"Microglial microvesicles contained microRNA-based methods for the diagnosis, prognosis and treatment monitoring of neurological, neurodegenerative and inflammation-based diseases"

The present invention describes a method for the in vitro diagnosis, prognosis and/or treatment monitoring of neurodegenerative, neurological and inflammation- based diseases, wherein the method comprises the steps: a) isolating microglial microvesicles (MVs) from biological fluids obtained from an individual;

b) collecting the microRNA (miRNA) contained into said MVs;

c) determining the expression profile of a predetermined set of miRNA;

d) comparing said expression profile to one or several reference expression profiles,

wherein the comparison of said determined expression profile to said one or several reference expression profiles allows for the diagnosis, prognosis and/or treatment monitoring of the disease.

Background

Emerging evidence indicates that inflammation represents a pathogenic factor in many CNS diseases, including chronic neurodegenerative diseases such as Alzheimer's Disease (AD), Parkinson's Disease (PD) , Amyotrophic Lateral Sclerosis (ALS) , Multiple Sclerosis (MS) , neurological disorders such as schizophrenia or epilepsy but also rare diseases such as Batten' s Disease.

Microglia, the resident immune cells in the brain, plays a crucial role in the onset of neuroinflammation . Microglial cells are the major cellular elements with immune function inside the CNS and are fundamental in orchestrating inflammatory brain responses to external challenges .

In spite of the evidence indicating that chronic inflammation might influence the pathogenesis of degenerative diseases, the mechanisms of communication between microglia and neurons have not been clearly elucidated, and it is still unclear which molecules are being released by these cells and how the damage occurs at neuronal level. Activated microglia may affect either positively or negatively neuronal survival, via the production of growth factors or pro-inflammatory mediators .

Upon cellular activation, microglia release plasma membrane-derived microvesicles (MVs) at a very early stage of the inflammatory process leading to neurodegeneration (Bianco F et al . Astrocyte-derived ATP induces vesicle shedding and IL-1 beta release from microglia. J Immunol. 2005 174 ( 11 ): 7268-77 ; Bianco F et al . Acid sphingomyelinase activity triggers microparticle release from glial cells. EMBO J. 2009 28 (8) : 1043-54) .

MVs have been found in high number in the cerebrospinal fluid of patients with mild cognitive impairment (Agosta F et al . Myeloid microvesicles in cerebrospinal fluid are associated with myelin damage and neuronal loss in mild cognitive impairment and Alzheimer disease. Ann Neurol. 2014 76 ( 6) : 813-25 ; US8999655 B2) .

MicroRNAs (miRNAs, miR) are small non-coding RNAs expressed in animals and plants. They regulate cellular function, cell survival, cell activation and cell differentiation during development. Many miRNAs are conserved in sequence between distantly related organisms .

A diagnostic method for neurodegenerative, neurological and inflammation-based diseases is strongly needed, as well as a method for monitoring the therapeutic outcome in diseases where the therapeutic protocol has to be strictly defined and punctually modified accordingly to the specific reaction observed in each treated individual .

Description of the invention The authors of the present invention have surprisingly demonstrated a strong and specific correlation between miRNA content and profile of MVs derived from microglia cells and neurodegenerative, neurological and inflammation-based diseases. The authors have surprisingly demonstrated that specific patterns of miRNAs are activated in microglial MVs derived under different detrimental conditions.

It is here firstly described a pathology and/or disease-specific miRNA profile within the microglial MVs isolated from biological fluids both for early diagnosis, prognosis and/or treatment monitoring.

A "miRNA" is a naturally occurring, small non- coding RNA that is about 17 to about 25 nucleotide (nt) in length in its biologically active form that negatively regulates mRNA translation on a sequence- specific manner. Identified miRNAs are registered in the miRNA database miRBase (http://microma.sanger.ac.uk/).

A "sample", as defined herein, is a small part of a subject, representative of the whole and may be constituted by a body fluid sample. Body fluid samples may be blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid samples and may likewise be fresh, frozen or fixed. Samples may be removed surgically, by extraction i.e. by hypodermic or other types of needles, by microdissection or laser capture. The sample should contain any biological material suitable for detecting the desired biomarker (miRNA) , thus, said sample should advantageously comprise cell material from the subject.

