CCOV25T chr12 g.(99917238_99918238)_(99927523_99928523) 10,286 -8.66 homozygous 0 ANKS1 B NA

CCOV25T chr13 g.(35558501_35559501)_(35562501_35563501) 4,001 -8.56 homozygous 3 NBEA NA

CCOV25T chr14 g.(33502125_33502225)_(33806675_33806775) 304,651 -1.42 hemizygous† 11 NPAS3 NA

CCOV25T chr16 g.(81175878_81175978)_(81188246_81188346) 12,469 -7.96 homozygous† 11 PKD1 L2 NA

CCOV25T chr20 g.(6589166_6589266)_(6614154_6614254) 25,089 -1.43 hemizygous† 10 NA NA

CCOV25T chr20 g.(14920162_14920262)_(15024789J 5024889) 104,728 -0.64 hemizygous† 9 MACRO D2 NA

CCOV25T chrX g.(6725420_6725520)_(7140011_7140111) 414,692 -1.63 hemizygous† 7 MIR4767, STS, HDHD1 NA

CCOV25T chrX g.(34043060_34043160)_(34072729_34072829) 29,770 -1.55 hemizygous† 14 NA NA

CCOV28T chr3 g. 10,183 -1.10 hemizygous+ 52 NA NA

(160355949J 60356049)_(160366031 _160366131 )

CCOV28T chr4 g. 25,120 -9.05 homozygous† 12 NA NA

(175961671 _175961771 )_(175986690J 75986790)

CCOV28T chr6 g.(14494026J 4494126)_(14499739_14499839) 5,814 -8.80 homozygous† 14 NA NA

CCOV28T chr6 g. 37,213 -8.86 homozygous† 11 SCAF8, MIR1273C NA

(155135096J 55135196)_(155172208J 55172308)

CCOV28T chr7 g. 442,223 -0.66 hemizygous† 10 EXOC4. LOC101928861 NA

(133260013_133260113)_(133702135_133702235)

CCOV28T chr7 g. 8,879 -0.98 hemizygous† 10 NA NA

(151590831J 51590931 )_(151599609J 51599709)

CCOV28T chr7 g. 6,550 -1.04 hemizygous† 14 PTPRN2 NA

(157591843_157591943)_(157598292J 57598392)

CCOV28T chr8 g.(2440119_2440219)_(2470609_2470709) 30,591 -0.80 hemizygous† 11 LOCI 01927815 NA

CCOV28T chr8 g.(9862648_9862748)_(9880889_9880989) 18,342 -0.88 hemizygous† 9 NA NA

CCOV28T chr9 g.(7827533_7827633)_(7846534_7846634) 19,102 -8.86 homozygous† 14 NA NA

CCOV28T chr9 g.(23289601_23290601)_(23299358_23300358) 9,758 -8.88 homozygous 1 NA NA

CCOV28T chr9 g. 31 ,590 -8.83 homozygous† 19 ADAMTSL2 NA

(136396620J 36396720)_(136428109_136428209)

CCOV28T chr10 g.(37020375_37020475)_(37030380_37030480) 10,106 -0.82 hemizygous† 12 NA NA

CCOV28T chr10 g.(90543987_90544987)_(90571212_90572212) 27,226 -8.89 homozygous 2 LI PM NA

CCOV28T chr10 g. 4,902 -8.40 homozygous 3 NA NA

(105715355J 05716355)_(105720256J 05721256)

CCOV28T chr11 g.(42252030_42252130)_(42266836_42266936) 14,907 -0.96 hemizygous† 13 LOC100507205 NA

CCOV28T chrX g.(46468558_46469558)_(46471706_46472706) 3,149 -7.69 homozygous 1 SLC9A7 NA

CCOV28T chrX g. 8,141 -8.35 homozygous 0 NA NA

(136185614_136186614)_(136193754J 36194754)

CCOV28T chrX g. 17,001 -8.89 homozygous 0 NA NA

(154392501 _154393501 )_(154409501 _154410501 )

CCOV30T chr2 g. 313,736 -1.31 hemizygous† 1 1 FSIP2, LINC01473 NA

(186644331J 86644431 )_(186957966J 86958066) Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV30T chr3 g.(7634615_763471 S)_(78302S6_78303S6) 195,742 -1.20 hemizygous+ 9 GRM7 NA

CCOV30T chr3 g. 14,665 -1.17 hemizygous+ 6 NA NA

(153599268J S3S99368)_(153613832J 53613932)

CCOV30T chr4 g.(16043746J 6043846)_(16051820_16051920) 8,175 -8.53 homozygous† 7 PROM1 NA

CCOV30T chr4 g.(31463501_31464501)_(31467501_31468501) 4,001 -8.53 homozygous 1 NA NA

CCOV30T chr4 g. 95,729 -1.32 hemizygous† 6 ARHGEF38, ARHGEF38-IT1 NA

(106418218_106418318)_(106513846J 06513946)

CCOV30T chr4 g. 633,491 -1.33 hemizygous† 5 EDNRA, TMEM184C, NA

(148274180_148274280)_(148907570J 48907670) ARHGAP10, MIR4799,

PRMT9

CCOV30T chr6 g.(73345273_73345373)_(73521299_73521399) 176,127 -1.29 hemizygous† 5 KCNQ5, KCNQ5-IT1 NA

CCOV30T chr6 g. 9,712 -8.52 homozygous† 9 NA NA

(122159169_122159269)_(122168780J 22168880)

CCOV30T chr7 g.(8118612_8118712)_(8192039_8192139) 73,528 -1.35 hemizygous† 5 GLCCI1, ICA1 NA CCOV30T chr8 g.(20101643_20101743)_(20114694_20114794) 13,152 -1.40 hemizygous† 5 LZTS1 NA

CCOV30T chr8 g. 6,550 -8.42 homozygous† 23 NA NA

(142927661 _142927761 )_(142934110_142934210)

CCOV30T chr9 g.(72832227_72832327)_(73061137_73061237) 229,011 -1.36 hemizygous† 6 MAMDC2, SMC5, SMC5-AS1 , NA

KLF9

CCOV30T chr9 g. 306,239 -8.47 homozygous 0 RALGPS1 , GARNL3, NA

(129753263J 29754263)_(130059501 _130060501 ) ANGPTL2

CCOV30T chr9 g. 80,280 -8.41 homozygous† 13 LRSAM1, FAM129B NA

(130243462J 30243562)_(130323641 _130323741 )

CCOV30T chr9 g. 40,876 -8.41 homozygous 0 ENG, AK1, MIR4672 NA

(130595085J 30596085)_(130635960J 30636960)

CCOV30T chr9 g. 12,008 -8.42 homozygous 3 PRRX2 NA

(132442256J 32443256)_(132454263J 32455263)

CCOV30T chr12 g. 221 ,730 -1.52 hemizygous† 10 TMEM120B, SETD1 B, NA

(122155247J 22155347)_(122376876J 22376976) PSMD9, WDR66, RHOF,

LINC01089, HPD

CCOV30T chr14 g.(80803045_80803145)_(80914933_80915033) 111 ,989 -1.31 hemizygous† 5 DI02-AS1 NA

CCOV30T chr15 g.(63697036_63698036)_(63701360_63702360) 4,325 -6.94 homozygous 2 LOC102723344 NA

CCOV30T chr15 g.(75029360_75029460)_(75172915_75173015) 143,656 -8.43 homozygous† 8 CYP1A2, CSK, LMAN1 L, NA

CPLX3, MIR4513, ULK3,

MIR6882, SCAMP2

CCOV30T chr20 g.(14134326J 4134426)_(14142623J 4142723) 8.398 -8.48 homozygous† 11 MACRO D2 NA

CCOV30T chr21 g.(44023501_44024501)_(44038501_44039501) 15,001 -8.53 homozygous 0 LOC101928233 NA

CCOV30T chr22 g.(30882816_30882916)_(30885793_30885893) 3,078 -6.28 homozygous† 12 SEC14L4 NA

CCOV30T chr22 g.(40883801_40884801)_(40894559_40895559) 10,759 -8.56 homozygous 0 MKL1 NA

CCOV30T chr22 g.(50683538_50684538)_(50690839_50691839) 7,302 -8.43 homozygous 0 TUBGCP6, HDAC10, NA

MAPK12

CCOV30T chr22 g.(50706820_50707820)_(50714143_50715143) 7,324 -7.94 homozygous 0 MAPK11 , PLXNB2 NA

CCOV30T chr22 g.(50974351_50975351)_(50977749_50978749) 3.399 -6.97 homozygous 0 ODF3B NA

CCOV30T chrX g.(23266755_23266855)_(23330923_23331023) 64,269 -8.55 homozygous† 16 PTCHD1-AS NA

CCOV30T chrX g.(31837277_31837377)_(31894267_31894367) 57,091 -1.34 hemizygous† 5 DMD NA

CCOV30T chrX g. 455,995 -1.28 hemizygous† 6 SMARCA1 NA

(128154820J 28154920)_(128610714_128610814)

CCOV30T chrX g. 15,159 -1.38 hemizygous† 8 NA NA

(130731297_130731397)_(130746355J 30746455)

CCOV30T chrX g. 4,237 -8.54 homozygous† 15 FGF13 NA

(138263632J 38263732)_(138267768J 38267868) Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV32T chr2 g. 3,664 -7.57 homozygous† 8 NA NA

(153796005J 53796105)_(153799568J 53799668)

CGOV32T chr2 g. 7,926 -1.54 hemizygous† 18 ERBB4 ERBB4

(213184021 _213184121 )_(213191846_213191946)

CGOV32T chr2 g. 6,322 -1.40 hemizygous† 20 NA NA

(226832018_226832118)_(226838239_226838339)

CGOV32T chr3 g. 142,547 -1.87 hemizygous† 10 LSAMP NA

(115736880J 15736980)_(115879326J 15879426)

CGOV32T chr3 g. 27,587 -1.30 hemizygous† 18 NA NA

(175887258J 75887358)_(175914744J 75914844)

CGOV32T chr5 g.(87378945_87379045)_(87381902_87382002) 3,058 -8.61 homozygous† 33 NA NA

CGOV32T chr6 g.(14712629_14712729)_(16058481_16058581) 1,345,953 -8.53 homozygous† 15 JARID2, JARID2-AS1, NA

DTNBP1

CCOV32T chr6 g.(39068610_39068710)_(39072708_39072808) 4,199 -8.56 homozygous† 10 SAYSD1 NA

CCOV32T chr6 g.(57284962_57285062)_(57289212_57289312) 4,351 -0.51 hemizygous† 10 PRIM2 NA

CCOV32T chr6 g. 4,371 -8.61 homozygous† 12 GRIK2 NA

(101934624J 01934724)_(101938894J 01938994)

CCOV32T chr6 g. 18,141 -8.62 homozygous† 10 NA NA

(110396120_110396220)_(110414160_110414260)

CCOV32T chr6 g. 4,815 -8.62 homozygous† 8 PTPRK NA

(128432727J 28432827)_(128437441 _128437541 )

CCOV32T chr6 g. 105,956 -8.48 homozygous† 6 EZR-AS1, C6orf99, EZR, NA

(159212184_159212284)_(159318039J 59318139) OSTCP1

CCOV32T chr7 g. 2,944 -0.55 hemizygous† 14 CUX1 NA

(101724549J 01724649)_(101727392J 01727492)

CCOV32T chr9 g. 17,107 -8.60 homozygous† 14 NA NA

(121861410_121861510)_(121878416_121878516)

CCOV32T chr11 g. 11 ,001 -8.29 homozygous 0 CWF19L2 NA

(107231501 _107232501 )_(107242501 _107243501 )

CCOV32T chr11 g. 19,576 -8.45 homozygous† 8 TMPRSS4, TMPRSS4-AS1 NA

(117923302J 17923402)_(117942777J 17942877)

CCOV32T chr12 g.(27648190_27648290)_(27655003_27655103) 6,914 -0.56 hemizygous† 17 SMC02 NA

CCOV32T chr14 g.(85454792_85454892)_(85547158_85547258) 92,467 -0.50 hemizygous† 10 NA NA

CCOV32T chr14 g.(91810963_91811063)_(91987467_91987567) 176,605 -1.43 hemizygous† 20 CCDC88C, PPP4R3A NA

CCOV32T chr18 g.(40054133_40054233)_(40057514_40057614) 3,482 -6.44 homozygous† 12 LINC00907 NA

CCOV32T chrX g.(26543501_26544501)_(29198501_29199501) 2,655,001 -8.67 homozygous 0 VENTXP1, DCAF8L2, NA

MAGEB10, IL1 RAPL1,

PPP4R3CP, DCAF8L1 ,

MIR6134

Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV34T chr4 g. 4,889 -8.70 homozygous 0 NA NA

(112237002J 12238002)_(112241890_112242890)

CCOV34T chrS g.(17600501_17601501 )_(17643501_17644501) 43,001 -8.76 homozygous 0 NA NA

CCOV34T chr6 g.(2568252_2568352)_(2571823_2S71923) 3,672 -6.88 homozygous† 18 NA NA

CCOV34T chr6 g.(41442616_41442716)_(41447949_41448049) 5,434 -1.08 hemizygous† 7 NA NA

CCOV34T chr6 g. 5,001 -3.39 homozygous 0 NA NA

(142237501 _142238501 )_(142242501 _142243501 )

CCOV34T chr6 g. 6,496 -9.87 homozygous† 22 RAB32 NA

(146869348J 46869448)_(146875743J 46875843)

CCOV34T chr7 g.(85044501_85045501)_(85046501_85047501) 2,001 -6.07 homozygous 0 NA NA

CCOV34T chr7 g. 9,881 -0.95 hemizygous† 22 PLXNA4 NA

(132136647J 32136747)_(132146427J 32146527)

CCOV34T chr8 g.(2508866_2508966)_(2526090_2526190) 17,325 -8.81 homozygous† 14 LOCI 01927815 NA

CCOV34T chr8 g.(16262079_16262179)_(16274536J 6274636) 12,558 -0.81 hemizygous† 14 NA NA

CCOV34T chr9 g.(20919501_20920501)_(23847501_23848501) 2,928,001 -8.85 homozygous 0 FOCAD, IFNA8, IFNA1, CDKN2A,

MTAP, CDKN2A-AS1 , CDKN2B

CDKN2B-AS1, DMRTA1 ,

LINC01239, HACD4, IFNB1 , IFNW1, IFNA21, IFNA4,

IFNA7, IFNA10, IFNA16,

IFNA17, IFNA14, IFNA22P,

IFNA5, KLHL9, IFNA6,

IFNA13, IFNA2, MIR31 HC,

IFNE, MIR31, CDKN2A,

CDKN2B, LOC101929563,

ELAVL2

CCOV34T chr9 g. 5,923 -8.93 homozygous† 19 NA NA

(115661708_115661808)_(115667530J 15667630)

CCOV34T chr10 g.(24147354_24147454)_(24156837_24156937) 9,584 -4.93 homozygous† 20 KIAA1217 NA

CCOV34T chr10 g.(88380446_88380546)_(88402375_88402475) 22,030 -0.88 hemizygous† 10 NA NA

CCOV34T chr11 g.(46819792_46819892)_(46835963_46836063) 16,272 -0.62 hemizygous† 17 CKAP5 NA

CCOV34T chr11 g.(47612771_47612871)_(47635915_47636015) 23,245 -0.89 hemizygous† 8 FAM180B. C1QTNF4, NA

MTCH2

CCOV34T chr11 g.(49116350_49116450)_(49119531_49119631) 3,282 -0.76 hemizygous† 8 NA NA

CCOV34T chr11 g.(49709847_49709947)_(49757556_49757656) 47,810 -0.88 hemizygous† 9 LOC440040 NA

CCOV34T chr11 g. 6,813 -0.68 hemizygous† 13 GRIA4 NA

(105612470J 05612570)_(105619182_105619282)

CCOV34T chr11 g. 33,284 -0.74 hemizygous† 17 CUCY1A2 NA

(106551771 _106551871 )_(106584954J 06585054)

CCOV34T chr11 g. 12,131 -0.91 hemizygous† 19 NA NA

(116255656J 16255756)_(116267686J 16267786)

CCOV34T chr12 g. 49,892 -0.96 hemizygous† 9 CLT1 D1 NA

(129405278J 29405378)_(129455069J 29455169)

Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV44T chr2 g.(60525347_60525447)_(60532673_60532773) 7,427 -1.43 hemizygous† 8 NA NA

CCOV44T chr2 g.(95730268_95731268)_(95736462_95737462) 6,195 -8.70 homozygous 3 NA NA

CCOV44T chr3 g. 162,578 -0.57 hemizygous† 19 NA NA

(117122100_117122200)_(117284577J 17284677)

CCOV44T chr4 g.(22602001_22602101)_(22605901_22606001) 4,001 -7.80 homozygous 4 NA NA

CCOV44T chr4 g.(26289989_26290989)_(26294876_26295876) 4,888 -8.81 homozygous 1 NA NA

CCOV44T chr4 g.(40377081_40377181)_(40440094_40440194) 63,114 -8.75 homozygous† 14 RBM47 NA

CCOV44T chr4 g.(92857501_92858501)_(92945501_92946501) 88,001 -8.76 homozygous 0 NA NA

CCOV44T chr5 g.(41226856_41226956)_(41243798_41243898) 17,043 -0.51 hemizygous† 18 C6 NA

CCOV44T chr5 g. 5,067 -7.23 homozygous 1 NA NA

(180590874J 80591874)_(180595940J 80596940)

CCOV44T chr6 g.(77016759_77016859)_(77028997_77029097) 12,339 -1.37 hemizygous† 16 NA NA

CCOV44T chr6 g. 14,753 -0.67 hemizygous† 25 NA NA

(169506347J 69506447)_(169520999J 69521099)

CCOV44T chr7 g.(2902501_2903501)_(5191501_5192501) 2,289,001 -8.67 homozygous 0 SDK1 , FOXK1 , AP5Z1 , NA

RNF216P1 , RBAK, RBAK- RBAKDN, RBAKDN,

CARD11, LOC100129603,

MIR4656, RADIL, PAPOLB, MMD2, ZNF890P

CGOV44T chr7 g.(5205501_5206501)_(5291501_5292501) 86,001 -8.62 homozygous 0 WIPI2 NA

CGOV44T chr7 g.(5337501_5338501)_(5512501_5513501) 175,001 -8.53 homozygous 0 SLC29A4, TNRC18, FBXL18 NA

CGOV44T chr7 g.(97635501_97636501)_(97874501_97875501) 239,001 -8.57 homozygous 0 LMTK2, BHLHA15, TECPR1 NA

CGOV44T chr7 g. 24,359 -8.71 homozygous 3 NA NA

(152251843_152252843)_(152276201 _152277201 )

CGOV44T chr14 g.(72805851_72805951 )_(72810773_72810873) 5,023 -1.24 hemizygous† 8 RGS6 NA

CGOV44T chr15 g. (63201003_63201103)_(63209143_63209243) 8,241 -8.79 homozygous† 51 NA NA

CGOV44T chr17 g.(29447326_29448326)_(29705997_29706997) 258,672 -8.89 homozygous 0 NF1, OMG, EVI2B, EVI2A NF1

CGOV44T chr20 g.(37008042_37009042)_(37014845_37015845) 6,804 -8.24 homozygous 0 LBP NA

CGOV44T chr21 g.(17874424_17874524)_(17891690_17891790) 17,367 -1.47 hemizygous† 13 MIR99AHG NA

CGOV44T chr22 g.(24873967_24874067)_(24886524_24886624) 12,658 -8.82 homozygous† 6 UPB1 , ADORA2A-AS1 NA

CGOV44T chrX g.(56811501_56812501 )_(56861501_56862501) 50,001 -3.48 homozygous 0 LINC01420 NA

CGOV44T chrX g.(92796360_92796460)_(92801380_92801480) 5,121 -1.17 hemizygous† 17 NA NA

CGOV45T chr1 g.(72755761_72755861 )_(72763911_72764011) 8,251 -8.70 homozygous† 23 NA NA

CGOV45T chr4 g.(29035847_29035947)_(29140721_29140821) 104,975 -0.87 hemizygous† 5 NA NA

CGOV45T chr4 g. 7,095 -1.63 hemizygous† 12 NA NA

(134385737J 34385837)_(134392731 _134392831 )

CGOV45T chr4 g. 336,873 -0.92 hemizygous† 6 TMEM184C, ARHGAP10, NA

(148551875_148551975)_(148888647J 48888747) MIR4799, PRMT9

CGOV45T chr5 g. (58400155_58400255)_(58878623_58878723) 478,569 -1.77 hemizygous† 9 PDE4D NA

CGOV45T chr6 g.(77438501_77439501)_(77452501_77453501) 14,001 -7.80 homozygous 0 NA NA

CGOV45T chr6 g. 544,490 -0.76 hemizygous† 9 PARK2 NA

(161817300J 61817400)_(162361689_162361789)

CGOV45T chr9 g. 143,083 -0.80 hemizygous† 8 EPB41 L4B, PTPN3 NA

(112048997J 12049097)_(112191979_112192079)

CGOV45T chr13 g.(19449094_19450094)_(19641121_19642121) 192,028 -8.77 homozygous 0 LINC00408, LINC00442, NA

ANKRD20A9P Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV45T chr13 g.(1965182S_196S282S)_(207S4429_207SS429) 1,102,605 -8.77 homozygous 0 RNU6-52P, LOC101928697, NA

LINC00421, LINC00350,

MPHOSPH8, ZMYM2,

LINC01072, TUBA3C,

ANKRD26P3, TPTE2, PSPC1 , ZMYMS, GJA3

CCOV4ST Chris g.(45153623_45154623)_(45159015_45160015) 5,393 -7.94 homozygous 0 NA NA

CCOV45T chr19 g.(40329972_40330072)_(40334288_40334388) 4,417 -1.43 hemizygous† 54 FBL NA

CCOV45T chr22 g.(40812967_40813067)_(40960092_40960192) 147,226 -0.74 hemizygous† 8 LOC101927257, MKL1 NA

CCOV45T chrX g.(32250501_32251501)_(32254501_32255501) 4,001 -7.17 homozygous 0 DMD NA

CCOV45T chrX g.(79977350_79977450)_(80201290_80201390) 224,041 -1.78 hemizygous† 6 BRWD3 NA

CCOV46T chr1 g.(39128575_39128675)_(39137102_39137202) 8,628 -1.45 hemizygous† 9 NA NA

CCOV46T chrS g.(11128325_11128425)_(11135083_11135183) 6,859 -1.59 hemizygous† 15 CTNND2 NA

CCOV46T chrS g.(58845780_58845880)_(59135606_59135706) 289,927 -1.57 hemizygous† 12 PDE4D NA

CCOV46T chr6 g.(770167S0_770168S0)_(77028996_77029096) 12,347 -0.43 hemizygous† 9 NA NA

CCOV46T chr9 g.(19770501_19771501)_(20340501_20341501) 570,001 -8.77 homozygous 0 SLC24A2, MLLT3 NA

CCOV46T chr9 g.(20341 S01_20342S01)_(21806S01_21807S01) 1,465,001 -7.92 homozygous 0 FOCAD, MIR491, IFNA8, NA

IFNA1 , MTAP, MLLT3,

MIR4473, MIR4474, FOCAD- AS1 , HACD4, IFNB1, IFNW1, IFNA21, IFNA4, IFNA7,

IFNA10, IFNA16, IFNA17,

IFNA14, IFNA22P, IFNA5,

KLHL9, IFNA6, IFNA13,

IFNA2, MIR31 HG, IFNE,

MIR31

CGOV46T chr9 g.(21806526_21807526)_(26655233_26656233) 4,848,708 -8.87 homozygous 0 MTAP, CDKN2A-AS1 , CDKN2A,

CDKN2B-AS1, DMRTA1 , CDKN2B LINC01239, LINC01241 ,

LOC100506422, CDKN2A,

CDKN2B. LOC101929563,

ELAVL2, IZUM03, TUSC1

CCOV46T chr14 g.(7280S866_7280S966)_(7281076S_7281086S) 5,000 -1.17 hemizygous† 11 RGS6 NA

CCOV46T chr14 g. 6,197 -0.50 hemizygous† 13 YY1, MIR6764 NA

(100733823J 00733923)_(100739919_100740019)

CCOV46T chr16 g.(600811 S7_600812S7)_(60098400_60098S00) 17,344 -0.89 hemizygous† 9 LOC101927580 NA

CCOV46T chr18 g.(6674S661_6674S761)_(667S6849_667S6949) 11 ,289 -8.75 homozygous† 11 NA NA

CCOV46T chr20 g.(37008031_37009031)_(37014845_37015845) 6,815 -8.73 homozygous 0 LBP NA

CCOV46T chr21 g.(48092501_48093S01)_(48099S01_48100S01) 7,001 -7.25 homozygous 0 NA NA

CCOV46T chrX g. 8,960 -0.74 hemizygous† 24 NA NA

(143628756J 436288S6)_(14363761 S_143637715)

Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV47T chrS g.(9519086_9519186)_(9541565_9541665) 22,580 -0.60 hemizygous† 10 CTD-2201 E9.1 , SNHC18, NA

SEMA5A

CGOV47T chr5 g.(19809241_19809341 )_(19814977J 9815077) 5,837 -1.68 hemizygous† 13 CDH18 NA

CGOV47T chr5 g.(41226884_41226984)_(41243801_41243901) 17,018 -0.68 hemizygous† 17 C6 NA

CGOV47T chr5 g.(96247341_96248341)_(96257220_96258220) 9,880 -8.51 homozygous 1 ERAP2 NA

CGOV47T chr5 g. 5,894 -6.82 homozygous† 11 NA NA

(170760162_170760262)_(170765955J 70766055)

CGOV47T chr6 g.(71648501_71649501 )_(71652501_71653501) 4,001 -8.02 homozygous 0 B3GAT2 NA

CGOV47T chr7 g. 3,701 -7.41 homozygous 3 SMO, AHCYL2 SMO

(128857006J 28858006)_(128860706J 28861706)

CGOV47T chr8 g.(42397231_42397331)_(42402702_42402802) 5,572 -1.32 hemizygous† 15 SMIM19, SLC20A2 NA

CGOV47T chr9 g.(21879213_21880213)_(30059468_30060468) 8,180,256 -8.59 homozygous 0 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A,

DMRTA1 , LINC01239, CDKN2B

LINC01241, LOC100506422,

IFT74, TEK, IFNK, CDKN2A, CDKN2B. LOC101929563,

ELAVL2, IZUM03, TUSC1 ,

CAAP1 , PLAA, IFT74-AS1 ,

LRRC19, LINC00032, EQTN,

MOB3B, C9orf72, LINC02,

MIR876, MIR873

CCOV47T chr9 g· 3,887 -7.41 homozygous† 10 PAPPA NA

(119016898J 19016998)_(119020684J 19020784)

CCOV47T chr10 g.(77463909_77464009)_(78040863_78040963) 577,055 -1.63 hemizygous† 18 C10orf11 NA

CCOV47T chr10 g.(83901865_83901965)_(85290509_85290609) 1,388,745 -0.83 hemizygous† 6 NRG3, NRG3-AS1 NA

CCOV47T chr14 g.(41552735_41552835)_(41579743_41579843) 27,109 -0.64 hemizygous† 18 LOC644919 NA

CCOV47T chr15 g.(73858030_73858130)_(73922322_73922422) 64,393 -1.52 hemizygous† 11 NPTN, NPTN-IT1 NA

CCOV47T chr15 g.(77451538_77451638)_(77462213_77462313) 10,776 -8.36 homozygous† 32 PEAK1 NA

CCOV47T chr16 g.(60081169_60081269)_(60098425_60098525) 17,357 -8.44 homozygous† 22 LOC101927580 NA

CCOV47T chr17 g.(58239224_58239324)_(58250351_58250451) 11 ,228 -1.58 hemizygous† 11 CA4, USP32 NA

CCOV47T chr17 g.(62686931_62687031)_(62691831_62691931) 5,001 -8.27 homozygous† 16 NA NA

CCOV47T chr18 g.(66745583_66745683)_(66756838_66756938) 11 ,356 -0.55 hemizygous† 21 NA NA

CCOV47T chr19 g.(15985069J 5985169)_(16017239J 6017339) 32,271 -0.62 hemizygous† 7 CYP4F2 NA

CCOV47T chr20 g.(37008082_37009082)_(37014795_37015795) 6,714 -8.36 homozygous 0 LBP NA

CCOV47T chrX g.(14209295J 4209395)_(14253155_14253255) 43,961 -9.99 homozygous† 36 NA NA

CCOV4T chr1 9 89,656 -0.64 hemizygous† 8 KIRREL NA

(157986802J 57986902)_(158076357J 58076457)

CCOV4T chr1 9 4,635 -0.89 hemizygous† 14 CR1 L NA

(207841132. 207841232)_(207845666_207845766)

CCOV4T chr1 g· 35,403 -0.91 hemizygous† 16 SMYD3 NA

(246294852. 246294952)_(246330154_246330254)

CCOV4T chr3 9 36,042 -1.01 hemizygous† 10 NA NA

(116679538. .116679638)_(116715479J 16715579)

CCOV4T chr4 g.(91433300..91433400)_(91895466_91895566) 462,267 -0.63 hemizygous† 7 CCSER1 NA

CCOV4T chr5 g.(16974890..16974990)_(16979126_16979226) 4,337 -0.91 hemizygous† 19 NA NA

CCOV4T chr6 g.(55341703..55341803)_(55345507_55345607) 3,905 -8.86 homozygous† 19 HMGCLL1 NA

CCOV4T chr8 g.(16321297..16321397)_(16326435_16326535) 5,239 -8.82 homozygous† 13 NA NA

CCOV4T chr9 g.(21792496..21793496)_(21881429_21882429) 88,934 -8.73 homozygous 0 MTAP NA

CCOV4T chr9 g.(21920364..21920464)_(22468845_22468945) 548,582 -1.38 overlapping 19 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A, hemizygous† DMRTA1 , CDKN2A, CDKN2B CDKN2B Number Previously

Log2 paired Implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV4T chr9 g.(21919864_21920864)_(22384501_22385501) 464,638 -8.74 homozygous 0 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A,

CDKN2A, CDKN2B CDKN2B

CCOV4T chr9 g.(22428152_22429152)_(22468445_22469445) 40,294 -8.73 homozygous 0 DMRTA1 NA

CCOV4T chr9 g.(2636S138_26366138)_(26423261_26424261) 58,124 -8.73 homozygous 0 NA NA

CCOV4T chr12 g.(44348174_44349174)_(44553448_44554448) 205,275 -9.04 homozygous 0 TMEM117 NA

CCOV4T chr12 g.(45790501_45791501)_(47514501_47515501) 1,724,001 -9.00 homozygous 0 AN 06, ARID2, NA

LOC100288798, PCED1 B,

LINC00938, SCAF11,

SLC38A1 , SLC38A2,

SLC38A4, AMIG02

CGOV4T chr14 g.(70017049_70017149)_(70022314_70022414) 5,366 -1.15 hemizygous† 12 NA NA

CGOV4T chr19 g.(46956435_46957435)_(46962402_46963402) 5,968 -7.73 homozygous 1 NA NA

CGOV4T chr22 g.(30039501_30040501)_(30093501_30094501) 54,001 -8.79 homozygous 0 NF2 NF2

CGOV4T chr22 g.(33755264_33756264)_(33759554_33760554) 4,291 -8.98 homozygous 0 LARGE NA

CGOV4T chr22 g.(49709664_49709764)_(49713003_49713103) 3,440 -0.79 hemizygous† 9 NA NA

CGOV4T chrX g.(62577501_62578501)_(62585501_62586501) 8,001 -7.82 homozygous 1 NA NA

CGOV5T chr1 g.(67391182_67391282)_(67414068_67414168) 22,987 -1.49 hemizygous† 12 MIER1 , WDR78 NA

CGOV5T chr2 g.(26489459_26489559)_(26535565_26535665) 46,207 -0.56 hemizygous† 13 HADHB, ADGRF3 NA

CGOV5T chr2 g. 530,447 -1.08 hemizygous† 10 NA NA

(116622904J 16623004)_(117153250J 17153350)

CGOV5T chr2 g. 70,001 -4.82 homozygous 0 LRP1 B NA

(141909501 _141910501 )_(141979501 _141980501 )

CGOV5T chr2 g. 118,001 -8.95 homozygous 0 MBD5 NA

(149085501 _149086501 )_(149203501 _149204501 )

CGOV5T chr2 g. 3,682 -7.39 homozygous† 11 NA NA

(153796001 _153796101 )_(153799582J 53799682)

CGOV5T chr2 g. 81 ,344 -0.81 hemizygous† 17 ERBB4 ERBB4

(212342019_212342119)_(212423262_212423362)

CGOV5T chr2 g. 54,998 -0.40 hemizygous† 9 CUL3 NA

(225364116_225364216)_(225419013_225419113)

CGOV5T chr2 g. 112,606 -2.35 hemizygous† 5 LRRFIP1 NA

(238549106_238549206)_(238661611 _238661711 )

CGOV5T chr3 g.(59887527_59888527)_(60109181_60110181) 221 ,655 -9.06 homozygous 3 FHIT NA

CGOV5T chr3 g. 12,570 -0.60 hemizygous† 11 ZBTB20 NA

(114799749J 14799849)_(114812218_114812318)

CGOV5T chr3 g. 426,303 -1.55 hemizygous† 13 NA NA

(117321313_117321413)_(117747515_117747615)

CGOV5T chr3 g. 6,215 -0.73 hemizygous† 38 NA NA

(148963434J 48963534)_(148969548J 48969648)

CGOV5T chr4 g.(64134424_64134524)_(64154373_64154473) 20,050 -1.63 hemizygous† 33 NA NA

WO 2020/081549 Number PCT/US2019/056299 'eviously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOVST chrS g.(56103139_56103239)_(56136450_56136550) 33,412 -0.24 overlapping 27 MAP3K1 NA hemizygous†

CCOVST chrS g.(S6119617_S6120617)_(561360S0_S6137050) 16,434 -8.63 homozygous 0 MAP3K1 NA

CCOV5T chr5 g. 100,626 -0.41 hemizygous† 21 DCP2, MCC NA

(112331964_112332064)_(112432489J 12432589)

CCOVST chr6 g.(2568260_2568360)_(2571821_2571921) 3,662 -1.37 hemizygous† 43 NA NA

CCOVST chr6 g.(90121181_90121281)_(90213196_90213296) 92,116 -0.85 hemizygous† 23 ANKRD6, RRACD NA

CCOV5T chr6 g. 8,416 -1.68 hemizygous† 26 TRDN NA

(123817241 _123817341 )_(123825556J 23825656)

CCOVST chr7 g.(32533101_32533201)_(32547986_32548086) 14,986 -8.91 homozygous† 35 AVL9, LSM5 NA

CCOV5T chr7 g.(76886077_76887077)_(76928048_76929048) 41 ,972 -8.94 homozygous 0 CCDC146 NA

CCOVST chr7 g. 30,834 -0.60 hemizygous† 10 FOXP2 NA

(11387013S_113870235)_(113900868J 13900968)

CCOVST chr7 g. 9,450 -9.07 homozygous† 8 LOC102724434 NA

(115931734_115931834)_(115941083_115941183)

CCOVST chr7 g. 161 ,498 -1.40 hemizygous+ 10 CHCHD3, MIR36S4 NA

(132564147_132S64247)_(132725544J 32725644)

CCOVST chr8 g.(26131921_26132021)_(26172032_26172132) 40,212 -1.45 hemizygous† 17 PPP2R2A NA

CCOVST chr8 g.(61619114_61619214)_(61694530_61694630) 75,517 -8.99 homozygous† 9 CHD7 NA

CCOVST chr9 g.(6700069_6701069)_(6710134_6711134) 10,066 -8.45 homozygous 2 NA NA

CCOVST chr9 g.(33885970_33886070)_(34014974_34015074) 129,105 -1.47 hemizygous† 12 UBE2R2, UBAP2, NA

SNORD121 B, SNORD121A

CCOVST chr10 g.(54537328_54537428)_(54554716_54554816) 17,489 -0.78 hemizygous† 10 NA NA

CCOVST chr10 g.(788333S9_788334S9)_(79049403_79049S03) 216,145 -0.95 hemizygous† 6 KCNMA1-AS2, KCNMA1 NA

CCOVST chr11 g.(14093330J 4093430)_(14333554J 4333654) 240,325 -1.40 hemizygous† 17 SPON1 , RRAS2 NA

CCOVST chr12 g.(11156098_11157098)_(11182501_11183501) 26,404 -4.64 homozygous 0 PRH1-PRR4, PRH1, NA

TAS2R19, TAS2R31

CCOVST chr12 g.(11183501_11184501 )_(11198501_11199501) 15,001 -9.04 homozygous 0 PRH1-PRR4, PRH1, TAS2R31 NA

CCOVST chr12 g.(11199501_11200501 )_(11248501_11249501) 49,001 -4.41 homozygous 0 PRH1-PRR4, PRH1, NA

TAS2R46, TAS2R43

CCOVST chr12 g.(89533079_89534079)_(89541612_89542612) 8,534 -9.02 homozygous 1 NA NA

CCOVST chr12 g. 418,442 -1.66 hemizygous† 9 TBX5-AS1 , TBX5 NA

(114599607J 14S99707)_(115017948J 15018048)

CCOVST chr12 g. 79,914 -8.96 homozygous† 29 XLOC_009911 , SPPL3 NA

(121268792J 21268892)_(121348605J 21348705)

CCOVST chr13 g.(961S318S_961 S328S)_(96169361_96169461) 16,277 -8.98 homozygous† 27 CLDN10, CLDN10-AS1 NA

CCOVST chr14 g.(67139489_67139S89)_(67217879_67217979) 78,491 -9.02 homozygous† 14 CPHN NA

CCOVST chr14 g.(700170S3_700171S3)_(70022328_70022428) 5,376 -8.40 homozygous† 25 NA NA

CCOVST Chris g.(6467S677_6467S777)_(64711628_64711728) 36,052 -1.52 hemizygous† 6 TRIP4, KIAA0101 NA

CCOVST chr16 g.(1994S646J 994S746)_(19967S0SJ 9967605) 21 ,960 -1.93 hemizygous† 12 NA NA

CCOVST chr16 g.(58S66092_S8S66192)_(S8640891_S8640991) 74,900 -0.51 hemizygous† 13 CNOT1. SNORA46, NA

SNORA76A

CCOVST chr17 g.(29663S21_29663621)_(2967SS26_2967S626) 12,106 -3.46 overlapping 40 NF1 NF1 hemizygous†

CCOVST chr17 g.(29663031_29664031)_(2967189S_2967289S) 8,865 -9.02 homozygous 0 NF1 NF1

CCOVST chr18 g.(45971240_4S971340)_(460S2073_460S2173) 80,934 -1.47 hemizygous† 6 NA NA

CCOVST chr19 g.(1873871_1873971)_(189S073_189S173) 21 ,303 -1.53 hemizygous† 20 ABHD17A NA

CCOVST chr19 g.(SS26SS01_5S266S01)_(SS286S01_SS287S01) 21 ,001 -4.64 homozygous 0 KIR2DL3, KIR2DL1, NA

LOC101928804

CCOV5T chr19 g.(56594560_56595560)_(56612790_56613790) 18,231 -8.76 homozygous 0 LOC101928886, ZNF787 NA Number Previously

WO 2020/081549 Log2 paired PCT/US2019/056299 _jmpl icated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOVST chr21 g.(38745983_38746083)_(38834317_38834417) 88,435 -1.54 hemizygous† 8 DYRK1A NA

CGOVST chrX g.(7010785_7010885)_(7018229_7018329) 7,545 -8.78 homozygous† 17 HDHD1 NA

CGOVST chrX g.(34043034_34043134)_(34072726_34072826) 29,793 -9.04 homozygous† 9 NA NA

CGOV6T chr1 g.(72755752_72755852)_(72763911_72764011) 8,260 -1.29 hemizygous† 14 NA NA

CGOV6T chr3 g.(60169866_60169966)_(60399371_60399471) 229,606 -1.31 overlapping 7 FHIT NA hemizygous†

CGOV6T chr3 g.(603787S3_603797S3)_(60398971_60399971) 20,219 -8.56 homozygous 0 FHIT NA

CGOV6T chr9 g. 4,040 -6.44 homozygous† 17 HMCN2 NA

(133030714_133030814)_(1330346S3J 33034753)

CGOV6T chr16 g.(7874S60S_7874S70S)_(78776S39_78776639) 31 ,035 -1.05 hemizygous† 17 WWOX NA

CGOV6T chr20 g.(7398784_7398884)_(7403433_7403S33) 4,750 -0.81 hemizygous† 23 NA NA

CGOV6T chr20 g.(S2647132_S2647232)_(S26S7841_S26S7941) 10,810 -0.80 hemizygous† 17 BCAS1 NA

CGOV6T chrX g.(6946313_6946413)_(7200948_7201048) 254,736 -1.17 hemizygous† 13 MIR4767, STS, HDHD1 NA

CGOV8T chr3 g. 42,302 -0.95 hemizygous† 24 LINC01322 NA

(165041002_165041102)_(165083203J 65083303)

CGOV8T chr7 g.(8826562_8826662)_(8866118_8866218) 39,657 -0.90 hemizygous† 7 NA NA

CGOV8T chr8 g.(40182911_40183011)_(40189654_40189754) 6,844 -1.98 hemizygous† 11 NA NA

CGOV8T chr9 g.(21 S13318_21S13418)_(23236722_23236822) 1,723,505 -8.82 homozygous† 16 MTAP, CDKN2A-AS1 , CDKN2A,

CDKN2B-AS1 , DMRTA1 , CDKN2B

LINC01239, MIR31 HG,

MIR31, CDKN2A, CDKN2B

CC0V8T chr9 g. 4,259 -8.80 homozygous 1 NA NA

(133382642J 33383642)_(133386900J 33387900)

CCOV8T chr12 g.(96674843_96674943)_(96797912_96798012) 123,170 -1.05 hemizygous† 9 CDK17 NA

CCOV8T chr13 g. 10,470 -1.87 hemizygous† 17 NA NA

(105680183_105680283)_(105690552J 05690652)

CCOV8T chr18 g.(41976771_41976871 )_(41981913_41982013) 5,243 -8.87 homozygous† 12 LINC01478 NA

CCOV8T chr18 g.(63906673_63907673)_(63911231_63912231) 4,559 -8.74 homozygous 0 NA NA

CCOV8T chr20 g.(59111694_59111794)_(59124714_59124814) 13,121 -0.93 hemizygous† 6 NA NA

CCOV8T chr22 g.(27220819_27220919)_(27224406_27224506) 3,688 -8.75 homozygous† 16 NA NA

CCOV8T chr22 g.(30066862_30066962)_(30100486_30100586) 33,725 -8.71 homozygous† 17 NF2 NF2

CCOV92T chr1 g.(39679839_39679939)_(39788784_39788884) 109,046 -0.87 hemizygous† 12 MACF1 NA

CCOV92T chr1 g.(41464636_41464736)_(41566388_41566488) 101 ,853 -0.86 hemizygous† 17 CTPS1 , SLFNL1 -AS1 , NA

SLFNL1. SCMH1

CCOV92T chr1 g.(48191487_48191587)_(48202675_48202775) 11 ,289 -0.77 hemizygous† 18 NA NA

CCOV92T chr2 g.(7060501_7061501)_(7074501_7075501) 14,001 -8.74 homozygous 0 RNF144A, RNF144A-AS1 NA

CCOV92T chr2 g.(23999810_23999910)_(24149156_24149256) 149,447 -0.75 hemizygous† 20 ATAD2B NA

CCOV92T chr2 g.(43450966_43451066)_(43569072_43569172) 118,207 -0.87 hemizygous† 7 LINC01126, ZFP36L2, NA

THADA

CCOV92T chr2 g. 163,170 -0.83 hemizygous† 10 FMNL2 NA

(153339700J 53339800)_(153502769J 53502869)

CCOV92T chr3 g.(19045992J 9046992)_(19050838J 9051838) 4,847 -8.68 homozygous 0 NA NA

CCOV92T chr3 g.(88468267_88468367)_(88479958_88480058) 11 ,792 -0.76 hemizygous† 18 NA NA

CCOV92T chr3 g. 20,261 -0.91 hemizygous† 6 ZBTB20 NA

(114827592J 14827692)_(114847752J 14847852)

CCOV92T chr4 g. 183,432 -8.73 homozygous† 12 ALPK1. TIFA NA

(113208974J 13209074)_(113392305J 13392405) Number Previously

Log2 paired Implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV92T chr6 g.(470S2279_470S2379)_(470S7840_470S7940) 5,662 -0.61 hemizygous+ 20 NA NA

CGOV92T chr6 g. 31 ,766 -8.84 homozygous+ 10 FABP7, SMPDL3A NA

(123102293J 23102393)_(123133958J 23134058)

CGOV92T chr6 g. 441 ,307 -8.71 homozygous 2 UTRN NA

(144601606_144602606)_(145042912_145043912)

CGOV92T chr6 g. 14,951 -8.75 homozygous+ 21 SYNE1 NA

(152766491 _152766591 )_(152781341 _152781441 )

CGOV92T chr7 g.(15912386J 5912486)_(15928765J 5928865) 16,480 -4.65 overlapping 10 NA NA hemizygous†

CGOV92T chr7 g.(15912501_15913501)_(15926501_15927501) 14,001 -8.54 homozygous 2 NA NA

CGOV92T chr7 g.(36949872_36949972)_(37130059_37130159) 180,288 -0.83 hemizygous+ 21 ELM01-AS1 , ELM01 , NA

MIR1200

CGOV92T chr7 g.(73183508_73183608)_(73272055_73272155) 88,648 -1.12 hemizygous+ 18 CLDN4, WBSCR28, CLDN3, NA

WBSCR27

CGOV92T chr7 g.(95823219_95823319)_(95827392_95827492) 4,274 -7.39 homozygous† 11 SLC25A13 NA

CGOV92T chr7 g. 299,983 -0.92 hemizygous+ 14 NA NA

(109821953_109822053)_(110121835_110121935)

CGOV92T chr7 g. 4,445 -8.84 homozygous 0 LVCAT5 NA

(119297676J 19298676)_(119302120_119303120)

CGOV92T chr8 g.(11666494J 1666594)_(11701747_11701847) 35,354 -8.72 homozygous† 16 FDFT1 , CTSB NA

CGOV92T chr8 g.(56690639_56690739)_(56720755_56720855) 30,217 -0.43 hemizygous† 11 TGS1, TMEM68 NA

CGOV92T chr8 g.(61327681_61327781 )_(61536789_61536889) 209,209 -0.94 hemizygous† 9 RAB2A, LINC01301 NA

CGOV92T chr8 g.(61613200_61613300)_(61772127_61772227) 159,028 -0.82 hemizygous† 28 CHD7 NA

CGOV92T chr10 g.(58894847_58894947)_(58936981_58937081) 42,235 -0.80 hemizygous† 8 NA NA

CGOV92T chr10 g.(74507435_74507535)_(74530685_74530785) 23,351 -0.73 hemizygous† 7 MCU NA

CGOV92T chr11 g.(27380143_27380243)_(27397690_27397790) 17,648 -0.88 hemizygous† 21 CCDC34, LGR4 NA

CGOV92T chr11 g.(59056058_59056158)_(59567931_59568031) 511 ,974 -0.55 hemizygous† 23 OR5AN1, OR5A1, OR4D6, NA

OR4D10, OR4D11, OR4D9,

OR10V2P, STX3, OR5A2,

OSBP, MIR3162, PATL1,

OR10V1

CGOV92T chr11 g.(78691152_78691252)_(79000488_79000588) 309,437 -0.91 hemizygous† 14 TENM4 NA

CGOV92T chr12 g.(24067469_24067569)_(24550505_24550605) 483,137 -1.77 hemizygous† 11 MIR920, LOC101928471, NA

SOX5

CGOV92T chr12 g.(99573589_99573689)_(99956476_99956576) 382,988 -8.53 overlapping 33 ANKS1 B NA hemizygous†

CGOV92T chr12 g.(99573501_99574501)_(99584501_99585501) 11 ,001 -7.54 homozygous 0 ANKS1 B NA

CGOV92T chr12 g.(99585501_99586501)_(99954501_99955501) 369,001 -8.54 homozygous 0 ANKS1 B NA

CGOV92T chr13 g.(96621899_96621999)_(96643785_96643885) 21 ,987 -0.74 hemizygous† 12 UGGT2 NA

CGOV92T chr14 g.(50921928_50922928)_(51230510_51231510) 308,583 -8.69 homozygous 0 ATL1 , MAP4K5, SAV1 , NIN NA

CGOV92T chr16 g.(18821410_18821510)_(18838772J 8838872) 17,463 -0.76 hemizygous† 6 SMG1 NA

CGOV92T chr16 g.(19332935_19333035)_(19397623_19397723) 64,789 -0.86 hemizygous† 8 NA NA

CGOV92T chr16 g.(23317517_23317617)_(23370413_23370513) 52,997 -0.85 hemizygous† 5 SCNN1 B NA

CGOV92T chr17 g.(15043969J 5044069)_(15058563_15058663) 14,695 -8.84 homozygous† 9 NA NA

CGOV92T chr17 g.(61226501_61227501)_(61374501_61375501) 148,001 -8.69 homozygous 0 MIR548W, TANC2 NA

CGOV92T chr17 g.(61381501_61382501)_(61453501_61454501) 72,001 -8.68 homozygous 0 TANC2 NA

CGOV92T chr20 g.(40698580_40698680)_(40703597_40703697) 5,118 -8.75 homozygous† 30 PTPRT NA

CGOV92T chr21 g.(29653613_29653713)_(29786849_29786949) 133,337 -0.64 hemizygous† 8 NA NA

CGOV92T chr22 g.(46985937_46986037)_(46989975_46990075) 4,139 -8.66 homozygous† 17 NA NA Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV92T chr22 g.(S0722482_S0722S82)_(S0778127_S0778227) 55,746 -8.66 homozygous† 9 PPP6R2, PLXNB2, NA

DENND6B

CCOV92T chrX g.(636863S0_636864S0)_(6396SS97_6396S697) 279,348 -0.92 hemizygous† 6 NA NA

CCOV92T chrX g.(832364S6_83236SS6)_(83429S72_83429672) 193,217 -1.03 hemizygous† 19 RPS6KA6 NA

CCOV92T chrX g. 195,383 -1.02 hemizygous† 9 NA NA

(127300220J 27300320)_(12749SS02J 27495602)

CCOV92T chrX g. 112,795 -1.01 hemizygous† 7 NA NA

(128236172_128236272)_(128348866J 28348966)

CCOV12T chr1 g.(16751245_16751345)_(16754940J 6755040) 3,796 -0.90 hemizygous† 11 SPATA21 NA

CCOV12T chr1 g. 13,889 -0.83 hemizygous† 9 NA NA

(203919144_203919244)_(203932932_203933032)

CCOV12T chr3 g. 219,939 -1.00 hemizygous† 6 NLGN1, NLGN1-AS1 NA

(173422155_173422255)_(173641993_173642093)

CCOV12T chr3 g. 37,665 -1.02 hemizygous† 11 NA NA

(174446190_174446290)_(174483754J 74483854)

CCOV12T chr4 g. 26,744 -1.04 hemizygous† 7 LRBA NA

(151883961J 51884061 )_(151910604J 51910704)

CCOV12T chr7 g. 178,295 -1.00 hemizygous† 7 IMMP2L NA

(111020069J 11020169)_(111198263J 11198363)

CCOV12T chr8 g.(79746431_79746531)_(79902820_79902920) 156,490 -1.01 hemizygous† 7 NA NA

CCOV12T chr9 g.(11947435_11947535)_(12188439_12188539) 241 ,105 -1.02 hemizygous† 10 NA NA

CCOV12T chr11 g.(83965068_83965168)_(84000318_84000418) 35,351 -1.02 hemizygous† 6 DLG2 NA

CCOV12T chr16 g.(72078972_72079072)_(72157134_72157234) 78,263 -0.89 hemizygous† 7 HP, HPR, DHX38, TXNL4B, NA

PMFBP1

CCOV12T chr16 g.(78194275_78194375)_(78260423_78260523) 66,249 -0.95 hemizygous† 9 WWOX NA

CCOV12T chr21 g.(27184281_27184381 )_(27236785_27236885) 52,605 -0.91 hemizygous† 5 NA NA

CCOV20T chr1 g. 10,674 -0.71 hemizygous† 27 DENND2D NA

(111748043J 11748143)_(111758616_111758716)

CCOV20T chr1 g. 143,473 -1.19 hemizygous† 10 KCNN3 NA

(154691759_154691859)_(154835131 _154835231 )

CCOV20T chr2 g.(4116305_4117305)_(4125389_4126389) 9,085 -8.93 homozygous 1 NA NA

CCOV20T chr2 g. 19,678 -0.64 hemizygous† 18 GLS NA

(191754503J 91754603)_(191774080J 91774180)

CCOV20T chr3 g. 19,049 -1.08 hemizygous† 8 XRN1 NA

(142055351 _142055451 )_(142074299J 42074399)

CCOV20T chr4 g.(30738167_30738267)_(30880428_30880528) 142,362 -8.99 homozygous† 21 PCDH7 NA

CCOV20T chr5 g.(3957872_3957972)_(3970555_3970655) 12,784 -0.62 hemizygous† 16 NA NA

CCOV20T chr5 g.(17342810_17342910)_(17357022J 7357122) 14,313 -0.65 hemizygous† 12 NA NA

CCOV20T chr5 g. 9,786 -0.69 hemizygous† 14 TRIM7 NA

(180632057J 80632157)_(180641742_180641842)

CCOV20T chr7 g. 2,901 -6.04 homozygous† 17 CUX1 NA

(101724584J 01724684)_(101727384J 01727484)

CCOV20T chr7 g. 24,100 -9.01 homozygous† 11 IMMP2L NA

(111024561 _111024661 )_(111048560J 11048660)

CCOV20T chr7 g. 39,082 -1.28 hemizygous† 18 LOC100506860, LINC-PINT NA

(130607267J 30607367)_(130646248J 30646348)

CCOV20T chr7 g. 73,561 -1.18 hemizygous† 6 CUL1. EZH2 EZH2

(148427284J 48427384)_(148500744J 48500844)

CCOV20T chr8 g.(16262122_16262222)_(16274520J 6274620) 12,499 -8.99 homozygous† 25 NA NA

CCOV20T chr9 g.(24502136_24502236)_(24518938_24519038) 16,903 -1.33 hemizygous† 30 NA NA Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV20T chr11 g. 12,142 -8.91 homozygous† 8 OPCML NA

(1329922S4J 32992354)_(133004295J 33004395)

CCOV20T chr12 g.(13356624J 3356724)_(13436104_13436204) 79,581 -1.17 hemizygous† 9 EMP1 NA

CCOV20T chr13 g.(48899250_48899350)_(48953887_48953987) 54,738 -9.01 homozygous† 9 RB1 RB1

CCOV20T chr14 g.(38133163_38133263)_(38137648_38137748) 4,586 -7.85 homozygous† 17 TTC6 NA

CCOV20T chr15 g.(54883501_54884501)_(54886501_54887501) 3,001 -8.88 homozygous 0 UNC13C NA

CCOV20T chr16 g.(74376501_74377501)_(74390501_74391501) 14,001 -5.93 homozygous 0 LOC283922 NA

CCOV20T chr16 g.(78552722_78552822)_(78569810_78569910) 17,189 -8.90 homozygous† 72 WWOX NA

CCOV20T chr16 g.(89516738_89516838)_(89526411_89526511) 9,774 -7.88 homozygous† 24 LOC101927817, ANKRD11 NA

CCOV20T chr18 g.(37355778_37355878)_(37371489_37371589) 15,812 -2.18 hemizygous† 25 NA NA

CCOV20T chr18 g.(40054149_40054249)_(40057502_40057602) 3,454 -2.10 hemizygous† 16 LINC00907 NA

CCOV20T chr18 g.(54339023_54339123)_(54493894_54493994) 154,972 -0.64 hemizygous† 6 WDR7 NA

CCOV20T chr20 g.(12147980_12148080)_(13150916_13151016) 1,003,037 -1.19 hemizygous† 33 LOC100505515, SPTLC3, NA

LOC101929486,

LOC102606466

CCOV20T chrX g. 38,976 -0.56 hemizygous† 11 CPC3 CPC3

(133082255J 33082355)_(133121130_133121230)

CCOV27T chr1 g. 11 ,437 -0.39 hemizygous† 15 NA NA

(105832867J 05832967)_(105844203J 05844303)

CCOV27T chr2 g. 4,698 -1.49 hemizygous† 8 NA NA

(223865143_223865243)_(223869740_223869840)

CCOV27T chr3 g.(53267005_53267105)_(53283225_53283325) 16,321 -1.31 hemizygous† 5 TKT NA

CCOV27T chr3 g. 545,742 -0.54 hemizygous† 10 LSAMP-AS1 , LSAMP NA

(115663498J 15663598)_(116209139_116209239)

CCOV27T chr7 g.(3882244_3882344)_(3905752_3905852) 23,609 -1.43 hemizygous† 23 SDK1 NA

CCOV27T chr8 g.(7224501_7225501)_(8085501_8086501) 861 ,001 -6.91 homozygous 0 DEFB105B, DEFB105A, NA

DEFB107A, DEFB107B,

PRR23D1 , PRR23D2,

FAM90A1 OP, DEFB106B,

DEFB106A, DEFB104B,

DEFB104A, SPAC11 B,

SPAC11A, DEFB103A,

DEFB103B, DEFB4A,

ZNF705B, FAM66E,

FAM86B3P, ZNF705C,

DEFB4B, FAM90A7P,

USP17L8, USP17L3,

DEFB109P1 B, MIR548I3

CCOV27T chr12 g. 2,373 -0.87 hemizygous† 8 MAPI LC3B2 NA

(117005397J 17005497)_(117007669J 17007769)

CCOV27T chr13 g. 11 ,987 -1.38 hemizygous† 12 ATP11A NA

(113514115_113514215)_(113526001J 13526101 )

CCOV27T chr14 g.(24264965_24265065)_(24271869_24271969) 7,005 -1.27 hemizygous† 16 NA NA

Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV31T chr2 g. 77,952 -1.57 hemizygous+ 9 ERBB4 ERBB4

(212283626_212283726)_(212361477_212361577)

CCOV31T chr4 g.(25712067_25712167)_(25735734_25735834) 23,768 -1.85 hemizygous+ 12 NA NA

CCOV31T chr4 g. 5,723 -1.61 hemizygous+ 22 NA NA

(161013866J 61013966)_(161019488J 61019588)

CCOV31T chr5 g.(51466747_51466847)_(51471207_51471307) 4,561 -1.58 hemizygous+ 19 NA NA

CCOV31T chr9 g.(20799110_20800110)_(20804125_20805125) 5,016 -8.61 homozygous 2 FOCAD NA

CCOV31T chr9 g.(21952605_21952705)_(22006797_22006897) 54,293 -8.63 homozygous† 16 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A,

CDKN2A, CDKN2B CDKN2B

CCOV31T chr9 g.(43503501_43504501)_(43658501_43659501) 155,001 -8.51 homozygous 0 FAM74A7, SPATA31A6 NA

CCOV31T chr9 g. 3,894 -7.20 homozygous† 8 PAPPA NA

(119016894J 19016994)_(119020687J 19020787)

CCOV31T chr11 g.(97818282_97818382)_(97877935_97878035) 59,754 -8.73 homozygous† 23 NA NA

CCOV31T chr13 g. 65,659 -1.43 hemizygous† 22 COL4A2, MIR8073, COL4A1 NA

(110928407J 10928507)_(110993965J 10994065)

CCOV31T chr22 g.(42519278_42519378)_(42531382_42531482) 12,205 -0.89 hemizygous† 5 NDUFA6-AS1 , CYP2D6, NA

LOC101929829, CYP2D7

CCOV31T chrX g.(76764950_76765050)_(76769316_76769416) 4,467 -7.89 homozygous† 5 ATRX ATRX

CCOV31T chrX g. 9,087 -8.58 homozygous 0 NA NA

(137045303J 37046303)_(137054389J 37055389)

CCOV35T chr1 g.(16751232_16751332)_(16754942J 6755042) 3,811 -1.25 hemizygous† 15 SPATA21 NA

CCOV35T chr1 g.(82317730_82317830)_(82356590_82356690) 38,961 -1.16 hemizygous† 8 ADGRL2 NA

CCOV35T chr1 g. 60,445 -0.96 hemizygous† 9 NOS1AP NA

(162054321 _162054421 )_(162114665J 62114765)

CCOV35T chr1 g. 44,718 -8.64 homozygous† 12 UCHL5 NA

(192931990_192932090)_(192976607J 92976707)

CCOV35T chr1 g. 98,431 -1.08 hemizygous† 8 CDC73, LINC01031 CDC73

(193211752_193211852)_(193310082J 93310182)

CCOV35T chr1 g. 213,362 -1.09 hemizygous† 18 NA NA

(193412100_193412200)_(193625361 _193625461 )

CCOV35T chr1 g. 5,942 -1.06 hemizygous† 11 NID1 NA

(236232977_236233077)_(236238818_236238918)

CCOV35T chr2 g.(34991190_34991290)_(35024397_35024497) 33,308 -0.90 hemizygous† 5 NA NA

CCOV35T chr2 g.(58119113_58119213)_(58266111_58266211) 147,099 -0.95 hemizygous† 14 VRK2 NA

CCOV35T chr2 g. 181 ,827 -1.06 hemizygous† 7 LRP1 B NA

(141529999J 41530099)_(141711725_141711825)

CCOV35T chr2 g. 43,499 -1.04 hemizygous† 13 NA NA

(186750647J 86750747)_(186794045J 86794145)

CCOV35T chr2 g. 95,720 -0.87 hemizygous† 18 IKZF2 NA

(213880087_213880187)_(213975706_213975806)

CCOV35T chr2 g. 216,913 -0.90 hemizygous† 14 AGAP1 NA

(236733493_236733593)_(236950305_236950405)

CCOV35T chr3 g.(6191068_6191168)_(6220739_6220839) 29,772 -1.00 hemizygous† 26 NA NA

CCOV35T chr3 g.(67537842_67537942)_(67584362_67584462) 46,621 -1.01 hemizygous† 12 SUCLG2 NA

CCOV35T chr3 g.(70199247_70200247)_(70315743_70316743) 116,497 -8.54 homozygous 0 NA NA

CCOV35T chr3 g.(71104703_71104803)_(71551796_71551896) 447,194 -1.06 hemizygous† 17 FOXP1 -AS1 , FOXP1 NA

CCOV35T chr3 g. 563,630 -0.96 hemizygous† 10 TUSC7, LINC00901 , NA

(116214454J 16214554)_(116777983J 16778083) MIR4447

CCOV35T chr3 g. 79,338 -1.01 hemizygous† 9 KCNMB2, KCNMB2-AS1 NA

(178284052J 78284152)_(178363289J 78363389)

CCOV35T chr4 g.(67379750_67379850)_(67393459_67393559) 13,810 -0.83 hemizygous† 7 NA NA Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV3ST chr4 g. 223,180 -1.07 hemizygous+ 15 LRBA NA

(151272601J 51272701 )_(151495680J 51495780)

CCOV35T chr4 g. 238,679 -8.47 homozygous† 16 LINC00290 NA

(181823765J 81823865)_(182062343J 82062443)

CCOV35T chr4 g. 240,544 -0.92 hemizygous† 28 NA NA

(182200049J 82200149)_(182440492J 82440592)

CCOV35T chr5 g.(12276683_12276783)_(12292247_12292347) 15,665 -0.99 hemizygous† 7 NA NA

CCOV35T chr5 g.(59265559_59265659)_(59546661_59546761) 281 ,203 -9.01 overlapping 13 PDE4D NA hemizygous†

CCOV35T chr5 g.(59266501_59267501)_(59404501_59405501) 138,001 -8.33 homozygous 0 PDE4D NA

CCOV35T chr5 g.(59405340_59406340)_(59546297_59547297) 140,958 -9.08 homozygous 0 PDE4D NA

CCOV35T chr5 g.(59781013_59781113)_(59967067_59967167) 186,155 -0.96 hemizygous† 15 PART1 , PDE4D, DEPDC1 B NA

CCOV35T chr5 g.(60681576_60681676)_(60770103_60770203) 88,628 -0.98 hemizygous† 10 ZSWIM6 NA

CCOV35T chr5 g. 91 ,383 -1.00 hemizygous† 12 RAPGEF6 NA

(130851788_130851888)_(130943070J 30943170)

CCOV35T chr5 g. 284,049 -1.01 hemizygous† 11 NA NA

(162521084_162521184)_(162805032J 62805132)

CCOV35T chr5 g. 35,313 -0.99 hemizygous† 14 NA NA

(173061278_173061378)_(173096490J 73096590)

CCOV35T chr6 g.(77016777_77016877)_(77029005_77029105) 12,329 -8.55 homozygous† 24 NA NA

CCOV35T chr6 g. 252,788 -0.99 hemizygous† 8 ASCC3 NA

(100940693J 00940793)_(101193380J 01193480)

CCOV35T chr6 g. 186,399 -1.02 hemizygous† 16 LINC00222, ARMC2, NA

(109042913_109043013)_(109229211_109229311 ) ARMC2-AS1

CCOV35T chr6 g. 65,430 -1.02 hemizygous† 12 PARK2 NA

(162726253J 62726353)_(162791582_162791682)

CCOV35T chr7 g.(16269984J 6270084)_(16459393_16459493) 189,510 -1.01 hemizygous† 9 ISPD-AS1, ISPD NA

CCOV35T chr7 g.(35858815_35858915)_(35881925_35882025) 23,211 -1.04 hemizygous† 10 SEPT7 NA

CCOV35T chr7 g. 107,584 -8.59 homozygous† 9 IMMP2L NA

(110787147_110787247)_(110894630J 10894730)

CCOV35T chr7 g. 27,607 -0.90 hemizygous† 10 EZH2 EZH2

(148516934J 48517034)_(148544440J 48544540)

CCOV35T chr9 g.(10977771_10977871 )_(11039577J 1039677) 61 ,907 -1.03 hemizygous† 8 NA NA

CCOV35T chr9 g.(21908449_21908549)_(21992673_21992773) 84,325 -1.77 overlapping 15 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A hemizygous† CDKN2A

CCOV35T chr9 g.(21907949_21908949)_(21989501_21990501) 81 ,553 -8.54 homozygous 0 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A

CDKN2A

CCOV35T chr9 g. 738,352 -1.00 hemizygous† 16 SLC44A1 , FSD1 L, FKTN, NA

(108101838_108101938)_(108840089J 08840189) TAL2. TMEM38B CCOV35T chr10 g.(556290_556390)_(582581_582681) 26,392 -0.94 hemizygous† 20 DIP2C NA

CCOV35T chr10 g.(20228769_20228869)_(20377976_20378076) 149,308 -1.08 hemizygous† 8 PLXDC2 NA

CCOV35T chr10 g.(35698356_35698456)_(35785482_35785582) 87,227 -0.94 hemizygous† 13 CCNY NA

CCOV35T chr10 g.(60186785_60186885)_(60333223_60333323) 146,539 -1.03 hemizygous† 10 BICC1 NA

CCOV35T chr10 g.(77573487_77573587)_(77592952_77593052) 19,566 -0.96 hemizygous† 16 C10orf11 NA

CCOV35T chr10 g. 7,715 -0.95 hemizygous† 14 MXI1 NA

(112019953J 12020053)_(112027567J 12027667)

CCOV35T chr11 g.(9944084_9944184)_(10058832J 0058932) 114,849 -1.00 hemizygous† 15 LOC101928008, SBF2 NA

CCOV35T chr11 g.(29021852_29021952)_(29214082_29214182) 192,331 -1.02 hemizygous† 13 NA NA

CCOV35T chr11 g.(93586244_93586344)_(93710286_93710386) 124,143 -0.99 hemizygous† 17 VSTM5 NA

CCOV35T chr12 g.(15927615_15927715)_(16072744J 6072844) 145,230 -1.03 hemizygous† 6 STRAP, DERA, EPS8 NA Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV35T chr12 g.(32688373_32688473)_(32804685_32804785) 116,413 -0.99 overlapping 8 FGD4 NA hemizygous†

CCOV3ST chr12 g.(32790562_32791562)_(32804285_32805285) 13,724 -8.40 homozygous 0 FGD4 NA

CCOV3ST chr12 g.(32791062_32791162)_(32824460_32824S60) 33,499 -1.19 overlapping 6 FGD4 NA hemizygous†

CCOV3ST chr12 g.(79959640_799S9740)_(7999S899_7999S999) 36,360 -1.03 hemizygous† 9 PAWR NA

CCOV3ST chr14 g.(46127209_46127309)_(46162996_46163096) 35,888 -1.03 hemizygous† 15 NA NA

CCOV35T chr14 g.(64490205_64490305)_(64553115_64553215) 63,011 -0.93 hemizygous† 5 SYNE2, MIR548AZ NA

CCOV35T chr15 g.(25601425_25601525)_(25665725_25665825) 64,401 -1.03 hemizygous† 15 UBE3A NA

CCOV35T chr15 g.(49410612_49410712)_(49589004_49589104) 178,493 -1.09 hemizygous† 5 GALK2, NDUFAF4P1 , NA

COPS2, MIR4716

CCOV35T chr15 g.(64774738_64774838)_(64819881_64819981) 45,244 -0.98 hemizygous† 10 ZNF609 NA

CCOV35T chr15 g.(67418598_67418698)_(67476818_67476918) 58,321 -1.01 hemizygous† 14 SMAD3 SMAD3

CCOV35T chr16 g.(20632787_20632887)_(20671284_20671384) 38,598 -1.04 hemizygous† 13 ACSM1 NA

CCOV35T chr16 g.(72686200_72686300)_(72875566_72875666) 189,467 -1.05 hemizygous† 13 LINC01572, ZFHX3 NA

CCOV35T chr16 g.(78531906_78532006)_(78717421_78717521) 185,616 -1.10 overlapping 6 WWOX NA hemizygous†

CCOV35T chr16 g.(78561196_78562196)_(78717021_78718021) 155,826 -8.48 homozygous 0 WWOX NA

CCOV35T chr16 g.(79029196_79029296)_(79077123_79077223) 48,028 -1.10 hemizygous† 13 WWOX NA

CCOV35T chr17 g.(9924658_9924758)_(9927853_9927953) 3,296 -8.47 homozygous† 10 GAS7 NA

CCOV35T chr18 g.(8035157_8035257)_(8041215_8041315) 6,159 -8.51 homozygous† 15 PTPRM NA

CCOV35T chr21 g.(38792673_38792773)_(38834029_38834129) 41 ,457 -1.03 hemizygous† 8 DYRK1A NA

CCOV35T chr22 g.(47201644_47201744)_(47323642_47323742) 122,099 -1.12 hemizygous† 16 TBC1 D22A, TBC1 D22A-AS1 NA

CCOV35T chrX g.(6748902_6749002)_(6922726_6922826) 173,925 -8.45 homozygous† 15 NA NA

CCOV35T chrX g.(6978933_6979033)_(7010753_7010853) 31 ,921 -8.42 homozygous† 16 HDHD1 NA

CCOV35T chrX g.(9619187_9619287)_(9903884_9903984) 284,798 -8.51 homozygous† 5 TBL1 X, SHROOM2, GPR143 NA

CCOV35T chrX g.(10115127_10115227)_(10546593J 0546693) 431 ,567 -8.50 homozygous† 13 WWC3, CLCN4, MIDI NA

CCOV35T chrX g.(28520819_28520919)_(28525862_28525962) 5,144 -7.45 homozygous† 26 NA NA

CCOV35T chrX g.(56145982_56146082)_(56242433_56242533) 96,552 -8.48 homozygous 4 NA NA

CCOV35T chrX g.(93695433_93696433)_(93953334_93954334) 257,902 -8.56 homozygous 0 NA NA

CCOV35T chrX g.(96475496_96475596)_(96487316_96487416) 11 ,921 -8.51 homozygous† 15 DIAPH2 NA

CCOV35T chrX g. 4,896 -8.50 homozygous† 8 NA NA

(120275502J 20275602)_(120280297J 20280397)

CCOV39T chr1 g.(26459605_26460605)_(26464273_26465273) 4,669 -8.69 homozygous 1 NA NA

CCOV39T chr2 g. 14,284 -0.85 hemizygous† 16 NA NA

(185166764J 85166864)_(185180947J 85181047)

CCOV39T chr4 g. 4,935 -8.87 homozygous 0 NA NA

(112236956J 12237956)_(112241890_112242890)

CCOV39T chr5 g.(27606207_27606307)_(27633232_27633332) 27,126 -1.01 hemizygous† 8 NA NA

CCOV39T chr9 g.(43503501_43504501)_(43658501_43659501) 155,001 -7.79 homozygous 0 FAM74A7, SPATA31 A6 NA

CCOV39T chr12 g.(6241499_6241599)_(6247972_6248072) 6,574 -1.22 hemizygous† 7 NA NA

CCOV7T chr2 g. 44,734 -0.78 hemizygous† 7 LRP1 B NA

(141801123_141801223)_(141845756J 41845856)

CCOV7T chr3 g. 27,593 -0.82 hemizygous† 15 NA NA

(175887255J 75887355)_(175914747J 75914847)

CCOV7T chr4 g.(29355881_29355981)_(29436257_29436357) 80,477 -0.81 hemizygous† 5 NA NA

CCOV7T chr6 g. 16,655 -0.49 hemizygous† 6 ESR1 ESR1

(152282226_152282326)_(152298780_152298880) Number Previously

WO 2020/081549 Log2 paired PCT/US2019/056299 implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV7T chr7 g. 2,997 -1.65 hemizygous+ 7 CUX1 NA

(101724536J 01724636)_(101727432J 01727532)

CGOV7T chr8 g.(7224501_7225501)_(8085501_8086501) 861 ,001 -6.15 homozygous 0 DEFB105B, DEFB105A, NA

DEFB107A, DEFB107B,

PRR23D1 , PRR23D2,

FAM90A1 OP, DEFB106B,

DEFB106A, DEFB104B,

DEFB104A, SPAG11 B,

SPAG11A, DEFB103A,

DEFB103B, DEFB4A,

ZNF705B, FAM66E,

FAM86B3P, ZNF705G,

DEFB4B, FAM90A7P,

USP17L8, USP17L3,

DEFB109P1 B, MIR548I3

CC0V7T chr8 g.(81990694_81990794)_(81993860_81993960) 3,267 -1.34 hemizygous+ 14 PAG1 NA CCOV7T chr10 g.(S79324S2_S7932SS2)_(S79S4488_S79S4S88) 22,137 -0.68 hemizygous+ 14 NA NA CCOV7T chr12 g.(799801S0_799802S0)_(80293410_80293S10) 313,361 -0.72 hemizygous+ 7 PAWR, PPP1 R12A NA CCOV7T chr13 g.(36129417_36129517)_(36140362_36140462) 11 ,046 -0.85 hemizygous+ 9 NBEA, MIR548F5 NA CCOV7T chr16 g.(78548743_78548843)_(78556729_78556829) 8,087 -1.67 hemizygous+ 6 WWOX NA CCOV7T chr16 g.(78646020_78646120)_(78695574_78695674) 49,655 -1.58 hemizygous+ 7 WWOX NA CCOV7T chr18 g.(6103935_6104035)_(6109267_6109367) 5,433 -1.10 hemizygous+ 25 L3MBTL4 NA CCOV7T chr18 g.(55093038_55093138)_(55124573_55124673) 31 ,636 -0.87 hemizygous+ 8 ONECUT2 NA CCOV7T chr18 g.(66745650_66745750)_(66756847_66756947) 11 ,298 -1.52 hemizygous+ 11 NA NA CCOV7T chrX g.(29655863_29655963)_(29825683_29825783) 169,921 -1.60 hemizygous+ 6 IL1 RAPL1 NA CGOV11TJ chr1 g.(43460100_43460200)_(43464195_43464295) 4,196 -8.97 homozygous† 20 NA NA CGOV11TJ chr2 g. 246.883 -0.57 hemizygous+ 9 LOC101927055, TTN, NA

(179573984J 79574084)_(179820766J 79820866) CCDC141

CGOV11TJ chr4 g.(53825244_53825344)_(54132027_54132127) 306.884 -1.57 hemizygous+ 17 SCFD2 NA CGOV11 T_1 chr6 g.(6948886_6948986)_(6953333_6953433) 4,548 -1.50 hemizygous+ 22 NA NA CGOV11TJ chr6 g.(53924871_53924971)_(53934671_53934771) 9,901 -1.06 hemizygous+ 11 MLIP NA CGOV11TJ chr11 g.(80306216_80306316)_(80312975_80313075) 6,860 -1.73 hemizygous+ 6 NA NA CGOV11TJ chr11 g.(81089108_81089208)_(81138743_81138843) 49,736 -1.64 hemizygous+ 17 NA NA CGOV11TJ chr12 g. 177,165 -0.68 hemizygous+ 11 MIR1827, ACTR6, NA

(100453239J 00453339)_(100630303J 00630403) UHRF1 BP1 L, GOLGA2P5

CGOV11TJ chr13 g.(58589205_58589305)_(58599626_58599726) 10,522 -1.58 hemizygous+ 17 NA NA CGOV11TJ chr13 g. 222,617 -1.58 hemizygous+ 11 COL4A2, MIR8073, COL4A1 , NA

(110930279J 10930379)_(111152795J 11152895) COL4A2-AS1

CGOV11TJ chr18 g.(7888970_7889070)_(8246655_8246755) 357,786 -1.57 hemizygous+ 14 PTPRM NA CGOV11TJ chr18 g.(31655160_31655260)_(31686013_31686113) 30,954 -1.57 hemizygous+ 12 NOL4 NA CGOV11TJ chrX g. 248,775 -0.62 hemizygous+ 25 NA NA

(120768859J 20768959)_(121017533J 21017633)

CGOV14T chr1 g. 17,163 -0.57 hemizygous+ 10 NA NA

(193777526J 93777626)_(193794588J 93794688)

CGOV14T chr1 g. 10,514 -0.89 hemizygous+ 12 EGLN1 NA

(231535433_231535533)_(231545846_231545946)

CGOV14T chr3 g.(60273501_60274501)_(60444501_60445501) 171 ,001 -9.02 homozygous 0 FHIT NA CGOV14T chr3 g.(60561988_60562088)_(60675475_60675575) 113,588 -1.79 overlapping 10 FHIT, MIR548BB NA hemizygous+

CGOV14T chr3 g.(60591926_60592926)_(60675075_60676075) 83,150 -9.01 homozygous 0 FHIT, MIR548BB NA CGOV14T chr3 g.(60831480_60831580)_(61223873_61223973) 392,494 -0.77 hemizygous+ 11 FHIT NA CGOV14T chr3 g.(61652007_61652107)_(61805810_61805910) 153,904 -0.82 hemizygous+ 6 PTPRG NA WO 2020/081549 Number pCT/US2019/056299’ ^reviously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CC0V14T chr4 g.(30193251_30193351 )_(30199442_30199542) 6,292 -1.60 hemizygous† 13 NA NA

CC0V14T chrS g.(67438096_67438196)_(67470485_67470585) 32,490 -1.84 hemizygous† 5 NA NA

CC0V14T chr7 g.(18SS0890_18SS0990)_(18S67966_18568066) 17,177 -1.29 hemizygous† 6 HDAC9 NA

CC0V14T chr7 g. 8,534 -1.78 hemizygous† 10 NA NA

(106639172_106639272)_(106647605J 06647705)

CC0V14T chr9 g.(18045835_18045935)_(18048938_18049038) 3,204 -8.90 homozygous† 27 NA NA

CC0V14T chr16 g.(78627527_78627627)_(78639492_78639592) 12,066 -1.05 hemizygous† 6 WWOX NA

CCOV36T chr1 g. 149,025 -8.90 homozygous† 7 SPATA17, SPATA17-AS1 NA

(217854654_217854754)_(218003578_218003678)

CCOV36T chr2 g. 3,687 -7.24 homozygous 4 NA NA

(153796026J 53796126)_(153799612_153799712)

CCOV36T chr2 g. 121 ,664 -1.02 hemizygous† 19 ACAP1 NA

(236906617_236906717)_(237028180_237028280)

CCOV36T chr3 g.(37978429_37978529)_(37986777_37986877) 8,449 -8.81 homozygous† 13 CTDSPL NA

CCOV36T chr3 g.(45920231_45920331 )_(45924147_45924247) 4,017 -7.85 homozygous† 17 CCR9, LZTFL1 NA

CCOV36T chr3 g.(60546038_60546138)_(60807141_60807241) 261 ,204 -8.88 homozygous† 23 FHIT, MIR548BB NA

CCOV36T chr4 g.(477193_477293)_(483925_484025) 6,833 -1.23 hemizygous† 14 ZNF721 NA

CCOV36T chr4 g.(64134366_64134466)_(64154377_64154477) 20,112 -1.02 hemizygous† 18 NA NA

CCOV36T chr4 g. 451 ,675 -1.11 hemizygous† 14 GUCY1 A3, CUCY1 B3, TD02, NA

(156457596J 56457696)_(156909170_156909270) ASIC5, CTSO

CCOV36T chr4 g. 704,264 -8.93 homozygous† 9 LINC00290 NA

(181616277J 81616377)_(182320440J 82320540)

CCOV36T chr6 g. 1,915,851 -8.97 homozygous 0 TMEM200A, SMLR1 , AKAP7, NA

(130482079J 30483079)_(132397929J 32398929) ARG1, ENPP3, MIR548H5,

ENPP1. SAMD3, EPB41 L2,

MED23, OR2A4, CTAGE9,

CTGF

CGOV36T chr6 g. 7,716 -8.77 homozygous 0 NA NA

(169247518_169248518)_(169255233J 69256233)

CGOV36T chr6 g. 473,882 -8.82 homozygous 0 LOC101929504, THBS2 NA

(169272099J 69273099)_(169745980J 69746980)

CGOV36T chr6 g. 508,373 -8.84 homozygous 0 C6orf120, ERMARD, NA

(169760688J 69761688)_(170269060J 70270060) LINC00574, WDR27, PHF10,

TCTE3, LINC00242

CCOV36T chr7 g.(16348899_16348999)_(16402033_16402133) 53,235 -0.80 hemizygous† 19 ISPD NA

CCOV36T chr9 g.(28514890_28514990)_(28521597_28521697) 6,808 -8.88 homozygous† 9 LING02 NA

CCOV36T chr9 g.(29414314_29415314)_(29493663_29494663) 79,350 -8.87 homozygous 0 NA NA

CCOV36T chr11 g.(98822208_98822308)_(98896885_98896985) 74,778 -0.99 hemizygous† 10 CNTN5 NA

CCOV36T chr13 g. (67464318_67464418)_(68397963_68398063) 933,746 -1.03 hemizygous† 15 PCDH9-AS2, PCDH9-AS3, NA

PCDH9-AS4, LINC00364,

PCDH9

CGOV36T chr15 g.(68750329_68750429)_(68763974_68764074) 13,746 -1.04 hemizygous† 19 NA NA

CGOV36T chr16 g.(47544078_47544178)_(47550398_47550498) 6,421 -0.93 hemizygous† 9 PHKB NA

CGOV36T chr16 g. (60081171_60081271 )_(60098411_60098511) 17,341 -8.91 homozygous† 18 LOC101927580 NA

CGOV36T chr18 g.(13337272_13337372)_(13368161_13368261) 30,990 -1.04 hemizygous† 10 LDLRAD4 NA

CGOV36T chr18 g. (30081909_30082909)_(30323322_30324322) 241 ,414 -8.86 homozygous 0 WBP11 P1 , KLHL14 NA

CGOV36T chr18 g.(48110088_48111088)_(48636743_48637743) 526,656 -8.87 homozygous 0 MAPK4, ME2, ELAC1 , SMAD4

SMAD4, MRO

CGOV36T chr18 g.(48646704_48647704)_(48924002_48925002) 277,299 -8.86 homozygous 0 LOC100287225, MEX3C NA

CGOV36T chr18 g.(48969198_48969298)_(49587451_49587551) 618,354 -8.87 homozygous† 19 LOC100287225 NA

CGOV36T chr18 g.(54734501_54735501)_(54737501_54738501) 3,001 -7.25 homozygous 0 LINC-ROR NA

CCOV36T chr18 g.(64557877_64558877)_(65001416_65002416) 443,540 -8.95 homozygous 0 MIR5011 NA

CCOV36T chr18 g.(66745649_66745749)_(66756842_66756942) 11 ,294 -8.96 homozygous† 17 NA NA

CCOV36T chr19 g.(1194869_1194969)_(1208881_1208981) 14,113 -7.86 homozygous† 13 STK11 STK11

CCOV36T chrX g.(33662265_33662365)_(33675743_33675843) 13,579 -0.96 hemizygous† 14 NA NA

CCOV36T chrX g.(41454974_41455074)_(41560090_41560190) 105,217 -0.99 hemizygous† 7 CPR34, CASK NA

CCOV36T chrX g.(78679335_78679435)_(78708145_78708245) 28,911 -0.94 hemizygous† 12 NA NA

CCOV36T chrX g.(80088296_80088396)_(80174822_80174922) 86,627 -1.05 hemizygous† 23 NA NA

CCOV36T chrX g.(81166475_81166575)_(81569724_81569824) 403,350 -1.00 hemizygous† 18 NA NA

CCOV36T chrX g. (83721783_83721883)_(84144376_84144476) 422,694 -0.99 hemizygous† 13 HDX NA