A "reference sample", as used herein, means a sample obtained from individuals, preferably two or more individuals, known to be free of any neurodegenerative, neurological disease or neuro-inflammation or from the general population. The suitable reference expression levels of miRNAs can be determined by measuring the expression levels of said miRNAs in several suitable individuals, and such reference levels can be adjusted to specific populations. In a preferred embodiment, the reference sample is obtained from a pool of healthy individuals. The expression profile of the miRNAs in the reference sample can, preferably, be generated from a population of two or more individuals; for example, the population can comprise 3, 4, 5, 10, 15, 20, 30, 40, 50 or more subjects.

An "individual", as used herein, refers to a mammal, human or non-human, under observation, preferably a human being. The individual may be any individual, an individual predisposed to a neuro-related disease or an individual suffering from a neuro-related disease. As used herein, the expression "diagnosis" or "diagnosing" relates to methods by which the skilled person can estimate and even determine whether or not an individual is suffering from a given disease or condition.

Along with diagnosis, clinical disease prognosis is also an area of great concern and interest. It is important to know the stage and rapidity of advancement of the disease in order to plan the most effective therapy. If a more accurate prognosis can be made, appropriate therapy, and in some instances less severe therapy for the patient can be chosen.

Further, the expression "method of diagnosing" as used herein relates to a method that may essentially consist of the steps mentioned below, or may include additional steps. However, it must be understood that the method, in a preferred embodiment, is a method that is carried out in vitro, i.e., it is not carried out in the human or animal body.

It has here surprisingly found that the miRNAs contained in microglial MVs, microglial MVs that can be isolated according to procedures known in the state of the art, reflect in a reproducible manner any variation from the physiological state in the CNS. CNS impairments due to neurodegenerative diseases, but also linked to neurological disorders or neuroinflammation are each linked to a very specific and reproducible miRNA profile. The variation from the physiological miRNAs profile of microglial MVs miRNAs is very sensitive to disease progression, therefore making said miRNA a very useful tool not only for an early diagnosis but also for therapeutic monitoring.

In a first embodiment, the present invention describes a method for the in vitro diagnosis or clinical disease prognosis of a neurodegenerative, neurological or inflammation-based disease, wherein the method comprises the steps:

a) isolating microglial MVs from biological fluids obtained from an individual;

b) collecting the miRNA contained into said MVs;

c) determining the expression profile of a predetermined set of miRNA;

d) comparing said expression profile to one or several reference sample expression profiles,

wherein the comparison of said determined expression profiles to said one or several reference sample expression profiles allows for the diagnosis or prognosis of the disease.

In a preferred embodiment, the disease is selected form the group comprising: AD, PD, ALS, MS, Batten's Disease, Schizophrenia, Epilepsy, Neuropathic pain,

Neuroinflammation . In a further preferred embodiment, the disease is a neurodegenerative disease selected from AD, PD, ALS, MS. In a preferred embodiment, said expression profile is determined of miRNAs selected from the group consisting of miR-125a-5p (SEQ ID 1), miR-300-3p (SEQ ID 2), miR- 330-3p (SEQ ID 3), miR-466n-3p (SEQ ID 4), miR-501-5p (SEQ ID 5), miR-146a-5p (SEQ ID 6), miR-24-l-5p (SEQ ID 7), miR-1306-5p (SEQ ID 8), miR-744-5p (SEQ ID 9), miR- 671-5p (SEQ ID 10), miR-134-5p (SEQ ID 11), miR-877-5p (SEQ ID 12), miR-23b-5p (SEQ ID 13), miR-669c-5p (SEQ ID 14), miR-29b-3p (SEQ ID 15), miR-195a-5p (SEQ ID 16), miR-151-5p (SEQ ID 17), miR-374c-3p (SEQ ID 18), miR- 6539 (SEQ ID 19), miR-16-l-3p (SEQ ID 20), miR-6399 (SEQ ID 21), miR-6240 (SEQ ID 22), miR-23a-5p (SEQ ID 23), miR-92a-l-5p (SEQ ID 24), miR-219a- 1 -3p (SEQ ID 25), miR-128-l-5p (SEQ ID 26), miR-1949 (SEQ ID 27), miR-872- 3p (SEQ ID 28), miR-582-3p (SEQ ID 29), miR-338-5p (SEQ ID 30), miR-379-5p (SEQ ID 31), miR-155-5p (SEQ ID 32), miR-450a-5p (SEQ ID 33), miR-100-5p (SEQ ID 34), miR- 152-3p (SEQ ID 35), miR-222-3p (SEQ ID 36).

In a further preferred embodiment, said method is a method for diagnosis or prognosis of PD in an individual, wherein a pattern of 11 up-regulated and 7 down-regulated specific miRNAs listed above is an indicator of PD, preferably said pattern is the pattern listed in Table 1. microglial MVs miRNA pattern downregulated)

In a further preferred embodiment, said method is a method for diagnosis or prognosis of AD in an individual, wherein a pattern of 12 up-regulated and 4 down-regulated specific miRNAs listed above is an indicator of AD, preferably said pattern is the pattern listed in Table 2.

Table 2: AD, microglial MVs pattern (+, upregulated; -, downregulated)

miR-23b-5p (SEQ ID 13) - miR-24-l-5p (SEQ ID 7) + miR-300-3p (SEQ ID 2) + miR-330-3p (SEQ ID 3) + miR-374c-3p (SEQ ID 18) - miR-466n-3p (SEQ ID 4) + miR-669c-5p (SEQ ID 14) - miR-671-5p (SEQ ID 10) + miR-744-5p (SEQ ID 9) + miR-877-5p (SEQ ID 12) +

The expression levels of a plurality of miRNAs are determined as expression level values and, in a further preferred embodiment, said step d) comprises mathematically combining the expression level values of said plurality miRNAs by applying an algorithm to obtain a normalized expression level relative to at least one reference pattern of expression level.

In a preferred embodiment, the determination of the expression profile in said step c) is obtained by the use of a method selected from the group consisting of a Sequencing-based method, an array based method and a PCR based method.

In a further aspect, a kit for diagnosis and prognosis of neurodegenerative, neurological and inflammation- based diseases is described, comprising: a) means for determining the miRNA expression profile of a miRNA sample of microglial microvesicles of a subject, and

b) at least one reference set of miRNA profile characteristic for a particular condition. Examples

Materials and Methods

Microglial cell cultures

Microglial cells were obtained from mixed glial cultures of P2 postnatal CD1 mice (Harlan Laboratories) . Cortices were isolated in ice-cold balanced salt solution (HBSS) without Ca ⁺⁺ and Mg ⁺⁺ . Brains were collected and meninges were manually removed under dissecting microscopes under sterile hood. The tissues were then finely chopped using a scalpel. All of these operations were carried out at 4°C.

The tissue fragments were incubated at 37°C for 20-30 min in a HBSS solution with 2.5 mg/ml trypsin, 0.2 mg/ml EDTA, 1 mg/ml glucose and 0.1 mg/ml bovine pancreatic DNase I in persistent gentle shaking in a water bath incubator .

Following incubation, fresh culture medium (DMEM/F12 (3:1) containing 20% heat-inactivated fetal bovine serum, 100 U/ml penicillin-streptomycin was added, and the suspension was centrifuged at 1500 rpm for 5 min at 4°C. Finally, single cell suspension was obtained by manual resuspension of the pellet using a sterile Pasteur pipette.

The dissociated cells were plated onto poly-L-lysine coated flasks supplemented with 20% heat-inactivated fetal bovine serum and 100 U/ml penicillin, 10 mg/ml streptomycin, and 5.5 g/L glucose (glial medium) . Purified microglial cultures were harvested by shaking 3-week-old mixed glial cultures. Detached microglia was seeded on poly-L-lysine- coated flasks.

Purity of microglial cultures was carried out by immunocytochemical analysis of specific cellular markers: Antibodies against glial fibrillar acidic protein (GFAP) (1:400) for astrocytes, IB4 (1:100) for microglia, olig2 for oligodendrocytes.

Abeta amyloid preparation

Beta Amyloid 1-42 (American Peptide) is prepared as recommended in the data sheet and in literature; briefly the lyophilized peptide is dissolved in HPLC grade water at 6 mg/mL and then diluted to 1 mg/mL with PBS lx without Calcium and Magnesium. After 48h of incubation (37°C) the peptide is incubated with the cells at a final concentration of 5 microM.