CCOV48T chr2 g. 6,801 -9.00 homozygous† 17 NA NA

(129456302J 294S6402)_(129463002J 29463102)

CCOV48T chr2 g. 358,406 -0.56 hemizygous† 15 NA NA

(221011 S06_221011606)_(221369811_221369911 )

CCOV48T chr2 g. 78,693 -1.25 hemizygous† 20 INPPSD NA

(233905717_233905817)_(233984309_233984409)

CCOV48T chr4 g.(31463462_31463S62)_(31469423_31469523) 6,062 -8.88 homozygous† 5 NA NA

CCOV48T chr4 g. 5,731 -1.43 hemizygous† 12 NA NA

(161013855J 61013955)_(161019485J 61019585)

CCOV48T chr4 g. 53,402 -1.16 hemizygous† 7 PALLD NA

(169825579J 6982S679)_(169878880J 69878980)

CCOV48T chr9 g.(21814704_21814804)_(22S23689_22S23789) 709,086 -8.93 homozygous† 20 MTAP, CDKN2A-AS1 , CDKN2A,

CDKN2B-AS1 , DMRTA1 , CDKN2B

CDKN2A, CDKN2B

CCOV48T chr9 g. 5,483 -8.90 homozygous† 31 NA NA

(113604657J 13604757)_(113610039J 13610139)

CCOV48T chr9 g. 4,401 -8.38 homozygous† 11 ZNF883 NA

(115777752J 15777852)_(115782052J 15782152)

CCOV48T chr10 g.(87337803_87337903)_(87353880_87353980) 16,178 -8.87 homozygous† 24 GRID1-AS1 NA

CCOV48T chr12 g.(85756813_85756913)_(86225814_86225914) 469,102 -0.68 hemizygous† 15 RASSF9 NA

CCOV48T chr18 g.(9743935_9744035)_(9754335_9754435) 10,501 -1.12 hemizygous† 5 RAB31 NA

CCOV48T chr19 g.(4988019_4989019)_(4993797_4994797) 5,779 -7.85 homozygous 1 KDM4B NA

CCOV48T chr19 g.(49183621_49183721 )_(49206388_49206488) 22,868 -1.12 hemizygous† 5 SEC1 P, FUT2, NA

LOC105447645

CCOV48T chr22 g.(337SS272_337S6272)_(337S9SSS_33760SSS) 4,284 -8.32 homozygous 2 LARGE NA

CCOV48T chrX g. 8,978 -1.09 hemizygous† 7 NA NA

(143628747J 43628847)_(143637624J 43637724)

CCOV38T chr1 g.(6437685_6438685)_(6445386_6446386) 7,702 -8.57 homozygous 1 ACOT7 NA

CCOV38T chr1 g.(43445793_43446793)_(43452756_43453756) 6,964 -8.58 homozygous 1 SLC2A1 -AS1 NA

CCOV38T chr1 g. 20,331 -8.64 homozygous† 14 NBPF18P, S100A11 NA

(151980225J 51980325)_(1 S20004SS_1 S2000SSS)

CCOV38T chr2 g. 3,682 -1.13 hemizygous† 8 NA NA

(153796000J 53796100)_(153799581 _153799681 )

CCOV38T chr6 g.(77438501_77439501)_(77452501_77453501) 14,001 -8.53 homozygous 0 NA NA

CCOV38T chr6 g. 4,367 -8.60 homozygous† 23 GRIK2 NA

(101934600J 01934700)_(101938866J 01938966)

CCOV38T chr9 g.(27777159_27777259)_(27798066_27798166) 21 ,008 -1.22 hemizygous† 16 NA NA

CCOV38T chr13 g.(3SSS8S01_3SSS9S01)_(3SS62S01_3SS63S01) 4,001 -8.63 homozygous 0 NBEA NA Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV38T chrX g.(6501878_6502878)_(6506061_6507061) 4,184 -3.56 homozygous 0 NA NA CCOV38T chrX g. 17,021 -1.18 hemizygous+ 8 STAG2 STAG2

(123104860 I 23104960)_(123121780_123121880)

CCOV49T chr3 g.(20311501_20312501)_(20315501_20316501) 4,001 -7.39 homozygous 0 NA NA

CCOV49T chr3 g. 14,656 -0.81 hemizygous+ 9 NA NA

(153599278J S3S99378)_(153613833J 53613933)

CCOV49T chr4 g. 50,992 -0.96 hemizygous+ 19 LINC01098, LINC01099 NA

(178821252_178821352)_(178872143_178872243)

CCOV49T chr6 g. 117,421 -1.02 hemizygous+ 12 PARK2 NA

(162322953J 62323053)_(162440273J 62440373)

CCOV49T chr9 g.(22599342_22599442)_(22606500_22606600) 7,259 -0.94 hemizygous+ 11 NA NA

CCOV49T chr9 g. 4,073 -1.00 hemizygous+ 10 HMCN2 NA

(133030683J 33030783)_(133034655J 33034755)

CCOV49T chr10 g. 4,826 -0.94 hemizygous+ 11 NA NA

(105715870J 05715970)_(105720595J 05720695)

CCOV49T chr15 g.(72016688_72016788)_(72104337_72104437) 87,750 -1.06 hemizygous+ 14 THSD4, NR2E3 NA

CCOV49T chr18 g.(66784036_66784136)_(66807797_66807897) 23,862 -1.02 hemizygous+ 21 NA NA

CCOV49T chr19 g.(55266691_55266791)_(55281325_55281425) 14,735 -0.89 hemizygous+ 5 KIR2DL3, KIR2DL1, NA

LOC101928804

CCOV10T chr1 g.(26460210_26460310)_(26464644_26464744) 4,535 -6.85 homozygous† 5 NA NA

CCOV10T chr1 g.(98168988_98169088)_(98176058_98176158) 7,171 -1.01 hemizygous† 8 DPYD NA

CCOV10T chr1 g. 472,922 -0.94 hemizygous† 15 TROVE2, CDC73, MIR1278, CDC73

(192945596J 92945696)_(193418417_193418517) LINC01031, UCHL5, GLRX2,

B3GALT2

CCOV10T chr2 g.(78565959_78566059)_(78666645_78666745) 100,787 -1.06 hemizygous† 6 NA NA

CCOV10T chr2 g. 7,685 -6.91 homozygous† 5 NA NA

(176203347J 76203447)_(176210931J 76211031 )

CCOV10T chr2 g. 9,001 -7.31 homozygous 0 ZNF385B NA

(180411501 _180412501 )_(180420501 _180421501 )

CCOV10T chr3 g.(59811733_59811833)_(60140716_60140816) 329,084 -1.04 hemizygous† 14 FHIT NA

CCOV10T chr3 g.(60246710_60246810)_(60435013_60435113) 188,404 -1.14 overlapping 7 FHIT NA hemizygous†

CCOV10T chr3 g.(60318539_60318639)_(60632927_60633027) 314,489 -1.01 overlapping 5 FHIT, MIR548BB NA hemizygous†

CCOV10T chr3 g.(60318039_60319039)_(60433501_60434501) 115,463 -8.94 homozygous 0 FHIT NA

CCOV10T chr3 g.(60866915_60867015)_(60958337_60958437) 91 ,523 -1.05 hemizygous† 12 FHIT NA

CCOV10T chr3 g.(97293289_97293389)_(97440831_97440931) 147,643 -0.92 hemizygous† 5 EPHA6 NA

CCOV10T chr3 g. 139,534 -0.92 overlapping 12 NAALADL2, MIR4789, NA

(175026820J 75026920)_(175166253J 75166353) hemizygous† MIR548AY

CCOV10T chr3 g. 132,182 -8.81 homozygous 0 NAALADL2, MIR4789, NA

(175026320J 75027320)_(175158501 _175159501 ) MIR548AY

CCOV10T chr4 g.(12677485J 2677585)_(12711162J 2711262) 33,778 -1.11 hemizygous† 9 NA NA

CCOV10T chr4 g.(13119160_13119260)_(13208066_13208166) 89,007 -0.77 hemizygous† 5 NA NA

CCOV10T chr4 g.(19084501_19085501)_(19169501_19170501) 85,001 -8.88 homozygous 0 NA NA

CCOV10T chr5 g.(59161500_59161600)_(59534753_59534853) 373,354 -1.01 hemizygous† 10 PDE4D NA

CCOV10T chr5 g.(59850099_59850199)_(60140400_60140500) 290,402 -1.02 hemizygous† 6 DEPDC1 B, ELOVL7 NA

CCOV10T chr5 g.(60314810_60314910)_(60417192_60417292) 102,483 -1.09 hemizygous† 9 NDUFAF2 NA

CCOV10T chr5 g.(65288688_65288788)_(65294084_65294184) 5,497 -8.92 homozygous† 11 ERBB2IP NA

CCOV10T chr5 g.(96372415_96372515)_(96417202_96417302) 44,888 -0.94 hemizygous† 12 NA NA

CCOV10T chr5 g.(97047921_97048021)_(97095986_97096086) 48,166 -1.05 hemizygous† 13 NA NA Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV10T chrS g. 165,656 -1.03 hemizygous† 11 NA NA

(161893168_161893268)_(162058723J 62058823)

CCOV10T chr5 g. 12,464 -0.89 hemizygous† 15 NA NA

(165767447J 65767547)_(165779810_165779910)

CCOV10T chr6 g.(77438501_77439501)_(77452501_77453501) 14,001 -7.25 homozygous 0 NA NA

CCOV10T chr6 g. 34,494 -1.05 hemizygous† 17 PARK2 NA

(162769012_162769112)_(162803405J 62803505)

CCOV10T chr7 g.(40115044_40115144)_(40240948_40241048) 126,005 -1.06 hemizygous† 9 CDK13, SUCCT, MPLKIP NA

CCOV10T chr7 g.(90013231_90013331 )_(90142691_90142791) 129,561 -0.97 hemizygous† 7 CTPBP10. LOC101409256, NA

CLDN12

CCOV10T chr7 g. 51 ,206 -1.02 hemizygous† 8 KMT2E NA

(104662593J 04662693)_(104713698J 04713798)

CCOV10T chr7 g. 405,154 -0.98 hemizygous† 7 NA NA

(109632363J 09632463)_(110037416_110037516)

CCOV10T chr7 g. 12,088 -8.86 homozygous† 11 LRRN3, IMMP2L NA

(110768465J 10768565)_(110780452J 10780552)

CCOV10T chr7 g. 242,702 -1.02 hemizygous+ 17 EXOC4 NA

(133518916_133519016)_(133761517_133761617)

CCOV10T chr8 g.(40182947_40183047)_(40189649_40189749) 6,803 -0.94 hemizygous† 13 NA NA

CCOV10T chr9 g.(9053905_9054005)_(9259998_9260098) 206,194 -0.96 hemizygous† 8 PTPRD NA

CCOV10T chr9 g. (9990197_9990297)_(10379332_10379432) 389,236 -8.78 homozygous† 16 PTPRD NA

CCOV10T chr9 g.(74827975_74828075)_(74915865_74915965) 87,991 -0.93 hemizygous† 8 CDA, LINC01504 NA

CCOV10T chr11 g.(29027686_29027786)_(29457684_29457784) 430,099 -0.98 hemizygous† 11 NA NA

CCOV10T chr11 g.(70155057_70155157)_(70238991_70239091) 84,035 -0.90 hemizygous† 7 PPFIA1 NA

CCOV10T chr12 g.(93178251_93178351 )_(94329770_94329870) 1,151 ,620 -1.02 hemizygous† 6 LOC102724933, NUDT4, NA

NUDT4P2, NUDT4P1,

MRPL42, SOCS2, CRADD,

EEA1 , LOC643339, UBE2N, SOCS2-AS1 , LOC101928731

CCOV10T chr14 g.(70017062_70017162)_(70022324_70022424) 5,363 -8.33 homozygous† 20 NA NA

CCOV10T chr16 g.(78162775_78162875)_(78352369_78352469) 189,695 -0.99 hemizygous† 8 WWOX NA

CCOV10T chr16 g.(78609922_78610022)_(78626990_78627090) 17,169 -0.89 hemizygous† 15 WWOX NA

CCOV10T chr16 g. (78741639_78741739)_(78811297_78811397) 69,759 -1.01 hemizygous† 11 WWOX NA

CCOV10T chr16 g.(78847865_78847965)_(78955560_78955660) 107,796 -1.00 hemizygous† 10 WWOX NA

CCOV10T chr17 g.(22060527_22060627)_(22066595_22066695) 6,169 -1.09 hemizygous† 6 NA NA

CCOV10T chr20 g.(14676042_14676142)_(15296859J 5296959) 620,918 -3.04 overlapping 10 MACRO D2, MACRO D2-AS1 NA hemizygous†

CCOV10T chr20 g.(14723501_14724501 )_(14754501_14755501) 31 ,001 -6.07 homozygous 0 MACRO D2 NA

CCOV10T chr20 g.(14724034_14724134)_(14934392_14934492) 210,459 -3.54 overlapping 11 MACRO D2, MACRO D2-AS1 NA hemizygous†

CCOV10T chr20 g.(14755501_14756501 )_(14778501_14779501) 23,001 -4.32 homozygous 0 MACRO D2 NA

CCOV10T chr20 g.(14876501_14877501 )_(14933990J 4934990) 57,490 -5.20 homozygous 0 MACRO D2, MACROD2-AS1 NA

CCOV10T chr20 g.(14939501_14940501 )_(14984501_14985501) 45,001 -6.85 homozygous 1 MACRO D2 NA

CCOV10T chr20 g.(15096346_15096446)_(15139610_15139710) 43,365 -9.02 homozygous† 7 MACRO D2 NA

CCOV10T chr20 g.(15155501_15156501 )_(15214501_15215501) 59,001 -9.01 homozygous 0 MACRO D2 NA

CCOV10T chr20 g.(15255748_15256748)_(15296459_15297459) 40,712 -8.93 homozygous 0 MACRO D2 NA

CCOV10T chrX g.(6686876_6686976)_(6987973_6988073) 301 ,198 -1.13 overlapping 11 HDHD1 NA hemizygous†

CCOV10T chrX g.(6686376_6687376)_(6736501_6737501) 50,126 -8.87 homozygous 0 NA NA

CCOV10T chrX g.(7022694_7022794)_(7044555_7044655) 21 ,962 -1.02 hemizygous† 10 HDHD1 NA Number Previously

Log2 paired Implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV13T chr2 g. 1,087,764 -0.48 hemizygous† 11 ERBB4, MIR548F2 ERBB4

(212321097_212321197)_(213408760_213408860)

CGOV13T chr3 g.(80863479_80863579)_(80972333_80972433) 108,955 -1.40 hemizygous† 8 NA NA

CGOV13T chr4 g.(21900075_21900175)_(21910945_21911045) 10,971 -1.41 hemizygous† 8 KCNIP4 NA

CGOV13T chr5 g. 2,957 -5.77 homozygous† 15 ADAMTS19 NA

(128926970J 28927070)_(128929826J 28929926)

CGOV13T chr7 g.(1388847_1388947)_(1462551_1462651) 73,805 -1.33 hemizygous† 16 NA NA

CGOV13T chr7 g.(51816029_51816129)_(51828512_51828612) 12,584 -8.86 homozygous† 20 NA NA

CGOV13T chr12 g.(23123501_23124501 )_(23153501_23154501) 30,001 -4.07 homozygous 0 NA NA

CGOV13T chr12 g.(27648223_27648323)_(27654963_27655063) 6,841 -0.91 hemizygous† 152 SMC02 NA

CGOV13T chr12 g. 22,052 -1.36 hemizygous† 10 GCN1, MIR4498 NA

(120577774J 20577874)_(120599725J 20599825)

CGOV13T chr13 g.(84820374_84820474)_(84999433_84999533) 179,160 -0.40 hemizygous† 6 LINC00333 NA

CGOV13T chr14 g.(72805874_72805974)_(72810762_72810862) 4,989 -8.39 homozygous† 18 RGS6 NA

CGOV13T chr18 g.(41325958_41326958)_(41330769_41331769) 4,812 -8.91 homozygous 0 NA NA

CGOV13T chr18 g. (54021489_54022489)_(54026036_54027036) 4,548 -8.88 homozygous 1 NA NA

CGOV13T chr18 g.(69591274_69591374)_(69607621_69607721) 16,448 -8.86 homozygous† 11 NA NA

CGOV13T chrX g.(8017546_8017646)_(8459534_8459634) 442,089 -8.84 overlapping 6 MIR651 , VCX3B, VCX2 NA hemizygous†

CGOV13T chrX g.(8017501_8018501)_(8206501_8207501) 189,001 -4.23 homozygous 0 MIR651. VCX2 NA

CGOV13T chrX g.(8207501_8208501)_(8430501_8431501) 223,001 -8.86 homozygous 0 VCX3B NA

CGOV13T chrX g.(71532361_71533361 )_(71608180_71609180) 75,820 -8.83 homozygous 3 HDAC8 NA

CGOV40T chr3 g.(30109860_30110860)_(30448241_30449241) 338,382 -8.60 homozygous 0 NA NA

CGOV40T chr3 g. (30476177_30477177)_(30518460_30519460) 42,284 -8.60 homozygous 0 NA NA

CGOV40T chr3 g.(30664108_30665108)_(30702536_30703536) 38,429 -8.59 homozygous 0 TGFBR2 TGFBR2

CGOV40T chr3 g. (60322103_60322203)_(60462343_60462443) 140,341 -1.28 overlapping 9 FHIT NA hemizygous†

CGOV40T chr3 g.(60365451_60365551)_(60580322_60580422) 214,972 -8.70 overlapping 10 FHIT NA hemizygous†

CGOV40T chr3 g.(60364959_60365959)_(60461943_60462943) 96,985 -8.72 homozygous 0 FHIT NA

CGOV40T chr3 g. (60467710_60467810)_(60555646_60555746) 88,037 -8.72 homozygous† 5 FHIT NA

CGOV40T chr4 g. 171 ,549 -8.80 homozygous† 25 GPM6A NA

(176779205J 76779305)_(176950653J 76950753)

CGOV40T chr6 g.(12478890_12478990)_(12483270_12483370) 4,481 -1.10 hemizygous† 8 NA NA

CGOV40T chr6 g. 5,528 -3.42 homozygous 0 NA NA

(142237501 _142238501 )_(142243028J 42244028)

CGOV40T chr8 g.(83693267_83693367)_(83703040_83703140) 9,874 -1.21 hemizygous† 21 NA NA

CGOV40T chr9 g.(21879264_21880264)_(22014155_22015155) 134,892 -8.89 homozygous 1 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A,

CDKN2A, CDKN2B CDKN2B

CGOV40T chr9 g.(43503501_43504501)_(43658501_43659501) 155,001 -7.19 homozygous 0 FAM74A7, SPATA31 A6 NA

CGOV40T chr9 g. 5,820 -8.81 homozygous 0 0R13C5. 0R13C2 NA

(107361193_107362193)_(107367012_107368012)

CGOV40T chr9 g. 4,458 -8.31 homozygous† 6 ZNF883 NA

(115777732J 15777832)_(115782089J 15782189)

CGOV40T chr10 g.(67905425_67906425)_(67915416_67916416) 9,992 -8.77 homozygous 2 CTNNA3 NA

CGOV40T chr13 g.(69244761_69244861)_(69268614_69268714) 23,954 -1.23 hemizygous† 7 NA NA

CGOV40T chr13 g. 17,306 -1.29 hemizygous† 9 FAM155A NA

(108112115_108112215)_(108129320J 08129420)

CGOV40T chr16 g.(78169069_78169169)_(78178012_78178112) 9,044 -1.42 hemizygous† 8 WWOX NA WO 2020/081549 _Number PCT/US2019/056299, _reviously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV40T chr16 g. (78581883_78581983)_(78624144_78624244) 42,362 -1.61 hemizygous _† 12 WWOX NA

CCOV40T chr17 g.(28939501_28940501)_(28949501_28950501) 10,001 -7.98 homozygous 0 LRRC37BP1 , SH3GL1 P2 NA

CCOV40T chr18 g.(66745659_66745759)_(66756839_66756939) 11 ,281 -8.81 homozygous _† 17 NA NA

CCOV40T chr19 g.(11130042_11131042)_(11133876_11134876) 3,835 -8.57 homozygous 0 SMARCA4 NA

CCOV40T chr19 g.(11153594_11154594)_(11160561_11161561) 6,968 -7.39 homozygous 0 SMARCA4 NA

CCOV40T chr21 g.(43343501_43344501)_(43349501_43350501) 6,001 -8.65 homozygous 0 C2CD2 NA

CCOV40T chr22 g.(19892068_19892168)_(20024323_20024423) 132,356 -1.23 hemizygous _† 12 COMT, MIR4761, TANC02, NA

MIR185, TXNRD2, ARVCF

CCOV40T chrX g.(6855501_6856501)_(6910501_6911501) 55,001 -8.63 homozygous 0 NA NA

CCOV15T chr1 g.(21966870_21966970)_(21980618_21980718) 13,849 -1.60 hemizygous _† 7 RAP1 CAP NA

CCOV15T chr1 g.(77031928_77032028)_(77047415_77047515) 15,588 -0.45 hemizygous _† 13 ST6CALNAC3 NA

CCOV15T chr1 g. 133,050 -2.28 hemizygous _† 14 XPR1 NA

(180742702J 80742802)_(180875651 _180875751 )

CCOV15T chr1 g. 38,275 -1.39 hemizygous _† 7 HHAT NA

(210582343_210582443)_(210620517_210620617)

CCOV15T chr2 g.(3732876_3732976)_(3737864_3737964) 5,089 -9.16 homozygous _† 30 ALLC NA

CCOV15T chr2 g. 19,642 -0.89 hemizygous _† 12 NA NA

(122767609J 22767709)_(122787150_122787250)

CCOV15T chr3 g. (83342471_83342571)_(83368227_83368327) 25,857 -1.71 hemizygous _† 15 NA NA

CCOV15T chr4 g.(28131351_28131451)_(28177945_28178045) 46,695 -1.05 hemizygous _† 6 NA NA

CCOV15T chr4 g.(55072681_55072781)_(55081578_55081678) 8,998 -1.22 hemizygous _† 11 NA NA

CCOV15T chr4 g.(92100501_92101501)_(92334501_92335501) 234,001 -8.76 homozygous 0 CCSER1 NA

CCOV15T chr5 g.(44548972_44549072)_(44554728_44554828) 5,857 -2.14 hemizygous _† 13 NA NA

CCOV15T chr5 g. 4,627 -7.50 homozygous _† 12 NA NA

(111939649J 11939749)_(111944175_111944275)

CCOV15T chr5 g. 2,356,089 -8.20 homozygous 0 LOC102467224, HNCAT21, NA

(117400375J 17401375)_(119756463J 19757463) LOC102467225, MIR1244-1 ,

MIR1244-2, MIR1244-3,

MIR1244-4, DMXL1,

MIR5706, TNFAIP8,

HSD17B4, FAM170A,

HRAT56, DTWD2

CC0V1ST chr5 g. 16,127 -1.30 hemizygous _† 12 CANX NA

(179132631 _179132731 )_(179148657J 79148757)

CC0V1ST chr6 g.(62759791_62759891)_(62792146_62792246) 32,456 -1.14 hemizygous _† 14 KHDRBS2 NA

CC0V1ST chr6 g. (65221140_65221240)_(65227676_65227776) 6,637 -0.83 hemizygous _† 8 EYS NA

CC0V1ST chr7 g.(49168703_49168803)_(49233800_49233900) 65,198 -0.66 hemizygous _† 8 NA NA

CC0V1ST chr7 g. 30,166 -0.69 hemizygous _† 6 NRCAM NA

(107899737J 07899837)_(107929802J 07929902)

CC0V1ST chr10 g.(1105261 _1105361 )_(1118994_1119094) 13,834 -0.89 hemizygous _† 7 WDR37 NA

CC0V1ST chr10 g.(23415227_23415327)_(23436931_23437031) 21 ,805 -1.20 hemizygous _† 7 MSRB2 NA

CC0V1ST chr10 g.(51003501_51004501 )_(51009501_51010501) 6,001 -5.41 homozygous 0 NA NA

CC0V1ST chr12 g.(8378501_8379501)_(8411501_8412501) 33,001 -6.67 homozygous 0 LOC101927905, FAM90A1 , NA

FAM86FP

CC0V1ST chr12 g. 29,309 -0.62 hemizygous _† 9 TTC41 P NA

(104282150_104282250)_(104311358_104311458)

CC0V1ST chr12 g. 12,914 -0.50 hemizygous _† 6 POLR3B NA

(106811523_106811623)_(106824336J 06824436)

CC0V1ST chr13 g. 291 ,808 -0.96 hemizygous _† 29 LINC00676, IRS2 NA

(110177155_110177255)_(110468862J 10468962)

CC0V1ST chr14 g.(25373790_25373890)_(25458530_25458630) 84,841 -0.59 hemizygous _† 10 STXBP6 NA WO 2020/081549 . Log ,2 ^Nu p"ali ^b re ^e d ^r . PCT/US2019/056299 implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV15T Chris g.(29864654_29864754)_(29918051_29918151) 53,498 -8.77 homozygous† 17 FAM189A1 NA

CGOV15T chr15 g. (54851057_54851157)_(54973874_54973974) 122,918 -1.41 hemizygous† 7 UNC13C NA

CGOV15T chr16 g.(19945577_19945677)_(19967459_19967559) 21 ,983 -8.69 homozygous 4 NA NA

CGOV15T chr16 g.(55956023_55956123)_(56056729_56056829) 100,807 -0.77 hemizygous† 6 CES5A NA

CGOV15T chr16 g.(62612601_62612701 )_(62833269_62833369) 220,769 -1.18 hemizygous† 9 NA NA

CGOV15T chr17 g.(151746_151846)_(227412_227512) 75,767 -8.69 homozygous† 10 LOC100506388, RPH3AL NA

CGOV15T chr17 g.(9590501_9591501)_(9946501_9947501) 356,001 -8.26 homozygous 0 USP43, CLP2R, DHRS7C, NA

CSC1 L2, RCVRN, CAS7

CGOV15T chr17 g.(10619784J 0620784)_(12488757J 2489757) 1,868,974 -8.50 homozygous 0 TMEM220-AS1 , SHISA6, MAP2K4

DNAH9, MAP2K4, MIR744, LINC00670, TMEM220,

MACOH2P, LINC00675,

PIRT, ZNF18

CC0V1ST chr17 g.(13082022_13082122)_(13822892J 3822992) 740,971 -8.66 homozygous† 10 HS3ST3A1 NA

CC0V1ST chr17 g.(19615501_19616501 )_(20548501_20549501) 933,001 -8.66 homozygous 0 SPECC1 , CCDC144CP, NA

FAM106B, CDRT15L2,

SLC47A2, ALDH3A1 , ULK2, AKAP10, LCALS9B,

KRT16P3

CGOV15T chr17 g.(20785501_20786501)_(21504501_21505501) 719,001 -8.70 homozygous 0 CCDC144NL-AS1, NA

LOC339260, LINC01563,

DHRS7B, MAP2K3, KCNJ12,

KCN J18, CCDC144NL,

USP22, TMEM11 , NATD1,

C17orf51

CC0V1ST chr18 g.(7SS08039_7SS08139)_(7SSSS191_7SSSS291) 47,253 -0.61 hemizygous† 11 NA NA

CC0V1ST chr19 g.(3350028_3350128)_(3394707_3394807) 44,780 -8.65 homozygous† 6 NFIC NA

CC0V1ST chr20 g.(15927164_15927264)_(16058289J 6058389) 131 ,226 -0.49 hemizygous† 7 MACROD2, LOC613266 NA

CC0V1ST chr21 g.(15957697_15958697)_(16976324_16977324) 1,018,628 -8.79 homozygous 0 SAMSN1-AS1 , SAMSN1, NA

LOC388813, NRIP1

CC0V1ST chr22 g.(46475503_46475603)_(46492250_46492350) 16,848 -1.51 hemizygous† 10 MIRLET7BHG, MIR3619 NA

CC0V1ST chrX g.(26225501_26226501 )_(26710501_26711501) 485,001 -5.39 homozygous 0 MAGEB5, VENTXP1 NA

CC0V1ST chrX g.(39610501_39611501 )_(39623501_39624501) 13,001 -4.46 homozygous 0 NA NA

CC0V1ST chrX g.(57745501_57746501)_(57767501_57768501) 22,001 -5.43 homozygous 0 NA NA

CC0V1ST chrX g.(71347989_71348089)_(71433156_71433256) 85,268 -8.73 homozygous 4 NHSL2, FLJ44635, PIN4, NA

RGAG4, ERCC6L

CC0V1ST chrX g. (86649199_86649299)_(86658925_86659025) 9,827 -8.73 homozygous† 9 NA NA

CC0V1ST chrX g. 218,146 -8.73 homozygous 0 NA NA

(140344044_140345044)_(140562189_140563189)

CC0V1ST chrX g. 8,942 -8.73 homozygous† 8 NA NA

(143628754J 436288S4)_(143637S9SJ 43637695)

CC0V1T chr1 g.(19599702_19599802)_(19614010_19614110) 14,409 -1.02 hemizygous† 10 AKR7L, AKR7A3 NA

CC0V1T chr1 g.(26459640_26460640)_(26464310_26465310) 4,671 -8.73 homozygous 1 NA NA

CC0V1T chr1 g.(98689985_98690085)_(99141697_99141797) 451 ,813 -0.97 hemizygous† 13 LOC729987, SNX7 NA

CC0V1T chr2 g.(7229968_7230068)_(7235598_7235698) 5,731 -1.05 hemizygous† 5 NA NA

CC0V1T chr2 g.(9925530_9925630)_(9928887_9928987) 3,458 -7.98 homozygous† 5 NA NA

CC0V1T chr3 g.(60345982_60346082)_(60383574_60383674) 37,693 -1.23 hemizygous† 10 FHIT NA

CC0V1T chr4 g.(19278234_19278334)_(19460166_19460266) 182,033 -0.99 hemizygous† 12 NA NA

CC0V1T chr4 g. 3,973 -7.19 homozygous† 37 GUCY1A3 NA

(156594266J 56594366)_(156598138_156598238)

CC0V1T chr4 g. 183,155 -1.05 hemizygous† 8 LINC00290 NA

(181848196_181848296)_(182031250_182031350) Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV1T chr4 g. 524,126 -1.05 hemizygous+ 13 NA NA

(182123700J 82123800)_(18264772SJ 82647825)

CCOV1T chr5 g. 14,079 -0.97 hemizygous+ 11 NA NA

(155577264J 55577364)_(155591242_155591342)

CCOV1T chr6 g.(21090286_21090386)_(21160245_21160345) 70,060 -0.99 hemizygous+ 7 CDKAL1 NA

CCOV1T chr6 g. 4,773 -8.45 homozygous+ 5 NA NA

(121795537J 21795637)_(121800209J 21800309)

CCOV1T chr6 g. 6,393 -8.75 homozygous† 11 MIR3668 NA

(140530722J 40530822)_(140537014_140537114)

CCOV1T chr7 g.(6908501_6909501)_(6915501_6916501) 7,001 -7.26 homozygous 0 NA NA

CCOV1T chr7 g.(40085858_40085958)_(40124311_40124411) 38,554 -0.99 hemizygous† 13 CDK13 NA

CCOV1T chr7 g.(69458323_69458423)_(69800753_69800853) 342,531 -1.02 hemizygous† 10 AUTS2 NA

CCOV1T chr7 g. 53,474 -1.04 hemizygous† 11 IMMP2L NA

(110580825J 10580925)_(110634198_110634298)

CCOV1T chr7 g. 364,481 -1.01 hemizygous† 11 EXOC4 NA

(133043937J 33044037)_(133408317_133408417)

CCOV1T chr8 g.(16262064_16262164)_(16274526J 6274626) 12,563 -1.08 hemizygous† 9 NA NA

CCOV1T chr8 g.(82974620_82975620)_(82980136_82981136) 5,517 -8.94 homozygous 2 NA NA

CCOV1T chr10 g.(67324149_67324249)_(67336328_67336428) 12,280 -0.92 hemizygous† 20 LINC01515 NA

CCOV1T chr11 g.(15807501_15808501)_(15814501_15815501) 7,001 -8.78 homozygous 0 NA NA

CCOV1T chr11 g.(25019501_25020501)_(25034501_25035501) 15,001 -8.70 homozygous 0 LUZP2 NA

CCOV1T chr11 g.(25702329_25702429)_(25720746_25720846) 18,518 -8.88 homozygous† 23 NA NA

CCOV1T chr11 g.(84163691_84163791 )_(84211492_84211592) 47,902 -0.75 hemizygous† 25 DLG2 NA

CCOV1T chr11 g.(84389850_84389950)_(84418921_84419021) 29,172 -1.02 hemizygous† 6 DLG2 NA

CCOV1T chr13 g.(92386303_92386403)_(92392209_92392309) 6,007 -0.93 hemizygous† 8 GPC5 NA

CCOV1T chr13 g.(93962563_93962663)_(93995411_93995511) 32,949 -0.94 hemizygous† 16 GPC6 NA

CCOV1T chr14 g.(68712272_68712372)_(69157739_69157839) 445,568 -1.00 hemizygous† 16 RAD51 B NA

CCOV1T chr15 g.(24055429_24055529)_(24061470_24061570) 6,142 -0.86 hemizygous† 21 NA NA

CCOV1T chr15 g.(25420182_25420282)_(25430634_25430734) 10,553 -1.00 hemizygous† 11 SNORD115-1, SNORD115-2, NA

SNORD115-3, SNORD115-4, SNORD115-5, SNORD115-9, SNORD115-10, SNORD115- 12, SNORD115-6,

SNORD115-7, SNORD115-8, SNORD115-11, SNORD115-

29, SNORD115-36,

SNORD115-43

CCOV1T chr16 g.(78925208_78925308)_(79006380_79006480) 81 ,273 -1.00 hemizygous† 13 WWOX NA

CCOV1T chr17 g.(13876885_13876985)_(14059858_14059958) 183,074 -0.91 hemizygous† 12 CDRT15P1 , COX10, COX10- NA

AS1

CCOV1T chr18 g.(36656930_36657030)_(36666550_36666650) 9,721 -1.01 hemizygous† 12 NA NA

CCOV1T chr18 g.(36905374_36905474)_(37108979_37109079) 203,706 -1.05 hemizygous† 7 LINC00669 NA

CCOV1T chrX g.(32475980_32476080)_(32598402_32598502) 122,523 -1.12 hemizygous† 16 DMD. MIR3915 NA

CCOV26T chr2 g. 9,623 -1.10 hemizygous† 21 NA NA

(184794361 _184794461 )_(184803883J 84803983)

CCOV26T chr3 g.(59763028_59763128)_(59894791_59894891) 131 ,864 -1.21 hemizygous† 8 FHIT NA

CCOV26T chr4 g.(37925922_37926022)_(37960519_37960619) 34,698 -1.20 hemizygous† 9 TBC1 D1 , PTTG2 NA

CCOV26T chr4 g.(39704426_39704526)_(39713802_39713902) 9,477 -7.90 homozygous† 9 UBE2K NA

CCOV26T chr5 g.(97047921_97048021)_(97096045_97096145) 48,225 -8.66 homozygous† 35 NA NA

CCOV26T chr7 g.(3863809_3863909)_(3911770_3911870) 48,062 -1.24 hemizygous† 50 SDK1 NA Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV26T chr7 g.(48581358_48581458)_(48592493_48592593) 11 ,236 -1.28 hemizygous† 22 ABCA13 NA

CGOV26T chr7 g. 8,453 -4.87 overlapping 11 CNTNAP2 NA

(145997335J 45997435)_(146005687J 46005787) hemizygous†

CGOV26T chr7 g. 3,368 -8.00 homozygous 0 CNTNAP2 NA

(145996923J 45997923)_(146000290J 46001290)

CGOV26T chr9 g.(21714247_21714347)_(22214586_22214686) 500,440 -8.57 homozygous† 12 MTAP, CDKN2A-AS1 , CDKN2A,

CDKN2B-AS1, CDKN2A, CDKN2B CDKN2B

CCOV26T chr9 g.(30501164_30S01264)_(30S37747_30S37847) 36,684 -1.23 hemizygous† 12 NA NA

CCOV26T chr9 g. 4,254 -1.12 hemizygous† 5 HMCN2 NA

(133030507J 33030607)_(133034660J 33034760)

CCOV26T chr9 g. 19,425 -1.12 hemizygous† 10 C9orf163, SEC16A, NOTCH1 NOTCH1

(139365645J 39365745)_(139384969J 39385069)

CCOV26T chr10 g.(58512930_58513030)_(58526800_58526900) 13,971 -1.15 hemizygous† 9 NA NA

CCOV26T chr12 g.(51376582_51376682)_(51380169_51380269) 3,688 -8.48 homozygous† 8 SLC11A2 NA

CCOV26T chr14 g.(55788248_55788348)_(56113943_56114043) 325,796 -1.35 hemizygous† 9 FBX034, KTN1 , ATG14, NA

TBPL2, KTN1-AS1

CCOV26T chr17 g.(49079114_49079214)_(49109589_49109689) 30,576 -0.53 hemizygous† 22 SPAG9 NA

CCOV26T chr19 g.(348972_349072)_(364146_364246) 15,275 -1.48 hemizygous† 8 MIER2, THEG NA

CCOV26T chr20 g.(7398616_7398716)_(7403427_7403527) 4,912 -1.26 hemizygous† 20 NA NA

CCOV26T chr20 g.(52647045_52647145)_(52657841_52657941) 10,897 -1.08 hemizygous† 14 BCAS1 NA

CCOV26T chr22 g.(46515882_46515982)_(46521451_46521551) 5,670 -8.36 homozygous† 18 NA NA

CCOV26T chrX g. 92,769 -8.58 homozygous† 31 NA NA

(127626935J 27627035)_(127719603J 27719703)

CCOV2T chr1 g.(31600723_31600823)_(31624480_31624580) 23,858 -7.85 homozygous† 16 NA NA

CCOV2T chr1 g.(71728900_71729000)_(71829880_71829980) 101 ,081 -0.42 hemizygous† 22 NA NA

CCOV2T chr1 g. 9,681 -8.89 homozygous 4 SPTA1 NA

(158624153_158624253)_(158633733J 58633833)

CCOV2T chr1 g. 45,001 -6.25 homozygous 0 FCGR2C, HSPA7, FCGR3B NA

(161573501J 61574501 )_(161618501J 61619501 )

CCOV2T chr1 g. 15,188 -8.90 homozygous† 12 C1 orf110 NA

(162830890J 62830990)_(162845977J 62846077)

CCOV2T chr2 g.(18597257_18597357)_(18630511_18630611) 33,355 -1.25 hemizygous† 16 NA NA

WO 2020/081549 Number PCT/US2019/056299p _reviously

Log2 paired Implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CGOV2T chr4 g. 7,976,275 -8.83 homozygous 0 NPY2R, LOC102724776, NA

(155875122_155876122)_(163851396_163852396) GUCY1 A3, GUCY1 B3, TD02,

GLRB, GRIA2, LOC340017,

TMEM144, RXFP1, ETFDH,

FNIP2, MIR3688-2,

RAPGEF2, LOC101928052,

MAP9, ASIC5, CTSO, PDGFC,

FAM198B, C4orf46, PPID,

C4orf45, MIR3688-1, FSTL5

CGOV2T chrS g.(16115873_16115973)_(16126604_16126704) 10,832 -0.55 hemizygous† 9 MARCH11 NA

CGOV2T hrS g.(87378949_87379049)_(87381901_87382001) 3,053 -8.90 homozygous+ 23 NA NA

CGOV2T chr8 g.(7224S01_722SS01)_(808SS01_8086S01) 861 ,001 -6.09 homozygous 0 DEFB105B, DEFB105A, NA

DEFB107A, DEFB107B,

PRR23D1 , PRR23D2,

FAM90A1 OP, DEFB106B,

DEFB106A, DEFB104B,

DEFB104A, SPAG11 B,

SPAG11A, DEFB103A,

DEFB103B, DEFB4A,

ZNF705B, FAM66E,

FAM86B3P, ZNF705G,

DEFB4B, FAM90A7P,

USP17L8, USP17L3,

DEFB109P1 B, MIR548I3

CGOV2T chr8 g.(4018292S_4018302S)_(40189629_40189729) 6,805 -1.22 hemizygous+ 18 NA NA

CGOV2T chr8 g. 97,202 -1.50 hemizygous+ 13 NA NA

(140371181 _140371281 )_(140468282J 40468382)

CGOV2T chr10 g.(67298233_67298333)_(67436538_67436638) 138,406 -0.77 hemizygous+ 7 LINC01515 NA

CGOV2T chr10 g.(87781729_87781829)_(87803914_87804014) 22,286 -0.73 hemizygous+ 18 GRID1 NA

CGOV2T chr11 g.(63918342_63918442)_(63984807_63984907) 66,566 -0.58 hemizygous+ 17 STIP1, FERMT3, MACROD1 NA

CGOV2T chr11 g. 18,001 -8.88 homozygous 0 NA NA

(134927501 _134928501 )_(134945501 _134946501 )

CGOV2T chr12 g.(86426154_86426254)_(86432770_86432870) 6,717 -8.67 homozygous† 5 MGAT4C NA

CGOV2T chr13 g.(67377894_67377994)_(67397021_67397121) 19,228 -8.86 homozygous† 5 PCDH9-AS2, PCDH9 NA

CGOV2T chr15 g.(39995634_39995734)_(41216175_41216275) 1,220,642 -0.51 hemizygous† 6 EIF2AK4, SRP14-AS1 , BUB1 B

BUB1 B, PAK6, INAFM2,

PHGR1 , DISP2, KNSTRN,

IVD, BAHD1 , CHST14,

RPUSD2, CASC5, RAD51,

GCHFR, C15orf62, ZFYVE19,

SPINT1 , VPS18, FSIP1 ,

GPR176, SRP14. BMF,

C15orf56, ANKRD63, PLCB2, C15orf52, C15orf57,

MRPL42P5, RAD51-AS1,

RMDN3, DNAJC17,

PPP1 R14D. RHOV

Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer CCOV33T chr1 g. 7,805 -1.88 hemizygous _† 21 NA NA

(164263758J 64263858)_(164271462_164271562)

CCOV33T chr2 g. 7,908 -8.84 homozygous _† 20 ERBB4 ERBB4

(213184027_213184127)_(213191834_213191934)

CCOV33T chr2 g. 826,557 -0.76 hemizygous _† 18 MRPL44, SCC2, AP1 S3, NA

(224183534_224183634)_(225009990_225010090) WDFY1 , SERPINE2

CCOV33T chr3 g.(13670383J 3670483)_(13685181_13685281) 14,899 -8.48 homozygous _† 18 FBLN2 NA

CCOV33T chr3 g. 175,569 -8.76 homozygous _† 13 NA NA

(116750517_116750617)_(116925985J 16926085)

CCOV33T chr3 g. 6,517 -8.24 homozygous 3 NA NA

(197050011_197051011 )_(197056527J 97057527)

CCOV33T chr4 g. 1,601 ,298 -8.76 homozygous 0 F11 -AS1 , MTNR1 A, FAT1 , NA

(187294251 _187295251 )_(188895548J 88896548) LOC339975, LOC100506272

CCOV33T chr5 g.(801501_802501)_(835501_836501) 34,001 -7.01 homozygous 0 ZDHHC11 NA

CCOV33T chr5 g.(97047920_97048020)_(97095996_97096096) 48,177 -1.68 hemizygous _† 14 NA NA

CCOV33T chr7 g. 9,620 -0.78 hemizygous+ 5 LOC102724434 NA

(115931689_115931789)_(115941208_115941308)

CCOV33T chr9 g.(6700548_6700648)_(6710469_6710569) 10,022 -8.66 homozygous _† 9 NA NA

CCOV33T chr11 g.(78768586_78768686)_(78783435_78783535) 14,950 -0.77 hemizygous _† 17 TENM4 NA

CCOV33T chr11 g. 6,339 -8.65 homozygous _† 14 CADM1 NA

(115161091 _115161191 )_(115167329J 15167429)

CCOV33T chr13 g.(69244758_69244858)_(69268600_69268700) 23,943 -8.89 homozygous _† 27 NA NA

CCOV33T chr15 g.(83353829_83353929)_(83384013_83384113) 30,285 -0.94 hemizygous _† 6 CPEB1 -AS1 , AP3B2, NA

LOC338963

CCOV33T chr16 g.(78507078_78507178)_(78703215_78703315) 196,238 -0.88 hemizygous _† 11 WWOX NA

CCOV33T chr17 g.(9218275_9218375)_(9222529_9222629) 4,355 -8.67 homozygous _† 7 STX8 NA

CCOV33T chr21 g.(38742100_38742200)_(38758613_38758713) 16,614 -0.75 hemizygous _† 19 DYRK1A NA

CCOV33T chr22 g.(1862SS66_18626S66)_(18629269_18630269) 3,704 -6.74 homozygous 0 USP18 NA

CCOV33T chrX g.(82319877_82320877)_(82324858_82325858) 4,982 -8.74 homozygous 0 NA NA

CCOV3T chr4 g. 4,940 -8.76 homozygous 0 NA NA

(112236959J 12237959)_(112241898_112242898)

CCOV3T chr9 g. 5,416 -6.53 homozygous 0 NA NA

(134260046J 34261046)_(134265461 _134266461 )

CCOV3T chr10 g.(82879485_82879585)_(82891184_82891284) 11 ,800 -8.69 homozygous _† 26 NA NA

CCOV3T chr11 g.(85263096_85263196)_(85274620_85274720) 11 ,625 -0.90 hemizygous _† 8 DLC2 NA

CCOV3T chr13 g.(83788283_83788383)_(83792440_83792540) 4,258 -8.66 homozygous _† 8 NA NA

CCOV3T chr13 g.(98529959_98530059)_(98532905_98533005) 3,047 -8.72 homozygous _† 8 NA NA

CCOV3T chr17 g.(22060527_22060627)_(22066594_22066694) 6,168 -1.06 hemizygous _† 5 NA NA

CCOV42T chr1 g. 4,860 -1.44 hemizygous _† 12 NA NA

(182728047J 82728147)_(182732806J 82732906)

CCOV42T chr1 g. 5,980 -1.67 hemizygous _† 7 SMG7 NA

(183501670_183501770)_(183507549J 83507649)

CCOV42T chr2 g.(148434S0_14843SS0)_(14941023_14941123) 97,674 -1.25 hemizygous _† 10 NA NA

CCOV42T chr2 g.(15217654_15217754)_(15405895_15405995) 188,342 -1.27 hemizygous _† 5 NBAS NA

CCOV42T chr2 g.(33852018_33852118)_(33937227_33937327) 85,310 -1.51 hemizygous _† 14 LINC01317 NA

CCOV42T chr3 g.(21338538_21338638)_(21397459_21397559) 59,022 -1.26 hemizygous _† 15 NA NA Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV42T chr3 g. 5,932,201 -8.82 homozygous 0 LINC01322, LINC01327, NA

(16198719S_161988195)_(16791939SJ 67920395) SERPINI1 , LINC01330,

LINC01192, MIR1263,

LINC01324, SI, SLITRK3,

BCHE, ZBBX, SERPINI2,

WDR49, PDCD10, GOLIM4

CGOV42T chr3 g. 1,317,001 -8.72 homozygous 0 EGFEM1 P, MIR551 B, NA

(167922501 _167923501 )_(169239501 _169240501 ) LOC100507661, MECOM

CGOV42T chr4 g.(16343864_16343964)_(16356548_16356648) 12,785 -1.19 hemizygous† 7 NA NA

CGOV42T chr4 g.(81209059_81209159)_(81228236_81228336) 19,278 -1.23 hemizygous† 11 FGFS NA

CGOV42T chr4 g. 7,389 -8.77 homozygous† 13 NA NA

(166772764J 66772864)_(166780052J 66780152)

CGOV42T chr4 g. 1,465,620 -8.80 homozygous 0 NEIL3, LINC01098, AGA, NA

(177955251 _177956251 )_(179420870J 79421870) LINC01099

CGOV42T chr5 g.(1489490_1489590)_(1525158_1525258) 35,769 -8.53 homozygous† 22 LPCAT1, MIR6075 NA

CGOV42T chr5 g. 34,398 -1.30 hemizygous† 20 NA NA

(125109232J 25109332)_(125143529J 25143629)

CGOV42T chr5 g. 6,966 -7.72 homozygous† 9 NA NA

(162048798J 62048898)_(162055663J 62055763)

CGOV42T chr5 g. 4,728 -8.21 homozygous† 26 ZFP2 NA

(178348356J 78348456)_(178352983J 78353083)

CGOV42T chr6 g. 102,344 -1.29 hemizygous† 6 NA NA

(126839504J 26839604)_(126941747_126941847)

CGOV42T chr7 g. (69834817_69834917)_(69890868_69890968) 56,152 -1.18 hemizygous† 9 AUTS2 NA

CGOV42T chr7 g.(78035451_78035551)_(78379562_78379662) 344,212 -1.29 hemizygous† 6 MAGI2 NA

CGOV42T chr7 g. 3,444 -4.97 homozygous 4 CUX1 NA

(101724570J 01724670)_(101727913_101728013)

CGOV42T chr8 g.(89828384_89828484)_(89922135_89922235) 93,852 -0.56 hemizygous† 7 NA NA

CGOV42T chr11 g.(28184661_28184761 )_(28461232_28461332) 276,672 -1.29 hemizygous† 7 METTL15 NA

CGOV42T chr11 g. 42,982 -1.27 hemizygous† 8 OR10G4, OR10G9, OR10G8, NA

(123866862J 23866962)_(123909743J 23909843) OR10G7

CGOV42T chr12 g.(29316667_29316767)_(29697815_29697915) 381 ,249 -1.09 hemizygous† 12 FAR2, OVCH1-AS1 , NA

LOC100506606, ERGIC2,

OVCH1 , TMTC1

CGOV42T chr12 g.(86426152_86426252)_(86432770_86432870) 6,719 -1.57 hemizygous† 5 MGAT4C NA

CGOV42T chr12 g. 3,503 -1.48 hemizygous† 8 ATXN2 NA

(111976338J 11976438)_(111979740J 11979840)

CGOV42T chr13 g. (80681134_80681234)_(80686285_80686385) 5,252 -8.76 homozygous† 10 NA NA

CGOV42T chr13 g. 8,762 -1.28 hemizygous† 17 NA NA

(109949122_109949222)_(109957783J 09957883)

CGOV42T chr15 g. (33986177_33986277)_(34030418_34030518) 44,342 -1.23 hemizygous† 10 RYR3 NA

CGOV42T chr16 g. (78262211_78262311 )_(78326681_78326781) 64,571 -8.38 homozygous† 7 WWOX NA

CGOV42T chr16 g.(79015446_79015546)_(79057892_79057992) 42,547 -7.92 homozygous† 9 WWOX NA

CGOV42T chr16 g.(83566487_83566587)_(83572114_83572214) 5,728 -8.58 homozygous† 7 CDH13 NA

CGOV42T chr16 g. (88895413_88895513)_(88905737_88905837) 10,425 -0.43 hemizygous† 7 GALNS NA

CGOV42T chr19 g.(244501_245501)_(437501_438501) 193,001 -8.73 homozygous 0 PPAP2C, MIER2, THEG, NA

C2CD4C, SHC2

CGOV42T chr19 g.(S146794S_S146894S)_(S1493S84_S1494584) 25,640 -8.63 homozygous 0 KLK6, KLK7 NA

CGOV42T chr19 g.(54356009_54356109)_(54369515_54369615) 13,607 -8.67 homozygous† 5 MYADM NA

CGOV42T chr20 g.(52285529_52285629)_(52291766_52291866) 6,338 -1.52 hemizygous† 6 NA NA

CGOV42T chr21 g.(46057573_46057673)_(46066375_46066475) 8,903 -1.32 hemizygous† 5 KRTAP10-10. KRTAP10-11, NA

TSPEAR Number Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOV42T chrX g.(3703400_3703500)_(3711152_3711252) 7,853 -7.71 homozygous† 8 NA NA

CCOV42T chrX g.(6501501_6502501)_(6505501_6506501) 4,001 -3.41 homozygous 0 NA NA

CCOV42T chrX g.(10390812_10390912)_(10559740J 0559840) 169,029 -8.78 homozygous† 19 MIDI NA

CCOV42T chrX g.(63700501_63701501)_(63715501_63716501) 15,001 -8.75 homozygous 0 NA NA

CCOV42T chrX g.(74663501_74664501)_(74666501_74667501) 3,001 -8.71 homozygous 0 ZDHHC15 NA

CCOV42T chrX g.(96006783_96006883)_(96025741_96025841) 19,059 -8.84 homozygous† 8 DIAPH2 NA

CCOV53T chr1 g.(7975030_7975130)_(7987470_7987570) 12,541 -0.94 hemizygous† 12 TNFRSF9 NA

CCOV53T chr2 g. 9,512 -1.63 hemizygous† 23 NA NA

(184794483J 84794583)_(184803894J 84803994)

CCOV53T chr2 g. 211 ,173 -0.40 hemizygous† 11 ERBB4 ERBB4

(212274020_212274120)_(212485092_212485192)

CCOV53T chr3 g.(59763116_59763216)_(59894753_59894853) 131 ,738 -0.86 hemizygous† 8 FHIT NA

CCOV53T chr3 g.(60477380_60477480)_(60692910_60693010) 215,631 -1.52 hemizygous† 13 FHIT, MIR548BB NA

CCOV53T chr4 g.(37925940_37926040)_(37960502_37960602) 34,663 -1.74 hemizygous† 15 TBC1 D1 , PTTG2 NA

CCOV53T chr4 g.(39704403_39704503)_(39713735_39713835) 9,433 -7.40 homozygous 4 UBE2K NA

CCOV53T chr4 g. 678,411 -0.78 hemizygous† 14 INPP4B NA

(143066945J 43067045)_(143745255J 43745355)

CCOV53T chr5 g.(97047935_97048035)_(97095991_97096091) 48,157 -8.60 homozygous† 24 NA NA

CCOV53T chr5 g. 4,664 -1.73 hemizygous† 23 ZFP2 NA

(178348453J 78348553)_(178353016_178353116)

CCOV53T chr7 g. (3863816_3863916)_(3911763_3911863) 48,048 -8.52 homozygous† 26 SDK1 NA

CCOV53T chr7 g. (48581358_48581458)_(48592487_48592587) 11 ,230 -0.56 hemizygous† 9 ABCA13 NA

CCOV53T chr7 g. 8,375 -4.34 overlapping 6 CNTNAP2 NA

(145997407J 45997507)_(146005681 _146005781 ) hemizygous†

CCOV53T chr7 g. 2,001 -8.49 homozygous 0 CNTNAP2 NA

(145997501 _145998501 )_(145999501 _146000501 )

CCOV53T chr8 g. 79,953 -0.59 hemizygous† 15 ASAP1 , ASAP1-IT1 NA

(131253805J 31253905)_(131333657J 31333757)

CCOV53T chr9 g.(21714106_21714206)_(22214507_22214607) 500,502 -8.45 homozygous† 11 MTAP, CDKN2A-AS1 , CDKN2A,

CDKN2B-AS1, CDKN2A, CDKN2B CDKN2B

CGOV53T chr10 g.(58513114_58513214)_(58526789_58526889) 13,776 -0.77 hemizygous† 13 NA NA

CGOV53T chr10 g.(72599046_72599146)_(72602587_72602687) 3,642 -0.71 hemizygous† 26 SGPL1 NA

CGOV53T chr11 g. 3,778 -8.43 homozygous† 10 TMEM123 NA

(102303643J 02303743)_(102307320J 02307420)

CGOV53T chr12 g.(20808640_20808740)_(20950019_20950119) 141 ,480 -0.86 hemizygous† 12 PDE3A, SLC01C1 NA

CGOV53T chr12 g.(44456088_44456188)_(44630675_44630775) 174,688 -0.88 hemizygous† 18 TMEM117 NA

CGOV53T chr12 g.(51376835_51376935)_(51380217_51380317) 3,483 -8.40 homozygous 4 SLC11A2 NA

CGOV53T chr12 g.(81711183_81711283)_(81773125_81773225) 62,043 -0.86 hemizygous† 10 LOC102724663, PPFIA2 NA

CGOV53T chr16 g.(78686925_78687025)_(78860448_78860548) 173,624 -1.16 overlapping 11 WWOX NA hemizygous†

CGOV53T chr16 g.(78779546_78779646)_(78796468_78796568) 17,023 -8.61 homozygous† 11 WWOX NA

CGOV53T chr16 g.(78811577_78812577)_(78858501_78859501) 46,925 -8.61 homozygous 0 WWOX NA

CGOV53T chr16 g.(78812077_78812177)_(78863098_78863198) 51 ,122 -1.03 overlapping 6 WWOX NA hemizygous†

CGOV53T chr17 g.(49079112_49079212)_(49109481_49109581) 30,470 -1.01 hemizygous† 34 SPAG9 NA

CGOV53T chr20 g.(7398778_7398878)_(7403413_7403513) 4,736 -8.54 homozygous† 21 NA NA

CGOV53T chr20 g. (52647122_52647222)_(52657842_52657942) 10,821 -1.39 hemizygous† 22 BCAS1 NA

CGOV53T chr22 g.(46516094_46516194)_(46521450_46521550) 5,457 -8.31 homozygous† 18 NA NA WO 2020/081549 Number PCT/US2019/056299 ^Previously

Log2 paired implicated

Lab id Chr Deletion Width ratio Type reads Gene in cancer

CCOVS3T chrX g.(17167316_17167416)_(17179418_17179518) 12,203 -8.48 homozygous† 9 REPS2 NA CCOVS3T chrX g. 151 ,718 -8.57 overlapping 10 IL1 RAPL2, TEX13A NA

(104368659J 04368759)_(104520276J 04520376) hemizygous†

CCOV53T chrX g. 75,001 -4.48 homozygous 0 IL1 RAPL2 NA

(104368501 _104369501 )_(104443501 _104444501 )

CCOV53T chrX g. 75.927 -8.60 homozygous 0 IL1 RAPL2. TEX13A NA

(104443941 _104444941 )_(104519867J 04520867)

CCOV53T chrX g. 92.763 -8.52 homozygous† 16 NA NA

(127626941 _127627041 )_(127719603J 27719703)

CCOV37T_3 chr1 g.(41087863_41087963)_(41221210_41221310) 133,448 -1.01 hemizygous† 19 NFYC, MIR30E, MIR30C1, NA

RIMS3, NFYC-AS1

CCOV37T_3 chr1 g.(72755758_72755858)_(72763943_72764043) 8,286 -9.21 homozygous† 16 NA NA CCOV37T_3 chr1 g. 39.927 -0.93 hemizygous† 17 FLG-AS1 , FLG2 NA

(152311258_152311358)_(152351084_152351184)

CGOV37T_3 chr2 g. 3,730 -5.71 homozygous† 7 NA NA

(153795954J 53796054)_(153799583J 53799683)

CGOV37T_3 chr3 g.(37046030_37046130)_(37185482_37185582) 139,553 -9.15 homozygous† 17 MLH1 , LRRFIP2 MLH1 CGOV37T_3 chr3 g. 5,620 -0.97 hemizygous† 14 PPM1 L NA

(160680330J 60680430)_(160685849J 60685949)

CGOV37T_3 chr3 g. 42,302 -0.95 hemizygous† 21 LINC01322 NA

(165041000_165041100)_(165083201 _165083301 )

CGOV37T_3 chr3 g. 5,604 -8.99 homozygous† 41 NA NA

(192776933J 92777033)_(192782436J 92782536)

CGOV37T_3 chr4 g.(64134360_64134460)_(64154376_64154476) 20,117 -0.96 hemizygous† 27 NA NA CGOV37T_3 chr7 g.(36037453_36037553)_(36041197_36041297) 3,845 -7.99 homozygous† 5 NA NA CGOV37T_3 chr7 g. 10,001 -4.35 homozygous 0 NA NA

(159117501 _159118501 )_(159127501 _159128501 )

CGOV37T_3 chr8 g.(40182920_40183020)_(40189648_40189748) 6,829 -0.99 hemizygous† 20 NA NA CGOV37T_3 chr8 g.(90171824_90171924)_(90277807_90277907) 106,084 -0.97 hemizygous† 21 NA NA CGOV37T_3 chr9 g.(21968502_21968602)_(22129928_22130028) 161 ,527 -8.55 homozygous† 16 CDKN2A-AS1 , CDKN2B-AS1 , CDKN2A,

CDKN2A, CDKN2B CDKN2B

CGOV37T_3 chr10 g.(58513132_58513232)_(58526794_58526894) 13.763 -0.93 hemizygous† 13 NA NA CGOV37T_3 chr12 g.(99041398_99041498)_(99503060_99503160) 461 ,763 -0.94 hemizygous† 9 APAF1 , LOC101928937, NA

IKBIP, ANKS1 B

CGOV37T_3 chr14 g.(46749199_46749299)_(46770458_46770558) 21 ,360 -0.98 hemizygous† 22 LINC00871 NA CGOV37T_3 chr14 g.(73526897_73526997)_(73531837_73531937) 5,041 -1.19 hemizygous† 8 RBM25 NA CGOV37T_3 chr17 g.(3914657_3915657)_(4208274_4209274) 293,618 -8.92 homozygous 1 CYB5D2, ZZEF1 , ANKFY1 , NA

UBE2G1. LOC103021295

CGOV37T_3 chr18 g.(7920468_7920568)_(7988489_7988589) 68,122 -0.98 hemizygous† 13 PTPRM NA CGOV37T_3 chr18 g.(41764002_41764102)_(41776785_41776885) 12,884 -1.00 hemizygous† 22 NA NA CGOV37T_3 chr20 g.(15726759_15726859)_(15789129_15789229) 62,471 -0.96 hemizygous† 19 MACRO D2 NA CGOV37T_3 chrX g. 8,968 -1.04 hemizygous† 10 NA NA

(143628759J 43628859)_(143637626J 43637726)

Table S9 Rearrangements

Related to Figures 3A and 5 and Experimental Procedures. Rearrangements were identified from rearranged read pairs and split reads.

Number Number rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV16T OAW-42 inversion chr19 chr19 4,835,211- 14,546,455- TICAM1. PLIN3 PKN1 5 2 100710-100892

4,835,361 14,546,615 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV16T OAW-42 gain chr20 chr20 15,996,052- 16,033,364- MACROD2 MACROD2.1 7 20 103419-103424

15,996,400 16,033,603

CCOV16T OAW-42 loss chr20 chr20 29,818,195- 33,630,734- NA TRPC4AP 16 40 104180-104215

29,818,564 33,631,024

CCOV16T OAW-42 gain chr20 chr20 32,658,167- 32,787,227- RALY NA 6 10 104202-104206

32,658,336 32,787,447

CCOV16T OAW-42 gain chr22 chr22 30,518,830- 38,489,532- HORMAD2 BAIAP2L2 6 20 108117-108279

30,519,127 38,489,875

CCOV16T OAW-42 inversion chrX chrX 9,815,075- 39,558,090- SHROOM2 NA 6 10 108882-110204

9,815,344 39,558,493

CCOV16T OAW-42 gain chrX chrX 16,316,966- 16,346,266- NA NA 8 8 109166-109168

16,317,166 16,346,455

CCOV16T OAW-42 translocation chr2 chr17 27,710,203- 48,261,240- IFT172, FNDC4 COL1A1 11 2 13311-97258

27,710,454 48,261,494

CCOV16T OAW-42 translocation chr2 chr19 54,636,653- 17,345,337- NA NR2F6 6 20 14528-100970

54,636,902 17,345,525

CCOV16T OAW-42 gain chr2 chr2 54,724,409- 54,775,457- SPTBN1 SPTBN1.1 5 6 14538-14547

54,724,638 54,775,685

CCOV16T OAW-42 translocation chr2 chr19 54,937,742- 17,049,492- NA CPAMD8 14 22 14570-100952

54,938,009 17,049,705

CCOV16T OAW-42 loss chr2 chr2 59,239,060- 59,870,706- LINC01122 NA 5 12 14761-14780

59,239,242 59,870,940

CCOV16T OAW-42 loss chr3 chr3 12,259,584- 76,732,223- NA NA 20 12 20766-22759

12,259,881 76,732,465

CCOV16T OAW-42 loss chr3 chr3 13,879,526- 76,530,605- WNT7A NA 18 24 20970-22746

13,879,874 76,530,877

CCOV16T OAW-42 gain chr1 chr1 98,677,099- 205,678,211- LOC729987 NUCKS1 8 16 2121-7658

98,677,377 205,678,416

CCOV16T OAW-42 inversion chr3 chr3 40,526,035- 64,654,951- ZNF619 ADAMTS9 7 10 22160-22519

40,526,699 64,655,128

CCOV16T OAW-42 gain chr3 chr3 47,807,980- 47,819,288- SMARCC1 SMARCC1.1 6 8 22326-22327

47,808,273 47,819,492

CCOV16T OAW-42 gain chr3 chr3 96,547,586- 101,714,307- EPHA6 LOC152225 9 4 23428-23845

96,547,785 101,714,685

CCOV16T OAW-42 inversion / chr3 chr12 101,699,368- 48,230,874- LOC152225 VDR 10 2 23842-84452 translocation 101,699,572 48,231,061

CCOV16T OAW-42 gain chr3 chr3 129,338,100- 129,350,552- NA NA 8 2 25087-25088

129,338,382 129,350,753

CCOV16T OAW-42 translocation chr3 chr8 143,163,633- 103,209,440- SLC9A9 NA 14 14 25675-67915

143,163,889 103,209,695

CCOV16T OAW-42 gain chr1 chr1 112,879,771- 112,969,181- NA CTTNBP2NL 9 2 2765-2776

112,879,969 112,969,353 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV16T OAW-42 gain chr6 chr6 6,741 ,881- 6,991,008- NA NA 19 16 42272-42297

6,742,151 6,991,254

CCOV16T OAW-42 loss chr6 chr6 85,514, eSS- 88,104,814- NA LINC01590 7 14 45697-45763 eS, 515,047 88,105,044

CCOV16T OAW-42 gain chr6 chr6 135,539,469- 135,557,357- MYB NA 6 6 47987-47989

135,539,705 135,557,500

CCOV16T OAW-42 gain chr1 chr1 27,114,787- 27,183,242- PICV ZDHHC18 13 16 524-528

27,115,180 27,183,471

CCOV16T OAW-42 gain chr1 chr1 182,884,773- 182,901 ,425- SHCBP1 L SHCBP1 L1 5 2 5843-5844

182,884,949 182,901 ,583

CCOV16T OAW-42 translocation chr8 chr17 71 ,316,592- 35,279,530- NCOA2 NA 12 10 64330-96632

71 ,317,147 35,279,719

CCOV16T OAW-42 gain chr8 chr8 79,333,654- 79,850,120- NA NA 6 14 65201-65282

79,333,882 79,850,339

CCOV16T OAW-42 gain chr8 chr8 100,846,149- 101,225,828- VPS13B SPAC1 11 8 67641-67690

100,846,595 101,226,034

CCOV16T OAW-42 gain chr9 chr9 108,009,472- 108,303,375- SLC44A1 FSD1 L 5 12 74082-74096

108,009,622 108,303,528

CCOV16T OAW-42 gain chr11 chr11 61 ,976,445- 61,989,785- SCCB2A1 NA 6 10 81210-81211

61 ,976,658 61,990,020

CCOV16T OAW-42 inversion / chr13 chr20 52,518,360- 11,481,763- ATP7B NA 43 56 88396-102795 translocation 52,518,684 11,482,040

CCOV16T OAW-42 translocation chr14 chr16 81 ,669,334- 84,652,974- CTF2A1 , COTL1 6 16 91071-95328

81 ,669,541 84,653,174 SNORA79

CCOV16T OAW-42 gain chr15 chr1 S 33,256,439- 74,543,020- FMN1 CCDC33 8 10 92055-93267

33,256,705 74,543,251

CCOV16T OAW-42 translocation chr15 chr21 34,142,581- 35,835,140- RYR3 KCNE1 11 12 92101-107520

34,142,784 35,835,424

CCOV16T OAW-42 inversion / chr15 chrX 53,703,416- 39,538,556- NA NA 10 10 92434-110201 translocation 53,703,640 39,538,796

CCOV16T OAW-42 gain chr1S chr1 S 66,419,293- 66,479,356- MEGF11 MEGF11.1 17 16 92804-92810

66,419,594 66,479,573

CCOV16T OAW-42 translocation chr1S chrX 91 ,025,616- 15,495,137- IQGAP1 PIR-FIGF, PIR 6 6 93503-109126

91 ,025,867 15,495,282

CCOV16T OAW-42 gain chr17 chr17 45,727,969- 45,794,333- KPNB1 TBKBP1 5 8 97148-97154

45,728,197 45,794,510

CCOV16T OAW-42 gain chr17 chr17 67,479,976- 67,543,211- MAP2K6 MAP2K6.1 7 18 98785-98794

67,480,183 67,543,517

CCOV17T OV-167 gain chr1 chr1 224,377,073- 224,407,753- DEGS1 LOC101927164 9 14 10061-10063

224,377,289 224,408,057

CCOV17T OV-167 gain chr20 chr20 16,360,876- 16,421,849- KIF16B KIF16B.1 21 28 101453-101460

16,361,162 16,422,118

CCOV17T OV-167 gain chr22 chr22 19,214,118- 20,959,852- CLTCL1 NA 10 8 104977-105100

19,214,281 20,960,079 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV17T OV-167 loss chrX chrX 127,630,362- 128,669,634- NA OCRL 5 17 107979-107984

127,630,624 128,669,799

CCOV17T OV-167 gain chr2 chr2 64,133,144- 64,656,237- VPS54 NA 35 62 18611-18691

64,133,425 64,656,490

CCOV17T OV-167 gain chr2 chr2 86,027,392- 86,209,918- NA NA 31 42 20934-20968

86,027,613 86,210,182

CCOV17T OV-167 gain chr1 chr1 50,736,658- 50,907,992- NA FAF1 19 24 2098-2121

50,736,883 50,908,188

CCOV17T OV-167 gain chr2 chr2 116,117,239- 116,184,338- DPP10 DPP10.1 19 20 22077-22084

116,117,479 116,184,569

CCOV17T OV-167 gain chr2 chr2 127,596,711- 128,359,796- NA MY07B 10 4 22488-22562

127,596,959 128,360,004

CCOV17T OV-167 loss chr2 chr2 141,712,249- 142,179,547- LRP1 B LRP1 B.1 5 2 23063-23071

141,712,417 142,179,773

CCOV17T OV-167 translocation chr2 chr14 175,832,973- 23,767,373- CHN1 PPP1 R3E 18 16 26097-86006

175,833,265 23,767,584

CCOV17T OV-167 inversion chr2 chr2 193,303,910- 198,809,718- NA PLCL1 13 32 26869-27071

193,304,131 198,809,916

CCOV17T OV-167 gain chr2 chr2 195,741,725- 195,773,163- NA NA 15 32 26941-26946

195,741,951 195,773,396

CCOV17T OV-167 inversion / chr2 chr9 213,892,673- 9,996,254- IKZF2 PTPRD 15 20 27165-66104 translocation 213,892,934 9,996,494

CCOV17T OV-167 gain chr2 chr2 237,918,244- 237,957,286- NA NA 17 30 27539-27544

237,918,501 237,957,603

CCOV17T OV-167 loss chr3 chr3 60,846,591- 173,223,541- FHIT NLGN1 10 14 28762-36041

60,846,798 173,223,707

CCOV17T OV-167 gain chr4 chr4 106,617,666- 106,646,733- INTS12 GSTCD 6 6 40664-40666

106,617,849 106,646,926

CCOV17T OV-167 inversion / chrS chr11 175,735,128- 77,511,522- SIMC1 RSF1 7 12 51474-77718 translocation 175,735,289 77,511,721

CCOV17T OV-167 inversion / chr6 chr8 34,444,810- 146,071 ,256- PACSIN1 ZNF7, COMMD5 8 12 53165-65952 translocation 34,445,010 146,071 ,479

CCOV17T OV-167 translocation chr6 chr14 113,722,686- 25,434,251- NA STXBP6 49 66 54447-86136

113,723,100 25,434,808

CCOV17T OV-167 gain chr7 chr7 33,300,266- 33,380,820- BBS9 BBS9.1 9 16 55822-55827

33,300,490 33,381,038

CCOV17T OV-167 gain chr7 chr7 51 ,409,487- 51,496,334- NA NA 7 6 56102-56105

51 ,409,686 51,496,506

CCOV17T OV-167 gain chr7 chr7 54,867,532- 55,063,674- LOC100996654 NA 10 6 56182-56196

54,867,789 55,063,886

CCOV17T OV-167 gain chr1 chr1 158,587,103- 166,568,059- SPTA1 FM09P 6 4 5924-6421

158,587,348 166,568,271

CCOV17T OV-167 gain chr7 chr7 155,067,842- 155,109,344- NA NA 23 20 62916-62920

155,068,138 155,109,595

CCOV17T OV-167 gain chr8 chr8 4,308,080- 4,343,436- CSMD1 CSMD1.1 6 2 63188-63192

4,308,309 4,343,628

CCOV17T OV-167 inversion / chr8 chr9 42,503,375- 15,494,783- NA PSIP1 9 8 63982-66335 translocation 42,503,890 15,495,241

CCOV17T OV-167 gain chr8 chr8 55,506,909- 58,484,277- NA NA 8 8 64266-64377

55,507,239 58,484,674 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV17T OV-167 gain chr8 chr8 122,102,896- 125,228,161- NA LOC101927588 6 12 65487-65611

122,103,058 125,228,406

CCOV17T OV-167 gain chr1 chr1 171,224,082- 171,399,868- FM01 NA 8 12 6705-6723

171,224,240 171,400,114

CCOV17T OV-167 gain chr10 chr10 75,149,295- 75,622,497- ANXA7 CAMK2G 6 10 72028-72062

75,149,434 75,622,706

CCOV17T OV-167 gain chr1 chr1 186,994,860- 187,050,053- NA NA 21 22 7593-7606

186,995,120 187,050,293

CCOV17T OV-167 loss chr11 chr11 59,145,236- 77,510,917- NA RSF1 8 8 76579-77718

59,145,434 77,511,142

CCOV17T OV-167 gain chr11 chr11 63,758,472- 63,821,326- OTUB1 MACROD1 16 30 76871-76879

63,758,788 63,821,550

CCOV17T OV-167 gain chr11 chr11 74,846,470- 75,348,524- NA MAP6 15 22 77504-77570

74,846,737 75,348,756

CCOV17T OV-167 loss chr13 chr13 77,602,339- 111,088,595- FBXL3 COL4A2 10 6 85686-85852

77,602,560 111,088,817

CCOV17T OV-167 translocation chr14 chrX 105,628,276- 85,353,335- JAC2 NA 8 2 90233-107341

105,628,453 85,353,510

CCOV17T OV-167 translocation chr1S chr22 48,772,963- 34,252,417- FBN1 LARGE 6 20 91050-105692

48,773,168 34,252,635

CCOV17T OV-167 gain chr16 chr16 12,361,936- 12,388,953- SNX29 SNX29.1 17 16 92050-92053

12,362,209 12,389,175

CCOV17T OV-167 gain chr16 chr16 69,327,563- 69,477,312- SNTB2 CYBSB 15 6 92784-92787

69,327,818 69,477,556

CCOV17T OV-167 gain chr17 chr17 8,431 ,424- 8,598,435- MYH10 NA 19 22 93279-93291

8,431 ,678 8,598,694

CCOV17T OV-167 gain chr17 chr17 69,863,856- 70,370,596- NA NA 29 22 95774-95862

69,864,120 70,370,895

CCOV17T OV-167 gain chr17 chr17 73,593,464- 73,809,028- MY01SB UNK 28 36 96065-96102

73,593,749 73,809,334

CCOV18T OV177 inversion chr18 chr18 392,725- 402,850- COLEC12 COLEC12.1 5 6 100082-100083

392,965 403,086

CCOV18T OV177 gain chr18 chr18 3,477,593- 4,284,566- GAPLINC DLGAP1-AS5, 20 28 100249-100361

3,477,924 4,284,816 DLGAP1

CCOV18T OV177 gain chr18 chr18 12,285,206- 14,006,999- NA NA 17 20 100795-101008

12,285,553 14,007,272

CCOV18T OV177 gain chr18 chr18 13,697,628- 14,022,017- FAM210A NA 14 2 100963-101011

13,697,947 14,022,245 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV18T OV177 gain chr18 chr18 44,661,429- 44,784,323- HDHD2 NA 8 12 102075-102080

44,661,643 44,784,501

CCOV18T OV177 gain chr18 chr18 72,375,427- 72,985,799- ZNF407 TSHZ1 14 12 102377-102396

72,375,637 72,986,044

CCOV18T OV177 gain chr19 chr19 12,888,769- 13,380,246- HOOK2 CACNA1A 11 12 102654-102732

12,889,046 13,380,489

CCOV18T OV177 inversion chr1 chr1 5,603,371- 5,959,940- NA NPHP4 21 20 103-134

5,603,702 5,960,286

CCOV18T OV177 inversion chr19 chr19 22,643,242- 42,366,897- NA RPS19 8 4 103163-103714

22,643,469 42,367,132

CCOV18T OV177 translocation chr1 chr13 212,789,941- 115,072,441- ATF3 UPF3A 16 14 10454-89988

212,790,155 115,072,687

CCOV18T OV177 gain chr20 chr20 30,609,350- 31,593,656- CCM2L BPIFB2, SUN5 6 4 104976-105131

30,609,598 31,593,869

CCOV18T OV177 gain chr20 chr20 59,819,289- 60,213,850- NA CDH4 16 16 108891-108967

59,819,513 60,214,096

CCOV18T OV177 gain chr21 chr21 35,073,089- 36,250,678- ITSN1 RUNX1 10 4 109907-109982

35,073,261 36,251,006

CCOV18T OV177 gain chr21 chr21 40,013,758- 40,467,552- ERG NA 11 20 110086-110114

40,013,960 40,467,796

CCOV18T OV177 gain chr22 chr22 41 ,546,030- 41,896,673- EP300 AC02 9 10 110869-110889

41 ,546,308 41,896,835

CCOV18T OV177 gain chr22 chr22 46,354,233- 46,470,260- WNT7B NA 38 42 110947-110961

46,354,552 46,470,562

CCOV18T OV177 gain chrX chrX 12,720,075- 14,347,230- FRMPD4 NA 6 6 111105-111133

12,720,301 14,347,467

CCOV18T OV177 loss chrX chrX 30,728,073- 31,382,372- GK DMD 11 4 111242-111243

30,728,334 31,382,557

CCOV18T OV177 gain chr1 chr1 231,312,554- 232,023,081- TRIM67 TSNAX-DISC1 , 10 30 11251-11345

231,312,854 232,023,335 DISC1

CCOV18T OV177 gain chr2 chr2 7,298,478- 7,361,454- NA NA 16 34 12151-12161

7,298,729 7,361,730

CCOV18T OV177 gain chr2 chr2 46,310,675- 46,387,133- PRKCE PRKCE.1 6 6 14181-14190

46,310,888 46,387,296

CCOV18T OV177 gain chr2 chr2 48,662,202- 48,979,784- NA STON1- 14 18 14304-14336

48,662,464 48,980,039 GTF2A1 L, LHCGR

CCOV18T OV177 gain chr2 chr2 51 ,956,459- 52, 072, 608- NA NA 14 18 14494-14509

SI ,956,692 52,072,895

CCOV18T OV177 gain chr2 chr2 70,280,303- 70,568,596- PCBP1-AS1 NA 8 20 15480-15504

70,280,548 70,568,867

CCOV18T OV177 gain chr2 chr2 77,539,561- 77,676,038- LRRTM4 LRRTM4.1 20 40 15878-15898

77,539,818 77,676,318

CC0V18T OV177 gain chr2 chr2 85,964,021- 86,293,367- NA POLR1A 5 12 16615-16667

85,964,279 86,293,711

CC0V18T OV177 inversion / chr2 chr3 113,725,356- 185,968,003- NA DGKG 6 18 17673-29674 translocation 113,725,595 185,968,210

CC0V18T OV177 translocation chr2 chr18 114,722,970- 44,583,110- ACTR3 KATNAL2 7 16 17792-102071

114,723,159 44,583,348

CC0V18T OV177 translocation chr2 chr19 120,823,397- 17,138,863- EPB41 L5 CPAMD8 22 14 18109-102945

120,823,587 17,139,251

CC0V18T OV177 gain chr2 chr2 178,292,907- 178,678,341- ACPS PDE11A 9 18 21165-21214

178,293,200 178,678,646

CC0V18T OV177 gain chr2 chr2 186,895,343- 187,167,551- LINC01473 NA 6 6 21404-21413

186,895,582 187,167,767

CC0V18T OV177 gain chr2 chr2 201,501,185- 201,721 ,424- AOX1 CLK1 13 16 21622-21627

201,501,414 201,721 ,750

CC0V18T OV177 gain chr2 chr2 203,323,806- 203,889,582- BMPR2 NBEAL1 19 14 21646-21671

203,324,092 203,889,821

CC0V18T OV177 translocation chr3 chr18 1,936,528- 385,647- NA COLEC12 7 6 22991-100081

1,936,756 385,858

CC0V18T OV177 gain chr1 chr1 71 ,805,449- 72,010,902- NA NEGR1 11 12 2312-2334

71 ,805,686 72,011,132

CC0V18T OV177 gain chr3 chr3 27,138,798- 27,903,097- NA NA 22 32 24052-24139

27,139,119 27,903,353

CC0V18T OV177 gain chr3 chr3 32,140,906- 32,488,474- NA CMTM7 7 8 24282-24296

32,141,114 32,488,806

CC0V18T OV177 inversion chr3 chr3 50,288,755- 50,378,845- CNAI2 RASSF1-AS1 , 18 22 24642-24646

50,289,070 50,379,102 RASSF1 ,

ZMYND10

CGOV18T OV177 inversion chr3 chr3 74,095,046- 74,270,259- NA NA 23 36 25172-25175

74,095,333 74,270,552

CGOV18T OV177 gain chr3 chr3 107,455,491- 107,853,142- BBX LINC01215 9 16 25763-25805

107,455,722 107,853,350

CGOV18T OV177 inversion chr3 chr3 107,454,052- 107,873,619- BBX NA 8 8 25763-25807

107,454,327 107,873,890

CGOV18T OV177 loss chr3 chr3 116,287,933- 117,005,395- NA NA 11 10 25960-25966

116,288,202 117,005,622

CGOV18T OV177 translocation chr1 chr6 78,602,425- 40,315,952- CIPC2 LINC00951 8 4 2705-47090

78,602,636 40,316,124

CGOV18T OV177 inversion chr3 chr3 158,416,717- 158,429,722- RARRES1 RARRES1.1 8 4 27548-27549

158,416,984 158,429,972

CGOV18T OV177 gain chr4 chr4 6,537,696- 6,754,934- PPP2R2C NA 11 2 31087-31108

6,537,964 6,755,165

CGOV18T OV177 gain chr4 chr4 31 ,475,187- 31,724,197- NA NA 14 12 33535-33579

31 ,475,448 31,724,385

CGOV18T OV177 gain chr4 chr4 54,143,618- 54,869,579- SCFD2 NA 15 22 35527-35641

54,143,889 54,869,852

CGOV18T OV177 gain chr4 chr4 91 ,697,409- 91,870,695- CCSER1 CCSER1.1 13 8 37110-37127

91 ,697,666 91,870,950

CGOV18T OV177 gain chr4 chr4 162,011,686- 162,064,237- NA NA 7 4 39158-39162

162,011,925 162,064,597

CGOV18T OV177 gain chr5 chr5 1,588,915- 2,042,511- SDHAP3 NA 18 18 40185-40239

1,589,184 2,042,789

CGOV18T OV177 gain chr5 chr5 10,426,173- 10,604,434- MARCH6 ANKRD33B 5 2 40706-40723

10,426,478 10,604,619

CGOV18T OV177 gain chr5 chr5 36,803,782- 37,064,726- NA NIPBL 8 20 42441-42465

36,804,085 37,064,967 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV18T OV177 gain chrS chrS 110,025,017- 110,099,513- TMEM232 SLC25A46 15 8 43343-43350

110,025,242 110,099,740

CCOV18T OV177 gain chr5 chr5 115,404,271- 116,295,633- NA NA 11 12 43401-43430

115,404,520 116,295,852

CCOV18T OV177 gain chr5 chr5 160,780,940- 160,980,972- CABRB2 NA 9 8 44482-44499

160,781,153 160,981,242

CCOV18T OV177 gain chr5 chr5 166,284,000- 166,329,652- NA CTB-7E3.1 6 16 44674-44677

166,284,273 166,329,899

CCOV18T OV177 gain chr5 chr5 174,900,383- 175,097,697- SFXN1 HRH2 10 10 44939-44946

174,900,681 175,097,902

CCOV18T OV177 gain chr5 chr5 180,128,181- 180,399,915- NA NA 18 18 45064-45084

180,128,466 180,400,155

CCOV18T OV177 gain chr6 chr6 3,747,804- 3,906,961- PXDC1 NA 14 18 45357-45369

3,748,274 3,907,241

CCOV18T OV177 inversion/ chr6 chr14 16,330,205- 26,654,391- ATXN1 NA 5 6 45857-90504 translocation 16,330,349 26,654,599

CCOV18T OV177 gain chr6 chr6 39,262,709- 39,400,855- KCNK17 KIF6 7 8 47041-47049

39,262,933 39,401,109

CCOV18T OV177 gain chr6 chr6 41,826,488- 43,636,621- USP49 RSPH9, 18 30 47160-47339

41,826,879 43,636,964 MRPS18A

CCOV18T OV177 gain chr6 chr6 45,713,384- 45,830,755- NA NA 6 4 47430-47446

45,713,555 45,830,956

CCOV18T OV177 gain chr1 chr1 111,085,739- 111,100,202- NA NA 11 4 4753-4756

111,085,924 111,100,379

CCOV18T OV177 gain chr6 chr6 46,911,071- 47,026,179- ADCRF5 NA 16 12 47616-47637

46,911,355 47,026,507

CCOV18T OV177 loss chr6 chr6 75,344,933- 75,820,112- LOCI 01928516 COL12A1 8 2 49032-49051

75,345,133 75,820,362

CCOV18T OV177 inversion/ chr6 chrX 86,127,078- 47,107,242- NA USP11 12 12 49568-111423 translocation 86,127,349 47,107,527

CCOV18T OV177 gain chr6 chr6 103,219,699- 103,431,199- NA NA 23 26 49854-49882

103,219,901 103,431,500

CCOV18T OV177 translocation chr6 chr13 111,832,790- 59,737,176- TRAF3IP2-AS1 NA 9 10 50030-85232

111,833,033 59,737,426

CCOV18T OV177 translocation chr6 chr13 137,651,855- 53,764,883- NA NA 21 28 50238-84896

137,652,228 53,765,229

CCOV18T OV177 translocation chr6 chr13 140,339,540- 53,226,103- LOC100507477 SUCT1 6 30 50385-84805

140,339,809 53,226,294

CCOV18T OV177 inversion/ chr7 chr14 25,682,533- 35,541,604- NA FAM177A1 12 24 51961-91497 translocation 25,682,803 35,541,855

CCOV18T OV177 inversion chr7 chr7 62,261,919- 146,732,868- NA CNTNAP2 12 16 53184-56502

62,262,129 146,733,123

CCOV18T OV177 inversion/ chr7 chr20 85,949,697- 58,721,004- NA MIR646HG 6 14 54238-108783 translocation 85,949,857 58,721,161

CCOV18T OV177 gain chr7 chr7 87,233,256- 87,447,792- ABCB1 RUNDC3B 6 4 54333-54357

87,233,483 87,448,035

CCOV18T OV177 translocation chr7 chr11 88,174,450- 98,975,375- NA CNTN5 7 14 54410-77743

88,174,743 98,975,572

CCOV18T OV177 inversion/ chr7 chr11 124,805,295- 108,126,334- NA ATM 6 10 55968-78473 translocation 124,805,549 108,126,566 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV18T OV177 gain chr1 chr1 149,896,610- 149,979,595- SF3B4, OTUD7B 11 10 5804-5808

149,896,822 149,979,817 MTMR11

CGOV18T OV177 gain chr8 chr8 27,166,624- 27,858,401- PTK2B, TRIM35 NA 12 22 58343-58438

27,166,857 27,858,634

CGOV18T OV177 inversion/ chr1 chr11 150,577,835- 2,635,416- NA KCNQ1, 6 8 5848-74128 translocation 150,578,087 2,635,617 KCNQ10T1

CGOV18T OV177 gain chr8 chr8 53,609,090- 53,819,158- RB1CC1 NA 21 28 59740-59778

53,609,298 53,819,390

CGOV18T OV177 gain chr8 chr8 54,963,831- 55,547,703- LYPLA1 RP1 19 30 59858-59953

54,964,028 55,547,985

CGOV18T OV177 translocation chr8 chr15 55,123,926- 80,983,322- NA ABHD17C 6 4 59878-95009

55,124,058 80,983,498

CGOV18T OV177 gain chr8 chr8 73,817,494- 74,063,617- KCNB2 NA 27 12 61310-61340

73,817,780 74,063,814

CGOV18T OV177 inversion chr8 chr8 73,838,986- 74,052,023- KCNB2 NA 16 36 61315-61338

73,839,232 74,052,293

CGOV18T OV177 gain chr8 chr8 98,086,395- 98,166,568- CPQ, CPQ, 7 4 63165-63175

98,086,628 98,166,821 LOC101927066 LOC101927066.1

CGOV18T OV177 inversion/ chr8 chr15 98,594,435- 80,991,940- NA ABHD17C 15 20 63201-95010 translocation 98,594,712 80,992,162

CGOV18T OV177 gain chr1 chr1 156,586,575- 156,649,682- HAPLN2 NES 8 20 6373-6383

156,586,761 156,649,899

CGOV18T OV177 gain chr8 chr8 124,555,874- 124,706,515- FBX032 ANXA13 11 16 65540-65557

124,556,117 124,706,851

CGOV18T OV177 inversion chr1 chr1 161,742,529- 162,561,395- ATF6 UAP1 5 10 6570-6665

161,742,701 162,561,588

CGOV18T OV177 gain chr8 chr8 137,554,659- 137,670,581- NA NA 11 18 66791-66811

137,554,908 137,670,815

CGOV18T OV177 gain chr9 chr9 79,400,606- 79,676,633- PCA3, PRUNE2 NA 7 22 68213-68237

79,400,768 79,676,882

CGOV18T OV177 gain chr9 chr9 116,524,519- 117,237,639- NA DFNB31 15 30 69277-69327

116,524,943 117,237,956

CGOV18T OV177 gain chr9 chr9 125,277,392- 125,319,886- 0R1J2.0R1J4 OR1 N2 18 12 69662-69669

125,277,745 125,320,115

CGOV18T OV177 gain chr9 chr9 125,832,846- 126,137,052- RABGAP1 CRB2, DENND1A 8 4 69699-69735

125,833,050 126,137,318

CGOV18T OV177 translocation chr9 chr11 126,689,821- 64,703,300- DENND1A PPP2R5B, 5 2 69770-75103

126,689,988 64,703,530 GPHA2,

C11orf85

CGOV18T OV177 inversion/ chr9 chr10 127,025,623- 127,483,916- NEK6 UROS 9 18 69793-73886 translocation 127,025,858 127,484,162

CGOV18T OV177 translocation chr9 chr11 132,293,488- 14,079,678- NA SPON1 6 6 69950-74239

132,293,754 14,079,920

CGOV18T OV177 gain chr9 chr9 135,779,593- 135,829,548- TSC1 GFI1B 7 2 70003-70005

135,779,850 135,829,827

CGOV18T OV177 gain chr9 chr9 139,350,681- 139,991,047- SEC16A MAN1 B1 7 6 70049-70069

139,350,985 139,991,303

CGOV18T OV177 inversion chr10 chr10 11,317,791- 11,432,447- CELF2 NA 28 30 70418-70435

11,318,097 11,432,766

CGOV18T OV177 inversion chr10 chr10 68,346,127- 69,048,301- CTNNA3 CTNNA3.1 7 6 72148-72163

68,346,296 69,048,644

CGOV18T OV177 gain chr10 chr10 68,954,084- 69,296,175- CTNNA3 CTNNA3.1 12 14 72156-72179

68,954,338 69,296,332 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV18T OV177 gain chr10 chr10 99,001,810- 99,187,942- ARHCAP19- PGAM1 9 8 73019-73035

99,001,990 99,188,137 SLIT1,

ARHCAP19

CGOV18T OV177 inversion / chr11 chr16 30,765,718- 70,437,984- NA ST3GAL2 8 12 74524-96882 translocation 30,765,908 70,438,252

CGOV18T OV177 inversion / chr11 chr16 31 ,109, 523- 70,794,928- NA VAC14-AS1 , 5 4 74537-96938 translocation SI ,109,679 70,795,183 VAC14

CGOV18T OV177 gain chr11 chr11 34,454,831- 34,724,996- NA NA 5 12 74599-74619

34,455,058 34,725,203

CGOV18T OV177 inversion / chr11 chr14 46,826,041- 51, 417, 647- CKAP5 NA 12 20 74836-92079 translocation 46,826,299 SI, 417, 849

CGOV18T OV177 gain chr1 chr1 183,579,811- 183,683,251- NA RGL1 5 2 7496-7501

183,580,078 183,683,438

CGOV18T OV177 translocation chr11 chr19 64,483,949- 51, 035, 528- NRXN2 LRRC4B 21 20 75090-103942

64,484,241 SI, 035, 754

CGOV18T OV177 gain chr11 chr11 66,026,486- 66,922,724- KLC2 KDM2A 10 12 75181-75283

66,026,833 66,922,885

CGOV18T OV177 gain chr11 chr11 75,805,887- 76,787,545- UVRAC CAPNS 13 12 75842-75992

75,806,110 76,787,827

CGOV18T OV177 gain chr11 chr11 129,800,923- 130,105,866- PRDM10 ZBTB44 12 14 79119-79144

129,801,188 130,106,052

CGOV18T OV177 gain chr12 chr12 67,625,991- 67,745,309- NA NA 7 8 81553-81563

67,626,198 67,745,507

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV18T OV177 inversion chr13 chr13 74,439,073- 74,449,788- KLF12 KLF12.1 5 10 86710-86711

74,439,253 74,449,970

CGOV18T OV177 inversion chr13 chr13 77,218,050- 82,787,380- NA NA 12 14 87073-87525

77,218,360 82,787,750

CGOV18T OV177 gain chr13 chr13 113,705,022- 113,736,690- MCF2L MCF2L.1 11 2 89914-89919

113,705,291 113,736,968

CGOV18T OV177 inversion / chr1 chr19 32,405,039- 50,791,012- PTP4A2 MYH14 20 20 916-103931 translocation 32,405,365 50,791,299

CGOV18T OV177 gain chr14 chr14 77,662,336- 77,983,677- TMEM63C SPTLC2 12 14 92926-92952

77,662,629 77,984,026

CGOV18T OV177 inversion / chr1 chr10 32,658,503- 127,488,036- TXLNA UROS 6 14 930-73887 translocation 32,658,837 127,488,192

CGOV18T OV177 gain chr14 chr14 100,556,354- 101,578,453- EVL NA 7 6 93670-93726

100,556,588 101,578,667

CGOV18T OV177 gain chr14 chr14 100,920,091- 100,966,383- WDR25 WDR2S.1 9 14 93682-93686

100,920,321 100,966,611

CGOV18T OV177 inversion chr1 chr1 203,914,319- 204,164,516- NA KISS1 , GOLT1 A 6 20 9373-9400

203,914,589 204,164,767

CGOV18T OV177 gain chr1S chr1 S 23,718,919- 23,844,812- NA NA 8 12 94046-94050

23,719,252 23,845,122

CGOV18T OV177 gain chr15 chr15 42,104,715- 42,121,762- MAPKBP1 MAPKBP1.1 12 12 94323-94324

42,104,978 42,121,958

CGOV18T OV177 inversion chr15 chr15 86,007,947- 86,092,952- AKAP13 AKAP13.1 7 6 95126-95129

86,008,149 86,093,172

CGOV18T OV177 gain chr15 chr15 101,113,307- 102,006,360- LINS PCSK6 6 14 95375-95415

101,113,566 102,006,518

CGOV18T OV177 gain chr16 chr16 13,622,190- 14,186,184- NA MKL2 9 10 95760-95779

13,622,412 14,186,430

CGOV18T OV177 gain chr16 chr16 65,625,232- 65,694,365- NA NA 8 8 96763-96770

65,625,506 65,694,731

CGOV18T OV177 gain chr16 chr16 70,160,473- 70,745,317- PDPR VAC14 10 2 96849-96936

70,160,624 70,745,510

CGOV18T OV177 gain chr16 chr16 74,291,456- 75,660,950- NA ADAT1 , KARS 16 24 97088-97245

74,291,754 75,661,241

CGOV18T OV177 inversion / chr16 chr17 85,146,188- 35,985,740- FAM92B DDXS2 17 10 97487-98240 translocation 85,146,459 35,985,999

CGOV18T OV177 gain chr17 chr17 632,461- 1 ,513,143- FAM57A SLC43A2 11 22 97588-97655

632,669 1 ,513,352

CGOV18T OV177 gain chr17 chr17 1,411 ,601- 1 ,553,655- INPP5K SCARF1 , RILP, 12 16 97643-97659

1,411 ,907 1 ,553,917 PRPF8

CGOV18T OV177 translocation chr1 chr8 208,931,552- 138,977,433- NA NA 7 8 9816-66932

208,931,839 138,977,630

CGOV18T OV177 gain chr17 chr17 35,127,939- 35,148,713- NA NA 15 12 98202-98203

35,128,139 35,148,953

CGOV18T OV177 inversion chr1 chr1 209,385,028- 213,630,604- NA NA 11 14 9864-10557

209,385,244 213,630,866

CGOV18T OV177 gain chr17 chr17 49,075,945- 49,397,690- SPAG9 LOC101927274 5 10 98678-98697

49,076,176 49,397,948

CGOV18T OV177 inversion / chr17 chr19 54,074,872- 14,673,265- NA TECR, NDUFB7 6 4 98944-102814 translocation 54,075,103 14,673,509 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV21T OV-90 gain chr10 chr10 82,094,769- 82,117,260- DYDC1 DYDC1.1 10 20 26955-26957

82,095,088 82,117,603

CCOV21T OV-90 inversion chr11 chr11 24,533,015- 37,631,277- LUZP2 NA 11 26 27801-28534

24,533,376 37,631,591

CCOV21T OV-90 inversion chr11 chr11 36,314,331- 36,339,739- PRR5L, PRR5L, 17 18 28528-28529

36,314,629 36,340,068 COMMD9 COMMD9.1

CCOV21T OV-90 translocation chr11 chr17 37,429,070- 10,138,602- NA NA 10 12 28533-40895

37,429,229 10,138,916

CCOV21T OV-90 gain chr2 chr2 13,200,694- 13,282,031- NA NA 13 20 3731-3734

13,200,955 13,282,270

CCOV21T OV-90 loss chr14 chr14 98,030,526- 99,417,366- LOC101929241 NA 7 28 37889-37893

98,030,793 99,417,557

CCOV21T OV-90 gain chr20 chr20 59,567,777- 59,590,068- NA NA 12 16 46707-46708

59,568,063 59,590,342

CCOV21T OV-90 inversion / chr3 chr22 75,698,731- 27,869,301- NA NA 7 8 8187-47715 translocation 75,698,906 27,869,521

CCOV23T OVCA-429 inversion chr3 chr3 166,592,131- 169,647,332- NA SAMD7 30 20 10208-10607

166,592,358 169,647,629

CCOV23T OVCA-429 gain chr3 chr3 187,961,522- 187,975,951- LPP LPP.1 5 4 11183-11185

187,961,683 187,976,163

CCOV23T OVCA-429 gain chr4 chr4 59,973,867- 59,988,095- NA NA 9 28 11850-11851

59,974,116 59,988,290

CCOV23T OVCA-429 inversion chr1 chr1 31 ,391,707- 90,365,131- NA LRRC8D 12 20 124-1440

31 ,391,973 90,365,349

CCOV23T OVCA-429 gain chr5 chr5 153,956,078- 153,975,079- NA MIR3141 12 14 14751-14753

153,956,326 153,975,331

CCOV23T OVCA-429 gain chr6 chr6 46,950,202- 46,969,387- NA ADGRF1 6 8 15468-15469

46,950,414 46,969,535 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV23T OVCA-429 gain chr8 chr8 99,984,552- 100,047,598- NA VPS13B 5 2 19993-19997

99,984,689 100,047,799

CCOV23T OVCA-429 gain chr9 chr9 77,054,458- 77,154,676- MIR6130 MIR6130.1 7 10 22532-22534

77,054,641 77,154,947

CCOV23T OVCA-429 translocation chr9 chr16 122,649,638- 959,831- NA LMF1 7 20 23897-29916

122,649,811 959,945

CCOV23T OVCA-429 inversion / chr9 chr12 131,123,739- 120,572,369- SLC27A4, GCN1 5 18 24122-27357 translocation 131,123,934 120,572,674 MIR1268A

CCOV23T OVCA-429 gain chr10 chr10 83,641,079- 83,715,203- NRC3 NRG3.1 7 6 24753-24754

83,641,321 83,715,420

CCOV23T OVCA-429 gain chr12 chr12 18,413,640- 18,454,805- PIK3C2G PIK3C2G.1 7 4 26142-26144

18,413,915 18,455,031

CCOV23T OVCA-429 gain chr14 chr14 50,551,651- 50,585,195- LINC01599 VCPKMT, SOS2 6 8 29148-29149

50,551,871 50,585,436

CCOV23T OVCA-429 gain chr14 chr14 98,274,1 IQ- 98,286,897- NA NA 8 12 29351-29352

98, 274, 373 98,287,099

CCOV23T OVCA-429 gain chr16 chr16 66,906,346- 67,019,395- NA CES4A 10 6 30321-30323

66,906,546 67,019,604

CCOV23T OVCA-429 gain chr17 chr17 45,034,012- 45,066,341- NA NA 7 14 30868-30869

45,034,304 45,066,553

CCOV23T OVCA-429 inversion / chr17 chr19 48,053,439- 1 ,064,214- DLX4 ABCA7, HMHA1 5 10 30960-32151 translocation 48,053,617 1 ,064,448

CCOV23T OVCA-429 gain chr20 chr20 7,017,144- 7,028,741- NA NA 6 4 32728-32730

7,017,428 7,028,915

CCOV23T OVCA-429 gain chr22 chr22 44,788,830- 45,018,500- NA LINC00229 18 22 33856-33859

44,789,065 45,018,753

CCOV23T OVCA-429 gain chrX chrX 67,596,1 IQ- 67,755,921- OPHN1 YIPF6 6 8 34166-34168

67, 596, 304 67,756,113

CCOV23T OVCA-429 gain chrX chrX 111,178, 654- 111,284,937- TRPC5 TRPC5.1 6 14 34342-34344 i n, 178, 853 111,285,179

CCOV23T OVCA-429 gain chr2 chr2 10,526,352- 10,669,746- HPCAL1 NA 9 10 3505-3508

10,526,543 10,669,972

CCOV23T OVCA-429 gain chr2 chr2 36,628,436- 36,756,764- CRIM1 CRIM1.1 6 4 3841-3844

36,628,608 36,756,983

CCOV23T OVCA-429 gain chr2 chr2 166,707,427- 166,725,334- NA LOC100506124, 17 36 5669-5671

166,707,659 166,725,535 TTC21 B

CCOV23T OVCA-429 gain chr3 chr3 60,066,796- 60,126,166- FHIT FHIT.1 6 2 7020-7023

60,066,985 60,126,383

CCOV23T OVCA-429 inversion chr3 chr3 102,446,997- 166,142,863- NA NA 18 64 7309-10147

102,447,207 166,143,086

CCOV23T OVCA-429 loss chr3 chr3 105,384,490- 162,707,625- CBLB NA 14 2 7640-9671

105,384,686 162,707,813

CCOV23T OVCA-429 gain chr3 chr3 105,588,843- 115,955,171- CBLB LSAMP 29 44 7642-8614

105,589,067 115,955,437

CCOV23T OVCA-429 inversion chr3 chr3 110,141,916- 178,259,594- NA KCNMB2, 13 28 7832-10726

110,142,138 178,259,874 KCNMB2-AS1

CCOV23T OVCA-429 gain chr3 chr3 114,817,056- 116,231 ,028- ZBTB20-AS4, NA 38 82 8466-8668

114,817,285 116,231 ,314 ZBTB20 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV23T OVCA-429 loss chr3 chr3 126,002,481- 187,861 ,659- NA NA 23 26 8967-11173

126,002,689 187,861 ,898

CCOV2ST OVCAR-3 gain chr22 chr22 19,582,986- 19,610,461- NA NA 6 10 10127-10128

19,583,255 19,610,763

CCOV2ST OVCAR-3 gain chr22 chr22 23,549,313- 23,569,617- BCR BCR.1 11 6 10146-10147

23,549,646 23,570,001

CCOV2ST OVCAR-3 gain chr22 chr22 24,491,105- 24,601,827- CABIN1 NA 6 12 10165-10166

24,491,388 24,602,075

CCOV2ST OVCAR-3 gain chrX chrX 49,510,429- 50,143,759- NA DGKK 24 22 10315-10339

49,510,732 50,144,060

CCOV2ST OVCAR-3 gain chrX chrX 126,812,735- 126,836,704- NA NA 5 8 10515-10516

126,812,893 126,836,937

CCOV2ST OVCAR-3 gain chrX chrX 134,583,157- 134,606,807- NA NA 6 8 10525-10526

134,583,413 134,606,995

CCOV2ST OVCAR-3 inversion chrX chrX 154,555,740- 154,670,695- CLIC2 NA 13 18 10562-10563

154,556,036 154,670,947

CCOV2ST OVCAR-3 gain chr2 chr2 149,982,470- 150,908,715- LYPD6B NA 14 10 1102-1103

149,982,730 150,909,060

CCOV2ST OVCAR-3 gain chr1 chr1 15,206,634- 15,718,156- KAZN FHAD1 17 20 111-117

15,207,083 15,718,456

CCOV2ST OVCAR-3 gain chr2 chr2 212,336,446- 212,362,110- ERBB4 ERBB4.1 10 22 1186-1187

212,336,723 212,362,347

CCOV2ST OVCAR-3 inversion / chr1 chr6 16,264,957- 31,829,177- SPEN. ZBTB17 NEU1. SLC44A4 8 10 124-3511 translocation 16,265,378 31,829,422

CCOV2ST OVCAR-3 inversion chr1 chr1 16,292,380- 116,479,097- ZBTB17 LOC101928977 7 10 125-347

16,292,594 116,479,312

CCOV2ST OVCAR-3 loss chr3 chr3 5,030,805- 5,614,061- BHLHE40 NA 20 14 1260-1261

5,031 ,125 5,614,352

CCOV2ST OVCAR-3 gain chr3 chr3 9,489,963- 9,522,342- SETD5 SETD5.1 8 4 1267-1269

9,490,234 9,522,661

CCOV2ST OVCAR-3 gain chr1 chr1 16,391,666- 16,519,877- FAM131 C ARHGEF19 19 16 130-135

16,391,939 16,520,131

CCOV2ST OVCAR-3 gain chr3 chr3 32,075,589- 32,726,990- NA CNOT10 10 14 1309-1314

32,075,837 32,727,253

CCOV2ST OVCAR-3 gain chr3 chr3 47,285,965- 47,777,585- KIF9-AS1, KIF9 SMARCC1 11 14 1344-1347

47,286,289 47,777,786

CCOV2ST OVCAR-3 inversion chr1 chr1 16,451,152- 206,677,345- EPHA2 RASSF5 34 10 134-625

16,451,526 206,677,708

CCOV2ST OVCAR-3 gain chr3 chr3 48,295,686- 48,833,518- ZNF589 PRKAR2A 8 6 1348-1351

48,296,119 48,833,713

CCOV2ST OVCAR-3 inversion chr1 chr1 16,594,062- 117,233,996- FBX042 C1orf137 9 12 136-352

16,594,327 117,234,295

CCOV2ST OVCAR-3 gain chr3 chr3 60,013,983- 60,791,559- FHIT FHIT.1 15 16 1367-1374

60,014,446 60,791,799

CCOV2ST OVCAR-3 inversion / chr3 chr9 64,346,683- 27,362,920- NA MOB3B 24 8 1386-4791 translocation 64,346,995 27,363,143

CCOV2ST OVCAR-3 gain chr3 chr3 83,794,788- 83,821,981- NA NA 13 8 1440-1441

83,795,159 83,822,404

CCOV2ST OVCAR-3 gain chr3 chr3 96,691,801- 96,709,266- EPHA6 EPHA6.1 12 18 1477-1478

96,692,089 96,709,533 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV2ST OVCAR-3 gain chr3 chr3 122,109,013- 122,392,527- FAM162A NA 36 48 1714-1746

122,109,347 122,392,924

CCOV2ST OVCAR-3 inversion / chr3 chr18 122,728,986- 46,800,288- SEMA5B DYM 45 34 1776-8560 translocation 122,729,425 46,800,634

CCOV2ST OVCAR-3 inversion chr3 chr3 124,064,806- 168,797,502- KALRN MECOM 21 24 1792-2371

124,065,179 168,797,846

CCOV2ST OVCAR-3 inversion / chr3 chr1 S 125,086,763- 73,323,290- ZNF148 NA 21 24 1836-7786 translocation 125,087,132 73,323,667

CCOV2ST OVCAR-3 inversion / chr1 chr12 32,102,547- 48,122,580- PEF1 ENDOU 10 8 183-6841 translocation 32,102,797 48,122,851

CCOV2ST OVCAR-3 inversion / chr1 chr3 34,874,647- 63,385,915- NA SYNPR 23 16 187-1375 translocation 34,875,009 63,386,219

CCOV2ST OVCAR-3 gain chr3 chr3 133,716,850- 134,146,756- SLC02A1 NA 32 24 1925-1950

133,717,171 134,147,101

CCOV2ST OVCAR-3 gain chr3 chr3 133,948,296- 134,158,679- RYK MIR4788 42 28 1944-1951

133,948,637 134,158,960

CCOV2ST OVCAR-3 translocation chr1 chr20 35,647,745- 7,749,167- SFPQ NA 37 54 196-9498

35,648,071 7,749,518

CCOV2ST OVCAR-3 gain chr3 chr3 168,384,079- 169,080,709- EGFEM1 P MECOM 6 6 2368-2375

168,384,214 169,081 ,035

CCOV2ST OVCAR-3 translocation chr3 chr16 170,153,978- 69,827,654- CLDN11 WWP2 5 6 2386-7923

170,154,221 69,827,819

CCOV2ST OVCAR-3 gain chr3 chr3 176,668,085- 177,462,456- NA LINC00S78 32 32 2429-2455

176,668,478 177,462,872

CCOV2ST OVCAR-3 gain chr3 chr3 177,223,612- 177,496,666- LINC00S78 NA 10 8 2441-2456

177,223,949 177,496,908

CCOV2ST OVCAR-3 gain chr4 chr4 88,027,019- 88,057,799- AFF1 AFF1.1 5 6 2771-2772

88,027,242 88,058,026

CCOV2ST OVCAR-3 translocation chr4 chr17 89,789,473- 48,927,130- FAM13A NA 9 8 2781-8185

89,789,748 48,927,666

CCOV2ST OVCAR-3 gain chr4 chr4 106,197,068- 106,738,412- TET2, TET2-AS1 CSTCD, 7 6 2807-2808

106,197,334 106,738,608 LOCI 01929529

CCOV2ST OVCAR-3 gain chr4 chr4 124,126,471- 124,960,326- SPATAS NA 10 20 2843-2847

124,126,775 124,960,605

CCOV2ST OVCAR-3 loss chr4 chr4 181,698,109- 182,566,045- NA NA 13 6 2963-2967

181,698,395 182,566,329

CCOV2ST OVCAR-3 loss chr4 chr4 181,728,980- 182,612,495- NA NA 11 4 2964-2968

181,729,444 182,612,787

CCOV2ST OVCAR-3 loss chr4 chr4 181,802,495- 182,463,527- NA NA 9 8 2965-2966

181,802,809 182,463,756

CCOV2ST OVCAR-3 gain chrS chrS 50,789,565- 50,815,933- NA NA 6 8 3201-3202

50,789,775 50,816,153

CCOV2ST OVCAR-3 inversion / chrS chr12 51 ,130,651- 28,648,936- NA CCDC91 7 4 3207-6693 translocation 51 ,130,917 28,649,245

CCOV2ST OVCAR-3 inversion chrS chrS 51 ,150,838- 53,218,788- NA ARL1 S 13 12 3208-3220

51 ,151,126 53,219,142

CCOV2ST OVCAR-3 inversion / chrS chr11 138,728,698- 78,104,464- MZB1. PROB1, CAB2 55 44 3336-6364 translocation 138,729,110 78,104,828 SPATA24

CCOV2ST OVCAR-3 gain chrS chrS 141,360,368- 141,827,246- RNF14 LOC101926941 15 18 3345-3348

141,360,597 141,827,580 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV2ST OVCAR-3 gain chrS chr5 174,181,187- 174,200,065- MIR4634 NA 14 8 3387-3388

174,181,466 174,200,326

CC0V2ST OVCAR-3 inversion chr6 chr6 18,461,976- 18,500,178- RNF144B NA 7 6 3447-3448

18,462,367 18,500,352

CCOV2ST OVCAR-3 inversion / chr1 chr6 116,321,067- 68,036,552- NA NA 8 4 346-3669 translocation 116,321,250 68,036,740

CCOV2ST OVCAR-3 gain chr6 chr6 34,944,275- 35,314,023- ANKS1A PPARD 6 12 3543-3545

34,944,543 35,314,323

CCOV2ST OVCAR-3 gain chr6 chr6 41 ,675,496- 41,717,268- TFEB PGC 11 14 3562-3563

41 ,675,771 41,717,484

CCOV2ST OVCAR-3 inversion chr6 chr6 62,236,246- 62,269,878- NA NA 8 12 3645-3646

62,236,441 62,270,123

CCOV2ST OVCAR-3 inversion / chr6 chr12 100,577,636- 62,124,265- NA FAM19A2 5 2 3722-6884 translocation 100,577,782 62,124,443

CCOV2ST OVCAR-3 gain chr6 chr6 123,495,382- 123,526,461- NA NA 9 8 3756-3757

123,495,709 123,526,833

CCOV2ST OVCAR-3 translocation chr6 chr9 166,486,445- 123,297,922- NA CDK5RAP2 6 4 3811-5003

166,486,758 123,298,169

CCOV2ST OVCAR-3 translocation chr6 chr9 166,535,835- 123,384,755- NA MEGF9 9 2 3812-5005

166,535,995 123,385,019

CCOV2ST OVCAR-3 inversion chr7 chr7 70,731,137- 70,755,093- WBSCR17 WBSCR17.1 16 22 4026-4027

70,731,480 70,755,422

CCOV2ST OVCAR-3 inversion chr7 chr7 70,960,257- 71,173,139- WBSCR17 WBSCR17.1 12 12 4028-4030

70,960,577 71,173,383

CCOV2ST OVCAR-3 gain chr7 chr7 107,727,415- 108,473,397- LAMB4 NA 10 12 4094-4097

107,727,703 108,473,750

CCOV2ST OVCAR-3 translocation chr7 chr18 145,677,606- 68,451,118- NA NA 10 8 4179-8583

145,677,956 68,451,405

CCOV2ST OVCAR-3 inversion / chr7 chr17 145,696,122- 72,107,653- NA NA 8 4 4180-8337 translocation 145,696,352 72,107,932

CCOV2ST OVCAR-3 gain chr8 chr8 4,787,649- 4,801,074- CSMD1 CSMD1.1 15 8 4226-4227

4,787,903 4,801,383

CCOV2ST OVCAR-3 inversion chr8 chr8 14,737,631- 129,169,442- SGCZ NA 5 4 4244-4630

14,737,794 129,169,599

CCOV2ST OVCAR-3 gain chr1 chr1 6,364,041- 7,172,562- ACOT7 CAMTA1 5 6 42-58

6,364,277 7,172,781

CCOV2ST OVCAR-3 gain chr8 chr8 41 ,934,087- 42,537,167- NA NA 14 2 4316-4317

41 ,934,373 42,537,417

CCOV2ST OVCAR-3 gain chr8 chr8 50,367,287- 119,297,202- NA SAMD12 8 6 4336-4595

50,367,605 119,297,437

CCOV2ST OVCAR-3 gain chr8 chr8 53,575,407- 53,600,140- RB1CC1 RB1CC1.1 14 18 4345-4347

53,575,678 53,600,475

CCOV2ST OVCAR-3 loss chr8 chr8 64,495,485- 116,180,858- NA NA 6 8 4398-4578

64,495,712 116,181 ,114

CCOV2ST OVCAR-3 inversion chr8 chr8 65,218,382- 65,236,347- LOC102724623 LOC102724623.1 10 6 4401-4402

65,218,633 65,236,569

CCOV2ST OVCAR-3 inversion chr8 chr8 65,235,206- 65,249,738- LOC102724623 LOC102724623.1 12 9 4402-4403

65,235,529 65,249,995

CCOV2ST OVCAR-3 gain chr8 chr8 105,067,570- 105,086,690- RIMS2 RIMS2.1 9 18 4544-4545

105,067,885 105,087,091 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV2ST OVCAR-3 gain chr8 chr8 129,092,258- 129,689,741- PVT1 NA 15 18 4627-4634

129,092,575 129,689,976

CCOV2ST OVCAR-3 gain chr9 chr9 2,075,405- 2,948,418- SMARCA2 NA 15 4 4688-4700

2,075,657 2,948,677

CCOV2ST OVCAR-3 gain chr1 chr1 150, 048, 557- 150,815,384- VPS45 ARNT 15 16 471-476

ISO, 048, 875 150,815,657

CCOV2ST OVCAR-3 inversion / chr9 chrX 9,285,663- 142,896,446- PTPRD NA 8 8 4748-10546 translocation 9,285,986 142,896,739

CCOV2ST OVCAR-3 gain chr9 chr9 26,397,623- 26,420,857- NA NA 9 6 4788-4789

26,397,901 26,421,203

CCOV2ST OVCAR-3 gain chr9 chr9 28,443,410- 28,469,688- LINC02 LING02.1 9 4 4799-4800

28,443,651 28,469,998

CCOV2ST OVCAR-3 loss chr1 chr1 151,905,143- 153,247,522- NA NA 11 12 482-487

151,905,516 153,247,919

CCOV2ST OVCAR-3 gain chr1 chr1 153,176,002- 153,194,104- LELP1 PRR9 8 14 485-486

153,176,318 153,194,348

CCOV2ST OVCAR-3 gain chr9 chr9 76,426,104- 76,474,468- MIR6130 MIR6130.1 8 6 4925-4926

76,426,409 76,474,779

CCOV2ST OVCAR-3 gain chr1 chr1 154,782,046- 155,470,750- KCNN3 ASH1 L 23 12 494-495

154,782,490 155,471 ,008

CCOV2ST OVCAR-3 gain chr9 chr9 116, 341, 430- 116,483,533- RCS3 NA 6 8 4995-4996 l i e, 341 ,739 116,483,846

CCOV2ST OVCAR-3 loss chr10 chr10 28,392,965- 29,945,784- MPP7 SVIL 8 6 5146-5154

28,393,173 29,946,025

CCOV2ST OVCAR-3 translocation chr10 chr12 28,419,439- 32,496,032- MPP7 BICD1 5 10 5148-6734

28,419,623 32,496,187

CCOV2ST OVCAR-3 gain chr10 chr10 35,024,623- 35,270,705- PARD3 NA 9 8 5164-5168

35,024,791 35,270,987

CCOV2ST OVCAR-3 inversion / chr10 chr20 35,358,628- 49,501,204- CUL2 ADNP 8 16 5170-9765 translocation 35,359,003 49,501,614

CCOV2ST OVCAR-3 gain chr10 chr10 61 ,637,577- 61,901,338- CCDC6 ANK3 14 4 5269-5275

61 ,637,808 61,901,551

CCOV2ST OVCAR-3 gain chr10 chr10 76,448,594- 77,289,711- ADK C10orf11 6 2 5321-5339

76,448,790 77,289,948

CCOV2ST OVCAR-3 gain chr10 chr10 95,624,046- 95,654,139- NA SLC35G1 18 20 5377-5378

95,624,361 95,654,468

CCOV2ST OVCAR-3 gain chr10 chr10 102,530,182- 103,077,086- PAX2 NA 13 18 5406-5416

102,530,437 103,077,419

CCOV2ST OVCAR-3 gain chr10 chr10 102,570,641- 103,041 ,835- PAX2 NA 10 10 5407-5415

102,570,870 103,042,122

CCOV2ST OVCAR-3 gain chr10 chr10 103,958,891- 104,318,514- NA SUFU 10 16 5422-5428

103,959,175 104,318,812

CCOV2ST OVCAR-3 gain chr10 chr10 115,131,534- 115,535,551- NA PLEKHS1 , 11 6 5467-5471

115,131,748 115,535,802 MIR4483

CCOV2ST OVCAR-3 gain chr10 chr10 121,261,526- 121,532,092- RGS10 INPPSF 9 6 5484-5486

121,261,689 121,532,278

CCOV2ST OVCAR-3 translocation chr10 chr13 123,226,220- 44,592,292- NA LINC00284 11 6 5493-7082

123,226,532 44,592,531

CGOV25T OVCAR-3 inversion / chr11 chr14 14,360,012- 50,118,225- RRAS2 POLE2 8 8 5593-7259 translocation 14,360,378 50,118,466

CGOV25T OVCAR-3 gain chr11 chr11 35,390,784- 36,151,310- SLC1A2 LDLRAD3 23 16 5662-5674

35,391,125 36,151,648

CGOV25T OVCAR-3 translocation chr11 chr17 37,429,052- 10,138,604- NA NA 18 10 5678-7980

37,429,230 10,138,925

CGOV25T OVCAR-3 gain chr11 chr11 59,523,908- 59,546,107- STX3 STX3.1 8 12 5793-5794

59,524,125 59,546,415

CGOV25T OVCAR-3 gain chr11 chr11 65,220,655- 65,371,887- NA MAP3K11 5 8 5820-5826

65,220,903 65,372,121

CGOV25T OVCAR-3 gain chr11 chr11 65,268,641- 65,362,329- MALAT1 EHBP1 L1, 10 4 5822-5825

65,268,931 65,362,535 KCNK7,

MAP3K11

CGOV25T OVCAR-3 gain chr11 chr11 66,242,878- 66,382,949- PELI3, DPP3, RBM14, RBM14- 5 2 5831-5833

66,243,146 66,383,147 LOC101928069 RBM4

CGOV25T OVCAR-3 gain chr11 chr11 72,734,135- 72,999,051- FCHSD2 P2RY6 9 10 5870-5878

72,734,432 72,999,341

CGOV25T OVCAR-3 translocation chr1 chr17 205,587,067- 62,713,665- ELK4 NA 13 14 615-8275

205,587,378 62,713,955

CGOV25T OVCAR-3 gain chr11 chr11 87,829,956- 87,845,038- NA RAB38 11 2 6372-6373

87,830,227 87,845,439

CGOV25T OVCAR-3 gain chr11 chr11 129,834,888- 129,940,742- PRDM10 APLP2 21 12 6423-6424

129,835,240 129,941 ,159

CGOV25T OVCAR-3 gain chr12 chr12 3,101 ,897- 3,209,422- TEAD4 TSPAN9 5 2 6433-6434

3,102,048 3,209,633

CGOV25T OVCAR-3 gain chr12 chr12 22,092,529- 27,929,687- ABCC9 KLHL42 38 42 6513-6683

22,092,844 27,929,954

CGOV25T OVCAR-3 gain chr12 chr12 26,750,710- 32,990,254- ITPR2 PKP2 11 4 6627-6739

26,751,057 32,990,460

CGOV25T OVCAR-3 gain chr12 chr12 46,616,183- 48,373,908- SLC38A1 COL2A1 11 8 6837-6845

46,616,470 48,374,177

CGOV25T OVCAR-3 gain chr12 chr12 112,172,363- 112,839,860- ACAD10 RPL6 17 4 6971-6974

112,172,689 112,840,209

CGOV25T OVCAR-3 gain chr13 chr13 108,126,625- 108,161 ,652- FAM155A FAM155A.1 12 10 7141-7142

108,126,921 108,161 ,937

CGOV25T OVCAR-3 translocation chr14 chr17 24,201,264- 9,295,485- NA STX8 17 16 7181-7977

24,201,514 9,295,897

CGOV25T OVCAR-3 gain chr14 chr14 27,603,035- 27,631,506- NA NA 7 10 7192-7193

27,603,393 27,631,742

CGOV25T OVCAR-3 inversion chr14 chr14 27,789,633- 27,815,921- NA NA 8 8 7194-7196

27,789,904 27,816,209

CGOV25T OVCAR-3 gain chr14 chr14 74,786,440- 74,867,439- NA SYNDIG1 L 7 8 7345-7348

74,786,634 74,867,718

CGOV25T OVCAR-3 gain chr14 chr14 77,477,286- 77,518,299- NA LOC283575 9 8 7370-7371

77,477,526 77,518,579

CGOV25T OVCAR-3 loss chr14 chr14 80,302,355- 80,919,770- NRXN3 DI02-AS1 5 6 7375-7377

80,302,476 80,919,947

CGOV25T OVCAR-3 loss chr14 chr14 80,718,589- 81,218,191- DI02-AS1 CEP128 7 8 7376-7378

80,718,774 81,218,456

CGOV25T OVCAR-3 gain chr14 chr14 88,479,087- 88,532,248- GPR65 LINC01146 7 10 7396-7397

88,479,358 88,532,470 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV2ST OVCAR-3 gain chr14 chr14 103,978,820- 104, 206, eSS- NA PPP1 R13B 18 14 7442-7445

103,979,197 104, 207, 170

CCOV2ST OVCAR-3 gain chr2 chr2 9,712,980- 10,284,716- NA C2orf48 14 22 749-754

9,713,260 10,285,017

CCOV2ST OVCAR-3 gain chr1S chr1 S 60,378,070- 61,034,716- NA RORA 17 28 7743-7753

60,378,300 61,035,058

CCOV2ST OVCAR-3 gain chr16 chr16 84,309,061- 85,970,606- NA NA 11 8 7942-7947

84,309,391 85,970,881

CCOV2ST OVCAR-3 gain chr2 chr2 28,524,649- 29,208,999- BRE FAM179A 6 10 795-798

28,524,919 29,209,223

CCOV2ST OVCAR-3 gain chr17 chr17 16,364,830- 17,401,817- LRRC75A-AS1 , RASD1 16 14 7997-8011

16,365,232 17,402,090 LRRC75A

CCOV2ST OVCAR-3 gain chr17 chr17 18,821,468- 19,532,299- PRPSAP2 NA 11 10 8014-8023

18,821,763 19,532,636

CCOV2ST OVCAR-3 inversion / chr17 chr18 28,785,698- 54,871,449- CPD NA 16 22 8095-8572 translocation 28,785,987 54,871,742

CCOV2ST OVCAR-3 gain chr17 chr17 45,995,228- 46,335,463- SP2, SP2-AS1 SKAP1 6 8 8164-8165

45,995,710 46,335,666

Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV25T OVCAR-3 gain chr2 chr2 85,567,233- 86,063,481- RETSAT ST3CAL5 5 4 912-917

85,567,362 86,063,679

CCOV25T OVCAR-3 loss chr19 chr19 40,965,964- 54,030,834- BLVRB ZNF331 149 208 9235-9279

40,966,274 54,031,199

CCOV25T OVCAR-3 gain chr19 chr19 47,474,139- 47,577,855- ARHCAP35 ZC3H4 5 2 9257-9258

47,474,384 47,578,064

CCOV25T OVCAR-3 gain chr20 chr20 30,012,866- 30,250,013- DEFB122 BCL2L1 11 8 9661-9664

30,013,169 30,250,347

CCOV25T OVCAR-3 gain chr20 chr20 55,824,863- 55,949,520- BMP7 RAE1 11 6 9801-9804

55,825,198 55,949,847

CCOV28T OVKATE inversion / chr12 chr20 27,328,132- 32,328,160- NA ZNF341 8 8 100985-130671 translocation 27,328,457 32,328,488

CCOV28T OVKATE translocation chr1 chr18 235,279,134- 45,247,013- TOMM20 NA 16 16 10284-127116

235,279,443 45,247,428

CCOV28T OVKATE gain chr12 chr12 99,293,202- 99,317,257- ANKS1 B ANKS1 B.1 10 18 104046-104049

99,293,471 99,317,528

CCOV28T OVKATE gain chr13 chr13 22,257,083- 99,490,678- FCF9 DOCK9-AS1 , 7 16 105135-109460

22,257,357 99,490,902 DOCK9

CCOV28T OVKATE translocation chr13 chr14 89,967,877- 57,380,538- NA OTX2-AS1 16 22 108455-111988

89,968,187 57,380,824

CCOV28T OVKATE gain chr14 chr14 41 ,789,225- 41,814,065- NA NA 12 18 111138-111139

41 ,789,519 41,814,335

CCOV28T OVKATE inversion / chr14 chr18 80,082,738- 7,835,787- NRXN3 PTPRM 10 8 112550-125124 translocation 80,082,908 7,836,092

CCOV28T OVKATE translocation chr17 chrX 74,833,213- 28,002,112- NA DCAF8L1 17 16 124439-134504

74,833,541 28,002,388

CCOV28T OVKATE gain chr20 chr20 36,295,883- 36,306,178- NA LOC100287792 6 20 130829-130831

36,296,182 36,306,391

CCOV28T OVKATE gain chr20 chr20 48,314,804- 48,411,594- B4CALT5 NA 13 38 131281-131298

48,315,020 48,411,844

CCOV28T OVKATE translocation chr2 chr4 40,322,354- 39,183,131- SLC8A1-AS1 MIR1273H, 18 4 13379-41690

40,322,590 39,183,422 WDR19

CCOV28T OVKATE gain chr2 chr2 102,446,725- 102,456,946- MAP4K4 MAP4K4.1 15 14 15973-15974

102,446,955 102,457,153

CCOV28T OVKATE translocation chr2 chr13 170,562,447- 101 ,823, 124- PHOSPH02, NALCN 10 16 20321-109584

170,562,667 I d ,823, 319 PHOSPH02-

KLHL23

CCOV28T OVKATE translocation chr2 chr13 170,559,182- 101 ,825, 685- PHOSPH02, NALCN 24 46 20321-109585

170,559,499 I ,825,995 PHOSPH02-

KLHL23

CCOV28T OVKATE translocation chr2 chr3 194,977,964- 156,239,017- NA KCNAB1 11 20 23569-30413

194,978,211 156,239,301

CCOV28T OVKATE gain chr2 chr2 232,850,960- 232,862,393- DIS3L2 DIS3L2.1 10 18 25744-25747

232,851,169 232,862,612

CCOV28T OVKATE translocation chr2 chr3 239,555,818- 154,302,356- NA NA 21 34 26067-30182

239,556,231 154,302,751

CCOV28T OVKATE translocation chr3 chr17 86,184,189- 80,888,004- NA TBCD 8 16 27116-124944

86,184,477 80,888,295

CCOV28T OVKATE translocation chr3 chr14 189,405,765- 34,715,978- TP63 NA 11 22 36182-110400

189,406,053 34,716,257 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV28T OVKATE translocation chr3 chr12 195,030,246- 82,280,049- ACAP2 NA 8 4 36996-103462

195,030,489 82,280,315

CCOV28T OVKATE inversion/ chr4 chr7 10,700,578- 155,398,726- NA NA 8 5 38239-67410 translocation 10,700,834 155,398,979

CCOV28T OVKATE inversion/ chr4 chr8 26,430,420- 129,655,550- RBPJ NA 14 12 39780-76183 translocation 26,430,790 129,655,825

CCOV28T OVKATE inversion/ chr4 chr8 38,023,558- 134,350,662- TBC1D1 NA 24 26 41644-76730 translocation 38,023,862 134,350,958

CCOV28T OVKATE inversion/ chr4 chr8 45,558,437- 132,268,754- NA NA 15 10 42001-76438 translocation 45,558,735 132,269,031

CCOV28T OVKATE gain chr4 chr4 84,367,783- 84,385,348- HELQ MRPS18C, 18 4 43661-43663

84,368,135 84,385,563 FAM175A

CCOV28T OVKATE inversion/ chr4 chr5 150,312,256- 42,723,435- NA CHR 15 30 46579-51493 translocation 150,312,717 42,723,733

CCOV28T OVKATE inversion/ chr5 chr11 97,985,936- 68,488,341- NA MTL5 8 20 53878-94596 translocation 97,986,225 68,488,572

CCOV28T OVKATE gain chr6 chr6 108,006,718- 108,018,403- NA SCML4 13 22 59879-59881

108,007,027 108,018,641

CCOV28T OVKATE gain chr7 chr7 147,287,080- 147,350,574- CNTNAP2 CNTNAP2.1 8 10 67118-67125

147,287,295 147,350,825

CCOV28T OVKATE gain chr8 chr8 3,686,605- 5,950,987- CSMD1 NA 6 24 67669-67887

3,686,916 5,951,241

CCOV28T OVKATE inversion/ chr8 chr14 23,485,565- 31,450,137- NA STRN3 7 14 68537-110241 translocation 23,485,756 31,450,390

CCOV28T OVKATE translocation chr1 chr12 172,916,943- 89,339,331- NA NA 10 22 7521-103556

172,917,204 89,339,552

CCOV28T OVKATE inversion chr8 chr8 122,020,603- 132,844,621- NA NA 14 8 75282-76498

122,020,825 132,844,893

CCOV28T OVKATE translocation chr9 chr20 26,129,123- 19,108,544- NA NA 18 26 77479-130228

26,129,329 19,108,966

CCOV28T OVKATE translocation chr9 chr20 26,139,754- 19,103,137- NA NA 11 16 77480-130226

26,140,082 19,103,403

CCOV28T OVKATE translocation chr9 chr11 79,302,284- 107,390,125- PRUNE2 ALKBH8 8 10 78220-98499

79,302,506 107,390,270

CCOV28T OVKATE inversion/ chr9 chr12 103,827,049- 18,524,822- LPPR1 PIK3C2G 18 12 80483-99992 translocation 103,827,385 18,525,107

CCOV28T OVKATE inversion chr10 chr10 27,118,834- 105,278,147- ABI1 NEURL1, 14 10 87951-92297

27,119,139 105,278,441 NEURL1-AS1

CCOV28T OVKATE inversion/ chr1 chr9 25,899,408- 138,662,650- LDLRAP1 KCNT1 12 12 917-84472 translocation 25,899,642 138,662,882

CCOV28T OVKATE inversion/ chr11 chr18 29,984,063- 76,557,836- NA NA 9 18 92940-127422 translocation 29,984,360 76,558,069

CCOV28T OVKATE gain chr11 chr11 47,737,934- 47,761,866- AGBL2, FNBP4 AGBL2, FNBP4.1 13 18 93727-93729

47,738,275 47,762,178

CCOV28T OVKATE gain chr11 chr11 124,430,443- 124,445,480- NA OR8A1 10 24 99216-99218

124,430,703 124,445,776

CCOV30T OVSAHO gain chr1 chr1 53,388,753- 53,446,183- SCP2, ECHDC2 SCP2, ECHDC2.1 15 22 1118-1123

53,388,955 53,446,448

CCOV30T OVSAHO gain chr3 chr3 160,412,473- 160,467,172- NA NA 6 12 11656-11662

160,412,746 160,467,357 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV30T OVSAHO gain chr4 chr4 216,080- 654,220- ZNF876P PDE6B 12 10 13139-13145

216,294 654,479

CCOV30T OVSAHO gain chr4 chr4 6,055,512- 8,521,533- JAKMIP1 NA 17 16 13200-13287

6,055,755 8,521,827

CCOV30T OVSAHO gain chr4 chr4 57,599,743- 57,617,777- NA NA 14 14 13604-13607

57,600,036 57,617,992

CCOV30T OVSAHO loss chr4 chr4 148,273,906- 148,907,720- NA ARHGAP10 5 8 14209-14210

148,274,130 148,907,902

CCOV30T OVSAHO gain chrS chrS 53,129,190- 53,482,458- NA ARL1 S 18 18 16449-16490

53,129,413 53,482,690

CCOV30T OVSAHO gain chrS chrS 53,624,592- 54,564,624- LINC01033 DHX29 10 12 16498-16537

53,624,799 54,564,848

CCOV30T OVSAHO inversion chrS chrS 54,814,134- 139,139,718- PPAP2A NA 10 24 16542-18803

54,814,323 139,139,879

CCOV30T OVSAHO gain chrS chrS 59,648,959- 108,904,461- PDE4D NA 15 6 16551-17681

59,649,301 108,904,672

CCOV30T OVSAHO inversion chrS chrS 59,688,754- 138,950,538- PDE4D UBE2D2 8 16 16552-18796

59,689,005 138,950,728

CCOV30T OVSAHO inversion chrS chrS 105,518,388- 108,075,753- NA NA 17 30 17621-17643

105,518,646 108,075,985

CCOV30T OVSAHO loss chrS chr5 105,550,080- 138,878,513- NA NA 9 20 17624-18794

105,550,302 138,878,674

CCOV30T OVSAHO gain chrS chr5 134,127,285- 134,328,584- DDX46 CATSPER3 12 16 18625-18633

134,127,573 134,328,776

CCOV30T OVSAHO gain chrS chr5 138,955,238- 139,131 ,711- UBE2D2 NA 6 20 18797-18802

138,955,517 139,131 ,840

CCOV30T OVSAHO inversion / chrS chr9 164,342,826- 30,418,480- NA NA 26 48 19791-30544 translocation 164,343,074 30,418,766

CCOV30T OVSAHO gain chrS chr5 172,771,423- 172,982,264- MIR8056 NA 19 26 20085-20107

172,771,695 172,982,582

CCOV30T OVSAHO gain chrS chr5 176,024,175- 176,746,056- CDHR2, GPRIN1 NA 6 10 20265-20382

176,024,341 176,746,282

CCOV30T OVSAHO gain chr6 chr6 33,190,543- 33,730,549- NA NA 6 8 21180-21197

33,190,791 33,730,814

CCOV30T OVSAHO inversion / chr6 chr10 37,332,211- 87,402,165- RNF8 GRID1 7 10 21271-35323 translocation 37,332,447 87,402,379

CCOV30T OVSAHO gain chr6 chr6 73,933,411- 74,506,805- KHDC1 L CD109 12 28 22039-22097

73,933,649 74,507,045

CCOV30T OVSAHO gain chr6 chr6 145,536,650- 145,652,773- NA NA 6 14 22641-22645

145,536,904 145,652,991

CCOV30T OVSAHO gain chr7 chr7 14,510,392- 15,180,174- DGKB NA 9 4 22941-22951

14,510,588 15,180,357

CCOV30T OVSAHO gain chr1 chr1 98,432,322- 98,538,138- NA NA 11 16 2662-2670

98,432,601 98,538,347

CCOV30T OVSAHO gain chr7 chr7 145,306,472- 145,582,748- NA NA 10 12 27202-27225

145,306,691 145,582,913

CCOV30T OVSAHO gain chr8 chr8 19,038,939- 19,137,670- LOC100128993 NA 6 10 28502-28505

19,039,103 19,137,900

CCOV30T OVSAHO gain chr8 chr8 101,823,362- 102,121 ,730- NA NA 9 24 29011-29020

101,823,598 102,122,002 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV30T OVSAHO translocation chr8 chr20 145,695,856- 48,116,067- KIFC2, CYHR1 , PTGIS 10 14 30251-52897

145,696,090 48,116,407 FOXH1

CGOV30T OVSAHO inversion / chr8 chr20 145,696,628- 48,712,689- KIFC2, FOXH1 UBE2V1 , 5 6 30251-53009 translocation 145,696,769 48,712,953 TMEM189-

UBE2V1

CGOV30T OVSAHO inversion chr9 chr9 129,753,474- 130,595,310- RALCPS1 ENG 18 12 31132-31136

129,753,763 130,595,589

CGOV30T OVSAHO gain chr10 chr10 26,304,556- 26,394,289- MY03A MY03A.1 11 26 32208-32218

26,304,841 26,394,493

CGOV30T OVSAHO gain chr10 chr10 78,274,934- 84,802,550- C10orf11 NA 22 22 34323-35211

78,275,194 84,802,827

CGOV30T OVSAHO inversion / chr10 chr22 102,707,733- 42,422,676- SLF2 WBP2NL 5 4 35909-54906 translocation 102,707,967 42,422,871

CGOV30T OVSAHO gain chr10 chr10 105,934,111- 106,187,480- CFAP43 CFAP58 10 6 35990-36013

105,934,407 106,187,750

CGOV30T OVSAHO gain chr10 chr10 108,218,100- 109,097,824- NA NA 17 24 36101-36178

108,218,341 109,098,079

CGOV30T OVSAHO inversion / chr10 chr17 115,007,353- 55,846,028- NA NA 7 4 36386-46606 translocation 115,007,613 55,846,243

CGOV30T OVSAHO translocation chr10 chr16 124,038,906- 4,755,427- BTBD16 ANKS3 5 2 36696-45631

124,039,136 4,755,589

CGOV30T OVSAHO loss chr11 chr11 120,359,993- 134,944,024- ARHCEF12 NA 13 12 39199-39224

120,360,195 134,944,255

CGOV30T OVSAHO inversion / chr12 chr14 57, 280, 708- 22,496,189- NA NA 10 28 39984-44334 translocation 57,280,944 22,496,350

CGOV30T OVSAHO loss chr12 chr12 98,520,459- 126,724,937- NA NA 5 20 40796-41028

98,520,647 126,725,172

CGOV30T OVSAHO translocation chr13 chr19 74,691,827- 40,192,754- KLF12 LGALS14 24 42 41471-49902

74,692,085 40,193,006

CGOV30T OVSAHO gain chr14 chr14 22,798,183- 23,049,433- NA DAD1 6 14 44336-44343

22,798,383 23,049,596

CGOV30T OVSAHO translocation chr14 chr22 94,474,928- 19,028,982- LINC00S21 DGCR2, DGCR11 7 4 44805-54736

94,475,097 19,029,211

CGOV30T OVSAHO gain chr1S chr1 S 58,201,627- 58,341,487- NA ALDH1A2 14 24 45298-45304

58,201,846 58,341,730

CGOV30T OVSAHO gain chr16 chr16 74,736,1 OS- 75,114,273- MLKL ZNRF1 15 4 46074-46088

74,736,389 75,114,578

CGOV30T OVSAHO gain chr16 chr16 79,653,109- 79,732,529- NA NA 9 16 46126-46129

79,653,339 79,732,753

CGOV30T OVSAHO gain chr17 chr17 48,591,698- 48,856,784- MYCBPAP NA 6 2 46556-46563

48,591,878 48,856,982

CGOV30T OVSAHO gain chr17 chr17 66,772,435- 67,037,100- NA ABCA9 14 22 46685-46693

66,772,736 67,037,319

CGOV30T OVSAHO gain chr18 chr18 24,776,579- 25,649,898- NA CDH2 17 22 47346-47404

24,776,988 25,650,186

CGOV30T OVSAHO gain chr19 chr19 1,950,612- 2,146,895- CSNK1G2, AP3D1 6 4 47898-47904

1,950,832 2,147,087 CSNK1G2-AS1

CGOV30T OVSAHO loss chr19 chr19 7,292,115- 8,278,794- INSR CERS4 7 28 47935-47942

7,292,283 8,279,017

CGOV30T OVSAHO gain chr19 chr19 18,586,503- 21,975,830- ELL NA 11 16 48519-48928

18,586,802 21,976,048 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV30T OVSAHO gain chr19 chr19 30,263,943- 30,505,057- NA URI1 7 6 49251-49271

30,264,212 30,505,241

CCOV30T OVSAHO translocation chr20 chr22 19,719,893- 50,974,616- NA ODF3B 5 28 50429-54973

19,720,039 50,974,783

CCOV30T OVSAHO gain chr20 chr20 32,306,577- 34,321,550- PXMP4 RBM39 21 34 51147-51519

32,306,727 34,321,783

CCOV30T OVSAHO gain chr20 chr20 33,615,769- 36,129,658- TRPC4AP NA 7 14 51390-51726

33,615,970 36,129,822

CCOV30T OVSAHO gain chr1 chr1 244,059,285- 244,669,648- NA C1orf101 20 14 5170-5261

244,059,536 244,670,006

CCOV30T OVSAHO gain chr1 chr1 245,549,993- 245,839,297- KIF26B KIF26B.1 7 10 5304-5338

245,550,227 245,839,567

CCOV30T OVSAHO gain chr21 chr21 44,397,994- 44,766,887- PKNOX1 NA 5 4 54683-54688

44,398,149 44,767,267

CCOV30T OVSAHO gain chr22 chr22 18,544,133- 38,907,469- NA NA 16 12 54726-54876

18,544,456 38,907,721

CCOV30T OVSAHO loss chr22 chr22 19,847,156- 40,895,065- CNB1 L, MKL1 15 18 54743-54899

19,847,432 40,895,271 C22orF29

CCOV30T OVSAHO inversion / chr1 chr9 248,837,832- 130,636,485- NA AK1. MIR4672 18 22 5529-31137 translocation 248,838,078 130,636,797

CCOV30T OVSAHO gain chr2 chr2 12,987,706- 13,364,245- NA NA 6 6 5830-5850

12,988,011 13,364,513

CCOV30T OVSAHO gain chr2 chr2 18,306,263- 18,431,723- NA NA 13 10 5951-5955

18,306,479 18,431,962

CCOV30T OVSAHO gain chr2 chr2 37,537,086- 37,683,978- PRKD3 NA 10 14 6397-6404

37,537,261 37,684,255

CCOV30T OVSAHO gain chr2 chr2 64,124,874- 64,527,565- VPS54 NA 7 14 6902-6920

64,125,107 64,527,757

CCOV30T OVSAHO gain chr2 chr2 77,977,694- 78,103,550- LOC101927967 LOC101927967.1 10 2 7158-7165

77,977,939 78,103,813

CCOV30T OVSAHO gain chr2 chr2 96,986,000- 97,389,332- ITPRIPL1 LMAN2L 15 10 7441-7464

96,986,349 97,389,564

CCOV30T OVSAHO gain chr2 chr2 238,035,463- 238,189,847- NA NA 17 28 8973-8977

238,035,710 238,190,116

CCOV30T OVSAHO translocation chr2 chr1 S 242,019,021- 42,946,039- SNED1 STARD9 12 6 9013-45191

242,019,513 42,946,418

CCOV30T OVSAHO inversion chr3 chr3 28,523,215- 29,902,775- ZCWPW2 RBMS3 8 2 9271-9305

28,523,441 29,903,039

CCOV30T OVSAHO inversion / chr3 chr1 S 32,727,004- 74,533,293- CNOT10 CCDC33 7 14 9326-45398 translocation 32,727,313 74,533,465

CCOV30T OVSAHO gain chr3 chr3 85, 072, SOO- 85,353,348- CADM2 CADM2.1 5 11 9847-9853 eS, 073, 038 85,353,523

CCOV32T PEO-14 gain chr1 chr1 204,233,975- 204,474,735- PLEKHA6 NA 18 6 1005-1010

204,234,238 204,475,039

CCOV32T PEO-14 gain chr1 chr1 204,892,099- 205,209,169- NFASC TMCC2 7 10 1013-1026

204,892,384 205,209,506 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV32T PEO-14 gain chr1 chr1 228,784,829- 229,640,516- RHOU, LOC101927478, 14 2 1131-1136

228,785,078 229,640,776 DUSP5P1, NUP133

MIR7641 -2

CGOV32T PEO-14 gain chr2 chr2 7,485,939- 7,614,108- NA NA 15 12 1198-1200

7,486,311 7,614,404

CGOV32T PEO-14 gain chr2 chr2 8,934,787- 9,955,619- KIDINS220 NA 20 12 1203-1211

8,935,167 9,955,964

CGOV32T PEO-14 gain chr2 chr2 11 ,504,166- 11,651,083- NA NA 14 8 1215-1216

11 ,504,419 11,651,375

CGOV32T PEO-14 gain chr2 chr2 37,507,927- 37,806,001- PRKD3 NA 15 26 1270-1273

37,508,215 37,806,366

CGOV32T PEO-14 gain chr2 chr2 45,007,165- 47,898,089- NA NA 21 10 1286-1309

45,007,535 47,898,520

CGOV32T PEO-14 gain chr2 chr2 54,492,555- 54,674,446- ACYP2 NA 7 2 1317-1320

54,492,783 54,674,689

CGOV32T PEO-14 gain chr2 chr2 71 ,508,274- 72,108,710- NA NA 34 24 1355-1359

71 ,508,650 72,109,049

CGOV32T PEO-14 gain chr2 chr2 79,330,150- 79,343,454- NA REG1A 25 36 1368-1370

79,330,569 79,343,766

CGOV32T PEO-14 gain chr2 chr2 103,421,753- 103,502,524- TMEM182 NA 11 6 1463-1464

103,422,063 103,502,789

CGOV32T PEO-14 gain chr2 chr2 105,316,517- 105,445,221- NA LINC01158 14 4 1467-1468

105,316,834 105,445,471

CGOV32T PEO-14 gain chr2 chr2 120,183,678- 120,666,388- NA PTPN4 15 24 1493-1496

120,183,989 120,666,741

CGOV32T PEO-14 gain chr2 chr2 141,366,947- 141,606,471- LRP1 B LRP1 B.1 12 6 1544-1546

141,367,291 141,606,737

CGOV32T PEO-14 gain chr2 chr2 153,013,800- 153,165,669- STAM2 NA 23 10 1561-1562

153,014,186 153,165,929

CGOV32T PEO-14 gain chr2 chr2 154,930,218- 155,002,919- GALNT13 GALNT13.1 23 16 1565-1566

154,930,430 155,003,153

CGOV32T PEO-14 loss chr2 chr2 155,227,788- 221,130,586- GALNT13 NA 14 8 1567-1718

155,228,079 221,131 ,158

CGOV32T PEO-14 gain chr2 chr2 165,686,393- 167,912,978- COBLL1 XIRP2 17 8 1587-1596

165,686,772 167,913,522

CGOV32T PEO-14 gain chr2 chr2 166,019,921- 166,180,252- SCN3A SCN2A 9 20 1590-1591

166,020,253 166,180,560

CGOV32T PEO-14 gain chr2 chr2 173,144,572- 173,374,966- NA ITGA6 26 14 1604-1606

173,144,891 173,375,292

CGOV32T PEO-14 gain chr2 chr2 179,184,053- 179,294,542- OSBPL6 MIR548N, 25 14 1609-1610

179,184,579 179,294,887 LOC101927027,

PRKRA

CGOV32T PEO-14 gain chr2 chr2 203,063,002- 203,312,500- KIAA2012 BMPR2 6 8 1638-1639

203,063,330 203,312,808

CGOV32T PEO-14 gain chr1 chr1 50,565,336- 51,026,223- ELAVL4 FAF1 21 18 165-172

50,565,597 51,026,507

CGOV32T PEO-14 gain chr2 chr2 212,717,243- 213,055,320- ERBB4 ERBB4.1 20 16 1655-1659

212,717,547 213,055,721

CGOV32T PEO-14 gain chr2 chr2 220,047,000- 220,476,936- FAM134A STK11 IP 12 4 1705-1714

220,047,344 220,477,309

CGOV32T PEO-14 gain chr1 chr1 5,909,838- 6,891,329- NA CAMTA1 11 8 17-23

5,910,122 6,891,537

CGOV32T PEO-14 gain chr2 chr2 235,355,574- 236,034,221- NA NA 22 12 1738-1745

235,355,888 236,034,520 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV32T PEO-14 translocation chr2 chr21 239,981,605- 36,389,361- HDAC4 RUNX1 34 20 1752-7608

239,982,288 36,390,006

CCOV32T PEO-14 gain chr3 chr3 6,714,699- 6,750,585- GRM7-AS3 GRM7-AS3.1 13 4 1778-1779

6,715,055 6,750,858

CCOV32T PEO-14 gain chr3 chr3 10,746,959- 85,909,032- NA CADM2 23 20 1798-1956

10,747,865 85,909,381

CCOV32T PEO-14 loss chr3 chr3 10,806,199- 85,645,570- LINC00606 CADM2 6 6 1799-1953

10,806,457 85,645,769

CCOV32T PEO-14 translocation chr3 chrX 15,763,543- 29,200,588- ANKRD28 IL1 RAPL1 26 32 1823-7803

15,763,867 29,200,996

CCOV32T PEO-14 gain chr3 chr3 21 ,941,651- 22,034,743- NA NA 20 8 1831-1834

21 ,942,079 22,035,061

CCOV32T PEO-14 gain chr3 chr3 30,159,823- 30,562,231- NA NA 12 10 1839-1843

30,160,165 30,562,658

CCOV32T PEO-14 gain chr3 chr3 32,538,245- 34,060,918- CMTM6 NA 15 2 1847-1856

32,538,560 34,061,255

CCOV32T PEO-14 gain chr3 chr3 33,176,085- 33,252,307- CRTAP SUSDS 11 18 1851-1853

33,176,451 33,252,703

CCOV32T PEO-14 gain chr3 chr3 33,709,656- 34,773,867- CLASP2 NA 12 2 1854-1859

33,709,935 34,774,141

CCOV32T PEO-14 gain chr3 chr3 73,735,317- 74,273,674- NA NA 7 8 1890-1891

73,735,682 74,273,912

CCOV32T PEO-14 gain chr1 chr1 6,519,620- 6,744,446- ESPN, DNAJC11 29 6 19-22

6,519,954 6,744,810 TNFRSF25

CCOV32T PEO-14 translocation chr3 chrX 77,011,813- 15,069,810- NA NA 8 14 1927-7799

77,012,186 15,070,135

CCOV32T PEO-14 gain chr3 chr3 81 ,106,743- 81,118,642- NA NA 10 12 1939-1940

81 ,107,013 81,118,968

CCOV32T PEO-14 inversion chr3 chr3 81 ,135,438- 82,763,768- NA NA 7 4 1941-1945

81 ,135,741 82,763,974

CCOV32T PEO-14 gain chr3 chr3 81 ,134,644- 85,414, SOSNA CADM2 9 6 1941-1950

81 ,134,894 es, 414,592

CCOV32T PEO-14 translocation chr3 chrX 82,728,234- 26,543,252- NA NA 12 8 1944-7801

82,728,552 26,543,598

CCOV32T PEO-14 gain chr3 chr3 110,798,707- 113,600,131- PVRL3 GRAMD1C 8 6 1993-2003

110,799,002 113,600,432

CCOV32T PEO-14 translocation chr3 chrS 116,486,741- 71,007,392- NA NA 13 2 2007-2779

116,487,028 71,007,761

CCOV32T PEO-14 gain chr3 chr3 124,333,738- 125,279,560- KALRN OSBPL11 5 6 2025-2044

124,333,949 125,279,865

CCOV32T PEO-14 inversion chr3 chr3 137,714,542- 138,009,019- CLDN18 ARMC8, NME9 12 12 2075-2076

137,714,829 138,009,315

CCOV32T PEO-14 translocation chr3 chrS 155,590,047- 63,461,948- GMPS RNF180 13 4 2119-2769

155,590,417 63,462,353

CCOV32T PEO-14 inversion chr3 chr3 157,104,815- 158,179,179- VEPH1 RSRC1 10 8 2125-2127

157,105,120 158,179,575

CCOV32T PEO-14 gain chr3 chr3 158,246,263- 158,327,051- RSRC1 MLF1 12 8 2128-2129

158,246,706 158,327,404

CCOV32T PEO-14 gain chr3 chr3 163,368,431- 163,401 ,717- NA NA 13 12 2136-2137

163,368,708 163,402,045 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV32T PEO-14 gain chr3 chr3 188,020,486- 188,693,208- LPP NA 15 16 2170-2177

188,020,838 188,693,483

CCOV32T PEO-14 translocation chr3 chr7 188,424,890- 111,884, 142- LPP ZNF277 11 10 2174-3689

188,425,154 i n, 884, 336

CCOV32T PEO-14 translocation chr3 chr7 189,065,794- 112,277,245- NA LOCI 01928012 15 28 2181-3692

189,066,156 112,277,482

CCOV32T PEO-14 gain chr3 chr3 190,342,676- 190,490,152- IL1 RAP NA 8 8 2195-2199

190,343,014 190,490,380

CCOV32T PEO-14 gain chr4 chr4 60,264,885- 60,374,130- NA NA 27 18 2342-2344

60,265,185 60,374,474

CCOV32T PEO-14 gain chr4 chr4 181,093,223- 181,164,155- NA NA 17 20 2425-2426

181,093,592 181,164,557

CCOV32T PEO-14 inversion / chrS chr16 1,285,993- 85,305,221- TERT NA 8 4 2498-6336 translocation 1,286,288 85,305,670

CCOV32T PEO-14 inversion chrS chrS 2,669,875- 3,976,209- NA NA 14 16 2511-2516

2,670,180 3,976,555

CCOV32T PEO-14 inversion chrS chrS 2,676,910- 4,516,585- NA NA 25 24 2512-2518

2,677,290 4,516,935

CCOV32T PEO-14 translocation chrS chr11 4,523,598- 32,348,290- NA NA 9 14 2519-4777

4,523,879 32,348,627

CCOV32T PEO-14 gain chrS chrS 37,193,857- 37,556,987- C5orf42 WDR70 6 6 2707-2711

37,194,019 37,557,246

CCOV32T PEO-14 gain chrS chrS 58,238,976- 58,272,037- NA PDE4D 9 8 2753-2754

58,239,311 58,272,364

CCOV32T PEO-14 inversion / chrS chr7 103,218,842- 8,174,1 OS- NA ICA1 26 16 2815-3239 translocation 103,219,172 8,174,430

CCOV32T PEO-14 inversion / chrS chr7 104,945,313- 8,554,423- NA NXPH1 17 8 2819-3242 translocation 104,945,635 8,554,754

CCOV32T PEO-14 gain chrS chrS 138,514,271- 139,381 ,797- SIL1 NRC2 8 14 2854-2865

138,514,573 139,382,030

CCOV32T PEO-14 gain chrS chrS 138,633,227- 138,921 ,604- MATR3 NA 8 8 2855-2858

138,633,590 138,921 ,895

CCOV32T PEO-14 gain chrS chrS 139,235,133- 140,039,321- NRC2 IK, WDRSS 38 20 2859-2873

139,235,518 140,039,666

CCOV32T PEO-14 gain chrS chrS 139,236,030- 141,928,291- NRC2 NA 6 6 2859-2883

139,236,265 141,928,692

Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV32T PEO-14 inversion chrS chrS 177,584,328- 177,610,763- NHP2 GMCL1 P1 9 2 2925-2926

177,584,514 177,610,905

CCOV32T PEO-14 gain chr6 chr6 11 ,342,302- 11,916,032- NEDD9 NA 18 8 2959-2967

11 ,342,566 11,916,314

CCOV32T PEO-14 gain chr6 chr6 11 ,467,496- 11,828,369- NA NA 11 10 2960-2966

11 ,467,820 11,828,707

CCOV32T PEO-14 loss chr6 chr6 14,712,273- 16,058,631- NA NA 15 16 2976-2977

14,712,579 16,058,922

CCOV32T PEO-14 gain chr6 chr6 38,340,004- 40,049,534- BTBD9 NA 11 8 3070-3075

38,340,422 40,049,882

CCOV32T PEO-14 gain chr6 chr6 63,222,820- 63,293,733- NA NA 19 22 3111-3112

63,223,171 63,294,137

CCOV32T PEO-14 gain chr6 chr6 70,348,079- 70,387,411- NA LMBRD1 26 8 3117-3119

70,348,413 70,387,790

CCOV32T PEO-14 gain chr1 chr1 16,082,800- 16,331,552- FBLIM1 C1orf64 10 8 31-32

16,083,125 16,331,798

CCOV32T PEO-14 translocation chr6 chr14 113,722,703- 25,434,154- NA STXBP6 38 28 3143-5806

113,723,091 25,434,903

CCOV32T PEO-14 gain chr6 chr6 160,699,422- 162,016,080- NA PARK2 13 10 3181-3187

160,699,691 162,016,344

CCOV32T PEO-14 gain chr6 chr6 162,717,348- 162,915,707- PARK2 PARK2.1 24 14 3188-3189

162,717,703 162,916,027

CCOV32T PEO-14 gain chr7 chr7 3,418,493- 3,445,794- SDK1 SDK1.1 9 10 3209-3210

3,418,778 3,446,183

CCOV32T PEO-14 gain chr7 chr7 3,904,676- 4,004,742- SDK1 SDK1.1 19 12 3213-3215

3,905,083 4,005,032

CCOV32T PEO-14 inversion / chr7 chr20 6,234,555- 30,182,127- CYTH3 NA 6 4 3229-7174 translocation 6,234,783 30,182,486

CCOV32T PEO-14 gain chr7 chr7 25,841,720- 27,418,994- NA NA 8 4 3293-3303

25,842,069 27,419,264

CCOV32T PEO-14 gain chr7 chr7 39,796,484- 40,017,523- LINC00265 CDK13 14 24 3350-3353

39,796,815 40,017,808

CCOV32T PEO-14 gain chr7 chr7 45,614,328- 50,147,422- ADCY1 C7orf72 15 6 3364-3403

45,614,664 50,147,684

CCOV32T PEO-14 gain chr7 chr7 48,141,843- 48,232,012- UPP1 ABCA13 19 24 3382-3384

48,142,185 48,232,241

CCOV32T PEO-14 gain chr1 chr1 91 ,626,649- 92,546,726- NA BTBD8 24 14 339-352

91 ,627,015 92,547,088

CCOV32T PEO-14 gain chr7 chr7 52,179,570- 52,277,988- NA NA 16 10 3413-3414

52,179,893 52,278,357

CCOV32T PEO-14 gain chr7 chr7 79,278,121- 79,855,759- NA NA 9 6 3583-3586

79,278,485 79,855,991

CCOV32T PEO-14 inversion chr7 chr7 82,934,495- 83,224,991- NA SEMA3E 11 6 3591-3593

82,934,651 83,225,244

CCOV32T PEO-14 gain chr7 chr7 95,546,472- 95,777,655- DYNC1 I1 SLC25A13 17 14 3617-3620

95,546,911 95,777,900

CCOV32T PEO-14 gain chr1 chr1 93,790,264- 94,305,956- LOC100131564 BCAR3 7 8 363-377

93,790,418 94,306,275

CCOV32T PEO-14 gain chr7 chr7 109,859,474- 110,075,414- NA NA 11 16 3678-3680

109,859,758 110,075,635 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV32T PEO-14 gain chr7 chr7 129,506,798- 129,772,556- UBE2H KLHDC10 27 20 3715-3717

129,507,095 129,772,952

CCOV32T PEO-14 gain chr7 chr7 130,801,786- 131,196,597- MKLN1 PODXL 6 2 3718-3719

130,801,927 131,196,874

CCOV32T PEO-14 inversion chr7 chr7 145,147,117- 145,169,147- NA NA 16 18 3761-3763

145,147,436 145,169,488

CCOV32T PEO-14 gain chr7 chr7 158,735,512- 158,748,886- WDR60 NA 12 8 3808-3809

158,735,760 158,749,182

CCOV32T PEO-14 inversion chr8 chr8 4,238,815- 4,276,262- CSMD1 CSMD1.1 11 6 3811-3812

4,239,081 4,276,506

CCOV32T PEO-14 gain chr8 chr8 15,973,240- 16,221,030- MSR1 NA 9 10 3819-3820

15,973,525 16,221,354

CCOV32T PEO-14 gain chr8 chr8 24,548,807- 24,631,841- NA NA 10 12 3829-3831

24,549,060 24,632,144

CCOV32T PEO-14 gain chr8 chr8 49,073,980- 49,865,116- NA NA 8 6 3848-3849

49,074,236 49,865,300

CCOV32T PEO-14 gain chr8 chr8 67,278,588- 67,519,396- NA MYBL1 13 2 3869-3870

67,278,847 67,519,695

CCOV32T PEO-14 inversion chr8 chr8 84,769,728- 84,878,927- NA NA 11 10 3898-3900

84,770,004 84,879,248

CCOV32T PEO-14 gain chr8 chr8 102,263,323- 102,530,413- NA CRHL2 5 5 3917-3921

102,263,493 102,530,596

CCOV32T PEO-14 gain chr8 chr8 102,341,630- 102,576,464- NA CRHL2 8 2 3919-3922

102,341,804 102,576,693

CCOV32T PEO-14 gain chr8 chr8 120,739,912- 121,480,220- TAF2 MTBP 5 20 3952-3964

120,740,095 121,480,382

CCOV32T PEO-14 gain chr8 chr8 125,660,131- 126,043,222- MTSS1 KIAA0196 17 6 3969-3970

125,660,459 126,043,606

CCOV32T PEO-14 gain chr8 chr8 129,374,777- 129,630,363- NA NA 30 32 3977-3992

129,375,078 129,630,680

CCOV32T PEO-14 gain chr8 chr8 129,420,339- 129,611,653- LINC00824 NA 13 18 3978-3991

129,420,634 129,612,014

CCOV32T PEO-14 inversion/ chr8 chr9 139,969,294- 126,103,262- NA NA 14 10 4001-4243 translocation 139,969,721 126,103,589

CCOV32T PEO-14 gain chr9 chr9 2,576,812- 2,718,303- VLDLR-AS1 KCNV2 11 8 4015-4018

2,577,343 2,718,736

CCOV32T PEO-14 gain chr9 chr9 10,537,356- 10,566,234- PTPRD PTPRD.1 16 14 4038-4039

10,537,629 10,566,575

CCOV32T PEO-14 gain chr9 chr9 25,435,020- 26,471,810- NA NA 7 6 4074-4079

25,435,199 26,472,032

CCOV32T PEO-14 gain chr9 chr9 28,093,779- 28,184,651- LING02 LINC02.1 18 16 4081-4082

28,094,192 28,184,945

CCOV32T PEO-14 translocation chr1 chr3 100,490,361- 1,407,510- SLC35A3 CNTN6 22 30 412-1764

100,490,712 1,407,778

CCOV32T PEO-14 inversion chr9 chr9 85,575,528- 85,595,197- NA RASEF 15 12 4190-4192

85,575,838 85,595,634

CCOV32T PEO-14 gain chr9 chr9 118,542,735- 119,935,634- NA ASTN2 11 8 4227-4228

118,543,060 119,935,898

CCOV32T PEO-14 gain chr10 chr10 14,956,244- 15,700,027- DCLRE1C ITCA8 5 18 4333-4347

14,956,500 15,700,273 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV32T PEO-14 inversion / chr10 chr12 28,670,517- 62,174,140- NA FAM19A2 9 16 4405-5251 translocation 28,670,683 62,174,429

CCOV32T PEO-14 gain chr10 chr10 29,946,994- 30,313,119- SVIL KIAA1462 29 36 4417-4419

29,947,383 30,313,512

CCOV32T PEO-14 gain chr10 chr10 52,103,342- 52,152,733- SGMS1 SGMS1.1 17 4 4531-4532

52,103,747 52,153,063

CCOV32T PEO-14 gain chr10 chr10 71 ,888,863- 72,110,326- AIFM2 LRRC20 13 24 4595-4600

71 ,889,153 72,110,559

CCOV32T PEO-14 gain chr10 chr10 71 ,939,834- 72,134,618- NA LRRC20 18 18 4597-4602

71 ,940,130 72,134,953

CCOV32T PEO-14 gain chr10 chr10 76,350,905- 76,778,524- ADK KAT6B 11 4 4620-4625

76,351,242 76,778,866

CCOV32T PEO-14 gain chr10 chr10 82,052,553- 82,225,309- MAT1A TSPAN14 5 20 4639-4641

82,052,922 82,225,641

CCOV32T PEO-14 gain chr10 chr10 90, 948, 375- 91,196,845- NA SLC16A12 16 10 4646-4647 gO, 948, 702 91,197,231

CCOV32T PEO-14 translocation chr10 chr13 127,574,438- 20,371,305- DHX32 NA 79 64 4707-5473

127,574,749 20,371,594

CCOV32T PEO-14 inversion chr11 chr11 2,974,947- 96,444,244- NAP1 L4 NA 24 24 4750-4994

2,975,316 96,444,573

CCOV32T PEO-14 gain chr11 chr11 7,425,276- 7,784,098- SYT9 NA 7 6 4756-4759

7,425,585 7,784,453

CCOV32T PEO-14 gain chr11 chr11 17,802,482- 18,253,901- KCNC1 SAA4, SAA2- 17 12 4763-4768

17,802,761 18,254,208 SAA4

CCOV32T PEO-14 gain chr11 chr11 71 ,685,932- 73,842,880- RNF121 C2CD3 11 4 4916-4928

71 ,686,176 73,843,138

CCOV32T PEO-14 gain chr12 chr12 2,474,549- 2,507,821- CACNA1C CACNA1C.1 13 2 5035-5036

2,474,919 2,508,156

CCOV32T PEO-14 gain chr1 chr1 120,221,300- 120,374,904- NA NBPF7 7 4 518-519

120,221,611 120,375,194

CCOV32T PEO-14 gain chr12 chr12 42,181,030- 42,349,236- NA NA 27 22 5199-5200

42,181,330 42,349,642

CCOV32T PEO-14 gain chr12 chr12 60,443,519- 60,535,261- NA NA 10 10 5249-5250

60,443,730 60,535,497

CCOV32T PEO-14 gain chr12 chr12 68,355,641- 69,121,615- LINC01479 NUP107 11 6 5270-5274

68,355,949 69,121,920

CCOV32T PEO-14 inversion chr12 chr12 107,125,244- 109,084,498- RFX4, COR01 C 16 22 5362-5382

107,125,546 109,084,852 LOC100287944

CCOV32T PEO-14 gain chr12 chr12 113,185,006- 113,498,025- NA DTX1 19 18 5389-5392

113,185,366 113,498,342

CCOV32T PEO-14 gain chr13 chr13 45,182,443- 45,626,524- NA NA 8 4 5583-5589

45,182,678 45,626,727

CCOV32T PEO-14 gain chr13 chr13 61 ,215,291- 61,351,845- NA NA 13 6 5619-5621

61 ,215,569 61,352,139

CCOV32T PEO-14 gain chr13 chr13 76,462,724- 78,795,078- LM07DN RNF219-AS1 29 22 5664-5688

76,463,088 78,795,494 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene 1 Gene 2 read pairs reads id

CGOV32T PEO-14 gain chr14 chr14 25,906,023- 25,947,254- NA NA 10 10 5807-5808

25,906,348 25,947,524

CGOV32T PEO-14 gain chr14 chr14 26,424,759- 26,540,034- NA NA 23 2 5809-5810

26,425,282 26,540,481

CGOV32T PEO-14 gain chr14 chr14 38,828,947- 38,910,784- NA NA 8 10 5824-5825

38,829,209 38,911,033

CGOV32T PEO-14 gain chr14 chr14 39,599,267- 39,734,914- GEMIN2 CTAGE5, 14 16 5826-5827

39,599,634 39,735,215 LOC100288846

CGOV32T PEO-14 gain chr14 chr14 45,673,984- 45,773,934- FAN CM, NA 8 12 5836-5837

45,674,301 45,774,210 MIS18BP1

CGOV32T PEO-14 gain chr14 chr14 61 ,439,296- 103,439,189- MNAT1 , TRMT5 CDC42BPB 17 4 5857-5943

61 ,439,601 103,439,456

CGOV32T PEO-14 gain chr14 chr14 61 ,507,959- 61,652,290- SLC38A6 NA 40 44 5859-5864

61 ,508,357 61,652,707

CGOV32T PEO-14 gain chr14 chr14 76,944,568- 77,776,503- ESRRB POMT2 15 6 5896-5902

76,944,991 77,776,823

CGOV32T PEO-14 gain chr14 chr14 104,162,846- 104,313,269- KLC1 , XRCC3 LINC00637, 12 6 5946-5948

104,163,116 104,313,630 PPP1 R13B

CGOV32T PEO-14 gain chr15 chr15 38,387,356- 38,437,646- NA NA 17 20 6105-6106

38,387,631 38,437,960

CGOV32T PEO-14 gain chr15 chr15 42,138,339- 42,734,294- JMJD7- ZNF106 6 18 6111-6112

42,138,622 42,734,565 PLA2G4B,

PLA2G4B,

SPTBN5

CCOV32T PEO-14 gain chr15 chr15 51 ,003, 828- 52,245,125- SPPL2A LE01 20 8 6129-6132

SI ,004,070 52,245,415

CCOV32T PEO-14 gain chr15 chr15 52,390,093- 52,678,589- NA MYOSA 18 30 6133-6134

52,390,445 52,678,882

CCOV32T PEO-14 gain chr15 chr15 64,148,149- 64,539,713- NA CSNK1G1 27 10 6139-6140

64,148,450 64,540,059

CCOV32T PEO-14 gain chr16 chr16 76,856,527- 76,933,187- NA NA 16 12 6331-6332

76,856,876 76,933,516

CCOV32T PEO-14 gain chr17 chr17 27,166,573- 27,236,256- FAM222B PHF12 10 10 6411-6414

27,166,858 27,236,557

CCOV32T PEO-14 gain chr17 chr17 38,043,573- 38,786,171- NA SMARCE1 13 32 6431-6434

38,043,863 38,786,535

CCOV32T PEO-14 gain chr17 chr17 49,750,927- 49,845,351- CA10 CA10.1 18 10 6506-6507

49,751,228 49,845,607

CCOV32T PEO-14 gain chr17 chr17 57,918,244- 58,316,892- VMP1, MIR21 USP32 5 4 6531-6534

57,918,563 58,317,103

CCOV32T PEO-14 gain chr17 chr17 63,199,056- 63,530,873- RGS9 AXIN2 19 14 6554-6558

63,199,443 63,531,201

CCOV32T PEO-14 gain chr17 chr17 78,595,549- 78,754,231- RPTOR RPTOR.1 6 8 6610-6612

78,595,821 78,754,479

CCOV32T PEO-14 gain chr17 chr17 79,225,377- 80,620,421- SLC38A10 RAB40B 16 18 6615-6622

79,225,686 80,620,762

CCOV32T PEO-14 gain chr18 chr18 49,164,283- 49,335,059- NA NA 12 24 6678-6679

49,164,637 49,335,377

CCOV32T PEO-14 gain chr19 chr19 3,814,966- 4,585,325- MIR1268A, NA 9 8 6710-6714

3,815,212 4,585,551 ZFR2

CCOV32T PEO-14 loss chr19 chr19 4,583,452- 6,159,926- NA ACSBG2 13 4 6713-6721

4,583,831 6,160,139

CCOV32T PEO-14 gain chr19 chr19 5,895,830- 6,021,641- NDUFA11 LOC100128568, 12 18 6719-6720

5,896,196 6,021,919 RFX2 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV32T PEO-14 gain chr19 chr19 18,967,867- 19,352,104- UPF1 NCAN 17 12 6784-6788

18,968,169 19,352,446

CCOV32T PEO-14 gain chr1 chr1 150, 444, 288- 151,032,273- RPRD2 MLLT11, 21 18 683-708

ISO, 444, 601 151,032,597 CDC42SE1

CCOV32T PEO-14 gain chr19 chr19 23,870,553- 24,002,589- ZNF67S RPSAP58 12 14 6877-6886

23,870,953 24,002,840

CCOV32T PEO-14 gain chr19 chr19 36,182,726- 36,666,188- NA NA 7 4 6930-6933

36,183,047 36,666,420

CCOV32T PEO-14 inversion chr19 chr19 36,487,498- 38, 539, eSS- SDHAF1 SIPA1 L3 13 5 6932-6938

36,487,780 38, 540, 016

CCOV32T PEO-14 gain chr19 chr19 44,420,957- 48,847,594- ZNF45 TMEM143 9 14 6956-7003

44,421,235 48,847,965

CCOV32T PEO-14 gain chr19 chr19 48,657,426- 48,900,511- LIC1 CRIN2D 10 8 7002-7005

48,657,717 48,900,830

CCOV32T PEO-14 gain chr20 chr20 30,147,433- 31,112, 282- HM13 LOC101929698, 75 SO 7172-7214

30,147,820 31,112,665 NOL4L

CCOV32T PEO-14 loss chr20 chr20 30,351,815- 30,968,737- TPX2 ASXL1 25 12 7184-7203

30,352,069 30,969,063

CCOV32T PEO-14 gain chr20 chr20 30,531,904- 30,734,247- TTLL9, PDRC1 TM9SF4 13 10 7192-7198

30,532,183 30,734,514

CCOV32T PEO-14 gain chr20 chr20 35,102,888- 35,286,886- DLCAP4 NDRG3 9 10 7235-7238

35,103,240 35,287,250

CCOV32T PEO-14 gain chr20 chr20 36,110,866- 36,817,300- NA NA 26 12 7247-7255

36,111,225 36,817,699

CCOV32T PEO-14 gain chr20 chr20 37,145,645- 37,696,458- RALCAPB NA 19 14 7256-7262

37,146,015 37,696,745

CCOV32T PEO-14 gain chr20 chr20 38,656,298- 50,285,174- NA ATP9A 9 6 7267-7407

38,656,494 50,285,437

CCOV32T PEO-14 loss chr20 chr20 38,657,756- 39,480,160- NA NA 22 26 7268-7271

38,658,170 39,480,454

CCOV32T PEO-14 gain chr20 chr20 56,330,162- 56,797,867- NA ANKRD60 20 26 7428-7431

56,330,518 56,798,300

CCOV32T PEO-14 gain chr20 chr20 57,143,675- 57,524,765- APCDD1 L-AS1 NA 11 12 7432-7435

57,144,053 57,525,163

CCOV32T PEO-14 gain chr21 chr21 21 ,339,463- 21,382,876- NA NA 20 10 7570-7571

21 ,339,841 21,383,164

CCOV32T PEO-14 gain chr21 chr21 28,327,683- 28,495,207- MIR47S9, NA 9 8 7589-7590

28,327,916 28,495,432 ADAMTSS

CCOV32T PEO-14 inversion chr1 chr1 22,106,909- 22,143,565- USP48 LDLRAD2, 10 6 76-77

22,107,227 22,143,846 HSPC2

CCOV32T PEO-14 gain chr22 chr22 20,048,931- 20,208,465- TANG02 NA 9 2 7680-7682

20,049,211 20,208,709

CCOV32T PEO-14 gain chr22 chr22 29,096,545- 29,396,562- CHEK2 ZNRF3 7 8 7722-7723

29,096,764 29,396,896

CCOV32T PEO-14 gain chr22 chr22 29,794,368- 30,049,545- NA NF2 10 22 7727-7728

29,794,687 30,049,958

CCOV32T PEO-14 gain chr22 chr22 39,078,007- 39,806,643- TOMM22, TAB1 17 10 7745-7747

39,078,320 39,807,056 JOSD1

CCOV32T PEO-14 gain chr22 chr22 43,321,762- 43,468,032- PACSIN2 TTLL1 6 12 7752-7756

43,321,999 43,468,221 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV32T PEO-14 gain chrX chrX 132,435,332- 135,426,108- CPC4 ADCRC4 21 22 7882-7900

132,435,659 135,426,530

CCOV32T PEO-14 gain chrX chrX 153,108,063- 153,404,417- NA 0PN1 LW 10 10 7924-7926

153,108,282 153,404,846

CCOV32T PEO-14 gain chr1 chr1 163,158,310- 163,245,151- L0C101928404, L0C101928404, 12 10 809-812

163,158,614 163,245,495 RCS5 RCS5.1

CCOV32T PEO-14 gain chr1 chr1 173,915,870- 174,093,705- RC3H1 LOC102724601 5 8 856-858

173,916,101 174,093,925

CCOV32T PEO-14 gain chr1 chr1 200,740,256- 202,323,128- CAMSAP2 PPP1 R12B 30 18 962-993

200,740,520 202,323,477

CCOV32T PEO-14 loss chr1 chr1 201,986,436- 202,695,773- ELF3 KDM5B 12 7 986-994

201,986,711 202,696,138

CCOV34T PEO-6 translocation chr1 chr17 204,969,207- 58,425,024- NFASC USP32 10 4 1010-13405

204,969,455 58,425,209

CCOV34T PEO-6 gain chr2 chr2 6,021 ,959- 15,330,465- NA NBAS 8 14 1106-1267

6,022,262 15,330,741

CCOV34T PEO-6 gain chr13 chr13 51 ,708, 376- 51, 931 ,886- LINC00371 SERPINE3, INTS6 13 24 11508-11509

SI ,708,701 SI, 932, 212

CCOV34T PEO-6 translocation chr13 chrX 61 ,743,909- 39,845,466- NA NA 9 16 11516-15687

61 ,744,157 39,845,834

CCOV34T PEO-6 gain chr14 chr14 51 ,094,340- 51,134, 453- ATL1 SAV1 21 26 11758-11761

SI ,094,578 SI, 134, 726

CCOV34T PEO-6 gain chr14 chr14 58,104,123- 62,335,778- SLC35F4 NA 11 28 11798-11893

58,104,309 62,336,022

CCOV34T PEO-6 gain chr14 chr14 63,760,947- 63,934,465- RHOJ PPP2R5E 16 16 11907-11914

63,761,323 63,934,772

CCOV34T PEO-6 translocation chr14 chrX 85,056,306- 71,248,082- NA NHSL2 37 36 12011-15713

85,056,873 71,248,689

CCOV34T PEO-6 loss chr16 chr16 78,144,305- 78,869,794- WWOX WWOX.1 27 16 13079-13080

78,144,589 78,870,093

CCOV34T PEO-6 gain chr17 chr17 80,250,594- 80,350,548- NA OCFOD3 12 10 13890-13893

80,250,844 80,350,912

CCOV34T PEO-6 translocation chr18 chr20 19,491,787- 151,160- NA NA 20 8 14025-15031

19,492,111 151,468

CCOV34T PEO-6 gain chr20 chr20 15,215,890- 15,258,832- MACROD2 MACROD2.1 14 12 15099-15102

15,216,112 15,259,110

CCOV34T PEO-6 translocation chr2 chr22 104,809,309- 29,065,347- NA TTC28 19 10 1807-15590

104,809,781 29,065,922

CCOV34T PEO-6 translocation chr2 chr9 238,445,012- 133,542,144- MLPH PRDM12 45 14 2494-9081

238,445,675 133,542,846

CCOV34T PEO-6 inversion / chr3 chr11 43,420,703- 90, 877, 790- ANO10 NA 10 14 2815-10392 translocation 43,420,972 gO, 878, 192

Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV34T PEO-6 gain chr5 chr5 98,193,157- 98,302,957- CHD1 NA 15 30 5083-5086

98,193,364 98,303,215

CCOV34T PEO-6 gain chr6 chr6 12,765,809- 87,463,355- PHACTR1 NA 11 20 5523-5919

12,766,157 87,463,599

CCOV34T PEO-6 gain chr6 chr6 75,893,047- 75,927,957- COL12A1 NA 16 18 5870-5872

75,893,284 75,928,247

CCOV34T PEO-6 inversion/ chr6 chr11 151,237,123- 15,485,553- MTHFD1 L NA 18 20 5985-9629 translocation 151,237,432 15,485,830

CCOV34T PEO-6 translocation chr6 chr17 153,006,880- 72,342,210- NA KIF19 15 34 5997-13642

153,007,152 72,342,535

CCOV34T PEO-6 translocation chr7 chr12 54,071,391- 82,433,424- NA NA 24 34 6088-11149

54,071,574 82,434,457

CCOV34T PEO-6 inversion/ chr7 chr8 87,318,596- 137,001,331- RUNDC3B, NA 23 30 6194-8608 translocation 87,318,908 137,001,653 ABCB1

CCOV34T PEO-6 inversion/ chr9 chr11 31,585,039- 64,258,554- NA NA 19 26 8787-9913 translocation 31,585,341 64,258,916

CCOV34T PEO-6 translocation chr10 chr17 116,656,047- 35,274,288- FAM160B1 NA 15 14 9580-13208

116,656,337 35,274,565

CCOV34T PEO-6 translocation chr10 chr13 127,574,440- 20,371,300- DHX32 NA 54 66 9594-11445

127,574,736 20,371,568

CCOV44T FU-OV-1 gain chr6 chr6 76,032,873- 76,104,056- FILIP1 FILIP1.1 17 12 10064-10066

76,033,217 76,104,356

CCOV44T FU-OV-1 translocation chr6 chr14 87,484,794- 29,201,028- NA FOXC1-AS1 11 8 10134-19137

87,485,065 29,201,287

CCOV44T FU-OV-1 gain chr6 chr6 133,891,035- 134,721,371- TARID NA 11 8 10543-10585

133,891,265 134,721,612

CCOV44T FU-OV-1 gain chr6 chr6 144,377,261- 144,770,756- PLACL1 UTRN 17 10 10656-10665

144,377,645 144,770,969

CCOV44T FU-OV-1 gain chr6 chr6 150,539,004- 150,552,526- PPP1R14C PPP1R14C.1 8 12 10718-10719

150,539,309 150,552,846

CCOV44T FU-OV-1 gain chr6 chr6 151,924,393- 152,190,186- CCDC170 ESR1 12 10 10729-10741

151,924,712 152,190,441

CCOV44T FU-OV-1 translocation chr6 chr20 152,059,419- 46,485,768- ESR1 NA 5 8 10733-25564

152,059,635 46,485,981

CCOV44T FU-OV-1 inversion/ chr6 chr20 166,651,006- 15,582,788- LOC101929297 MACROD2 11 8 10850-24624 translocation 166,651,377 15,583,012

CCOV44T FU-OV-1 gain chr7 chr7 121,700,414- 121,742,637- PTPRZ1 AASS 10 8 11521-11522

121,700,677 121,742,826

CCOV44T FU-OV-1 gain chr7 chr7 129,360,399- 129,620,978- NRF1 NA 30 42 11585-11598

129,360,847 129,621,348

CCOV44T FU-OV-1 gain chr8 chr8 8,526,427- 8,624,652- NA NA 26 42 11873-11876

8,526,647 8,624,957

CCOV44T FU-OV-1 gain chr8 chr8 40,036,851- 40,078,870- NA NA 23 24 11980-11983

40,037,098 40,079,218

CCOV44T FU-OV-1 gain chr8 chr8 64,348,297- 75,396,192- NA NA 10 12 12047-12078

64,348,673 75,396,468

CCOV44T FU-OV-1 inversion chr1 chr1 161,145,268- 161,155,563- PPOX, B4CALT3 ADAMTS4 12 16 1209-1211

161,145,606 161,155,832

CCOV44T FU-OV-1 gain chr8 chr8 91,092,746- 91,126,591- CALB1 NA 7 16 12145-12147

91,093,007 91,126,971 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV44T FU-OV-1 gain chr8 chr8 128,691,748- 129,615,326- NA NA 52 60 12701-12842

128,692,097 129,615,637

CCOV44T FU-OV-1 inversion / chr8 chr17 129,352,725- 66,561,166- NA FAM20A 33 32 12812-21753 translocation 129,353,152 66,561,517

CCOV44T FU-OV-1 loss chr8 chr8 132,901,216- 145,545,863- NA DGAT1, MIR6848 19 32 12907-13096

132,901,505 145,546,168

CCOV44T FU-OV-1 inversion chr8 chr8 144,989,866- 145,058,608- PLEC PARP10 14 16 13078-13081

144,990,269 145,059,038

CCOV44T FU-OV-1 inversion / chr8 chr18 145,013,377- 42,440,172- PLEC SETBP1 16 22 13079-22607 translocation 145,013,642 42,440,447

CCOV44T FU-OV-1 gain chr9 chr9 37,502,506- 37,514,838- POLR1 E FBXO10 14 20 13394-13395

37,502,757 37,515,092

CCOV44T FU-OV-1 gain chr10 chr10 34,287,165- 34,735,166- NA PARD3 9 6 13870-13874

34,287,373 34,735,380

CCOV44T FU-OV-1 gain chr10 chr10 73,633,808- 74,649,445- NA MCU, OIT3 12 40 14180-14226

73,634,123 74,649,741

CCOV44T FU-OV-1 translocation chr10 chrX 116,552,052- 66,867,293- NA AR 10 10 14541-26457

116,552,330 66,867,657

CCOV44T FU-OV-1 translocation chr10 chr22 116,554,293- 22,024,885- NA PPIL2 7 18 14542-26212

116,554,511 22,025,113

CCOV44T FU-OV-1 translocation chr10 chr13 127,574,394- 20,371,261- DHX32 NA 67 70 14632-18524

127,574,703 20,371,568

CCOV44T FU-OV-1 inversion / chr11 chr14 2,532,425- 37,315,124- KCNQ1 SLC25A21 10 6 14702-19160 translocation 2,532,705 37,315,548

CCOV44T FU-OV-1 gain chr11 chr11 13,163,214- 13,203,116- NA NA 12 10 15084-15088

13,163,505 13,203,363

CCOV44T FU-OV-1 gain chr11 chr11 27,904,975- 27,930,114- NA NA 11 12 15332-15333

27,905,192 27,930,314

CCOV44T FU-OV-1 translocation chr1 chr13 199,615,565- 103,189,265- NA NA 18 8 1562-19082

199,615,917 103,189,568

CCOV44T FU-OV-1 gain chr11 chr11 71 ,184,421- 103,237,304- NADSYN1, DYNC2H1 20 28 15751-16134

71 ,184,707 103,237,628 MIR6754

CCOV44T FU-OV-1 inversion / chr11 chr12 73,106,661- 12,592,476- RELT, FAM168A BORCS5 17 12 15795-16884 translocation 73,107,033 12,592,687

CCOV44T FU-OV-1 gain chr11 chr11 94,679,351- 94,696,517- NA CWC15 12 10 16004-16006

94,679,576 94,696,757

CCOV44T FU-OV-1 inversion chr11 chr11 101,694,409- 112,932,922- NA NCAM1 15 20 16073-16219

101,694,705 112,933,234

CCOV44T FU-OV-1 translocation chr1 chr3 218,883,352- 25,099,751- MIR548F3 NA 40 50 1684-3764

218,884,610 25,100,360

CCOV44T FU-OV-1 gain chr1 chr1 219,635,765- 219,651 ,951- NA NA 21 22 1691-1693

219,636,005 219,652,323

CCOV44T FU-OV-1 gain chr12 chr12 56,868,051- 56,939,205- SPRYD4, GLS2 RBMS2 18 4 17806-17811

56,868,361 56,939,568

CCOV44T FU-OV-1 inversion / chr12 chr20 71 ,689,995- 2,011,782- NA NA 10 18 17945-24491 translocation 71 ,690,177 2,012,020

CCOV44T FU-OV-1 gain chr12 chr12 117,849,806- 119,299,479- NA NA 7 8 18326-18362

117,849,953 119,299,660 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV44T FU-OV-1 inversion chr14 chr14 29,203,804- 29,312,524- FOXC1-AS1 NA 9 12 19138-19139

29,204,088 29,312,752

CCOV44T FU-OV-1 loss chr14 chr14 33,539,425- 84,764,540- NPAS3 NA 18 10 19151-19306

33,539,751 84,764,831

CCOV44T FU-OV-1 gain chr14 chr14 38,894,431- 38,965,574- NA NA 11 14 19168-19169

38,894,728 38,965,824

CCOV44T FU-OV-1 gain chr14 chr14 71 ,577,333- 71,666,486- PCNX NA 13 12 19266-19267

71 ,577,747 71,666,759

CCOV44T FU-OV-1 gain chr14 chr14 85,615,041- 85,625,399- NA NA 10 14 19310-19311

85,615,336 85,625,671

CCOV44T FU-OV-1 gain chr2 chr2 378,301- 187,915,873- NA NA 11 14 1975-3304

378,557 187,916,184

CCOV44T FU-OV-1 gain chr1S chr1 S 63,093,892- 63,357,756- TLN2 TPM1 19 12 19876-19896

63,094,115 63,358,139

CCOV44T FU-OV-1 gain chr17 chr17 12,739,933- 12,822,156- ARHCAP44 ARHCAP44.1 15 20 21019-21022

12,740,205 12,822,424

CCOV44T FU-OV-1 inversion chr2 chr2 11 ,975,623- 11,991,713- MIR4262 NA 7 8 2106-2107

11 ,975,857 11,992,012

CCOV44T FU-OV-1 translocation chr17 chr19 36,837,085- 57,726,809- NA ZNF264 19 26 21201-24414

36,837,347 57,727,134

CCOV44T FU-OV-1 gain chr2 chr2 17,023,791- 17,037,141- NA NA 11 12 2124-2126

17,024,033 17,037,388

CCOV44T FU-OV-1 gain chr17 chr17 42,625,543- 43,210,269- NA ACBD4, PLCD3 51 46 21386-21452

42,625,886 43,210,582

CCOV44T FU-OV-1 gain chr17 chr17 43,927,763- 43,938,410- MAPT-AS1, MAPT-AS1, 5 10 21454-21455

43,927,975 43,938,638 SPPL2C SPPL2C.1

CCOV44T FU-OV-1 gain chr17 chr17 64,834,308- 65,777,077- NA NA 22 36 21631-21695

64,834,619 65,777,508

CCOV44T FU-OV-1 gain chr18 chr18 29,927,968- 73,363,751- CAREM NA 11 8 22299-22781

29,928,226 73,363,972

CCOV44T FU-OV-1 gain chr2 chr2 33,791,516- 33,825,765- RASCRP3 FAM98A 9 14 2236-2237

33,791,868 33,826,019

CCOV44T FU-OV-1 gain chr18 chr18 35,852,984- 35,868,710- NA NA 8 6 22521-22522

35,853,256 35,868,996

CCOV44T FU-OV-1 gain chr18 chr18 36,914,375- 42,443,067- LINC00669 SETBP1 15 22 22570-22608

36,914,602 42,443,427

CCOV44T FU-OV-1 inversion chr18 chr18 44,881,707- 46,667,363- NA DYM 9 16 22624-22638

44,882,051 46,667,644

CCOV44T FU-OV-1 inversion chr18 chr18 46,003,259- 51,037,152- NA DCC 10 10 22631-22657

46,003,458 51,037,468

CCOV44T FU-OV-1 inversion chr18 chr18 46,002,566- 72,997,687- NA TSHZ1 8 14 22631-22779

46,002,859 72,998,097

CCOV44T FU-OV-1 gain chr18 chr18 46,666,074- 58,433,390- DYM NA 13 12 22638-22713

46,666,293 58,433,605

CCOV44T FU-OV-1 inversion chr18 chr18 49,110,730- 51,026,339- NA DCC 8 6 22649-22655

49,111,024 51,026,691

CCOV44T FU-OV-1 gain chr18 chr18 59,605,919- 62,012,018- NA LOC284294 13 2 22724-22747

59,606,253 62,012,301 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV44T FU-OV-1 gain chr19 chr19 972,464- 1 ,457,059- ARID3A APC2 14 18 22805-22813

972,809 1 ,457,374

CCOV44T FU-OV-1 inversion chr19 chr19 31 ,122,919- 31,142,136- NA NA 10 12 23281-23284

31 ,123,159 31,142,427

CCOV44T FU-OV-1 gain chr1 chr1 33,081,867- 33,093,120- ZBTB80S ZBTB80S.1 8 4 234-235

33,082,128 33,093,376

CCOV44T FU-OV-1 translocation chr19 chr20 33,687,431- 37,670,334- LRP3 DHX35 8 4 23580-25336

33,687,662 37,670,500

CCOV44T FU-OV-1 gain chr19 chr19 39,138,903- 39,786,016- ACTN4 IFNL1 11 30 23867-23929

39,139,164 39,786,253

CCOV44T FU-OV-1 gain chr20 chr20 13,880,290- 14,386,217- SEL1 L2 MACROD2 11 10 24589-24601

13,880,482 14,386,535

CCOV44T FU-OV-1 gain chr20 chr20 14,830,317- 14,884,434- MACROD2 MACROD2.1 6 2 24605-24608

14,830,520 14,884,672

CCOV44T FU-OV-1 gain chr20 chr20 15,027,478- 15,840,064- MACROD2 MACROD2.1 19 26 24609-24643

15,027,885 15,840,429

CCOV44T FU-OV-1 gain chr20 chr20 16,332,975- 16,344,798- KIF16B KIF16B.1 27 32 24655-24657

16,333,296 16,345,141

CCOV44T FU-OV-1 gain chr2 chr2 61 ,944,370- 62,157,878- NA COMMD1 9 14 2486-2490

61 ,944,573 62,158,139

CCOV44T FU-OV-1 gain chr20 chr20 32,417,479- 33,407,838- CHMP4B NCOA6 12 16 25022-25171

32,417,733 33,408,173

CCOV44T FU-OV-1 gain chr20 chr20 38,473,152- 39,603,440- NA NA 8 2 25343-25369

38,473,391 39,603,798

CCOV44T FU-OV-1 gain chr21 chr21 35,067,087- 35,091,738- ITSN1 ITSN1.1 14 12 26123-26124

35,067,460 35,091,966

CCOV44T FU-OV-1 gain chrX chrX 117,263,695- 117,289,780- NA NA 14 12 26709-26710

117,264,031 117,290,060

CCOV44T FU-OV-1 gain chr2 chr2 85,591,134- 86,239,128- ELMOD3 NA 17 12 2695-2728

85,591,380 86,239,399

CCOV44T FU-OV-1 gain chr1 chr1 46,351,450- 46,437,585- MAST2 MAST2.1 9 18 284-285

46,351,663 46,437,882

CCOV44T FU-OV-1 gain chr1 chr1 46,960,049- 47,015,442- NA MKNK1-AS1 , 12 6 288-289

46,960,527 47,015,873 KNCN

CCOV44T FU-OV-1 gain chr2 chr2 149,624,599- 149,999,299- NA LYPD6B 8 14 3132-3137

149,624,809 149,999,475

CCOV44T FU-OV-1 gain chr2 chr2 149,625,933- 149,990,548- NA LYPD6B 6 2 3133-3135

149,626,120 149,990,755

CCOV44T FU-OV-1 inversion / chr2 chr10 149,997,540- 95,862,647- LYPD6B PLCE1 , PLCE1 - 9 12 3136-14390 translocation 149,997,809 95,862,907 AS2

CCOV44T FU-OV-1 gain chr2 chr2 159,933,997- 161,385,397- TANC1 NA 13 4 3170-3207

159,934,316 161,385,638 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV44T FU-OV-1 inversion chr2 chr2 177,373,335- 177,386,338- NA NA 19 16 3263-3264

177,373,677 177,386,720

CCOV44T FU-OV-1 inversion chr2 chr2 177,888,707- 202,583,519- NA ALS2 12 8 3269-3366

177,889,014 202,583,862

CCOV44T FU-OV-1 gain chr2 chr2 178,144,819- 178,203,841- LOC100130691 LOC100130691.1 13 8 3270-3271

178,145,210 178,204,068

CCOV44T FU-OV-1 loss chr2 chr2 200,087,705- 200,789,647- NA C2orf69, TYW5 6 14 3349-3350

200,087,910 200,789,932

CCOV44T FU-OV-1 gain chr1 chr1 63,140,259- 63,214, gleDOCK7 NA 14 6 344-345

63,140,534 es, 215,132

CCOV44T FU-OV-1 loss chr3 chr3 16,227,124- 17,340,057- CALNT15 TBC1 D5 11 10 3737-3744

16,227,420 17,340,338

CCOV44T FU-OV-1 inversion chr1 chr1 72,957,230- 161,135,866- NA USP21 , PPOX, 18 8 374-1208

72,957,533 161,136,216 B4CALT3

CCOV44T FU-OV-1 inversion chr3 chr3 24,290,733- 24,746,536- THRB NA 14 12 3762-3763

24,291,030 24,746,894

CCOV44T FU-OV-1 gain chr3 chr3 32,376,159- 33,728,156- CMTM8 CLASP2 30 28 3788-3850

32,376,463 33,728,615

CCOV44T FU-OV-1 gain chr3 chr3 52,283,594- 53,152,934- PPM1 M, RFT1 8 26 3925-3961

52,283,822 53,153,155 WDR82

CCOV44T FU-OV-1 gain chr3 chr3 112,082,569- 112,255,599- CD200 ATC3 16 18 4406-4414

112,083,015 112,255,948

CCOV44T FU-OV-1 gain chr3 chr3 141,151,799- 141,184,842- ZBTB38 NA 8 20 4647-4649

141,152,090 141,185,009

CCOV44T FU-OV-1 inversion chr3 chr3 168,608,389- 168,631 ,835- NA LOC100507661 10 8 4835-4836

168,608,603 168,632,084

CCOV44T FU-OV-1 translocation chr3 chr12 169,185,565- 8,296,189- MECOM CLEC4A 15 24 4881-16716

169,185,784 8,296,408

CCOV44T FU-OV-1 inversion / chr3 chr11 174,668,658- 70,163,482- NAALADL2 PPFIA1 15 8 5137-15745 translocation 174,668,948 70,163,765

CCOV44T FU-OV-1 inversion / chr3 chr4 178,484,439- 142,750,756- KCNMB2, NA 12 6 5246-6583 translocation 178,484,698 142,751 ,125 KCNMB2-AS1

CCOV44T FU-OV-1 gain chr3 chr3 184,836,402- 185,254,976- C3or(70 LIPH 13 6 5471-5489

184,836,745 185,255,200

CCOV44T FU-OV-1 gain chr3 chr3 191,937,198- 191,996,440- FCF12 FCF12.1 13 14 5707-5709

191,937,576 191,996,707

CCOV44T FU-OV-1 gain chr1 chr1 8,729,748- 9,804,788- RERE CLSTN1 16 24 58-83

8,730,091 9,805,083

CCOV44T FU-OV-1 inversion / chr3 chr5 196,336,132- 177,025,687- NA TMED9, 41 68 5948-9215 translocation 196,336,480 177,026,017 B4CALT7

CCOV44T FU-OV-1 translocation chr3 chr8 197,480,898- 139,972,709- FYTTD1 , NA 20 2 5997-13010

197,481,323 139,973,259 KIAA0226

CCOV44T FU-OV-1 inversion / chr4 chr19 2,235,479- 45,227,330- POLN, HAUS3 NA 59 90 6086-24221 translocation 2,235,867 45,227,691

CCOV44T FU-OV-1 gain chr4 chr4 46,511,487- 46,533,334- NA NA 8 24 6232-6233

46,511,760 46,533,613

CCOV44T FU-OV-1 translocation chr4 chr16 84,596,414- 3,252,006- NA OR1 F1 25 26 6371-20275

84,596,763 3,252,326

CCOV44T FU-OV-1 inversion / chr4 chr16 84,622,398- 2,769,735- NA PRSS27 29 26 6372-20240 translocation 84,622,797 2,770,128 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV44T FU-OV-1 gain chr4 chr4 150,850,068- 150,899,146- NA NA 8 18 6645-6647

150,850,357 150,899,355

CCOV44T FU-OV-1 translocation chr4 chr11 175,454,226- 127,378,388- NA NA 5 4 6850-16363

175,454,446 127,378,570

CCOV44T FU-OV-1 gain chr4 chr4 183,470,364- 183,511,374- TENM3 TENM3.1 6 12 6912-6913

183,470,547 183,511,593

CCOV44T FU-OV-1 inversion/ chr1 chr20 9,607,503- 42,158,884- SLC25A33 L3MBTL1 27 32 76-25446 translocation 9,607,757 42,159,213

CCOV44T FU-OV-1 gain chr5 chr5 58,519,403- 60,182,846- PDE4D ERCC8 13 32 7900-7983

58,519,649 60,183,296

CCOV44T FU-OV-1 loss chr5 chr5 58,787,947- 59,257,221- PDE4D PDE4D.1 20 4 7918-7932

58,788,221 59,257,467

CCOV44T FU-OV-1 gain chr5 chr5 58,894,430- 59,001,266- PDE4D PDE4D.1 5 22 7923-7928

58,894,756 59,001,493

CCOV44T FU-OV-1 inversion chr5 chr5 170,567,206- 170,751,134- RANBP17 NA 10 12 8977-8978

170,567,562 170,751,378

CCOV44T FU-OV-1 translocation chr5 chr19 176,930,670- 37,864,714- DOK3 ZNF527 13 6 9199-23795

176,930,968 37,865,049

CCOV44T FU-OV-1 gain chr6 chr6 51,354,543- 52,562,827- NA NA 30 32 9781-9825

51,354,900 52,563,194

CCOV4ST COV-318 gain chr17 chr17 51,820,594- 51,834,156- NA NA 7 6 103741-103742

51,820,878 51,834,389

CCOV4ST COV-318 translocation chr19 chrX 10,451,387- 125,768,493- ICAM3 NA 10 16 107126-121483

10,451,631 125,768,785

CCOV4ST COV-318 translocation chr1 chr3 16,678,689- 126,277,791- FBX042 C3orf22 25 26 1073-34246

16,678,914 126,278,271

CCOV4ST COV-318 translocation chr19 chr20 28,620,590- 58,216,960- NA PHACTR3 9 20 107791-117210

28,620,850 58,217,221

CCOV4ST COV-318 gain chr19 chr19 28,807,890- 37,448,919- NA ZNF568 5 2 107806-108768

28,808,096 37,449,116

CCOV4ST COV-318 loss chr19 chr19 29,154,483- 37,419,473- LOC100420587 ZNF568 18 22 107852-108764

29,154,721 37,419,719

CCOV4ST COV-318 translocation chr19 chrX 29,878,906- 48,402,582- LOC284395 TBC1D25 5 12 107987-120711

29,879,079 48,402,717

CCOV4ST COV-318 inversion chr19 chr19 35,310,472- 37,476,032- LOC400685 ZNF568 5 6 108534-108774

35,310,659 37,476,208

CCOV4ST COV-318 inversion/ chr19 chr20 40,728,356- 38,074,747- TTC9B, CNTD2 NA 9 26 108999-114365 translocation 40,728,602 38,075,091

CCOV4ST COV-318 loss chr19 chr19 46,913,483- 58,574,694- CCDC8 ZNF135 24 34 109228-109679

46,913,727 58,574,981

CCOV4ST COV-318 inversion chr20 chr20 53,797,858- 53,820,569- NA NA 8 6 116478-116479

53,798,071 53,820,841

CCOV4ST COV-318 translocation chr2 chr10 104,977,217- 52,785,227- NA PRKC1 5 8 22722-77265

104,977,399 52,785,589

CCOV4ST COV-318 loss chr5 chr5 58,399,815- 58,878,773- PDE4D PDE4D.1 9 2 45242-45246

58,400,105 58,878,971

CCOV4ST COV-318 loss chr5 chr5 66,230,269- 98,211,618- MAST4 CHD1 9 6 45413-45959

66,230,467 98,211,824

CCOV4ST COV-318 gain chr5 chr5 167,200,153- 167,339,355- TENM2 TENM2.1 5 12 49252-49268

167,200,377 167,339,515 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV45T COV-318 inversion chr1 chr1 81 ,941,992- 81,960,138- NA NA 6 12 6238-6242

81 ,942,168 81,960,338

CCOV45T COV-318 gain chr7 chr7 127,811,383- 127,882,282- NA LEP 6 16 66925-66933

127,811,572 127,882,511

CCOV45T COV-318 gain chr8 chr8 128,459,748- 139,627,843- CASC8 COL22A1 19 22 72099-72376

128,459,999 139,628,087

CCOV45T COV-318 inversion / chr9 chr14 3,844,704- 91,830,238- CLIS3 CCDC88C 5 10 72512-96878 translocation 3,844,838 91,830,436

CCOV45T COV-318 inversion chr10 chr10 50,313,917- 124,543,768- VSTM4 DMBT1 P1 6 8 77201-79659

50,314,119 124,544,003

CCOV45T COV-318 gain chr10 chr10 116, 096, 007- 120,513,799- AFAP1 L2 CACUL1 8 12 79030-79522 l i e, 096, 270 120,514,042

CCOV45T COV-318 loss chr10 chr10 119,883,977- 123,057,997- CASC2 NA 6 4 79480-79580

119,884,213 123,058,190

CCOV45T COV-318 gain chr11 chr11 8,936,666- 9,159,341- AKIP1, ST5, DENNDSA 5 8 80010-80021

8,936,889 9,159,524 C11 orf16

CCOV45T COV-318 inversion / chr11 chr19 62,467,958- 30,903,387- BSCL2, ZNF536 5 2 80961-108150 translocation 62,468,144 30,903,518 HNRNPUL2-

BSCL2

CCOV45T COV-318 translocation chr11 chr19 62,676,641- 28,900,689- CHRM1 NA 12 14 80989-107822

62,676,896 28,900,879

CCOV45T COV-318 inversion / chr11 chr19 62,755,737- 45,145,676- SLC22A6, PVR 11 24 80999-109101 translocation 62,755,982 45,145,856 SLC22A8

CCOV45T COV-318 inversion / chr11 chr18 71 ,115,239- 8,029,019- FLJ42102 PTPRM 9 2 81378-104727 translocation 71 ,115,522 8,029,329

CCOV45T COV-318 loss chr12 chr12 24,896,748- 30,633,958- NA NA 7 6 86758-86858

24,896,976 30,634,151

CCOV45T COV-318 gain chr12 chr12 99,298,161- 99,723,361- ANKS1 B ANKS1 B.1 9 10 88735-88758

99,298,470 99,723,619

CCOV45T COV-318 translocation chr13 chr22 29,475,992- 46,467,846- NA NA 8 10 89835-120320

29,476,315 46,468,050

CCOV45T COV-318 inversion / chr13 chr14 61 ,461,440- 93,887,593- NA UNC79 6 8 90620-97059 translocation 61 ,461,762 93,887,748

CCOV45T COV-318 gain chr14 chr14 39,268,409- 39,767,367- LINC00639 CTAGES 12 6 93251-93294

39,268,689 39,767,617

CCOV45T COV-318 gain chr15 chr15 48,026,030- 48,712,750- SEMA6D FBN1 10 4 98992-99025

48,026,310 48,713,023

CCOV46T JHOS-2 inversion / chr2 chr5 172,659,264- 73,361,063- SLC25A12 NA 12 16 11117-23963 translocation 172,659,406 73,361,261

CCOV46T JHOS-2 translocation chr2 chr12 172,696,182- 114,190,264- SLC25A12 LINC01234 7 24 11122-46099

172,696,428 114,190,527

CCOV46T JHOS-2 gain chr2 chr2 182,621,628- 184,461 ,405- NA NA 5 14 11620-11799

182,621,849 184,461 ,839

CCOV46T JHOS-2 gain chr3 chr3 1,563,937- 2,096,992- NA NA 17 14 13169-13206

1,564,154 2,097,256

CCOV46T JHOS-2 inversion / chr1 chr6 8,914,268- 89,765,182- NA NA 10 14 133-28065 translocation 8,914,472 89,765,428

CCOV46T JHOS-2 gain chr3 chr3 17,340,842- 17,355,143- TBC1 DS TBC1 DS.1 8 4 13701-13704

17,341,040 17,355,430

CCOV46T JHOS-2 gain chr1 chr1 1,613,581- 11,985,028- CDK11 B, KIAA2013 12 10 14-220

1,613,926 11,985,295 SLC3SE2B Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV46T JHOS-2 inversion/ chr3 chr7 52,546,536- 157,000,834- STAB1 UBE3C 9 16 15330-31629 translocation 52,546,688 157,001,089

CCOV46T JHOS-2 translocation chr1 chr4 70,294,517- 37,324,203- LRRC7 NWD2 10 18 1694-21723

70,294,796 37,324,419

CCOV46T JHOS-2 translocation chr3 chr16 137,930,167- 70,602,415- ARMC8 SF3B3 10 10 17030-52997

137,930,371 70,602,681

CCOV46T JHOS-2 inversion chr1 chr1 72,949,613- 85,757,558- NA NA 8 2 1812-2456

72,949,844 85,757,999

CCOV46T JHOS-2 translocation chr3 chr10 165,324,444- 33,167,299- NA CCDC7 22 12 18379-37397

165,324,615 33,167,826

CCOV46T JHOS-2 gain chr1 chr1 77,871,174- 77,885,500- AK5 AK5.1 11 12 2016-2017

77,871,385 77,885,837

CCOV46T JHOS-2 inversion/ chr1 chr21 78,623,983- 30,070,497- NA NA 8 8 2056-59209 translocation 78,624,204 30,070,812

CCOV46T JHOS-2 gain chr4 chr4 20,897,854- 20,908,647- KCNIP4 KCNIP4.1 15 16 21372-21375

20,898,071 20,908,899

CCOV46T JHOS-2 gain chr4 chr4 23,295,778- 23,306,592- MIR548AJ2 MIR548AJ2.1 15 32 21432-21434

23,296,021 23,306,818

CCOV46T JHOS-2 translocation chr4 chr8 76,296,742- 55,958,036- NA NA 11 14 22389-31899

76,296,933 55,958,360

CCOV46T JHOS-2 translocation chr5 chr18 339,108- 39,973,392- AHRR LINC00907 28 26 22999-55706

339,328 39,973,960

CCOV46T JHOS-2 gain chr5 chrS 23,618,132- 74,215,019- NA NA 11 16 23280-23982

23,618,352 74,215,250

CCOV46T JHOS-2 gain chr5 chrS 36,028,907- 36,043,169- NA UGT3A2 15 18 23518-23519

36,029,112 36,043,450

CCOV46T JHOS-2 gain chr5 chrS 74,989,658- 75,002,672- POC5 POC5.1 16 20 24010-24011

74,989,959 75,002,891

CCOV46T JHOS-2 inversion chr5 chrS 76,303,114- 81,315,951- NA ATG10 15 18 24036-24138

76,303,355 81,316,177

CCOV46T JHOS-2 translocation chr5 chr10 90, 861, 422- 60,046,608- NA CISD1 10 12 24375-37536 gO, 861, 612 60,046,812

CCOV46T JHOS-2 translocation chr5 chr12 115,781,176- 110,218,914- SEMA6A-AS1, TRPV4 18 12 24521-46028

115,781,489 110,219,205 SEMA6A

CCOV46T JHOS-2 inversion/ chr5 chr12 119,774,552- 98,701,921- NA NA 9 8 24634-45651 translocation 119,774,847 98,702,189

CCOV46T JHOS-2 inversion/ chr5 chr12 134,109,404- 42,515,992- DDX46 CXYLT1 9 12 25054-44638 translocation 134,109,593 42,516,133

CCOV46T JHOS-2 gain chr5 chr5 141,959,194- 141,980,287- NA FCF1 13 6 25278-25280

141,959,402 141,980,513

CCOV46T JHOS-2 translocation chr5 chr7 145,143,841- 89,798,834- PRELID2 STEAP1 , 11 2 25373-30936

145,143,987 89,799,427 STEAP2-AS1

CCOV46T JHOS-2 gain chr5 chr5 167,696,194- 167,711,700- NA NA 5 6 26041-26042

167,696,515 167,711,889

CCOV46T JHOS-2 inversion/ chr6 chr14 82,650,264- 49,318,894- NA NA 5 2 27859-49340 translocation 82,650,443 49,319,073

CCOV46T JHOS-2 inversion chr6 chr6 90,809,548- 140,679,943- BACH2 NA 13 10 28101-29185

90,809,790 140,680,152

CCOV46T JHOS-2 inversion chr6 chr6 102,883,155- 133,485,428- NA NA 15 20 28480-29125

102,883,429 133,485,752 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV46T JHOS-2 inversion / chr7 chr11 20,897,680- 42,565,955- LINC01162 NA 7 2 29531-39880 translocation 20,897,834 42,566,130

CCOV46T JHOS-2 inversion / chr7 chr8 33,337,347- 136,951 ,386- BBS9 NA 15 6 29635-34794 translocation 33,337,649 136,951 ,653

CCOV46T JHOS-2 gain chr7 chr7 81 ,218,849- 81,242,958- LOC100128317 LOC100128317.1 11 22 30720-30724

81 ,219,109 81,243,171

CCOV46T JHOS-2 inversion / chr7 chr19 81 ,476,370- 59,073,877- NA MZF1-AS1, 12 6 30735-56957 translocation 81 ,476,600 59,074,336 UBE2M, MZF1

CCOV46T JHOS-2 loss chr7 chr7 91 ,771,168- 130,956,897- CYP51A1-AS1, MKLN1 7 2 30987-31288

91 ,771,348 130,957,117 LRRD1

CCOV46T JHOS-2 translocation chr7 chr8 117,613,672- 31,588,560- NA NRC1 9 8 31231-31806

117,613,966 31,588,758

CCOV46T JHOS-2 translocation chr7 chr8 119,419,790- 108,167,421- LVCATS NA 16 22 31265-33122

119,420,075 108,167,741

CCOV46T JHOS-2 gain chr7 chr7 128,966,317- 128,985,221- AHCYL2 AHCYL2.1 9 2 31283-31284

128,966,603 128,985,392

CCOV46T JHOS-2 gain chr7 chr7 150,924,386- 151,033,814- CHPF2, ABCF2 NUB1 6 16 31509-31513

150,924,588 151,033,958

CCOV46T JHOS-2 inversion / chr8 chrX 38,050,901- 22,413,890- BAC4 PTCHD1-AS 7 6 31833-60262 translocation 38,051,107 22,414,155

CCOV46T JHOS-2 gain chr8 chr8 63,133,493- 63,146,894- NA NA 13 30 32054-32056

63,133,726 63,147,131

CCOV46T JHOS-2 gain chr8 chr8 110,573,318- 110,623,125- EBAC9 SYBU 12 18 33294-33302

110,573,653 110,623,366

CCOV46T JHOS-2 gain chr8 chr8 116,759,346- 116,771 ,620- NA NA 15 22 33725-33727

116,759,599 116,771 ,862

CCOV46T JHOS-2 translocation chr8 chr12 128,652,387- 125,034,865- NA NCOR2 14 4 34505-46156

128,652,556 125,035,142

CCOV46T JHOS-2 loss chr8 chr8 131,121,891- 144,349,490- ASAP1 ZFP41, GLI4 17 22 34681-35159

131,122,132 144,349,727

CCOV46T JHOS-2 translocation chr8 chr15 143,809,685- 89,843,640- THEM6, FANCI 16 10 35149-51796

143,809,926 89,843,879 LOC100288181

CCOV46T JHOS-2 loss chr9 chr9 19,769,987- 32,244,292- SLC24A2 NA 14 14 35357-35376

19,770,269 32,244,548

CCOV46T JHOS-2 gain chr9 chr9 75,791,586- 75,814,617- NA NA 16 26 35711-35715

75,791,850 75,814,861

CCOV46T JHOS-2 inversion / chr9 chr22 78,826,059- 25,997,718- PCSK5 ADRBK2 14 14 35794-59614 translocation 78,826,234 25,997,970

CCOV46T JHOS-2 translocation chr9 chr19 97,321,077- 50,165,591- PCAT7, FBP2 SCAF1 , BCL2L12, 5 6 36185-56745

97,321,333 50,165,829 IRF3

CCOV46T JHOS-2 inversion / chr9 chr19 97,496,808- 50,219,642- C9orF3 CPT1C 7 12 36193-56746 translocation 97,497,087 50,219,853

CCOV46T JHOS-2 gain chr9 chr9 98,711,667- 98,726,336- ERCC6L2 ERCC6L2.1 13 10 36230-36232

98,711,975 98,726,549

CCOV46T JHOS-2 gain chr9 chr9 130,728,486- 130,957,882- FAM102A CIZ1 8 6 37020-37029

130,728,685 130,958,110

CCOV46T JHOS-2 gain chr10 chr10 20,480,021- 20,514,764- PLXDC2 PLXDC2.1 11 18 37328-37329

20,480,252 20,515,037

CCOV46T JHOS-2 gain chr10 chr10 118,542,265- 118,553,673- NA NA 11 14 38762-38765

118,542,501 118,553,902 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV46T JHOS-2 inversion / chr11 chr17 73,604,189- 77,330,674- PAAF1 RBFOX3 16 24 40444-54667 translocation 73,604,484 77,330,909

CGOV46T JHOS-2 gain chr1 chr1 159,629,016- 159,646,531- NA NA 11 2 4076-4081

159,629,284 159,646,791

CGOV46T JHOS-2 inversion chr11 chr11 102,969,166- 119,632,920- NA NA 21 16 42265-42618

102,969,473 119,633,210

CGOV46T JHOS-2 gain chr1 chr1 164,282,356- 164,293,663- NA NA 12 10 4336-4338

164,282,819 164,293,889

CGOV46T JHOS-2 inversion chr12 chr12 32,464,953- 46,133,027- BICD1 ARID2 13 10 44456-44725

32,465,273 46,133,224

CGOV46T JHOS-2 inversion chr12 chr12 32,484,246- 46,149,463- BICD1 ARID2 13 24 44458-44727

32,484,527 46,149,683

CGOV46T JHOS-2 gain chr12 chr12 46,274,144- 46,295,609- ARID2 ARID2.1 14 16 44729-44731

46,274,512 46,295,956

CGOV46T JHOS-2 gain chr12 chr12 56,080,212- 56,176,203- METTL7B, SARNP 9 24 44902-44904

56,080,498 56,176,554 ITGA7

CGOV46T JHOS-2 gain chr12 chr12 68,013,945- 68,042,660- NA DYRK2 10 2 45096-45097

68,014,212 68,042,932

CGOV46T JHOS-2 translocation chr12 chrX 105,364,486- 17,099,824- NA REPS2 23 16 45798-60196

105,364,713 17,100,103

CGOV46T JHOS-2 inversion / chr12 chr20 114,218,833- 50,286,361- NA ATP9A 31 36 46102-57812 translocation 114,219,112 50,286,617

CGOV46T JHOS-2 gain chr13 chr13 81 ,848,675- 81,859,287- NA NA 11 6 47861-47862

81 ,848,936 81,859,549

CGOV46T JHOS-2 translocation chr1 chr7 33,516,320- 24,448,435- NA NA 16 14 481-29558

33,516,541 24,448,714

CGOV46T JHOS-2 gain chr13 chr13 96,527,511- 96,539,316- UGGT2 UGGT2.1 13 24 48172-48174

96,528,097 96,539,560

CGOV46T JHOS-2 gain chr13 chr13 99,193,549- 99,465,513- STK24 DOCK9 5 6 48232-48239

99,193,770 99,465,747

CGOV46T JHOS-2 gain chr14 chr14 44,132,092- 55,126,501- NA SAMD4A 5 2 49086-49647

44,132,318 55,126,708

CGOV46T JHOS-2 gain chr14 chr14 75,024,680- 75,119,277- LTBP2 NA 6 8 50140-50144

75,024,835 75,119,470

CGOV46T JHOS-2 gain chr14 chr14 81 ,782,060- 81,820,918- STON2 STON2.1 6 2 50293-50296

81 ,782,235 81,821,116

CGOV46T JHOS-2 gain chr14 chr14 100,163,952- 100,209,427- CYP46A1 NA 16 16 50612-50615

100,164,370 100,209,729

CGOV46T JHOS-2 gain chr15 chr15 75,133,404- 75,202,040- ULK3, MIR6882, FAM219B 12 12 51726-51729

75,133,668 75,202,247 SCAMP2

CGOV46T JHOS-2 inversion / chr15 chr22 75,201,111- 45,657,390- FAM219B NA 7 24 51729-59897 translocation 75,201,407 45,657,582

CGOV46T JHOS-2 inversion / chr1 chr15 180,485,111- 26,163,338- NA LOCI 00128714 8 8 5204-51019 translocation 180,485,312 26,163,514

CGOV46T JHOS-2 gain chr16 chr16 24,252,626- 24,262,904- NA CACNG3 5 6 52293-52295

24,252,798 24,263,146

CGOV46T JHOS-2 gain chr16 chr16 76,765,797- 78,417,680- NA WWOX 23 22 53065-53101

76,766,011 78,417,950

CGOV46T JHOS-2 gain chr16 chr16 83,826,384- 84,137,548- CDH13, MBTPS1 13 22 53125-53171

83,826,654 84,137,813 LOC102724163 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV46T JHOS-2 loss chr19 chr19 39,859,558- 49,651,239- SAMD4B PPFIA3, HRC 21 12 56660-56737

39,859,812 49,651,559

CGOV46T JHOS-2 gain chr20 chr20 15,803,244- 15,821,414- MACROD2 MACROD2.1 11 24 57298-57302

15,803,453 15,821,695

CGOV46T JHOS-2 gain chr20 chr20 37,164,020- 37,175,758- RALCAPB RALCAPB.1 26 28 57671-57672

37,164,247 37,176,038

CGOV46T JHOS-2 gain chr21 chr21 33,059,870- 35,845,659- SCAF4 KCNE1 12 28 59229-59335

33,060,155 35,845,920

CGOV46T JHOS-2 gain chr1 chr1 209,661,199- 209,679,889- NA NA 10 8 6011-6012

209,661,490 209,680,111

CGOV46T JHOS-2 translocation chr1 chr10 221,508,874- 91,793,822- C1orf140 NA 11 10 6057-38182

221,509,089 91,794,019

CGOV46T JHOS-2 gain chr2 chr2 18,696,531- 18,735,573- NA RDH14, NT5C1 B- 9 14 7008-7009

18,696,800 18,735,743 RDH14

CGOV46T JHOS-2 gain chr2 chr2 39,719,906- 39,823,510- LOC728730 LOC728730.1 8 10 7480-7487

39,720,178 39,823,779

CGOV46T JHOS-2 gain chr2 chr2 85,569,398- 85,581,825- RETSAT RETSAT.1 12 12 8521-8522

85,569,717 85,582,149

CGOV46T JHOS-2 inversion / chr2 chr5 97,461,241- 133,144,553- CNNM4, NA 12 8 8691-25037 translocation 97,461,488 133,144,826 MIR3127

CGOV46T JHOS-2 gain chr2 chr2 151,884,725- 235,359,938- NA NA 13 26 9622-13113

151,885,093 235,360,293

CGOV47T JHOS-4 inversion / chr3 chr21 175,243,695- 19,140,059- NAALADL2 NA 12 4 1061-4784 translocation 175,243,909 19,140,329

CGOV47T JHOS-4 translocation chr3 chr7 187,264,647- 139,826,562- NA KDM7A 27 12 1083-2028

187,265,051 139,826,885

CGOV47T JHOS-4 translocation chr4 chr12 18,062,446- 82,537,170- NA NA 10 2 1132-3064

18,062,644 82,537,493

CGOV47T JHOS-4 loss chr4 chr4 23,489,985- 37,608,512- NA RELL1 11 4 1136-1149

23,490,291 37,609,031

CGOV47T JHOS-4 inversion chr4 chr4 35,766,900- 190,601 ,002- NA NA 26 10 1145-1294

35,767,337 190,601 ,429

CGOV47T JHOS-4 loss chr4 chr4 37,232,281- 176,478,695- NA NA 7 4 1148-1273

37,232,936 176,478,944

CGOV47T JHOS-4 gain chr4 chr4 87,798,816- 87,828,587- C4orf36 NA 7 2 1225-1226

87,799,068 87,828,942

CGOV47T JHOS-4 gain chr4 chr4 108,723,931- 108,764,468- NA SGMS2 20 18 1240-1241

108,724,237 108,764,902

CGOV47T JHOS-4 inversion chr4 chr4 172,015,860- 176,934,525- NA NA 19 4 1271-1275

172,016,095 176,934,842

CGOV47T JHOS-4 translocation chr1 chr2 72,286,239- 125,390,884- NEGR1, NEGR1- CNTNAP5 17 8 132-662

72,286,557 125,391 ,219 IT1

CGOV47T JHOS-4 inversion chr5 chr5 45,060,442- 45,287,273- NA HCN1 11 12 1359-1360

45,060,952 45,287,602 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV47T JHOS-4 inversion / chrS chr11 65,409,721- 18,178,478- NA NA 12 4 1380-2681 translocation 65,410,020 18,178,715

CGOV47T JHOS-4 inversion / chr5 chr9 73,508,337- 14,354,167- NA NFIB 18 14 1384-2302 translocation 73,508,962 14,354,408

CGOV47T JHOS-4 gain chr1 chr1 85,136,429- 85,717,868- SSX2IP C1orfS2 9 4 141-143

85,136,849 85,718,283

CGOV47T JHOS-4 inversion / chr5 chrX 171,015,773- 58,067,810- NA NA 16 18 1449-4963 translocation 171,016,190 58,068,384

CGOV47T JHOS-4 gain chr6 chr6 2,396,599- 2,412,181- GMDS-AS1 GMDS-AS1.1 16 12 1516-1517

2,397,122 2,412,616

CGOV47T JHOS-4 inversion / chr6 chrX 8,342,616- 74,158,788- NA NA 14 10 1531-4977 translocation 8,342,896 74,159,057

CGOV47T JHOS-4 loss chr6 chr6 64,377,615- 99,865,257- PHF3 PNISR 8 2 1659-1693

64,377,942 99,865,551

CGOV47T JHOS-4 gain chr6 chr6 76,681,281- 76,708,063- IMPG1 IMPG1.1 21 28 1677-1678

76,681,806 76,708,561

CGOV47T JHOS-4 inversion / chr6 chr17 79,399,732- 9,871,636- NA GAS7 14 6 1680-3921 translocation 79,400,081 9,872,041

CGOV47T JHOS-4 inversion / chr6 chr17 79,400,925- 9,880,414- NA GAS7 14 6 1680-3922 translocation 79,401,364 9,880,780

CGOV47T JHOS-4 translocation chr6 chr1 S 87,862,605- 35,119,855- ZNF292 NA 12 8 1687-3687

87,862,990 35,120,219

CGOV47T JHOS-4 translocation chr6 chr13 120,992,911- 84,778,978- NA LINC00333 27 18 1709-3389

120,993,335 84,779,400

CGOV47T JHOS-4 inversion chr6 chr6 130,788,188- 151,538,191- NA LOC102723831 16 10 1712-1725

130,788,670 151,538,644

CGOV47T JHOS-4 translocation chr6 chr10 145,529,685- 86,752,722- NA NA 21 14 1721-2595

145,529,985 86,753,023

CGOV47T JHOS-4 inversion chr6 chr6 157,543,672- 157,691 ,838- NA NA 8 6 1730-1732

157,543,935 157,692,111

CGOV47T JHOS-4 gain chr6 chr6 157,609,970- 157,700,567- NA NA 12 14 1731-1733

157,610,392 157,700,824

CGOV47T JHOS-4 inversion / chr7 chr8 17,518,412- 118,800,692- LOC101927630 NA 10 6 1753-2242 translocation 17,518,665 118,801 ,024

CGOV47T JHOS-4 translocation chr7 chr8 18,326,868- 125,776,838- HDAC9 NA 18 16 1754-2264

18,327,675 125,777,813

CGOV47T JHOS-4 gain chr7 chr7 18,685,840- 18,790,259- HDAC9 HDAC9.1 29 18 1755-1756

18,686,214 18,790,861

CGOV47T JHOS-4 inversion chr7 chr7 23,247,869- 138,921 ,737- NA UBN2 64 32 1759-2024

23,248,332 138,922,207

CGOV47T JHOS-4 inversion chr7 chr7 25,594,947- 139,832,845- NA KDM7A 31 20 1766-2029

25,595,310 139,833,602

CGOV47T JHOS-4 inversion / chr1 chr6 117,637,264- 134,550,452- TTF2. MIR942 SGK1 5 5 184-1715 translocation 117,637,491 134,550,581

CGOV47T JHOS-4 inversion chr7 chr7 78,342,745- 78,564,163- MAGI2 MAGI2.1 31 28 1978-1982

78,343,221 78,564,624

CGOV47T JHOS-4 inversion chr7 chr7 78,559,729- 78,642,662- MAGI2 MAGI2.1 35 30 1981-1983

78,560,108 78,643,169

CGOV47T JHOS-4 gain chr7 chr7 111,014,234- 111,067,207- IMMP2L IMMP2L1 13 4 2009-2010

111,014,653 111,067,627 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV47T JHOS-4 inversion chr8 chr8 26,299,990- 143,856,214- NA LYNX1 21 16 2127-2290

26,300,557 143,856,551

CGOV47T JHOS-4 translocation chr8 chr10 58,160,591- 69,594,841- NA DNAJC12 13 4 2160-2562

58,161,052 69,595,233

CGOV47T JHOS-4 gain chr8 chr8 67,832,996- 67,845,658- MCMDC2, NA 13 14 2171-2172

67,833,503 67,846,002 SNHG6,

SNORD87

CGOV47T JHOS-4 gain chr8 chr8 94,910,715- 94,937,514- NA PDP1 24 8 2210-2211

94,911,246 94,938,033

CGOV47T JHOS-4 loss chr8 chr8 104,492,071- 105,247,549- NA RIMS2 10 2 2221-2223

104,492,370 105,247,867

CGOV47T JHOS-4 gain chr8 chr8 113,333,803- 136,650,711- CSMD3 KHDRBS3 6 16 2227-2287

113,334,023 136,651 ,252

CGOV47T JHOS-4 translocation chr9 chr13 74,357,023- 115,080,045- TMEM2 CHAMP1 13 8 2394-3401

74,357,553 115,080,392

CGOV47T JHOS-4 loss chr10 chr10 77,463,437- 78,040,973- C10orf11 C10orf11.1 41 24 2574-2575

77,463,895 78,041,500

CGOV47T JHOS-4 loss chr10 chr10 83,901,377- 85,290,610- NRG3 NA 21 24 2591-2593

83,901,823 85,291,083

CGOV47T JHOS-4 loss chr10 chr10 120,344,302- 126,472,017- NA METTL10 11 10 2632-2636

120,344,606 126,472,386

CGOV47T JHOS-4 translocation chr10 chr13 127,574,426- 20,371,108- DHX32 NA 123 32 2643-3174

127,575,281 20,371,568

CGOV47T JHOS-4 gain chr11 chr11 76,474,802- 102,808,756- NA MMP13 23 10 2809-2893

76,475,336 102,809,253

CGOV47T JHOS-4 translocation chr1 chr7 151,023,285- 105,516,528- BNIPL, C1orf56, ATXN7L1 12 6 285-2004

151,023,577 105,516,895 CDC42SE1

CGOV47T JHOS-4 translocation chr1 chr14 152,129,099- 80,866,346- RPTN DI02-AS1 9 12 287-3491

152,129,532 80,866,677

CGOV47T JHOS-4 inversion / chr1 chr11 156,469,903- 32,334,069- MEF2D NA 9 8 292-2695 translocation 156,470,266 32,334,446

CGOV47T JHOS-4 inversion / chr12 chrX 48,323,476- 78,112,989- NA NA 15 10 3035-4984 translocation 48,323,847 78,113,357

CGOV47T JHOS-4 gain chr1 chr1 167,296,624- 167,313,237- POU2F1 POU2F1.1 13 4 306-307

167,297,252 167,313,718

CGOV47T JHOS-4 gain chr1 chr1 169,109,719- 169,122,435- NME7 NME7.1 12 6 313-314

169,110,106 169,122,774

CGOV47T JHOS-4 inversion chr13 chr13 23,315,580- 51,570,828- NA GUCY1 B2 11 10 3189-3307

23,315,923 51,571,223

CGOV47T JHOS-4 gain chr13 chr13 34,865,052- 62,462,287- NA NA 10 4 3236-3344

34,865,334 62,462,557

CGOV47T JHOS-4 inversion chr13 chr13 45,090,704- 66,026,467- TSC22D1 NA 9 2 3285-3364

45,090,943 66,026,805

CGOV47T JHOS-4 inversion chr14 chr14 36,624,131- 42,019,133- LINC00609, NA 42 34 3454-3468

36,624,581 42,019,611 PTCSC3

CGOV47T JHOS-4 inversion chr14 chr14 42,022,267- 42,297,528- NA LRFN5 21 12 3469-3470

42,022,690 42,297,915

CGOV47T JHOS-4 inversion / chr1 chr17 202,822,081- 75,767,188- NA NA 15 32 353-4034 translocation 202,822,323 75,767,530

CGOV47T JHOS-4 inversion / chr1 chr3 208,455,391- 14,670,108- NA NA 18 14 364-843 translocation 208,455,775 14,670,689

CGOV47T JHOS-4 gain chr15 chr15 29,605,973- 29,616,662- FAM189A1 FAM189A1.1 6 6 3670-3671

29,606,380 29,616,963

CGOV47T JHOS-4 gain chr15 chr15 59,349,649- 59,365,015- RNF111 RNF111.1. 14 28 3720-3721

59,349,946 59,365,398 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV47T JHOS-4 inversion / chr16 chr22 23,030,224- 23,423,525- NA GNAZ, RSPH14 13 6 3796-4858 translocation 23,030,657 23,423,793

CGOV47T JHOS-4 gain chr16 chr16 72,688,642- 72,710,871- LINC01572 NA 23 16 3872-3873

72,688,996 72,711,299

CGOV47T JHOS-4 gain chr16 chr16 79,182,335- 79,192,846- WWOX WWOX.1 15 4 3884-3885

79,182,678 79,193,353

CGOV47T JHOS-4 gain chr17 chr17 29,632,752- 29,661,366- NF1 , EVI2B NF1 , EVI2B.1 25 8 3979-3980

29,633,290 29,661,821

CGOV47T JHOS-4 gain chr18 chr18 56,226,716- 56,356,388- ALPK2 MALT1 15 10 4143-4144

56,227,155 56,356,789

CGOV47T JHOS-4 gain chr19 chr19 5,006,830- 5,041,471- KDM4B KDM4B.1 19 12 4206-4207

5,007,288 5,041,943

CGOV47T JHOS-4 inversion chr19 chr19 36,059,743- 40.493.508- NA NA 23 2 4367-4383

36,060,063 40,494,013

CGOV47T JHOS-4 translocation chr19 chr22 52,845,321- 36,830,845- ZNF610 NA 7 8 4436-4886

52,845,623 36,831,134

CGOV47T JHOS-4 gain chr20 chr20 4,715,382- 37,383,559- PRNT ACTRS 14 8 4533-4649

4,715,645 37,383,899

CGOV47T JHOS-4 gain chr20 chr20 46,395,662- 46,411,498- SULF2 SULF2.1 10 4 4657-4658

46,396,075 46,411,888

CGOV47T JHOS-4 gain chr21 chr21 38,975,089- 39,155,339- NA KCNJ6 8 14 4800-4801

38,975,355 39,155,713

CGOV47T JHOS-4 gain chr2 chr2 24,122,596- 24.346.508- ATAD2B FAM228B, PFN4 12 8 481-483

24,122,799 24,346,922

CGOV47T JHOS-4 inversion / chr2 chr12 73,037,315- 48,863,705- EXOC6B ANP32D 9 14 525-3036 translocation 73,037,601 48,864,039

CGOV47T JHOS-4 gain chr1 chr1 17,835,312- 17,866,334- NA ARHGEF10L 12 8 64-65

17,835,630 17,866,785

CGOV47T JHOS-4 gain chr2 chr2 111,914,978- 111,936,721- BCL2L11 NA 9 12 656-657

111,915,387 111,937,047

CGOV47T JHOS-4 inversion chr2 chr2 177,373,330- 177,386,206- NA NA 19 18 739-740

177,373,692 177,386,650

CGOV47T JHOS-4 inversion / chr2 chr12 192,921,708- 117,690,793- TMEFF2 NOS1 13 4 752-3094 translocation 192,921,962 117,691 ,083

CGOV47T JHOS-4 translocation chr2 chr12 199,416,995- 133,217,352- NA POLE 22 6 758-3140

199,417,550 133,217,667

CGOV47T JHOS-4 gain chr2 chr2 201,815,662- 201,829,595- ORC2 ORC2.1 6 20 759-760

201,815,963 201,829,967

CGOV47T JHOS-4 gain chr2 chr2 242,333,090- 242,355,166- FARP2 FARP2.1 11 8 783-784

242,333,424 242,355,485

CGOV47T JHOS-4 gain chr3 chr3 8,980,303- 9,019,275- RAD18 SRGAP3 32 12 818-819

8,980,743 9,019,897

CGOV47T JHOS-4 translocation chr3 chr20 11 ,964,534- 14,757,036- NA MACROD2 23 18 834-4561

11 ,964,933 14,757,447

CGOV47T JHOS-4 translocation chr1 chr3 29,802,472- 31,516,804- NA NA 13 10 83-855

29,802,844 31,517,134

CGOV47T JHOS-4 inversion / chr3 chr17 14,809,672- 56,419,169- C3orf20 BZRAP1-AS1 , 6 10 844-4018 translocation 14,810,011 56,419,517 SUPT4H1

CGOV47T JHOS-4 loss chr3 chr3 34,855,364- 36,214,141- NA NA 11 2 863-864

34,855,892 36,214,632 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV47T JHOS-4 gain chr3 chr3 78,746,344- 78,766,228- R0B01 R0B01.1 20 10 926-927

78,746,748 78,766,595

CGOV47T JHOS-4 inversion chr3 chr3 79,371,685- 115,189,624- R0B01 NA 10 30 928-964

79,371,939 115,190,012

CGOV47T JHOS-4 translocation chr3 chr13 131,113,473- 80,507,074- NA NA 27 23 991-3384

131,113,705 80,507,888

CGOV47T JHOS-4 inversion chr3 chr3 133,109,910- 186,445,907- TMEM108 KNG1 10 6 996-1080

133,110,192 186,446,240

CGOV4T DOV-13 translocation chr1 chr20 28,678,197- 46,316,091- NA SULF2 12 6 109-24774

28,678,486 46,316,357

CGOV4T DOV-13 translocation chr1 chr22 28,727,433- 39,653,765- PHACTR4 NA 12 14 111-25461

28,727,636 39,654,033

CGOV4T DOV-13 translocation chr7 chr20 36,432,058- 34,417,465- ANLN, PHF20 12 6 11483-24662

36,432,292 34,417,732 KIAA089S

CGOV4T DOV-13 inversion / chr7 chr9 39,885,021- 26,365,421- NA NA 13 14 11539-14373 translocation 39,885,225 26,365,643

CGOV4T DOV-13 translocation chr7 chr9 39,956,128- 95,838,092- NA SUSD3 7 10 11541-14780

39,956,342 95,838,445

CGOV4T DOV-13 inversion chr7 chr7 39,978,865- 40,132,437- NA CDK13 12 22 11543-11546

39,979,040 40,132,685

CGOV4T DOV-13 inversion / chr7 chr9 40,101,394- 22,418,244- CDK13 NA 6 14 11544-14365 translocation 40,101,564 22,418,460

CGOV4T DOV-13 translocation chr7 chr21 40,130,975- 27,350,340- CDK13 APP 6 18 11546-25061

40,131,299 27,350,634

CGOV4T DOV-13 loss chr9 chr9 13,266,156- 34,687,285- MPDZ CCL19 5 2 14350-14400

13,266,344 34,687,445

CGOV4T DOV-13 translocation chr9 chr21 21 ,881,939- 27,400,156- NA APP 5 26 14363-25063

21 ,882,137 27,400,361

CGOV4T DOV-13 loss chr9 chr9 21 ,920,076- 22,468,945- NA NA 19 18 14364-14367

21 ,920,364 22,469,139

CGOV4T DOV-13 loss chr9 chr9 22,428,497- 112,355,115- NA NA 9 18 14366-14942

22,428,641 112,355,325

CGOV4T DOV-13 inversion / chr9 chr22 34,665,643- 45,371,535- IL11 RA, CCL27 PHF21 B 16 16 14399-25482 translocation 34,665,961 45,371,782

CGOV4T DOV-13 inversion / chr9 chr21 95,835,325- 27,346,569- SUSD3 APP 7 4 14779-25060 translocation 95,835,487 27,346,753

CGOV4T DOV-13 gain chr9 chr9 119,523,149- 119,536,659- ASTN2 ASTN2.1 16 14 15017-15018

119,523,354 119,536,921

CGOV4T DOV-13 inversion / chr11 chr13 119,050,155- 27,765,470- NLRX1 NA 13 14 17831-19408 translocation 119,050,298 27,765,714

CGOV4T DOV-13 inversion / chr12 chr19 51 ,587,644- 48,255,473- POU6F1 GLTSCR2, 11 4 18454-24184 translocation 51 ,587,829 48,255,748 SNORD23

CGOV4T DOV-13 translocation chr17 chr21 51 ,015,262- 20,966,170- NA NA 9 14 22588-25010

51 ,015,592 20,966,330

CGOV4T DOV-13 gain chr18 chr18 11 ,150,413- 11,164,154- PIEZ02 NA 8 2 23073-23074

11 ,150,654 11,164,400

CGOV4T DOV-13 loss chr19 chr19 40,437,244- 45,669,692- FCGBP TRAPPC6A 8 14 24134-24174

40,437,464 45,669,960

CGOV4T DOV-13 gain chr20 chr20 14,408,482- 14,615,388- MACROD2 MACROD2.1 5 6 24454-24458

14,408,699 14,615,654 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV4T DOV-13 gain chrX chrX 127,905,405- 128,004,600- NA NA 19 30 26575-26577

127,905,684 128,004,869

CCOV4T DOV-13 translocation chr2 chr3 60,744,879- 14,544,769- BCL11A GRIP2 15 20 2837-4407

60,745,333 14,544,983

CCOV4T DOV-13 translocation chr1 chr22 79,657,606- 38,552,221- NA PLA2G6 11 10 621-25451

79,657,845 38,552,358

CCOV4T DOV-13 gain chr5 chr5 83,756,688- 83,787,170- NA NA 13 16 8597-8599

83,756,914 83,787,416

CCOV4T DOV-13 translocation chr1 chr12 109,842,465- 51,612,576- MYBPHL POU6F1 18 18 981-18455

109,842,710 51,612,860

CCOV5T EFO-21 translocation chr6 chr10 93,552,829- 124,854,666- NA NA 16 18 10204-13311

93,553,095 124,855,022

CCOV5T EFO-21 gain chr6 chr6 138,698,610- 138,741,345- NA NHSL1 16 6 10406-10407

138,698,914 138,741,647

CCOV5T EFO-21 inversion chr7 chr7 19,254,128- 47,062,580- NA NA 32 26 10596-10768

19,254,430 47,062,872

CCOV5T EFO-21 translocation chr7 chr21 110,286,295- 45,626,507- NA NA 10 6 11271-19614

110,286,546 45,626,694

CCOV5T EFO-21 inversion / chr7 chr12 134,957,636- 13,474,610- NA NA 10 8 11415-14755 translocation 134,957,862 13,474,857

CCOV5T EFO-21 gain chr7 chr7 158,358,453- 158,506,475- PTPRN2 NA 12 22 11670-11676

158,358,711 158,506,740

CCOV5T EFO-21 gain chr8 chr8 12,756,955- 12,804,059- NA KIAA1456 6 2 11682-11683

12,757,184 12,804,314

CCOV5T EFO-21 loss chr8 chr8 60,252,922- 72,795,793- NA MSC-AS1 17 18 11882-11887

60,253,197 72,796,124

CCOV5T EFO-21 inversion chr8 chr8 78,147,802- 83,682,208- NA NA 13 14 11908-11928

78,148,030 83,682,413

CCOV5T EFO-21 gain chr8 chr8 97,171,225- 101,937,389- CDF6 YWHAZ 11 10 11988-12101

97,171,431 101,937,730

CCOV5T EFO-21 gain chr9 chr9 101,409,199- 101,424,775- CABBR2 GABBR2.1 10 18 12745-12746

101,409,413 101,425,065

CCOV5T EFO-21 gain chr9 chr9 132,062,209- 132,096,164- NA LINC01503 13 16 12807-12809

132,062,448 132,096,385

CCOV5T EFO-21 inversion/ chr10 chr18 43,984,208- 1,171,073- NA NA 10 12 13016-17990 translocation 43,984,543 1,171,297

CCOV5T EFO-21 gain chr10 chr10 65,288,472- 65,306,460- REEP3 REEP3.1 10 10 13120-13122

65,288,771 65,306,749

CCOV5T EFO-21 translocation chr11 chr17 37,429,069- 10,138,516- NA NA 28 4 13405-17361

37,429,225 10,138,928

CCOV5T EFO-21 translocation chr11 chr14 127,006,675- 41,091,979- NA NA 13 12 14614-15781

127,007,216 41,092,505

CCOV5T EFO-21 translocation chr1 chr14 198,061,878- 31,186,066- NA SCFD1 11 10 1467-15737

198,062,130 31,186,332

CCOV5T EFO-21 translocation chr12 chr16 26,729,203- 10,684,945- ITPR2 NA 35 40 14807-16695

26,729,465 10,685,274

CCOV5T EFO-21 inversion/ chr1 chr6 207,579,508- 57,493,991- NA PRIM2 6 4 1493-9975 translocation 207,579,636 57,494,232

CCOV5T EFO-21 translocation chr1 chr2 213,163,710- 233,173,636- VASH2, DIS3L2 28 28 1512-3471

213,163,990 233,173,923 ANCEL2 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOVST EFO-21 gain chr1 chr1 218,592,766- 218,604,919- TCFB2 TGFB2.1 12 18 1561-1562

218,593,093 218,605,220

CGOVST EFO-21 gain chr13 chr13 99,338,656- 99,494,195- SLC15A1 DOCK9 23 30 15646-15649

99,339,038 99,494,447

CGOVST EFO-21 translocation chr13 chrX 108,348,454- 54,535,617- FAM155A NA 9 2 15672-19866

108,348,693 54,535,836

CGOVST EFO-21 gain chr14 chr14 37,795,947- 37,838,003- MIPOL1 MIPOL1.1 9 6 15771-15772

37,796,182 37,838,219

CGOVST EFO-21 gain chr15 chr15 55,743,213- 55,822,646- DYX1C1- NA 6 2 16401-16402

55,743,470 55,822,962 CCPG1 , DYX1C1

CGOVST EFO-21 translocation chr15 chr19 72,606,118- 56,594,761- CELF6 LOC101928886, 28 26 16487-18833

72,606,474 56,595,041 ZNF787

CGOVST EFO-21 translocation chr15 chr19 81 ,234,404- 38,995,045- CEMIP RYR1 11 4 16553-18695

81 ,234,578 38,995,351

CGOVST EFO-21 gain chr16 chr16 3,211 ,557- 3,245,075- NA NA 23 26 16665-16667

3,211 ,958 3,245,390

CGOVST EFO-21 gain chr1 chr1 234,687,063- 234,765,763- NA LINC00184 5 2 1723-1724

234,687,282 234,765,993

CGOVST EFO-21 gain chr17 chr17 7,613,791- 7,724,660- EFNB3 DNAH2 26 34 17344-17347

7,614,210 7,725,040

CGOVST EFO-21 loss chr17 chr17 39,541,715- 43,063,763- KRT34 NA 6 2 17577-17611

39,542,033 43,063,993

CGOVST EFO-21 gain chr18 chr18 3,252,581- 3,309,957- MYL12A, NA 24 12 18002-18003

3,252,838 3,310,202 LOC104968399

CGOVST EFO-21 gain chr19 chr19 387,869- 504,532- NA MADCAM1 , 6 2 18228-18229

388,063 504,755 TPGS1

CGOV5T EFO-21 gain chr2 chr2 19,098,668- 50,337,135- NA NRXN1 12 8 2010-2239

19,098,954 50,337,374 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV5T EFO-21 gain chr2 chr2 23,843,531- 23,885,928- KLHL29 KLHL29.1 9 10 2019-2020

23,843,960 23,886,210

CCOV5T EFO-21 inversion chr2 chr2 25,941,624- 35,156,227- NA NA 16 16 2025-2081

25,941,995 35,156,530

CCOV5T EFO-21 translocation chr2 chr7 26,117,146- 56,317,845- NA NA 11 16 2026-10817

26,117,378 56,318,109

CCOV5T EFO-21 gain chrX chrX 135,819,055- 135,829,136- ARHCEF6 ARHGEF6.1 13 12 20299-20300

135,819,339 135,829,417

CCOV5T EFO-21 inversion / chr1 chrX 29,785,621- 125,037,646- NA NA 9 20 203-20142 translocation 29,785,869 125,037,838

CCOV5T EFO-21 inversion chr2 chr2 29,115,085- 30,630,991- WDR43 NA 6 10 2052-2061

29,115,433 30,631,456

CCOV5T EFO-21 gain chr2 chr2 46,159,517- 46,181,866- PRKCE PRKCE.1 8 6 2151-2152

46,159,765 46,182,098

CCOV5T EFO-21 gain chr2 chr2 46,294,084- 100,351 ,380- PRKCE AFF3 9 16 2155-2630

46,294,406 100,351 ,664

CCOV5T EFO-21 gain chr2 chr2 49,949,211- 113,058,714- NA ZC3H6 10 12 2230-2706

49,949,505 113,059,043

CCOV5T EFO-21 inversion chr2 chr2 52,966,767- 83,900,645- NA NA 18 18 2283-2476

52,967,112 83,900,923

CCOV5T EFO-21 translocation chr1 chr7 31 ,196,611- 11,751,581- MATN1-AS1 , THSD7A 17 28 235-10563

31 ,196,873 11,751,845 MATN1

CCOV5T EFO-21 translocation chr1 chr19 31 ,214,815- 36,078,276- LAPTM5, NA 9 12 236-18653

31 ,215,100 36,078,547 MIR4420

CCOV5T EFO-21 inversion chr1 chr1 31 ,220,792- 31,239,464- LAPTM5 NA 20 6 237-238

31 ,221,034 31,239,846

CCOV5T EFO-21 translocation chr2 chr10 58,536,736- 104,593,708- NA CYP17A1 9 18 2392-13270

58,537,007 104,594,045

CCOV5T EFO-21 inversion / chr2 chr7 66,698,194- 115,710,821- MEIS1 NA 6 26 2422-11290 translocation 66,698,485 115,711 ,050

CCOV5T EFO-21 inversion / chr2 chrX 78,897,475- 117,355,682- NA NA 16 14 2460-20126 translocation 78,897,743 117,355,954

CCOV5T EFO-21 inversion / chr2 chr9 79,053,748- 137,173,071- NA NA 13 4 2461-12821 translocation 79,053,977 137,173,358

CCOV5T EFO-21 inversion chr2 chr2 84,930,323- 96,198,993- DNAH6 NA 8 18 2480-2570

84,930,553 96,199,205

CCOV5T EFO-21 loss chr2 chr2 113,654,516- 119,229,430- NA NA 11 16 2713-2781

113,654,766 119,229,697

CCOV5T EFO-21 gain chr2 chr2 113,929,052- 146,180,801- PSD4 NA 10 18 2716-3013

113,929,346 146,181 ,058

CCOV5T EFO-21 loss chr2 chr2 116,622,578- 117,153,400- NA NA 10 22 2745-2746

116,622,854 117,153,594

CCOV5T EFO-21 inversion / chr2 chr19 151,316,745- 5,623,538- NA SAFB, SAFB2 23 16 3028-18241 translocation 151,317,050 5,623,876

CCOV5T EFO-21 translocation chr2 chr18 170,201,256- 44,882,332- LRP2 NA 13 8 3161-18183

170,201,660 44,882,663

CCOV5T EFO-21 translocation chr2 chr18 170,246,962- 44,899,433- NA NA 19 10 3165-18184

170,247,227 44,899,822

CCOV5T EFO-21 translocation chr2 chrX 189,368,762- 99,495,272- CULP1 NA 13 16 3257-19997

189,369,037 99,495,507 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV5T EFO-21 inversion / chr3 chr20 133,055,293- 21,765,610- TMEM108 NA 8 18 3857-18902 translocation 133,055,528 21,765,831

CGOV5T EFO-21 loss chr3 chr3 161,473,735- 181,709,310- NA LINC01206 14 8 4453-5031

161,474,101 181,709,639

CGOV5T EFO-21 gain chr3 chr3 165,278,873- 188,757,383- NA NA 17 26 4482-5448

165,279,134 188,757,771

CGOV5T EFO-21 translocation chr1 chr3 81 ,930,795- 123,592,210- NA MYLK 7 2 455-3794

81 ,931,144 123,592,400

CGOV5T EFO-21 gain chr3 chr3 168,788,859- 168,813,274- NA MECOM 25 34 4583-4584

168,789,177 168,813,551

CGOV5T EFO-21 inversion / chr1 chr7 90, 462, 363- 70,075,947- ZNF326, AUTS2 20 18 500-10982 translocation gO, 462, 658 70,076,203 GEMIN8P4

CGOV5T EFO-21 gain chr4 chr4 6,466,185- 6,484,566- PPP2R2C PPP2R2C1 27 4 6437-6438

6,466,497 6,484,867

CGOV5T EFO-21 gain chr4 chr4 19,543,243- 19,853,033- NA NA 7 2 6460-6462

19,543,469 19,853,261

CGOV5T EFO-21 gain chr4 chr4 47,642,034- 47,694,644- CORIN CORIN.1 8 20 6545-6548

47,642,268 47,694,903

CGOV5T EFO-21 translocation chr4 chr10 55,917,800- 85,912,656- NA GHITM 5 6 6586-13196

55,917,974 85,912,822

CGOV5T EFO-21 inversion / chr5 chrX 32,159,697- 73,048,484- GOLPH3 TSIX, XIST 13 18 7579-19947 translocation 32,159,935 73,048,739

CGOV5T EFO-21 inversion / chr5 chr13 32,387,547- 46,960,269- ZFR KIAA0226L 7 16 7583-15537 translocation 32,387,787 46,960,474

CGOV5T EFO-21 inversion / chr5 chr9 45,454,189- 112,877,621- HCN1 PALM2-AKAP2, 11 14 7658-12761 translocation 45,454,397 112,877,900 AKAP2

CGOV5T EFO-21 inversion chr5 chr5 45,990,056- 78,863,246- NA NA 15 12 7665-8027

45,990,337 78,863,480

CGOV5T EFO-21 loss chr5 chr5 56,119,831- 93,445,148- MAP3K1 FAM172A 20 26 7801-8052

56,120,110 93,445,434

CGOV5T EFO-21 gain chr5 chr5 111,724,958- 111,847,987- EPB41 L4A NA 5 6 8241-8246

111,725,233 111,848,332

CGOV5T EFO-21 translocation chr1 chr2 116,164,290- 241,667,838- NA KIF1A 12 26 826-3480

116,164,909 241,668,137

CGOV5T EFO-21 gain chr5 chr5 125,779,285- 125,894,803- GRAMD3 ALDH7A1 13 8 8382-8384

125,779,457 125,895,022

CGOV5T EFO-21 gain chr5 chr5 139,091,202- 139,710,364- NA HBEGF 23 32 8522-8546

139,091,540 139,710,670

CGOV5T EFO-21 gain chr5 chr5 176,982,476- 177,035,159- FAM193B B4GALT7 8 10 8863-8865

176,982,701 177,035,333

CGOV5T EFO-21 gain chr5 chr5 179,113,961- 179,132,851- NA CANX 17 4 8898-8899

179,114,151 179,133,113

CGOV5T EFO-21 inversion / chr6 chr12 28,694,095- 80,379,927- NA NA 23 12 9735-15230 translocation 28,694,359 80,380,247

CGOV5T EFO-21 translocation chr6 chr15 54,050,684- 98,442,096- MLIP NA 6 18 9935-16630

54,050,972 98,442,362

CGOV5T EFO-21 translocation chr6 chr15 54,054,576- 98,434,158- MLIP NA 7 16 9936-16629

54,054,900 98,434,356

CGOV6T EFO-27 gain chr3 chr3 58,024,492- 60,494,176- FLNB FHIT 9 2 1123-1133

58,024,795 60,494,498 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV6T EFO-27 gain chr4 chr4 23,175,761- 23,316,108- NA MIR548AJ2 9 14 1414-1415

23,176,057 23,316,347

CGOV6T EFO-27 translocation chr4 chr11 106,502,767- 130,692,004- ARHGEF38 NA 15 12 1542-4249

106,503,064 130,692,322

CGOV6T EFO-27 translocation chr4 chr11 106,512,813- 130,658,768- ARHGEF38 NA 13 14 1543-4248

106,512,999 130,658,933

CGOV6T EFO-27 gain chr6 chr6 46,418,912- 46,451,847- RCAN2 RCAN2.1 16 14 2195-2196

46,419,158 46,452,237

CGOV6T EFO-27 gain chr7 chr7 7,496,729- 7,521,166- COL28A1 COL28A1.1 16 16 2476-2477

7,497,004 7,521,407

CGOV6T EFO-27 gain chr7 chr7 110,538, 020- 110,557, 466- IMMP2L IMMP2L1 24 6 2794-2795

H O, 538, 307 HO, 557, 804

CGOV6T EFO-27 gain chr7 chr7 144,129,510- 144,172,997- NA TPK1 15 10 2879-2880

144,129,778 144,173,325

CGOV6T EFO-27 gain chr8 chr8 120,917,264- 121,176,797- DEPTOR COL14A1 6 6 3137-3138

120,917,488 121,177,084

CGOV6T EFO-27 gain chr10 chr10 56,445,974- 56,469,385- PCDH15 PCDH15.1 20 14 3807-3808

56,446,308 56,469,614

CGOV6T EFO-27 translocation chr10 chr13 127,574,439- 20,371,308- DHX32 NA 51 78 3917-4606

127,574,765 20,371,568

CGOV6T EFO-27 translocation chr11 chr17 37,429,052- 10,138,621- NA NA 13 6 4010-5570

37,429,233 10,138,909

CGOV6T EFO-27 gain chr2 chr2 47,563,300- 47,588,410- LOC101927043 NA 9 4 625-626

47,563,537 47,588,698

CGOV6T EFO-27 gain chr1 chr1 17,664,726- 18,061,650- PADI4 NA 16 16 69-73

17,664,967 18,061,948

CGOV6T EFO-27 gain chrX chrX 83,047,241- 83,064,558- NA NA 14 2 7042-7043

83,047,566 83,064,814

CGOV8T HEY loss chr7 chr7 11 ,284,368- 38,151,655- NA NA 6 6 17077-17246

11 ,284,568 38,151,852

CGOV8T HEY gain chr9 chr9 28,647,647- 28,661,618- LING02 LING02.1 8 10 24004-24005

28,647,882 28,661,834

CGOV8T HEY translocation chr10 chr13 127,574,443- 20,371,421- DHX32 NA 22 104 26613-30983

127,574,612 20,371,629

CGOV8T HEY loss chrX chrX 34,999,100- 54,838,507- NA MAGED2, 5 6 41573-41587

34,999,264 54,838,712 SNORA11

CGOV8T HEY inversion chr3 chr3 8,821 ,431- 8,860,344- NA NA 9 2 5565-5567

8,821 ,644 8,860,550

CGOV8T HEY gain chr3 chr3 106,466,956- 106,539,318- NA NA 6 6 6447-6449

106,467,162 106,539,528

CGOV92T JHOS-3 gain chr2 chr2 122,517,131- 122,658,478- TSN NA 8 17 1039-1040

122,517,421 122,658,682

CGOV92T JHOS-3 translocation chr2 chr15 172,855,414- 72,756,926- NA NA 10 16 1134-5109

172,855,680 72,757,177

CGOV92T JHOS-3 translocation chr2 chr8 183,996,956- 80,074,688- NUP35 NA 10 14 1141-2998

183,997,116 80,074,901

CGOV92T JHOS-3 gain chr2 chr2 206,519,631- 206,563,130- NA NRP2 11 14 1177-1178

206,519,823 206,563,386

CGOV92T JHOS-3 inversion / chr2 chr11 208,184,946- 133,966,023- NA JAM3 13 14 1180-4210 translocation 208,185,275 133,966,328 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV92T JHOS-3 gain chr2 chr2 237,021,379- 237,123,320- ACAP1 ASB18 14 4 1202-1204

237,021,738 237,123,584

CCOV92T JHOS-3 translocation chr1 chr12 19,342,130- 18,481,951- NA PIK3C2G 7 26 121-4252

19,342,367 18,482,303

CCOV92T JHOS-3 gain chr3 chr3 15,689,423- 15,699,739- BTD NA 13 8 1241-1242

15,689,779 15,700,065

CCOV92T JHOS-3 gain chr3 chr3 107,489,824- 107,657,575- BBX NA 19 24 1386-1387

107,490,158 107,657,993

CCOV92T JHOS-3 gain chr3 chr3 133,210,934- 133,222,232- NA NA 16 20 1445-1446

133,211,195 133,222,542

CCOV92T JHOS-3 gain chr3 chr3 152,721,271- 152,732,453- NA NA 13 20 1490-1491

152,721,541 152,732,730

CCOV92T JHOS-3 gain chr3 chr3 177,314,977- 177,477,163- LINC00578 NA 13 20 1542-1544

177,315,258 177,477,436

CCOV92T JHOS-3 gain chr3 chr3 178,119,696- 178,130,787- NA NA 32 26 1547-1549

178,120,040 178,131 ,139

CCOV92T JHOS-3 gain chr3 chr3 180,111,094- 180,140,248- NA NA 27 16 1555-1556

180,111,399 180,140,565

CCOV92T JHOS-3 gain chr4 chr4 4,599,863- 4,610,890- STX18-AS1 STX18-AS1.1 16 14 1652-1653

4,600,131 4,611,215

CCOV92T JHOS-3 gain chr1 chr1 40,147,207- 40,215,248- HPCAL4 PPIE 19 2 168-169

40,147,499 40,215,606

CCOV92T JHOS-3 inversion chr4 chr4 71 ,223,037- 71,599,449- SMR3A RUFY3 36 38 1769-1776

71 ,223,360 71,599,682

CCOV92T JHOS-3 gain chr4 chr4 87,584,084- 87,790,873- PTPN13 NA 13 24 1799-1800

87,584,332 87,791,244

CCOV92T JHOS-3 inversion chr4 chr4 143,200,835- 144,574,560- INPP4B FREM3 19 26 1830-1833

143,201,126 144,574,844

CCOV92T JHOS-3 gain chr4 chr4 144,555,202- 144,655,572- FREM3 NA 9 18 1832-1834

144,555,456 144,655,850

CCOV92T JHOS-3 loss chrS chrS 60,420,758- 71,778,212- NDUFAF2 ZNF366 15 4 1991-2000

60,421,053 71,778,520

CCOV92T JHOS-3 gain chrS chrS 71 ,036,646- 71,073,754- NA NA 15 14 1996-1997

71 ,036,931 71,074,052

CCOV92T JHOS-3 gain chrS chrS 141,178,955- 141,302,936- NA KIAA0141 23 16 2072-2073

141,179,342 141,303,303

CCOV92T JHOS-3 gain chrS chrS 150,742,307- 150,752,935- NA NA 19 14 2082-2083

150,742,510 150,753,256 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV92T JHOS-3 inversion / chr1 chr17 61 ,255,258- 61,455,467- LOC101926964 TANC2 60 44 213-5589 translocation 61 ,255,484 61,455,823

CGOV92T JHOS-3 gain chr6 chr6 4,044,809- 4,081,806- PRPF4B C6orf201 , 15 16 2156-2157

4,045,100 4,082,013 FAM217A

CGOV92T JHOS-3 inversion chr6 chr6 14,952,175- 20,288,572- NA NA 10 12 2175-2186

14,952,381 20,288,879

CGOV92T JHOS-3 translocation chr6 chr22 42,769,088- 30,759,015- NA CCDC157 12 24 2311-6507

42,769,361 30,759,433

CGOV92T JHOS-3 inversion chr6 chr6 42,772,138- 54,808,191- NA FAM83B 14 12 2312-2353

42,772,446 54,808,460

CGOV92T JHOS-3 gain chr1 chr1 73,108,512- 73,265,799- NA NA 14 16 232-233

73,108,880 73,266,108

CGOV92T JHOS-3 inversion chr6 chr6 67,081,037- 67,110,795- NA NA 15 16 2386-2387

67,081,247 67,111,092

CGOV92T JHOS-3 gain chr6 chr6 72,250,588- 72,326,094- NA NA 17 18 2393-2394

72,250,861 72,326,457

CGOV92T JHOS-3 gain chr6 chr6 93,840,850- 94,014,433- NA EPHA7 22 16 2404-2405

93,841,194 94,014,735

CGOV92T JHOS-3 gain chr6 chr6 110,905,555- 110,921 ,179- NA NA 20 18 2410-2411

110,905,849 110,921 ,428

CGOV92T JHOS-3 gain chr6 chr6 143,099,882- 143,136,909- HIVEP2 HIVEP2.1 20 18 2438-2439

143,100,152 143,137,239

CGOV92T JHOS-3 inversion / chr7 chr15 26,740,805- 65,922,581- SKAP2 SLC24A1 35 14 2494-5091 translocation 26,741,090 65,922,890

CGOV92T JHOS-3 translocation chr7 chr12 27,859,710- 26,313,038- TAX1 BP1 NA 11 16 2498-4268

27,860,072 26,313,296

CGOV92T JHOS-3 inversion chr7 chr7 65,676,342- 79,096,940- TPST1 MAGI2-AS3 8 14 2653-2698

65,676,640 79,097,121

CGOV92T JHOS-3 gain chr7 chr7 69,411,385- 69,429,778- AUTS2 AUTS2.1 9 14 2674-2675

69,411,701 69,430,159

CGOV92T JHOS-3 translocation chr7 chr14 133,248,933- 91,193,685- EXOC4 TTC7B 13 22 2771-4861

133,249,257 91,194,009

CGOV92T JHOS-3 inversion / chr1 chr11 100,327,453- 133,740,417- AGL NA 12 16 278-4209 translocation 100,327,716 133,740,699

CGOV92T JHOS-3 inversion / chr1 chr15 102,898,997- 78,728,842- NA IREB2 13 24 280-5150 translocation 102,899,290 78,729,187

CGOV92T JHOS-3 translocation chr7 chr21 155,523,296- 35,708,633- RBM33 NA 10 14 2862-6407

155,523,642 35,708,899

CGOV92T JHOS-3 gain chr1 chr1 110,622,403- 110,673,996- LINC01397 NA 14 6 288-289

110,622,663 110,674,292

CGOV92T JHOS-3 gain chr8 chr8 21 ,355,428- 21,369,578- NA NA 8 12 2891-2892

21 ,355,701 21,369,758

CGOV92T JHOS-3 loss chr8 chr8 41 ,678,659- 121,029,910- ANK1 DEPTOR 20 22 2924-3116

41 ,679,004 121,030,330

CGOV92T JHOS-3 gain chr8 chr8 48,643,294- 48,828,938- SPIDR PRKDC 8 12 2932-2934

48,643,561 48,829,119

CGOV92T JHOS-3 inversion / chr1 chr14 116,315,807- 51,231,019- CASQ2 NIN 21 36 293-4769 translocation 116,316,210 51,231,299

CGOV92T JHOS-3 translocation chr8 chr12 68,768,429- 122,375,253- NA WDR66 37 32 2969-4484

68,768,768 122,375,588 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV92T JHOS-3 inversion / chr8 chr11 115,870,940- 47,746,687- NA FNBP4 35 20 3094-4027 translocation 115,871,366 47,746,921

CGOV92T JHOS-3 translocation chr8 chr11 141,008,061- 87,491,107- TRAPPC9 NA 15 4 3300-4127

141,008,319 87,491,354

CGOV92T JHOS-3 gain chr8 chr8 144,375,847- 144,516,310- ZNF696 MAFA, ZC3H3 10 20 3342-3346

144,376,223 144,516,585

CGOV92T JHOS-3 gain chr8 chr8 145,676,062- 145,742,273- CYHR1 LRRC14, RECQL4 17 14 3364-3367

145,676,417 145,742,581

CGOV92T JHOS-3 gain chr9 chr9 74,194,322- 74,267,477- NA NA 17 26 3506-3507

74,194,572 74,267,777

CGOV92T JHOS-3 inversion chr9 chr9 95,854,536- 132,868,195- C9orf89 GPR107 20 4 3542-3606

95,854,901 132,868,534

CGOV92T JHOS-3 translocation chr9 chr14 122,176,692- 105,099,993- NA NA 28 28 3585-4884

122,176,923 105,100,364

CGOV92T JHOS-3 inversion chr9 chr9 132,868,910- 133,020,546- GPR107 NA 6 12 3606-3608

132,869,155 133,020,710

CGOV92T JHOS-3 gain chr10 chr10 2,181 ,298- 2,211,342- NA NA 11 20 3652-3653

2,181 ,584 2,211,590

CGOV92T JHOS-3 inversion / chr10 chr14 56,591,256- 50,744,665- NA L2HGDH 12 8 3814-4767 translocation 56,591,434 50,744,964

CGOV92T JHOS-3 gain chr10 chr10 61 ,644,281- 61,769,092- CCDC6 NA 19 16 3829-3830

61 ,644,561 61,769,341

CGOV92T JHOS-3 gain chr10 chr10 70,056,875- 70,067,118- PBLD PBLD.1 16 6 3841-3842

70,057,166 70,067,372

CGOV92T JHOS-3 gain chr10 chr10 70,700,345- 70,711,073- DDX50 DDX50.1 6 24 3843-3844

70,700,681 70,711,212

CGOV92T JHOS-3 gain chr10 chr10 72,920,001- 73,012,827- NA UNC5B 15 10 3849-3850

72,920,300 73,013,183

CGOV92T JHOS-3 gain chr10 chr10 77,139,547- 77,158,795- ZNF503 ZNF503.1 26 26 3866-3867

77,139,920 77,159,134

CGOV92T JHOS-3 translocation chr10 chr14 81 ,388, 674- 73,061,826- NA NA 7 10 3875-4798

SI ,388,850 73,062,041

CGOV92T JHOS-3 gain chr10 chr10 101,949,186- 101,960,917- ERLIN1, CHUK ERLIN1, CHUK.1 16 20 3884-3885

101,949,499 101,961 ,209

CGOV92T JHOS-3 translocation chr10 chr13 127,574,438- 20,371,290- DHX32 NA 67 44 3904-4556

127,574,798 20,371,568

CGOV92T JHOS-3 translocation chr11 chr22 20,627,825- 32,640,132- SLC6A5 SLC5A4 23 20 3953-6509

20,628,173 32,640,355

CGOV92T JHOS-3 loss chr11 chr11 28,089,164- 28,873,654- KIF18A NA 10 12 3966-3968

28,089,423 28,874,006

CGOV92T JHOS-3 gain chr11 chr11 33,290,821- 35,784,745- HIPK3 TRIM44 7 6 3982-3998

33,291,045 35,785,052

CGOV92T JHOS-3 gain chr11 chr11 33,656,280- 33,691,807- KIAA1549L KIAA1549L1 20 30 3985-3986

33,656,523 33,692,107

CGOV92T JHOS-3 inversion chr11 chr11 43,330,522- 116,942,127- APIS SIK3 19 6 4019-4152

43,330,766 116,942,480

CGOV92T JHOS-3 gain chr11 chr11 46,690,210- 47,032,775- ATG13 C11orf49 16 24 4022-4024

46,690,578 47,033,065

CGOV92T JHOS-3 inversion chr11 chr11 71 ,909,665- 71,940,107- FOLR1 INPPL1 18 12 4104-4106

71 ,910,104 71,940,469 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV92T JHOS-3 gain chr12 chr12 6,638,010- 6,693,122- NCAPD2 CHD4, 19 10 4216-4217

6,638,392 6,693,475 SCARNA11

CGOV92T JHOS-3 inversion chr12 chr12 32,297,673- 90,169,577- BICD1 NA 12 6 4279-4397

32,297,967 90,169,825

CGOV92T JHOS-3 translocation chr12 chrX 44,115,532- 122,529,821- NA GRIA3 9 20 4339-6710

44,115,905 122,530,185

CGOV92T JHOS-3 gain chr12 chr12 77,548,577- 77,565,977- NA NA 18 12 4393-4394

77,548,946 77,566,290

CGOV92T JHOS-3 gain chr12 chr12 109,442,255- 109,454,178- SVOP SVOP.1 23 24 4422-4423

109,442,588 109,454,494

CGOV92T JHOS-3 gain chr12 chr12 116,457,540- 116,625,557- MED13L MED13L1 17 14 4440-4441

116,457,814 116,625,866

CGOV92T JHOS-3 inversion / chr12 chr14 116,891,086- 47,500,651- NA MDGA2 11 12 4443-4756 translocation 116,891,388 47,501,048

CGOV92T JHOS-3 gain chr12 chr12 120,499,256- 120,895,088- CCDC64 GATC, SRSF9 15 4 4466-4473

120,499,571 120,895,432

CGOV92T JHOS-3 inversion / chr13 chr16 32,861,595- 680,436- FRY RAB40C, 16 6 4616-5205 translocation 32,861,907 680,786 WFIKKN1,

C16orf13

CGOV92T JHOS-3 gain chr13 chr13 49,098,764- 49,239,806- RCBTB2 CYSLTR2 25 22 4634-4635

49,099,094 49,240,179

CGOV92T JHOS-3 gain chr13 chr13 95,261,221- 95,285,802- GPR180 GPR180.1 12 2 4684-4685

95,261,523 95,286,082

CGOV92T JHOS-3 gain chr14 chr14 50,418,612- 50,436,014- NA MIR6076 34 44 4762-4764

50,419,046 50,436,434

CGOV92T JHOS-3 gain chr14 chr14 50,417,673- 50,456,874- NA LINC01588 26 28 4762-4765

50,418,038 50,457,176

CGOV92T JHOS-3 gain chr14 chr14 73,924,796- 73,976,057- NUMB HEATR4 25 22 4805-4806

73,925,172 73,976,528

CGOV92T JHOS-3 gain chr14 chr14 77,909,046- 77,940,773- VIPAS39 AHSA1 , ISM2 12 20 4826-4827

77,909,491 77,941,067

CGOV92T JHOS-3 translocation chr1 chr5 163,665,941- 143,675,275- NA KCTD16 24 30 488-2075

163,666,268 143,675,551

CGOV92T JHOS-3 gain chr15 chr15 25,893,230- 25,955,802- NA ATP10A 15 10 5039-5040

25,893,526 25,956,112

CGOV92T JHOS-3 gain chr15 chr15 35,096,374- 35,107,528- LOCI 01928174 LOC101928174.1 14 40 5058-5059

35,096,646 35,107,830

CGOV92T JHOS-3 gain chr15 chr15 58,426,781- 58,469,688- AQP9 AQP9.1 21 26 5084-5085

58,427,056 58,470,021

CGOV92T JHOS-3 translocation chr1 chr17 173,931,267- 29,518,716- RC3H1 NF1 15 28 511-5483

173,931,572 29,518,993

CGOV92T JHOS-3 inversion / chr15 chrX 101, 625, 356- 117,071 ,057- NA KLHL13 14 10 5202-6699 translocation Id, 625, 748 117,071 ,273

CGOV92T JHOS-3 gain chr16 chr16 3,800,616- 3,840,042- CREBBP CREBBP.1 11 16 5209-5210

3,800,911 3,840,353

CGOV92T JHOS-3 inversion / chr16 chr20 17,719,338- 51, 848, 946- NA TSHZ2 8 18 5221-6218 translocation 17,719,663 SI, 849, 153

CGOV92T JHOS-3 gain chr16 chr16 47,159,817- 47,205,143- NET02 ITFG1 10 24 5321-5322

47,160,050 47,205,377 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV92T JHOS-3 gain chr16 chr16 87,205,252- 87,471,112- NA ZCCHC14 9 20 5381-5385

87,205,520 87,471,342

CGOV92T JHOS-3 gain chr17 chr17 40,931,287- 63,013,952- VPS25, WNK4 GNA13 13 14 5495-5595

40,931,540 63,014,173

CGOV92T JHOS-3 gain chr17 chr17 46,474,741- 46,669,144- SKAP1 HOXB-AS3, 16 20 5516-5518

46,474,994 46,669,404 HOXB5, HOXB6

CGOV92T JHOS-3 gain chr17 chr17 49,043,178- 61,824,521- SPAG9 CCDC47 36 32 5522-5590

49,043,529 61,824,897

CGOV92T JHOS-3 gain chr1 chr1 186,346,681- 186,390,999- C1orf27, C1orf27, 32 26 554-556

186,346,907 186,391 ,234 MIR548F1, TPR MIR548F1, TPR.1

CGOV92T JHOS-3 gain chr18 chr18 414,906- 426,978- COLEC12 COLEC12.1 22 24 5643-5644

415,287 427,497

CGOV92T JHOS-3 gain chr18 chr18 5,777,149- 5,787,512- MIR3976HG MIR3976HG.1 14 16 5649-5650

5,777,428 5,787,813

CGOV92T JHOS-3 gain chr18 chr18 21 ,514,364- 21,965,517- LAMA3 OSBPL1A 15 12 5694-5696

21 ,514,645 21,965,884

CGOV92T JHOS-3 gain chr20 chr20 5,980,513- 6,036,983- MCM8, MCM8- LRRN4 17 16 6048-6049

5,980,770 6,037,260 AS1

CGOV92T JHOS-3 loss chr20 chr20 13,960,657- 14,655,291- SEL1 L2 MACROD2 10 18 6055-6056

13,960,911 14,655,521

CGOV92T JHOS-3 translocation chr20 chr21 30,869,643- 28,215,088- KIF3B ADAMTS1 6 10 6169-6393

30,869,963 28,215,211

CGOV92T JHOS-3 inversion / chr20 chrX 43,704,995- 26,845,777- STK4 NA 18 16 6181-6569 translocation 43,705,288 26,845,996

CGOV92T JHOS-3 inversion / chr1 chr7 200,727,609- 117,061 ,079- CAMSAP2 ASZ1 16 16 632-2755 translocation 200,727,956 117,061 ,358

CGOV92T JHOS-3 gain chr1 chr1 202,737,332- 203,096,174- KDM5B ADORA1 18 18 636-639

202,737,585 203,096,513

CGOV92T JHOS-3 gain chr21 chr21 24,254,374- 24,296,695- NA NA 21 10 6388-6389

24,254,658 24,297,048

CGOV92T JHOS-3 gain chr21 chr21 45,295,003- 45,600,148- AGPAT3 NA 6 10 6413-6414

45,295,196 45,600,327

CGOV92T JHOS-3 gain chr22 chr22 28,836,159- 29,406,357- TTC28 ZNRF3 21 26 6496-6501

28,836,458 29,406,696

CGOV92T JHOS-3 gain chr22 chr22 30,547,714- 30,749,012- HORMAD2 CCDC157, SF3A1 18 14 6505-6506

30,547,997 30,749,276

CGOV92T JHOS-3 loss chrX chrX 8,098,487- 93,714,051- MIR651 NA 6 14 6553-6669

8,098,661 93,714,335

CGOV92T JHOS-3 gain chrX chrX 13,316,161- 13,326,183- NA GS1-600G8.3 5 6 6557-6558

13,316,367 13,326,408

CGOV92T JHOS-3 gain chrX chrX 40,214,057- 40,225,068- NA NA 9 20 6587-6588

40,214,316 40,225,359

CGOV92T JHOS-3 gain chrX chrX 70,411,084- 70,423,522- NA NA 12 2 6633-6634

70,411,334 70,423,816

CGOV92T JHOS-3 gain chrX chrX 136,313,709- 136,347,567- NA NA 8 20 6738-6739

136,313,930 136,347,786 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV92T JHOS-3 gain chr1 chr1 230,978,548- 230,990,987- C1orf198 C1orf 198.1 19 38 718-719

230,978,858 230,991 ,312

CGOV92T JHOS-3 gain chr1 chr1 235,158,864- 235,420,050- NA ARID4B 27 14 738-742

235,159,206 235,420,327

CGOV92T JHOS-3 translocation chr1 chr20 246,284,377- 39,925,980- SMYD3 ZHX3 17 26 789-6178

246,284,605 39,926,337

CGOV92T JHOS-3 gain chr2 chr2 3,894,391- 3,905,756- DCDC2C NA 12 12 820-821

3,894,624 3,906,117

CGOV92T JHOS-3 inversion chr2 chr2 7,060,435- 237,621 ,471- RNF144A, NA 13 6 823-1206

7,060,686 237,621 ,659 RNF144A-AS1

CGOV92T JHOS-3 inversion chr2 chr2 7,076,500- 237,608,445- RNF144A NA 20 8 824-1205

7,076,861 237,608,786

CGOV92T JHOS-3 gain chr2 chr2 7,483,504- 14,310,526- NA NA 16 2 827-844

7,483,682 14,310,823

CGOV92T JHOS-3 gain chr2 chr2 17,915,510- 17,949,697- SMC6 GEN1 15 16 848-849

17,915,826 17,950,096

CGOV92T JHOS-3 inversion / chr2 chr12 23,849,051- 95,241,102- KLHL29 NA 12 10 855-4401 translocation 23,849,352 95,241,430

CGOV92T JHOS-3 gain chr2 chr2 31 ,808,876- 31,960,954- SRD5A2 NA 25 16 868-871

31 ,809,227 31,961,288

CGOV92T JHOS-3 gain chr2 chr2 31 ,918, 531- 31,958,207- NA NA 7 14 869-870

SI ,918,874 31,958,442

CGOV92T JHOS-3 inversion chr2 chr2 34,743,202- 39,593,302- NA MAP4K3 12 10 881-892

34,743,464 39,593,547

CGOV92T JHOS-3 gain chr1 chr1 1,282,937- 1 ,301,487- DVL1 , MXRA8 DVL1, MXRA8.1 6 8 8-9

1,283,217 1 ,301,719

CGOV92T JHOS-3 inversion chr2 chr2 40,465,986- 41,268,918- SLC8A1-AS1 , NA 18 16 894-896

40,466,317 41,269,217 SLC8A1

CGOV92T JHOS-3 gain chr2 chr2 66,702,452- 66,743,536- MEIS1 MEIS1.1 13 18 927-928

66,702,767 66,743,844

CGOV92T JHOS-3 inversion / chr2 chr4 67,608,759- 79,121,234- NA FRAS1 9 10 932-1790 translocation 67,609,032 79,121,482

CGOV12T KOC-7C gain chr1 chr1 155,218,175- 155,266,671- GBA, FAM189B PKLR 11 22 1107-1108

155,218,392 155,266,989

CGOV12T KOC-7C gain chr15 chr15 72,051,118- 72,102,853- THSD4 NR2E3 15 20 17600-17603

72,051,378 72,103,092

CGOV12T KOC-7C gain chr15 chr15 99,033,965- 99,080,520- FAM169B NA 13 8 17821-17825

99,034,224 99,080,789

CGOV12T KOC-7C gain chr2 chr2 43,379,810- 43,489,178- NA THADA 7 16 2155-2160

43,380,095 43,489,328

CGOV12T KOC-7C gain chr2 chr2 176,405,690- 223,080,290- NA PAX3 19 14 3121-3465

176,405,945 223,080,496

CGOV12T KOC-7C translocation chr1 chr7 33,516,320- 24,448,476- NA NA 15 12 328-9195

33,516,546 24,448,707

CGOV12T KOC-7C gain chr3 chr3 191,937,195- 191,996,523- FCF12 FGF12.1 15 18 4959-4962

191,937,448 191,996,712

CGOV12T KOC-7C translocation chr1 chr22 55,029,914- 19,435,945- ACOT11 C22orf39, UFD1 L 10 4 499-21493

55,030,038 19,436,158

CGOV12T KOC-7C gain chr4 chr4 61 ,495,525- 61,533,062- NA NA 10 22 5447-5449

61 ,495,817 61,533,391

CGOV12T KOC-7C inversion / chrS chr11 180,672,562- 1 ,970,597- CTC-338M12.4, MRPL23 7 12 7638-13554 translocation 180,672,817 1 ,970,795 GNB2L1,

SNORD96A,

SNORD95 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV20T OV207 inversion / chr6 chr11 3,610,879- 120,879,979- NA NA 12 28 10330-20505 translocation 3,611 ,198 120,880,219

CGOV20T OV207 gain chr1 chr1 87,121,473- 87,495,087- CLCA3P HS2ST1 14 16 1035-1058

87,121,718 87,495,311

CGOV20T OV207 gain chr6 chr6 12,172,557- 12,740,888- NA PHACTR1 12 30 10520-10544

12,172,835 12,741,185

CGOV20T OV207 inversion / chr1 chr9 18,052,713- 21,724,453- NA NA 17 6 106-16185 translocation 18,053,198 21,724,855

CGOV20T OV207 inversion / chr6 chr10 18,488,304- 70,574,705- NA NA 30 4 10636-17344 translocation 18,488,584 70,574,938

CGOV20T OV207 loss chr6 chr6 18,503,239- 24,375,266- NA DCDC2 14 10 10637-10846

18,503,526 24,375,584

CGOV20T OV207 translocation chr6 chr10 30,902,102- 756,611- SFTA2 NA 11 16 10955-16932

30,902,371 756,955

CGOV20T OV207 translocation chr6 chr10 30,956,086- 6,400,493- MUC21 NA 12 18 10963-16950

30,956,303 6,400,703

CGOV20T OV207 translocation chr6 chr19 30,955,244- 42,827,369- MUC21 TMEM145, 6 2 10963-26631

30,955,405 42,827,515 MEGF8

CGOV20T OV207 translocation chr6 chr10 33,571,576- 95,250,621- NA NA 14 10 11035-17552

33,571,785 95,250,898

CGOV20T OV207 gain chr6 chr6 37,005,066- 37,761,180- NA NA 17 6 11076-11111

37,005,423 37,761,488

CGOV20T OV207 translocation chr6 chr22 42,751,938- 41,031,869- NA MKL1 13 16 11164-29130

42,752,211 41,032,166

CGOV20T OV207 gain chr6 chr6 47,511,249- 47,574,187- CD2AP CD2AP.1 14 14 11248-11253

47,511,594 47,574,464

CGOV20T OV207 gain chr6 chr6 51 ,911, 799- 52,110,706- PKHD1 IL17F 18 26 11310-11319

SI ,912,158 52,110,992

CGOV20T OV207 gain chr6 chr6 51 ,931, 614- 51, 983, 914- PKHD1 NA 10 2 11311-11316

SI ,931, 889 SI, 984,114

CGOV20T OV207 gain chr6 chr6 76,227,698- 76,245,300- NA NA 9 12 11694-11695

76,227,908 76,245,542

CGOV20T OV207 gain chr1 chr1 1,817,683- 1 ,861,591- GNB1 CFAP74 11 8 12-13

1,818,052 1 ,861,895

CGOV20T OV207 inversion / chr6 chr15 106,412,223- 85,657,461- NA PDE8A 20 30 12134-23247 translocation 106,412,486 85,657,778

CGOV20T OV207 gain chr6 chr6 106,577,569- 136,662,681- NA MAP7 21 36 12145-12586

106,577,832 136,663,006

CGOV20T OV207 loss chr6 chr6 106,605,228- 136,618,886- NA NA 24 32 12150-12581

106,605,519 136,619,235

CGOV20T OV207 inversion / chr6 chr9 106,720,080- 131,084,132- ATGS COQ4, TRUB2 12 30 12163-16864 translocation 106,720,371 131,084,321

CGOV20T OV207 gain chr6 chr6 107,191,257- 107,311 ,820- LOC100422737 NA 17 14 12170-12177

107,191,526 107,312,087

CGOV20T OV207 translocation chr1 chr3 94,794,552- 50,606,522- NA HEMK1 , C3orf18 19 30 1236-5414

94,794,875 50,606,794 Number Number

- ·-— ¹ — ⁿ — rangement

Lab ID WO 2020/081549 Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 PCT/US2019/056299

CGOV20T OV207 gain chr6 chr6 143,020,747- 143,032,293- NA NA 27 26 12676-12679

143,021,013 143,032,666

CGOV20T OV207 loss chr6 chr6 154,358,116- 167,716,950- OPRM1 UNC93A 17 22 12840-12875

154,358,350 167,717,256

CGOV20T OV207 gain chr7 chr7 7,617,022- 7,628,878- MIOS MIOS.1 25 24 13142-13144

7,617,359 7,629,171

CGOV20T OV207 translocation chr7 chr11 27,188,390- 34,457,378- HOXA-AS3, CAT 23 32 13830-17953

27,188,756 34,457,668 HOXA6, HOXA7

CGOV20T OV207 gain chr7 chr7 73,837,159- 73,854,827- NA NA 9 20 14105-14106

73,837,405 73,855,107

CGOV20T OV207 gain chr7 chr7 133,951,836- 144,152,505- LRGUK TPK1 18 24 14368-14667

133,952,085 144,152,822

CGOV20T OV207 translocation chr8 chr10 102,153,698- 927,253- NA LARP4B 8 10 15229-16935

102,153,948 927,577

CGOV20T OV207 translocation chr8 chr10 102,516,926- 123,446,808- GRHL2 NA 14 14 15236-17747

102,517,216 123,447,152

CGOV20T OV207 gain chr8 chr8 103,160,081- 103,177,890- NA NA 11 22 15240-15243

103,160,271 103,178,098

CGOV20T OV207 translocation chr8 chr20 126,441,189- 45,388,926- TRIB1 NA 21 28 15373-27371

126,441,443 45,389,238

CGOV20T OV207 inversion/ chr1 chr11 23,884,262- 59,193,449- ID3 OR5A2 9 4 160-18572 translocation 23,884,484 59,193,704

CGOV20T OV207 translocation chr1 chr6 24,222,835- 4,060,735- CNR2 PRPF4B 30 28 162-10372

24,223,198 4,061,076

CGOV20T OV207 gain chr9 chr9 35,631,832- 35,679,271- NA CA9, TPM2 10 32 16408-16411

35,632,074 35,679,589

CGOV20T OV207 gain chr9 chr9 36,103,840- 36,475,414- RECK NA 5 24 16412-16433

36,104,002 36,475,686

CGOV20T OV207 gain chr9 chr9 131,083,473- 131,152,105- COQ4, TRUB2 MIR1268A, 33 40 16864-16865

131,083,836 131,152,487 URM1, MIR219B,

MIR219A2

CGOV20T OV207 inversion / chr10 chrX 514, 553- 153,280,329- DIP2C IRAK1, MIR718 11 8 16929-30934 translocation SI 4,818 153,280,580

CGOV20T OV207 gain chr10 chr10 8,727,315- 14,896,724- NA HSPA14 14 14 16959-16989

8,727,579 14,897,022

CGOV20T OV207 inversion / chr10 chr11 63,810,526- 101,621,691- ARIDSB NA 33 28 17296-20372 translocation 63,810,818 101,621,999

CGOV20T OV207 gain chr10 chr10 63,812,030- 63,836,137- ARID5B ARID5B.1 16 16 17297-17301

63,812,314 63,836,369

CGOV20T OV207 translocation chr10 chr19 70,591,809- 50,665,551- STOX1 IZUM02 10 14 17345-26702

70,592,081 50,665,719

CGOV20T OV207 gain chr10 chr10 71,355,483- 81,186,843- NA ZCCHC24 9 8 17348-17469

71,355,805 81,187,146

CGOV20T OV207 gain chr10 chr10 75,585,199- 75,646,969- CAMK2G NA 10 8 17411-17414

75,585,492 75,647,247

CGOV20T OV207 inversion/ chr1 chr10 24,645,964- 123,978,966- GRHL3 TACC2 10 16 174-17760 translocation 24,646,282 123,979,280

CGOV20T OV207 gain chr10 chr10 95,096,340- 95,135,354- MYOF MYOF.1 8 14 17548-17549

95,096,590 95,135,646

CGOV20T OV207 gain chr10 chr10 103,804,409- 104,191,263- C10or(76 MIR146B, 9 20 17600-17608

103,804,607 104,191,492 CUEDC2 Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV20T OV207 inversion / chr11 chr17 34,640,579- 39,975,349- EHF FKBP10 59 56 17964-25064 translocation 34,640,950 39,975,628

CGOV20T OV207 gain chr11 chr11 65,062,339- 65,126,569- POLA2 TIGD3 10 8 18727-18730

65,062,491 65,126,796

CGOV20T OV207 gain chr11 chr11 71 ,791,374- 72,076,472- LRTOMT, CLPB 6 16 19016-19041

71 ,791,695 72,076,714 NUMA1

CGOV20T OV207 gain chr11 chr11 72,887,210- 73,143,338- NA FAM168A 19 20 19081-19110

72,887,524 73,143,631

CGOV20T OV207 gain chr11 chr11 73,021,386- 73,178, SOS- ARHCEF17 FAM168A 33 56 19090-19115

73,022,000 73, 178, 824

CGOV20T OV207 translocation chr11 chr14 74,446,945- 22,842,954- CHRDL2 NA 78 82 19187-22051

74,447,305 22,843,458

CGOV20T OV207 gain chr1 chr1 26,188,525- 26,233,428- AUNIP, PAQR7 STMN1, MIR3917 41 58 195-200

26,188,860 26,233,722

CGOV20T OV207 gain chr11 chr11 116,575,733- 116,780,949- NA SIK3 30 16 20467-20479

116,575,977 116,781 ,298

CGOV20T OV207 translocation chr11 chrX 121,357,706- 152,861 ,782- SORL1 LOC105373383, 23 34 20520-30913

121,358,058 152,862,162 FAM58A

CGOV20T OV207 translocation chr11 chr20 129,196,584- 45,395,112- NA NA 6 12 20554-27372

129,196,838 45,395,303

CGOV20T OV207 gain chr12 chr12 6,772,264- 7,243,465- INC4, ZNF384 C1 R, C1 RL 7 14 20589-20599

6,772,554 7,243,677

CGOV20T OV207 gain chr12 chr12 48,095,606- 48,294,567- RPAP3 VDR 9 16 20899-20906

48,095,863 48,294,848

CGOV20T OV207 gain chr12 chr12 51 ,784,486- 51, 798, 083- SLC4A8, SLC4A8, 11 12 20926-20927

SI ,784,699 SI, 798, 328 CALNT6 GALNT6.1

CGOV20T OV207 loss chr12 chr12 56,553,377- 57,837,416- MYL6B, MYL6, INHBC 7 22 20959-20965

56,553,701 57,837,589 SMARCC2

CGOV20T OV207 gain chr12 chr12 117,547,976- 117,560,131- TESC-AS1 TESC-AS1.1 9 10 21248-21249

117,548,226 117,560,379

CGOV20T OV207 inversion / chr1 chr17 145,746,625- 73,871,091- NBPF20, TRIM47 10 10 2126-25641 translocation 145,746,865 73,871,340 NBPF10, PDZK1

CGOV20T OV207 inversion / chr12 chr16 122,508,263- 57,548,859- NA CCDC102A 7 18 21279-23617 translocation 122,508,480 57,549,097

CGOV20T OV207 gain chr12 chr12 122,735,962- 123,135,276- VPS33A NA 9 6 21280-21285

122,736,143 123,135,474

CGOV20T OV207 gain chr12 chr12 130,699,304- 130,754,161- NA NA 12 20 21325-21327

130,699,580 130,754,483

CGOV20T OV207 inversion chr13 chr13 21 ,090,372- 25,282,638- CRYL1 ATP12A 13 2 21387-21442

21 ,090,598 25,283,003

CGOV20T OV207 gain chr13 chr13 35,809,307- 36,851,611- NBEA CCDC169- 7 8 21461-21484

35,809,533 36,851,900 SOHLH2,

CCDC169

CGOV20T OV207 inversion / chr13 chr16 36,267,291- 75,045,664- LINC0044S, ZNRF1 10 14 21469-23773 translocation 36,267,593 75,045,899 MIR548F5

CGOV20T OV207 gain chr13 chr13 42,107,967- 42,122,789- NA NA 11 8 21496-21497

42,108,283 42,122,989

CGOV20T OV207 gain chr13 chr13 49,161,921- 49,200,457- NA NA 9 14 21514-21516

49,162,164 49,200,705

CGOV20T OV207 inversion / chr1 chr17 151,939,609- 66,741,118- NA NA 31 24 2188-25532 translocation 151,939,949 66,741,466 WO 2020/081549 PC■«Tdu/dUiiSye2u019/0 sp5u6e2 R9e9arrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV20T OV207 translocation chr14 chr22 62,027,026- 42,223,837- LOC101927780 CCDC134, 22 18 22277-29174

62,027,348 42,224,211 SREBF2

CGOV20T OV207 gain chr14 chr14 64,146,815- 64,404,592- SGPP1 SYNE2 24 2 22307-22330

64,147,131 64,404,978

CGOV20T OV207 gain chr14 chr14 93,419,365- 93,775,939- ITPK1 BTBD7 33 34 22618-22636

93,419,778 93,776,203

CGOV20T OV207 gain chr14 chr14 104,328,497- 104,343,595- LINC00637 NA 11 12 22727-22729

104,328,772 104,343,833

CGOV20T OV207 gain chr15 chr15 90,076,361- 90,588,167- NA ZNF710 17 20 23264-23271

90,076,593 90,588,450

CGOV20T OV207 gain chr15 chr15 90,584,783- 90,828,554- ZNF710 NA 15 18 23270-23272

90,585,101 90,828,785

CGOV20T OV207 gain chr15 chr15 93,408,390- 93,419,043- NA NA 12 20 23277-23278

93,408,623 93,419,418

CGOV20T OV207 gain chr15 chr15 99,468,420- 99,805,175- IGF1 R LRRC28, 10 10 23283-23284

99,468,750 99,805,432 HSP90B2P

CGOV20T OV207 gain chr16 chr16 2,067,048- 2,133,162- NPW TSC2 18 36 23304-23305

2,067,293 2,133,480

CGOV20T OV207 gain chr16 chr16 11 ,962,812- 12,214,729- GSPT1 SNX29 45 34 23340-23355

11 ,963,114 12,215,072

CGOV20T OV207 gain chr16 chr16 21 ,995,699- 22,021,737- UQCRC2, C16orf52 24 32 23388-23389

21 ,996,157 22,022,039 PDZD9

CGOV20T OV207 inversion chr16 chr16 53,391,777- 76,564,549- NA CNTNAP4 12 20 23579-23805

53,392,021 76,564,787

CGOV20T OV207 gain chr1 chr1 183,020,890- 183,321 ,048- LAMC1 NMNAT2 16 12 2369-2382

183,021,171 183,321 ,278

CGOV20T OV207 gain chr16 chr16 74,289,314- 74,526,160- NA GLG1 5 14 23755-23765

74,289,453 74,526,382

CGOV20T OV207 inversion / chr1 chr2 198,348,349- 234,073,753- NA INPP5D 26 44 2403-4992 translocation 198,348,682 234,074,029

CGOV20T OV207 loss chr17 chr17 5,497,536- 6,429,390- NA PITPNM3 17 28 24119-24136

5,497,788 6,429,649

CGOV20T OV207 inversion chr17 chr17 5,687,589- 6,146,756- LOC339166 NA 26 20 24121-24127

5,687,905 6,147,067

CGOV20T OV207 gain chr17 chr17 9,901 ,207- 32,507,261- GAS7 LOC101927239 22 14 24210-24721

9,901 ,465 32,507,577

CGOV20T OV207 gain chr17 chr17 12,385,000- 31,123,601- NA MY01 D 21 20 24266-24667

12,385,271 31,123,947

CGOV20T OV207 inversion chr17 chr17 12,876,705- 32,703,595- ARHGAP44 NA 14 34 24272-24726

12,877,047 32,703,901

CGOV20T OV207 inversion chr17 chr17 29,450,435- 30,921,247- NF1 MY01 D 12 36 24602-24664

29,450,700 30,921,480

CGOV20T OV207 loss chr17 chr17 34,980,695- 76,390,901- NA PGS1 13 4 24821-25677

34,980,988 76,391,140

CGOV20T OV207 gain chr17 chr17 37,823,524- 73,569,167- STARD3, TCAP, LLGL2 11 10 24997-25622

37,823,741 73,569,364 PNMT, PGAP3

CGOV20T OV207 loss chr17 chr17 37,886,552- 73,484,171- ERBB2, KIAA0195 19 14 25002-25618

37,886,859 73,484,524 MIR4728,

MIEN1

CGOV20T OV207 translocation chr17 chr20 38,725,420- 45,393,876- CCR7 NA 20 22 25023-27372

38,725,710 45,394,236 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV20T OV207 gain chr17 chr17 45,294,925- 45,314,116- MYL4 NA 11 12 25174-25176

45,295,113 45,314,437

CGOV20T OV207 inversion / chr1 chr3 224,239,865- 9,176,806- NA SRGAP3 15 16 2529-5143 translocation 224,240,112 9,177,053

CGOV20T OV207 inversion / chr17 chr20 72,989,831- 3,345,364- CDR2L C20orf194 27 54 25594-26815 translocation 72,990,105 3,345,633

CGOV20T OV207 inversion / chr17 chr20 73,157,965- 3,529,768- NA ATRN 10 56 25606-26830 translocation 73,158,171 3,529,948

CGOV20T OV207 loss chr17 chr17 73,494,890- 75,972,390- KIAA0195, NA 14 14 25619-25673

73,495,158 75,972,706 MIR6785,

CASKIN2

CGOV20T OV207 gain chr17 chr17 73,673,989- 74,032,869- SAP30BP SRP68 19 36 25625-25645

73,674,326 74,033,306

CGOV20T OV207 gain chr17 chr17 74,170,124- 74,554,024- RNF157 SNHG16, 18 18 25648-25658

74,170,566 74,554,368 SNORD1C,

SNORD1 B,

SNORD1A

CCOV20T OV207 inversion chr17 chr17 75,026,922- 75,719,667- NA LOCI 00132174 11 28 25666-25668

75,027,075 75,719,948

CCOV20T OV207 inversion chr17 chr17 76,126,420- 76,400,138- TMC8. TMC6 PGS1 11 6 25676-25680

76,126,695 76,400,372

CCOV20T OV207 gain chr18 chr18 21 ,534,741- 23,189,322- LAMA3 NA 7 6 25888-25893

21 ,534,983 23,189,584

CCOV20T OV207 gain chr1 chr1 230,601,721- 230,668,315- NA NA 12 10 2630-2633

230,601,915 230,668,632

CCOV20T OV207 gain chr1 chr1 235,097,108- 235,111 ,610- LOC101927851 NA 20 24 2690-2693

235,097,382 235,111 ,888

CCOV20T OV207 loss chr20 chr20 12,147,579- 13,151,066- NA SPTLC3 33 4 26955-26957

12,147,930 13,151,340

CCOV20T OV207 gain chr20 chr20 44,433,467- 44,465,441- DNTTIP1 SNX21 , ACOT8 10 8 27365-27366

44,433,725 44,465,642

CCOV20T OV207 gain chr20 chr20 52,397,823- 52,647,125- NA BCAS1 17 30 27503-27529

52,398,140 52,647,454

CCOV20T OV207 gain chr20 chr20 62,585,218- 62,788,520- UCKL1-AS1, NA 26 38 27785-27794

62,585,580 62,788,791 UCKL1 ,

ZNF512B

CCOV20T OV207 gain chr22 chr22 19,581,538- 19,963,691- NA ARVCF 20 28 28723-28741

19,581,805 19,963,963

CCOV20T OV207 gain chr22 chr22 41 ,631,697- 41,708,236- L3MBTL2, ZC3H7B 5 12 29148-29156

41 ,631,903 41,708,442 CHADL

CCOV20T OV207 gain chr22 chr22 41 ,649,587- 41,912,348- RANGAP1 , AC02 37 18 29150-29170

41 ,649,835 41,912,704 MIR6889

CCOV20T OV207 gain chr22 chr22 44,942,766- 45,342,777- NA PHF21 B 20 24 29223-29233

44,943,118 45,343,057

CCOV20T OV207 inversion / chr2 chr17 28,067,530- 58,521,329- RBKS APPBP2 49 68 3073-25382 translocation 28,067,895 58,521,682

CCOV20T OV207 translocation chr2 chr17 28,080,518- 58,696,859- RBKS PPM1 D 20 2 3076-25392

28,080,831 58,697,157

CCOV20T OV207 translocation chr2 chr11 28,826,720- 65,332,802- PLB1 SSSCA1 , SSSCA1 - 6 12 3136-18743

28,826,965 65,333,100 AS1

CCOV20T OV207 translocation chr2 chr5 28,862,786- 33,311,771- PLB1 NA 23 26 3139-8019

28,863,222 33,312,110

CCOV20T OV207 gain chr2 chr2 38,317,701- 38,337,103- NA NA 18 24 3346-3347

38,318,073 38,337,426 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV20T OV207 inversion/ chr2 chr19 43,374,269- 18,497,501- NA GDF15, 6 16 3452-26409 translocation 43,374,578 18,497,746 MIR3189,

LRRC25

CCOV20T OV207 inversion/ chr1 chr7 36,852,416- 117,285,932- STK40 CFTR 17 52 354-14297 translocation 36,852,776 117,286,209

CCOV20T OV207 inversion / chr1 chr19 36,895,162- 2,037,989- OSCP1 MKNK2 13 32 357-26259 translocation 36,895,484 2,038,350

CCOV20T OV207 inversion chr2 chr2 60,865,392- 178,364,590- NA AG PS 20 30 3604-4523

60,865,739 178,364,876

CCOV20T OV207 inversion/ chr2 chr5 61,208,801- 135,199,125- PUS10 SLC25A48 28 26 3615-9663 translocation 61,209,116 135,199,404

CCOV20T OV207 gain chr2 chr2 63,652,216- 63,695,149- WDPCP WDPCP.1 15 14 3635-3637

63,652,469 63,695,419

CCOV20T OV207 inversion/ chr1 chr7 39,365,548- 2,224,796- RHBDL2 MAD1L1 18 20 382-12960 translocation 39,365,742 2,225,069

CCOV20T OV207 gain chr2 chr2 122,289,482- 122,632,413- RNU4ATAC, NA 8 14 4053-4060

122,289,678 122,632,694 CLASP1

CCOV20T OV207 inversion/ chr1 chr20 41,357,642- 54,838,517- NA NA 23 30 407-27604 translocation 41,357,940 54,838,813

CCOV20T OV207 inversion/ chr1 chr20 41,429,455- 54,882,307- NA NA 18 8 409-27610 translocation 41,429,697 54,882,585

CCOV20T OV207 translocation chr2 chr3 153,302,041- 71,552,992- FMNL2 FOXP1 15 12 4311-5533

153,302,305 71,553,332

CCOV20T OV207 translocation chr2 chr3 161,058,618- 13,820,276- ITGB6 NA 5 10 4381-5197

161,058,853 13,820,562

CCOV20T OV207 translocation chr2 chr3 161,141,242- 13,582,353- RBMS1 NA 9 4 4385-5192

161,141,490 13,582,746

CCOV20T OV207 gain chr2 chr2 169,412,528- 169,829,601- CERS6 ABCB11 14 26 4458-4469

169,412,862 169,830,048

CCOV20T OV207 gain chr2 chr2 172,651,483- 172,864,296- SLC25A12 METAP1 D 14 20 4486-4492

172,651,794 172,864,591

CCOV20T OV207 translocation chr2 chr5 178,721,888- 134,829,532- PDE11A NA 9 16 4533-9641

178,722,200 134,829,790

CCOV20T OV207 gain chr1 chr1 45,084,125- 45,285,555- RNF220 PTCH2 24 18 459-475

45,084,440 45,285,791

CCOV20T OV207 gain chr2 chr2 190,943,350- 190,954,760- NA NA 8 16 4622-4624

190,943,573 190,955,074

CCOV20T OV207 inversion/ chr2 chr20 223,561,585- 46,006,924- MOGAT1 NA 6 10 4894-27377 translocation 223,561,881 46,007,088

CCOV20T OV207 translocation chr2 chr12 228,652,730- 48,227,352- NA NA 12 14 4936-20903

228,652,914 48,227,691

CCOV20T OV207 inversion / chr2 chr11 234,286,252- 102,091,180- DGKD YAP1 15 30 4999-20391 translocation 234,286,531 102,091,391

CCOV20T OV207 gain chr3 chr3 13,555,317- 13,590,330- NA FBLN2 17 8 5191-5193

13,555,618 13,590,634

CCOV20T OV207 gain chr3 chr3 14,265,218- 14,288,155- NA NA 68 38 5201-5206

14,265,636 14,288,502

CCOV20T OV207 inversion / chr3 chr22 48,476,608- 24,553,836- TMA7, CCDC51 CABIN1 12 30 5394-28847 translocation 48,476,810 24,554,210

CCOV20T OV207 translocation chr3 chr10 55,858,439- 124,116,997- ERC2 NA 5 18 5435-17761

55,858,710 124,117,904 Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV20T OV207 gain chr3 chr3 101 ,596,582- 169,606,812- NA NA 13 2 5719-6104

101 ,596,818 169,607,120

CGOV20T OV207 inversion chr3 chr3 101 ,783,001 - 101 ,844,502- NA NA 42 32 5723-5733

101 ,783,358 101 ,844,805

CGOV20T OV207 inversion chr3 chr3 101 ,834,058- 172,188,579- NA NA 41 28 5731-6121

101 ,834,379 172,188,937

CGOV20T OV207 loss chr3 chr3 101 ,914,842- 172,155,208- NA NA 49 40 5741-61 18

101 ,915,156 172,155,549

CGOV20T OV207 loss chr3 chr3 102,046,395- 171 ,326,754- NA PLD1 16 14 5744-61 10

102,046,634 171 ,326,999

CGOV20T OV207 translocation chr3 chr4 112,211 ,138- 952,414- BTLA TMEM175, 17 20 5809-6314

112,211 ,412 952,710 DGKQ

CGOV20T OV207 translocation chr3 chr4 112,221 ,463- 947,373- BTLA TMEM175 8 16 5810-6313

112,221 ,763 947,657

CGOV20T OV207 gain chr3 chr3 118,962,697- 1 19,045,348- B4GALT4-AS1 , ARHGAP31 , 9 14 5843-5845

118,962,941 1 19,045,533 B4GALT4 ARHGAP31-AS1

CGOV20T OV207 gain chr3 chr3 122,982,928- 123,012,922- SEC22A ADCY5 5 14 5867-5868

122,983,140 123,013,187

CGOV20T OV207 gain chr3 chr3 149,210,461 - 149,533,983- TM4SF4 RNF13 13 10 5999-6004

149,210,805 149,534,297

CGOV20T OV207 gain chr3 chr3 168,627,357- 168,815,252- LOC100507661 MECOM 25 18 6081-6096

168,627,737 168,815,575

CGOV20T OV207 gain chr3 chr3 168,656,823- 168,720,250- NA NA 13 14 6083-6090

168,657,114 168,720,538

CGOV20T OV207 gain chr3 chr3 168,707,751 - 168,735,077- NA NA 41 36 6087-6091

168,708,060 168,735,491

CGOV20T OV207 gain chr3 chr3 169,127,730- 171 ,906,075- MECOM FNDC3B 6 6 6098-61 17

169,127,936 171 ,906,261

CGOV20T OV207 gain chr3 chr3 172,198,673- 172,425,731- NA NCEH1 13 26 6122-6135

172,198,944 172,425,961

CGOV20T OV207 gain chr3 chr3 189,972,181 - 189,989,265- NA NA 15 20 6235-6238

189,972,448 189,989,591

CGOV20T OV207 translocation chr1 chr17 58,608,895- 73,637,308- DAB1 SMIM5, RECQL5 25 6 629-25623

58,609,275 73,637,604

CGOV20T OV207 gain chr4 chr4 15,933,439- 16,356,622- FGFBP1 NA 23 38 6403-6411

15,933,777 16,356,932

CGOV20T OV207 gain chr1 chr1 59,898,443- 183,255,701- FGGY NMNAT2 16 18 644-2379

59,898,849 183,255,966

CGOV20T OV207 loss chr1 chr1 60,11 1 ,950- 183,112,077- FGGY LAMC1 11 12 650-2371

60,112,232 183,112,486

CGOV20T OV207 gain chr4 chr4 95,167,966- 95,519,091 - SMARCAD1 PDLIM5 22 32 6844-6849

95,168,346 95,519,333

CGOV20T OV207 translocation chr4 chr1 1 11 1 ,068,121 - 34,637,271 - ELOVL6 NA 62 50 6921-17963

11 1 ,068,342 34,637,578

CGOV20T OV207 gain chr4 chr4 143,082,597- 143,134,603- INPP4B INPP4B.1 20 18 7066-7069

143,082,847 143,134,850

CGOV20T OV207 inversion / chr1 chr17 67,820,582- 58,517,116- IL12RB2 APPBP2 9 12 749-25381 translocation 67,820,840 58,517,436

CGOV20T OV207 translocation chr5 chr19 33,257,331- 40,444,242- NA FCGBP 32 32 801 1-26612

33,257,610 40,444,489 Number Number

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV20T OV207 inversion chr5 chrS 66,700,341- 66,933,914- NA NA 15 32 8590-8596

66,700,669 66,934,322

CGOV20T OV207 gain chrS chrS 125,686,536- 125,700,782- NA GRAMD3 29 32 9433-9434

125,686,820 125,701 ,077

CGOV20T OV207 inversion / chrS chr22 132,171,882- 32,107,004- NA PRR14L 16 14 9571-28978 translocation 132,172,072 32,107,209

CGOV20T OV207 inversion / chrS chr22 132,633,672- 32,522,708- FSTL4 AP1 B1 P1 8 24 9605-29001 translocation 132,633,926 32,523,053

CGOV20T OV207 gain chrS chrS 149,297,480- 149,326,889- PDE6A PDE6A.1 18 12 9829-9830

149,297,707 149,327,189

CGOV20T OV207 gain chrS chrS 150,270,153- 150, 653, 688- ZNF300 GM2A, SLC36A3 10 12 9840-9853

ISO, 270, 421 I SO, 653, 926

CGOV27T OVISE gain chr4 chr4 159,429,415- 159,442,045- NA RXFP1 5 12 11523-11524

159,429,579 159,442,286

CGOV27T OVISE gain chr1 chr1 94,365,941- 94,624,442- CCLM NA 7 16 1181-1191

94,366,196 94,624,625

CGOV27T OVISE translocation chr1 chr17 10,258,425- 42,431,945- NA GRN, FAM171A2 6 6 133-31349

10,258,589 42,432,160

CGOV27T OVISE translocation chr6 chr7 32,078,287- 28,816,967- TNXB, ATF6B CREBS 10 16 14086-16839

32,078,524 28,817,191

CGOV27T OVISE inversion chr6 chr6 44,364,814- 126,305,304- CDCSL HINT3, TRMT11 22 52 14262-15369

44,365,069 126,305,521

CGOV27T OVISE gain chr6 chr6 52,975,673- 52,997,923- NA GCM1 7 14 14385-14387

52,975,822 52,998,126

CGOV27T OVISE translocation chr6 chr19 136,588,966- 39,987,730- BCLAF1 DLL3 7 8 15492-34512

136,589,208 39,987,897

CGOV27T OVISE inversion / chr7 chr1 S 75,971,553- 65,549,126- YWHAC PARP16 14 4 17799-29740 translocation 75,971,817 65,549,447

CGOV27T OVISE gain chr1 chr1 164,561,576- 164,736,102- PBX1 PBX1.1 9 16 1890-1898

164,561,850 164,736,393

CGOV27T OVISE gain chr8 chr8 67,272,639- 67,658,561- NA C8orf44-SGK3, 8 14 19022-19047

67,272,878 67,658,854 SGK3

CGOV27T OVISE translocation chr1 chr13 167,084,977- 60,348,921- DUSP27 DIAPH3 7 2 1919-27700

167,085,172 60,349,177

CGOV27T OVISE gain chr8 chr8 101,359,613- 101,611 ,643- NA SNX31 15 12 19958-19979

101,359,833 101,612,002

CGOV27T OVISE gain chr1 chr1 182,083,880- 182,227,733- NA LINC01344 10 12 2085-2093

182,084,232 182,227,969

CGOV27T OVISE gain chr9 chr9 3,510,051- 3,948,247- RFX3 GLIS3 22 6 21251-21281

3,510,410 3,948,568

CGOV27T OVISE translocation chr9 chr19 133,536,293- 1 ,086,560- PRDM12 HMHA1 , POLR2E 12 6 22591-33116

133,536,582 1 ,086,780

CGOV27T OVISE inversion / chr10 chr17 35,593,534- 74,857,472- CCNY NA 8 10 22882-32225 translocation 35,593,756 74,857,646

CGOV27T OVISE gain chr10 chr10 59,434,785- 60,907,961- NA NA 12 8 23182-23229

59,434,968 60,908,230

CGOV27T OVISE gain chr1 chr1 202,076,015- 202,087,375- NA GPR37L1 9 10 2352-2354

202,076,417 202,087,612

CGOV27T OVISE translocation chr10 chr13 127,574,414- 20,371,424- DHX32 NA 21 44 24245-27490

127,574,664 20,371,564 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV27T OVISE inversion chr11 chr11 63,567,368- 73,837,846- NA C2CD3 10 6 25139-25216

63,567,576 73,838,215

CGOV27T OVISE inversion / chr11 chr19 64,636,153- 1 ,580,453- EHD1 MBD3 14 12 25147-33124

translocation 64,636,476 1 ,580,749

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV27T OVISE translocation chr17 chr19 76,340,719- 39,891,050- NA MED29, ZFP36 19 24 32230-34500

76,342,292 39,893,195

CGOV27T OVISE gain chr17 chr17 78,978,066- 79,180,016- CHMP6 CEP131 9 6 32245-32254

78,978,272 79,180,250

CGOV27T OVISE gain chr18 chr18 2,897,309- 4,054,829- EMILIN2 DLGAP1 13 16 32359-32446

2,897,520 4,055,077

CGOV27T OVISE inversion chr18 chr18 19,697,607- 22,080,326- NA NA 7 8 32779-32811

19,697,838 22,080,581

CGOV27T OVISE gain chr2 chr2 27,600,892- 28,744,324- SNX17, PLB1 16 10 3320-3409

27,601,182 28,744,590 ZNF513,

PPM1 G

CGOV27T OVISE gain chr2 chr2 27,923,522- 27,936,172- NA NA 6 12 3341-3344

27,923,676 27,936,412

CGOV27T OVISE translocation chr2 chrS 28,183,108- 176,715,847- BRE NSD1 10 20 3370-13494

28,183,429 176,716,041

CGOV27T OVISE gain chr19 chr19 49,897,386- 50,090,094- CCDC1SS PRRG2, PRR12 5 12 34790-34801

49,897,527 50,090,214

CGOV27T OVISE inversion chr19 chr19 53,795,484- 58,761,601- BIRC8 ZNF544 5 4 34887-35107

53,795,829 58,761,867

CGOV27T OVISE gain chr19 chr19 55,527,583- 56,465,704- GP6 NLRP8 11 7 34972-35041

55,527,836 56,465,932

CGOV27T OVISE inversion chr20 chr20 3,757,953- 3,817,214- SPEF1 NA 9 19 35157-35159

3,758,217 3,817,480

CGOV27T OVISE gain chr20 chr20 31 ,683, gee- 33,144,074- BPIFB4 MAP1 LC3A, PIGU 7 6 35533-35587

SI ,684,129 33,144,302

CGOV27T OVISE gain chr20 chr20 32,142,551- 33,307,677- CBFA2T2 NCOA6 7 12 35547-35589

32,142,785 33,307,986

CGOV27T OVISE gain chr20 chr20 46,071,189- 46,088,080- NA NA 21 14 35750-35752

46,071,436 46,088,222

CGOV27T OVISE inversion chr21 chr21 25,360,899- 25,778,503- NA NA 19 22 36444-36448

25,361,244 25,778,809

CGOV27T OVISE gain chr21 chr21 46,793,152- 46,825,530- NA COL18A1, 8 6 37058-37061

46,793,382 46,825,750 COL18A1-AS2

CGOV27T OVISE gain chr2 chr2 54,662,848- 54,784,847- NA SPTBN1 6 18 3758-3761

54,663,149 54,785,134

CGOV27T OVISE translocation chr2 chr8 59,647,569- 73,783,519- NA KCNB2 8 4 3821-19207

59,647,893 73,783,930

CGOV27T OVISE gain chr2 chr2 61 ,340,528- 61,442,982- KIAA1841 USP34 13 20 3842-3851

61 ,340,929 61,443,325

CGOV27T OVISE gain chr2 chr2 79,330,160- 79,343,404- NA REG1A 28 36 4086-4088

79,330,530 79,343,789

CGOV27T OVISE translocation chr1 chr7 33,516,337- 24,448,446- NA NA 7 14 425-16711

33,516,627 24,448,700

CGOV27T OVISE inversion / chr2 chr19 125,383,394- 9,641,136- CNTNAPS ZNF426 6 18 5613-33259 translocation 125,383,535 9,641,470

CGOV27T OVISE translocation chr2 chr14 180,731,187- 59,220,481- ZNF385B NA 19 22 6375-28842

180,731,688 59,221,048

CGOV27T OVISE gain chr2 chr2 228,099,073- 228,270,676- COL4A3, NA 14 6 7038-7046

228,099,360 228,270,990 LOC654841

CGOV27T OVISE loss chr3 chr3 12,996,036- 46,982,181- IQSEC1 CCDC12 6 24 7332-7531

12,996,224 46,982,404 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV27T OVISE gain chr3 chr3 30,585,042- 30,599,157- NA NA 9 8 7448-7449

30,585,374 30,599,457

CCOV27T OVISE translocation chr3 chr6 47,569,081- 15,234,562- NA NA 9 8 7538-13761

47,569,312 15,234,847

CCOV27T OVISE loss chr3 chr3 115,663,199- 116,209,289- LSAMP NA 10 30 8276-8278

115,663,448 116,209,543

CCOV27T OVISE loss chr3 chr3 116,888,605- 117,363,270- NA NA 14 10 8299-8303

116,888,848 117,363,630

CCOV27T OVISE translocation chr3 chr6 122,776,731- 126,250,937- NA NCOA7 26 32 8466-15364

122,777,062 126,251 ,226

CCOV27T OVISE translocation chr3 chr21 148,656,490- 44,763,623- NA NA 20 48 9138-37012

148,656,838 44,763,927

CCOV27T OVISE inversion / chr3 chr20 168,710,446- 17,527,714- NA BFSP1 8 11 9861-35355 translocation 168,710,732 17,527,880

CCOV27T OVISE gain chr3 chr3 168,709,799- 168,770,284- NA NA 30 36 9861-9874

168,710,113 168,770,595

CCOV27T OVISE inversion / chr3 chr20 168,731,634- 17,549,006- NA DSTN, BFSP1 6 8 9866-35357 translocation 168,731,841 17,549,211

CCOV29T OVMANA gain chr2 chr2 160,143,799- 160,165,834- WDSUB1 NA 23 26 1203-1205

160,144,080 160,166,158

CCOV29T OVMANA loss chr3 chr3 60,663,747- 61,187,289- FHIT FHIT.1 9 10 1468-1471

60,663,996 61,187,548

CCOV29T OVMANA gain chr3 chr3 148,852,679- 149,186,137- HPS3 NA 9 14 1727-1731

148,852,880 149,186,435

CCOV29T OVMANA translocation chr6 chr21 559,156- 25,792,716- EXOC2 NA 7 4 2472-6868

559,308 25,793,305

CCOV29T OVMANA inversion chr6 chr6 43,810,829- 43,869,621- NA LINC01512 9 6 2557-2559

43,811,122 43,869,933

CCOV29T OVMANA inversion chr6 chr6 43,846,258- 43,946,236- NA NA 10 2 2558-2560

43,846,518 43,946,516

CCOV29T OVMANA inversion / chr6 chr9 44,048,282- 115,104,832- NA MIR3134 8 16 2561-3532 translocation 44,048,576 115,105,138

CCOV29T OVMANA gain chr6 chr6 74,192,049- 74,453,872- MT01 CD109 6 2 2614-2616

74,192,261 74,454,101

CCOV29T OVMANA gain chr6 chr6 100,724,574- 101,171 ,807- NA ASCC3 9 10 2634-2636

100,724,823 101,171 ,997

CCOV29T OVMANA inversion / chr7 chr19 44,638,971- 39,347,471- NA HNRNPL 13 14 2874-6245 translocation 44,639,323 39,347,758

CCOV29T OVMANA gain chr7 chr7 116,211,062- 116,968,876- LINC01510 NA 21 20 3131-3134

116,211,342 116,969,201

CCOV29T OVMANA gain chr8 chr8 115,473,051- 115,504,014- NA NA 7 6 3336-3337

115,473,411 115,504,264

CCOV29T OVMANA translocation chr9 chr22 74,809,677- 18,218,004- CDA BCL2L13, BID 10 13 3490-6943

74,809,975 18,218,187

CCOV29T OVMANA translocation chr9 chr22 75,209,492- 18,028,664- TMC1 CECR2 7 10 3492-6942

75,209,756 18,028,860

CCOV29T OVMANA gain chr9 chr9 75,727,576- 75,765,577- NA ANXA1 10 16 3494-3496

75,727,843 75,765,883

CCOV29T OVMANA translocation chr9 chr12 92,154,750- 52,641,886- NA KRT7 9 16 3508-4444

92,155,067 52,642,232 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV29T OVMANA loss chr1 chr1 155,309,203- 202,130,818- ASH1 L PTPN7 7 14 404-460

155,309,444 202,131 ,178

CGOV29T OVMANA gain chr11 chr11 64,611,682- 65,081,101- CDC42BPC CDC42EP2 10 4 4046-4049

64,611,917 65,081,393

CGOV29T OVMANA inversion chr11 chr11 65,190,815- 65,224,123- NEAT1 NA 12 8 4051-4052

65,191,121 65,224,447

CGOV29T OVMANA inversion / chr11 chr19 65,484,149- 49,226,433- KAT5, MAMSTR, 8 6 4053-6345 translocation 65,484,374 49,226,574 RNASEH2C RASIP1

CGOV29T OVMANA gain chr1 chr1 159,866,150- 159,882,149- CFAP45, NA 10 2 414-415

159,866,459 159,882,343 MIR4259

CGOV29T OVMANA gain chr11 chr11 134,613,639- 134,626,805- NA NA 8 4 4201-4202

134,613,885 134,627,094

CGOV29T OVMANA translocation chr12 chr17 6,392,937- 38,062,261- NA GSDMB 6 2 4226-5703

6,393,258 38,062,633

CGOV29T OVMANA gain chr1 chr1 178,006,681- 178,058,859- LOC730102 RASAL2, 8 8 436-437

178,006,897 178,059,112 RASAL2-AS1

CGOV29T OVMANA inversion chr12 chr12 93,343,510- 106,109,848- NA CASC18 19 20 4573-4630

93,343,846 106,110,210

CGOV29T OVMANA inversion / chr12 chr14 105,353,514- 100,113,751- NA HHIPL1 6 2 4621-5087 translocation 105,353,909 100,113,985

CGOV29T OVMANA gain chr12 chr12 125,079,244- 125,262,167- NA SCARB1 14 8 4689-4690

125,079,544 125,262,447

CGOV29T OVMANA translocation chr13 chr14 56,478,145- 104,815,107- NA NA 10 6 4821-5102

56,478,407 104,815,435

CGOV29T OVMANA translocation chr13 chr17 99,317,030- 71,172,104- NA SSTR2 13 4 4895-5847

99,317,435 71,172,391

CGOV29T OVMANA gain chr1 chr1 225,665,361- 226,257,737- NA H3F3A, H3F3AP4 16 6 497-506

225,665,641 226,257,995

CGOV29T OVMANA translocation chr14 chr19 57,079,093- 566,814- TMEM260 BSG 8 8 5005-5980

57,079,394 567,013

CGOV29T OVMANA gain chr14 chr14 61 ,973,907- 61,987,231- PRKCH PRKCH.1 16 21 5020-5021

61 ,974,226 61,987,584

CGOV29T OVMANA gain chr14 chr14 61 ,972,638- 62,142,322- PRKCH NA 14 10 5020-5023

61 ,973,000 62,142,619

CGOV29T OVMANA gain chr14 chr14 64,180,018- 64,381,273- SCPP1 SYNE2 21 32 5028-5031

64,180,347 64,381,586

CGOV29T OVMANA gain chr15 chr15 40,326,660- 40,384,907- EIF2AK4, BMF 5 8 5276-5278

40,326,952 40,385,129 SRP14-AS1,

SRP14

CGOV29T OVMANA inversion / chr15 chr19 64,106,948- 45,533,423- HERC1 RELB 18 18 5324-6325 translocation 64,107,269 45,533,693

CGOV29T OVMANA translocation chr16 chr21 11 ,431,837- 44,333,488- NA NDUFV3, 14 16 5389-6912

11 ,432,066 44,333,850 ERVH48-1

CGOV29T OVMANA inversion chr17 chr17 35,508,069- 35,588,679- ACACA ACACA.1 9 6 5689-5690

35,508,422 35,589,014

CGOV29T OVMANA gain chr17 chr17 45,933,668- 45,944,803- SP6 NA 6 14 5758-5759

45,933,959 45,945,122

CGOV29T OVMANA inversion / chr19 chr22 1,046,520- 46,132,253- ABCA7 ATXN10 17 8 5981-7079 translocation 1,046,847 46,132,533

CGOV29T OVMANA inversion chr19 chr19 4,064,459- 23,620,313- ZBTB7A NA 6 8 5984-6150

4,064,749 23,620,465 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV29T OVMANA inversion chr19 chr19 19,790,688- 19,818,542- ZNF101 ZNF14 11 14 6052-6054

19,791,016 19,818,809

CGOV29T OVMANA translocation chr2 chr10 20,821,754- 118,871 ,629- HS1 BP3 SHTN1 9 30 623-3901

20,822,027 118,872,084

CGOV29T OVMANA inversion / chr19 chr22 48,690,031- 50,100,015- C19orf68 NA 9 10 6339-7088 translocation 48,690,342 50,100,328

CGOV29T OVMANA gain chr19 chr19 50,656,109- 50,795,382- IZUM02 MYH14 8 2 6351-6352

50,656,375 50,795,609

CGOV29T OVMANA gain chr2 chr2 27,594,211- 28,271,169- SNX17, EIF2B4 BRE 30 18 640-649

27,594,572 28,271,514

CGOV29T OVMANA gain chr20 chr20 51 ,905, 221- 52,958,046- TSHZ2 NA 44 36 6645-6699

SI ,905,526 52,958,450

CGOV29T OVMANA gain chr20 chr20 60,868,924- 60,992,071- OSBPL2 RBBP8NL 26 18 6745-6749

60,869,293 60,992,406

CGOV29T OVMANA gain chr22 chr22 30,501,497- 30,905,269- HORMAD2 SEC14L4 5 6 7016-7021

30,501,865 30,905,399

CGOV29T OVMANA inversion chrX chrX 115,045,199- 121,087,210- DANT2 NA 8 12 7191-7196

115,045,521 121,087,586

CGOV29T OVMANA gain chr2 chr2 85,151,273- 85,378,014- NA TCF7L1 6 8 888-892

85,151,554 85,378,286

CGOV29T OVMANA inversion chr2 chr2 86,365,101- 197,638,853- PTCD3, GTF3C3 26 20 899-1331

86,365,498 197,639,195 SNORD94

CGOV31T OVTOKO gain chr1 chr1 45,193,489- 45,292,522- C1orf228 PTCH2 11 20 102-103

45,193,779 45,292,786

CGOV31T OVTOKO translocation chr1 chrS 53,827,791- 68,002,152- NA NA 21 8 121-2407

53,828,166 68,002,582

CGOV31T OVTOKO translocation chr2 chr4 158,948,922- 140,140,958- UPP2 NA 15 26 1335-2203

158,949,229 140,141 ,249

CGOV31T OVTOKO inversion / chr2 chr4 159,059,058- 170,857,946- CCDC148-AS1 , LOC100506085 13 12 1337-2235 translocation 159,059,381 170,858,279 CCDC148

CGOV31T OVTOKO inversion / chr2 chr6 161,066,536- 37,140,510- NA PIM1 6 8 1348-2685 translocation 161,066,773 37,140,739

CGOV31T OVTOKO inversion / chr3 chr16 49,163,057- 57,596,015- USP19, LAMB2 ADGRGS 18 16 1682-6008 translocation 49,163,434 57,596,376

CGOV31T OVTOKO inversion / chr3 chr20 112,144,050- 33,994,074- NA UQCC1 12 4 1809-7003 translocation 112,144,386 33,994,404

CGOV31T OVTOKO inversion / chr3 chr20 112,257,096- 34,094,951- ATC3 CEP2S0 5 4 1810-7004 translocation 112,257,457 34,095,171

CGOV31T OVTOKO gain chr3 chr3 169,106,179- 169,577,397- MECOM LRRC31 22 10 1887-1891

169,106,610 169,577,686

CGOV31T OVTOKO inversion chr4 chr4 31 ,820,563- 31,865,372- NA NA 9 10 2025-2026

31 ,820,764 31,865,677

CGOV31T OVTOKO inversion chr4 chr4 140,075,565- 170,823,057- NA NA 10 6 2202-2233

140,075,759 170,823,321

CGOV31T OVTOKO gain chr4 chr4 185,190,941- 185,382,166- NA IRF2 14 16 2260-2266

185,191,294 185,382,574

CGOV31T OVTOKO gain chrS chrS 55,821,052- 55,837,764- C5orf67 C5orf67.1 6 8 2386-2387

55,821,411 55,837,936

CGOV31T OVTOKO inversion / chrS chr14 137,230,624- 62,183,715- PKD2L2 HIF1A 12 28 2481-5444 translocation 137,230,767 62,184,003 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV31T OVTOKO gain chr6 chr6 2,917,258- 3,040,471- NA NA 7 2 2549-2550

2,917,581 3,040,755

CGOV31T OVTOKO inversion / chr7 chr18 6,287,643- 19,979,744- CYTH3 NA 21 12 2896-6555 translocation 6,287,984 19,980,047

CGOV31T OVTOKO gain chr7 chr7 108,811,466- 109,044,317- NA NA 11 30 3148-3151

108,811,711 109,044,617

CGOV31T OVTOKO gain chr7 chr7 134,156,827- 134,384,084- NA NA 11 24 3191-3193

134,157,114 134,384,324

CGOV31T OVTOKO translocation chr1 chr5 155,689,813- 67,908,423- DAP3 NA 8 14 320-2406

155,690,065 67,908,651

CGOV31T OVTOKO gain chr7 chr7 144,843,514- 144,859,900- NA NA 10 6 3233-3234

144,843,733 144,860,198

CGOV31T OVTOKO gain chr8 chr8 56,456,250- 56,475,033- NA NA 9 2 3429-3430

56,456,615 56,475,388

CGOV31T OVTOKO gain chr8 chr8 107,553,291- 107,626,102- OXR1 OXR1.1 10 10 3568-3569

107,553,625 107,626,377

CGOV31T OVTOKO gain chr1 chr1 182,797,526- 183,203,508- NPL LAMC2 8 36 357-361

182,797,774 183,203,803

CGOV31T OVTOKO gain chr9 chr9 130,682,164- 130,940,501- ST6GALNAC4, CIZ1 5 30 3884-3886

130,682,451 130,940,675 PIP5KL1

CGOV31T OVTOKO gain chr9 chr9 132,118,026- 132,299,983- NA NA 9 14 3889-3893

132,118,283 132,300,215

CGOV31T OVTOKO translocation chr9 chr17 139,407,332- 46,089,378- NOTCH1 NA 14 4 3904-6302

139,407,721 46,089,721

CGOV31T OVTOKO gain chr10 chr10 11 ,914,996- 11,961,222- PROSER2, UPF2 14 14 3959-3960

11 ,915,356 11,961,600 PROSER2-AS1

CGOV31T OVTOKO gain chr10 chr10 104,391,396- 104,411 ,173- SUFU TRIM8 14 12 4268-4269

104,391,663 104,411 ,569

CGOV31T OVTOKO gain chr10 chr10 105,144,486- 105,247,460- TAF5, USMG5 NEURL1-AS1 19 26 4272-4276

105,144,882 105,247,794

CGOV31T OVTOKO translocation chr10 chr13 127,574,437- 20,371,277- DHX32 NA 70 42 4336-5164

127,574,729 20,371,597

CGOV31T OVTOKO gain chr1 chr1 230,889,898- 230,915,183- CAPN9 CAPN9.1 15 6 436-437

230,890,230 230,915,454

CGOV31T OVTOKO translocation chr1 chr4 230,919,848- 39,309,409- CAPN9 MIR1273H, RFC1 8 20 438-2040

230,920,062 39,309,656

CGOV31T OVTOKO gain chr11 chr11 65,056,718- 65,235,683- POLA2 NA 12 10 4569-4570

65,057,063 65,236,024

CGOV31T OVTOKO gain chr11 chr11 76,475,898- 76,505,505- NA TSKU 6 4 4628-4629

76,476,158 76,505,786

CGOV31T OVTOKO gain chr11 chr11 118,207,995- 118,639,747- CD3D DDX6 7 2 4709-4713

118,208,119 118,640,016

CGOV31T OVTOKO translocation chr12 chr14 9,531 ,080- 56,115,291- LOC101930452, KTN1 20 20 4760-5426

9,531 ,403 56,115,630 LOC101928030

CGOV31T OVTOKO translocation chr12 chr14 9,831 ,722- 55,990,770- CLEC2D NA 11 9 4766-5423

9,832,075 55,991,027

CGOV31T OVTOKO gain chr12 chr12 105,687,054- 105,723,615- NA C12or(75, 21 18 5076-5080

105,687,319 105,723,938 KCCAT198

CGOV31T OVTOKO gain chr12 chr12 109,870,833- 110,087,452- MY01 H NA 10 6 5086-5089

109,871,215 110,087,691 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV31T OVTOKO translocation chr14 chr20 61 ,935,882- 47,959,786- PRKCH NA 39 30 5437-7044

61 ,936,223 47,960,080

CCOV31T OVTOKO translocation chr14 chr20 62,148,735- 47,852,734- HIF1A-AS1 DDX27 6 12 5442-7043

62,148,950 47,853,122

CCOV31T OVTOKO translocation chr14 chr17 74,228,758- 36,085,408- MIR4505, HNF1 B 18 20 5467-6249

74,229,054 36,085,760 ELMSAN1

CCOV31T OVTOKO inversion / chr14 chr19 103,763,613- 45,313,413- NA BCAM 6 4 5524-6816 translocation 103,763,928 45,313,688

CCOV31T OVTOKO gain chr15 chr15 62,332,785- 62,390,378- VPS13C NA 20 14 5744-5745

62,333,078 62,390,722

CCOV31T OVTOKO gain chr15 chr15 65,442,256- 65,569,622- CLPX PARP16 6 28 5748-5749

65,442,393 65,569,945

CCOV31T OVTOKO gain chr16 chr16 11 ,175,863- 11,641,342- CLEC16A LITAF 10 16 5880-5884

11 ,176,279 11,641,680

CCOV31T OVTOKO gain chr17 chr17 9,707,734- 9,769,079- CSC1 L2 CLP2R 8 6 6113-6114

9,708,110 9,769,446

CCOV31T OVTOKO gain chr17 chr17 18,004,034- 18,128,857- DRC2 LLCL1 6 16 6135-6137

18,004,305 18,129,140

CCOV31T OVTOKO gain chr17 chr17 26,817,813- 26,943,533- SLC13A2 SPAC5-AS1 , 14 32 6215-6216

26,818,153 26,943,819 SCK494,

KIAA0100

CCOV31T OVTOKO inversion / chr19 chr20 10,183,710- 47,700,000- C3P1 CSE1 L 15 10 6672-7042 translocation 10,184,063 47,700,429

CCOV31T OVTOKO gain chr20 chr20 407,281- 742,141- RBCK1 SLC52A3 8 14 6862-6866

407,466 742,472

CCOV31T OVTOKO gain chr2 chr2 42,219,981- 42,456,319- NA EML4 18 18 689-692

42,220,323 42,456,657

CCOV31T OVTOKO inversion chr20 chr20 14,058,148- 14,374,583- MACROD2 MACROD2.1 25 20 6906-6907

14,058,518 14,374,911

CCOV31T OVTOKO gain chr20 chr20 14,961,408- 15,106,343- MACROD2 MACROD2.1 8 5 6910-6913

14,961,649 15,106,677

CCOV31T OVTOKO gain chr22 chr22 38,665,586- 38,879,938- TMEM184B KDELR3, DDX17 14 4 7321-7323

38,665,971 38,880,229

CCOV31T OVTOKO gain chr22 chr22 50,289,639- 50,474,460- NA NA 18 16 7358-7361

50,289,990 50,474,769

CCOV31T OVTOKO gain chr22 chr22 50,309,831- 50,354,108- CRELD2, ALC12 PIM3, MIR6821 6 6 7359-7360

50,309,961 50,354,326

CCOV31T OVTOKO gain chrX chrX 23,795,932- 23,881,595- NA APOO 7 10 7393-7394

23,796,150 23,881,814

CCOV31T OVTOKO gain chrX chrX 149,436,621- 149,543,213- NA MAMLD1 30 32 7478-7479

149,436,928 149,543,600

CCOV31T OVTOKO gain chr1 chr1 30,497,577- 30,610,915- LOC101929406 NA 13 16 77-78

30,497,962 30,611,251

CCOV31T OVTOKO inversion / chr1 chr19 31 ,679,082- 5,013,882- NKAIN1 KDM4B 12 2 82-6668 translocation 31 ,679,267 5,014,215

CCOV31T OVTOKO translocation chr1 chr7 33,516,312- 24,448,403- NA NA 18 14 88-2933

33,516,612 24,448,725

CCOV35T RMG-I inversion chr2 chr2 210,995,957- 211,078,257- KANSU L ACADL 9 16 1013-1014

210,996,219 211,078,548

CCOV35T RMG-I gain chr2 chr2 230,702,693- 230,752,996- TRIP12 TRIP12.1 6 4 1034-1035

230,702,970 230,753,162 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV35T RMG-I translocation chr3 chr19 10,116,533- 1 ,866,797- FANCD2 KLF16 10 1085-5232

10,116,826 1 ,867,152

CGOV35T RMG-I loss chr3 chr3 69,975,861- 71,008,000- MITF FOXP1 11 16 1146-1147

69,976,199 71,008,246

CGOV35T RMG-I gain chr3 chr3 101,869,173- 101,889,323- NA NA 17 30 1228-1229

101,869,664 101,889,647

CGOV35T RMG-I loss chr3 chr3 116,214,030- 116,778,085- NA NA 17 12 1246-1247

116,214,404 116,778,452

CGOV35T RMG-I translocation chr3 chr4 177,017,907- 110,360,493- LINC00501 SEC24B 9 8 1325-1541

177,018,135 110,360,796

CGOV35T RMG-I inversion / chr3 chr17 187,596,918- 80,034,864- NA FASN 20 6 1329-5119 translocation 187,597,294 80,035,202

CGOV35T RMG-I gain chr1 chr1 47,434,303- 48,116,078- NA NA 17 20 139-143

47,434,545 48,116,351

CGOV35T RMG-I inversion / chr4 chr17 19,525,610- 44,215,238- NA KANSU 16 8 1432-4615 translocation 19,525,905 44,215,482

CGOV35T RMG-I translocation chr1 chr18 52,043,874- 11,876,856- NA GNAL 15 22 147-5141

52,044,155 11,877,136

CGOV35T RMG-I gain chr4 chr4 74,440,407- 74,718,983- RASSF6 PF4V1 40 28 1510-1514

74,440,719 74,719,378

CGOV35T RMG-I translocation chr1 chr22 55,029,787- 19,435,991- ACOT11 C22orf39, UFD1 L 6 4 156-5915

55,030,040 19,436,173

CGOV35T RMG-I gain chr4 chr4 142,972,390- 143,102,426- INPP4B INPP4B.1 9 16 1618-1619

142,972,679 143,102,631

CGOV35T RMG-I gain chr4 chr4 159,203,262- 159,585,981- NA C4orf46 24 30 1658-1678

159,203,598 159,586,314

CGOV35T RMG-I inversion / chr4 chr6 159,323,369- 30,651,149- NA PPP1 R18, NRM 22 28 1661-2032 translocation 159,323,746 30,651,472

CGOV35T RMG-I translocation chr4 chr19 159,423,935- 45,249,382- NA BCL3 22 28 1667-5459

159,424,242 45,249,679

CGOV35T RMG-I loss chr4 chr4 181,588,466- 182,073,090- NA LINC00290 28 26 1724-1727

181,588,896 182,073,509

CGOV35T RMG-I translocation chr5 chr17 13,231,538- 32,521,417- NA NA 14 8 1803-4533

13,231,770 32,521,881

CGOV35T RMG-I translocation chr5 chr18 56,281,932- 3,847,656- NA DLGAP1 16 18 1844-5136

56,282,301 3,847,949

CGOV35T RMG-I translocation chr5 chr18 56,285,342- 3,843,195- NA DLGAP1 18 10 1845-5135

56,285,688 3,843,611

CGOV35T RMG-I gain chr5 chr5 56,566,487- 56,662,343- NA NA 14 18 1846-1847

56,566,891 56,662,691

CGOV35T RMG-I loss chr5 chrS 58,655,910- 59,672,930- PDE4D PDE4D.1 19 18 1853-1857

58,656,175 59,673,294

CGOV35T RMG-I translocation chr1 chr19 81 ,690,188- 55,616,926- NA PPP1 R12C 8 16 210-5560

81 ,690,456 55,617,222

CGOV35T RMG-I gain chr6 chr6 92,333,550- 92,389,929- CASC6 CASC6.1 8 6 2172-2174

92,333,874 92,390,191

CGOV35T RMG-I gain chr7 chr7 1,563,866- 1 ,690,747- NA NA 10 10 2267-2269

1,564,186 1 ,691,050 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV35T RMG-I translocation chr7 chr14 100,750,845- 62,020,788- NA PRKCH, 14 10 2441-3966

100,751,196 62,021,123 LOC101927780

CGOV35T RMG-I translocation chr7 chr14 100,749,920- 62,023,328- NA LOC101927780 9 8 2441-3967

100,750,111 62,023,635

CGOV35T RMG-I gain chr8 chr8 128,985,368- 129,289,808- PVT1 NA 5 4 2676-2678

128,985,601 129,290,015

CGOV35T RMG-I gain chr9 chr9 4,440,689- 4,697,333- NA CDC37L1 18 4 2698-2699

4,440,968 4,697,739

CGOV35T RMG-I translocation chr9 chr10 74,774,631- 32,867,802- CDA CCDC7 15 6 2829-2993

74,774,983 32,868,067

CGOV35T RMG-I loss chr9 chr9 108,101,513- 108,840,239- SLC44A1 NA 16 12 2865-2866

108,101,788 108,840,568

CGOV35T RMG-I gain chr9 chr9 111,917,244- 111,928,445- FRRS1 L FRRS1 L.1 9 16 2869-2870

111,917,554 111,928,709

CGOV35T RMG-I gain chr9 chr9 116,116,368- 116,386,149- BSPRY NA 15 12 2877-2879

116,116,665 116,386,397

CGOV35T RMG-I gain chr9 chr9 117,881,376- 118,258,542- TNC, NA 14 14 2881-2882

117,881,694 118,258,821 LOC101928748

CGOV35T RMG-I inversion/ chr9 chr16 135,965,929- 2,929,792- CELP FLYWCH2 14 8 2903-4321 translocation 135,966,254 2,930,155

CGOV35T RMG-I translocation chr9 chr17 139,804,972- 79,899,934- TRAF2 PYCR1 , 12 12 2912-5118

139,805,256 79,900,313 MYADML2

CGOV35T RMG-I translocation chr9 chr17 140,074,667- 79,658,025- ANAPC2 HGS, MIR6786 12 14 2915-5117

140,074,993 79,658,287

CGOV35T RMG-I gain chr10 chr10 61,603,481- 61,689,679- CCDC6 NA 8 16 3065-3066

61,603,766 61,689,955

CGOV35T RMG-I gain chr10 chr10 75,511,359- 75,757,457- SEC24C VCL 11 6 3085-3088

75,511,718 75,757,931

CGOV35T RMG-I gain chr10 chr10 82,079,252- 82,287,769- NA LOC102723703, 8 10 3099-3101

82,079,463 82,288,031 LOC101929574

CGOV35T RMG-I translocation chr10 chr20 98,865,871- 49,245,215- SLIT1-AS1, FAM65C 24 14 3109-5735

98,866,155 49,245,458 SLIT1

CGOV35T RMG-I translocation chr10 chr20 99,439,407- 33,626,294- PI4K2A, AVPI1 TRPC4AP 18 20 3113-5690

99,439,773 33,626,569

CGOV35T RMG-I gain chr10 chr10 99,955,106- 100,090,517- R3HCC1 L NA 8 16 3115-3117

99,955,415 100,090,703

CGOV35T RMG-I translocation chr10 chr13 127,574,409- 20,371,253- DHX32 NA 72 73 3163-3707

127,574,761 20,371,596

CGOV35T RMG-I gain chr11 chr11 495,060- 647,091- PTDSS2, RNH1 DEAF1 8 10 3187-3188

495,292 647,259

CGOV35T RMG-I gain chr11 chr11 11,740,219- 11,949,248- NA USP47 7 10 3205-3206

11,740,485 11,949,553

CGOV35T RMG-I gain chr11 chr11 86,244,082- 86,286,466- ME3 ME3.1 11 4 3330-3331

86,244,375 86,286,697

CGOV35T RMG-I gain chr1 chr1 155,040,460- 155,050,711- EFNA4, EFNA3 7 12 343-344

155,040,621 155,050,968 LOC100505666

CGOV35T RMG-I translocation chr12 chr13 53,642,953- 44,973,643- MFSD5 SERP2, TUSC8 11 4 3497-3759

53,643,199 44,973,899

CGOV35T RMG-I gain chr12 chr12 56,347,778- 56,524,958- DGKA, PMEL ESYT1 9 14 3502-3503

56,348,069 56,525,282 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV35T RMG-I gain chr13 chr13 40,457,616- 40,858,624- NA NA 15 8 3747-3753

40,457,878 40,858,890

CGOV35T RMG-I gain chr13 chr13 40,534,118- 40,820,477- NA NA 10 14 3748-3752

40,534,404 40,820,953

CGOV35T RMG-I gain chr13 chr13 40,899,130- 41,131,926- NA FOX01 16 12 3754-3756

40,899,367 41,132,201

CGOV35T RMG-I inversion / chr13 chr19 45,927,875- 40,966,046- TPT1-AS1 BLVRB 6 6 3762-5421 translocation 45,928,184 40,966,386

CGOV35T RMG-I gain chr13 chr13 78,023,309- 78,135,155- NA SCEL 6 18 3838-3839

78,023,572 78,135,448

CGOV35T RMG-I inversion chr1 chr1 185,484,893- 185,524,479- NA LINC01350 10 10 387-388

185,485,268 185,524,696

CGOV35T RMG-I translocation chr13 chr14 110,911,138- 73,777,339- COL4A1 NUMB 11 12 3914-3979

110,911,489 73,777,595

CGOV35T RMG-I gain chr15 chr15 60,385,586- 61,005,885- NA RORA 16 16 4268-4270

60,385,885 61,006,156

CGOV35T RMG-I gain chr1 chr1 226,044,727- 226,141 ,068- TMEM63A NA 18 4 432-434

226,045,077 226,141 ,407

CGOV35T RMG-I gain chr1 chr1 15,930,036- 16,069,173- NA SLC25A34, 25 16 43-44

15,930,480 16,069,566 TMEM82

CGOV35T RMG-I inversion / chr1 chr15 235,081,873- 90,642,341- NA IDH2 15 18 449-4304 translocation 235,082,300 90,642,647

CGOV35T RMG-I gain chr1 chr1 235,114,880- 235,150,456- NA NA 8 20 450-452

235,115,234 235,150,815

CGOV35T RMG-I gain chr17 chr17 37,901,219- 37,954,143- GRB7 IKZF3 13 10 4571-4573

37,901,519 37,954,490

CGOV35T RMG-I gain chr17 chr17 46,656,611- 46,779,457- HOXB3, NA 20 8 4653-4654

46,656,980 46,779,781 HOXB4,

MIR10A

CGOV35T RMG-I loss chr17 chr17 54,289,943- 54,800,206- ANKFN1 NA 20 14 4855-4881

54,290,233 54,800,527

CGOV35T RMG-I inversion / chr17 chr22 57,947,392- 36,867,205- TUBD1 TXN2 8 14 5007-5969 translocation 57,947,720 36,867,428

CGOV35T RMG-I inversion chr17 chr17 59,590,593- 61,490,818- NA TANC2 24 44 5038-5075

59,590,929 61,491,172

CGOV35T RMG-I gain chr17 chr17 76,254,081- 76,504,035- LOC100996291 DNAH17-AS1 , 14 16 5107-5109

76,254,442 76,504,373 DNAH17

CGOV35T RMG-I inversion chr18 chr18 63,225,505- 63,883,262- NA NA 14 6 5206-5208

63,225,696 63,883,625

CGOV35T RMG-I gain chr19 chr19 4,596,344- 4,607,262- NA NA 13 6 5238-5239

4,596,644 4,607,558

CGOV35T RMG-I gain chr19 chr19 45,047,667- 45,348,956- CEACAM22P PVRL2 21 8 5456-5461

45,048,066 45,349,334

CGOV35T RMG-I gain chr19 chr19 45,356,071- 45,506,827- PVRL2 RELB 17 36 5462-5463

45,356,364 45,507,107

CGOV35T RMG-I gain chr2 chr2 20,397,302- 20,993,360- SDC1 LDAH 11 18 556-559

20,397,530 20,993,647

CGOV35T RMG-I gain chr20 chr20 277,953- 415,009- ZCCHC3 RBCK1 , 33 10 5584-5586

278,327 415,379 TBC1 D20 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV35T RMC-I gain chr22 chr22 43,538,999- 43,561,300- MCAT TSPO, TTLL12 14 10 5985-5986

43,539,315 43,561,651

CCOV35T RMC-I gain chrX chrX 107,437,529- 107,447,876- COL4A6 COL4A6.1 15 12 6076-6077

107,437,837 107,448,244

CCOV35T RMC-I gain chr2 chr2 62,524,542- 62,534,850- NA NA 9 26 657-658

62,524,891 62,535,103

CCOV35T RMC-I inversion chr2 chr2 98,561,421- 106,468,304- TMEM131 NCK2 7 10 824-845

98,561,632 106,468,571

CCOV35T RMC-I inversion / chr1 chr17 17,973,191- 73,842,051- ARHCEF10L UNC13D, WBP2 8 10 82-5103 translocation 17,973,550 73,842,404

CCOV35T RMC-I inversion / chr2 chr12 101,957,143- 105,854,142- NA NA 13 4 836-3603 translocation 101,957,520 105,854,486

CCOV35T RMC-I gain chr2 chr2 113,213,609- 113,517,782- NA CKAP2L 21 16 867-873

113,213,928 113,518,198

CCOV39T TOV-21 G gain chr7 chr7 135,660,988- 135,675,252- LUZP6, MTPN NA 6 18 11203-11205

135,661,336 135,675,593

CCOV39T TOV-21 G gain chr10 chr10 56,445,968- 56,469,374- PCDH15 PCDH15.1 25 30 14790-14792

56,446,280 56,469,610

CCOV39T TOV-21 G inversion chrX chrX 111,711,711- 111,761 ,408- NA NA 12 14 25736-25737

111,711,929 111,761 ,630

CCOV39T TOV-21 G inversion / chr3 chr6 182,655,042- 158,638,635- DCUN1 D1 NA 11 8 5460-9964 translocation 182,655,372 158,638,863

CCOV39T TOV-21 G translocation chr5 chr22 106,354,398- 29,065,252- NA TTC28 15 6 7994-24858

106,354,810 29,066,089

CCOV7T ES-2 inversion / chr8 chr17 34,254,100- 10,200,133- NA MYH13 7 10 11551-21283 translocation 34,254,399 10,200,456

CCOV7T ES-2 inversion / chr8 chr17 34,301,927- 54,541,234- NA ANKFN1 13 2 11552-21740 translocation 34,302,192 54,541,520

CCOV7T ES-2 inversion / chr8 chr17 34,601,593- 26,244,222- NA NA 7 4 11555-21460 translocation 34,601,821 26,244,396

CCOV7T ES-2 translocation chr8 chr17 36,532,588- 8,507,720- NA MYH10 5 6 11557-21259

36,532,753 8,507,880

CCOV7T ES-2 inversion / chr8 chr9 47,328,979- 14,425,726- NA NA 8 6 11596-13099 translocation 47,329,208 14,425,942

CCOV7T ES-2 translocation chr11 chr18 62,165,874- 886,920- ASRCL1 NA 5 4 15887-22066

62,166,165 887,139

CCOV7T ES-2 gain chr11 chr11 63,363,717- 112,557,158- PLA2C16 NA 7 20 15898-17747

63,363,903 112,557,390

CCOV7T ES-2 gain chr11 chr11 63,644,301- 97,049,648- MARK2 NA 27 32 15906-17023

63,644,587 97,049,876

CCOV7T ES-2 loss chr11 chr11 63,681,166- 64,835,582- MARK2, RCOR2 NA 5 14 15909-15954

63,681,340 64,835,699

CCOV7T ES-2 loss chr11 chr11 64,675,092- 98,194,026- ATG2A NA 7 10 15948-17028

64,675,383 98,194,245

CCOV7T ES-2 loss chr11 chr11 67,068,374- 69,065,540- ANKRD13D, MYEOV 12 16 16007-16055

67,068,669 69,065,862 SSH3

CCOV7T ES-2 gain chr11 chr11 67,834,244- 96,842,240- CHKA NA 29 58 16021-17015

67,834,516 96,842,486 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene 1 Gene 2 read pairs reads id

CGOV7T ES-2 gain chr11 chr11 69,443,222- 69,600,079- NA NA 10 14 16089-16115

69,443,434 69,600,285

CGOV7T ES-2 gain chr11 chr11 69,457,545- 70,472,305- CCND1 SHANK2-AS1, 18 34 16091-16258

69,457,796 70,472,624 SHANK2

CGOV7T ES-2 inversion chr11 chr11 70,139,383- 101,292,918- PPFIA1 NA 13 12 16192-17344

70,139,617 101,293,105

CGOV7T ES-2 inversion chr11 chr11 70,138,790- 102,057,947- PPFIA1 YAP1 9 22 16192-17448

70,139,026 102,058,224

CGOV7T ES-2 loss chr11 chr11 70,355,341- 102,680,364- SHANK2 WTAPP1 16 26 16237-17536

70,355,586 102,680,674

CGOV7T ES-2 loss chr11 chr11 70,398,188- 99,097,164- SHANK2 CNTN5 33 12 16246-17062

70,398,471 99,097,427

CGOV7T ES-2 gain chr11 chr11 70,462,467- 99,215,199- SHANK2 CNTN5 21 18 16255-17077

70,462,765 99,215,516

CGOV7T ES-2 loss chr11 chr11 70,494,589- 77,540,216- SHANK2 AAMDC 8 14 16262-16494

70,494,889 77,540,434

CGOV7T ES-2 inversion chr11 chr11 71 ,182,664- 74,444,760- NADSYN1, CHRDL2 20 4 16350-16406

71 ,182,901 74,444,954 MIR6754

CGOV7T ES-2 inversion chr11 chr11 71 ,975,919- 94,493,460- NA NA 6 8 16392-16908

71 ,976,071 94,493,742

CGOV7T ES-2 inversion chr11 chr11 75,221,027- 101,733,351- GDPD5 NA 36 52 16411-17402

75.221.393 101,733,737

CGOV7T ES-2 inversion chr11 chr11 75,245,153- 90,405,252- NA DISCI FP1 22 70 16417-16597

75.245.393 90,405,494

CGOV7T ES-2 gain chr11 chr11 75,760,938- 75,782,270- UVRAG UVRAG.1 6 8 16477-16478

75,761,219 75,782,470

CGOV7T ES-2 inversion chr11 chr11 76,547,715- 99,091,197- NA CNTNS 18 18 16484-17061

76,547,896 99,091,443

CGOV7T ES-2 inversion chr11 chr11 90,682,113- 96,208,544- NA JRKL-AS1 19 28 16641-16984

90,682,362 96,208,823

CGOV7T ES-2 inversion chr11 chr11 90,688,932- 96,170,689- NA NA 14 30 16643-16982

90,689,200 96,170,923

CGOV7T ES-2 inversion chr11 chr11 90,882,507- 95,293,142- NA NA 15 10 16661-16936

90,882,743 95,293,426

CGOV7T ES-2 inversion chr11 chr11 90,897,093- 99,297,428- NA CNTNS 13 10 16664-17091

90,897,262 99,297,606

CGOV7T ES-2 inversion chr11 chr11 90,909,161- 95,811,607- NA MAML2 13 18 16667-16975

90,909,387 95,811,834

CGOV7T ES-2 loss chr11 chr11 91 ,699,672- 94,884,773- NA LOC101929295 34 38 16769-16913

91 ,700,148 94,885,104

CGOV7T ES-2 gain chr11 chr11 95,294,107- 101,999,431- NA YAP1 12 12 16936-17434

95,294,409 101,999,764

CGOV7T ES-2 inversion chr11 chr11 95,494,120- 102,678,914- NA WTAPP1 18 22 16943-17536

95,494,534 102,679,211

CGOV7T ES-2 inversion chr11 chr11 95,497,000- 102,370,287- FAM76B NA 12 14 16944-17487

95,497,244 102,370,545

CGOV7T ES-2 inversion chr11 chr11 95,842,262- 102,091 ,251- MAML2 YAP1 17 26 16978-17458

95,842,577 102,091 ,510

CGOV7T ES-2 inversion / chr11 chr16 96,533,163- 78,487,877- NA WWOX 6 14 16990-20987 translocation 96,533,394 78,488,112 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV7T ES-2 inversion chr12 chr12 126,843,968- 126,893,213- NA NA 7 10 18662-18663

126,844,204 126,893,473

CGOV7T ES-2 gain chr12 chr12 126,844,906- 126,902,155- NA NA 7 14 18662-18664

126,845,099 126,902,422

CGOV7T ES-2 translocation chr13 chrX 34,132,926- 52,621,049- STARD13 NA 5 18 18812-24754

34,133,079 52,621,282

CGOV7T ES-2 translocation chr13 chrX 37,670,591- 120,567,540- NA NA 7 4 18832-25025

37,670,790 120,567,767

CGOV7T ES-2 gain chr14 chr14 45,725,675- 45,742,493- MIS18BP1 NA 7 11 19329-19330

45,725,822 45,742,702

CGOV7T ES-2 translocation chr1 chr7 198,052,737- 69,507,026- NA AUTS2 15 22 1964-10425

198,052,970 69,507,250

CGOV7T ES-2 gain chr1S chr1 S 48,926,797- 48,946,403- FBN1 NA 6 10 20092-20093

48,926,960 48,946,630

CGOV7T ES-2 gain chr1S chr1 S 89,175,091- 89,207,007- AEN, ISC20 NA 5 10 20332-20333

89,175,273 89,207,229

CGOV7T ES-2 loss chr17 chr17 10,265,629- 11,253,731- MYH13 SHISA6 12 14 21285-21291

10,265,936 11,253,995

CGOV7T ES-2 gain chr18 chr18 58,263,102- 58,313,043- NA NA 6 16 22551-22552

58,263,305 58,313,225

CGOV7T ES-2 loss chrX chrX 46,450,008- 154,561 ,081- CHST7 CLIC2 5 6 24688-25161

46,450,245 154,561 ,273

CGOV7T ES-2 gain chrX chrX 46,656,220- 46,679,582- NA NA 5 4 24690-24691

46,656,469 46,679,737

CGOV7T ES-2 gain chrX chrX 98,206,834- 99,166,449- NA XRCC6P5 5 16 24914-24920

98,206,982 99,166,630

CGOV7T ES-2 translocation chr2 chr8 30,645,248- 116, 405, 696- NA NA 6 6 2718-12514

30,645,435 l ie, 405, 884

CGOV7T ES-2 inversion / chr2 chr3 125,843,481- 13,518,574- NA HDAC11 , 20 24 3385-4274 translocation 125,843,685 13,518,791 HDAC11-AS1

CGOV7T ES-2 inversion / chr3 chr19 78,186,906- 51, 566, 729- NA KLK13 9 12 4639-22994 translocation 78,187,067 SI, 567, 013

CGOV7T ES-2 inversion / chr3 chr9 171,402,818- 91,926,473- PLD1 CKS2, MIR3153 5 6 5579-13452 translocation 171,402,968 91,926,607

CGOV7T ES-2 translocation chr4 chr11 1,680,816- 99,256,316- FAM53A CNTN5 19 98 5911-17083

1,681 ,111 99,256,564

CGOV7T ES-2 translocation chr4 chr11 1,800,826- 69,535,595- FGFR3 NA 41 68 5931-16107

1,801 ,143 69,535,943

CGOV7T ES-2 translocation chr4 chr11 2,775,449- 99,502,088- NA CNTN5 37 32 5948-17120

2,775,774 99,502,454

CGOV7T ES-2 inversion / chr4 chr11 2,953,441- 70,343,019- NOP14-AS1, SHANK2 9 12 5958-16234 translocation 2,953,662 70,343,235 NOP14

CGOV7T ES-2 loss chr4 chr4 5,857,816- 6,648,725- CRMP1 MRFAP1 34 70 6045-6053

5,858,089 6,649,036

CGOV7T ES-2 translocation chr4 chr11 5,883,839- 94,591,218- CRMP1 AMOTL1 24 32 6047-16909

5,884,184 94,591,433

CGOV7T ES-2 inversion / chr4 chr11 5,888,153- 67,840,717- CRMP1 CHKA 17 20 6048-16022 translocation 5,888,402 67,840,933 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CC0V7T ES-2 translocation chr4 chr11 10,441,310- 70,127,971- ZNF518B PPFIA1, 5 20 6102-16190

10,441,519 70,128,114 MIR548K

CC0V7T ES-2 gain chr4 chr4 22,013,882- 22,445,551- NA ADGRA3 5 4 6169-6174

22,014,086 22,445,819

CC0V7T ES-2 gain chr4 chr4 22,164,529- 30,844,482- NA PCDH7 10 12 6170-6196

22,164,772 30,844,741

CC0V7T ES-2 translocation chr4 chr10 37,394,408- 117,115,194- NWD2 ATRNL1 5 18 6243-15299

37,394,653 117,115,390

CC0V7T ES-2 loss chr6 chr6 1,615,418- 2,334,662- FOXC1 GMDS-AS1 6 6 7817-7822

1,615,644 2,334,981

CC0V7T ES-2 translocation chr6 chr11 15,625,240- 99,373,846- DTNBP1 CNTN5 14 12 7993-17101

15,625,458 99,374,073

CC0V7T ES-2 gain chr6 chr6 162,253,697- 162,835,872- PARK2 PARK2.1 17 30 9323-9328

162,254,064 162,836,161

CC0V7T ES-2 inversion chr6 chr6 168,947,206- 169,109,931- SMOC2 NA 5 10 9501-9506

168,947,416 169,110,152

CG0V11TJ KK gain chr3 chr3 47,253,248- 47,351,612- KIF9-AS1 KLHL18 6 8 10356-10360

47,253,501 47,351,943

CG0V11TJ KK gain chr3 chr3 58,908,846- 59,949,626- C3orf67-AS1, FHIT 10 10 10546-10582

58,909,069 59,949,883 C3orf67

CG0V11TJ KK loss chr3 chr3 122,097,425- 143,643,296- CCDC58 NA 6 14 12263-12576

122,097,709 143,643,553

CG0V11TJ KK gain chr3 chr3 146,974,038- 147,302,885- NA NA 6 6 12686-12698

146,974,253 147,303,075

CG0V11TJ KK gain chr3 chr3 149,173,664- 149,679,748- NA RNF13, PFN2 30 24 12766-12838

149,174,064 149,680,083

CG0V11TJ KK gain chr3 chr3 168,654,283- 168,807,609- NA MECOM 19 46 13469-13487

168,654,596 168,807,949

CG0V11TJ KK translocation chr3 chr15 171,752,949- 99,550,503- FNDC3B PGPEP1 L 17 2 13607-44076

171,753,140 99,551,051

CG0V11TJ KK gain chr3 chr3 187,389,255- 187,988,456- SST LPP 10 16 14161-14186

187,389,604 187,988,642

CG0V11TJ KK gain chr4 chr4 160,475,080- 160,514,441- NA NA 14 16 15574-15577

160,475,458 160,514,677

CG0V11TJ KK loss chr5 chr5 59,150,727- 59,646,159- PDE4D PDE4D.1 7 2 16502-16504

59,150,968 59,646,507

CG0V11TJ KK gain chr5 chr5 126,167,877- 126,182,174- LMNB1 NA 11 10 17549-17550

126,168,113 126,182,496

CG0V11TJ KK inversion / chr1 chr15 111,507,204- 37,905,022- LRIF1 NA 13 22 1756-43131 translocation 111,507,555 37,905,267

CG0V11TJ KK translocation chr5 chr17 149,509,160- 42,292,445- PDGFRB UBTF 13 22 17962-46260

149,509,421 42,292,610

CG0V11TJ KK inversion chr6 chr6 4,087,692- 5,895,141- C6orF201 NA 14 14 18535-18573

4,087,945 5,895,692

CG0V11TJ KK gain chr6 chr6 8,006,679- 8,020,810- BLOC1S5- BLOC1S5- 15 4 18608-18611

8,006,970 8,021,052 TXNDC5 TXNDC5.1

CG0V11TJ KK inversion chr6 chr6 10,483,378- 38,622,458- NA NA 7 4 18642-19309

10,483,658 38,622,664 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CG0V11TJ KK inversion chr6 chr6 13,243,793- 34,057,725- PHACTR1 GRM4 14 12 18726-19209

13,244,082 34,057,980

CG0V11TJ KK inversion chr6 chr6 25,606,713- 48,272,571- LRRC16A NA 6 2 18966-19457

25,606,920 48,272,803

CG0V11TJ KK inversion chr6 chr6 28,232,655- 63,596,412- NKAPL, NA 18 8 19022-19682

28,232,947 63,596,714 ZSCAN26

CG0V11TJ KK gain chr6 chr6 34,203,648- 34,646,944- HMGA1 , C6orf106 25 24 19211-19239

34,204,043 34,647,322 MIR6835

CG0V11TJ KK loss chr6 chr6 34,657,115- 37,129,085- C6orf106 NA 16 4 19241-19278

34,657,382 37,129,359

CG0V11TJ KK inversion chr6 chr6 43,186,784- 64,837,799- CUL9 EYS 10 14 19382-19705

43,187,095 64,838,063

CG0V11TJ KK inversion chr6 chr6 44,096,542- 46,481,860- TMEM63B, LOC101926898 15 12 19394-19429

44,096,884 46,482,186 MRPL14

CG0V11TJ KK gain chr6 chr6 49,556,253- 50,802,104- NA TFAP2B 19 16 19485-19502

49,556,523 50,802,357

CG0V11TJ KK inversion chr6 chr6 50,754,653- 57,343,009- NA PRIM2 8 16 19501-19612

50,754,887 57,343,327

CG0V11TJ KK inversion / chr7 chrX 29,543,897- 144,362,346- CHN2 NA 9 8 20929-58623 translocation 29,544,102 144,362,530

CG0V11TJ KK translocation chr8 chr20 29,131,071- 49,282,316- NA FAM65C 7 10 23776-50491

29,131,230 49,282,501

CG0V11TJ KK gain chr8 chr8 90, 755, 389- 91,027,102- LOC101929709 DECR1 10 8 25336-25371 gO, 755, 645 91,027,296

CG0V11TJ KK gain chr8 chr8 90, 803, 799- 90, 944, 930- RIPK2 OSGIN2, NBN 9 12 25344-25366 gO, 804,113 gO, 945, 305

CG0V11TJ KK loss chr8 chr8 110,986, 789- 111,664, 522- KCNV1 NA 5 2 25940-25965

H O, 986, 973 I H, 664, 848

CG0V11TJ KK inversion / chr9 chr17 33,870,632- 35,834,542- UBE2R2 TAD A2A 23 32 28265-46015 translocation 33,870,967 35,834,871

CG0V11TJ KK translocation chr9 chr14 135,674,664- 35,636,489- AK8 KIAA0391 11 10 30260-40657

135,674,930 35,636,710

CG0V11TJ KK gain chr9 chr9 139,380,503- 139,492,004- C9orf163, NA 11 18 30331-30340

139,380,850 139,492,227 SEC16A

CGOV11TJ KK inversion / chr10 chr20 44,307,723- 3,310,746- NA C20orf194 5 2 31132-49085 translocation 44,307,910 3,310,945

CGOV11TJ KK gain chr11 chr11 48,065,382- 48,112,073- PTPRJ PTPRJ.1 13 8 33163-33167

48,065,719 48,112,415

CGOV11TJ KK loss chr12 chr12 7,121 ,212- 8,606,508- LPCAT3 CLEC6A 12 12 34778-34832

7,121 ,551 8,606,764

CGOV11TJ KK gain chr12 chr12 69,094,034- 69,298,173- NUP107 CPM 14 12 37281-37305

69,094,338 69,298,441

CGOV11TJ KK gain chr12 chr12 98,722,430- 99,258,535- NA ANKS1 B 16 16 38370-38409

98,722,824 99,258,834

CGOV11TJ KK gain chr14 chr14 77,151,680- 77,679,482- NA TMEM63C 21 24 42002-42044

77,151,964 77,679,768

CGOV11TJ KK gain chr15 chr15 41 ,066,710- 41,224,480- C15orf62, DLL4 21 16 43177-43185

41 ,067,001 41,224,761 DNAJC17

CGOV11TJ KK gain chr15 chr15 90,689,003- 90,768,438- NA SEMA4B, CIB1 15 18 43945-43951

90,689,279 90,768,747 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CG0V11T 1 KK inversion chr16 chr16 20,780,412- 29,971,974- ACSM3 TMEM219 8 14 44469-44668

20,780,673 29,972,126

CCOV11T 1 KK inversion chr17 chr17 45,833,173- 74,012,066- NA EVPL 18 8 46390-47360

45,833,454 74,012,421

CGOV11T 1 KK inversion chr17 chr17 46,330,924- 74,411,776- SKAP1 UBE20 10 20 46429-47388

46,331,307 74,412,066

CGOV11T 1 KK translocation chr17 chrX 69,786,817- 97,976,250- NA NA 11 2 47232-56523

69,787,048 97,976,534

CGOV11T 1 KK gain chr17 chr17 72,424,242- 72,588,326- CPRCSC C17orf77, 8 10 47310-47317

72,424,614 72,588,553 CD300LD

CGOV11T 1 KK inversion / chr17 chr19 74,013,792- 1 ,107,871- EVPL GPX4, SBN02 19 12 47360-48055 translocation 74,014,009 1 ,108,188

CGOV11T 1 KK gain chr18 chr18 4,142,224- 4,468,189- DLCAP1 NA 11 16 47588-47598

4,142,535 4,468,521

CGOV11T 1 KK gain chrX chrX 26,220,054- 27,125,078- NA NA 15 24 53695-53794

26,220,391 27,125,347

CGOV11T 1 KK gain chr2 chr2 180,028,429- 180,057,284- SESTD1 SESTD1.1 17 16 8530-8533

180,028,746 180,057,659

CGOV11T 1 KK translocation chr2 chr22 188,144,025- 31,679,181- NA LIMK2, PIK3IP1 18 26 8687-52254

188,144,555 31,679,365

CGOV11T 1 KK gain chr2 chr2 213,078,258- 213,557,366- ERBB4 NA 14 2 9125-9169

213,078,519 213,557,692

CGOV11T 1 KK gain chr2 chr2 213,286,246- 213,914,215- ERBB4, IKZF2 15 16 9136-9181

213,286,448 213,914,445 MIR548F2

CGOV11T 1 KK inversion / chr2 chr11 218,936,224- 62,154,683- RUFY4 ASRCL1 27 28 9258-33360 translocation 218,936,552 62,155,019

CGOV11T 1 KK inversion / chr2 chr11 219,352,440- 62,361,732- USP37 TUT1. MTA2 27 24 9281-33369 translocation 219,352,712 62,362,040

CGOV11T 1 KK gain chr2 chr2 236,286,431- 236,503,549- NA AGAP1 19 2 9550-9557

236,286,747 236,503,764

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV14T MCAS gain chr21 chr21 36,355,521- 36,678,365- RUNX1 NA 6 6 125388-125401

36,355,715 36,678,580

CGOV14T MCAS gain chrX chrX 36,090,242- 36,104,971- CFAP47 CFAP47.1 5 6 127574-127575

36,090,450 36,105,193

CGOV14T MCAS gain chr2 chr2 79,330,150- 79,343,471- NA REG1A 54 54 13959-13962

79,330,399 79,343,772

CGOV14T MCAS translocation chr1 chr22 55,029,891- 19,435,961- ACOT11 C22orf39, UFD1 L 6 4 1866-125970

55,030,041 19,436,247

CGOV14T MCAS inversion / chr7 chr17 12,725,574- 29,755,526- ARL4A RAB11 FIP4 8 16 58037-114149 translocation 12,725,781 29,755,721

CGOV14T MCAS inversion / chr7 chr17 16,250,174- 27,075,031- ISPD-AS1 , ISPD TRAF4 5 2 58088-114085 translocation 16,250,366 27,075,208

CGOV14T MCAS inversion / chr7 chr17 16,673,236- 76,913,595- ANKMY2 TIMP2 8 12 58092-116303 translocation 16,673,480 76,913,826

CGOV14T MCAS gain chr7 chr7 17,415,017- 17,472,154- KCCAT333 KCCAT333.1 13 16 58112-58117

17,415,281 17,472,386

CGOV14T MCAS gain chr7 chr7 65,972,924- 98,614,148- NA TRRAP, 5 14 59630-62533

65,973,085 98,614,287 LOC101927550

CGOV14T MCAS gain chr7 chr7 70,013,284- 73,920,361- AUTS2 GTF2IRD1 11 28 60012-60225

70,013,484 73,920,606

CGOV14T MCAS inversion chr7 chr7 73,082,812- 78,096,438- VPS37D MAGI2 7 4 60135-60394

73,083,002 78,096,659

CGOV14T MCAS inversion chr7 chr7 73,095,297- 78,108,597- WBSCR22, MAGI2 17 16 60137-60396

73,095,786 78,109,465 DNAJC30

CGOV14T MCAS inversion / chr7 chr8 73,897,701- 43,672,410- GTF2IRD1 NA 10 12 60222-65125 translocation 73,897,904 43,672,626

CGOV14T MCAS inversion / chr7 chr20 75,608,529- 49,052,875- POR NA 16 22 60271-123375 translocation 75,608,793 49,053,083

CGOV14T MCAS inversion chr7 chr7 77,883,647- 83,390,300- MAGI2 NA 12 10 60374-60754

77,883,868 83,390,579

CGOV14T MCAS inversion / chr7 chr8 78,879,803- 38,898,580- MAGI2 ADAM9 5 6 60454-64940 translocation 78,880,032 38,898,869

CGOV14T MCAS loss chr7 chr7 83,628,284- 88,018,392- SEMA3A NA 6 12 60793-61415

83,628,455 88,018,567

CGOV14T MCAS inversion chr7 chr7 83,944,334- 88,202,676- NA NA 5 12 60833-61442

83,944,580 88,202,810

CGOV14T MCAS inversion / chr7 chr20 83,959,147- 51, 872, 628- NA TSHZ2 20 20 60836-123714 translocation 83,959,397 SI, 872, 862

CGOV14T MCAS inversion / chr7 chr20 86,284,800- 54,493,764- GRM3 NA 7 24 61155-124093 translocation 86,284,984 54,493,993

CGOV14T MCAS gain chr7 chr7 89,354,173- 90,068,149- NA NA 17 14 61577-61638

89,354,436 gO, 068, 462

CGOV14T MCAS inversion chr7 chr7 89,449,399- 92,001,112- NA ANKIB1 11 4 61588-61836

89,449,595 92,001,283

CGOV14T MCAS inversion / chr7 chr20 89,468,707- 49,028,117- NA NA 18 26 61590-123373 translocation 89,468,933 49,028,337

CGOV14T MCAS inversion chr7 chr7 90,042,361- 98,598,561- CLDN12 TRRAP 10 12 61636-62531

90,042,656 98,598,734 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV14T MCAS translocation chr7 chr20 92,713,1 OS- 47,474,829- NA NA 10 20 61907-123289

92,713,364 47,475,042

CCOV14T MCAS gain chr7 chr7 93,742,020- 93,752,856- NA NA 12 26 62013-62015

93,742,255 93,753,171

CCOV14T MCAS translocation chr7 chr12 94,821,893- 28,261,838- PPP1 R9A NA 12 20 62136-93074

94,822,157 28,262,035

CCOV14T MCAS gain chr7 chr7 94,953,343- 94,968,339- PON1 NA 7 4 62156-62160

94,953,526 94,968,610

CCOV14T MCAS translocation chr7 chr20 98,227,475- 51, 883, 114- NA TSHZ2 16 16 62489-123717

98,227,782 SI, 883, 276

CCOV14T MCAS gain chr7 chr7 142,018,084- 142,044,016- NA NA 9 10 63809-63812

142,018,364 142,044,246

CCOV14T MCAS gain chr9 chr9 24,350,912- 24,372,098- NA NA 6 6 71772-71773

24,351,065 24,372,272

CCOV14T MCAS gain chr10 chr10 2,236,798- 3,274,602- NA NA 12 18 74711-74822

2,236,997 3,274,887

CCOV14T MCAS gain chr11 chr11 98,302,587- 98,315,133- NA NA 6 16 89718-89719

98,302,818 98,315,378

CCOV14T MCAS inversion / chr12 chr20 26,219,808- 47,499,300- RASSF8 NA 7 2 92874-123294 translocation 26,220,032 47,499,541

CCOV14T MCAS gain chr1 chr1 214,337,313- 214,392,733- NA NA 8 10 9547-9556

214,337,520 214,392,955

CCOV36T RMUC-S translocation chr2 chr6 212,248,703- 169,255,744- ERBB4 NA 14 6 1148-2676

212,249,058 169,256,075

CCOV36T RMUC-S gain chr4 chr4 14,902,618- 15,136,975- NA LOC101929095 5 6 1645-1646

14,902,883 15,137,116

CCOV36T RMUC-S gain chr4 chr4 25,988,260- 26,082,816- NA NA 11 26 1663-1664

25,988,504 26,083,028

CCOV36T RMUC-S inversion chr4 chr4 137,134,942- 146,939,992- NA NA 7 10 1905-1937

137,135,231 146,940,180

CCOV36T RMUC-S inversion chr4 chr4 137,612,798- 147,335,049- NA SLC10A7 18 8 1906-1938

137,613,043 147,335,290

CCOV36T RMUC-S loss chr4 chr4 146,093,514- 146,709,219- OTUD4 ZNF827 14 18 1935-1936

146,093,814 146,709,589

CCOV36T RMUC-S translocation chr4 chr11 175,454,243- 127,378,378- NA NA 11 10 1989-4385

175,454,439 127,378,583

CCOV36T RMUC-S loss chr4 chr4 181,615,936- 182,320,590- NA NA 9 41 1991-1993

181,616,227 182,320,864

CCOV36T RMUC-S loss chr1 chr1 6,033,434- 29,603,041- NPHP4 PTPRU 7 16 23-73

6,033,595 29,603,261

CCOV36T RMUC-S gain chr7 chr7 15,075,259- 15,154,550- NA NA 12 14 2790-2791

15,075,539 15,154,918

CCOV36T RMUC-S gain chr7 chr7 93,752,209- 93,793,422- NA NA 22 24 3261-3262

93,752,458 93,793,713

CCOV36T RMUC-S translocation chr9 chrX 29,414,369- 86,828,585- NA KLHL4 17 14 3648-7374

29,414,804 86,828,859

CCOV36T RMUC-S translocation chr10 chr13 127,574,403- 20,371,280- DHX32 NA 70 84 4056-4806

127,574,730 20,371,567

CCOV36T RMUC-S gain chr11 chr11 101,324,640- 102,025,845- TRPC6 YAP1 17 28 4341-4343

101,324,960 102,026,098 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV36T RMUG-S gain chr12 chr12 104,534,162- 104,858,736- NFYB CHST11 18 20 4711-4715

104,534,466 104,859,077

CGOV36T RMUG-S gain chr15 chr1 S 54,427,058- 87,317,915- UNC13C AGBL1 17 18 5432-5605

54,427,325 87,318,156

CGOV36T RMUG-S inversion chr1S chr1 S 67,413,412- 70,615,985- SMAD3 NA 26 12 5458-5468

67,413,736 70,616,326

CGOV36T RMUG-S loss chr16 chr16 59,626,487- 60,220,273- NA NA 13 12 5857-5860

59,626,754 60,220,566

CGOV36T RMUG-S gain chr16 chr16 63,533,155- 63,578,127- NA NA 15 16 5869-5870

63,533,423 63,578,373

CGOV36T RMUG-S inversion chr18 chr18 30,082,187- 30,368,407- NA NA 11 20 6236-6239

30,082,409 30,368,636

CGOV36T RMUG-S inversion chr18 chr18 30,323,822- 30,369,315- KLHL14 NA 14 30 6238-6239

30,324,123 30,369,657

CGOV36T RMUG-S loss chr18 chr18 48,968,769- 49,587,601- LOC100287225 NA 19 16 6250-6252

48,969,148 49,587,865

CGOV36T RMUG-S inversion chrX chrX 36,115,703- 36,329,090- CFAP47 CFAP47.1 19 34 7254-7257

36,115,992 36,329,440

CGOV36T RMUG-S loss chrX chrX 84,898,724- 124,216,231- NA NA 13 12 7369-7457

84,899,056 124,216,563

CGOV48T JHOM-1 gain chrS chrS 3,022,860- 3,509,447- NA LINC01019 19 14 1271-1275

3,023,164 3,509,838

CGOV48T JHOM-1 inversion chrS chrS 37,886,420- 38,029,668- NA NA 18 14 1348-1349

37,886,741 38,030,063

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV48T JHOM-1 gain chr10 chr10 125,336,816- 125,515,097- NA CPXM2 11 14 2781-2784

125,337,078 125,515,401

CGOV48T JHOM-1 gain chr10 chr10 125,501,088- 130,398,320- CPXM2 NA 12 12 2782-2802

125,501,459 130,398,622

CGOV48T JHOM-1 inversion chr10 chr10 125,511,837- 133,126,057- CPXM2 NA 19 12 2783-2817

125,512,141 133,126,432

CGOV48T JHOM-1 translocation chr10 chr13 127,574,421- 20,371,268- DHX32 NA 74 60 2789-3500

127,574,754 20,371,596

CGOV48T JHOM-1 gain chr10 chr10 130,390,062- 130,533,570- NA NA 17 14 2801-2808

130,390,344 130,533,903

CGOV48T JHOM-1 inversion chr10 chr10 130,401,390- 133,112,015- NA TCERG1 L 17 16 2803-2815

130,401,654 133,112,260

CGOV48T JHOM-1 inversion chr11 chr11 55,953,901- 92,748,946- NA NA 6 2 2909-3054

55,954,194 92,749,166

CGOV48T JHOM-1 gain chr11 chr11 68,298,410- 81,488,565- PPP6R3 NA 77 78 2939-3013

68,298,774 81,488,942

CGOV48T JHOM-1 inversion chr11 chr11 68,534,997- 87,158,960- CPT1A NA 20 12 2943-3027

68,535,274 87,159,138

CGOV48T JHOM-1 gain chr11 chr11 70,533,200- 70,546,642- SHANK2 SHANK2.1 10 8 2962-2963

70,533,671 70,546,970

CGOV48T JHOM-1 inversion chr11 chr11 74,636,794- 76,611,501- XRRA1 ACER3 26 32 2981-2991

74,637,175 76,611,820

CGOV48T JHOM-1 inversion chr11 chr11 74,909,748- 82,750,783- SLC02B1 RAB30, 68 74 2984-3022

74,910,096 82,751,213 SNORA70E

CGOV48T JHOM-1 inversion chr11 chr11 75,254,598- 80,086,868- NA NA 10 14 2985-3001

75,254,916 80,087,148

CGOV48T JHOM-1 inversion chr11 chr11 76,604,176- 100,929,521- ACER3 PGR 14 18 2990-3070

76,604,477 100,929,858

CGOV48T JHOM-1 inversion chr11 chr11 77,102,262- 80,505,049- PAK1 NA 18 16 2994-3006

77,102,622 80,505,568

CGOV48T JHOM-1 inversion chr11 chr11 79,454,374- 82,083,043- NA LOC101928989 45 56 2998-3016

79,454,707 82,083,370

CGOV48T JHOM-1 loss chr11 chr11 79,660,550- 90,451,620- NA DISCI FP1 18 14 3000-3050

79,660,883 90,451,929

CGOV48T JHOM-1 gain chr11 chr11 81 ,065,320- 82,235,726- NA NA 13 16 3011-3017

81 ,065,615 82,236,019

CGOV48T JHOM-1 inversion chr11 chr11 82,731,674- 100,859,118- RAB30 ARHGAP42, 18 8 3021-3069

82,732,033 100,859,441 TMEM133

CGOV48T JHOM-1 gain chr11 chr11 90,887,697- 104,445,900- NA LOC102723895 15 24 3051-3079

90,888,072 104,446,260

CGOV48T JHOM-1 inversion chr11 chr11 90,936,855- 95,196,057- NA NA 24 30 3052-3062

90,937,189 95,196,352

CGOV48T JHOM-1 inversion chr11 chr11 110,671,573- 111,515,659- NA SIK2 61 42 3106-3110

110,672,000 111,516,177

CGOV48T JHOM-1 inversion chr11 chr11 122,569,222- 122,579,973- UBASH3B UBASH3B.1 21 2 3120-3121

122,569,566 122,580,287

CGOV48T JHOM-1 inversion chr11 chr11 123,280,388- 134,224,152- NA GLB1 L2 7 6 3122-3130

123,280,581 134,224,374

CGOV48T JHOM-1 inversion chr11 chr11 123,286,497- 130,616,047- NA NA 8 2 3123-3128

123,286,728 130,616,306 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV48T JHOM-1 chr12 chr12 41 ,141,689- 55,005,144- CNTN1 CLYCAM1 15 22 3276-3315

41 ,142,110 55,005,544

CCOV48T JHOM-1 gain chr12 chr12 41 ,185,327- 61,521,960- CNTN1 NA 17 18 3278-3340

41 ,185,636 61,522,312

CCOV48T JHOM-1 loss chr12 chr12 43,856,014- 62,705,923- ADAMTS20 USP15 15 14 3286-3347

43,856,350 62,706,171

CCOV48T JHOM-1 loss chr12 chr12 53,815,116- 61,446,174- SP1, AMHR2 NA 10 8 3306-3337

53,815,335 61,446,374

CCOV48T JHOM-1 loss chr12 chr12 53,849,438- 61,491,952- PCBP2 NA 13 8 3308-3339

53,849,708 61,492,190

CCOV48T JHOM-1 loss chr12 chr12 53,925,697- 113,858,799- ATF7 SDSL 12 10 3311-3437

53,926,015 113,859,090

CCOV48T JHOM-1 loss chr12 chr12 55,040,038- 61,523,969- DCD NA 12 16 3316-3341

55,040,484 61,524,216

CCOV48T JHOM-1 inversion / chr12 chr14 100,451,334- 45,563,767- UHRF1 BP1 L PRPF39 6 4 3408-3707 translocation 100,451,638 45,564,054

CCOV48T JHOM-1 loss chr12 chr12 120,973,829- 127,043,550- RNF10 NA 9 18 3450-3462

120,974,194 127,043,903

CCOV48T JHOM-1 gain chr14 chr14 44,105,015- 44,183,574- NA NA 19 6 3701-3702

44,105,329 44,183,854

CCOV48T JHOM-1 gain chr14 chr14 51 ,999, 623- 52,173,069- FRMD6, FRMD6, FRMD6- 18 2 3717-3718

SI ,999,924 52,173,372 FRMD6-AS2 AS2.1

CCOV48T JHOM-1 translocation chr2 chr6 22,951,084- 42,062,325- NA NA 27 20 432-1650

22,951,752 42,063,063

CCOV48T JHOM-1 gain chr2 chr2 73,728,978- 73,759,236- ALMS1 ALMS1.1 5 8 480-481

73,729,212 73,759,517

CCOV48T JHOM-1 gain chr2 chr2 76,077,680- 76,089,957- NA NA 12 4 484-485

76,077,918 76,090,291

CCOV48T JHOM-1 inversion / chr2 chr4 77,437,035- 112,628,971- LRRTM4 NA 7 2 486-1162 translocation 77,437,482 112,629,167

CCOV48T JHOM-1 inversion / chr2 chr12 78,749,336- 19,016,228- NA NA 9 8 489-3206 translocation 78,749,674 19,016,517

CCOV48T JHOM-1 gain chr2 chr2 79,330,146- 79,343,398- NA REC1A 75 74 492-493

79,330,557 79,343,773

CCOV48T JHOM-1 gain chr3 chr3 61 ,281,177- 61,608,673- NA PTPRC 7 10 812-813

61 ,281,449 61,609,023

CCOV38T TOV-112D inversion / chr6 chr14 22,347,173- 61,408,088- NA MNAT1 16 32 3768-8650 translocation 22,347,391 61,408,349

CCOV38T TOV-112D inversion / chr8 chr14 49,272,639- 20,611,695- NA OR4NS 12 16 5414-8475 translocation 49,272,921 20,611,935

CCOV38T TOV-112D inversion / chr8 chr14 50,909,266- 22,167,402- SNTC1 NA 36 36 5459-8562 translocation 50,909,567 22,167,680

CCOV38T TOV-112D gain chr12 chr12 98,396,503- 98,413,365- NA NA 10 10 8001-8002

98,396,878 98,413,599

CCOV49T OVK-18 inversion chr5 chr5 24,457,970- 24,468,929- NA NA 5 8 1520-1521

24,458,226 24,469,121

CCOV49T OVK-18 gain chr8 chr8 37,070,491- 37,286,712- MIR1268A LINC01605 12 10 2345-2346

37,070,776 37,286,990

CCOV49T OVK-18 translocation chr10 chr13 127,574,440- 20,371,277- DHX32 NA 52 58 3090-3633

127,574,783 20,371,632 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV49T OVK-18 gain chr16 chr16 78,141,666- 78,305,130- WWOX WWOX.1 9 2 4270-4273

78,141,925 78,305,347

CGOV49T OVK-18 inversion / chr17 chr19 59,583,567- 42,998,917- NA LIPE-AS1 14 14 4451-4766 translocation 59,583,791 42,999,163

CGOV49T OVK-18 inversion chr19 chr19 53,762,319- 53,821,247- VN1 R2. ZNF677 NA 8 8 4824-4829

53,762,532 53,821,594

CGOV49T OVK-18 gain chr2 chr2 81 ,159,012- 81,249,748- NA NA 8 22 709-710

81 ,159,208 81,250,083

CGOV10T IGROV-1 inversion chr1 chr1 85,934,756- 86,208,506- DDAH1 COL24A1 6 14 1024-1029

85,934,967 86,208,686

CGOV10T IGROV-1 gain chr5 chr5 120,933,960- 121,032,142- NA NA 9 16 10727-10730

120,934,281 121,032,359

CGOV10T IGROV-1 gain chr6 chr6 12,236,208- 12,453,022- NA NA 9 20 11551-11562

12,236,500 12,453,284

CGOV10T IGROV-1 translocation chr6 chr14 113,722,719- 25,434,340- NA STXBP6 20 20 12818-24257

113,723,095 25,434,850

CGOV10T IGROV-1 gain chr6 chr6 120,967,460- 120,979,149- NA NA 9 8 12903-12905

120,967,793 120,979,472

CGOV10T IGROV-1 gain chr7 chr7 73,748,846- 73,910,340- CLIP2 GTF2IRD1 13 14 14386-14393

73,749,140 73,910,619

CGOV10T IGROV-1 gain chr7 chr7 73,918,091- 74,090,377- GTF2IRD1 GTF2I 9 12 14395-14404

73,918,330 74,090,583

CGOV10T IGROV-1 gain chr7 chr7 110,784,307- 110,893,622- IMMP2L IMMP2L1 12 26 14794-14798

110,784,722 110,893,957

CGOV10T IGROV-1 gain chr7 chr7 134,526,503- 134,726,748- CALD1 AGBL3 11 20 15072-15078

134,526,783 134,727,134

CGOV10T IGROV-1 gain chr8 chr8 109,911,197- 134,455,265- NA NA 6 12 16499-16748

109,911,404 134,455,458

CGOV10T IGROV-1 translocation chr9 chr18 138,592,020- 67,681,825- KCNT1 , RTTN 27 30 18277-29212

138,592,491 67,682,281 SOHLH1

CGOV10T IGROV-1 gain chr10 chr10 99,251,442- 99,494,983- MMS19 ZFYVE27 7 16 19484-19496

99,251,603 99,495,235

CGOV10T IGROV-1 gain chr10 chr10 105,383,107- 105,561 ,344- SH3PXD2A SH3PXD2A.1 18 6 19581-19587

105,383,458 105,561 ,542

CGOV10T IGROV-1 translocation chr10 chr22 125,756,526- 24,105,576- NA C22orf15, 8 10 19812-31629

125,756,735 24,105,799 CHCHD10

CGOV10T IGROV-1 loss chr1 chr1 192,945,327- 193,418,567- NA NA 15 4 2080-2083

192,945,546 193,418,838

CGOV10T IGROV-1 loss chr12 chr12 93,178,026- 94,329,920- EEA1 NA 6 32 22563-22567

93,178,201 94,330,129

CGOV10T IGROV-1 translocation chr13 chr22 108,646,129- 29,065,947- NA TTC28 14 10 24103-31720

108,646,451 29,066,131

CGOV10T IGROV-1 translocation chr13 chr20 113,706,333- 45,880,371- MCF2L ZMYND8 18 18 24151-30856

113,706,785 45,880,761

CGOV10T IGROV-1 inversion / chr16 chr17 69,341,335- 79,988,208- SNTB2, VPS4A LRRC45, RAC3 8 18 27091-28472 translocation 69,341,586 79,988,374

CGOV10T IGROV-1 gain chr17 chr17 66,512,224- 66,635,822- PRKAR1A LINC01482 12 20 28323-28328

66,512,520 66,636,053

CGOV10T IGROV-1 gain chr18 chr18 9,358,097- 9,510,365- TWSG1 RALBP1 15 6 28600-28608

9,358,454 9,510,656 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene 1 Gene 2 read pairs reads id

CGOV10T IGROV-1 loss chr20 chr20 14,675,847- 15,296,959- MACROD2 MACROD2.1 10 12 30479-30485

14,676,042 15,297,240

CGOV10T IGROV-1 gain chr20 chr20 38,984,818- 39,027,602- NA NA 14 10 30777-30781

38,985,049 39,027,877

CGOV10T IGROV-1 translocation chr1 chrX 30,893,466- 38,441,881- NA TSPAN7 18 16 422-32388

30,893,862 38,442,079

CGOV10T IGROV-1 translocation chr2 chr5 223,926,507- 116, 766, 591- NA LINC00992 13 40 5165-10692

223,926,912 l ie, 767, 080

CGOV10T IGROV-1 gain chr3 chr3 13,356,808- 13,514,811- NUP210 HDAC11-AS1 12 12 5545-5552

13,356,976 13,515,162

CGOV10T IGROV-1 inversion chr3 chr3 175,026,543- 175,166,353- NAALADL2 NAALADL2.1 12 6 7306-7309

175,026,820 175,166,631

CGOV10T IGROV-1 gain chr4 chr4 93,326,785- 93,349,493- GRID2 GRID2.1 10 26 8619-8621

93,326,971 93,349,768

CGOV13T Kuramochi gain chr1 chr1 16,732,357- 16,761,613- SPATA21 SPATA21.1 8 10 1061-1062

16,732,618 16,761,784

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV13T Kuramochi translocation chr8 chr11 121,885,185- 57,508,725- NA TMX2, TMX2- 10 10 64795-76360

121,885,676 57,509,173 CTNND1,

C11orf31 ,

BTBD18

CC0V13T Kuramochi loss chr9 chr9 136,908,490- 138,275,721- BRD3 NA 11 18 72194-72210

136,908,725 138,275,925

CC0V13T Kuramochi inversion chr10 chr10 22,178,111- 22,440,604- DNAJC1 NA 7 10 72778-72788

22,178,258 22,440,825

CC0V13T Kuramochi translocation chr10 chr11 71 ,925,474- 121,437,524- SAR1A SORL1 9 12 74034-78509

71 ,925,707 121,437,786

CC0V13T Kuramochi loss chr11 chr11 68,115,389- 121,438,396- LRP5 SORL1 10 24 76696-78509

68,115,617 121,438,659

CC0V13T Kuramochi gain chr12 chr12 122,090,505- 123,122,258- MORN3 NA 9 4 81178-81198

122,090,762 123,122,413

CC0V13T Kuramochi inversion / chr13 chr21 23,772,130- 15,523,464- SCCC LIPI 8 10 81721-98534 translocation 23,772,378 15,523,665

CC0V13T Kuramochi gain chr1 chr1 158,045,629- 158,099,969- KIRREL LOC646268 11 6 8740-8742

158,045,829 158,100,226

CC0V13T Kuramochi inversion chr17 chr17 630,156- 16,004,742- NA NCOR1 8 6 90709-91129

630,513 16,005,027

CC0V13T Kuramochi inversion chr17 chr17 12,337,222- 21,710,791- NA NA 8 8 91071-91241

12,337,439 21,711,054

CC0V13T Kuramochi loss chr18 chr18 19,250,008- 22,306,253- ABHD3 NA 13 16 92443-92455

19,250,351 22,306,464

CC0V13T Kuramochi inversion chr19 chr19 47,858,344- 58,947,345- DHX34 ZNF132 6 12 94897-95227

47,858,562 58,947,583

CCOV40T TYK-nu inversion / chr11 chr15 90,067,906- 68,227,940- DISCI FP1 NA 6 6 10009-11552 translocation 90,068,063 68,228,134

CCOV40T TYK-nu inversion chr1 chr1 150,582,151- 150,616,122- NA COLPH3L 7 2 1027-1028

150,582,327 150,616,335

CCOV40T TYK-nu inversion / chr12 chr17 88,925,121- 56, 570, 143- KITLC HSF5, MTMR4 8 12 10643-12147 translocation 88,925,393 56,570,427

CCOV40T TYK-nu inversion chr12 chr12 93,343,500- 106,109,853- NA CASC18 20 30 10669-10734

93,343,833 106,110,169

CCOV40T TYK-nu gain chr16 chr16 53,105,175- 53,191,273- CHD9 CHD9.1 10 22 11769-11771

53,105,447 53,191,535

CCOV40T TYK-nu gain chr17 chr17 29,461,099- 72,803,693- NF1 TMEM104 11 6 12072-12254

29,461,358 72,803,981

CCOV40T TYK-nu inversion chr19 chr19 11 ,134,392- 11,161,013- SMARCA4 SMARCA4.1 28 18 12462-12464

11 ,134,736 11,161,430

CCOV40T TYK-nu gain chr2 chr2 56,675,248- 56,822,006- NA NA 15 12 1921-1924

56,675,547 56,822,190

CCOV40T TYK-nu gain chr2 chr2 79,330,181- 79,343,562- NA REC1A 11 14 2077-2078

79,330,483 79,343,773

CCOV40T TYK-nu gain chr3 chr3 27,615,502- 27,843,302- NA NA 10 4 3012-3014

27,615,746 27,843,517

CCOV40T TYK-nu inversion chr3 chr3 30,110,122- 30,476,398- NA NA 18 16 3020-3022

30,110,360 30,476,665

CCOV40T TYK-nu gain chr3 chr3 30,448,751- 30,664,397- NA TCFBR2 11 10 3021-3024

30,449,069 30,664,588

CCOV40T TYK-nu inversion chr3 chr3 30,518,971- 30,703,036- NA TCFBR2 15 22 3023-3025

30,519,284 30,703,364

CCOV40T TYK-nu gain chr3 chr3 106,409,436- 106,562,998- NA NA 11 24 3291-3296

106,409,681 106,563,283 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV40T TYK-nu chr4 chr4 64,069,572- 64,091,048- NA NA 18 16 4028-4029

64,069,865 64,091,309

CCOV40T TYK-nu gain chr4 chr4 166,730,207- 166,900,864- NA TLL1 5 4 4221-4222

166,730,429 166,901 ,051

CCOV40T TYK-nu translocation chr4 chr11 175,454,187- 127,378,377- NA NA 11 6 4238-10282

175,454,448 127,378,542

CCOV40T TYK-nu gain chr5 chr5 38,961,059- 39,163,868- RICTOR FYB 20 20 4510-4516

38,961,344 39,164,127

CCOV40T TYK-nu gain chr7 chr7 3,442,252- 3,469,589- SDK1 SDK1.1 13 22 5616-5619

3,442,542 3,469,904

CCOV40T TYK-nu gain chr9 chr9 138,272,777- 138,349,229- NA NA 9 12 9018-9020

138,273,049 138,349,541

CCOV40T TYK-nu loss chr11 chr11 3,127,785- 24,815,072- OSBPL5 LUZP2 10 4 9542-9580

3,128,014 24,815,356

CCOV15T OAW-28 translocation chr1 chr8 214,750,450- 65,145,784- NA LOC102724623 6 4 10052-70594

214,750,701 65,146,061

CCOV15T OAW-28 loss chr13 chr13 106,594,207- 110,593,197- NA NA 21 20 105068-105373

106,594,492 110,593,495

CCOV15T OAW-28 gain chr14 chr14 21 ,077,345- 21,253,833- LOC254028 RNASE6 13 12 105911-105932

21 ,077,642 21,254,097

CCOV15T OAW-28 gain chr14 chr14 25,546,644- 25,593,905- NA NA 11 8 106239-106246

25,546,913 25,594,102

CCOV15T OAW-28 loss chr14 chr14 40,354,503- 70,505,290- NA NA 8 12 107628-109398

40,354,721 70,505,542

CCOV15T OAW-28 gain chr1 chr1 228,243,246- 228,311 ,520- WNT3A NA 6 10 10894-10901

228,243,442 228,311 ,677

CCOV15T OAW-28 gain chr14 chr14 68,907,524- 69,179,345- RAD51 B NA 10 20 109252-109279

68,907,752 69,179,576

CCOV15T OAW-28 gain chr14 chr14 69,224,975- 69,798,559- NA CALNT16 15 22 109284-109357

69,225,254 69,798,747

CCOV15T OAW-28 gain chr14 chr14 75,730,753- 75,773,064- NA NA 5 10 109927-109932

75,730,904 75,773,251

CCOV15T OAW-28 gain chr14 chr14 79,423,293- 80,818,018- NRXN3 DI02-AS1 20 28 110341-110569

79,423,583 80,818,303

CCOV15T OAW-28 gain chr14 chr14 91 ,290,649- 92,642,794- NA NA 10 14 111753-111988

91 ,290,894 92,643,115

CCOV15T OAW-28 translocation chr1 chr20 233,116,410- 62,672,655- NTPCR, LINC00176 10 4 11429-128913

233,116,624 62,672,902 PCNXL2

CCOV15T OAW-28 gain chr15 chr15 77,746,963- 77,922,1 IQ- HMG20A LINC01 11 10 115341-115347

77, 747, 205 77,922,385

CCOV15T OAW-28 gain chr15 chr15 81 ,039,282- 81,278,547- ABHD17C MESDC2 27 40 115387-115424

81 ,039,561 81,278,767

CCOV15T OAW-28 gain chr16 chr16 56,882,601- 56,913,110- NUP93 SLC12A3 9 12 117620-117625

56,882,836 56,913,378

CCOV15T OAW-28 translocation chr17 chr19 9,590,565- 29,641,195- USP43 NA 9 12 118831-125274

9,590,807 29,641,337

CCOV15T OAW-28 translocation chr17 chr20 10,619,931- 1 ,541,643- TMEM220, SIRPD, SIRPB1 12 12 118837-126408

10,620,279 1 ,541,924 MACOH2P

CCOV15T OAW-28 gain chr17 chr17 12,489,285- 19,615,683- LINC00670 SLC47A2 10 6 118838-118988

12,489,523 19,615,826 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV15T OAW-28 gain chr18 chr18 59,232,454- 59,500,193- NA RNF152 28 26 123660-123700

59,232,751 59,500,492

CCOV15T OAW-28 gain chr18 chr18 66,242,371- 66,530,639- NA CCDC102B 8 20 124006-124028

66,242,536 66,530,875

CCOV15T OAW-28 gain chr19 chr19 901,610- 925,896- R3HDM4 KISS1 R, ARID3A 10 6 124550-124552

901,853 926,158

CCOV15T OAW-28 gain chr19 chr19 9,038,039- 9,309,864- MUC16 NA 9 10 124640-124662

9,038,294 9,310,103

CCOV15T OAW-28 gain chr19 chr19 14,127,359- 14,239,212- NA ASF1 B 5 16 124807-124816

14,127,561 14,239,398

CCOV15T OAW-28 gain chr19 chr19 19,176,488- 19,188,238- SLC25A42 SLC25A42.1 11 4 124972-124973

19,176,689 19,188,505

CCOV15T OAW-28 gain chr19 chr19 50,046,277- 50,096,203- RCN3 PRRC2, PRR12 8 10 125987-125990

50,046,470 50,096,437

CCOV15T OAW-28 inversion / chr20 chr21 2,720,983- 34,618,069- EBF4 IFNAR2 8 12 126543-129717 translocation 2,721 ,286 34,618,248

CCOV15T OAW-28 gain chr20 chr20 13,363,059- 13,392,633- NA TASP1 6 16 126973-126976

13,363,369 13,392,867

CCOV15T OAW-28 loss chr20 chr20 20,126,723- 24,684,025- CFAP61 NA 9 12 127441-127682

20,126,936 24,684,254

CCOV15T OAW-28 inversion chr20 chr20 23,622,258- 23,649,008- CST3 NA 6 10 127624-127627

23,622,494 23,649,312

CCOV15T OAW-28 inversion chr20 chr20 50,314,227- 56,237,194- ATP9A PMEPA1 7 6 128688-128795

50,314,429 56,237,439

CCOV15T OAW-28 loss chr20 chr20 50,322,003- 56,431,300- ATP9A NA 5 6 128689-128799

50,322,206 56,431,514

CCOV15T OAW-28 inversion chr20 chr20 56,183,518- 61,406,633- ZBP1 LINC00659 6 6 128794-128875

56,183,708 61,407,039

CCOV15T OAW-28 gain chr20 chr20 56,311,362- 61,498,989- NA NA 9 4 128797-128879

56,311,643 61,499,179

CCOV15T OAW-28 inversion chr20 chr20 61 ,401,549- 61,451,792- LINC00659 COL9A3 6 10 128874-128878

61 ,401,724 61,451,992

CCOV15T OAW-28 gain chr22 chr22 36,640,426- 36,656,617- APOL2 APOL1 10 22 130824-130827

36,640,606 36,656,850

CCOV15T OAW-28 gain chr22 chr22 46,656,185- 46,768,010- PKDREJ CELSR1 7 10 131128-131140

46,656,390 46,768,210

CCOV15T OAW-28 inversion chrX chrX 81 ,313,212- 136,896,320- NA NA 8 4 132080-132668

81 ,313,370 136,896,500

CCOV15T OAW-28 gain chr2 chr2 2,123,714- 4,141,472- MYT1 L NA 11 20 13735-13859

2,123,950 4,141,812

CCOV15T OAW-28 gain chr2 chr2 24,544,334- 24,723,312- ITSN2 NA 6 6 14603-14614

24,544,535 24,723,525

CCOV15T OAW-28 gain chr2 chr2 26,563,309- 26,695,070- ADCRF3 OTOF 8 14 14680-14686

26,563,552 26,695,292

CCOV15T OAW-28 inversion chr2 chr2 58,208,118- 59,195,107- VRK2 LINC01122 10 8 17595-17673

58,208,397 59,195,377

CCOV15T OAW-28 gain chr2 chr2 65,799,842- 65,989,696- NA NA 12 8 18172-18197

65,799,982 65,989,902

CCOV15T OAW-28 gain chr2 chr2 129,058,694- 129,224,417- HS6ST1 NA 9 4 21348-21367

129,059,031 129,224,701 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV15T OAW-28 gain chr2 chr2 141,846,450- 142,195,527- LRP1 B LRP1 B.1 22 21780-21810

141,846,664 142,195,741

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV15T OAW-28 translocation chr4 chr7 105,875,933- 141,618,902- NA OR9A4 5 10 42475-66018

105,876,105 141,619,046

CCOV15T OAW-28 gain chr4 chr4 141,085,326- 141,116,574- NA NA 9 14 43419-43423

141,085,481 141,116,810

CCOV15T OAW-28 gain chr4 chr4 169,876,643- 170,007,383- NA NA 6 2 44475-44485

169,876,812 170,007,519

CCOV15T OAW-28 translocation chr4 chr9 171,952,726- 11,254,419- NA NA 7 2 44550-75104

171,952,953 11,254,544

CCOV15T OAW-28 gain chr1 chr1 94,119,562- 95,499,035- BCAR3 ALG14 7 2 4490-4642

94,119,739 95,499,166

CCOV15T OAW-28 inversion / chr5 chr21 54,721,763- 16,976,836- SKIV2L2, NA 13 26 48295-129087 translocation 54,722,004 16,977,113 PPAP2A

CCOV15T OAW-28 inversion / chr5 chr6 73,048,769- 12,227,408- ARHCEF28 NA 11 8 48475-53621 translocation 73,049,081 12,227,637

CCOV15T OAW-28 inversion / chr5 chr6 73,596,152- 12,847,832- NA PHACTR1 9 30 48501-53690 translocation 73,596,405 12,848,046

CCOV15T OAW-28 inversion / chr5 chr12 80,518,704- 515,523- RASGRF2, CCDC77 19 18 48608-90920 translocation 80,518,935 515,792 RNU5E-1,

RNU5D-1

CCOV15T OAW-28 gain chr1 chr1 24,506,141- 26,551,544- IFNLR1 LOC101928303 5 12 489-558

24,506,285 26,551,751

CCOV15T OAW-28 inversion chr5 chr5 92,145,385- 107,086,017- NA NA 12 20 49337-50504

92,145,648 107,086,279

CCOV15T OAW-28 loss chr5 chr5 92,928,696- 95,906,621- NR2F1 , LOC101929710 5 12 49418-49571

92,928,894 95,906,863 MIR548AO

CCOV15T OAW-28 translocation chr5 chr17 105,419,137- 54,651,801- NA NA 8 18 50337-120026

105,419,275 54,652,120

CCOV15T OAW-28 translocation chr5 chr20 130,915,874- 30,283,561- RAPCEF6 BCL2L1 7 14 50991-127919

130,916,109 30,283,737

CCOV15T OAW-28 gain chr5 chr5 133,332,764- 133,426,245- VDAC1 NA 11 6 51070-51076

133,333,060 133,426,493

CCOV15T OAW-28 inversion / chr5 chr8 141,988,330- 145,095,415- FCF1 SPATC1 7 14 51333-74014 translocation 141,988,518 145,095,568

CCOV15T OAW-28 gain chr1 chr1 104,372,899- 105,191 ,530- NA NA 6 10 5141-5195

104,373,151 105,191 ,800

CCOV15T OAW-28 inversion chr5 chr5 160,228,775- 169,123,448- ATP10B DOCK2 5 4 51954-52322

160,229,105 169,123,631

CCOV15T OAW-28 gain chr6 chr6 4,487,304- 4,815,942- NA CDYL 10 10 53053-53087

4,487,578 4,816,198

CCOV15T OAW-28 gain chr6 chr6 32,850,642- 32,973,737- NA HLA-DOA 7 10 54799-54806

32,850,784 32,973,928

CCOV15T OAW-28 gain chr6 chr6 75,561,657- 76,965,912- NA NA 5 16 56555-56691

75,561,854 76,966,149

CCOV15T OAW-28 translocation chr6 chr18 111,790,661- 2,500,117- REV3L NA 10 4 58681-121047

111,790,820 2,500,312

CCOV15T OAW-28 gain chr6 chr6 112,309,244- 112,329,055- NA NA 6 24 58710-58712

112,309,484 112,329,318

CCOV15T OAW-28 gain chr6 chr6 116,855,604- 116,895,434- FAM26D, RWDD1 5 14 58897-58900

116,855,750 116,895,598 TRAPPC3L

CCOV15T OAW-28 gain chr6 chr6 152,071,717- 152,118,554- ESR1 ESR1.1 14 12 60198-60205

152,071,921 152,118,786 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV1ST OAW-28 gain chr7 chr7 67,644,071- 69,234,554- NA AUTS2 5 4 63891-63922

67,644,262 69,234,750

CGOV1ST OAW-28 gain chr7 chr7 82,542,798- 82,625,701- PCLO PCLO.1 16 10 64020-64026

82,543,109 82,625,948

CGOV1ST OAW-28 gain chr7 chr7 89,842,071- 89,862,770- STEAP2, STEAP2, 34 42 64149-64155

89,842,440 89,863,065 STEAP2-AS1 STEAP2-AS1.1

CGOV1ST OAW-28 loss chr7 chr7 102,759,507- - 116,399,088- NAPEPLD MET 12 16 64584-64737

102,759,787 116,399,306

CGOV1ST OAW-28 gain chr7 chr7 106,616,328- 107,947,759- NA NRCAM 5 26 64607-64659

106,616,463 107,947,970

CGOV1ST OAW-28 inversion / chr7 chr16 132,109,900- 20,367,779- PLXNA4 UMOD, PDILT 16 14 65302-116433 translocation 132,110,253 20,368,092

CGOV1ST OAW-28 inversion chr1 chr1 156,136,047- 234,501 ,148- SEMA4A NA 10 4 6575-11583

156,136,228 234,501 ,324

CGOV1ST OAW-28 inversion chr1 chr1 156,429,701- 201,520,173- MEF2D NA 12 24 6602-9614

156,429,911 201,520,356

CGOV1ST OAW-28 gain chr8 chr8 10,061,962- 11, 457,1 SoMSRA NA 5 4 67408-67456

10,062,120 i l, 457, 362

CGOV1ST OAW-28 gain chr8 chr8 27,358,681- 27,607,294- EPHX2 CCDC2S 16 22 67732-67753

27,358,832 27,607,512

CGOV1ST OAW-28 inversion / chr8 chr18 31 ,263,354- 23,807,622- NA TAF4B 22 6 67861-121940 translocation 31 ,263,634 23,807,931

CGOV1ST OAW-28 loss chr8 chr8 31 ,293,940- 41,457,175- NA CPAT4 10 14 67867-68594

31 ,294,182 41,457,488

CGOV1ST OAW-28 gain chr8 chr8 33,700,932- 40,589,256- NA ZMAT4 6 28 68105-68490

33,701,105 40,589,435

CGOV1ST OAW-28 inversion chr8 chr8 34,924,524- 36,631,462- NA NA 21 24 68236-68314

34,924,779 36,631,780

CGOV1ST OAW-28 loss chr8 chr8 49,996,394- 52,496,883- NA PXDNL 8 20 69304-69502

49,996,647 52,497,175

CGOV1ST OAW-28 inversion chr8 chr8 59,899,853- 66,062,533- TOX NA 5 12 70167-70631

59,900,024 66,062,823

CGOV1ST OAW-28 gain chr8 chr8 110,447, 628- 110,512,543- PKHD1 L1 PKHD1 L1.1 7 6 71977-71987

H O, 447, 927 110,512,712

CGOV1ST OAW-28 gain chr8 chr8 111,078,159- 114,357,509- NA CSMD3 27 62 72014-72471

111,078,470 114,357,749

CGOV1ST OAW-28 inversion chr8 chr8 112,399,989- 118,154,946- NA SLC30A8 34 44 72098-72584

112,400,309 118,155,263

CGOV1ST OAW-28 translocation chr8 chr20 118,787,477- 54,922,709- NA NA 6 6 72691-128782

118,787,608 54,922,896

CGOV1ST OAW-28 inversion chr9 chr9 3,603,637- 130,396,544- NA STXBP1 6 6 74511-79610

3,603,830 130,396,778

CGOV1ST OAW-28 gain chr9 chr9 3,785,846- 5,065,913- NA JAK2 9 10 74543-74706

3,786,031 5,066,150

CGOV1ST OAW-28 inversion chr9 chr9 3,836,953- 130,595,867- GLIS3 ENG 22 22 74554-79629

3,837,252 130,596,139

CGOV1ST OAW-28 translocation chr9 chr17 32,857,460- 17,000,907- NA MPRIP 8 18 76744-118940

32,857,720 17,001,544

CGOV1ST OAW-28 gain chr9 chr9 114,729,317- 114,749,545- NA NA 6 2 78380-78382

114,729,550 114,749,738 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV15T OAW-28 gain chr9 chr9 124,010,249- 124,107,205- NA STOM 9 18 78978-78993

124,010,411 124,107,361

CCOV15T OAW-28 gain chr9 chr9 130,311,315- 130,355,393- FAM129B NA 12 18 79601-79607

130,311,509 130,355,639

CCOV15T OAW-28 gain chr1 chr1 188,375,750- 190,150,093- NA BRINP3 6 12 8314-8567

188,375,947 190,150,316

CCOV15T OAW-28 gain chr10 chr10 112,434,551- 112,752,805- RBM20 SHOC2 15 12 83987-84013

112,434,922 112,753,146

CCOV15T OAW-28 gain chr10 chr10 121,486,497- 121,562,960- INPP5F INPP5F.1 8 6 84337-84341

121,486,721 121,563,196

CCOV15T OAW-28 gain chr10 chr10 134,126,971- 134,226,854- NA PWWP2B 8 8 84729-84737

134,127,195 134,227,071

CCOV15T OAW-28 gain chr11 chr11 7,997,233- 8,032,847- NA CASC23 9 10 85062-85068

7,997,432 8,033,056

CCOV15T OAW-28 gain chr1 chr1 189,940,989- 191,251 ,447- NA NA 7 6 8526-8695

189,941,236 191,251 ,611

CCOV15T OAW-28 gain chr11 chr11 68,415,879- 68,432,905- NA NA 12 16 86990-86992

68,416,110 68,433,249

CCOV15T OAW-28 gain chr11 chr11 78,180,944- 78,504,610- NARS2 TENM4 10 20 87710-87762

78,181,156 78,504,835

CCOV15T OAW-28 translocation chr11 chr15 99,916,314- 62,424,616- CNTN5 NA 10 20 89449-114527

99,916,654 62,424,886

CCOV15T OAW-28 gain chr11 chr11 101,526,433- 101,546,629- NA NA 6 28 89666-89670

101,526,763 101,546,839

CCOV15T OAW-28 translocation chr11 chrX 128,475,800- 131,402,283- NA RAP2C-AS1 10 18 90844-132469

128,475,982 131,402,487

CCOV15T OAW-28 translocation chr12 chr20 22,786,377- 22,461,783- ETNK1 NA 5 6 92433-127591

22,786,552 22,462,033

CCOV15T OAW-28 gain chr12 chr12 54,563,244- 54,575,893- NA SMUG1 7 12 95158-95159

54,563,444 54,576,127

CCOV15T OAW-28 gain chr12 chr12 56,482,185- 57,661,744- ERBB3 R3HDM2 16 14 95209-95285

56,482,486 57,661,994

CCOV15T OAW-28 inversion chr12 chr12 61 ,584,461- 62,917,814- NA MON2 6 16 95363-95469

61 ,584,718 62,917,953

CGOV15T OAW-28 gain chr12 chr12 65,858,791- 98,885,137- MSRB3, LOC643770 5 8 95821-98286

65,858,986 98,885,369 LOC100507065

CCOV15T OAW-28 gain chr12 chr12 103,134,528- 103,172,659- NA NA 16 22 98529-98533

103,134,821 103,173,019

CCOV15T OAW-28 gain chr1 chr1 210,017,184- 210,127,384- DIEXF SYT14 9 18 9931-9935

210,017,433 210,127,654

CCOV1T A2780 inversion / chr1 chr2 158,725,578- 148,952,361- OR6K6 MBD5 16 8 1081-3891 translocation 158,725,920 148,952,706

CCOV1T A2780 gain chr11 chr11 13,934,522- 14,528,310- NA PSMA1 12 12 12497-12511

13,934,776 14,528,605

CCOV1T A2780 gain chr11 chr11 41 ,369,777- 42,202,732- LRRC4C NA 16 18 12657-12674

41 ,370,055 42,203,000

CCOV1T A2780 loss chr12 chr12 43,686,736- 64,173,930- NA TMEM5 16 4 13554-13684

43,687,046 64,174,854

CCOV1T A2780 gain chr13 chr13 80,825,670- 80,914,321- NA SPRY2 22 8 14577-14581

80,826,038 80,914,635 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV1T A2780 inversion chr21 chr21 45,232,565- 45,254,546- AATBC NA 20 24 18910-18911

45,232,874 45,255,042

CCOV1T A2780 gain chrX chrX 8,293,339- 8,404,653- NA NA 11 20 19254-19256

8,293,596 8,404,903

CCOV1T A2780 loss chrX chrX 31 ,893, 033- 32,441,671- DMD DMD.1 12 12 19373-19374

SI ,893,274 32,441,964

CCOV1T A2780 gain chr2 chr2 73,344,244- 73,703,374- RAB11 FIP5 ALMS1 13 14 3407-3417

73,344,492 73,703,612

CCOV1T A2780 translocation chr1 chr22 55,029,896- 19,435,973- ACOT11 C22orf39, UFD1 L 14 12 345-18972

55,030,057 19,436,239

CCOV1T A2780 gain chr2 chr2 133,280,576- 133,308,484- CPR39 CPR39.1 14 26 3809-3810

133,280,898 133,308,777

CCOV1T A2780 gain chr2 chr2 165,178,673- 165,219,130- NA NA 15 20 3993-3994

165,178,932 165,219,398

CCOV1T A2780 gain chr2 chr2 187,370,838- 187,839,397- ZC3H15 NA 8 4 4157-4174

187,371,133 187,839,637

CCOV1T A2780 gain chr2 chr2 218,646,920- 218,696,848- NA TNS1 8 8 4372-4375

218,647,130 218,696,996

CCOV1T A2780 translocation chr1 chr2 72,360,958- 102,912,399- NECR1 NA 9 6 452-3639

72,361,233 102,912,631

CCOV1T A2780 translocation chr1 chr6 90, 943, 677- 153,010,402- NA NA 27 6 557-8881 gO, 944, 239 153,011 ,864

CCOV1T A2780 gain chr1 chr1 98,407,002- 98,425,364- NA NA 10 22 603-604

98,407,277 98,425,663

CCOV1T A2780 gain chr1 chr1 102,282,363- 102,319,859- OLFM3 OLFM3.1 20 12 627-628

102,282,729 102,320,235

CCOV1T A2780 gain chr4 chr4 105,207,315- 105,434,043- NA LOC101929468 14 12 6409-6416

105,207,764 105,434,402

CCOV1T A2780 translocation chr4 chr17 137,220,688- 26,052,022- NA NA 18 12 6610-16773

137,220,917 26,052,297

CCOV1T A2780 loss chr4 chr4 182,123,297- 182,647,875- NA NA 13 10 6889-6890

182,123,650 182,648,068

CCOV1T A2780 gain chr7 chr7 72,869,255- 72,941,362- BAZ1 B BAZ1 B.1 8 13 9426-9431

72,869,409 72,941,564

CCOV1T A2780 inversion chr7 chr7 110, 493, 563- 110,511 , 817- IMMP2L IMMP2L1 15 14 9668-9670

H O, 493, 911 HO, 512, 079

CCOV1T A2780 gain chr7 chr7 110,787,957- 111,105,258- IMMP2L IMMP2L1 18 6 9674-9685

110,788,219 111,105,549

CCOV26T OVCAR-5 translocation chr5 chr17 12,484,067- 33,270,122- NA CCT6B 21 2 1038-3414

12,484,507 33,270,610

CCOV26T OVCAR-5 translocation chr6 chr9 1,996,875- 11,968,525- GMDS NA 16 4 1237-1874

1,997,471 11,969,210

CCOV26T OVCAR-5 inversion / chr8 chr22 126,537,073- 29,065,646- NA TTC28 23 2 1835-4124 translocation 126,537,679 29,066,107

CCOV26T OVCAR-5 loss chr9 chr9 9,571 ,516- 10,346,511- PTPRD PTPRD.1 28 18 1869-1872

9,572,004 10,347,072

CCOV26T OVCAR-5 loss chr9 chr9 13,393,367- 25,879,567- NA NA 9 12 1875-1884

13,393,770 25,880,109

CCOV26T OVCAR-5 translocation chr10 chr13 127,574,426- 20,371,085- DHX32 NA 157 84 2205-2627

127,575,236 20,371,633 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV26T OVCAR-S loss chr17 chr17 27,804,174- 69,412,826- TAOK1 NA 18 2 3404-3511

27,804,729 69,413,488

CCOV26T OVCAR-S loss chr17 chr17 32,726,776- 49,117,132- NA SPAC9 8 8 3413-3476

32,727,151 49,117,318

CCOV26T OVCAR-5 gain chr17 chr17 34,443,666- 69,148,062- NA CASC17 28 16 3418-3510

34,444,188 69,148,690

CCOV26T OVCAR-5 loss chr17 chr17 62,687,444- 63,687,483- NA CEP112 31 32 3497-3501

62,688,248 63,688,031

CCOV26T OVCAR-5 inversion chr18 chr18 20,614,033- 24,935,797- NA NA 16 10 3578-3585

20,614,305 24,936,268

CCOV26T OVCAR-S inversion chr18 chr18 20,758,401- 24,782,280- CABLES1 NA 27 4 3582-3584

20,759,111 24,782,653

CCOV26T OVCAR-S inversion chr2 chr2 65,579,395- 67,342,838- SPRED2 LOC102800447 17 4 385-393

65,579,952 67,343,390

CCOV26T OVCAR-S inversion chr2 chr2 65,583,350- 66,615,622- SPRED2 LOC729348 19 14 386-390

65,583,815 66,616,199

CCOV26T OVCAR-S inversion chr22 chr22 23,804,785- 27,717,118- LOC388882 NA 6 4 4091-4120

23,805,266 27,717,475

CCOV26T OVCAR-S inversion chr22 chr22 25,289,218- 29,993,319- SCSM1 NA 24 14 4109-4126

25,289,821 29,993,827

CCOV26T OVCAR-S inversion chr22 chr22 26,640,587- 28,448,314- SEZ6L TTC28 45 18 4116-4123

26,641,211 28,448,976

CCOV26T OVCAR-S loss chr22 chr22 28,358,311- 34,653,413- TTC28-AS1 NA 56 12 4122-4140

28,359,005 34,654,012

CCOV26T OVCAR-S inversion chr22 chr22 30,631,439- 33,030,488- LIF SYN3 117 54 4129-4138

30,632,095 33,031,123

CCOV26T OVCAR-S translocation chr2 chr19 205,154,085- 7,633,926- NA NA 10 12 627-3617

205,154,540 7,634,734

CCOV26T OVCAR-S translocation chr2 chr19 205,318,418- 7,691,756- NA PET100, XAB2, 26 10 628-3618

205,318,988 7,692,413 PCP2

CCOV26T OVCAR-S translocation chr3 chrS 157,824,682- 60,420,440- RSRC1 , SHOX2 NDUFAF2 30 30 789-1077

157,825,190 60,420,896

CCOV2T Caov-3 inversion / chr3 chr4 15,016,592- 155,875,384- NR2C2 NA 9 16 10241-17643 translocation 15,016,847 155,875,586

CCOV2T Caov-3 gain chr3 chr3 99,637,148- 100,399,202- CMSS1, ADCRC7 20 24 11569-11611

99,637,362 100,399,455 MIRS48C,

FILIP1 L

CCOV2T Caov-3 gain chr3 chr3 99,939,588- 100,972,721- NA IMPG2 5 38 11578-11655

99,939,802 100,972,968

CCOV2T Caov-3 gain chr3 chr3 104,634,117- 144,039,524- NA NA 10 18 11775-13036

104,634,447 144,039,729

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV2T Caov-3 inversion / chr3 chr12 125,166,019- 86,738,559- SNX4 MCAT4C 14 24 12722-40123 translocation 125,166,252 86,738,823

CCOV2T Caov-3 gain chr3 chr3 128,131,604- 128,369,660- EEFSEC RPN1 28 30 12735-12741

128,132,096 128,369,868

CCOV2T Caov-3 inversion / chr3 chr11 133,449,141- 441,792- NA AN09 11 24 12783-36651 translocation 133,449,302 442,118

CCOV2T Caov-3 gain chr3 chr3 167,663,945- 167,707,265- NA NA 5 12 13435-13438

167,664,127 167,707,477

CCOV2T Caov-3 inversion chr3 chr3 168,834,843- 168,874,399- MECOM MECOM.1 22 40 13475-13481

168,835,093 168,874,655

CCOV2T Caov-3 translocation chr3 chr6 168,906,640- 7,836,449- MECOM BMP6 34 60 13488-22674

168,906,891 7,836,676

CCOV2T Caov-3 gain chr3 chr3 171,921,802- 171,949,369- FNDC3B FNDC3B.1 8 10 13887-13889

171,921,992 171,949,671

CCOV2T Caov-3 gain chr3 chr3 173,094,343- 173,113,001- NA NLCN1 20 44 14055-14059

173,094,641 173,113,357

CCOV2T Caov-3 loss chr3 chr3 187,568,161 - 192,707,756- NA NA 45 28 15382-15383

187,568,455 192,708,051

CCOV2T Caov-3 gain chr1 chr1 59,943,200- 59,967,938- FCCY FCCY.1 10 16 1606-1611

59,943,402 59,968,401

CCOV2T Caov-3 gain chr4 chr4 17,395,162- 17,419,739- NA NA 14 12 16082-16083

17,395,415 17,419,920

CCOV2T Caov-3 gain chr4 chr4 39,284,431- 39,303,547- MIR1273H, MIR1273H, 28 28 16200-16202

39,284,738 39,303,841 WDR19, RFC1 WDR19, RFC1.1

CCOV2T Caov-3 gain chr4 chr4 39,305,825- 40,700,040- MIR1273H, NA 23 6 16203-16237

39,306,101 40,700,308 RFC1

CCOV2T Caov-3 translocation chr4 chr17 46,950,350- 42,264,598- GABRA4 TMUB2, ASB16- 13 30 16263-46008

46,950,571 42,264,866 AS1, ATXN7L3

CCOV2T Caov-3 gain chr4 chr4 57,661,908- 58,243,361- NA NA 12 30 16439-16467

57,662,251 58,243,594

CCOV2T Caov-3 gain chr1 chr1 61 ,100,136- 61,591,651- NA NFIA 13 24 1665-1724

61 ,100,415 61,591,834

CCOV2T Caov-3 inversion / chr4 chr17 81 ,946,281- 58,652,486- NA LOC388406 29 38 16912-46498 translocation 81 ,946,520 58,652,739

CCOV2T Caov-3 gain chr4 chr4 91 ,757,318- 92,045,436- CCSER1 CCSER1.1 26 20 16965-16975

91 ,757,654 92,045,742

CCOV2T Caov-3 gain chr4 chr4 139,721,379- 139,766,622- NA NA 21 30 17563-17564

139,721,690 139,766,851

CCOV2T Caov-3 gain chr4 chr4 140,856,952- 140,871 ,663- MAML3 MAML3.1 11 32 17570-17572

140,857,150 140,871 ,869

CCOV2T Caov-3 gain chr4 chr4 169,960,627- 170,578,062- NA CLCN3 15 14 17672-17687

169,960,861 170,578,266

CCOV2T Caov-3 inversion / chr5 chr11 2,980,513- 134,927,498- NA NA 15 22 18146-38596 translocation 2,980,801 134,927,744

CCOV2T Caov-3 inversion chr5 chr5 11 ,205,589- 14,329,415- CTNND2 TRIO 15 14 18557-18736

11 ,205,937 14,329,813

CCOV2T Caov-3 gain chr5 chr5 12,967,120- 12,986,753- NA NA 18 34 18663-18664

12,967,410 12,987,014

CCOV2T Caov-3 inversion / chr5 chr10 26,241,497- 76,965,598- NA VDAC2 10 26 19033-35386 translocation 26,241,701 76,965,814 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV2T Caov-3 gain chrS chrS 50,240,079- 50,265,397- NA LOC100287592 11 32 19620-19623

50,240,302 50,265,624

CCOV2T Caov-3 translocation chr5 chrX 71 ,482,975- 112,142,311- MAP1 B NA 10 18 19714-53324

71 ,483,274 112,142,544

CCOV2T Caov-3 loss chrS chrS 97,428,594- 155,071 ,422- NA NA 19 10 20266-21819

97,428,764 155,071 ,673

CCOV2T Caov-3 inversion chrS chrS 98,684,857- 98,719,806- NA NA 19 20 20293-20297

98,685,073 98,720,023

CCOV2T Caov-3 gain chr5 chr5 101,155,622- 101,222,551- NA NA 26 34 20370-20381

101,155,932 101,222,868

CCOV2T Caov-3 gain chr5 chr5 113,679,821- 113,696,037- NA KCNN2 30 36 20724-20727

113,680,093 113,696,325

CCOV2T Caov-3 inversion / chr5 chr6 139,351,539- 44,056,525- NRC2 NA 17 16 21360-23781 translocation 139,351,766 44,056,822

CCOV2T Caov-3 gain chr5 chr5 149,474,846- 149,520,227- CSF1 R PDCFRB 11 30 21653-21655

149,475,082 149,520,410

CCOV2T Caov-3 gain chr5 chr5 151,044,727- 151,204,680- SPARC CLRA1 12 22 21694-21710

151,044,986 151,204,932

CCOV2T Caov-3 gain chrS chrS 168,866,558- 169,126,081- NA DOCK2 10 24 22331-22351

168,866,795 169,126,303

CCOV2T Caov-3 gain chrS chrS 169,774,915- 169,834,447- NA KCNIP1, CTD- 12 20 22365-22373

169,775,115 169,834,713 2270F17.1

CCOV2T Caov-3 inversion / chrS chr6 179,217,125- 123,494,101- LTC4S NA 13 38 22596-25370 translocation 179,217,341 123,494,268

CCOV2T Caov-3 translocation chr6 chr20 10,005,712- 742,496- NA SLC52A3 8 24 22834-49311

10,005,993 742,769

CCOV2T Caov-3 gain chr6 chr6 11 ,669,555- 11,700,264- NA NA 35 44 22862-22869

11 ,669,850 11,700,483

CCOV2T Caov-3 translocation chr6 chrX 43,619,059- 63,868,683- RSPH9 NA 11 16 23773-53113

43,619,254 63,868,986

CCOV2T Caov-3 gain chr6 chr6 48,386,536- 48,396,818- NA NA 6 22 24062-24063

48,386,727 48,397,054

CCOV2T Caov-3 gain chr6 chr6 75,005,834- 75,025,242- LOCI 01928516 LOC101928516.1 14 14 24888-24889

75,006,039 75,025,495

CCOV2T Caov-3 gain chr6 chr6 76,011,837- 76,023,639- FILIP1 FILIP1.1 17 18 24905-24908

76,012,088 76,023,879

CCOV2T Caov-3 translocation chr6 chr12 92,051,809- 53,615,097- NA RARG 11 30 25226-39741

92,051,987 53,615,353

CCOV2T Caov-3 gain chr6 chr6 94,712,055- 94,760,887- NA NA 20 12 25241-25244

94,712,340 94,761,144

CCOV2T Caov-3 gain chr6 chr6 129,270,121- 129,342,378- LAMA2 LAMA2.1 11 14 25394-25401

129,270,323 129,342,576

CCOV2T Caov-3 gain chr6 chr6 137,048,348- 137,790,115- MAP3K5 NA 14 18 25438-25464

137,048,664 137,790,353

CCOV2T Caov-3 gain chr6 chr6 148,815,967- 149,122,850- SASH1 UST 20 30 25519-25528

148,816,302 149,123,131

CCOV2T Caov-3 gain chr6 chr6 154,397,691- 154,528,512- OPRM1 OPRM1.1 17 6 25552-25555

154,397,953 154,528,744

CCOV2T Caov-3 gain chr6 chr6 168,080,142- 168,107,413- LOC401286, NA 6 16 25669-25671

168,080,355 168,107,600 LOC441178 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene 1 Gene 2 read pairs reads id

CGOV2T Caov-3 gain chr7 chr7 76,872,593- 76,924,284- CCDC146 CCDC146.1 10 22 27858-27865

76,872,812 76,924,471

CGOV2T Caov-3 gain chr7 chr7 90,162,645- 90,216,086- NA NA 14 8 28192-28194

90,162,879 90,216,326

CGOV2T Caov-3 gain chr7 chr7 93,380,778- 93,413,200- NA NA 11 32 28273-28277

93,380,986 93,413,472

CGOV2T Caov-3 inversion / chr7 chr19 95,275,577- 16,008,997- NA CYP4F2 21 20 28378-48163 translocation 95,275,750 16,009,309

CGOV2T Caov-3 gain chr1 chr1 84,469,027- 84,506,368- TTLL7 NA 14 38 2843-2851

84,469,360 84,506,555

CGOV2T Caov-3 gain chr7 chr7 126,642,795- 127,018,192- GRM8 ZNF800 15 28 29166-29189

126,643,063 127,018,505

CGOV2T Caov-3 gain chr7 chr7 132,321,768- 132,458,246- PLXNA4 NA 15 22 29324-29335

132,322,301 132,458,525

CGOV2T Caov-3 inversion chr1 chr1 85,960,994- 155,217,581- DDAH1 GBA, FAM189B 19 22 2953-3900

85,961,235 155,217,890

CGOV2T Caov-3 loss chr7 chr7 151,496,313- 152,588,319- PRKAG2 NA 16 20 29819-29845

151,496,572 152,588,527

CGOV2T Caov-3 gain chr8 chr8 16,204,851- 16,223,855- NA NA 5 6 30254-30255

16,205,078 16,224,011

CGOV2T Caov-3 translocation chr8 chr19 25,691,331- 9,215,917- NA OR7G2 10 18 30436-48029

25,691,560 9,216,119

CGOV2T Caov-3 gain chr8 chr8 28,395,781- 28,664,806- FZD3 INTS9 15 28 30458-30476

28,396,031 28,665,085

CGOV2T Caov-3 inversion chr8 chr8 39,745,019- 41,441,185- NA GPAT4 7 14 30534-30550

39,745,236 41,441,385

CGOV2T Caov-3 gain chr8 chr8 48,624,164- 50,503,962- SPIDR NA 7 4 30634-30687

48,624,419 50,504,241

CGOV2T Caov-3 loss chr8 chr8 73,578,180- 144,640,992- KCNB2 GSDMD 15 18 31355-32230

73,578,385 144,641 ,248

CGOV2T Caov-3 gain chr8 chr8 90,340,547- 90,376,709- NA NA 10 8 31567-31570

90,340,818 90,376,935

CGOV2T Caov-3 inversion chr8 chr8 92,610,006- 111,387,399- NA NA 19 18 31612-31834

92,610,340 111,387,594

CGOV2T Caov-3 inversion chr8 chr8 92,616,325- 111,393,077- NA NA 11 20 31613-31835

92,616,672 111,393,325

CGOV2T Caov-3 gain chr8 chr8 126,369,888- 127,792,802- NSMCE2 NA 6 18 32030-32062

126,370,084 127,792,976

CGOV2T Caov-3 gain chr8 chr8 133,798,173- 133,831 ,549- PHF20L1 PHF20L1.1 18 40 32126-32132

133,798,432 133,831 ,735

CGOV2T Caov-3 gain chr8 chr8 134,805,939- 134,857,178- NA NA 12 24 32145-32147

134,806,193 134,857,375

CGOV2T Caov-3 gain chr8 chr8 136,232,491- 140,964,047- NA TRAPPC9 17 12 32158-32196

136,232,744 140,964,314

CGOV2T Caov-3 gain chr9 chr9 16,817,658- 16,837,625- BNC2 BNC2.1 21 10 32399-32400

16,818,027 16,837,890

CGOV2T Caov-3 gain chr9 chr9 26,617,341- 26,630,593- NA NA 13 26 32513-32515

26,617,600 26,630,802

CGOV2T Caov-3 translocation chr9 chr11 31 ,680,451- 47,923,746- NA NA 17 30 32560-36953

31 ,680,676 47,923,977 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV2T Caov-3 gain chr9 chr9 72,178,185- 72,833,222- APBA1 MAMDC2, SMC5- 11 28 32772-32800

72,178,397 72,833,435 AS1

CGOV2T Caov-3 translocation chr9 chr20 125,572,829- 49,503,798- NA ADNP 18 22 33608-50074

125,573,064 49,504,032

CGOV2T Caov-3 translocation chr9 chr20 125,902,227- 48,404,093- STRBP NA 32 32 33642-49959

125,902,486 48,404,384

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV2T Caov-3 translocation chr12 chr21 71 ,393,502- 40,477,230- NA NA 21 26 39884-50992

71 ,393,779 40,477,581

CGOV2T Caov-3 gain chr12 chr12 94,678,570- 94,757,064- PLXNC1 CEP83 12 22 40213-40218

94,678,826 94,757,346

CGOV2T Caov-3 gain chr13 chr13 32,826,600- 33,364,395- FRY NA 11 20 40971-40999

32,826,771 33,364,702

CGOV2T Caov-3 gain chr13 chr13 95,607,597- 96,222,547- LINC00557 CLDN10 18 20 41324-41346

95,607,904 96,222,765

CGOV2T Caov-3 gain chr1 chr1 200,444,373- 200,470,072- NA NA 15 26 4133-4135

200,444,600 200,470,325

CGOV2T Caov-3 gain chr14 chr14 20,487,506- 21,710,815- OR4K14 HNRNPC 22 30 41446-41509

20,487,742 21,711,076

CGOV2T Caov-3 gain chr14 chr14 61 ,240,808- 61,846,441- MNAT1 PRKCH 13 22 41842-41878

61 ,241,051 61,846,682

CGOV2T Caov-3 gain chr14 chr14 64,726,985- 64,760,373- MIR548AZ, MIR548AZ, 23 24 41912-41917

64,727,282 64,760,584 ESR2 ESR2.1

CGOV2T Caov-3 gain chr14 chr14 69,261,750- 69,383,444- ZFP36L1 ACTN1 7 6 41987-41991

69,261,993 69,383,638

CGOV2T Caov-3 gain chr14 chr14 78,343,660- 78,526,992- ADCK1 NA 11 22 42097-42103

78,344,002 78,527,174

CGOV2T Caov-3 inversion / chr1 chr10 213,978,589- 25,461,735- NA CPR158, 10 22 4214-34320 translocation 213,978,779 25,461,956 CPR158-AS1

CGOV2T Caov-3 inversion / chr1 chr6 29,071,490- 25,221,827- YTHDF2 NA 39 38 422-23213 translocation 29,071,758 25,222,089

CGOV2T Caov-3 gain chr15 chr15 35,762,389- 35,774,212- DPH6 DPH6.1 11 14 43263-43265

35,762,604 35,774,437

CGOV2T Caov-3 gain chr15 chr15 38,021,678- 38,065,288- NA NA 20 24 43331-43334

38,021,925 38,065,510

CGOV2T Caov-3 gain chr1 chr1 223,926,482- 223,941 ,134- CAPN2 CAPN2.1 13 26 4339-4340

223,926,781 223,941 ,463

CGOV2T Caov-3 gain chr15 chr15 41 ,809,189- 41,844,421- LTK, RPAP1 NA 14 2 43410-43412

41 ,809,405 41,844,636

CGOV2T Caov-3 gain chr15 chr15 61 ,400,489- 62,631,113- RORA MIR6085 14 10 43631-43661

61 ,400,747 62,631,397

CGOV2T Caov-3 gain chr15 chr15 85,641,975- 85,671,730- PDE8A PDE8A.1 5 24 44258-44259

85,642,139 85,671,919

CGOV2T Caov-3 gain chr16 chr16 8,499,338- 8,522,398- NA NA 13 28 44967-44970

8,499,549 8,522,636

CGOV2T Caov-3 inversion / chr16 chr17 48,098,163- 18,812,864- NA PRPSAP2 14 10 45279-45810 translocation 48,098,399 18,813,045

CGOV2T Caov-3 gain chr16 chr16 71 ,095,539- 71,112,846- HYDIN HYDIN.1 16 16 45511-45513

71 ,095,772 71,113,138

CGOV2T Caov-3 gain chr16 chr16 81 ,639,516- 82,021,030- CMIP NA 15 42 45590-45602

81 ,639,781 82,021,332

CGOV2T Caov-3 inversion chr17 chr17 42,246,916- 42,263,992- ASB16 TMUB2, ASB16- 5 16 46007-46008

42,247,033 42,264,176 AS1, ATXN7L3 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV2T Caov-3 inversion/ chr1 chr6 238,069,939- 159,596,647- LOC100130331 FNDC1 21 32 4736-25595 translocation 238,070,154 159,596,935

CGOV2T Caov-3 gain chr18 chr18 19,025,830- 19,036,776- GREB1L GREB1L.1 11 12 47616-47618

19,026,080 19,037,002

CGOV2T Caov-3 gain chr18 chr18 71,902,751- 71,928,883- NA CYB5A 16 24 47952-47953

71,903,028 71,929,145

CGOV2T Caov-3 gain chr20 chr20 30,217,639- 30,232,620- NA COX4I2 15 2 49781-49783

30,217,913 30,232,928

CGOV2T Caov-3 loss chr20 chr20 31,037,846- 43,001,978- NOL4L HNF4A, HNF4A- 6 24 49810-49869

31,038,051 43,002,158 AS1

CGOV2T Caov-3 translocation chr2 chr13 10,300- 34,149,358- NA STARD13 6 8 4996-41011

10,502 34,149,517

CGOV2T Caov-3 gain chr22 chr22 50,129,910- 50,244,726- NA ZBED4 39 44 52845-52864

50,130,239 50,245,012

CGOV2T Caov-3 inversion/ chr1 chr3 36,590,680- 134,887,476- COL8A2 EPHB1 16 30 531-12789 translocation 36,590,951 134,887,697

CGOV2T Caov-3 gain chrX chrX 79,990,527- 80,038,205- BRWD3 BRWD3.1 11 14 53184-53187

79,990,795 80,038,419

CGOV2T Caov-3 inversion chr2 chr2 22,642,431- 22,660,612- NA NA 20 18 5329-5330

22,642,645 22,660,839

CGOV2T Caov-3 inversion chrX chrX 110,754,698- 136,896,139- LINC00890 NA 19 30 53318-53426

110,755,029 136,896,370

CGOV2T Caov-3 gain chrX chrX 129,517,785- 129,538,805- GPR119 RBMX2 20 32 53390-53392

129,518,085 129,539,070

CGOV2T Caov-3 gain chr2 chr2 28,343,633- 28,448,078- BRE BRE.1 23 34 5421-5428

28,343,850 28,448,361

CGOV2T Caov-3 inversion chr2 chr2 34,815,923- 42,922,372- NA MTA3 10 2 5507-5745

34,816,057 42,922,669

CGOV2T Caov-3 inversion chr2 chr2 35,004,918- 43,501,669- NA THADA 10 14 5523-5823

35,005,082 43,501,926

CGOV2T Caov-3 gain chr2 chr2 54,197,413- 55,461,062- PSME4 RPS27A, 11 22 6097-6183

54,197,645 55,461,329 MIR4426, CLHC1 ,

MTIF2

CGOV2T Caov-3 inversion/ chr2 chr3 62,411,123- 171,198,703- NA NA 29 36 6387-13784 translocation 62,411 ,328 171,199,013

CGOV2T Caov-3 inversion/ chr2 chr5 111,879,856- 33,316,986- ACOXL, NA 11 24 7776-19246 translocation 111,880,131 33,317,147 BCL2L11

CGOV2T Caov-3 gain chr2 chr2 115,112,573- 115,134,703- NA NA 17 32 7860-7863

115,112,808 115,135,056

CGOV2T Caov-3 gain chr1 chr1 6,525,290- 6,966,366- ESPN, CAMTA1 26 SO 85-121

6,525,618 6,966,583 TNFRSF25,

PLEKHGS

CGOV2T Caov-3 gain chr2 chr2 142,862,830- 142,887,738- LRP1B LRP1B.1 6 6 8552-8554

142,863,050 142,887,988

CGOV2T Caov-3 gain chr2 chr2 160,385,699- 160,400,623- BAZ2B BAZ2B.1 8 8 8791-8792

160,385,882 160,400,827

CGOV2T Caov-3 gain chr2 chr2 169,628,636- 169,640,816- CERS6, CERS6- CERS6, CERS6- 18 44 8917-8918

169,629,009 169,641,063 AS1 AS1.1

CGOV2T Caov-3 gain chr2 chr2 174,827,499- 174,853,554- SP3 NA 8 2 8994-8995

174,827,653 174,853,709

CGOV2T Caov-3 gain chr2 chr2 183,748,733- 183,980,426- NA NUP35 14 4 9099-9107

183,748,932 183,980,630 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV2T Caov-3 gain chr2 chr2 220,425,803- 220,621 ,878- OBSL1 NA 5 8 9583-9587

220,425,956 220,622,038

CCOV2T Caov-3 gain chr2 chr2 221,148,210- 221,191 ,212- NA NA 9 14 9591-9592

221,148,430 221,191 ,434

CCOV2T Caov-3 gain chr2 chr2 223,885,637- 223,901 ,431- NA NA 12 30 9622-9623

223,885,821 223,901 ,619

CCOV2T Caov-3 gain chr2 chr2 231,671,438- 231,728,046- CAB39 ITM2C 5 2 9728-9730

231,671,665 231,728,202

CCOV2T Caov-3 gain chr2 chr2 242,185,701- 242,315,966- HDLBP FARP2 10 10 9841-9842

242,185,989 242,316,168

CCOV33T PEA2 inversion chr6 chr6 62,911,552- 63,467,206- KHDRBS2 NA 15 8 10086-10114

62,911,776 63,467,541

CCOV33T PEA2 inversion chr6 chr6 63,396,178- 63,471,539- NA NA 10 14 10109-10115

63,396,468 63,471,869

CCOV33T PEA2 inversion chr6 chr6 63,529,781- 65,585,555- NA EYS 11 8 10125-10205

63,530,123 65,585,934

CCOV33T PEA2 loss chr1 chr1 215,981,746- 216,668,699- USH2A NA 9 12 1142-1147

215,981,992 216,668,968

CCOV33T PEA2 loss chr7 chr7 121,989,542- 122,526,801- CADPS2 CADPS2.1 6 8 12567-12571

121,989,813 122,526,987

CCOV33T PEA2 loss chr7 chr7 135,211,079- 136,132,273- NA NA 13 22 12659-12690

135,211,365 136,132,502

CCOV33T PEA2 loss chr7 chr7 147,757,851- 150, 966, 722- CNTNAP2, SMARCD3 31 36 13116-13276

147,758,158 I SO, 967, 123 MIR548T

CCOV33T PEA2 gain chr1 chr1 238,114,521- 238,138,567- NA NA 15 20 1324-1325

238,114,784 238,139,038

CCOV33T PEA2 inversion chr7 chr7 149,491,291- 150,721 ,494- SSPO ABCB8, ATC9B 19 36 13258-13275

149,491,586 150,721 ,795

CCOV33T PEA2 inversion / chr8 chr16 66,284,074- 28,484,787- NA CLN3 10 26 13511-21012 translocation 66,284,308 28,484,989

CCOV33T PEA2 loss chr8 chr8 66,620,130- 71,173,803- MTFR1 NCOA2 13 4 13518-13549

66,620,479 71,174,056

CCOV33T PEA2 inversion chr8 chr8 101,579,343- 102,553,415- NA CRHL2 12 26 13791-13803

101,579,624 102,553,780

CCOV33T PEA2 translocation chr1 chr7 33,516,326- 24,448,426- NA NA 26 28 139-11642

33,516,625 24,448,726

CCOV33T PEA2 loss chr10 chr10 24,413,525- 31,635,541- KIAA1217 ZEB1 20 24 15386-15559

24,413,788 31,635,846

CCOV33T PEA2 translocation chr10 chr20 67,676,729- 23,413,409- CTNNA3 NA 22 16 15926-24589

67,677,265 23,413,631

CCOV33T PEA2 inversion chr11 chr11 14,084,957- 78,782,597- SPON1 TENM4 11 18 16614-17057

14,085,226 78,782,857

CCOV33T PEA2 loss chr13 chr13 24,810,062- 26,238,572- SPATA13 ATP8A2 17 18 18479-18495

24,810,336 26,238,941

CCOV33T PEA2 inversion chr14 chr14 73,805,002- 91,338,483- NUMB RPS6KAS 18 18 19953-20324

73,805,296 91,338,984

CCOV33T PEA2 inversion / chr1S chr18 45,864,105- 33,485,308- NA MIR187 43 32 20628-22961 translocation 45,864,556 33,485,689

CCOV33T PEA2 translocation chr1S chr20 46,219,356- 18,295,955- NA ZNF133 20 10 20638-24246

46,219,721 18,296,261 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV33T PEA2 translocation chr16 chr18 34,608,086- 28,329,857- LINC01566 NA 38 68 21212-22804

34,608,411 28,330,267

CGOV33T PEA2 inversion/ chr2 chr16 103,308,108- 31,130,333- SLC9A2 KAT8 10 12 2168-21078 translocation 103,308,347 31,130,518

CGOV33T PEA2 inversion/ chr2 chr16 104,474,012- 27,841,908- NA GSG1 L 12 22 2199-20996 translocation 104,474,371 27,842,175

CGOV33T PEA2 loss chr17 chr17 48,900,116- 56,177,384- NA NA 9 8 22240-22251

48,900,371 56,177,751

CGOV33T PEA2 loss chr18 chr18 21,409,787- 27,147,225- LAMA3 NA 47 28 22663-22679

21,410,174 27,147,580

CGOV33T PEA2 inversion chr18 chr18 36,761,444- 37,460,257- NA NA 62 34 23208-23230

36,761,820 37,460,624

CGOV33T PEA2 loss chr2 chr2 224,183,188- 225,010,140- NA NA 18 16 3150-3155

224,183,484 225,010,460

CGOV33T PEA2 translocation chr3 chr13 88,337,536- 31,901,348- NA B3GLCT 16 24 3620-18537

88,337,795 31,901,693

CGOV33T PEA2 inversion chr3 chr3 95,352,150- 95,397,389- NA MTHFD2P1 7 4 3664-3665

95,352,388 95,397,565

CGOV33T PEA2 inversion/ chr3 chr15 104,314,591- 47,540,566- NA SEMA6D 11 22 3762-20664 translocation 104,314,843 47,540,842

CGOV33T PEA2 translocation chr3 chr4 120,463,094- 48,621,188- GTF2E1, RABL3 FRYL 16 18 3847-5699

120,463,342 48,621,465

CGOV33T PEA2 inversion/ chr3 chr18 120,544,014- 34,890,371- NA CELF4 8 12 3853-23122 translocation 120,544,247 34,890,642

CGOV33T PEA2 inversion chr4 chr4 47,735,222- 48,906,165- CORIN OCIAD2 12 10 5685-5702

47,735,518 48,906,499

CGOV33T PEA2 translocation chr4 chr16 60,639,225- 14,041,248- NA ERCC4 11 12 5829-20832

60,639,469 14,041,554

CGOV33T PEA2 translocation chr5 chr7 31,067,782- 92,221,603- NA FAM133B, 5 8 7647-12349

31,068,025 92,221,815 FAM133DP

CGOV33T PEA2 inversion/ chr6 chr8 50,286,932- 101,593,401- NA SNX31 6 20 9828-13792 translocation 50,287,149 101,593,545

CGOV3T COLO-704 gain chr4 chr4 59,973,856- 59,988,102- NA NA 10 6 14185-14186

59,974,105 59,988,289

CGOV3T COLO-704 gain chr1 chr1 145,522,727- 145,586,776- NBPF20, NBPF20, 16 8 1495-1502

145,523,279 145,587,000 NBPF10, NBPF10,

PEX11B, PEX11B,

ITGA10 ITGA10.1

CGOV3T COLO-704 gain chr5 chr5 33,046,830- 33,218,978- NA NA 5 28 15917-15919

33,047,168 33,219,139

CGOV3T COLO-704 translocation chr5 chr19 139,402,219- 4,948,358- NRG2 UHRF1 12 4 16914-41984

139,402,472 4,948,571

CGOV3T COLO-704 inversion chr10 chr10 9,388,377- 9,472,400- NA NA 8 10 31155-31157

9,388,540 9,472,612

CGOV3T COLO-704 inversion chr10 chr10 9,422,866- 9,473,883- NA NA 7 8 31156-31158

9,423,145 9,474,078

CGOV3T COLO-704 gain chr11 chr11 85,023,227- 85,086,787- DLG2 DLG2.1 11 10 33536-33539

85,023,458 85,087,071

CGOV3T COLO-704 gain chr1 chr1 175,430,119- 175,761,631- TNR NA 9 20 3418-3458

175,430,329 175,761,849

CGOV3T COLO-704 gain chr14 chr14 56,995,827- 57,291,845- NA OTX2-AS1 16 20 37257-37276

56,996,066 57,292,073

CGOV3T COLO-704 gain chr15 chr15 56,433,869- 56,480,271- RFX7 RFX7.1 7 22 38485-38490

56,434,011 56,480,506 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CGOV3T COLO-704 gain chr16 chr16 5,014,993- 5,074,195- SEC14LS NAG PA 8 39080-39082

5,015,203 5,074,489

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CCOV42T OVCAR-8 gain chr4 chr4 186,207,555- 186,767,268- SNX25 SORBS2 5 16 18461-18470

186,207,766 186,767,487

CCOV42T OVCAR-8 inversion chr5 chr5 15,213,087- 97,122,249- LOC101929454 NA 30 46 19125-21539

15,213,420 97,122,582

CCOV42T OVCAR-8 gain chr5 chr5 68,730,002- 68,765,000- MARVELD2 NA 8 22 20770-20775

68,730,412 68,765,283

CCOV42T OVCAR-8 inversion / chr1 chr10 90,065,410- 45,532,107- LRRC8B NA 17 24 2279-43725 translocation 90,065,713 45,532,391

CCOV42T OVCAR-8 inversion chr5 chr5 159,777,221- 179,580,724- C1QTNF2 RASGEF1C 7 2 23942-24926

159,777,524 179,580,907

CCOV42T OVCAR-8 inversion chr6 chr6 35,542,073- 90,617,428- FKBP5 NA 16 42 27153-29567

35,542,400 90,617,702

CGOV42T OVCAR-8 gain chr1 chr1 99,748,913- 101,810,045- LPPR4 LINC01307, 22 42 2933-3239

99,749,177 101,810,273 RNU6-31 P

CGOV42T OVCAR-8 loss chr6 chr6 130,704,021- 164,885,729- TMEM200A NA 9 18 30029-30400

130,704,271 164,885,920

CGOV42T OVCAR-8 gain chr7 chr7 5,245,046- 5,266,397- WIPI2 WIPI2.1 6 10 30589-30590

5,245,227 5,266,632

CGOV42T OVCAR-8 gain chr7 chr7 73,639,027- 73,680,957- LAT2 NA 16 28 31783-31785

73,639,326 73,681,269

CGOV42T OVCAR-8 translocation chr7 chr19 131,176,059- 34,267,526- MKLN1 CHST8 24 30 32503-61996

131,176,333 34,267,796

CGOV42T OVCAR-8 translocation chr7 chr19 131,195,541- 34,261,259- PODXL CHST8 18 22 32505-61995

131,195,816 34,261,614

CGOV42T OVCAR-8 translocation chr8 chr19 30,436,331- 33,736,082- GTF2E2 NA 22 18 33559-61988

30,436,572 33,736,378

CGOV42T OVCAR-8 inversion / chr8 chr11 50,009,014- 80,658,272- NA NA 5 6 34587-47061 translocation 50,009,290 80,658,401

CGOV42T OVCAR-8 gain chr8 chr8 89,136,668- 89,244,062- MMP16 MMP16.1 8 12 36001-36006

89,136,921 89,244,346

CGOV42T OVCAR-8 translocation chr8 chr15 92,138,408- 41,836,337- LRRC69 RPAP1 11 26 36045-57040

92,138,664 41,836,663

CGOV42T OVCAR-8 gain chr8 chr8 94,749,632- 95,107,587- RBM12B-AS1, NA 11 12 36132-36158

94,749,910 95,107,854 RBM12B

CGOV42T OVCAR-8 gain chr8 chr8 110,402,533- 110,492,169- PKHD1 L1 PKHD1 L1.1 30 36 36732-36745

110,402,838 110,492,597

CGOV42T OVCAR-8 gain chr8 chr8 119,199,503- 119,365,729- SAMD12 SAMD12.1 11 16 37469-37498

119,199,681 119,366,104

CGOV42T OVCAR-8 translocation chr8 chr19 135,754,960- 51,482,359- NA KLK7 37 30 39318-62152

135,755,242 51,482,643

CGOV42T OVCAR-8 gain chr1 chr1 115,775,140- 115,896,101- NA NA 20 22 4068-4082

115,775,429 115,896,401

CGOV42T OVCAR-8 loss chr9 chr9 92,049,202- 107,860,458- SEMA4D NA 6 2 41512-41694

92,049,477 107,860,632

CGOV42T OVCAR-8 gain chr9 chr9 127,237,985- 127,275,812- NA NR6A1 13 18 42234-42237

127,238,322 127,276,156

CGOV42T OVCAR-8 translocation chr9 chr11 128,204,501- 79,726,956- MAPKAP1 NA 14 10 42258-46991

128,204,861 79,727,203

CGOV42T OVCAR-8 translocation chr9 chr11 128,218,055- 79,719,593- MAPKAP1 NA 14 36 42259-46990

128,218,309 79,719,928 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV42T OVCAR-8 inversion / chr10 chr11 24,009,738- 81,746,763- KIAA1217 LOC101928989 18 24 43249-47159 translocation 24,009,991 81,747,048

CGOV42T OVCAR-8 translocation chr10 chr18 36,116,030- 34,123,346- NA FHOD3 15 10 43412-61338

36,116,292 34,123,656

CGOV42T OVCAR-8 inversion / chr10 chr16 54,223,1 IQ- 71,344,146- LINC01468 NA 20 15 43915-58907 translocation 54, 223, 284 71,344,419

CGOV42T OVCAR-8 gain chr10 chr10 75,253,034- 75,662,374- PPP3CB-AS1 , NA 19 22 44534-44567

75,253,351 75,662,599 PPP3CB, USP54

CGOV42T OVCAR-8 gain chr11 chr11 64,403,808- 74,870,675- NRXN2 SLC02B1 16 12 46640-46874

64,404,147 74,870,948

CGOV42T OVCAR-8 gain chr11 chr11 64,551,376- 64,813,207- MAP4K2 SAC3D1 , 6 4 46643-46651

64,551,690 64,813,430 NAALADL1

CGOV42T OVCAR-8 loss chr11 chr11 72,635,771- 75,770,660- FCHSD2 UVRAC 11 10 46817-46893

72,635,965 75,770,861

CGOV42T OVCAR-8 translocation chr1 chr19 189,226,373- 1 ,955,059- NA CSNK1G2, 6 2 4950-61470

189,226,560 1 ,955,199 CSNK1G2-AS1

CGOV42T OVCAR-8 inversion / chr12 chr14 10,210,472- 71,501,499- CLEC9A PCNX 12 10 49857-56315 translocation 10,210,731 71,501,796

CGOV42T OVCAR-8 inversion / chr12 chr17 53,670,1 IQ- 86,620- ESPL1 RPH3AL 15 10 50389-59109 translocation 53, 670, 395 86,958

CGOV42T OVCAR-8 gain chr1 chr1 6,939,241- 7,148,590- CAMTA1 CAMTA1.1 7 16 50-54

6,939,509 7,148,867

CGOV42T OVCAR-8 loss chr12 chr12 62,724,381- 97,742,063- USP15 NA 5 4 50675-51031

62,724,560 97,742,301

CGOV42T OVCAR-8 gain chr1 chr1 204,266,809- 204,292,149- PLEKHA6 PLEKHA6.1 9 20 5122-5123

204,267,109 204,292,369

CGOV42T OVCAR-8 gain chr12 chr12 119,937,368- 119,950,019- CCDC60 CCDC60.1 12 14 51730-51733

119,937,657 119,950,270

CGOV42T OVCAR-8 translocation chr13 chr19 43,761,493- 55,899,683- NA RPL28, MIR6805, 11 10 52324-62227

43,761,760 55,899,943 TMEM238

CGOV42T OVCAR-8 translocation chr1 chr7 228,186,234- 141,645,936- NA CLEC5A 14 26 5396-32816

228,186,428 141,646,461

CGOV42T OVCAR-8 gain chr14 chr14 66,909,692- 67,024,960- NA GPHN 11 6 56176-56183

66,910,037 67,025,290

CGOV42T OVCAR-8 translocation chr1 chr4 233,742,634- 151,767,652- NA LRBA 6 2 5622-18129

233,742,846 151,767,826

CGOV42T OVCAR-8 gain chr14 chr14 70,740,269- 70,754,547- NA NA 20 16 56291-56293

70,740,540 70,754,778

CGOV42T OVCAR-8 inversion chr14 chr14 79,356,695- 79,520,573- NRXN3 NRXN3.1 9 14 56384-56396

79,356,874 79,520,807

CGOV42T OVCAR-8 inversion chr14 chr14 79,500,642- 79,759,806- NRXN3 NRXN3.1 16 30 56395-56414

79,501,010 79,760,034

CGOV42T OVCAR-8 inversion / chr1 chr10 234,295,420- 11,350,047- SLC35F3 CELF2 25 4 5676-43130 translocation 234,295,715 11,350,353

CGOV42T OVCAR-8 gain chr1 chr1 235,368,566- 235,412,597- ARID4B ARID4B.1 12 8 5704-5706

235,368,822 235,412,786

CGOV42T OVCAR-8 gain chr15 chr15 92,367,731- 92,404,397- NA SLC03A1 20 22 57503-57506

92,368,013 92,404,681

CGOV42T OVCAR-8 gain chr16 chr16 2,947,445- 2,988,266- FLYWCH2 FLYWCH1 28 30 57663-57664

2,947,746 2,988,622 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV42T OVCAR-8 inversion / chr16 chr17 73,886,036- 4,670,106- NA TM4SF5 14 32 58964-59284 translocation 73,886,331 4,670,309

CCOV42T OVCAR-8 inversion chr17 chr17 56,340,668- 56,383,050- LPO BZRAP1 8 4 60028-60031

56,341,020 56,383,294

CCOV42T OVCAR-8 gain chr17 chr17 63,422,451- 63,799,721- NA CEP112 15 10 60349-60372

63,422,706 63,799,956

CCOV42T OVCAR-8 translocation chr2 chr3 1,683,224- 140,453,873- PXDN NA 8 9 6121-14445

1,683,535 140,454,112

CCOV42T OVCAR-8 gain chr18 chr18 24,844,914- 24,884,165- NA NA 10 22 61217-61218

24,845,178 24,884,461

CCOV42T OVCAR-8 inversion / chr2 chr11 4,502,415- 111,960,078- NA C11orfS7, SDHD, 9 8 6204-49107 translocation 4,502,717 111,960,333 TIMM8B

CCOV42T OVCAR-8 gain chr20 chr20 33,023,982- 33,047,095- ITCH ITCH.1 5 6 62900-62902

33,024,219 33,047,294

CCOV42T OVCAR-8 gain chr2 chr2 15,415,314- 15,838,736- NBAS LOC101926966 17 6 6318-6332

15,415,638 15,839,008

CCOV42T OVCAR-8 translocation chr2 chrS 16,486,391- 15,771,411- NA FBXL7 38 20 6337-19215

16,486,615 15,771,775

CCOV42T OVCAR-8 gain chr21 chr21 45,696,367- 45,707,477- NA AIRE 20 6 64411-64412

45,696,524 45,707,863

CCOV42T OVCAR-8 gain chr22 chr22 41 ,592,817- 41,628,925- EP300-AS1 L3MBTL2, 7 12 64716-64717

41 ,593,047 41,629,175 CHADL

CCOV42T OVCAR-8 gain chr22 chr22 50,348,168- 50,516,060- NA MLC1 18 20 64793-64795

50,348,486 50,516,278

CCOV42T OVCAR-8 gain chr2 chr2 31 ,862,587- 33,742,295- NA RASCRP3 15 8 6480-6528

31 ,862,873 33,742,563

CCOV42T OVCAR-8 gain chrX chrX 67,622,078- 68,303,868- OPHN1 NA 5 16 64971-64984

67,622,330 68,304,085

CCOV42T OVCAR-8 gain chrX chrX 108,869,988- 110, 653, 872- KCNES DCX, RNU6-28P 8 22 65100-65121

108,870,255 HO, 654, 105

CCOV42T OVCAR-8 translocation chr2 chr3 69,939,108- 140,471 ,448- NA NA 7 8 6881-14447

69,939,339 140,471 ,769

CCOV42T OVCAR-8 gain chr2 chr2 80,360,095- 81,218,650- CTNNA2 NA 14 12 7002-7032

80,360,417 81,218,968

CCOV42T OVCAR-8 gain chr2 chr2 141,900,044- 142,243,905- LRP1 B LRP1 B.1 8 4 9274-9303

141,900,207 142,244,077

CCOV42T OVCAR-8 inversion chr2 chr2 159,409,654- 205,266,331- PKP4 NA 11 12 9632-10163

159,409,895 205,266,680

CCOV53T OVCAR-5- inversion / chr6 chr21 19,625,881- 47,948,206- NA DIP2A 21 10 1003-3249

CisR translocation 19,626,229 47,948,506

CCOV53T OVCAR-5- gain chr1 chr1 72,502,415- 72,626,417- NECR1 NECR1.1 13 18 105-106

CisR 72,502,766 72,626,745

CCOV53T OVCAR-5- gain chr6 chr6 169,334,856- 169,352,647- NA NA 8 6 1145-1146

CisR 169,335,087 169,352,889

CCOV53T OVCAR-5- gain chr7 chr7 346,053- 2,558,059- NA LFNC 12 6 1148-1154

CisR 346,367 2,558,357

CCOV53T OVCAR-5- loss chr1 chr1 105,693,360- 107,213,020- NA NA 7 4 120-122

CisR 105,693,590 107,213,392

CCOV53T OVCAR-5- gain chr7 chr7 43,658,336- 43,796,242- STK17A BLVRA 10 8 1202-1203

CisR 43,658,646 43,796,501 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Cene l Gene 2 read pairs reads id

CCOV53T OVCAR-S- gain chr8 chr8 51 ,537,224- 51, 558, 365- SNTC1 SNTC1.1 8 8 1440-1441

CisR SI ,537,621 51,558,640

CCOV53T OVCAR-S- loss chr9 chr9 9,571 ,641- 10,346,500- PTPRD PTPRD.1 13 10 1501-1502

CisR 9,571 ,979 10,346,793

CCOV53T OVCAR-S- loss chr9 chr9 13,393,469- 25,879,527- NA NA 14 10 1506-1516

CisR 13,393,767 25,879,839

CCOV53T OVCAR-S- gain chr9 chr9 72,257,591- 72,356,979- APBA1 PTAR1 24 26 1598-1599

CisR 72,257,898 72,357,265

CCOV53T OVCAR-S- loss chr9 chr9 95,391,158- 120,694,814- IPPK NA 10 6 1613-1647

CisR 95,391,362 120,695,144

CCOV53T OVCAR-S- gain chr9 chr9 117,102,018- 119,823,485- AKNA ASTN2 7 14 1632-1641

CisR 117,102,304 119,823,825

CCOV53T OVCAR-S- inversion chr9 chr9 117,201,476- 117,424,040- DFNB31 LOC100505478 13 12 1633-1636

CisR 117,201,726 117,424,363

CCOV53T OVCAR-S- loss chr9 chr9 117,242,778- 119,845,908- DFNB31 ASTN2 14 14 1634-1642

CisR 117,243,070 119,846,291

CCOV53T OVCAR-S- inversion chr9 chr9 117,241,889- 120,424,336- DFNB31 NA 7 2 1634-1644

CisR 117,242,136 120,424,541

CCOV53T OVCAR-S- inversion chr9 chr9 117,406,340- 120,514,276- C9orf91 NA 14 16 1635-1646

CisR 117,406,651 120,514,561

CCOV53T OVCAR-S- gain chr9 chr9 117,469,281- 120,833,635- NA NA 11 18 1637-1648

CisR 117,469,674 120,833,883

CCOV53T OVCAR-S- loss chr9 chr9 117,482,552- 120,906,092- NA NA 15 16 1638-1649

CisR 117,482,957 120,906,368

CCOV53T OVCAR-S- gain chr9 chr9 119,623,309- 120,430,976- ASTN2 NA 8 20 1640-1645

CisR 119,623,600 120,431 ,321

CCOV53T OVCAR-S- inversion / chr9 chr17 138,156,405- 48,243,547- NA SGCA, HILS1 5 4 1672-2695

CisR translocation 138,156,664 48,243,820

CCOV53T OVCAR-S- gain chr10 chr10 4,678,750- 4,813,515- NA NA 9 4 1694-1695

CisR 4,679,030 4,813,895

CCOV53T OVCAR-S- gain chr10 chr10 16,783,774- 17,353,007- RSU1 NA 17 14 1704-1707

CisR 16,784,079 17,353,316

CCOV53T OVCAR-S- gain chr10 chr10 16,942,523- 17,191,599- CUBN TRDMT1 10 2 1705-1706

CisR 16,942,748 17,191,957

CCOV53T OVCAR-S- gain chr10 chr10 75,185,969- 75,885,017- MSSS1 AP3M1 18 8 1797-1799

CisR 75,186,409 75,885,319

CCOV53T OVCAR-5- translocation chr10 chr13 127,574,429- 20,371,336- DHX32 NA 51 48 1835-2189

CisR 127,574,877 20,371,631

CCOV53T OVCAR-5- translocation chr11 chr21 84,185,737- 17,190,953- DLC2 USP25 16 22 1951-3219

CisR 84,186,046 17,191,324

CCOV53T OVCAR-5- translocation chr11 chr21 104,160,073- 42,066,299- NA DSCAM 12 12 1984-3233

CisR 104,160,461 42,066,549

CCOV53T OVCAR-5- gain chr12 chr12 20,730,847- 20,749,293- PDE3A PDE3A.1 12 18 2046-2047

CisR 20,731,150 20,749,550

CCOV53T OVCAR-5- gain chr13 chr13 94,265,620- 94,284,232- CPC6 CPC6.1 8 12 2262-2263

CisR 94,265,971 94,284,547

CCOV53T OVCAR-S- loss chr1 chr1 188,663,690- 192,253,173- NA NA 12 8 248-249

CisR 188,664,035 192,253,460

CCOV53T OVCAR-S- inversion chr16 chr16 78,575,398- 78,659,390- WWOX WWOX.1 6 4 2529-2530

CisR 78,575,556 78,659,638 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CC0VS3T OVCAR-5- inversion chr17 chr17 45,959,122- 78,664,420- NA RPTOR 10 2688-2744

CisR 45,959,427 78,664,706

CGOV37T 3 SK-OV-3 gain chr3 chr3 169,381,559- 169,503,874- MECOM MYNN 29 14 1044-1046

169,382,061 169,504,145

CGOV37T 3 SK-OV-3 gain chr3 chr3 186,638,469- 186,652,770- NA ST6GAL1 14 20 1069-1070

186,638,685 186,653,055

CGOV37T 3 SK-OV-3 inversion / chr1 chr5 35,073,119- 139,405,543- NA NRG2 23 14 113-1561 translocation 35,073,409 139,405,845

CGOV37T 3 SK-OV-3 inversion / chr1 chr2 35,387,896- 122,731 ,985- DLGAP3 NA 19 18 115-641 translocation 35,388,156 122,732,297

CGOV37T 3 SK-OV-3 inversion / chr1 chr20 36,783,517- 42,215,355- SH3D21 , EVA1 B SGK2, IFT52 8 12 117-4934 translocation 36,783,805 42,215,561 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV37T_3 SK-OV-3 inversion / chr4 chr20 145,029,243- 6,945,789- GYPA NA 20 18 1323-4819 translocation 145,029,507 6,946,069

CGOV37T_3 SK-OV-3 gain chrS chrS 32,306,054- 32,329,372- MTMR12 NA 8 18 1441-1443

32,306,261 32,329,536

CGOV37T_3 SK-OV-3 gain chr1 chr1 67,631,889- 68,331,364- IL23R GNG12-AS1 16 30 146-150

67,632,152 68,331,611

CGOV37T_3 SK-OV-3 gain chrS chrS 71 ,009,049- 71,110,170- NA NA 19 26 1491-1492

71 ,009,287 71,110,479

CGOV37T_3 SK-OV-3 loss chr1 chr1 68,668,399- 94,455,112- GNG12-AS1, ABCA4 14 8 152-165

68,668,781 94,455,387 WLS

CGOV37T_3 SK-OV-3 gain chrS chrS 133,765,451- 134,023,747- LOC102546229 SEC24A 25 24 1548-1550

133,765,734 134,024,048

CGOV37T_3 SK-OV-3 gain chrS chrS 135,657,768- 135,801 ,779- TRPC7 NA 9 32 1553-1555

135,658,092 135,802,166

CGOV37T_3 SK-OV-3 gain chrS chrS 137,726,660- 138,373,158- KDM3B SIL1 22 20 1559-1560

137,726,940 138,373,502

CGOV37T_3 SK-OV-3 inversion / chrS chr9 179,335,448- 139,363,013- TBC1 D9B SEC16A 5 8 1600-2557 translocation 179,335,632 139,363,173

CGOV37T_3 SK-OV-3 gain chr6 chr6 6,653,000- 6,745,310- LY86 NA 18 2 1622-1623

6,653,337 6,745,581

CGOV37T_3 SK-OV-3 gain chr6 chr6 11 ,408,616- 11,423,427- NA NA 21 16 1630-1631

11 ,408,927 11,423,726

CGOV37T_3 SK-OV-3 gain chr6 chr6 11 ,447,798- 11,467,857- NA NA 18 26 1632-1633

11 ,448,136 11,468,141

CGOV37T_3 SK-OV-3 gain chr6 chr6 11 ,552,528- 11,675,478- TMEM170B NA 23 28 1634-1635

11 ,552,884 11,675,837

CGOV37T_3 SK-OV-3 inversion / chr6 chr14 36,949,421- 74,254,826- MTCH1 LOC100506476, 19 4 1759-3589 translocation 36,949,740 74,255,152 ELMSAN1

CGOV37T_3 SK-OV-3 inversion / chr6 chr14 37,049,109- 74,469,077- NA ENTPD5 9 16 1760-3591 translocation 37,049,306 74,469,287

CGOV37T_3 SK-OV-3 gain chr6 chr6 75,065,772- 75,172,853- LOC101928516 LOC101928516.1 14 26 1839-1840

75,065,995 75,173,148

CGOV37T_3 SK-OV-3 inversion / chr6 chr21 77,667,507- 41,404,609- NA DSCAM 6 18 1849-5099 translocation 77,667,708 41,404,746

CGOV37T_3 SK-OV-3 gain chr6 chr6 96,014,351- 97,368,485- MANEA-AS1 KLHL32 30 22 1866-1870

96,014,640 97,368,772

CGOV37T_3 SK-OV-3 gain chr6 chr6 100,498,002- 100,835,689- MCHR2-AS1 SIM1 16 21 1871-1872

100,498,310 100,835,942

CGOV37T_3 SK-OV-3 gain chr6 chr6 154,858,766- 154,906,000- NA NA 15 22 1926-1927

154,859,083 154,906,244

CGOV37T_3 SK-OV-3 gain chr8 chr8 28,763,955- 29,187,125- HMBOX1 DUSP4 10 10 2212-2215

28,764,123 29,187,441

CGOV37T_3 SK-OV-3 gain chr8 chr8 90,074,882- 90,418,451- NA NA 20 26 2269-2273

90,075,183 90,418,706

CGOV37T_3 SK-OV-3 inversion / chr8 chrX 128,276,953- 13,618,050- CASC21 EGFL6 18 16 2317-5260 translocation 128,277,243 13,618,335

CGOV37T_3 SK-OV-3 inversion / chr8 chr19 128,318,597- 19,387,356- CASC21, CASC8 TM6SF2, SUGP1 75 50 2318-4533 translocation 128,318,956 19,387,656

CGOV37T_3 SK-OV-3 gain chr9 chr9 80,822,555- 80,967,584- NA NA 6 9 2471-2472

80,822,826 80,967,732

CGOV37T_3 SK-OV-3 gain chr10 chr10 7,567,976- 7,605,685- NA ITIH5 18 24 2597-2598

7,568,275 7,606,014 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV37T_3 SK-OV-3 translocation chr1 chr9 145,470,581- 139,406,685- NBPF20, NOTCH1 18 18 261-2558

145,470,971 139,407,009 NBPF10,

ANKRD34A,

POLR3GL

CGOV37T_3 SK-OV-3 inversion / chr1 chrS 145, 593, 644- 179,382,807- NBPF20, RNF130 19 20 263-1601 translocation 145,593,984 179,383,175 NBPF10,

NUDT17,

POLR3C

CGOV37T_3 SK-OV-3 gain chr10 chr10 75,619,240- 75,654,296- CAMK2G NA 27 20 2759-2760

75,619,557 75,654,622

CGOV37T_3 SK-OV-3 gain chr10 chr10 82,179,315- 104,218,211- FAM213A RPARP-AS1 , 6 6 2774-2799

82,179,573 104,218,359 TMEM180

CGOV37T_3 SK-OV-3 translocation chr10 chr11 97,186,387- 102,425,394- SORBS1 NA 16 22 2789-3060

97,186,659 102,425,667

CGOV37T_3 SK-OV-3 gain chr10 chr10 114,625,990- 114,647,759- NA NA 6 16 2807-2808

114,626,145 114,647,944

CGOV37T_3 SK-OV-3 translocation chr10 chr13 127,574,439- 20,371,277- DHX32 NA 83 56 2821-3357

127,574,761 20,371,596

CGOV37T_3 SK-OV-3 gain chr11 chr11 910,847- 925,291- CHID1 AP2A2 13 16 2851-2852

911,169 925,581

CGOV37T_3 SK-OV-3 inversion / chr11 chr20 4,028,908- 32,670,584- STIM1 RALY 22 16 2864-4926 translocation 4,029,217 32,670,924

CGOV37T_3 SK-OV-3 gain chr11 chr11 13,878,239- 13,924,281- NA NA 25 18 2874-2875

13,878,591 13,924,654

CGOV37T_3 SK-OV-3 inversion / chr11 chr20 36,041,949- 32,236,392- LDLRAD3 CBFA2T2 16 30 2894-4924 translocation 36,042,222 32,236,879

CGOV37T_3 SK-OV-3 translocation chr11 chr17 37,429,049- 10,138,514- NA NA 12 10 2898-4178

37,429,230 10,138,909

CGOV37T_3 SK-OV-3 gain chr1 chr1 150, 880, 558- 151,518,417- NA TUFT1 , MIR554 14 6 297-300

ISO, 880, 876 151,518,720

CGOV37T_3 SK-OV-3 gain chr11 chr11 61 ,761,936- 61,906,980- NA INCENP 9 14 2973-2975

61 ,762,129 61,907,273

CGOV37T_3 SK-OV-3 gain chr11 chr11 73,151,379- 73,174,408- FAM168A FAM168A.1 9 28 3008-3009

73,151,555 73,174,638

CGOV37T_3 SK-OV-3 gain chr11 chr11 103,457,416- 103,496,123- NA NA 20 4 3061-3062

103,457,724 103,496,470

CGOV37T_3 SK-OV-3 gain chr1 chr1 153,227,750- 153,887,907- LOR GATAD2B 16 2 307-312

153,228,039 153,888,171

CGOV37T_3 SK-OV-3 gain chr12 chr12 27,646,054- 27,679,828- SMC02 PPFIBP1 16 68 3133-3134

27,646,375 27,680,140

CGOV37T_3 SK-OV-3 gain chr1 chr1 155,139,338- 155,155,819- KRTCAP2 TRIM46, MUC1 11 18 314-315

155,139,608 155,156,113

CGOV37T_3 SK-OV-3 gain chr12 chr12 29,082,788- 33,443,929- NA NA 26 16 3143-3169

29,083,164 33,444,304

CGOV37T_3 SK-OV-3 inversion chr12 chr12 38,446,050- 58,658,399- NA NA 20 30 3193-3243

38,446,287 58,658,767

CGOV37T_3 SK-OV-3 gain chr1 chr1 156,234,965- 156,814,144- SMG5 NTRK1, INSRR 23 14 321-322

156,235,341 156,814,440

CGOV37T_3 SK-OV-3 inversion / chr12 chr14 49,033,847- 62,276,789- NA NA 16 26 3229-3555 translocation 49,034,190 62,277,026

CGOV37T_3 SK-OV-3 translocation chr12 chr15 49,682,797- 41,268,271- LOC101927267 INO80 7 10 3231-3882

49,683,031 41,268,680

CGOV37T_3 SK-OV-3 loss chr12 chr12 58,501,310- 59,114,579- NA LOC100506869, 25 14 3242-3244

58,501,590 59,114,860 LOC101927653 rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV37T SK-OV-3 inversion chr12 chr12 95,905,558- 96,008,091- METAP2, USP44 NA 15 20 3271-3273

95,905,885 96,008,386

CCOV37T 3 SK-OV-3 translocation chr12 chr20 96,570,584- 34,483,839- NA PHF20 13 2 3276-4928

96,570,888 34,484,125

CGOV37T_3 SK-OV-3 gain chr12 chr12 100,116,416- 100,679,761- ANKS1 B SCYL2 8 18 3281-3284

100,116,650 100,679,970

CGOV37T 3 SK-OV-3 inversion chr12 chr12 110,321, 697- 110,350,722- GLTP TCHP 13 6 3293-3294

H O, 322, 000 110,350,966

CGOV37T_3 SK-OV-3 gain chr13 chr13 40,280,526- 40,655,752- COG6 NA 19 10 3414-3416

40,280,820 40,656,063

CGOV37T_3 SK-OV-3 gain chr14 chr14 44,865,763- 44,978,204- NA FSCB 12 16 3530-3532

44,866,136 44,978,422

CGOV37T_3 SK-OV-3 gain chr14 chr14 61 ,807,147- 62,586,207- PRKCH LINC00643 32 40 3551-3558

61 ,807,458 62,586,606

CGOV37T 3 SK-OV-3 translocation chr14 chr1 S 62,212,067- 41,144,641- HIF1A, HIF1A- SPINT1 12 10 3554-3881

62,212,426 41,144,847 AS2

CGOV37T 3 SK-OV-3 translocation chr14 chr1 S 62,343,684- 41,105,288- NA ZFYVE19, 32 26 3556-3880

62,344,053 41,105,710 PPP1 R14D

CGOV37T 3 SK-OV-3 translocation chr14 chr22 62,441,188- 47,081,262- NA CERK 18 12 3557-5240

62,441,440 47,081,471

CGOV37T 3 SK-OV-3 translocation chr1 chr10 183,065,149- 82,317,945- LAMC1 SH2D4B 24 30 356-2775

183,065,485 82,318,275

CGOV37T 3 SK-OV-3 translocation chr14 chr17 73,364,330- 46,826,021- DPF3 NA 20 34 3580-4322

73,364,697 46,826,350

CGOV37T_3 SK-OV-3 gain chr14 chr14 81 ,894,239- 81,929,915- STON2 NA 15 28 3600-3601

81 ,894,632 81,930,246

CGOV37T_3 SK-OV-3 gain chr14 chr14 103,377,885- 103,389,766- TRAF3 AMN 13 10 3621-3622

103,378,137 103,390,040

CGOV37T_3 SK-OV-3 inversion / chr1 chr21 205,718,559- 43,158,783- NUCKS1 RIPK4 17 20 377-5104 translocation 205,718,797 43,159,041

CGOV37T_3 SK-OV-3 gain chr1 chr1 206,219,102- 206,258,372- AVPR1 B C1orf186 15 20 379-380

206,219,433 206,258,687

CGOV37T_3 SK-OV-3 gain chr1S chr1 S 39,903,876- 76,712,718- FSIP1 SCAPER 15 18 3875-3951

39,904,163 76,712,977

CGOV37T_3 SK-OV-3 gain chr1S chr1 S 65,312,758- 65,360,887- MTFMT RASL12 21 22 3926-3927

65,313,094 65,361,201

CGOV37T_3 SK-OV-3 gain chr1S chr1 S 69,364,247- 69,396,321- MIRS48H4 MIRS48H4.1 24 26 3932-3934

69,364,573 69,396,615

CGOV37T_3 SK-OV-3 gain chr16 chr16 2,111 ,215- 2,252,570- TSC2 MLST8 8 8 3994-3996

2,111 ,393 2,252,843

CGOV37T_3 SK-OV-3 gain chr16 chr16 67,601,362- 67,945,578- CTCF PSKH1 17 8 4136-4138

67,601,660 67,945,855

CGOV37T_3 SK-OV-3 gain chr16 chr16 68,289,173- 68,302,889- PLA2G15 SLC7A6 16 26 4140-4141

68,289,462 68,303,196

rearranged split Rearrangement

Lab ID Cell line Type Chr 1 Chr 2 Region 1 Region 2 Gene l Gene 2 read pairs reads id

CGOV37T_3 SK-OV-3 translocation chr17 chr20 44,115,589- 62,219,897- KANSU GMEB2 16 10 4305-4969

44,115,957 62,220,286

CGOV37T_3 SK-OV-3 translocation chr19 chrX 19,248,784- 13,973,185- TMEM161A NA 26 30 4530-5262

19,249,088 13,973,503

CGOV37T_3 SK-OV-3 translocation chr2 chr3 25,711,722- 13,782,215- DTNB LINC00620 7 2 459-817

25,712,018 13,782,481

CGOV37T_3 SK-OV-3 inversion / chr1 chr3 16,777,837- 55,831,409- NECAP2 ERC2 22 26 46-858

translocation 16,778,152 55,831,748

CGOV37T_3 SK-OV-3 gain chr2 chr2 42,568,764- 42,608,757- NA NA 24 14 479-480

42,569,044 42,609,166

CGOV37T_3 SK-OV-3 gain chr20 chr20 14,966,502- 15,008,223- MACROD2 MACROD2.1 13 6 4821-4822

14,966,823 15,008,513

CGOV37T_3 SK-OV-3 gain chr20 chr20 29,877,203- 30,318,986- NA NA 5 9 4921-4922

29,877,329 30,319,164

CGOV37T_3 SK-OV-3 translocation chr20 chr21 34,578,212- 45,050,461- CNBD2 HSF2BP 8 10 4929-5109

34,578,508 45,050,716

CGOV37T_3 SK-OV-3 gain chr2 chr2 67,089,645- 67,099,868- NA NA 20 10 500-501

67,089,943 67,100,156

CGOV37T_3 SK-OV-3 inversion / chr21 chrX 43,067,168- 70,394,406- NA NLGN3 16 20 5102-5322 translocation 43,067,512 70,394,726

CGOV37T_3 SK-OV-3 gain chr21 chr21 46,297,199- 46,329,866- PTTG1 IP ITGB2 6 2 5115-5116

46,297,352 46,330,017

CGOV37T_3 SK-OV-3 gain chr22 chr22 47,070,614- 47,244,533- GRAMD4 TBC1 D22A 20 4 5239-5242

47,070,925 47,244,823

CGOV37T_3 SK-OV-3 gain chr2 chr2 102,590,025- 102,757,831- NA IL1 R1 15 20 623-624

102,590,336 102,758,105

CGOV37T_3 SK-OV-3 inversion / chr2 chr11 190,773,550- 102,214,353- NA BIRC3, BIRC2 13 20 732-3058 translocation 190,773,857 102,214,612

CGOV37T_3 SK-OV-3 inversion / chr2 chr10 190,964,011- 97,514,217- NA ENTPD1 , 15 20 734-2790 translocation 190,964,318 97,514,521 ENTPD1-AS1

CGOV37T_3 SK-OV-3 gain chr2 chr2 238,461,087- 238,666,365- MLPH LRRFIP1 16 20 780-781

238,461,343 238,666,648

CGOV37T_3 SK-OV-3 translocation chr3 chr14 13,403,680- 35,929,680- NUP210 NA 6 6 813-3524

13,403,946 35,929,931

CGOV37T_3 SK-OV-3 translocation chr3 chr4 55,890,017- 25,365,949- ERC2, MIR3938 ZCCHC4 27 14 859-1158

55,890,290 25,366,199

CGOV37T_3 SK-OV-3 translocation chr3 chr11 63,713,179- 65,565,258- NA OVOL1 6 4 868-2992

63,713,437 65,565,503

CGOV37T_3 SK-OV-3 loss chr3 chr3 86,343,891- 87,503,847- NA NA 6 10 927-934

86,344,177 87,504,080

CGOV37T_3 SK-OV-3 inversion chr3 chr3 86,535,950- 87,422,349- NA NA 8 2 928-933

86,536,172 87,422,621

CGOV37T_3 SK-OV-3 inversion / chr3 chr17 87,128,687- 29,743,119- NA RAB11 FIP4 6 4 930-4253 translocation 87,128,934 29,743,448

CGOV37T_3 SK-OV-3 inversion chr3 chr3 87,127,783- 87,233,663- NA NA 7 6 930-931

87,128,035 87,233,898

CGOV37T_3 SK-OV-3 inversion / chr1 chr11 27,668,069- 62,449,273- SYTL1 UBXN1 , 8 14 99-2977 translocation 27,668,371 62,449,545 LRRN4CL

CGOV37T_3 SK-OV-3 gain chr3 chr3 142,982,619- 143,098,375- SLC9A9 SLC9A9.1 14 30 997-998

142,982,971 143,098,610

CGOV37T_3 SK-OV-3 gain chr3 chr3 143,129,258- 143,242,703- SLC9A9 SLC9A9.1 23 28 999-1000

143,129,612 143,243,055

Table S10 Predicted in-frame coding fusions Related to Fii yo 2020/081549 imental Procedures. In-frame rearrangements were identified from rearranged reap( ^r p/ j^2019/056299

Amino Amino A Exons add 5' add 5 ^* a< .

Lab id Cell line Gene 5 ^* Gene 3' Tx5' Tx3’ Junction s’ Junction 3' Exons 5’ 3’ start end ™

. IG

CGOV16T OAW-42 TICAM1 PKN1 NMJ 82919 NM_002741 chr19:483S369 chr19:14546641 promoter 2-22 0 0 it

CGOV16T OAW-42 HORMAD2 BAIAP2L2 NMJ 52510 NM_025045 chr22:30S18842 chr22:38489889 1-9 8-14 1 273

CGOV16T OAW-42 BAIAP2L2 HORMAD2 NM_025045 NMJ S2S10 chr22:38489889 chr22:30S18842 1-7 10-10 1 204 2

CGOV16T OAW-42 SLC9A4 PSMD14 NM_001011552 NM_005805 chr2:103085631 chr2:162173960 promoter 1-10 0 0 2

CGOV16T OAW-42 ACOXL RYR3 NM_001142807 NM_001036 chr2:111568992 chr15:33657906 1-8 2-104 1 251

CGOV16T OAW-42 RYR3 ACOXL NM_001036 NM_001142807 chr15:33657906 chr2:111568992 1-1 9-17 1 17

CGOV16T OAW-42 ZNF619 ADAMTS9 NM_001145082 NMJ 82920 chr3:40526706 chr3:64655126 1-4 4-39 1 138 2

CGOV16T OAW-42 ADAMTS9 ZNF619 NMJ 82920 NM_001145082 chr3:64655126 chr3:40526706 1-3 5-5 1 226 2

CGOV16T OAW-42 SLC44A1 FSD1 L NM_001286730 NM_001145313 chr9:108009438 chr9:108303546 1-1 14-14 1 12 1

CGOV16T OAW-42 FSD1 L SLC44A1 NM_001145313 NM_001286730 chr9:108303546 chr9:108009438 1-13 2-16 1 489 4

CGOV16T OAW-42 IQGAP1 PIR NM_003870 NM_001018109 chr15:91025630 chrX:15495285 1-28 3-9 1 1185

CGOV16T OAW-42 PIR IQGAP1 NM_001018109 NM_003870 chrX:15495285 chr15:91025630 1-2 29-38 1 63

CGOV17T OV-167 FHIT NLGN1 NM_001166243 NM_014932 chr3:60846792 chr3:173223546 promoter 1-5 0 0 1

CGOV17T OV-167 NLGN1 FHIT NM_014932 NM_001166243 chr3:173223546 chr3:60846792 promoter 1-5 0 0

CGOV17T OV-167 INTS12 GSTCD NM_001142471 NM_024751 chr4:106617656 chr4:106646925 1-1 3-11 1 52

CGOV17T OV-167 GSTCD INTS12 NM_024751 NM_001142471 chr4:106646925 chr4:106617656 1-2 2-6 1 211 2

CGOV17T OV-167 ADCY10 MPC2 NM_001167749 NM_001143674 chr1:167779110 chr1 :167906195 1-27 1-5 1 1404

CGOV17T OV-167 MPC2 ADCY10 NM_001143674 NM_001167749 chr1:167906195 chr1 :167779110 promoter 28-28 0 0

CGOV17T OV-167 LM07 TFDP1 NM_005358 NM_007111 chr13:76214144 chr13:114249214 1-2 2-11 1 75 4

CGOV17T OV-167 TFDP1 LM07 NM_007111 NM_005358 chr13:114249214 chr13:76214144 1-1 3-30 1 4

CGOV17T OV-167 FBXL3 COL4A2 NM_012158 NM_001846 chr13:77602546 chr13:111088608 promoter 12-47 0 0

CGOV18T OV177 BPIFB2 CCM2L NM_025227 NM_080625 chr20:31593865 chr20:30609349 promoter 6-8 0 0 2

CGOV18T OV177 GK DMD NM_000167 NM_004014 chrX:30728348 chrX:31382379 1-12 7-25 1 319 3

CGOV18T OV177 DMD GK NM_004014 NM_000167 chrX:31382379 chrX:30728348 1-6 13-19 1 299 3

CGOV18T OV177 VAMP8 TCF7L1 NM_003761 NM_031283 chr2:85801589 chr2:85409211 promoter 4-12 0 0 3

CGOV18T OV177 CPAMD8 EPB41 L5 NM_015692 NM_001184939 chr19:17138870 chr2:120823603 promoter 3-16 0 0 1

CGOV18T OV177 RASSF1 GNAI2 NMJ 70713 NM_001282619 chr3:50379094 chr3:50289022 promoter 1-8 0 0

CGOV18T OV177 MARCH6 ANKRD33B NM_001270660 NM_001164440 chr5:10426176 chr5:10604608 1-22 2-4 1 743

CGOV18T OV177 ANKRD33B MARCH6 NM_001164440 NM_001270660 chr5:10604608 chr5:10426176 1-1 23-25 1 122 1

CGOV18T OV177 FBX032 ANXA13 NM_001242463 NM_001003954 chr8:124555878 chr8:124706835 promoter 8-12 0 0 7

CGOV18T OV177 NEK6 UROS NM_001145001 NM_000375 chr9:127025843 chr10:127484166 promoter 8-9 0 0 1

CGOV18T OV177 UROS NEK6 NM_000375 NM_001145001 chr10:127484166 chr9:127025843 1-7 1-10 1 187 1

CGOV18T OV177 NRXN2 LRRC4B NM_015080 NM_001080457 chr11 :64483965 chr19:51035746 promoter 2-2 0 0

CGOV18T OV177 LRRC4B NRXN2 NM_001080457 NM_015080 chr19:51035746 chr11:64483965 1-1 1-22 1 99 1

CGOV18T OV177 KLC2 KDM2A NM_001134775 NM_012308 chr11 :66026475 chr11:66922859 1-1 2-20 1 76

CGOV18T OV177 KDM2A KLC2 NM_012308 NM_001134775 chr11 :66922859 chr11:66026475 1-1 2-15 1 14

CGOV18T OV177 UVRAG CAPN5 NM_003369 NM_004055 chr11 :75805896 chr11:76787819 1-13 1-12 1 435

CGOV18T OV177 CAPN5 UVRAG NM_004055 NM_003369 chr11 :76787819 chr11:75805896 promoter 14-15 0 0

CGOV18T OV177 KSR2 WSB2 NMJ 73598 NM_001278558 chr12:118353206 chr12:118490460 1-1 1-5 1 31 4

CGOV18T OV177 WSB2 KSR2 NM_001278558 NM_173598 chr12:118490460 chr12:118353206 promoter 2-20 0 0

CGOV18T OV177 PTP4A2 MYH14 NM_080391 NM_001077186 chr1:32405045 chr19:50791023 promoter 33-41 0 0

CGOV18T OV177 TMEM63C SPTLC2 NM_020431 NM_004863 chr14:77662384 chr14:77983978 promoter 12-12 0 0 5

CGOV18T OV177 SPTLC2 TMEM63C NM_004863 NM_020431 chr14:77983978 chr14:77662384 1-11 1-22 1 523 5

CGOV18T OV177 PCSK6 LINS NM_001291309 NM_001040616 chr15:102006511 chr15:101113304 1-1 5-6 1 98

4 WO 2020/081549 PCT/US2019/056299 Amino Amino A

Exons add 5' add 5 ^* ai^

Lab id Cell line Gene s' Gene 3' Tx5' Tx3’ Junction s' Junction 3' Exons 5' 3' start end ,

ic

CGOV18T OV177 PDPR VAC14 NM_017990 NM_018052 chr16:70160412 chr16:70745499 1-1 15-19 1 75 lb

CGOV18T OV177 VAC14 PDPR NM_018052 NM_017990 chr16:70745499 chr16:70160412 1-14 2-17 1 553 5

CGOV18T OV177 SUM02 UBE20 NM_001005849 NM_022066 chr17:73169898 chr17:74421630 1-2 2-18 1 51

CGOV18T OV177 UBE20 SUM02 NM_022066 NM_001005849 chr17:74421630 chr17:73169898 1-1 3-3 1 139 1

CGOV21T OV-90 RIPK2 GPR158 NM_003821 NM_020752 chr8:90780887 chr10:25561561 1-3 3-11 1 161

CGOV21T OV-90 GPR158 RIPK2 NM_020752 NM_003821 chr10:25561561 chr8:90780887 1-2 4-11 1 336 3

CGOV25T OVCAR-3 SEMA5B DYM NM_001031702 NM_017653 chr3:122729389 chr18:46800595 promoter 10-16 0 0 1

CGOV25T OVCAR-3 DYM SEMA5B NM_017653 NM_001031702 chr18:46800595 chr3:122729389 1-9 1-22 1 375 3

CGOV25T OVCAR-3 ENDOU PEF1 NM_001172439 NM_012392 chr12:48122600 chr1 :32102532 promoter 2-5 0 0

CGOV25T OVCAR-3 TET2 GSTCD NM_001127208 NM_024751 chr4:106197072 chr4:106738622 1-8 5-11 1 1512

CGOV25T OVCAR-3 MZB1 GAB2 NM_016459 NM_080491 chr5:138729100 chr11:78104784 promoter 2-10 0 0 3

CGOV25T OVCAR-3 ANKS1A PPARD NM_015245 NMJ 77435 chr6:34944257 chr6:35314313 1-3 1-5 1 145

CGOV25T OVCAR-3 PPARD ANKS1A NMJ 77435 NM_015245 chr6:35314313 chr6:34944257 promoter 4-24 0 0

CGOV25T OVCAR-3 PGC TFEB NM_002630 NM_001271945 chr6:41717494 chr6:41675505 promoter 1-8 0 0 1

CGOV25T OVCAR-3 KCNN3 ASH1 L NMJ 70782 NM_018489 chr1:154782052 chr1 :155470980 1-2 2-27 1 38

CGOV25T OVCAR-3 ASH1 L KCNN3 NM_018489 NMJ 70782 chr1:155470980 chr1 :154782052 1-1 3-8 1 140 1

CGOV25T OVCAR-3 MPP7 BICD1 NMJ 73496 NM_001003398 chr10:28419608 chr12:32495936 1-5 8-8 1 149

CGOV25T OVCAR-3 BICD1 MPP7 NM_001003398 NMJ 73496 chr12:32495936 chr10:28419608 1-7 6-16 1 820 8

CGOV25T OVCAR-3 ANK3 CCDC6 NM_001149 NM_005436 chr10:61901547 chr10:61637591 promoter 2-9 0 0 1

CGOV25T OVCAR-3 NUP98 BEAN1 NM_016320 NM_001136106 chr11 :3805831 chr16:66503932 promoter 1-2 0 0 1

CGOV25T OVCAR-3 BEAN1 NUP98 NM_001136106 NM_016320 chr16:66503932 chr11:3805831 promoter 1-32 0 0

CGOV25T OVCAR-3 SLC1A2 LDLRAD3 NM_001195728 NM_001304264 chr11 :35390796 chr11 :36151619 promoter 1-3 0 0

CGOV25T OVCAR-3 LDLRAD3 SLC1A2 NM_001304264 NM_001195728 chr11 :36151619 chr11:35390796 promoter 1-10 0 0

CGOV25T OVCAR-3 RBM14 PELI3 NM_001198836 NM_001243135 chr11 :66383175 chr11:66242885 promoter 6-6 0 0

CGOV25T OVCAR-3 FCHSD2 P2RY6 NM_014824 NM_001277205 chr11 :72734145 chr11:72999349 1-3 1-1 1 55 2

CGOV25T OVCAR-3 P2RY6 FCHSD2 NM_001277205 NM_014824 chr11 :72999349 chr11:72734145 promoter 4-20 0 0

CGOV25T OVCAR-3 PRDM10 APLP2 NM_020228 NM_001142276 chr11 :129834904 chr11:129941149 promoter 2-17 0 0

CGOV25T OVCAR-3 APLP2 PRDM10 NM_001142276 NM_020228 chr11 :129941149 chr11:129834904 1-1 1-21 1 35

CGOV25T OVCAR-3 TEAD4 TSPAN9 NM_003213 NM_001168320 chr12:3101892 chr12:3209687 promoter 1-7 0 0

CGOV25T OVCAR-3 TSPAN9 TEAD4 NM_001168320 NM_003213 chr12:3209687 chr12:3101892 promoter 1-11 0 0

CGOV25T OVCAR-3 UBALD1 UBN1 NMJ 45253 NM_001079514 chr16:4664010 chr16:4916391 1-1 7-17 1 40

CGOV25T OVCAR-3 UBN1 UBALD1 NM_001079514 NMJ 45253 chr16:4916391 chr16:4664010 1-6 2-3 1 370 3

CGOV25T OVCAR-3 RASD1 LRRC75A NM_001199989 NM_001113567 chr17:17402084 chr17:16364853 promoter 3-4 0 0

CGOV25T OVCAR-3 PCTP ANKFN1 NM_021213 NMJ 53228 chr17:53835385 chr17:54552918 1-1 15-17 1 47 1

CGOV25T OVCAR-3 ANKFN1 PCTP NMJ 53228 NM_021213 chr17:54552918 chr17:53835385 1-14 2-6 1 594 5

CGOV25T OVCAR-3 ZNF142 POLR1A NM_001105537 NM_015425 chr2:219527459 chr2:86302146 promoter 13-34 0 0

CGOV28T OVKATE PHOSPH02- NALCN NM_001199290 NM_052867 chr2:170562657 chr13:101823128 promoter 15-43 0 0 5

KLHL23

6

CGOV28T OVKATE NALCN PHOSPH02- NM_052867 NM_001199290 chr13:101823128 chr2:170562657 1-14 1-3 1 613

KLHL23

CGOV28T OVKATE PHOSPH02- NALCN NM_001199290 NM_052867 chr2:170559191 chr13:101825977 promoter 15-43 0 0

KLHL23

_. 6

CGOV28T OVKATE NALCN PHOSPH02- NM_052867 NM_001199290 chr13:101825977 chr2:170559191 1-14 1-3 1 613

KLHL23

CGOV28T OVKATE HELQ FAM175A NM_001297755 NM_139076 chr4:84367790 chr4:84385564 1-3 8-9 1 397

CGOV28T OVKATE FAM175A HELQ NMJ 39076 NM_001297755 chr4:84385564 chr4:84367790 1-7 4-17 1 227 2 WO 2020/081549 PCT/US2019/056299 Amino Amino A

Exons add 5' add 5 ^* ai^

Lab id Cell line Gene s' Gene 3' Tx5' Tx3’ Junction s' Junction 3' Exons 5' 3' start end ,

ic

CGOV30T OVSAHO PDE4D UBE2D2 NM_001165899 NM_003339 chrS:59688998 chrS:138950713 promoter 2-7 0 0 iti

CGOV30T OVSAHO UBE2D2 PDE4D NM_003339 NM_001165899 chrS:138950713 chrS:59688998 1-1 1-16 1 8

CGOV30T OVSAHO DDX46 CATSPER3 NM_001300860 NMJ 78019 chrS:134127296 chrS:134328773 1-13 3-8 1 542

CGOV30T OVSAHO CATSPER3 DDX46 NMJ 78019 NM_001300860 chrS:134328773 chrS:134127296 1-2 14-23 1 84

CGOV30T OVSAHO RNF8 GRID1 NM_003958 NM_017551 chr6:37332447 chr10:87402385 1-2 14-16 1 80 5

CGOV30T OVSAHO GRID1 RNF8 NM_017551 NM_003958 chr10:87402385 chr6:37332447 1-13 3-8 1 731 7

CGOV30T OVSAHO KIFC2 UBE2V1 NMJ 45754 NM_001032288 chr8:145696757 chr20:48712948 1-12 3-4 1 460

CGOV30T OVSAHO UBE2V1 KIFC2 NM_001032288 NMJ 45754 chr20:48712948 chr8:145696757 1-2 13-17 1 57

CGOV30T OVSAHO RALGPS1 ENG NM_001190730 NM_001278138 chr9:129753751 chr9:130595556 1-3 1-11 1 72 4

CGOV30T OVSAHO ENG RALGPS1 NM_001278138 NM_001190730 chr9:130595556 chr9:129753751 promoter 4-11 0 0

CGOV30T OVSAHO CFAP43 CFAP58 NM_025145 NM_001008723 chr10:105934091 chr10:106187744 1-19 16-18 1 820

CGOV30T OVSAHO CFAP58 CFAP43 NM_001008723 NM_025145 chr10:106187744 chr10:105934091 1-15 20-38 1 752 7

CGOV30T OVSAHO LGALS14 KLF12 NM_020129 NM_007249 chr19:40192995 chr13:74691820 promoter 1-7 0 0 8

CGOV30T OVSAHO ISM2 COX16 NM_182509 NM_001204090 chr14:77969939 chr14:70819640 promoter 2-3 0 0

CGOV30T OVSAHO CSNK1 G2 AP3D1 NM_001319 NM_001261826 chr19:1950624 chr19:2147114 promoter 2-32 0 0

CGOV30T OVSAHO AP3D1 CSNK1G2 NM_001261826 NM_001319 chr19:2147114 chr19:1950624 1-1 1-11 1 32

CGOV30T OVSAHO GNB1 L MKL1 NM_053004 NM_001282661 chr22:19847415 chr22:40895073 promoter 1-11 0 0

CGOV30T OVSAHO MKL1 HDAC10 NM_001282661 NM_001159286 chr22:40884272 chr22:50684020 promoter 19-19 0 0

CGOV30T OVSAHO TUBGCP6 MKL1 NM_020461 NM_001282661 chr22:50684020 chr22:40884272 promoter 1-11 0 0 6

CGOV30T OVSAHO ZCWPW2 RBMS3 NM_001040432 NM_001177712 chr3:28523225 chr3:29902771 1-3 7-14 1 203

CGOV30T OVSAHO RBMS3 ZCWPW2 NM_001177712 NM_001040432 chr3:29902771 chr3:28523225 1-6 4-8 1 212 2

CGOV32T PEO-14 NFASC TMCC2 NM_001005389 NM_014858 chr1:204892095 chr1 :205209478 promoter 2-5 0 0 2

CGOV32T PEO-14 TMCC2 NFASC NM_014858 NM_001005389 chr1:205209478 chr1 :204892095 1-1 1-14 1 69

CGOV32T PEO-14 PUM1 SDC3 NM_001020658 NM_014654 chr1:31498176 chr1 :31349720 1-2 4-5 1 144

CGOV32T PEO-14 GMPS RNF180 NM_003875 NMJ 78532 chr3:155590056 chr5:63462331 1-1 1-4 1 9 2

CGOV32T PEO-14 MECOM TNIK NM_001205194 NM_001161560 chr3:169080667 chr3:170819804 promoter 21-32 0 0

CGOV32T PEO-14 TNIK MECOM NM_001161560 NM_001205194 chr3:170819804 chr3:169080667 1-20 1-14 1 794 7

CGOV32T PEO-14 ADCY1 C7orf72 NM_021116 NM_001161834 chr7:45614318 chr7:50147671 promoter 3-9 0 0

CGOV32T PEO-14 C7or(72 ADCY1 NM_001161834 NM_001281768 chr7:50147671 chr7:45614318 1-2 1-8 1 217 2

CGOV32T PEO-14 UPP1 ABCA13 NM_001287426 NMJ 52701 chr7:48141841 chr7:48232235 1-3 2-62 1 107

CGOV32T PEO-14 ABCA13 UPP1 NMJ 52701 NM_001287426 chr7:48232235 chr7:48141841 1-1 4-7 1 23

CGOV32T PEO-14 AIFM2 LRRC20 NM_001198696 NM_001278214 chr10:71888805 chr10:72110545 promoter 1-3 0 0 1

CGOV32T PEO-14 LRRC20 AIFM2 NM_001278214 NM_001198696 chr10:72110545 chr10:71888805 promoter 1-8 0 0

CGOV32T PEO-14 MAT1A TSPAN14 NM_000429 NM_001128309 chr10:82052544 chr10:82225622 promoter 1-5 0 0

CGOV32T PEO-14 KCNC1 SAA4 NM_001112741 NM_006512 chr11 :17802481 chr11:18254196 1-3 2-3 1 564

CGOV32T PEO-14 SAA4 KCNC1 NM_006512 NM_001112741 chr11 :18254196 chr11:17802481 1-1 4-4 1 30

CGOV32T PEO-14 SOX5 CCDC91 NM_001261414 NM_018318 chr12:24344394 chr12:28487998 promoter 6-12 0 0 5

CGOV32T PEO-14 CCDC91 SOX5 NM_018318 NM_001261414 chr12:28487998 chr12:24344394 1-5 1-12 1 192 1

CGOV32T PEO-14 SOX5 CCDC91 NM_001261414 NM_018318 chr12:24498891 chr12:28658074 promoter 12-12 0 0

CGOV32T PEO-14 CCDC91 SOX5 NM_018318 NM_001261414 chr12:28658074 chr12:24498891 1-11 1-12 1 405 4

CGOV32T PEO-14 GEMIN2 CTAGE5 NM_001009182 NM_203354 chr14:39599273 chr14:39735206 1-6 2-24 1 196

CGOV32T PEO-14 CTAGE5 GEMIN2 NM_001247988 NM_001009182 chr14:39735206 chr14:39599273 promoter 7-9 0 0

CGOV32T PEO-14 KLC1 PPP1 R13B NMJ 82923 NM_015316 chr14:104162879 chr14:104313619 1-12 2-17 1 550 1

CGOV32T PEO-14 PPP1 R13B KLC1 NM_015316 NMJ 82923 chr14:104313619 chr14:104162879 1-1 13-13 1 3

5 WO 2020/081549 PCT/US2019/056299 Amino Amino A

Exons add 5' add 5 ^* ai^

Lab id Cell line Gene s' Gene 3' Tx5' Tx3’ Junction s' Junction 3' Exons 5' 3' start end ,

ic

CGOV32T PEO-14 ZNF106 JMJD7- NM_001284306 NM_001198588 chr15:42734577 chr15:42138334 1-4 22-24 1 302 lb

PLA2G4B ₇

CGOV32T PEO-14 UPF1 NCAN NM_002911 NM_004386 chr19:18967880 chr19:19352438 1-14 12-14 1 656

CGOV32T PEO-14 NCAN UPF1 NM_004386 NM_002911 chr19:19352438 chr19:18967880 1-11 15-23 1 1164 1

CGOV32T PEO-14 DLGAP4 NDRG3 NM_001042486 NM_022477 chr20:35102889 chr20:35287242 promoter 12-14 0 0 6

CGOV32T PEO-14 NDRG3 DLGAP4 NM_022477 NM_001042486 chr20:35287242 chr20:35102889 1-11 1-4 1 274 2

CGOV32T PEO-14 TOMM22 TAB1 NM_020243 NM_006116 chr22:39078015 chr22:39807021 promoter 2-11 0 0

CGOV32T PEO-14 TAB1 TOMM22 NM_006116 NM_020243 chr22:39807021 chr22:39078015 1-1 2-4 1 11

CGOV32T PEO-14 CAMSAP2 PPP1 R12B NM_001297707 NM_001167857 chr1:200740267 chr1 :202323460 1-2 2-10 1 133

CGOV32T PEO-14 PPP1 R12B CAMSAP2 NM_001167857 NM_001297707 chr1:202323460 chr1 :200740267 1-1 3-18 1 97

CGOV34T PEO-6 NFASC USP32 NM_001005388 NM_032582 chr1:204969465 chr17:58425003 1-23 2-34 1 1006 1

CGOV34T PEO-6 USP32 NFASC NM_032582 NM_001005388 chr17:58425003 chr1 :204969465 1-1 24-28 1 19

CGOV34T PEO-6 ATL1 SAV1 NM_001127713 NM_021818 chr14:51094346 chr14:51134708 1-11 1-5 1 373 0

CGOV34T PEO-6 SAV1 ATL1 NM_021818 NM_001127713 chr14:51134708 chr14:51094346 promoter 12-13 0 0

CGOV34T PEO-6 MLPH PRDM12 NM_001281474 NM_021619 chr2:238445347 chr9:133542478 1-5 3-5 1 225 3

CGOV34T PEO-6 PRDM12 MLPH NM_021619 NM_001281474 chr9:133542437 chr2:238445398 1-2 6-12 1 138 1

CGOV44T FU-OV-1 PTPRZ1 AASS NM_001206838 NM_005763 chr7:121700400 chr7:121742833 1-29 11-23 1 1409 2

CGOV44T FU-OV-1 AASS PTPRZ1 NM_005763 NM_001206838 chr7:121742833 chr7:121700400 1-10 30-30 1 426 4

CGOV44T FU-OV-1 GLS2 RBMS2 NM_001280796 NM_002898 chr12:56868072 chr12:56939506 1-4 2-13 1 132 4

CGOV44T FU-OV-1 RBMS2 GLS2 NM_002898 NM_001280796 chr12:56939506 chr12:56868072 1-1 5-10 1 22

CGOV44T FU-OV-1 IFNL1 ACTN4 NMJ 72140 NM_004924 chr19:39786271 chr19:39138905 promoter 2-21 0 0 1

CGOV44T FU-OV-1 DEFB123 REM1 NM_153324 NM_014012 chr20:30025438 chr20:30067826 promoter 3-4 0 0

CGOV44T FU-OV-1 CMTM8 CLASP2 NMJ 78868 NM_015097 chr3:32376172 chr3:33728591 1-1 6-39 1 49 1

CGOV44T FU-OV-1 DOK3 ZNF527 NM_001144875 NM_032453 chr5:176930899 chr19:37864708 1-4 1-4 1 215 1

CGOV44T FU-OV-1 ZNF527 DOK3 NM_032453 NM_001144875 chr19:37864708 chr5:176930899 promoter 5-5 0 0

CGOV45T COV-318 C3orf22 FBX042 NM_152533 NM_018994 chr3:126278010 chr1 :16678898 promoter 1-9 0 0 2

CGOV45T COV-318 MAST4 CHD1 NMJ 98828 NM_001270 chr5:66230456 chr5:98211620 1-5 24-35 1 236

CGOV45T COV-318 CHD1 MAST4 NM_001270 NMJ 98828 chr5:98211620 chr5:66230456 1-23 6-6 1 1132 1

CGOV45T COV-318 BSCL2 ZNF536 NM_001130702 NM_014717 chr11 :62467932 chr19:30903392 1-2 1-4 1 98 2

CGOV45T COV-318 ZNF536 BSCL2 NM_014717 NM_001130702 chr19:30903392 chr11:62467932 promoter 3-8 0 0

CGOV46T JHOS-2 CDK11 B KIAA2013 NM_001291345 NMJ 38346 chr1:1613595 chr1 :11985279 1-5 2-3 1 198

CGOV46T JHOS-2 KIAA2013 CDK11 B NM_138346 NM_033487 chr1:11985279 chr1 :1613595 promoter 1-13 0 0 3

CGOV46T JHOS-2 STAB1 UBE3C NM_015136 NM_014671 chr3:52546518 chr7:157000784 1-27 14-23 1 993

CGOV46T JHOS-2 UBE3C STAB1 NM_014671 NM_015136 chr7:157000784 chr3:52546518 1-13 28-69 1 603 6

CGOV46T JHOS-2 ARMC8 SF3B3 NM_001282342 NM_012426 chr3:137930184 chr16:70602680 promoter 22-25 0 0 9

CGOV46T JHOS-2 SF3B3 ARMC8 NM_012426 NM_001282342 chr16:70602680 chr3:137930184 1-21 1-19 1 1055 0

CGOV46T JHOS-2 NUB1 ABCF2 NM_001243351 NM_005692 chr7:151033958 chr7:150924350 promoter 1-15 0 0

CGOV46T JHOS-2 THEM6 FANCI NM_016647 NM_001113378 chr8:143809946 chr15:89843694 1-1 26-37 1 171

CGOV46T JHOS-2 FANCI THEM6 NM_001113378 NM_016647 chr15:89843694 chr8:143809946 1-25 2-2 1 963 9

CGOV46T JHOS-2 PAAF1 RBFOX3 NM_001267806 NM_001082575 chr11 :73604197 chr17:77330684 promoter 1-11 0 0 1

CGOV46T JHOS-2 RBFOX3 PAAF1 NM_001082575 NM_001267806 chr17:77330684 chr11:73604197 promoter 1-8 0 0

CGOV46T JHOS-2 ITGA7 SARNP NM_001144996 NM_033082 chr12:56080266 chr12:56176595 1-24 10-11 1 1065

CGOV46T JHOS-2 SARNP ITGA7 NM_033082 NM_001144996 chr12:56176595 chr12:56080266 1-9 25-25 1 167 1

CGOV46T JHOS-2 DOCK9 STK24 NM_001130048 NM_001032296 chr13:99465746 chr13:99193561 1-46 2-11 1 1710 0

CGOV46T JHOS-2 MBTPS1 CDH13 NM_003791 NM_001220488 chr16:84137797 chr16:83826394 promoter 15-15 0 0

7 WO 2020/081549 PCT/US2019/056299 Amino Amino A

Exons add 5' add 5 ^* ai^

Lab id Cell line Gene s' Gene 3' Tx5' Tx3’ Junction s' Junction 3' Exons 5' 3' start end ,

ic

CGOV46T JHOS-2 SCAF4 KCNE1 NM_001145444 NM_001270403 chr21 :33059881 chr21:3584S908 1-15 1-1 1 666 lb

CGOV46T JHOS-2 KCNE1 SCAF4 NM_001270403 NM_001145444 chr21 :3584S908 chr21:33059881 promoter 16-19 0 0

CGOV47T JHOS-4 NEGR1 CNTNAPS NMJ 73808 NMJ 30773 chr1:72286536 chr2:125390892 1-2 13-24 1 136 6

CGOV47T JHOS-4 CNTNAP5 NEGR1 NMJ 30773 NMJ 73808 chr2:125390892 chr1 :72286536 1-12 3-7 1 624 6

CGOV47T JHOS-4 PHF3 PNISR NM_001290259 NM_015491 chr6:64377967 chr6:99865239 promoter 1-10 0 0 1

CGOV47T JHOS-4 PNISR PHF3 NM_015491 NM_001290259 chr6:99865239 chr6:64377967 promoter 1-14 0 0

CGOV47T JHOS-4 TTF2 SGK1 NM_003594 NM_001143676 chr1:117637160 chr6:134550455 1-18 3-14 1 992

CGOV47T JHOS-4 SGK1 TTF2 NM_001143676 NM_003594 chr6:134550455 chr1 :117637160 1-2 19-23 1 95

CGOV47T JHOS-4 PFN4 ATAD2B NM_199346 NM_001242338 chr2:24346939 chr2:24122590 promoter 2-28 0 0 9

CGOV47T JHOS-4 TMEM108 KNG1 NM_001136469 NM_001102416 chr3:133109909 chr3:186445898 1-3 6-10 1 535

CGOV47T JHOS-4 KNG1 TMEM108 NM_001102416 NM_001136469 chr3:186445898 chr3:133109909 1-5 4-4 1 224 2

CGOV4T DOV-13 CCL27 PHF21 B NM_006664 NM_001242450 chr9:34665685 chr22:45371566 promoter 3-13 0 0 5

CGOV4T DOV-13 POU6F1 GLTSCR2 NM_002702 NM_015710 chr12:51587665 chr19:48255484 1-2 6-13 1 83

CGOV4T DOV-13 GLTSCR2 POU6F1 NM_015710 NM_002702 chr19:48255484 chr12:51587665 1-5 3-5 1 223 2

CGOV5T EFO-21 CEMIP RYR1 NM_001293298 NM_000540 chr15:81234579 chr19:38995026 1-24 51- 1 1204

. 106

16

CGOV5T EFO-21 RYR1 CEMIP NM_000540 NM_001293298 chr19:38995026 chr15:81234579 1-50 25-28 1 2689

CGOV5T EFO-21 ZFR KIAA0226L NM_016107 NM_001286762 chr5:32387554 chr13:46960307 1-14 1-12 1 833 2

CGOV5T EFO-21 KIAA0226L ZFR NM_001286762 NM_016107 chr13:46960307 chr5:32387554 promoter 15-20 0 0

CGOV5T EFO-21 HCN1 PALM2- NM_021072 NM_007203 chr5:45454363 chr9:112877912 1-3 8-11 1 337 8

AKAP2

1

CGOV5T EFO-21 PALM2- HCN1 NM_007203 NM_021072 chr9:112877912 chr5:45454363 1-7 4-8 1 194

AKAP2 ₃

CGOV5T EFO-21 FAM193B B4GALT7 NM_001190946 NM_007255 chr5:176982475 chr5:177035363 promoter 4-6 0 0

CGOV92T JHOS-3 NDUFAF2 ZNF366 NMJ 74889 NMJ 52625 chr5:60421041 chr5:71778220 1-3 1-4 1 86 2

CGOV92T JHOS-3 ZNF366 NDUFAF2 NMJ 52625 NMJ 74889 chr5:71778220 chr5:60421041 promoter 4-4 0 0

CGOV92T JHOS-3 ANK1 DEPTOR NM_001142446 NM_001283012 chr8:41678994 chr8:121029925 1-1 7-7 1 42

CGOV92T JHOS-3 DEPTOR ANK1 NM_001283012 NM_001142446 chr8:121029925 chr8:41678994 1-6 2-43 1 266 2

CGOV92T JHOS-3 PRKDC SPIDR NM_001081640 NM_001080394 chr8:48829107 chr8:48643275 1-22 20-20 1 842

CGOV92T JHOS-3 CASQ2 NIN NM_001232 NM_020921 chr1:116315806 chr14:51231035 promoter 13-29 0 0 8

CGOV92T JHOS-3 DDX21 DDX50 NM_004728 NM_024045 chr10:70711228 chr10:70700297 promoter 13-15 0 0 5

CGOV92T JHOS-3 ERLIN1 CHUK NM_006459 NM_001278 chr10:101949199 chr10:101961193 promoter 15-21 0 0 5

CGOV92T JHOS-3 API5 SIK3 NM_001142930 NM_001281748 chr11 :43330756 chr11:116942479 promoter 1-20 0 0 5

CGOV92T JHOS-3 CHD4 NCAPD2 NM_001297553 NM_014865 chr12:6693462 chr12:6638017 1-24 26-31 1 1286

CGOV92T JHOS-3 WFIKKN1 FRY NM_053284 NM_023037 chr16:680775 chr13:32861894 promoter 59-61 0 0 1

CGOV92T JHOS-3 RCBTB2 CYSLTR2 NM_001268 NM_001308465 chr13:49098766 chr13:49240167 promoter 1-1 0 0 8

CGOV92T JHOS-3 CYSLTR2 RCBTB2 NM_001308465 NM_001268 chr13:49240167 chr13:49098766 promoter 1-12 0 0

CGOV92T JHOS-3 NET02 ITFG1 NM_001201477 NM_001305002 chr16:47159793 chr16:47205362 1-4 13-16 1 160

CGOV92T JHOS-3 ITFG1 NET02 NM_001305002 NM_001201477 chr16:47205362 chr16:47159793 1-12 5-9 1 371 3

CGOV92T JHOS-3 TANG06 CIRH1A NM_024562 NM_032830 chr16:69116717 chr16:69167154 1-17 1-16 1 1036 1

CGOV92T JHOS-3 CHTF8 TANG06 NM_001040146 NM_024562 chr16:69167154 chr16:69116717 promoter 18-18 0 0

CGOV92T JHOS-3 WNK4 GNA13 NM_032387 NM_001282425 chr17:40931276 chr17:63014192 promoter 3-3 0 0 0

CGOV92T JHOS-3 LAMA3 OSBPL1A NM_001127717 NM_080597 chr18:21514384 chr18:21965896 1-66 1-27 1 2898

CGOV92T JHOS-3 CAMSAP2 ASZ1 NM_001297707 NM_001301821 chr1:200727951 chr7:117061347 1-1 4-13 1 46

CGOV92T JHOS-3 ASZ1 CAMSAP2 NM_001301821 NM_001297707 chr7:117061347 chr1 :200727951 1-3 2-18 1 109 1

CGOV92T JHOS-3 ADORA1 KDM5B NM_000674 NM_006618 chr1:203096505 chr1 :202737339 promoter 5-27 0 0

1 WO 2020/081549 PCT/US2019/056299 Amino Amino A

Exons add 5' add 5 ^* ai^

Lab id Cell line Gene s' Gene 3' Tx5' Tx3’ Junction s' Junction 3' Exons 5' 3' start end ,

ic

CGOV92T JHOS-3 TTC28 ZNRF3 NM_001145418 NM_001206998 chr22:28836169 chr22:29406674 1-2 3-9 1 127 lb

CGOV92T JHOS-3 ZNRF3 TTC28 NM_001206998 NM_001145418 chr22:29406674 chr22:28836169 1-2 3-23 1 142 1

CGOV92T JHOS-3 HORMAD2 SF3A1 NM_152510 NM_005877 chr22:30547728 chr22:30749278 1-9 2-16 1 273 1

CGOV92T JHOS-3 CCDC157 HORMAD2 NM_001017437 NM_152510 chr22:30749278 chr22:30547728 promoter 10-10 0 0

CGOV92T JHOS-3 SMYD3 ZHX3 NM_022743 NM_015035 chr1:246284609 chr20:39925983 1-4 1-2 1 118 2

CGOV92T JHOS-3 ZHX3 SMYD3 NM_015035 NM_022743 chr20:39925983 chr1 :246284609 promoter 5-11 0 0

CGOV12T KOC-7C PKLR FAM189B NMJ 81871 NM_001267608 chr1:155266958 chr1 :155218191 1-2 10-11 1 63 1

CGOV12T KOC-7C NR2E3 THSD4 NM_016346 NM_024817 chr15:72103092 chr15:72051113 promoter 15-17 0 0 5

CGOV12T KOC-7C C22orf39 ACOT11 NM_001166242 NMJ 47161 chr22:19435941 chr1 :55030044 promoter 2-16 0 0 8

CGOV20T OV207 MEGF8 MUC21 NM_001271938 NM_001010909 chr19:42827499 chr6:30955211 promoter 3-3 0 0

CGOV20T OV207 ATG5 TRUB2 NM_001286106 NM_015679 chr6:106720377 chr9:131084314 1-4 2-8 1 159 5

CGOV20T OV207 COQ4 ATG5 NM_001305942 NM_001286111 chr9:131084314 chr6:106720377 promoter 2-3 0 0

CGOV20T OV207 STOX1 IZUM02 NM_001130159 NMJ 52358 chr10:70592072 chr19:50665540 1-1 3-7 1 103

CGOV20T OV207 IZUM02 STOX1 NMJ 52358 NM_001130159 chr19:50665540 chr10:70592072 1-2 2-4 1 102 1

CGOV20T OV207 C10or(76 CUEDC2 NM_024541 NM_024040 chr10:103804423 chr10:104191490 promoter 1-8 0 0 1

CGOV20T OV207 CUEDC2 C10or(76 NM_024040 NM_024541 chr10:104191490 chr10:103804423 promoter 1-25 0 0

CGOV20T OV207 RPAP3 VDR NM_001146075 NM_000376 chr12:48095585 chr12:48294838 1-1 1-8 1 51

CGOV20T OV207 VDR RPAP3 NM_000376 NM_001146075 chr12:48294838 chr12:48095585 promoter 2-15 0 0

CGOV20T OV207 SLC4A8 GALNT6 NM_001267615 NM_007210 chr12:51798329 chr12:51784489 promoter 1-10 0 0

CGOV20T OV207 MYL6 INHBC NM_021019 NM_005538 chr12:56553687 chr12:57837403 1-3 2-2 1 58

CGOV20T OV207 INHBC MYL6 NM_005538 NM_021019 chr12:57837403 chr12:56553687 1-1 4-6 1 104 1

CGOV20T OV207 RUSC1 ACLY NM_001105203 NM_001303274 chr1:155286921 chr17:40054877 promoter 13-29 0 0

CGOV20T OV207 ACLY FDPS NM_001303274 NM_001135822 chr17:40054877 chr1 :155286921 1-12 3-9 1 500 5

CGOV20T OV207 ITPK1 BTBD7 NM_001142594 NM_001289133 chr14:93419383 chr14:93776191 1-7 2-9 1 223

CGOV20T OV207 BTBD7 ITPK1 NM_001289133 NM_001142594 chr14:93776191 chr14:93419383 1-1 8-10 1 36

CGOV20T OV207 LAMC1 NMNAT2 NM_002293 NM_015039 chr1:183020893 chr1 :183321273 1-1 2-11 1 139 2

CGOV20T OV207 NMNAT2 LAMC1 NM_015039 NM_002293 chr1:183321273 chr1 :183020893 1-1 2-28 1 28

CGOV20T OV207 MIEN1 KIAA0195 NM_032339 NM_014738 chr17:37886847 chr17:73484178 promoter 6-31 0 0 1

CGOV20T OV207 DNTTIP1 SNX21 NM_052951 NM_001042633 chr20:44433481 chr20:44465641 1-8 4-5 1 201 2

CGOV20T OV207 SNX21 DNTTIP1 NM_001042633 NM_052951 chr20:44465641 chr20:44433481 1-3 9-13 1 149 1

CGOV20T OV207 STK40 CFTR NM_001282546 NM_000492 chr1:36852431 chr7:117285932 promoter 24-27 0 0 2

CGOV20T OV207 FMNL2 FOXP1 NM_052905 NM_001244816 chr2:153302287 chr3:71553006 1-1 1-16 1 39 2

CGOV20T OV207 FOXP1 FMNL2 NM_001244816 NM_052905 chr3:71553006 chr2:153302287 promoter 2-26 0 0

CGOV20T OV207 CERS6 ABCB11 NM_001256126 NM_003742 chr2:169412544 chr2:169830003 1-2 13-27 1 92

CGOV20T OV207 ABCB11 CERS6 NM_003742 NM_001256126 chr2:169830003 chr2:169412544 1-12 3-11 1 478 4

CGOV20T OV207 METAP1 D SLC25A12 NM_199227 NM_003705 chr2:172864577 chr2:172651497 promoter 14-18 0 0

CGOV20T OV207 DGKD YAP1 NMJ 52879 NM_001130145 chr2:234286562 chr11:102091380 1-1 7-9 1 52 4

CGOV20T OV207 YAP1 DGKD NM_001130145 NMJ 52879 chr11 :102091380 chr2:234286562 1-6 2-30 1 344 3

CGOV20T OV207 CCDC51 CABIN1 NM_001256964 NM_001201429 chr3:48476615 chr22:24553832 promoter 28-35 0 0

CGOV20T OV207 CABIN 1 CCDC51 NM_001201429 NM_001256964 chr22:24553832 chr3:48476615 1-27 1-3 1 1532 5

CGOV20T OV207 BTLA TMEM175 NM_001085357 NM_001297423 chr3:112221736 chr4:947376 promoter 6-8 0 0

CGOV20T OV207 SEC22A ADCY5 NM_012430 NM_001199642 chr3:122982899 chr3:123013193 1-5 18-21 1 241 1

CGOV20T OV207 ADCY5 SEC22A NM_001199642 NM_012430 chr3:123013193 chr3:122982899 1-17 6-6 1 671 6

CGOV20T OV207 SMARCAD1 PDLIM5 NM_001128430 NM_001256425 chr4:95167974 chr4:95519322 1-5 1-6 1 235 2

CGOV20T OV207 PDLIM5 SMARCAD1 NM_001256425 NM_001128430 chr4:95519322 chr4:95167974 promoter 6-23 0 0

2 WO 2020/081549 PCT/US2019/056299 Amino Amino A

Exons add 5' add 5 ^* ai^

Lab id Cell line Gene s' Gene 3' Tx5' Tx3’ Junction s' Junction 3' Exons 5' 3' start end ,

ic

CGOV20T OV207 KIF2A ADGRV1 NM_001098511 NM_032119 chrS:61638470 chr5:90388260 1-1 87-90 1 21 *

CGOV20T OV207 ADGRV1 KIF2A NM_032119 NM_001098511 chrS:90388260 chrS:61638470 1-86 2-21 1 6103 1

CGOV27T OVISE TNXB CREBS NM_019105 NM_182899 chr6:32078522 chr7:28816993 promoter 6-9 0 0

CGOV27T OVISE DLL3 BCLAF1 NM_016941 NM_001077440 chr19:39987897 chr6:136588934 promoter 9-10 0 0 2

CGOV27T OVISE DUSP27 DIAPH3 NM_001080426 NM_001258366 chr1:167085159 chr13:60348924 1-2 26-27 1 68 7

CGOV27T OVISE DIAPH3 DUSP27 NM_001258366 NM_001080426 chr13:60348924 chr1 :167085159 1-24 3-5 1 1043 0

CGOV27T OVISE RFX3 GLIS3 NM_001282116 NM_152629 chr9:3510057 chr9:3948542 promoter 3-9 0 0

CGOV27T OVISE GLIS3 RFX3 NMJ 52629 NM_001282116 chr9:3948542 chr9:3510057 1-2 1-16 1 415 4

CGOV27T OVISE MDM1 BEST3 NM_001205028 NM_001282614 chr12:68729071 chr12:70068534 promoter 7-9 0 0

CGOV27T OVISE NLRP8 GP6 NMJ 76811 NM_001083899 chr19:56465918 chr19:55527594 1-2 7-8 1 147 2

CGOV27T OVISE MAP1 LC3A BPIFB4 NM_032514 NMJ 82519 chr20:33144333 chr20:31683979 promoter 11-16 0 0 2

CGOV29T OVMANA PTPN7 ASH1 L NM_080588 NM_018489 chr1:202130802 chr1 :155309462 promoter 25-27 0 0 4

CGOV29T OVMANA KAT5 RASIP1 NM_001206833 NM_017805 chr11 :65484408 chr19:49226617 1-8 10-11 1 338 :8

CGOV29T OVMANA ATXN10 ABCA7 NM_001167621 NM_019112 chr22:46132525 chr19:1046834 1-6 14-46 1 234 8

CGOV29T OVMANA ZNF14 EPS15L1 NM_021030 NM_001258374 chr19:19844942 chr19:16578512 promoter 2-24 0 0 6

CGOV29T OVMANA EIF2B4 BRE NMJ 72195 NM_001261840 chr2:27594215 chr2:28271506 promoter 6-11 0 0

CGOV29T OVMANA BRE SNX17 NM_001261840 NM_001267059 chr2:28271506 chr2:27594215 1-5 3-15 1 190 1

CGOV29T OVMANA SEC14L4 HORMAD2 NM_001161368 NM_152510 chr22:30905392 chr22:30501496 promoter 5-10 0 0

CGOV29T OVMANA HERC1 RELB NM_003922 NM_006509 chr15:64107265 chr19:45533700 promoter 8-11 0 0

CGOV31T OVTOKO ST6GALNAC4 CIZ1 NM_175039 NM_001131016 chr9:130682139 chr9:130940702 promoter 9-16 0 0 3

CGOV31T OVTOKO RBCK1 SLC52A3 NM_006462 NM_033409 chr20:407263 chr20:742468 1-7 4-4 1 301 5

CGOV31T OVTOKO CRELD2 PIM3 NM_001135101 NM_001001852 chr22:50309756 chr22:50354313 promoter 1-6 0 0 4

CGOV31T OVTOKO PIM3 ALG12 NM_001001852 NM_024105 chr22:50354313 chr22:50309756 promoter 1-9 0 0

CGOV31T OVTOKO NKAIN1 KDM4B NM_024522 NM_015015 chr1:31679247 chr19:5014222 1-1 1-21 1 18

CGOV31T OVTOKO KDM4B NKAIN1 NM_015015 NM_024522 chr19:5014222 chr1 :31679247 promoter 2-7 0 0

CGOV35T RMG-I CD164L2 AHDC1 NM_207397 NM_001029882 chr1:27712722 chr1 :27917110 promoter 1-1 0 0

CGOV35T RMG-I KLF16 FANCD2 NM_031918 NM_033084 chr19:1866798 chr3:10116808 promoter 29-42 0 0

CGOV35T RMG-I C22orf39 ACOT11 NM_001166242 NMJ 47161 chr22:19435941 chr1 :55030044 promoter 2-16 0 0 9

CGOV35T RMG-I GDA CCDC7 NM_001242507 NM_024688 chr9:74774974 chr10:32867795 promoter 1-20 0 0

CGOV35T RMG-I CCDC7 GDA NM_024688 NM_001242507 chr10:32867795 chr9:74774974 promoter 1-12 0 0

CGOV35T RMG-I TRAF2 MYADML2 NM_021138 NM_001145113 chr9:139804973 chr17:79900310 1-5 1-1 1 201

CGOV35T RMG-I MYADML2 TRAF2 NM_001145113 NM_021138 chr17:79900310 chr9:139804973 promoter 6-10 0 0

CGOV35T RMG-I RAB3IP CNOT2 NM_022456 NM_014515 chr12:70174066 chr12:70690413 1-2 2-15 1 170 2

CGOV35T RMG-I CNOT2 RAB3IP NM_014515 NM_022456 chr12:70690413 chr12:70174066 1-1 3-10 1 16

CGOV35T RMG-I COL4A1 NUMB NM_001845 NM_001005743 chr13:110911488 chr14:73777345 1-1 4-10 1 28 1

CGOV35T RMG-I NUMB COL4A1 NM_001005743 NM_001845 chr14:73777345 chr13:110911488 1-3 2-52 1 78

CGOV35T RMG-I GRB7 IKZF3 NM_005310 NM_001284514 chr17:37901221 chr17:37954506 1-7 1-2 1 304

CGOV35T RMG-I IKZF3 GRB7 NM_001284514 NM_005310 chr17:37954506 chr17:37901221 promoter 9-14 0 0

CGOV7T ES-2 CCND1 SHANK2 NM_053056 NMJ 33266 chr11 :69457568 chr11:70472591 1-1 3-11 1 66 3

CGOV7T ES-2 SHANK2 CCND1 NMJ 33266 NM_053056 chr11 :70472591 chr11:69457568 1-2 2-5 1 99 1

CGOV7T ES-2 SHANK2 CNTN5 NMJ 33266 NM_001243271 chr11 :70398441 chr11:99097178 1-2 1-19 1 99

CGOV7T ES-2 CNTN5 SHANK2 NM_001243271 NM_133266 chr11 :99097178 chr11:70398441 promoter 3-11 0 0

CGOV7T ES-2 SHANK2 CNTN5 NMJ 33266 NM_001243271 chr11 :70462497 chr11:99215501 1-2 1-19 1 99 1

CGOV7T ES-2 CNTN5 SHANK2 NM_001243271 NM_133266 chr11 :99215501 chr11:70462497 promoter 3-11 0 0

CGOV7T ES-2 SHANK2 AAMDC NMJ 33266 NM_024684 chr11 :70494876 chr11:77540228 1-2 1-3 1 99 1

CGOV7T ES-2 MAML2 YAP1 NM_032427 NM_001130145 chr11 :95842569 chr11:102091494 1-1 7-9 1 171 1

CGOV7T ES-2 YAP1 MAML2 NM_001130145 NM_032427 chr11 :102091494 chr11:95842569 1-6 2-5 1 344 3

CGOV7T ES-2 FAM53A CNTN5 NM_001013622 NM_001243271 chr4:1680829 chr11:99256545 promoter 1-19 0 0 1

CGOV7T ES-2 CNTN5 FAM53A NM_001243271 NM_001013622 chr11 :99256545 chr4:1680829 promoter 1-4 0 0

CGOV7T ES-2 CRMP1 AMOTL1 NM_001288662 NM_001301007 chr4:5883856 chr11:94591384 1-1 8-12 1 7

CGOV7T ES-2 AMOTL1 CRMP1 NM_001301007 NM_001288662 chr11 :94591384 chr4:5883856 1-7 2-14 1 598 5

CGOV7T ES-2 CRMP1 CHKA NM_001288662 NM_001277 chr4:5888382 chr11:67840975 1-1 5-12 1 7

CGOV7T ES-2 CHKA CRMP1 NM_001277 NM_001288662 chr11 :67840975 chr4:5888382 1-4 2-14 1 210 2

CGOV7T ES-2 SORCS2 TYR NM_020777 NM_000372 chr4:7341228 chr11:88921539 1-1 2-5 1 160

CGOV7T ES-2 TYR SORCS2 NM_000372 NM_020777 chr11 :88921539 chr4:7341228 1-1 2-27 1 273 2

CGOV11TJ KK C3orf67 FHIT NMJ 98463 NM_001166243 chr3:58908808 chr3:59949878 1-1 4-5 1 6 1

CGOV11TJ KK FHIT C3orf67 NM_001166243 NMJ 98463 chr3:59949878 chr3:58908808 1-3 2-12 1 93

CGOV11TJ KK FNDC3B PGPEP1 L NM_022763 NM_001167902 chr3:171752966 chr15:99550846 promoter 1-2 0 0

CGOV11TJ KK SST LPP NM_001048 NM_001167672 chr3:187389262 chr3:187988635 promoter 1-9 0 0

CGOV11TJ KK TMEM219 ACSM3 NM_001083613 NM_202000 chr16:29972147 chr16:20780675 promoter 1-8 0 0

CGOV11TJ KK ERBB4 IKZF2 NM_001042599 NM_016260 chr2:213286255 chr2:213914447 1-1 5-7 1 27

CGOV11TJ KK IKZF2 ERBB4 NM_016260 NM_001042599 chr2:213914447 chr2:213286255 1-3 2-27 1 135 1

CGOV11TJ KK USP37 MTA2 NM_020935 NM_004739 chr2:219352749 chr11:62362005 1-12 17-18 1 530

CGOV11TJ KK TUT1 USP37 NM_022830 NM_020935 chr11 :62362005 chr2:219352749 promoter 13-23 0 0 5

CGOV14T MCAS C22orf39 ACOT11 NM_001166242 NMJ 47161 chr22:19435941 chr1 :55030044 promoter 2-16 0 0 5

CGOV14T MCAS ARL4A RAB11 FIP4 NM_001037164 NM_032932 chr7:12725576 chr17:29755530 promoter 2-15 0 0

CGOV14T MCAS ISPD TRAF4 NM_001101417 NM_004295 chr7:16250349 chr17:27075203 1-8 5-7 1 367

CGOV14T MCAS TRAF4 ISPD NM_004295 NM_001101417 chr17:27075203 chr7:16250349 1-4 9-9 1 154 1

CGOV14T MCAS AUTS2 GTF2IRD1 NM_001127231 NM_001199207 chr7:70013290 chr7:73920592 1-5 1-26 1 230 3

CGOV14T MCAS GTF2IRD1 AUTS2 NM_001199207 NM_001127231 chr7:73920592 chr7:70013290 promoter 6-18 0 0

CGOV48T JHOM-1 ATAD2 PPHLN1 NM_014109 NM_001143788 chr8:124394874 chr12:42826528 1-1 8-8 1 57 2

CGOV48T JHOM-1 PPHLN1 ATAD2 NM_001143788 NM_014109 chr12:42826528 chr8:124394874 1-7 2-28 1 284 2

CGOV48T JHOM-1 XRRA1 ACER3 NM_001270380 NM_001300954 chr11 :74637158 chr11:76611803 1-5 1-8 1 166

CGOV48T JHOM-1 ACER3 XRRA1 NM_001300954 NM_001270380 chr11 :76611803 chr11:74637158 promoter 6-13 0 0

CGOV48T JHOM-1 SLC02B1 RAB30 NM_001145212 NM_001286061 chr11 :74910084 chr11:82751149 1-7 1-4 1 389 1

CGOV48T JHOM-1 RAB30 SLC02B1 NM_001286061 NM_001145212 chr11 :82751149 chr11:74910084 promoter 8-11 0 0

CGOV48T JHOM-1 TMEM133 RAB30 NM_032021 NM_001286059 chr11 :100859445 chr11:82732024 promoter 1-4 0 0 3

CGOV48T JHOM-1 CNTN1 ADAMTS20 NM_001256063 NM_025003 chr12:41125528 chr12:43928691 promoter 3-39 0 0

CGOV48T JHOM-1 ADAMTS20 CNTN1 NM_025003 NM_001256063 chr12:43928691 chr12:41125528 1-2 1-15 1 151 1

CGOV48T JHOM-1 ADAMTS20 USP15 NM_025003 NM_001252079 chr12:43856339 chr12:62705911 1-11 4-7 1 538

CGOV48T JHOM-1 USP15 ADAMTS20 NM_001252079 NM_025003 chr12:62705911 chr12:43856339 1-3 12-39 1 116 1

CGOV48T JHOM-1 SDSL ATF7 NM_001304993 NM_001130060 chr12:113858829 chr12:53926007 promoter 8-11 0 0 5

CGOV10T IGROV-1 GTF2IRD1 GTF2I NM_001199207 NM_001280800 chr7:73918089 chr7:74090571 promoter 1-9 0 0 2

CGOV10T IGROV-1 GTF2I GTF2IRD1 NM_001280800 NM_001199207 chr7:74090571 chr7:73918089 promoter 1-26 0 0

CGOV10T IGROV-1 CALD1 AGBL3 NM_004342 NM_178563 chr7:134526497 chr7:134727120 promoter 8-16 0 0

CGOV10T IGROV-1 AGBL3 CALD1 NMJ 78563 NM_004342 chr7:134727120 chr7:134526497 1-7 1-12 1 500 5

CGOV10T IGROV-1 ZFYVE27 MMS19 NM_001002262 NM_001289404 chr10:99495244 chr10:99251446 promoter 1-26 0 0

CGOV10T IGROV-1 TWSG1 RALBP1 NM_020648 NM_006788 chr18:9358109 chr18:9510608 1-1 1-9 1 41

CGOV10T IGROV-1 RALBP1 TWSG1 NM_006788 NM_020648 chr18:9510608 chr18:9358109 promoter 2-4 0 0 WO 2020/081549 PCT/US2019/056299 Amino Amino A

Exons add 5' add 5 ^* ai^

Lab id Cell line Gene s' Gene 3' Tx5' Tx3’ Junction s' Junction 3' Exons 5' 3' start end , ic

CGOV13T Kuramochi FAM65B LRRC16A NM_014722 NM_001173977 chr6:24844384 chr6:25389278 1-12 3-37 1 409 iti

CGOV13T Kuramochi LRRC16A FAM65B NM_001173977 NM_014722 chr6:25389278 chr6:24844384 1-2 13-22 1 46

CGOV13T Kuramochi LRPS SORL1 NM_002335 NM_003105 chr11 :68115608 chr11:121438404 1-1 23-48 1 30 4

CGOV40T TYK-nu KITLG MTMR4 NM_000899 NM_004687 chr12:88925126 chr17:56570178 1-3 17-18 1 64 0

CGOV40T TYK-nu HSF5 KITLG NM_001080439 NM_000899 chr17:56570178 chr12:88925126 promoter 4-9 0 0 1

CGOV40T TYK-nu NF1 TMEM104 NM_001128147 NM_017728 chr17:29461093 chr17:72803987 1-1 8-9 1 20

CGOV40T TYK-nu TMEM104 NF1 NM_017728 NM_001128147 chr17:72803987 chr17:29461093 1-7 2-15 1 212 2

CGOV40T TYK-nu OSBPL5 LUZP2 NM_001144063 NM_001009909 chr11 :3128036 chr11:24815080 1-7 6-12 1 285

CGOV40T TYK-nu LUZP2 OSBPL5 NM_001009909 NM_001144063 chr11 :24815080 chr11:3128036 1-5 8-20 1 132 1

CGOV15T OAW-28 HMG20A LING01 NM_001304504 NM_032808 chr15:77746961 chr15:77922374 promoter 2-2 0 0 2

CGOV15T OAW-28 LING01 HMG20A NM_032808 NM_001304504 chr15:77922374 chr15:77746961 1-1 1-8 1 2

CGOV15T OAW-28 EBF4 IFNAR2 NM_001110514 NM_000874 chr20:2720981 chr21:34618082 1-7 4-8 1 181

CGOV15T OAW-28 IFNAR2 EBF4 NM_000874 NM_001110514 chr21 :34618082 chr20:2720981 1-3 8-17 1 73

CGOV15T OAW-28 ATP9A PMEPA1 NM_006045 NM_001255976 chr20:50314240 chr20:56237202 1-4 2-4 1 145 1

CGOV15T OAW-28 PMEPA1 ATP9A NM_001255976 NM_006045 chr20:56237202 chr20:50314240 1-1 5-28 1 8

CGOV15T OAW-28 ADGRF3 OTOF NMJ 53835 NM_004802 chr2:26563346 chr2:26695290 1-1 13-28 1 38 1

CGOV15T OAW-28 OTOF ADGRF3 NM_004802 NMJ 53835 chr2:26695290 chr2:26563346 1-12 2-12 1 521 5

CGOV15T OAW-28 MAP4 CBFA2T3 NM_001134364 NM_005187 chr3:48023675 chr16:88995202 1-1 2-12 1 74

CGOV15T OAW-28 CBFA2T3 MAP4 NM_005187 NM_001134364 chr16:88995202 chr3:48023675 1-1 2-17 1 50

CGOV15T OAW-28 MVD NME6 NM_002461 NM_001308427 chr16:88732892 chr3:48342884 promoter 1-5 0 0

CGOV15T OAW-28 EPHA6 FAM19A2 NM_001080448 NMJ 78539 chr3:97078603 chr12:62235028 1-5 2-4 1 535

CGOV15T OAW-28 FAM19A2 EPHA6 NMJ 78539 NM_001080448 chr12:62235028 chr3:97078603 1-1 6-18 1 35

CGOV15T OAW-28 RASGRF2 CCDC77 NM_006909 NM_001130147 chr5:80518715 chr12:515533 1-26 1-10 1 1207 5

CGOV15T OAW-28 CCDC77 RASGRF2 NM_001130147 NM_006909 chr12:515533 chr5:80518715 promoter 27-27 0 0

CGOV15T OAW-28 FAM26D RWDD1 NM_001256887 NM_001007464 chr6:116855605 chr6:116895606 promoter 1-4 0 0 2

CGOV15T OAW-28 RWDD1 FAM26D NM_001007464 NM_001256887 chr6:116895606 chr6:116855605 promoter 1-2 0 0

CGOV15T OAW-28 NAPEPLD MET NM_001122838 NM_000245 chr7:102759730 chr7:116399091 1-2 9-20 1 313

CGOV15T OAW-28 MET NAPEPLD NM_000245 NM_001122838 chr7:116399091 chr7:102759730 1-8 3-4 1 754 7

CGOV15T OAW-28 UMOD PLXNA4 NM_001008389 NM_020911 chr16:20367795 chr7:132109931 promoter 3-31 0 0 3

CGOV1T A2780 RAB11 FIP5 ALMS1 NM_015470 NM_015120 chr2:73344265 chr2:73703611 promoter 10-23 0 0 4

CGOV1T A2780 C22orf39 ACOT11 NM_001166242 NMJ 47161 chr22:19435941 chr1 :55030044 promoter 2-16 0 0 :5

CGOV26T OVCAR-5 RSRC1 NDUFAF2 NM_001271834 NMJ 74889 chr3:157824700 chr5:60420890 promoter 4-4 0 0

CGOV2T Caov-3 ZBTB20 GAP43 NM_001164343 NM_001130064 chr3:114591576 chr3:115392695 promoter 2-3 0 0

CGOV2T Caov-3 GAP43 ZBTB20 NM_001130064 NM_001164343 chr3:115392695 chr3:114591576 1-1 1-2 1 46

CGOV2T Caov-3 KALRN PLXNA1 NM_001024660 NM_032242 chr3:124281759 chr3:126740313 1-33 21-31 1 1643

CGOV2T Caov-3 GABRA4 TMUB2 NM_001204266 NM_001076674 chr4:46950349 chr17:42264845 1-8 1-3 1 359 3

CGOV2T Caov-3 TMUB2 GABRA4 NM_001076674 NM_001204266 chr17:42264845 chr4:46950349 promoter 9-9 0 0

CGOV2T Caov-3 CTNND2 TRIO NM_001288715 NM_007118 chr5:11205601 chr5:14329426 1-8 10-57 1 496 3

CGOV2T Caov-3 TRIO CTNND2 NM_007118 NM_001288715 chr5:14329426 chr5:11205601 1-9 9-20 1 577 5

CGOV2T Caov-3 CSF1 R PDGFRB NM_005211 NM_002609 chr5:149474852 chr5:149520408 promoter 1-22 0 0 4

CGOV2T Caov-3 PDGFRB CSF1 R NM_002609 NM_005211 chr5:149520408 chr5:149474852 promoter 1-21 0 0

CGOV2T Caov-3 OPRM1 IPCEF1 NM_001145280 NM_001130699 chr6:154397731 chr6:154528737 promoter 8-10 0 0

CGOV2T Caov-3 IPCEF1 OPRM1 NM_001130699 NM_001145280 chr6:154528737 chr6:154397731 1-7 1-3 1 179 1

CGOV2T Caov-3 WIPF3 NUDCD3 NM_001080529 NM_015332 chr7:29946428 chr7:44530324 1-7 1-6 1 476

CGOV2T Caov-3 NUDCD3 WIPF3 NM_015332 NM_001080529 chr7:44530324 chr7:29946428 promoter 8-8 0 0

4 WO 2020/081549 PCT/US2019/056299 Amino Amino A

Exons add 5' add 5 ^* ai^

Lab id Cell line Gene s' Gene 3' Tx5' Tx3’ Junction s' Junction 3' Exons 5' 3' start end , ic

CGOV2T Caov-3 GRM8 ZNF800 NM_000845 NMJ 76814 chr7:126642804 chr7:127018474 1-2 3-5 1 242 iti

CGOV2T Caov-3 ZNF800 GRM8 NMJ 76814 NM_000845 chr7:127018474 chr7:126642804 1-2 3-10 1 52

CGOV2T Caov-3 DDAH1 FAM189B NM_001134445 NM_001267608 chr1:85961238 chr1 :155217868 promoter 11-11 0 0 2

CGOV2T Caov-3 GBA DDAH1 NM_001005741 NM_001134445 chr1:155217868 chr1 :85961238 promoter 1-5 0 0 5

CGOV2T Caov-3 FZD3 INTS9 NM_017412 NM_001172562 chr8:28395799 chr8:28665083 1-3 8-16 1 468

CGOV2T Caov-3 INTS9 FZD3 NM_001172562 NM_017412 chr8:28665083 chr8:28395799 1-7 4-6 1 224 2

CGOV2T Caov-3 KCNB2 GSDMD NM_004770 NM_001166237 chr8:73578364 chr8:144640994 1-1 1-10 1 193 4

CGOV2T Caov-3 GSDMD KCNB2 NM_001166237 NM_004770 chr8:144640994 chr8:73578364 promoter 2-2 0 0

CGOV2T Caov-3 RUSC2 MTUS2 NM_014806 NM_001033602 chr9:35546833 chr13:29951510 promoter 7-14 0 0 1

CGOV2T Caov-3 APBA1 MAMDC2 NM_001163 NM_153267 chr9:72178183 chr9:72833408 promoter 13-14 0 0 0

CGOV2T Caov-3 SFXN2 WBP1 L NM_178858 NM_001083913 chr10:104473310 chr10:104533658 promoter 2-4 0 0 6

CGOV2T Caov-3 WBP1 L ARL3 NM_017787 NM_004311 chr10:104533658 chr10:104473310 promoter 2-6 0 0

CGOV2T Caov-3 OR2H1 RCSD1 NM_030883 NM_052862 chr6:29421614 chr1 :167621079 promoter 2-7 0 0

CGOV2T Caov-3 OR4K14 HNRNPC NM_001004712 NM_001077442 chr14:20487521 chr14:21711035 promoter 1-7 0 0

CGOV2T Caov-3 NOL4L HNF4A NM_080616 NM_001030004 chr20:31038045 chr20:43001970 1-6 2-8 1 363

CGOV2T Caov-3 HNF4A NOL4L NM_001030004 NM_080616 chr20:43001970 chr20:31038045 1-1 7-7 1 16

CGOV2T Caov-3 ITM2C CAB39 NM_001287240 NM_016289 chr2:231728238 chr2:231671436 promoter 5-8 0 0 3

CGOV2T Caov-3 HDLBP FARP2 NM_001243900 NM_001282983 chr2:242185719 chr2:242316142 1-14 2-17 1 617 1

CGOV2T Caov-3 FARP2 HDLBP NM_001282983 NM_001243900 chr2:242316142 chr2:242185719 1-1 15-26 1 61

CGOV33T PEA2 MTFR1 NCOA2 NM_014637 NM_006540 chr8:66620481 chr8:71173811 1-6 1-21 1 311 6

CGOV33T PEA2 SPATA13 ATP8A2 NM_001286792 NM_016529 chr13:24810331 chr13:26238549 1-3 25-37 1 613

CGOV33T PEA2 ATP8A2 SPATA13 NM_016529 NM_001286792 chr13:26238549 chr13:24810331 1-24 4-14 1 737 7

CGOV33T PEA2 NUMB RPS6KA5 NM_001005743 NM_004755 chr14:73805230 chr14:91338974 1-1 17-17 1 42 6

CGOV33T PEA2 RPS6KA5 NUMB NM_004755 NM_001005743 chr14:91338974 chr14:73805230 1-16 2-10 1 720 7

CGOV3T COLO-704 SLC8A2 CYTH2 NM_015063 NM_004228 chr19:47944528 chr19:48972792 1-4 2-12 1 622

CGOV3T COLO-704 CYTH2 SLC8A2 NM_004228 NM_015063 chr19:48972792 chr19:47944528 1-1 5-9 1 6

CGOV42T OVCAR-8 FAM160A1 FBXW7 NM_001109977 NM_033632 chr4:152373845 chr4:153414567 promoter 1-11 0 0 6

CGOV42T OVCAR-8 FBXW7 FAM160A1 NM_033632 NM_001109977 chr4:153414567 chr4:152373845 promoter 1-11 0 0

CGOV42T OVCAR-8 PODXL CHST8 NM_001018111 NM_001127895 chr7:131195794 chr19:34261318 1-1 2-3 1 33

CGOV42T OVCAR-8 NRXN2 SLC02B1 NMJ 38734 NM_001145212 chr11 :64403816 chr11:74870928 1-1 2-11 1 88

CGOV42T OVCAR-8 FLYWCH2 FLYWCH1 NM_001142499 NM_020912 chr16:2947471 chr16:2988601 1-1 7-7 1 107

CGOV42T OVCAR-8 FLYWCH1 FLYWCH2 NM_020912 NM_001142499 chr16:2988601 chr16:2947471 1-6 2-2 1 682 6

CGOV42T OVCAR-8 KCNE5 DCX NM_012282 NMJ 78151 chrX:108869998 chrX:110654092 promoter 1-6 0 0 1

CGOV53T OVCAR-5- BLVRA STK17A NM_000712 NM_004760 chr7:43796502 chr7:43658355 promoter 4-7 0 0

CisR

. 1

CGOV53T OVCAR-5- CUBN TRDMT1 NM_001081 NM_004412 chr10:16942536 chr10:17191973 1-53 11-11 1 2803

CisR ₃

CGOV53T OVCAR-5- TRDMT1 CUBN NM_004412 NM_001081 chr10:17191973 chr10:16942536 1-10 54-67 1 358

CisR

8

CGOV53T OVCAR-5- DLG2 USP25 NM_001300983 NM_001283041 chr11 :84185758 chr21:17191327 1-2 11-26 1 68

CisR ₃

CGOV53T OVCAR-5- USP25 DLG2 NM_001283041 NM_001300983 chr21 :17191327 chr11:84185758 1-10 3-23 1 360

CisR

CGOV53T OVCAR-5- PEX5L ASH2L NM_001256750 NM_001282272 chr3:179732696 chr8:37971188 1-1 3-13 1 7

CisR

CGOV53T OVCAR-5- ASH2L PEX5L NM_001282272 NM_001256750 chr8:37971188 chr3:179732696 1-2 2-15 1 56

CisR

CGOV37T_3 SK-OV-3 SIL1 KDM3B NM_001037633 NM_016604 chrS:138373493 chrS:137726670 1-4 8-24 1 151 1

CGOV37T_3 SK-OV-3 NOTCH1 NBPF10 NM_017617 NM_001039703 chr9:139406991 chr1 :145470591 1-15 69-86 1 822 4

CGOV37T_3 SK-OV-3 NUDT17 RNF130 NM_001012758 NM_001280801 chr1:145593970 chr5:179383167 promoter 8-8 0 0 8

CGOV37T_3 SK-OV-3 TMEM180 FAM213A NM_024789 NM_001243779 chr10:104218342 chr10:82179214 promoter 1-5 0 0 3

CGOV37T_3 SK-OV-3 AP2A2 CHID1 NM_001242837 NM_001142674 chr11 :925566 chr11:910840 promoter 1-12 0 0

CGOV37T_3 SK-OV-3 LOR GATAD2B NM_000427 NM_020699 chr1:153227752 chr1 :153888160 promoter 1-10 0 0

CGOV37T_3 SK-OV-3 SMC02 PPFIBP1 NM_001145010 NM_001198915 chr12:27646055 chr12:27680140 1-5 1-24 1 200

CGOV37T_3 SK-OV-3 PPFIBP1 SMC02 NM_001198915 NM_001145010 chr12:27680140 chr12:27646055 promoter 6-8 0 0

CGOV37T_3 SK-OV-3 ANKS1 B SCYL2 NMJ 52788 NM_017988 chr12:100116361 chr12:100679969 1-8 2-17 1 376 2

CGOV37T_3 SK-OV-3 SCYL2 ANKS1 B NM_017988 NMJ 52788 chr12:100679969 chr12:100116361 1-1 9-26 1 59

CGOV37T_3 SK-OV-3 SPINT1 HIF1A NM_003710 NMJ 81054 chr15:41144843 chr14:62212083 1-1 14-14 1 158 3

CGOV37T_3 SK-OV-3 LAMC1 SH2D4B NM_002293 NM_207372 chr1:183065144 chr10:82318269 1-1 2-7 1 139 7

CGOV37T_3 SK-OV-3 SH2D4B LAMC1 NM_207372 NM_002293 chr10:82318269 chr1 :183065144 1-1 2-28 1 61

CGOV37T_3 SK-OV-3 RASL12 MTFMT NM_001307930 NM_139242 chr15:65361183 chr15:65312741 promoter 5-9 0 0 1

CGOV37T_3 SK-OV-3 MLST8 TSC2 NM_001199173 NM_000548 chr16:2252862 chr16:2111203 promoter 11-41 0 0 2

CGOV37T_3 SK-OV-3 CTCF PSKH1 NM_001191022 NM_006742 chr16:67601365 chr16:67945844 promoter 2-2 0 0 3

CGOV37T_3 SK-OV-3 PSKH1 CTCF NM_006742 NM_001191022 chr16:67945844 chr16:67601365 1-1 1-8 1 319 3

CGOV37T_3 SK-OV-3 FAM222B MY018A NM_001288634 NM_078471 chr17:27123734 chr17:27500851 promoter 1-41 0 0

CGOV37T_3 SK-OV-3 MY018A FAM222B NM_078471 NM_001288634 chr17:27500851 chr17:27123734 promoter 1-2 0 0

CGOV37T_3 SK-OV-3 FBXL20 RFX2 NM_001184906 NM_000635 chr17:37558109 chr19:6085881 promoter 1-17 0 0

CGOV37T_3 SK-OV-3 CNBD2 HSF2BP NM_001207076 NM_007031 chr20:34578517 chr21:45050447 1-7 5-8 1 285

CGOV37T_3 SK-OV-3 HSF2BP CNBD2 NM_007031 NM_001207076 chr21 :45050447 chr20:34578517 1-4 8-11 1 147 1

CGOV37T_3 SK-OV-3 PTTG1 IP ITGB2 NM_001286822 NM_001303238 chr21 :46297107 chr21:46330013 promoter 1-13 0 0 2

CGOV37T_3 SK-OV-3 GRAMD4 TBC1 D22A NM_015124 NM_001284303 chr22:47070620 chr22:47244797 1-14 3-11 1 461

CGOV37T_3 SK-OV-3 MLPH LRRFIP1 NM_001281474 NM_001137550 chr2:238461087 chr2:238666648 1-11 18-24 1 449 1

CGOV37T_3 SK-OV-3 LRRFIP1 MLPH NM_001137550 NM_001281474 chr2:238666648 chr2:238461087 1-17 12-12 1 408 4

4

Table S11 Pathway inhibitors

Related to Figure 6 and Experimental Procedures.

Drug Pathway inhibition Cell line Lab id \(Vtext{IC}_{20}\) \(\text{IC}_{50}\) \(\text{IC}_{80}\)

BMN673 PARP inhibitor JHOS-4 CGOV47T -8.76 -7.70 -5.93

BMN673 PARP inhibitor JHOS-3 CGOV92T -9.07 -7.62 -6.13

BMN673 PARP inhibitor OVMANA CGOV29T -8.59 -6.89 -5.03

BMN673 PARP inhibitor OV177 CGOV18T -8.14 -6.50 -5.44

BMN673 PARP inhibitor PEO-14 CGOV32T -7.31 -5.52 -3.47

BMN673 PARP inhibitor FU-OV-1 CGOV44T -6.90 -4.79 -2.50

BMN673 PARP inhibitor A2780 CGOV1T -6.21 -4.42 -2.85

BMN673 PARP inhibitor TYK-nu CGOV40T -5.70 -4.21 -3.01

BMN673 PARP inhibitor COV-318 CGOV45T -6.70 -4.20 -2.34

BMN673 PARP inhibitor OAW-28 CGOV15T -5.94 -4.19 -2.47 Drug WO 2020/081549 Cell line Lab Id \(Vtext{IQ_{20}\) \(\tPCT/US2019/056299 t{iq_{80}\)

BMN673 PARP inhibitor JHOS-2 CCOV46T -5.93 -3.49 -1.70

BMN673 PARP inhibitor Kuramochi CGOV13T -5.33 -3.32 -1.53

BMN673 PARP inhibitor OV-167 CGOV17T -4.97 -2.46 -1.54

BMN673 PARP inhibitor OAW-42 CGOV16T -3.98 -2.27 -1.13

BMN673 PARP inhibitor KK CGOV11TJ -4.71 -2.11 0.01

BMN673 PARP inhibitor OVISE CCOV27T -4.61 -2.04 0.00

BMN673 PARP inhibitor ES-2 CCOV7T -2.97 -1.58 -0.22

BMN673 PARP inhibitor OVCAR-8 CCOV42T -3.96 -1.30 0.24

BMN673 PARP inhibitor OVCA-429 CCOV23T -2.85 -0.85 -0.95

BMN673 PARP inhibitor OVCAR-5 CCOV26T -2.16 -0.79 0.27

BMN673 PARP inhibitor OVTOKO CCOV31T -3.83 -0.69 1.04

BMN673 PARP inhibitor RMUG-S CCOV36T -3.28 -0.48 1.21

BMN673 PARP inhibitor OV207 CCOV20T -2.37 -0.21 0.11

BMN673 PARP inhibitor OV-90 CCOV21T -2.49 -0.16 1.31

BMN673 PARP inhibitor DOV-13 CCOV4T -2.18 -0.14 1.03

BMN673 PARP inhibitor OVKATE CCOV28T -1.06 0.00 0.73

BMN673 PARP inhibitor HEY CCOV8T -2.82 0.09 1.12

BMN673 PARP inhibitor RMG-I CCOV3ST -1.50 0.14 1.67

BMN673 PARP inhibitor OVCAR-3 CCOV2ST -2.20 0.15 -0.49

BMN673 PARP inhibitor TOV-112D CCOV38T -1.24 0.20 1.19

BMN673 PARP inhibitor EFO-21 CCOVST -3.09 0.21 2.09

BMN673 PARP inhibitor MCAS CGOV14T -1.40 0.68 2.00

BMN673 PARP inhibitor PEA2 CCOV33T -1.41 0.70 1.88

BMN673 PARP inhibitor PEO-6 CCOV34T -2.43 0.83 2.16

GNE-493 PI3K inhibitor A2780 CGOV1T -3.29 -1.78 -0.36

CNE-493 PI3K inhibitor Caov-3 CCOV2T -2.74 -1.05 0.63

GNE-493 PI3K inhibitor COV-318 CCOV4ST -2.32 -0.99 0.03

CNE-493 PI3K inhibitor DOV-13 CCOV4T -2.10 -0.64 0.57

CNE-493 PI3K inhibitor EFO-21 CCOVST -1.42 -0.33 0.56

GNE-493 PI3K inhibitor ES-2 CCOV7T -0.53 0.73 1.61

GNE-493 PI3K inhibitor HEY CCOV8T -1.52 -0.10 0.90

CNE-493 PI3K inhibitor JHOM-1 CCOV48T -0.55 0.85 2.23

CNE-493 PI3K inhibitor JHOS-2 CCOV46T -0.67 0.03 0.73

GNE-493 PI3K inhibitor JHOS-4 CCOV47T -1.62 -0.67 0.14

GNE-493 PI3K inhibitor KK CGOV11TJ -2.00 -0.95 0.25

CNE-493 PI3K inhibitor Kuramochi CGOV13T -2.80 -1.40 -0.18

CNE-493 PI3K inhibitor MCAS CGOV14T -1.09 -0.64 -0.24

GNE-493 PI3K inhibitor OAW-28 CGOV1 ST -0.83 0.06 0.90

GNE-493 PI3K inhibitor OAW-42 CGOV16T -1.43 -0.56 0.33

CNE-493 PI3K inhibitor OV-167 CGOV17T -2.05 -0.78 0.45

CNE-493 PI3K inhibitor OV177 CGOV18T -3.91 -2.63 -1.81

GNE-493 PI3K inhibitor OV207 CCOV20T -1.78 -0.54 0.96

GNE-493 PI3K inhibitor OV-90 CCOV21T -1.34 -0.35 0.88

CNE-493 PI3K inhibitor OVCA-429 CCOV23T -0.45 0.39 1.18

CNE-493 PI3K inhibitor OVCAR-3 CCOV2ST -1.27 -0.58 0.38

CNE-493 PI3K inhibitor OVCAR-5 CCOV26T -2.69 -0.23 1.42 Drug WO 2020/081549 Cell line Lab id \(Vtext{IQ_{20}\) \(\tPCT/US2019/056299 t{iq_{80}\) GNE-493 PI3K inhibitor OVCAR-8 CGOV42T -0.27 1.06 1.93

GNE-493 PI3K inhibitor OVISE CGOV27T -2.87 -2.06 -1.37

GNE-493 PI3K inhibitor OVKATE CGOV28T -3.85 -2.59 -1.74

GNE-493 PI3K inhibitor OVMANA CGOV29T -2.35 -1.28 -0.44

GNE-493 PI3K inhibitor OVSAHO CGOV30T -2.48 -1.37 -0.27

GNE-493 PI3K inhibitor OVTOKO CGOV31T -2.41 -1.54 -0.84

GNE-493 PI3K inhibitor PEA2 CGOV33T -1.08 -0.52 0.08

GNE-493 PI3K inhibitor PEO-14 CGOV32T -1.65 -0.81 0.19

GNE-493 PI3K inhibitor RMG-I CGOV3ST -3.52 -1.92 -0.36

GNE-493 PI3K inhibitor RMUG-S CGOV36T -2.06 -0.59 0.47

GNE-493 PI3K inhibitor SK-OV-3 CGOV37T_3 -1.97 -1.47 -1.03

GNE-493 PI3K inhibitor TOV-112D CGOV38T -1.07 0.31 1.97

GNE-493 PI3K inhibitor TYK-nu CGOV40T -1.16 -0.06 1.24

MEK162 MEK inhibitor A2780 CGOV1T -0.72 1.59 2.03

MEK162 MEK inhibitor Caov-3 CGOV2T -3.02 1.82 0.38

MEK162 MEK inhibitor DOV-13 CGOV4T -1.15 1.97 1.74

MEK162 MEK inhibitor EFO-21 CGOVST 0.05 1.48 2.50

MEK162 MEK inhibitor ES-2 CGOV7T -2.48 -1.07 0.63

MEK162 MEK inhibitor HEY CGOV8T -2.50 -0.63 0.90

MEK162 MEK inhibitor KK CGOV11TJ 0.33 1.55 2.20

MEK162 MEK inhibitor Kuramochi CGOV13T 0.27 1.93 2.72

MEK162 MEK inhibitor MCAS CGOV14T -4.47 -2.33 0.04

MEK162 MEK inhibitor OAW-28 CGOV1 ST -1.69 0.33 0.71

MEK162 MEK inhibitor OAW-42 CGOV16T 0.25 1.27 2.29

MEK162 MEK inhibitor OV-167 CGOV17T -4.24 -1.51 -0.59

MEK162 MEK inhibitor OV177 CGOV18T -2.50 -0.92 0.59

MEK162 MEK inhibitor OV207 CGOV20T -1.23 1.56 2.28

MEK162 MEK inhibitor OV-90 CGOV21T -4.00 -2.86 -0.87

MEK162 MEK inhibitor OVCA-429 CGOV23T -1.49 2.11 1.48

MEK162 MEK inhibitor OVCAR-5 CGOV26T -4.31 -0.91 1.31

MEK162 MEK inhibitor OVISE CGOV27T -2.50 0.25 0.10

MEK162 MEK inhibitor OVKATE CGOV28T -4.98 -3.70 -0.89

MEK162 MEK inhibitor OVMANA CGOV29T -5.14 -4.11 -3.06

MEK162 MEK inhibitor OVSAHO CGOV30T -3.70 0.44 -5.01

MEK162 MEK inhibitor OVTOKO CGOV31T -3.80 -1.62 0.72

MEK162 MEK inhibitor PEA2 CGOV33T -3.34 -1.51 0.45

MEK162 MEK inhibitor PEO-14 CGOV32T -1.35 1.52 1.56

MEK162 MEK inhibitor PEO-6 CGOV34T -3.22 -0.18 1.57

MEK162 MEK inhibitor RMG-I CGOV3ST -4.28 -3.19 -0.51

MEK162 MEK inhibitor RMUG-S CGOV36T -3.64 -2.00 -1.44

MEK162 MEK inhibitor TOV-112D CGOV38T 1.84 3.76 3.83

MEK162 MEK inhibitor TYK-nu CGOV40T -2.19 -0.26 2.14

Table S12 Rearrangement types identiPied Prom improperly paired reads

Related to Experimental Procedures. WO 2020/081549 R2 strand R1 < R2 Inter-chromosomal Aberrant separation (> 10kb) _l PCT/lJS2019/056299 _l ble groups

Inverted translocation \(-\) \(-\) NA TRUE NA \(-+\> 8

Table S13 Primers for Sanger sequencing and droplet digital PCR

Related to Experimental Procedures.

Fusions ISCN HGVS Sanger P1 Sanger P2 ddPCR

FAM160A1- seq[hg19]t(4;4) g[chr4:1S2373844::chr4:153414567] AAATTAATAAATAACCATATCTGTATCTGTCT TACTCACCTCTCTAAAGGCCCTATATC

FBXW7

NAPEPLD- seq[hg19]t(7;7) g[chr7:102759729::chr7:116399091] AGAATAAGAGTAGGTTTTATTACTGGCTGA GCATTTGTATTTTATTCACCGAATTAC NA

MET

NF1- seq[hg19]inv(17;17) g[chr17:29450665::chr17:30921282inv] TAACTTCTAGTCTCAAGTGGTCTTTCC TTAACATGTTGCCCATTATAACAGTAA AGTGC

MY01 D

IKZF2- seq[hg19] t(2;2) g[chr2:213914446::chr2:213286255] AAGCCGTAAAGTCTAAAAATGAAAGAT TGTAGTGATGTGGATAGTTTTGACAAT TTGGT

ERBB4

3

PDGFRB- seq[hg19]t(5;5) g[chr15:149520407::chr15:149474852] GTCTAGGGGAGCGGAGTAAGG CAATTTCCCAGATACCTTTTTGTTAAT NA

CSF1 R

SHANK2- seq[hg19]t(11;11) g[chr11:70472590::chr11:69457566] CATATCACCCACAATATCTGCAC GCAGGAGCTTCCCGTGAT NA

CCND1

YAP1- seq[hg19]inv(11 ;11) g[chr11:102091494::chr11:95842370inv] ACCAAAAGACAGCCAATAGACT AGGGATGAGAGTCAAGCAGG TGCAC

MAML2

ML5T8- seq[hg19]t(16;16;) g[chr16:2252862::chr16:2111204] TGGGGTGATCAAGTCATTCC CTGGCCTCCTGTACATCACC TCGAC

TSC2

NOTCH1- seq[hg19]t(9:1) g[chr9:139406991 ::chr1 :145470592] GCTTGTGGACTCTTCTTTGTCTT CAAGCTATGAAGCTAGAGTCACAAA NA

NBPF10

Table S14 R package versions

Related to Experimental Procedures. Packages were built using ~R 3.5.0-.

R package Version Source

acepack 1.4.1 CRAN (R 3.5.0) R package WO 2020/081549 Version Source PCT/US2019/056299 backports 1.1.2 CRAN (R 3.5.0)

base 3.5.0 local

base64enc 0.1-3 CRAN (R 3.5.0)

bindr 0.1.1 CRAN (R 3.5.0)

bindrcpp 0.2.2 CRAN (R 3.5.0)

Biobase 2.40.0 Bioconductor

BiocGenerics 0.26.0 Bioconductor

Bioclnstaller 1.30.0 Bioconductor

BiocParallel 1.14.1 Bioconductor

biomaRt 2.36.1 Bioconductor

Biostrings 2.48.0 Bioconductor

biovizBase 1.28.0 Bioconductor

bit 1.1-14 CRAN (R 3.5.0)

bit64 0.9-7 CRAN (R 3.5.0)

bitops 1.0-6 CRAN (R 3.5.0)

blob 1.1.1 CRAN (R 3.5.0)

boot 1.3-20 CRAN (R 3.5.0)

broom 0.4.4 CRAN (R 3.5.0)

BSgenome 1.48.0 Bioconductor

cellranger 1.1.0 CRAN (R 3.5.0)

checkmate 1.8.5 CRAN (R 3.5.0)

circlize 0.4.3 CRAN (R 3.5.0)

cli 1.0.0 CRAN (R 3.5.0)

cluster 2.0.7-1 CRAN (R 3.5.0)

CNPBayes 1.11.1 local

coda 0.19-1 CRAN (R 3.5.0)

colorspace 1.3-2 CRAN (R 3.5.0)

combinat 0.0-8 CRAN (R 3.5.0)

compiler 3.5.0 local

ComplexHeatmap 1.18.0 Bioconductor (R 3.5.0)

crayon 1.3.4 CRAN (R 3.5.0)

curl 3.2 CRAN (R 3.5.0)

data.table 1.11.4 CRAN (R 3.5.0)

datasets 3.5.0 local

DBI 1.0.0 CRAN (R 3.5.0)

deconstructSigs 1.8.0 CRAN (R 3.5.0)

R package WO 2020/081549 Version Source PCT/US2019/056299

Formula 1.2-3 CRAN (R 3.5.0)

GenomelnFoDb 1.16.0 Bioconductor

GenomelnFoDbData 1.1.0 Bioconductor

GenomicAlignments 1.16.0 Bioconductor

GenomicFeatures 1.32.0 Bioconductor

GenomicRanges 1.32.3 Bioconductor

GetoptLong 0.1.6 CRAN (R 3.5.0)

GGally 1.4.0 CRAN (R 3.5.0)

ggbio 1.28.0 Bioconductor

ggplot2 2.2.1 CRAN (R 3.5.0)

GlobalOptions 0.0.13 CRAN (R 3.5.0)

glue 1.2.0 CRAN (R 3.5.0)

graph 1.58.0 Bioconductor

graphics 3.5.0 local

grDevices 3.5.0 local

grid 3.5.0 local

gridExtra 2.3 CRAN (R 3.5.0)

gtable 0.2.0 CRAN (R 3.5.0)

gtools 3.5.0 CRAN (R 3.5.0)

haven 1.1.1 CRAN (R 3.5.0)

Hmisc 4.1-1 CRAN (R 3.5.0)

hms 0.4.2 CRAN (R 3.5.0)

htmlTable 1.12 CRAN (R 3.5.0)

htmltools 0.3.6 CRAN (R 3.5.0)

htmlwidgets 1.2 CRAN (R 3.5.0)

httr 1.3.1 CRAN (R 3.5.0)

integration 0.0.3 local

integration.data 0.0.1 local

IRanges 2.14.10 Bioconductor

jsonlite 1.5 CRAN (R 3.5.0)

kableExtra 0.9.0 CRAN (R 3.5.0)

knitr 1.20 CRAN (R 3.5.0)

lattice 0.20-35 CRAN (R 3.5.0)

latticeExtra 0.6-28 CRAN (R 3.5.0)

lazyeval 0.2.1 CRAN (R 3.5.0)

lubridate 1.7.4 CRAN (R 3.5.0)

R package WO 2020/081549 Version Source PCT/US2019/056299 nlme 3.1-137 CRAN (R 3.5.0)

nnet 7.3-12 CRAN (R 3.5.0)

OrganismDbi 1.22.0 Bioconductor

ovarian.cell.line.data 0.0.1 local

ovarian.manuscript 0.0.34 local

ovexpress 0.0.3 local

parallel 3.5.0 local

pastecs 1.3.21 CRAN (R 3.5.0)

pillar 1.2.3 CRAN (R 3.5.0)

pkgconFig 2.0.1 CRAN (R 3.5.0)

plyr 1.8.4 CRAN (R 3.5.0)

prettyunits 1.0.2 CRAN (R 3.5.0)

progress 1.1.2 CRAN (R 3.5.0)

ProtCenerics 1.12.0 Bioconductor

psych 1.8.4 CRAN (R 3.5.0)

purrr 0.2.5 cran (@0.2.5)

R6 2.2.2 CRAN (R 3.5.0)

RBCL 1.56.0 Bioconductor

RColorBrewer 1.1-2 CRAN (R 3.5.0)

Repp 0.12.17 CRAN (R 3.5.0)

RCurl 1.95-4.10 CRAN (R 3.5.0)

readr 1.1.1 CRAN (R 3.5.0)

readxl 1.1.0 CRAN (R 3.5.0)

rentrez 1.2.1 CRAN (R 3.5.0)

reshape 0.8.7 CRAN (R 3.5.0)

reshape2 1.4.3 CRAN (R 3.5.0)

rjson 0.2.19 CRAN (R 3.5.0)

rlang 0.2.1 CRAN (R 3.5.0)

rmarkdown 1.9 CRAN (R 3.5.0)

rpart 4.1-13 CRAN (R 3.5.0)

rprojroot 1.3-2 CRAN (R 3.5.0)

Rsamtools 1.32.0 Bioconductor

RSQLite 2.1.1 cran (@2.1.1)

rstudioapi 0.7 CRAN (R 3.5.0)

rtracklayer 1.40.3 Bioconductor

rvest 0.3.2 CRAN (R 3.5.0)

S4Vectors 0.18.2 Bioconductor

R package WO 2020/081549 Version Source PCT/US2019/056299 svovarian 0.0.7 local

tibble 1.4.2 CRAN (R 3.5.0)

tidyr 0.8.1 CRAN (R 3.5.0)

tidyselect 0.2.4 CRAN (R 3.5.0)

tidyverse 1.2.1 CRAN (R 3.5.0)

tools 3.5.0 local

trellis 0.0.36 local

utils 3.5.0 local

VariantAnnotation 1.26.0 Bioconductor

viridisLite 0.3.0 CRAN (R 3.5.0)

visdat 0.2.3.9500 Cithub (njtierney/visdat@364eded (mailto:njtierney/visdat@364eded))

withr 2.1.2 Cithub (jimhester/withr@79d7b0d (mailto:jimhester/withr@79d7b0d))

XML 3.98-1.11 CRAN (R 3.5.0)

xml2 1.2.0 CRAN (R 3.5.0)

XVector 0.20.0 Bioconductor

zlibbioc 1.26.0 Bioconductor