Isolation of CSF MVs

Approximately 4,500,000 cells/condition were primed with the different experimental stimuli (5 microM of Abeta oligomers for 24 hours or 1 hour of 20 microM 6-OHDA) . Control cells (Untreated) were kept in culture media without triggering stimuli. Following priming, cells were triggered with 100 microM BzATP for 30 minutes under gentle rotation in KRH containing solution. The supernatant, containing shed vesicles, was withdrawn and incubated for 10 min at 4°C under gentle periodic rotation with streptavidin beads, precoated with biotinylated Annexin V. Shed vesicles bound to Annexin- coated beads were then separated from the supernatant by gravity sedimentation at 4°C.

RNA extraction from isolated MVs

Total RNA (triplicate of biological samples) were extracted from isolated MVs collected in a RNA preserving solution using Trizol LS Reagent. Total RNA samples were analyzed by capillary electrophoresis on RNA 6000 Nano chip on Agilent Bioanalyzer 2100 Instrument and their integrity was checked through calculation of RNA Integrity Number (RIN) . The qualitative control of RNAs obtained from MVs was performed using a RNA 6000 Pico chip on Bioanalyzer 2100 Instrument .

Library preparation and sequencing

The sequencing activities was characterized by two main steps: library preparation and their sequencing. The libraries were prepared using TruSeq Small RNA Sample Preparation, a dedicated kit by Illumina, starting from total RNA as input material. The protocol takes advantage of the natural structure common to most known miRNA molecules and selectively enriches specifically in miRNAs . Each library was added with a unique index sequence and checked on Bioanalyzer 2100. Pooled libraries were sequenced on Illumina platform in single read protocol with the production of sequences of 36 bp in length.

Data analysis

Small RNA sequencing data was processed from raw FASTQ files. Using FastX toolkit, adaptors sequences were clipped from 3' end of each read. Reads with low complexity and with a length less than 16 nucleotides were discarded. Reads passing this QC step were aligned to the hgl9 human genome build allowing no mismatches in the seed region and discarding reads with more than 10 multi-mapping hits. Remnants reads were annotated and counted based on genomic annotations. Reads realigning to miRBase were used for differential expression analysis. Normalizations and differential expression tests were performed with Bioconductor Packages.

Results

MicroRNA content of MVs isolated from microglial cells challenged with different neurodegenerative scenarios has been analysed.

Microglial cells obtained from rodent model have been primed to selected inflammatory scenarios. MVs release has then be stimulated with 100 microM BzATP.

Isolated MVs were processed, RNA was isolated and microRNA analysis was carried out. Specific miRNA patterns were evaluated. Raw data was background-subtracted, Log2-transformed, and normalized on read per million base. Values for each pathological indication were compared to control, i.e. untreated cells, which were not primed but only exposed to 100 microM BzATP triggering.

MiRNA with ratio/control above 2 were considered upregulated, while MiRNA with ratio/control below 0.5 were considered downregulated.

Table 3 and 4 report the data observed in a AD microglial MVs model, i.e. Abeta-challenged microglial MVs with respect to control. In table 3 are reported the Abeta-upregulated miRNA, in table 4 the Abeta- downregulated miRNA.

Table 3:

miR-671-5p (SEQ ID 10) AGGAAGCCCUGGAGGGGCUGGAG 2 030987686 miR- 134 -5p (SEQ ID 11) UGUGACUGGUUGACCAGAGGGG 2 06964569 miR- 877 -5p (SEQ ID 12) GUAGAGGAGAUGGCGCAGGG 2 173997574

Table 4:

Table 5 and 6 report the data observed in a PD microglial MVs model, i.e. 6-OHDA-challenged microglial MVs with respect to control. In table 5 are reported the

-OHDA-upregulated miRNA, in table 6 the 6-OHDA' ownregulated miRNA.

Table 5:

miR- 92a-l-5p (SEQ ID 24) AGGUUGGGAUUUGUCGCAAUGCU 2 711519169 miR- 219a-l-3p (SEQ ID 25) AGAGUUGCGUCUGGACGUCCCG 2 803957322 miR- 128-1 -5p (SEQ ID 26) CGGGGCCGUAGCACUGUCUGA 3 822673178

Table 6: