The present invention is related to the fields of medicine and immunology. In particular, the present invention provides a modified Gram negative bacterium strain useful as a vaccine as well as a tool for differentiating animals suffering an infection from those animals vaccinated with the modified strain.

BACKGROUND ART Lipopolysaccharide region (LPS), which is located in the outer membrane of the Gram-negative bacterium, elicits an immune response in normal animals. It is a large molecule consisting of a glycolipid (named lipid A), an O-antigen, and a core oligosaccharide with two sections, outer core and inner core, all covalently bond. The LPS is of crucial importance to Gram-negative bacteria, whose death results if it is removed.

Antigen O (also so-called and referred hereinafter as Ό chain") is a repetitive glycan polymer of LPS. The O antigen is attached to the core oligosaccharide, and comprises the outermost domain of the LPS molecule. Consequently, it isa target for recognition by host antibodies. The composition of the O chain varies depending on the bacterium and serotype. The presence or absence of O chains determines whether the LPS is termed smooth or rough,

respectively. Full-length O-chains are characteristic of the smooth LPS, whereas the absence or reduction of O-chains would render the LPS rough. Presence of the O chain in smooth Brucella is a requisite for virulence and thus far the only strains affected in the O chain completely lack this

polysaccharide (i.e., they are rough mutants) and are attenuated.

There is a group of wild-type Gram negative bacteria which is characterized by expressing an autologous N-formyltransferase enzyme. This enzyme is crucial in the production of the O chain which, in this specific bacterial group, is a homopolymer consisting of N-formylperosamine residues.

It is well-known in the state of the art that these Gram negative bacteria expressing N-formyltransferase cause diseases in animals. In particular:

(a) Brucella causes brucellosis, a zoonotic disease affecting mostly ruminants (B. melitensis and B. abortus) and swine (B. suis), having a significant impact on animal market and products derived therefrom (including milk, cheese, dairy products, etc.). This disease can also be transmitted to human beings if infected products, such as unpasteurized milk or undercooked meat from infected animals, are ingested, or by contact with infected animals.

(b) Yersinia is a gram-negative bacterial genus that includes several animal and human pathogens. Y. enterocolitica, which causes mild intestinal infections in animals and humans, includes several serotypes.

These Y. enterocolitica serotypes differ in the O-chain of the LPS, and Y. enterocolitica serotype 0:9 carries an LPS with an O-chain that, like the O-chain of smooth Brucella, is a homopolymer of N- formylperosamine. Animal vaccination is the most important tool in the control and eradication of the diseases caused by Brucella. However, current vaccines, such as B.

abortus S19 and B. melitensis Rev1 (specifically developed for the

immunoprophylaxis of brucellosis), carry a smooth type LPS that stimulates an antibody response against the O chain very similar to that occurring during an infection. Since it has been established that the best diagnosis is based on detection of antibodies against the LPS O chain, the antibody response to the O-chain represents a drawback of brucellosis vaccines because it hampers the differentiation of vaccinated and infected animals. In an attempt to solve this problem, WO2012131 128 discloses the

modification of antigen O by replacing at least one N-formyl residue by a different acyl residue, such as an acetyl residue. In this way, the modified Brucella carries a modified epitope in O chain that can give rise to antibodies not developed during infection by wild-type smooth Brucella (which carry an unmodified O-chain). Therefore, this modification can be used for

differentiating the antibody response occurring during an infection by wild-type strains from that induced upon vaccination with a modified bacterium.

In spite of previous efforts, there is a need of further vaccines that elicit an immune response in the animal that is both protective against the

microorganism and can be readily differentiated from that resulting from infection. In addition, there is a need of further bacterial strains with the ability of eliciting an immune response which can be readily differentiated from the immune response due to the bacterial infection and which, at the same time, can be protective against the microorganism causing the infection.

SUMMARY OF THE INVENTION

The present inventors have developed a modified bacterium wherein (a) its authologous N-formyltransferase activity has been suppressed, and (b) a heterologous gene encoding a N-acyltransferase other than a N- formyltransferase enzyme is functionally expressed.

With these modifications, the resulting bacterium displays a LPS wherein the O chain is a homopolymer made of acylperosamine units, the "acyl" portion having been expressed by the heterologous gene. In other words, the modified bacterium differs from the wild-type version in the composition of the O chain: in the present invention the O chain is a homopolymer of N- acylperosamine residues (other than N-formylperosamine) and in the wild-type version the O chain is a homopolymer of N-formylperosamine.

Remarkably, the present inventors have found that upon performing these modifications in two different Brucella strains, the resulting modified strains carrying a so markedly different antigen O are still able to elicit an effective specific immune response. And what is even more remarkable, the modified bacteria were found to be attenuated despite carrying an O chain (see FIG. 4).

These results are unpredictable because Brucella strains carrying an O chain alternative to that in wild type Brucella have not been described so far but for the present invention. This is the first time that it is reported, for a Brucella strain, an attenuation on bacterial virulence due to the modification in O antigen composition. Remarkably, this attenuation in virulence does not negatively affect to the ability of the bacterium strain in raising an immune response.

In connection with the above, the experimental data provided below

demonstrate that the modified bacterium of the invention contains new epitopes due to the absence of any N-formyltransferase activity and to the presence of an alternative N-acyltransferase, which is consistent with the fact that the antibodies elicited are different. FIG. 2 and 3 show that the bacterium of the invention elicits completely different specific antibodies when compared with other modified strains. Furthermore, from the data obtained using the Rose Bengal test (OIE - World Organisation for Animal Health recommended diagnostic test

[http://www.oie. int/fileadmin/Home/eng/Health_standards/tahm/2008/pdf/2.04. 03_BOVINE_BRUCELL.pdf]) provided below it can also be concluded that the differentiation of animals infected by the wild type B. abortus or B. melitensis (O chain = N-formyl-perosamine) from animals vaccinated with the new constructions of the invention is feasible.

Thus, the present invention provides in a first aspect a modified Gram negative bacterium strain characterized in that (a) its autologous N- formyltransferase activity is suppressed; and (b) it comprises a functional heterologous gene coding for a N-acyltransferase enzyme other than a N- formyltransferase enzyme.

In a second aspect the present invention provides a process for preparing a modified Gram negative bacterium strain as defined in the first aspect of the invention, comprising, in any order, the following steps:

- suppressing the autologous N-formyltransferase activity; and

- including a functional heterologous gene coding for a N-acyltransferase other than a N-formyltransferase.

In a third aspect the present invention provides a modified Gram negative bacterium strain obtainable by the process as defined in the second aspect of the invention. In a fourth aspect the present invention provides a method for preparing a cell extract of the modified Gram negative bacterium strain as defined in the first or third aspect of the invention, which comprises the lysis of the strain.

In a further aspect, the present invention provides a cell extract of the modified Gram negative bacterium strain as defined in the first or third aspect of the invention. As stated above, the present inventors have found that the antibodies elicited by the modified bacterium of the invention are clearly different from those disclosed in the prior art. From this experimental data, the inventors, without being bound to the theory, assert that these new epitopes are due to the absence of autologous N-formyltransferase activity and to the expression of the heterologous gene.

Therefore, in a fifth aspect, the present invention provides an antibody against the modified Gram negative bacterium strain as defined in the first or third aspect of the invention.

In a sixth aspect the present invention provides a method for preparing antibodies which comprises: (a) administer the modified Gram negative bacterium strain as defined in the first or third aspect of the invention or the cell extract of the invention to a non-human animal, and (b) isolate the antibodies.

In a seventh aspect the invention provides an antibody obtainable by the method of the sixth aspect of the invention.

In view of the immunogenic profile of the new strain, either the modified bacterium, or the cell extract of the invention, or the antibody of the fifth or seventh aspect can be formulated in the form of a pharmaceutical or veterinary composition.

In an eight aspect the invention provides a veterinary or pharmaceutical composition comprising a therapeutically effective amount of the modified Gram negative bacterium strain as defined in the first or third aspect of the invention or the antibody of aspects fifth or seventh, or the cell extract of the invention, together with one or more veterinary or pharmacologically acceptable carriers or vehicles.

In a ninth aspect, the present invention provides a vaccine comprising a therapeutically effective amount of the modified Gram negative bacterium strain as defined in the first or third aspect of the invention or the antibody of the fifth or seventh aspect of the invention, or the cell extract of the invention, together with one or more pharmacologically or veterinary acceptable carriers or vehicles.

In a tenth aspect, the present invention provides the modified Gram negative bacterium strain as defined in the first or third aspect of the invention or of the antibody as defined in the fifth or seventh aspect of the invention or the cell extract of the invention, for use as a medicament.

In an eleventh aspect, the present invention provides a modified Gram negative bacterium strain as defined in the first or third aspect of the invention or the antibody defined in the fifth or seventh aspect of the invention or the cell extract of the invention, for use as immunogen.

In a further aspect, the present invention provides a modified Gram negative bacterium strain as defined in the first or third aspect, or of the antibody of the fifth or seventh aspect of the invention or the cell extract of the invention, for use in the treatment or prevention of an infection caused by a bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium. This aspect can also be formulated as the use of a modified Gram negative bacterium strain as defined in the first or third aspect of the invention, or of the antibody as defined in the fifth or seventh aspect of the invention or the cell extract of the invention, for the manufacture of a medicament for the treatment or prevention of an infection caused by a bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium. This aspect can also be formulated as a method for the treatment or prevention of an infection, the method comprising the step of administering an therapeutically effective amount of a modified Gram negative bacterium strain as defined in the first or third aspect of the invention, or of the antibody of the fifth or seventh aspect of the invention or the cell extract of the invention, in a subject in need thereof, and wherein the infection is caused by a bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium.

In a further aspect, the present invention provides the use of a modified Gram negative bacterium strain as defined in the first or third aspect of the invention, the antibodies of the fifth or seventh aspect or the cell extract of the invention, for use in diagnostics. In a further aspect, the present invention provides the use of a modified Gram negative bacterium strain as defined in the first or third aspect of the invention, or of the antibody of the fifth or seventh aspect of the invention or of the cell extract of the invention, for differentiating infected from vaccinated animals; particularly for differentiating an animal vaccinated with the modified bacterium of the first or third aspect of the invention from an animal infected with a bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium. In a further aspect, the present invention provides an in vitro method for differentiating an animal vaccinated with the modified Gram negative bacterium strain as defined in the first or third aspect of the invention from an animal infected with a bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium, the method

comprising the step of determining, in an isolated sample: (a) the presence of the modified Gram negative bacterium strain as defined in the first or third aspect of the invention, and/or (b) the presence of an antibody of the fifth or seventh aspect of the invention, and/or (c) the presence of the heterologous gene and the absence of the autologous N-formyltransferase activity; wherein either (a) and/or (b) and/or (c) is indicative that the animal has been vaccinated and that there is not an infection.

In a further aspect, the present invention provides a kit comprising the modified Gram negative bacterium strain as defined in the first or third aspect of the invention, and/or the antibody of the fifth or seventh aspect of the invention, and/or the cell extract of the invention.

The present invention also provides the use of a kit for differentiating an animal vaccinated with the modified Gram negative bacterium as defined in the first or third aspect of the invention, from an animal infected by a

bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium, the kit being one as above defined or one comprising:

(a) the bacterium, such as the wild-type bacterium strain, belonging to the same genus as the modified bacterium of the first aspect of the invention, or a variant of the bacterium, such as the wild-type bacterium strain, which retains the autologous N-formyltransferase activity, and/or

(b) a cell extract of bacterium referred in (a); and/or

(c) the antibodies raised against the bacterium referred in (a); and/or

5 (d) means for detecting the presence of the heterologous gene and the absence of the autologous gene.

Lastly, the present invention provides an in vitro method of differentiating an animal vaccinated with a modified Brucella strain from one infected with

0 Brucella, as well as the use of the bacterium of the invention or the kit of the invention for performing the differentiation between an animal vaccinated with a modified Brucella strain from an animal infected with Brucella.

Lastly, further aspects of the invention are:

5

(a) An in vitro method of differentiating an animal vaccinated with a modified Brucella strain from one infected with Brucella, which comprises one or more of the steps: (i) determining the presence of the modified Brucella strain; (ii) determining the presence of the antibody against said modified Brucella ; and o (iii) determining the presence of the heterologous gene and the absence of the autologous N-formyltransferase activity; wherein either (i) and/or (ii) and/or (iii) is indicative that the animal has been vaccinated;

(b) use of a kit for differentiating an animal vaccinated with a modified Brucella 5 strain from an animal infected with Brucella, the kit comprising one or more of the following components: (i) the bacterium strain of the invention as defined above, (ii) the antibodies raised against the bacterium of the invention; (iii) means for detecting the presence of the heterologous gene and the absence of the autologous gene; and/or (iv) the cell extract of the invention

0

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 . Reactivity of (A) Ba-parental LPS, and (B) Ba::Tn7wbdRAwbkC with sera form rabbit immunized with Ba-pwbR (black triangles) or with this sera5 absorbed with Ba-parental (black circles) or Ba::Tn7wbdRAwbkC (white circles). FIG. 2: Reactivity in ELISA of (A) Ba-parental, and (B) Ba::Tn7wbdRAwbkC with sera from mice infected with Ba-parental (black triangles), or

Ba::Tn7wbdRAwbkC (white circles). FIG. 3: Reactivity in ELISA of (A) Ba-parental LPS, and (B)

Ba::Tn7wbdRAwbkC LPS with sera sera from mice infected with Bme-parental (black triangles), or Bme::Tn7wbdRAwbkC (white circles).

FIG. 4. Bacterial multiplication in BALB/c mice. Each point is the mean +1- standard deviation (n = 5) of the log CFU per spleen. 1 ) Bme-parental; (2) Bme::Tn7wbdR; and (3) Bme:: Tn7wbdRAwbkC.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides a modified bacterium as defined in the first aspect of the invention.

The N-formyltransferase enzyme acts in the LPS biosynthesis pathway catalyzing the conversion of perosamine (GDP-4-NH-4,6dideoxymannose) to formylperosamine:

As far as it is presently known, this N-formyltransferase enzyme is only expressed in Brucella and Yersinia enterolitica serotype 0:9 strains.

In the present invention, the expression "its autologous N-formyltransferase activity is suppressed" means that the modified bacterium (either from

Brucella or Yersinia genus) is not able, when compared to the wild-type bacterium of the same genus, of catalyzing the conversion of perosamine (GDP-4-NH-4,6dideoxymannose) to N-formylperosamine. The lack of the autologous N-formyltransferase activity can be due to mutations in the gene encoding the N-formyltransferase that can stop either the transcription to RNA or the translation to protein or negatively affect the activity of the protein, so that it becomes inactive. Alternatively, it can be due to the removal of part or all the autologous gene coding for the enzyme.

Methods for performing mutations and gene deletions are well-known and routine for the person skilled person in the art (Sambrook, J. et al, 2001 , Molecular cloning Chapter 13. Mutagenesis. Pagesl 3.1 -13.62, Cold spring harbor laboratory press New York).

In one embodiment of the first or third aspect of the invention, the modified bacterium lacks the autologous gene coding for the N-formyltransferase enzyme. As explained below, the inventors achieved the deletion of the gene performing, in a first step, a PCR overlap strategy. The skilled person can design the appropriate pairs of primers for performing the PCR on the basis of the gene sequence and using available bioinformatics tools. In Example section below the inventors designed primers with sequences SEQ ID NO: 1 to 4 for performing the PCR. After that, in a second step, the resulting fragment could be cloned in an appropriate vector system. Of course, there are other alternative ways for deleting the autologous gene (Sambrook, J. et al., (2001 ). Molecular cloning Chapter 13. Mutagenesis. Pagesl 3.1 -13.62, Cold spring harbor laboratory press New York).

On the other hand, the N-acyltransferase encoded by the heterologous gene transfers an acyl group, other than the N-formyl, to the 4-amine group of perosamine. In one embodiment, the acyl group transferred by the heterologous enzyme is selected from the group consisting of: acetyl group, 3-deoxy-L- glycerotethronyl group, 3-hydroxypropionyl group, S(+)-2-hydroxypropionyl group, and R(-)2- hydroxypropionyl group. In another embodiment the acyl group transferred by the heterologous enzyme is an acetyl group.

In another embodiment of the first aspect of the invention, the heterologous gene codes for a N-acetyltransferase or a variant able of transferring an acetyl group to 4-amine perosamine position. This heterologous gene can be isolated from Escherichia coli O157:H7, Escherichia hermanii, Vibrio cholerae Hakata, Salmonella's N group, Stenotrophomonas maltophila, Citrobacter gillenii, Citrobacter youngae, or Caulobacter crescentus. In another embodiment, the heterologous gene is wbdR gene coding for the N- acetyltransferase in E.coli 0157:H7 (NCBI; 16.12.2010. ID: 962088; locus tag: z3192; ORF in SEQ ID NO: 15)

The heterologous gene coding for the N-acyltransferase can be isolated from any of the microorganisms listed above by cloning the gene from the wild-type bacteria. Alternatively, the heterologous gene can code for a variant of the wild-type gene isolated from the microorganism, provided that it keeps the property of transferring the acyl group. For selecting the appropriate heterologous gene, the following general strategy can be followed: (a) to identify bacteria with a O chain made of a N- acylperosamine with a group in N position different from N-formyl; (b) to identify the enzyme responsible for the substitution; (c) to clone the enzyme and include the resulting construct to the bacterium host (the one to be modified); and (d) to analyze the properties of the modified LPS.

The heterologous gene forms part of an expression construct or transcriptional unit, which allows the transcription and production of the heterologous enzyme in the host bacterium, comprising: (a) a regulatory-promoter region that drives and regulates the transcription; (b) a starting transcription signal; (c) the gene coding the enzyme; and (d) a stop transcription signal.

The construction of the expression constructs, their introduction in expression vectors appropriate for their subsequent introduction and transfer to the host bacterium, can be performed following any of the well-established routine techniques (Sambrook et al., 2001 , "Molecular cloning, to Laboratory Manual", 2 ^nd edition, Cold Spring Harbor Laboratory Press, N.Y., Vol. 1 -3 a).

In another embodiment, the bacterium of the first or third aspect of the invention is characterized by lacking the autologous gene expressing the N- formyltransferase and by expressing a heterologous gene coding for a N- acyltransferase other than a N-formyltransferase. In another embodiment, the bacterium of the first or third aspect of the invention is characterized by lacking the autologous gene expressing the N-formyltransferase and by expressing a heterologous gene coding for a N-acetyltransferase. In another embodiment, the bacterium of the first or third aspect of the invention is characterized by lacking the autologous gene expressing the N- formyltransferase and by expressing a heterologous gene coding for a N- acetyltransferase isolated from E. coli 0157:H7. In these embodiments, the O chain of the modified bacterium is a homopolymer totally lacking

formylpersonamine and carrying instead N-acetylperosamine.

5

According to the results obtained by the Rose Bengal test and ELISA, and from a practical point of view, the genetic modification could be extended to tag vaccines strains, such as the known smooth Brucella vaccines (i.e. the classical B. abortus S19 and B. melitensis Rev1 ), or LPS and/or metabolic

10 mutants suitable or not for developing new vaccines. Thus, in another

embodiment, the bacterium of the first or third aspect of the invention is a vaccine strain in nature. In the present invention, the expression "vaccine strain" means a strain inducing a protective immune response when inoculated in animals. There are well-known vaccine strains in the state of the

15 art, which are available for the skilled person in the art such as S19, Rev1 , among others. In another embodiment, the modified bacterium includes other modifications that have been previously disclosed as suitable for developing vaccine strains.

20 In another embodiment, the modified bacterium is of the genus Brucella.

In another embodiment, the bacterium of the first or third aspect of the invention is of the genus Brucella and is characterized by the lack of the autologous gene expressing the N-formyltransferase and by the expression of 25 a heterologous gene coding for a N-acyltransferase other than a N- formyltransferase. In another embodiment, the bacterium of the first or third aspect of the invention is of the genus Brucella and is characterized by the lack the autologous gene expressing the N-formyltransferase and by the expression of a heterologous gene coding for a N-acetyltransferase. In

30 another embodiment, the bacterium of the first or third aspect of the invention is of the genus Brucella and is characterized by the lack of the autologous gene expressing the N-formyltransferase and by the expression of a heterologous gene coding for a N-acetyltransferase obtained from E. coli O157:H7. In these embodiments, the O chain of the modified bacterium is a 35 100% N-acetylperosamine homopolymer.

The wbkC gene (NCBI-GenelD: 3787272) codes for protein of sequence SEQ ID NO: 15.

In another embodiment, the bacterium of the first or third aspect of the invention is from Brucella genus and of the specie selected from the group consisting of: Brucella melitensis, Brucella abortus, Brucella suis, Brucella pinnipedialis, Brucella ceti, Brucella microti, Brucella canis, and Brucella ovis. In another embodiment, the modified bacterium of the first or third aspect of the invention is from Brucella genus and of the specie selected from the group consisting of: Brucella melitensis, Brucella abortus, Brucella suis, Brucella pinnipedialis, Brucella ceti and Brucella microti. In another embodiment, the modified bacterium of the first or third aspect of the invention is from Brucella genus and of the specie selected from the group consisting of: Brucella melitensis and Brucella abortus. In another embodiment the modified bacterium is of the genus Brucella and it includes other genetic modifications previously disclosed in the prior art as responsible for conferring to the strain a vaccine profile, i.e., a protective immune response (Moriyon I. et al., "Rough vaccines in animal brucellosis: Structural and genetic basis and present status", 2004, Vet. Res., vol. 35, pages 1-38; Gonzalez D. et al., "Brucellosis vaccines: assessment of Brucella melitensis lipopolysaccharide rough mutants defective in core and O- polysaccharide synthesis and export", PLoS ONE, 2008, vol. 3, e2760;

Conde-Alvarez R. et al., "Lipopolysaccharide as a target for brucellosis vaccine design", Microb. Pathog, 2013, vol. 58, pages 29-34). In another embodiment, the modified bacterium of the first or third aspect of the invention further comprises one or more genetic modifications which suppresses the activity of one or more enzymes selected from the group consisting of: i) the glycosyltransferase enzymes involved in the synthesis of the core of the LPS of said Gram negative bacterium;

ii) the enzymes involved in the transport of the O chain of said Gram negative bacterium; and

iii) the enzymes involved in the metabolism of said Gram negative bacterium.

The suppression of the enzymatic activity can be due to the insertion, deletion or replacement of one or more nucleotides that gives rise to a frame-shift or to a change in the open reading frame. Alternatively, a construction carrying an antibiotic resistance gene can be inserted in the gene coding for the enzyme, which can disrupt the original reading frame, thus inactivating the gene.

Alternatively, the promoter region of the gene coding for the enzyme can be 5 partially or completely deleted. Routine methods can be followed to achieve this suppression (Conde-Alvarez R. et al., "Synthesis of phosphatidylcholine, a typical eukaryotic phospholipid, is necessary for full virulence of the

intracellular bacterial parasite Brucella abortus", Cell Microbiol., 2006, vol. 8, pages 1322-1335).

0

In one embodiment, the inactivation of any of the enzymes is due to the deletion of all or part of the gene(s) coding thereof.

In one embodiment, the enzymatic activity suppression is performed deleting5 all or part of a gene encoding a glycosyltransferase enzyme, the enzyme being selected from the group consisting of: WadA (glycosyltransferase), WadB (glycosyltransferase), WadC (mannosyl Itransferase), and WadD (glycosyltransferase). In another embodiment the suppression of

glycosyltransferase enzyme, involved in the synthesis of the core of the LPS, o is performed and comprises the deletion of all or part of a gene coding for the WadC mannosyl Itransferase.

In another embodiment, the suppression of the enzymatic activity comprises the deletion of all or part of a gene coding for an enzyme involved in the

5 transport of the O chain, the enzyme being selected from the group consisting of: Wzm (ABC transporter), Wzt (ABC transporter), and WbkF (undecaprenyl- glyscosyltransferase). In another embodiment, the suppression of the activity of an enzyme involved in the transport of the O chain is performed and consists in the deletion of the gene coding for ABC transporter Wzm.

0

In another embodiment, the suppression of the enzymatic activity comprises the deletion of all or part of a gene coding for an enzyme involved in the bacterial metabolism, the enzyme being selected from the group consisting of: Pyruvate phosphate dikinase (PpdK), Malic enzyme (Mae), Fba (Fructose5 bisphosphate aldolase), EryA (erythritol kinase), and RpiB (D-erythrose-4- phosphate isomerase). In another embodiment, the enzymatic suppression of the activity of an enzyme involved in the metabolism of said Gram negative bacterium is performed and comprises the deletion of the gene coding for enzyme Ppdk.

In one embodiment, the suppression of the activity of one or more

glycosyltransferase enzymes comprises the deletion of all or part of a gene encoding a glycosyltransferase enzyme which is selected from the group consisting of: WadA (SEQ ID NO: 16), WadB (SEQ ID NO: 17), WadC (SEQ ID NO: 18), and WadD (SEQ ID NO: 19). In another embodiment the inactivation of the gene encoding a glycosyltransferase involved in the synthesis of the core of the LPS comprises the deletion of all or part of a gene coding for the WadC mannosyl transferase of sequence SEQ ID NO: 18.

In another embodiment, the suppression in the activity of one or more enzymes involved in the transport of the O chain is performed and comprises the deletion of all or part of a gene coding for a protein selected from the group consisting of: Wzm (SEQ ID NO: 20), Wzt (SEQ ID NO: 21 ), and WbkF (SEQ ID NO: 22). In another embodiment, the suppression of the activity of an enzyme involved in the transport of the O chain is performed and consists in the deletion of the gene coding for protein Wzm (SEQ ID NO: 20).

In another embodiment, the suppression of the activity of one or more enzymes involved in the metabolism of said Gram negative bacterium is performed and comprises the deletion of all or part of a gene coding for a protein selected from the group consisting of: PpdK (SEQ ID NO: 23), Mae (SEQ ID NO: 24), Fba (SEQ ID NO: 25), Erya (SEQ ID NO: 26), and Rpib (SEQ ID NO: 27). In another embodiment, the suppression of the activity of an enzyme involved in the metabolism of said Gram negative bacterium is performed and comprises the deletion of the gene coding for enzyme Ppdk (SEQ ID NO: 23).

In another embodiment, the Gram negative bacterium is selected from the group consisting of:

- B. abortus S79-wbdRAwbkC: corresponds to the B. abortus S19 strain which lacks the autologous wbkC gene coding for N-formyltransferase and comprises a heterologous wbdR gene coding for the N- acetyltransferase; B.melitensis Rev1- wbdRAwbkC: corresponds to the B. melitensis Rev1 strain which lacks the autologous wbkC gene coding for N- formyltransferase and comprises a heterologous wbdR gene coding for the N-acetyltransferase;

B.melitensis Rev2-wbdRAwbkC: corresponds to the B. melitensis Rev2 strain which lacks the autologous wbkC gene coding for N- formyltransferase and comprises a heterologous wbdR gene coding for the N-acetyltransferase;

B. aborfus-wbdRAwbkC: corresponds to a B. abortus strain which lacks the autologous wbkC gene coding for N-formyltransferase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase;

B. aborfus-AwadCwbdRAwbkC: corresponds to a B. abortus strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous wadC gene coding for mannosyl transferase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase;

B. aborfus-AppdKwbdRAwbkC: corresponds to a B. abortus strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous ppdK gene coding for phosphoenolpyruvate dikinase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase;

B. aboffus-AwadCAppdKwbdRAwbkC: corresponds to a B. abortus strain which lacks the autologous wbkC gene coding for N- formyltransferase, the autologous wadC gene coding for mannosyl transferase, and the autologous ppdK gene coding for

phosphoenolpyruvate dikinase, and comprises a heterologous wbdR gene coding for the N-acetyltransferase;

B. aboffus-AwznnwbdRAwbkC: corresponds to a B. abortus strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous wzm gene coding for the ABC transporter, and comprises a heterologous wbdR gene coding for the N- acetyltransferase; - B. me//iens/s-wbdRAwbkC: corresponds to a B. melitensis strain which lacks the autologous wbkC gene coding for N-formyltransferase gene, and comprises a heterologous wbdR gene coding for the N- acetyltransferase; - B. me//iens/s-AwadCwbdRAwbkC: corresponds to a B. melitensis strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous wadC gene coding for a mannosyl transferase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase;

- B. /77e//tens/s-AppdKwbdRAwbkC: corresponds to a B. melitensis strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous wadC gene coding for mannosyl transferase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase;

- B. /77e//tens/s-AwadCAppdKwbdRAwbkC: corresponds to a B.

melitensis strain which lacks the autologous wbkC gene coding for N- formyltransferase, the autologous wadC gene coding for a mannosyl transferase, and the autologous ppdK gene coding for a

phosphoenolpyruvate dikinase; and comprises a heterologous wbdR gene coding for the N-acetyltransferase;

- B. me//iens/s-AwzmwbdRAwbkC: corresponds to a B. melitensis strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous wzm gene coding for the ABC transporter, and comprises a heterologous wbdR gene coding for the N- acetyltransferase; - B. su/s-AwadCwbdRAwbkC: corresponds to a B. suis strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous wadC gene coding for a mannosyl transferase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase;

B. su/s-wbdRAwbkC: corresponds to a B. suis strain which lacks the autologous wbkC gene coding for N-formyltransferase and comprises a heterologous wbdR gene coding for the N-acetyltransferase;

B.su/s-AppdKwbdRAwbkC: corresponds to a B. suis strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous ppdK gene coding for phosphoenolpyruvate dikinase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase;

B. su/s-AwadCAppdKwbdRAwbkC: corresponds to a B. suis strain which lacks the autologous wbkC gene coding for N-formyltransferase wbkC, the autologous wadC gene coding for a mannosyl transferase, and the autologous ppdK gene coding for a phosphoenolpyruvate dikinase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase;

B. su/s-AwzmwbdRAwbkC: corresponds to a B. suis strain which lacks the autologous wbkC gene coding for N-formyltransferase and the autologous wzm gene coding for the ABC transporter and comprises a heterologous wbdR gene coding for the N-acetyltransferase;

B. suis Tn7wbdRAwbkC: corresponds to a B. suis strain which lacks the autologous wbkC gene coding for N-formyltransferase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase, and the miniTn7 transposon;

B. abortus- 7n7wbdRAwbkC: corresponds to a B. abortus strain which lacks the autologous wbkC gene coding for N-formyltransferase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase, and the miniTn7 transposon; and

B. melitensis-Tn 7wbdRAwbkC: corresponds to a B. melitensis strain which lacks the autologous wbkC gene coding for N-formyltransferase, and comprises a heterologous wbdR gene coding for the N- acetyltransferase, and the miniTn7 transposon.

Followed gene nomenclature is described in Reeves, P. R. et al., "Bacterial polysaccharide synthesis and gene nomenclature", 1996, Trends Microbiol, vol. 4, pages 495-503, and specific gene names correspond to those registered in the Bacterial Polysaccharide Gene Database (BPGD;

http://sydney.edu.au/science/molecular_bioscience/BPGD/) In the above list, the strains referred as "B. abortus", "B. suis", and "B.

melitensis" correspond to the wild-type strains.

B. abortus S19 and B. melitensis Rev1 are vaccines (described in Nicoletti P.L: et al., 1990, and Elberg and Fraunce, 1957, respectively) that are currently marketed and are available in authorized brucellosis laboratories and culture collections worldwide. B. melitensis Rev2 is obtained as described by Mancilla, M., et al., "Deletion of the GI-2 integrase and the wbkA flanking transposase improves the stability of Brucella melitensis Rev 1 vaccine", Vet. Res., vol. 44, pages1-12.

In another embodiment, the strain of the first aspect of the invention is selected from the group consisting of:

- B. abortus- 7n7wbdRAwbkC: corresponds to a B. abortus strain which lacks the autologous wbkC gene coding for N-formyltransferase, and comprises the heterologous wbdR gene coding for the N- acetyltransferase, and the miniTn7 transposon;

- B. me/Ztens/s- 7n7wbdRAwbkC: corresponds to a B. melitensis strain which lacks the autologous wbkC gene coding for N-formyltransferase, and comprises the heterologous wbdR gene coding for the N- acetyltransferase, and the miniTn7 transposon;

- B. aboffus-wbdRAwbkC: corresponds to a B. abortus strain which lacks the autologous wbkC gene coding for N-formyltransferase, and comprises the heterologous wbdR gene coding for the N- acetyltransferase; and - B. me//tens/s-wbdRAwbkC: corresponds to a B. melitensis strain which lacks the autologous wbkC gene coding for N-formyltransferase, and comprises the heterologous wbdR gene coding for the N- acetyltransferase.

In another embodiment, the N-acetyltransferase gene of the strains referred in any of the previous lists is from E. coli 0157:H7. In a second aspect, the present invention provides a process for preparing the bacterium strain of the first aspect of the invention.

In one embodiment of the process of the second aspect of the invention, the step of suppressing the autologous N-formyltransferase activity comprises suppressing the expression of the autologous gene. Thus, in an embodiment of the second aspect the process comprises, in any order, the steps of:

- suppressing the expression of the autologous gene coding for the N- formyltransferase enzyme; and

- including a functional heterologous gene coding for a N-acyltransferase other than a N-formyltransferase.

In one embodiment of the second aspect of the invention the step of suppression of the expression of the autologous gene is due to a mutation, the mutation negatively affecting the ability of transcribing its mRNA, the translation to the protein or the activity of the enzyme. Protocols for performing these methods are well-known for the skilled in the art (Sambrook, J. and Russell, D. W. (2001 ). Molecular cloning. Chapter 13, Mutagenesis, pages 13.1 to 13.62, Cold spring harbor laboratory press New York).

Alternatively, the absence of autologous N-formyltransferase activity is caused by the deletion of part or the entire autologous gene coding for the N- fomyltransferase enzyme. Thus, in another embodiment of the second aspect, the method comprises, in any order, the steps of: - deleting all or part of the autologous gene coding for N- formyltransferase enzyme; and

- including a functional heterologous gene coding for a N-acyltransferase other than a N-formyltransferase.

In the present invention, the expression "deletion of part of the autologous gene coding for the N-formyltransferase enzyme", means that the modified bacterium of the invention lacks a region of the gene responsible for its transcription to RNA or its translation to protein. In the present invention, the deletion of part of the gene, means that about 1 to 99% of the whole sequence of the gene is deleted. In one embodiment, the deletion of part of the gene means that about 20-95% of the whole gene sequence is deleted.

In another embodiment of the process of the second aspect of the invention, the step of suppressing the autologous N-formyltransferase activity comprises the complete deletion of the autologous gene. There are well-known techniques for deleting the autologous gene (Sambrook, J. and Russell, D. W. (2001 ). Chapter 13. Mutagenesis. Pagesl 3.1 -13.62. Molecular cloning. Cold spring harbor laboratory press New York), such as the one disclosed by Conde-Alvarez R. et al., 2006. Briefly, the autologous gene is replaced by a mutated gene with an internal deletion. Replacement of the wild type gene for the mutated gene takes place by homologous recombination. As it is explained below, the inventors achieved the deletion of the gene performing, in first step, a PCR overlap strategy. The skilled person can design the appropriate pairs of primers and conditions for performing the PCR on the basis of the gene sequence and using available bioinformatics tools. In Example section below the inventors designed primers with sequences SEQ ID NO: 1 to 4 for performing the PCR. After that, in a second step, the resulting fragment was cloned in an appropriate vector system. Of course, there are alternative ways for getting the deletion of the autologous gene

(Sambrook, J. and Russell, D. W. (2001 ). Molecular cloning Chapter 13.

Mutagenesis. Pagesl 3.1 -13.62, Cold spring harbor laboratory press New York) that are also encompassed by the present invention. In another embodiment of the process of the second aspect, the step of including the functional heterologous gene comprises transferring an expression construct comprising the functional heterologous gene. The heterologous gene can be included in any appropriate system for the correct expression of the gene without negatively affecting the host. Following well-known techniques such as the transposon site-directed insertion in the host bacterium it is possible to perform the insertion of the heterologous gene. The insertion can be performed using an expression vector derived from mini-Tn7, such as mini-Tn7TpUC18T-Gm (Choi KH et al., 2005; Choi, K.-H. & Schweizer, H. P. (2006)), which drives the insertion of the heterologous gene in the region immediately downstream the stop codon of glms gene. Alternative methods based on the use of other mini-transposons are abundantly described in the literature (for example: Hoang et al. 2000; de Lorenzo et al. 1990 In one embodiment of the second aspect of the invention, the process comprises, in the specified order: (a) including a functional heterologous gene coding for a N-acyltransferase other than a N-formyltransferase; and (b) deleting all or part of the autologous gene coding for N-formyltransferase enzyme. In another embodiment of the second aspect the process comprises the following steps in the specified order: (1 ) including the functional heterologous gene coding for a N-acetyltransferase enzyme; and (2) deleting part or the entire autologous N-formyltransferase gene.

All the embodiments provided above for the first aspect of the invention, concerning the heterologous gene and the autologous gene, are also embodiments of the process of the second aspect of the invention.

In a fourth aspect the present invention provides a method for preparing an extract from the bacterium of the invention. The method comprises a step of cell lysis. The cell envelope can be broken by viral, enzymatic, physical or osmotic mechanisms. It is well-established which conditions can be used to lyse one cell. The skilled person, therefore, can routinely adjust the most appropriate conditions to lyse the bacterium cell of the invention. In a fifth aspect, the present invention provides an antibody against the bacterium strain as defined in the first or third aspect of the invention. There are well known means in the state of the art for preparing and

characterizing antibodies. Methods for generating polyclonal antibodies are well known in the prior art. Briefly, one prepares polyclonal antibodies by immunizing an animal with the bacterium of the first or third aspect of the invention; then, serum from the immunized animal is collected and the antibodies isolated. A wide range of animal species can be used for the production of the antiserum. Typically the animal used for production of antisera can be a rabbit, mouse, rat, hamster, guinea pig or goat. Moreover, monoclonal antibodies (MAbs) can be prepared using well-known techniques. Typically, the procedure involves immunizing a suitable animal with the bacterium of the first or third aspect of the invention. The immunizing composition can be administered in an amount effective to stimulate antibody producing cells. Methods for preparing monoclonal antibodies are initiated generally following the same lines as the polyclonal antibody preparation. The immunogen (bacterium) is injected into animals as antigen. The antigen may be mixed with adjuvants such as complete or incomplete Freund's adjuvant. At intervals of two weeks, approximately, the immunization is repeated with the same antigen.

In a further aspect, the present invention provides a pharmaceutical or veterinary composition comprising a therapeutically effective amount of the bacterium as defined in the first or third aspect of the invention or the antibody as defined in the fifth or seventh aspect, or the cell extract of the invention, together with one or more veterinary or pharmaceutically acceptable carriers or vehicles.

The expression "therapeutically effective amount" as used herein, refers to the amount of either the bacterium or antibody that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of the disease which is addressed. The particular dose administered according to this invention will of course be determined by the particular circumstances surrounding the case, including the compound administered, the route of administration, the particular condition being treated, and similar considerations.

In the present invention, the term "pharmaceutically acceptable vehicles or carriers" refers to pharmaceutically acceptable materials, compositions or excipients. Each component must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the pharmaceutical composition. It must also be suitable for use in contact with the tissue or organ of humans and animals without excessive toxicity, irritation, allergic response, immunogenicity or other problems or complications commensurate with a reasonable benefit/risk ratio. Likewise, the term "veterinary acceptable" means suitable for use in contact with a non-human animal. In a tenth aspect, the present invention provides the modified Gram negative bacterium of the first or third aspect of the invention or the antibody of the firth or seventh aspect of the invention or the cell extract of the invention, for use as a medicament. In one embodiment of the tenth aspect of the invention, the medicament is a vaccine.

In the present invention, the term "vaccine", when referred to the

pharmaceutical or veterinary composition, can be understood as a biological agent (either the modified bacterium of the first or third aspect of the invention or the antibody of the fifth or seventh aspect of the invention) capable of providing a protective response in an animal to which the vaccine has been delivered and that is incapable of causing severe disease. The vaccine stimulates antibody production or cellular immunity against the pathogen causing the disease; administration of the vaccine thus results in immunity to the disease.

Illustrative non-limitative examples of excipients commonly present in vaccine preparations are: aluminum salts or gels; oil-based adjuvants; formaldehyde, monosodium glutamate (MSG), or 2-phenoxyethanol, among others.

In further aspects the present invention provide uses of the bacterium or of antibody of the invention or of the cell extract of the invention for the prevention or treatment of an infection caused by a bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium, and for differentiating infected from vaccinated animals. In the present invention, the term "vaccinated animal" means an animal vaccinated with a modified Gram negative bacterium strain encompassing both the strain of the invention as well as other bacterium strains disclosed in the prior art which are modified in its genome. In one embodiment, the animal has been vaccinated with a modified bacterium strains as disclosed, for example, in WO2012131 128. In another embodiment, the animal has been vaccinated with the strain of the present invention. In one embodiment of these

therapeutic and differentiating uses, the modified Gram negative bacterium of the first and third aspect of the invention is of the Brucella genus and the animal is infected with Brucella.

In a further aspect, the present invention provides the use of a modified Gram negative bacterium strain as defined in the first or third aspect of the invention, the antibodies of the fifth or seventh aspect or the cell extract of the invention, for use in diagnostics.

In one embodiment, the present invention provides the use of a modified Gram negative bacterium strain as defined in the first or third aspect of the invention, the antibodies of the fifth or seventh aspect or the cell extract of the invention, for use in diagnosing brucellosis. This embodiment can be alternatively formulated as a method for diagnosing brucellosis, the method comprising contacting an isolated sample from a subject with the modified Gram negative bacterium strain as defined in the first or third aspect of the invention, the antibodies of the fifth or seventh aspect or the cell extract of the invention.

In a further aspect the present invention provides the use of the bacterium or of antibody of the invention or of the cell extract of the invention for

differentiating animals vaccinated with the strain of the invention from the animals infected with a a bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium.

In a further aspect the present invention provides an in vitro method for differentiating an animal vaccinated with the modified Gram negative bacterium strain as defined in the first or third aspect of the invention from an animal infected by a bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium, the process comprising the step of determining, in an isolated sample: (a) the presence of the modified Gram negative bacterium strain as defined in the first or third aspect of the invention (by culture or direct detection with specific

antibodies, [for example, by immunofluorescence), and/or (b) the presence of an antibody of the fifth or seventh aspect of the invention (by immunoassays such as agglutination, immunoprecipitation, or immunoenzymatic methods), and/or (c) the presence of heterologous gene and the absence of the N- formyltransferase activity (by DNA hybridization, PCR, or PCR-related methods); wherein either (a) and/or (b) and/or (c) is indicative that the animal has been vaccinated and that there is not any infection. In one embodiment, the modified Gram negative bacterium strain as defined in the first or third aspect is of the genus Brucella, and the animal is infected by Brucella.

The strain and antibodies of the invention are useful as reagents in

immunoassays to detect antibodies against the bacterium strain, such as a wild-type bacterium strain, belonging to the same genus as the modified bacterium.

The immunoassay procedures suitable include enzyme-linked immunosorbent assays (ELISA), enzyme immunodot assay, agglutination assay, antibody- antigen-antibody sandwich assay, antigen-antibody-antigen sandwich assay, immunocromatography or other immunoassay formats well-known to the ordinarily skilled artisan. These immunoassay formats and procedures have been described in many standard immunology manuals and texts. The preferred immunoassay formats are ELISA, agglutinations, such as a plaque- agglutination assay or a tube-agglutination assay, the most preferred tests are

ELISA and agglutination tests.

The immunochromatography tests are based on the immunological capture of antibodies against acetyl group. The LPS (or O-chain) of the modified Gram negative bacterium will be adsorbed to a chromatographic strip on which serum components and anti-immunoglobulin conjugate (usually colloidal gold) are developed.

In one embodiment, the in vitro immunoassay method comprises the step of coating a solid phase with:

(a) the modified Gram negative bacterium as defined in the first or third aspect of the invention or a cell extract thereof; or

(b) the wild-type bacterium strain that causes the disease or a variant thereof that retains the autologous N-formyltransferase activity; or a cell extract of the invention.

It is well-known in the state of the art how bacterial cells, cell extracts, and antibodies can be adsorbed on the surface of the solid phase

(http://www.protocol-online.org/prot/lmmunology/ELISA/). In another embodiment, the immunoassay method is selected from ELISA, plaque-agglutination assay, tube-agglutination assay, and

immunochromatography. In yet another embodiment, the immunoassay method is an ELISA or an agglutination test. Another aspect of the present invention is directed to a kit for differentiating an animal vaccinated with the modified bacterium of the invention or the antibody of the invention or the cell extract of the invention from one having the disease. In this way, the kit can comprise one or more of the following: - the modified bacterium of the first or third aspect of the invention;

- the antibodies of the fifth or seventh aspect of the invention;

- the cell extract of the invention;

- the bacterium, such as a wild-type bacterium, causing the infection;or a cell extract thereof;

- the antibodies raised during the infection process; and

- means for detecting the presence of the heterologous gene and the absence of the autologous gene.

When analyzing the sample of the animal with a kit comprising the modified bacterium or the antibodies of the invention or the cell extract of the invention, there will be binding reaction if the animal is vaccinated (positive reaction). If the kit comprises the wild-type bacterium or the antibodies raised by the wild- type bacterium or the cell extract of the wild-type bacterium, there will not be binding reaction (negative reaction) if the animal is vaccinated with the modified bacterium or the antibodies of the invention. And if it is detected the presence of the heterologous gene and the absence of the autologous gene, this will be indicative of the fact that the animal is vaccinated. The means for detecting the presence of the heterologous gene and the absence of the autologous gene can be primers specially designed for amplifying the target sequences. In one embodiment, the primers have sequences flanking the deleted or inserted genes, such as primers wbkC-F (SEQ ID NO: 1 ) and wbkC-R (SEQ ID NO: 4) for the wbkC deletion (which amplify a fragment of 827 bp in the mutant and a fragment of 1373 bp in the parental strain) and primers wbdR Fw: (SEQ ID NO: 5) and wbdR Rv: (SEQ ID NO: 6) for the wbdR insertion (which amplify a 1000 bp fragment).

The kit of the invention can be compartmentalized to receive a first container adapted to contain each one of the components, including the modified bacterium of the invention or a cell extract thereof or an antibody against it. Preferably the kit of this invention is an ELISA or an agglutination test kit for detecting of antibodies and thereby differentiating an animal infected by a wild-type bacterium strain belonging to the same genus as the modified bacterium. For an ELISA test kit, the kit contains (a) a container (e.g., a 96- well plate) having a solid phase coated with (i) the modified Gram negative bacterium of the first or third aspect, or a cell extract thereof; or (b) the wild- type bacterium strain which causes the infection disease or a variant thereof which retains the autologous N-formyltransferase activity, or cell extract thereof; (b) a negative control sample; (c) a positive control sample; and (d) specimen diluent. For an agglutination test, the kit comprises (a) a test card or microscope slide, (b) the bacterium strain of the invention as agglutinating agent and (c) means for visual detection (latex particles, gelatin beads, colloidal particles, among others) as separate components.

To use the kits of the present invention, a sample of body fluid to be tested, diluted in sample diluent if necessary, is placed in contact with the modified bacterium of the first or third aspect of the invention, or a cell extract thereof, on a coated solid phase for a time and under conditions for any antibodies present in the body fluid to bind to the modified bacterium of the first or third aspect of the invention, or a cell extract thereof. After removal of unbound material (e.g., by washing with phosphate buffered saline), the secondary complex is contacted with labeled antibodies to species-specific IgG or labeled protein A, protein G, or protein A G. These antibodies or proteins A, G or A/G bind to the secondary complex to form a tertiary complex and, since the second antibodies or proteins A, or G or A G are labeled with a reporter molecule, when subjected to a detecting means, the tertiary complex is detected. The reporter molecule can be an enzyme, radioisotope, fluorophore, bioluminescent molecule, chemiluminescent molecule, biotin, avidin, streptavidin or the like. For ELISA the reporter molecule is preferably an enzyme.

With the agglutination test, a suspension of the bacterial strain of the invention is contacted with an isolated test serum sample of the animal. If the animal has been vaccinated with the strain of the invention, agglutination will be detected, whereas if the animal is infected, no agglutination will be detected.

In one embodiment of these uses of the kits of the invention, the modified Gram negative bacterium of the first and third aspect of the invention is of the genus Brucella and the animal is infected with Brucella.

In further aspects the present invention provide an in vitro method of differentiating an animal vaccinated with a modified Brucella strain from one infected with Brucella, as well as the use of the bacterium of the invention or the kit of the invention for performing the differentiation between an animal vaccinated with a modified Brucella strain from an animal infected with

Brucella. In the present invention, the term "vaccinated with a modified

Brucella strain" encompasses both the strain of the invention as well as other Brucella strains disclosed in the prior art which are modified in its genome and show a protective effect. Modified Brucella strains are disclosed, for example, in WO2012131 128.

Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise" encompasses the case of "consisting of. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples and drawings are provided by way of illustration, and they are not intended to be limiting of the present invention. Reference signs related to drawings and placed in parentheses in a claim, are solely for attempting to increase the intelligibility of the claim, and shall not be construed as limiting the scope of the claim. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.

EXAMPLES

1 . MATERIAL AND METHODS 1 .1 . Bacterial growth conditions

The bacterial strains and plasmids are described in the sections below.

Bacteria were routinely grown in standard tryptic soy broth or agar either plain or supplemented with anamycin at 50 pg/ml, or/and A/a/idixic at 25 pg/ml, chloramphenicol at 20 g/ml or/and 5% sucrose. All strains were stored in skim milk at -80°C.

1 .2. DNA manipulations

But for the specific details and references given below, the skilled person can routinely adjust the conditions for manipulating the materials described.

Plasmid and chromosomal DNA were extracted with Qiaprep spin Miniprep (Qiagen GmbH, Hilden, Germany), and Ultradean Microbial DNA Isolation kit

(Mo Bio Laboratories) respectively. When needed, DNA was purified from agarose gels using Qiack Gel extraction kit (Qiagen). DNA sequencing was performed by the Servicio de Secuenciacion de CIMA (Centra de

Investigacion Medica Aplicada, Pamplona, Spain). Primers were synthesized by Sigma-Genosys Ltd. (Haverhill, United Kingdom).

1 .3. Construction of the B. abortus wbkC non polar mutant (BaAwbkC) wbkC = BAB1_0540 In-frame deletion mutant BaAwbkC was constructed by PCR overlap using genomic DNA of B. abortus 2308 as DNA template. B. abortus 2308 is a reference strain available in authorized brucellosis laboratories worldwide and culture collections, including the "Culture Colection of the Department of Microbiology, University of Navarra" . Primers were designed based on the available sequence of the corresponding genes in B. abortus 2308. For the construction of the wbkC mutant, we first generated two PCR fragments: oligonucleotides wbkC-F {5 ^' - AGGTGGCGACAAACGAATAA -3 ^' ; SEQ ID NO: 1 ) and wbkC-R2 (5 ^' -GCCCATGCCAATCAAGGT -3 ^' ; SEQ ID NO: 2) which were used to amplify a 393-bp fragment including codons 1 to 29 of the wbkC ORF, as well as 306 bp upstream of the wbkC start codon, and oligonucleotides wbkC -F3 (5 ^' -

ACCTTGATTGGCATGGGCAGATGGTCGGAAGTCCAGATT - 3'; SEQ ID NO: 3) and wbkC -R4 (5 ^' - TCTGAACTCGGCTGGATGAC -3 ^' ; SEQ ID NO: 4) were used to amplify a 434-bp fragment including codons 212 to 259 of the wbkC ORF and 287-bp downstream of the wbkC stop codon.

Both fragments were ligated by overlapping PCR using oligonucleotides wbkC -F1 (SEQ ID NO: 1 ) and wbkC -R4 (SEQ ID NO: 4) for amplification, and the complementary regions between wbkC -R2 (SEQ ID NO: 2) and wbkC -F3 (SEQ ID NO: 3) for overlapping. Using these sequences, the skilled person can routinely adjust other PCR conditions. Components are precisely described in Choi and Schweizer (2006).

Typical conditions for PCR amplification are:

Cycle number Denaturation Annealing Extension

1 95°C, 5 min. none none

2-30 95°C, 45 sec 59°C, 30 sec 72°C, 20 sec

31 72°C, 10 min

The resulting fragment, containing the wbkC deletion allele, was cloned into pCR2.1 (Invitrogen), to generate plasmid pCRAwbkC, sequenced to ensure the maintenance of the reading frame, and subsequently su-bcloned into the BamHI and the Xbal sites of the suicide plasmid pJQK (Scupham AJ et al. (1997) Gene 202: 53-59) to obtain plasmid pJQKAwbkC. The resulting mutator plasmid pJQKAwi / C was introduced in B. abortus 2308 by

conjugation. The first recombination (integration of the suicide vector in the chromosome) was selected by Nal and Kan resistance, and the second recombination (excision of the mutator plasmid leading to construction of the mutant by allelic exchange), was selected by Nal and sucrose resistance and Kan sensitivity (Conde-Alvarez et al. 2006).

The resulting colonies were screened by PCR with primers wbkC-F (SEQ ID NO: 1 ) and wbkC-RA (SEQ ID NO: 4) which amplify a fragment of 827 bp in the mutant and a fragment of 1373 bp in the parental strain. The mutant was called BaAwbkC. Typical conditions are those described above.

1 .4. Construction of Ba ::Tn7 wbc/f?

Gene wbdR (NCBI Reference Sequence: WP_001055391 .1 Gl:446978135) encoding a perosamine acetyltransferase (SEQ ID NO: 15) with the region upstream containing its promoter was amplified from E. coli 0157:H7 using primers wbdR Fw: 5 ^' TTCCCCGGGGGAGAAGTTCGCCACAGTAAATCGAA 3 ^' (SEQ ID NO: 5) and wbdR Rv: 5 ^'

TTCCCC GG G G G ATTAAATAGATGTTG GCG ATCTT 3 ^' (SEQ ID NO: 6), and cloned in pGEM-T Easy (Promega) to give pGEM-Pwi c/R.

The construction was verified by sequencing. Then, it was digested with EcoRI and the EcoRI fragment of pGEM-Pwi c/R containing wbdR and its promoter was subcloned in the corresponding site of pUC18R6KT- miniTn7TKmR (Llobet et al., "Klebsiella pneumoniae OmpA confers resistance to antimicrobial peptides", 2009, Antimicrob. Agents Chemother., 53(1 ), pages

298-302) to obtain pUC18R6KT-miniTn7T-KmR-Pwi c/R.

The miniTn7 vector carrying wbdR with its own promoter was inserted in B. abortus 2308 (Ba-parental) chromosome using a method previously described by Choi and Schweizer (2006) with some modifications. To adapt the protocol to Brucella we first introduced pUC18R6KT-miniTn7T-KmR-Pwi c/R in E. coli S17.1 Apir. The resulting plasmid was then transferred to Brucella strain using a four-parental mating among E. coli S17.1 Apir (pUC18R6KT-miniTn7T-KmR- PwbdR), E. coli HB101 (pRK2013), E. coli SM10 Apir (pTNS2) and Ba- parental (all these E. coli strains are commercially available) (Conde-Alvarez R. et al., 2006). The resulting strain was called Ba ::Tn7 wi c/R. The correct insertion of the transposon between genes glmS and recG and the orientation of the mini-Tn7 were checked by PCR using the following pairs of primers: (i) GlmS_B (5 ^' GTCCTTATGGGAACGGACGT 3 ^' ) (SEQ ID NO: 7) and TN7-R (5 ^' CACAGCATAACTGGACTGATT 3 ^' ) (SEQ ID NO: 8) that detect the upstream of the mini-Tn7 insertion; (ii) TN7-L (5 ^'

ATTAGCTTACGACGCTACACCC 3 ^' ) (SEQ ID NO: 9) and RecG (5 ^'

TATATTCTGGCGAGCGATCC 3 ^' ) (SEQ ID NO: 10) that detect the downstream of the mini-Tn7 insertion; and (iii) GlmS_B (SEQ ID NO: 7) and RecG (SEQ ID NO: 10) that only amplifies the intergenic region in the absence of the mini-Tn7. The presence of only one copy of the mini-Tn7 was determined by Southern-blot.

Strain Ba::Tn7wi c/R is resistant to kanamycin (Km). To avoid antibiotic resistance a non-polar mutant in the gene encoding Kanamycin resistance was constructed using a PCR overlap. Two PCR fragments were firstly generated: oligonucleotides Km-F1 (5 ^' - AGGAAGCGGAACACGTAGAA-3 ^' ; SEQ ID NO: 1 1 ) and Km-R2 (5 ^' -AATCATGCGAAACGATCCTC -3 ^' ; SEQ ID NO: 12) were used to amplify a 318-bp fragment including codons 1 to 2 of the Km ORF, as well as 312 bp upstream of the Km start codon, and

oligonucleotides Km -F3 (5 ^' -

GAGGATCGTTTCGCATGATTTTCTTCTGAGCGGGACTCTG-- 3'; SEQ ID NO:13) and Km -R4 (5 ^' -TGGTCCATATGAATATCCTCCTTA -3 ^' ; SEQ ID NO:14) were used to amplify a 268-bp fragment including codons 262 to 264 of the Km ORF and 256-bp downstream of the Km stop codon.

Both fragments were ligated by overlapping PCR using oligonucleotides Km - F1 (SEQ ID NO: 1 1 ) and Km -R4 (SEQ ID NO: 14) for amplification, and the complementary regions between Km -R2 (SEQ ID NO: 12) and Km -F3 (SEQ ID NO: 13) for overlapping.

The resulting fragment, containing the Km deletion allele, was cloned into pCR2.1 (Invitrogen), to generate plasmid pCRAKm, sequenced to ensure the maintenance of the reading frame, and subsequently subcloned into the EcoRI site of the suicide plasmid pNPTS138-Cm (Addgene) to generate plasmid pNPTS CmAKm. This suicide plasmid was used to delete the kanamycin gene of Ba ::Tn7 wi c/R using the allelic exchange by double recombination described above for wbkC mutation. Deletion of Km resistance gene was checked with oligonucleotides Km-F1 (SEQ ID NO: 1 1 ) and Km-R4 (SEQ ID NO: 14). Sensitivity to km was confirmed by plating

Ba::Tn7wi c/RAKm in km containing plates. The resulting strain was called Ba::Tn7w c/RAKm.

1 .5. Construction of Ba..Tn7 wbdRAwbkC

To construct Ba::Tn7 wbdRAwbkC, the mutator plasmid pJQKAwbkC (obtained as disclosed above) was introduced into strain Ba::Tn7w c/RAKm. After allelic exchange, the double mutant was selected as described above using primers wbkC-n (SEQ ID NO: 1 ) and wbkC-RA (SEQ ID NO: 4).

1 .6. Mutant characterization

- Smooth/ rough morphology

Smooth/ rough morphology was studied by the crystal violet dye exclusion and acriflavine agglutination as described by Alton et al. (Alton GG, Jones LM, Angus RD, Verger JM (1988) Techniques for the brucellosis laboratory. Paris, France: INRA, pages 40-42).

- LPS extraction

Total S-LPS was obtained by methanol precipitation of the phenol phase of a phenol-water extract (Leong, D et al 1970). This fraction (10 mg/ml in 175 mM NaCI, 0.05% NaN3, 0.1 M Tris-HCI [pH 7.0]) was then purified by digestion with nucleases (50 μg/ml each of DNase-ll type V, and RNase [Sigma, St. Louis, Missouri, U.S.A.] 30 min at 37 °C) and three times with proteinase K (Sigma, 50 μς/ιτιΙ, 3 hours at 55°C), and ultracentrifuged (6h, 100,000 x g) (Velasco et al 2000).

1 .7. Assay in mice

Female BALB/c mice (Charles River, France) were kept in cages with water and food ad libitum, and accommodated under P3 biosafety containment conditions 2 weeks before and during the experiments, in the facilities of the "CIMA" (registration code ES31 2010000132). The animal handling and other procedures were in accordance with the current European (directive

86/609/EEC) and Spanish (RD 53/2013) legislations, supervised by the Animal Welfare Committee of the "University of Navarra", CEEA 045/12 and 134/14 and authorized by the competent authority of "Gobierno de Navarra codigo identificacion 134-14" .

To prepare inocula, tryptic soy agar (TSA) or TSA-Km grown bacteria were harvested, adjusted spectrophotometrically (O.D.600nm =0.170) in 10 mM phosphate buffered saline (pH 6.85) and diluted in the same diluent up to approximately 5 10 ⁵ colony forming units (CFU)/ml_ (exact doses were assessed retrospectively).

For each bacterial strain, five mice were intraperitoneal^ inoculated with 0.1 mL/mouse and the CFU number in spleen was determined at different weeks post-inoculation as described previously. The identity of the spleen isolates was confirmed by PCR. Primers and conditions have been described above. The individual number of CFU/spleen was normalized by logarithmic transformation, and the mean log CFU/spleen values and the standard deviation were calculated for each group of mice (n=5). Statistical

comparisons were performed by a one-way ANOVA followed by the Fisher's

Protected Least Significant Differences (PLSD) tests (Grillo 2006).

Blood was extracted from infected mice by intracardiac puncture 2 and 8 weeks post-infection

1 .8.Agglutination Tests

1 .8.1 Rose Bengal Test (RBT) This agglutination test is based on the capacity of Brucella cells to agglutinate in the presence of specific antibodies present in the serum of infected and /or vaccinated animals. RBT antigen is composed by B. abortus phenol inactivated cells (B. abortus S99, Alton G. G. et al., Techniques for the brucellosis laboratory. Paris, France: INRA; 1988) stained with the colorant Rose Bengal (to facilitate the visualization of the agglutination reaction) and resuspended in citrate buffer (pH=3.65). This test allows the detection of antibodies directed to the N-formyl-perosamine wild type O chain. The test was performed according to Diaz R. et al, 201 1 .

Briefly, 25 ml_ of plain serum were dispensed on a white glossy ceramic tile and mixed with an equal volume of RBT antigen (which is the one also used in Diaz R. et al., 201 1 ) previously equilibrated at room temperature and shaken to resuspend any bacterial sediment) using a toothpick. The tile was then rocked at room temperature for 4 minutes and any visible agglutination and/or the appearance of a typical ring was taken as a positive result. [Alton GG, Jones LM, Angus RD, Verger JM (1988) Techniques for the brucellosis laboratory. Paris, France: INRA]

1 .8.2. Differentiation Infected Vaccinated Agglutination test (DIVAT)

To detect the presence of antibodies (directed) to the epitopes derived of perosamine acetylation, an agglutination test was also performed, similar to the RBT in which the B. abortus cells were substituted by Ba ::

Tn7 wbdRAwbkC cells stained with a mixture of crystal violet and brillant green (Diagnostic procedures and reagents. In Coleman, HA (ed.), Techniques for the laboratory diagnosis and control of communicable diseases. Chapter 12. American Public Health Association Inc., New York. 1963). The stained cells were resuspended in the same buffer used in the RBT comercial test

(pH=3.65). The DIVAT was performed using the same procedure described for the RB test.

1 .9. Rabbit Immune sera preparation

- Specific serum against epitopes related to formyl perosamine and or acetyl- perosamine

2.5 Kg New-Zealand female rabbits (San Bernardo) were kept in cages with water and food ad libitum at CIFA ("Centra de Investigacion en

Farmacobiologia aplicada"; University of Navarra).

Rabbits were immunized following the protocol previously described by Diaz et al., (1967). Briefly, rabbits were inoculated intravenously with 1 mg/ml of Ba-pwbdR cells (Gil-Ramirez, Y. 201 1 . Thesis with the title: Role of ethanolamine-phosphate transferase and a glycosyltransferase in the synthesis of a lipopolysaccharide of Brucella and use of an acetyltransferase for the epitope modification of the O chain, pages 1 19-139. University of Navarra) inactivated with phenol, lyophilized and resuspended in saline. Two and 4 days later, a similar dose was administrated intraperitoneally. Three weeks later the animals were bled and euthanized.

Rabbits were sacrificed according to the Spanish and European

recommendations (RD 1201/2005; directive 86/609/ECC). The protocols were supervised by the Animal Health Care Department of University of Navarra. In order to remove antibodies directed to Ba-parental strain, the pool of sera obtained from rabbits immunized with Ba-pwbdR were incubated with Ba- parental cells for 4 h at room temperature with occasional shaking. Then, the mixture was centrifuged (13200 rpm, 10 min, Eppendorf 5415R centrifuge) the supernatant was incubated again with Ba-parental cells and centrifuged to obtain the absorbed serum. A fraction of this serum was subsequently absorbed with Ba-pwbdR cells following the same procedure.

The same procedure was followed to absorb sera with the different tested Brucella strains.

- The sera of rabbits immunized with E. coli 0157:H7 belongs to the

Department of Microbiology collection.

1 .10. Coagglutination test

The staphylococci were prepared and sensitized with the corresponding antiserum as described by Kronvall (Kronvall, G. "A rapid slide-agglutination method for typing pneumococci by means of specific antibody adsorbed to protein A-containing staphylococci", 1973, J. Med. Microbiol., vol. 6, pages 187-190). Several colonies were resuspended in 25 μΙ saline solution on a glass slide and the suspension was mixed with an equal amount of the sensitized staphylococci.

1 .1 1 . Indirect ELISA

96-well ELISA plates (Thermo scientific) were coated with LPS (2,5 μg/ml) from wild-type (Ba-parental LPS) or (Ba::Tn7wbdRAwbkC-LPS) overnight at 4°C. Plates were then washed extensively with phosphate-buffered saline (PBS)-Tween 20, and incubated with serial dilutions of the sera from immunized rabbit, absorbed or not (see above) at 37°C for 5h. Then, the plates were washed extensively with PBS-Tween 20 and bound antibodies were detected with a protein G- peroxidase-conjugated (Nordic Immunological laboratories, Tilbrug, Netherlands). The reaction was developed with 2,2'- azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS)/H2O2. After 15 min, the plates were analyzed in a microtiter plate reader (Multiescan ex, Thermo electron corporation) at 405 nm

2. RESULTS

2.1 . Introduction of a gene encoding a perosamine acetylase (WbdR) revert the rough phenotype of BaAwbkC to smooth

Analysis of smooth /rough morphology using crystal violet and acriflavine tests (Alton et al 1988) are two classical tests that allow differentiation of smooth Brucella, which are characterized by carrying a complete O-chain LPS, from rough Brucella, which are characterized by having lost the O-chain: smooth Brucella exclude crystal violet and do not agglutinate in acriflavine solution, whereas rough Brucella retain the dye and agglutinate in acriflavine.

BaAwbkC and Ba::Tn7 wbdRAwbkC were grown on TSA and the plates were covered with crystal violet dye. The results showed that BaAwbkC colonies retained crystal violet whereas in the case of classical rough strains,

Ba..Tn7 wbdRAwbkC, colonies excluded the dye and were similar to those of the smooth Ba-parental strain that carry a complete O-chain. Moreover,

BaAwbkC, but not Ba::Tn7 wbdRAwbkC, agglutinated in acriflavine solutions.

These results indicate that in a rough wbkC mutant that lacks the O-chain LPS, the introduction of a gene encoding a perosamine acetylase allows the formation N-acetyl-perosamine and, unexpectedly, its polymerization by the N- formyl-perosamine-specific Brucella glycosyl transferases to form a complete O-chain in the bacterial surface, thus reverting the rough phenotype to smooth. 2.2. The LPS of Ba..Tn7 wbdRAwbkC carry new epitopes related to N-acetyl- perosamine and lacks epitopes related to N-formyl-perosamine 2.2.1 . Coagglutination

The epitopic structure of Ba::Tn 7 wi c/R and Ba..Tn7 wbdRAwbkC was first analyzed by coagglutination with staphylococci sensitized with sera from rabbits immunized with Ba pwbdR (that contain antibodies against N-acetyl and N-formyl perosamine related epitopes), or with the same sera absorbed with either Ba-parental (to remove the N-formyl-perosamine-related antibodies characteristic of infections by wild-type smooth Brucella) or

Ba..Tn7 wbdRAwbkC (to remove antibodies against epitopes related to N- acetyl-perosamine) or with Ba ::Tn7 wi c/R (as a control). Results are

summarized in Table 1 .

Ba::Tn7wi c/R and Bawlnl wbdRAwbkC reacted with sera from rabbits immunized with Ba-pwbdR and with the same sera absorbed with Ba-parental, but not with the sera absorbed with Ba ::Tn7 wi c/R. This indicates that both Ba::Tn7wi c/R and Ba::Tn7 wbdRAwbkC contain new epitope(s) not present in Ba-parental and, as these strains share only the N-acetyl-perosamine residues (not present in Ba-parental), the new epitope(s) are caused by N- acetyl perosamine.

Furthermore, since Ba ::Tn7 wi c/R, but not Ba::Tn7 wbdRAwbkC reacted with sera from rabbits immunized with Ba -pwbdR absorbed with

Ba..Tn7 wbdRAwbkC indicates that the latter lacks the epitopes related to N- formyl-perosamine (characteristic of Ba-parental and still present in Ba- pwbdR). The experiments in Table 1 also show some degree of reactivity of the sera to Ba parental with Ba::Tn7wbdRAwi / C. However, the antibodies involved were removed by absorption with a per mutant. Since this mutant lacks the O-chain and keeps the core oligosaccharide and lipid A of LPS, the absorption removes the antibodies to these last two sections but not against the O chain. Therefore, this result demonstrates (a) that the positive coagglutination with the anti-Ba-parental serum is caused by core-lipid A epitopes, and (b) the lack of cross-reactivity at O chain level between Ba-parental and

Ba::Tn7wbdRAwi / C with the serum to Ba-parental. In summary, the results obtained by coagglutination and absorption shows that the O chain of Ba::Tn7 wbdRAwbkC carries epitope(s) not present in either the wild type (i.e. Ba-parental) or constructs carrying the wbdR gene but not the wbkC deletion. 2.2.2. ELISA

To further confirm the presence of acetyl-perosamine and/or formyl- perosamine derived epitopes, LPS of Ba-parental LPS and

Ba..Tn7 wbdRAwbkC LPS were extracted and purified, and their reactivity was analyzed by ELISA with sera from rabbits immunized with Ba-pwbdR and with the same sera absorbed with either Ba-parental or Ba::Tn7 wbdRAwbkC. The results are shown in FIG. 1 . The two LPSs reacted with sera from rabbits immunized with Ba-pwbdR, and absorption with Ba-parental eliminated the reactivity with Ba parental LPS (Fig. 1 , panel A) but not with Ba Tn7 wbdRdwbkC LPS (Fig. 1 panel B), confirming that the latter LPS carries epitopes not present in wild-type strains and derived from N-acetyl-perosamine. These results are in agreement with those observed in the coagglutination tests.

2.3. Use of Ba::Tn7 wbdRAwbkC in DIVA strategies

2.3.1 . Test DIVA 1 : Agglutination Tests (Rose Bengal and DIVAT)

Mice were inoculated intraperitoneally with 5x10 ⁴ CFU/mouse Ba-parental, Ba::Tn7wi c/R or Ba::Tn7 wbdRAwbkC and bled by intracardiac puncture 2 and 8 weeks after infection. Sera from infected animals were tested in classical RBT and in DIVAT test that use B. abortus wilt type (homopolymer of N- formyl-perosamine) and Ba::Tn7 wbdRAwbkC (homopolymer of N-acetyl- perosamine) as antigen, respectively

Results are summarized in Tables 2 and 3.

Table 2. Results of the rose bengal test for smooth Brucella antibodies in the sera of mice infected with with wild- type or O-chain modified constructs

Table 3

Number of Sera from mice infected with 5xl0 ⁴ CFU of:

positive Ba-parental Ba::Tn7wM/?Aw¾C

2 wpi ^a 8 wpi 2 wpi 8 wpi BT 5/5 5/5 l/5 ^b l/5 ^b DIVAT 0/5 2/5 ^b 5/5 5/5

Number of Sera from mice infected with 5xl0 ⁴ CFU of:

positive Bme-parental Bme: :Tn7 wb RhwbkC

2 wpi ^a 8 wpi 2 wpi 8 wpi

RBT 5/5 5/5 0/5 2/5 ^b DIVAT 0/5 l/5 ^b 5/5 5/5 ^a weeks post infection

b very weak agglutination The results show that, whereas sera from animals infected with wild type strains of either B. abortus or B. melitensis give a strong positive reaction in RBT, sera from animals infected with either Ba::Tn7 wbdRAwbkC or

Bmevln f wbdRAwbkC do not react in the Rose Bengal test. The results also show that wbdR by itself is not enough to abrogate the production of antibodies detected by the test. Significantly, a negative result in this diagnostic test was achieved by the combination wbdRAwbkC in the infecting strain. Thus, the classical Rose Bengal test allows the differentiation of animals infected by wild type B abortus or B. melitensis (O chain = N-formyl- perosamine) from animals vaccinated with new constructs carrying

Tn7 wbdRAwbkC (O chain = N-acetyl-perosamine). Moreover, when

Ba..Tn7 wbdRAwbkC is used as antigen in the AAT agglutination test, all mice infected with Ba::Tn7 wbdRAwbkC or Bme:: Tn7 wbdRAwbkC become positive, while those infected with Ba-parental or Bme-parental are negative (only 3 out of 20 mice give a very weak and not clear agglutination).

2.3.2. Test DIVA 2: ELISA

Sera from mice infected with Ba-parental, or Ba..Tn7 wbdRAwbkC were analyzed by a classical indirect ELISA using plates coated with LPS from Ba- parental strain. As can be seen in FIG. 2, whereas the sera from animals inoculated with the B. abortus wild type strain give a clear positive reaction, sera from animals inoculated with Ba..Tn7 wbdRAwbkC do not react in this test (however, the sera from animals inoculated with Ba ::Tn7 wi c/R still give a weak reaction, (data not shown)). According to these results, the classical indirect ELISA used for brucellosis diagnosis would differentiate animals infected by a field strain (positive reaction) from animals vaccinated with a vaccine genetically modified to express a N-acetyl-perosamine O-chain (i.e. a Tn7 wbdRAwbkC construct).

In addition to the classical indirect ELISAs, such as those available

commercially, a complementary ELISA could be prepared with LPS extracted from Ba..Tn7 wbdR AwbkC. FIG. 2 panel B shows that in such an ELISA the sera from animals infected by field strains give only a very week response, significantly lower than that to Ba..Tn7 wbdRAwbkC, which would unable to differentiate animals vaccinated with the latter constructs.

The same conclusion is reached when the sera of animals inoculated with B. melitensis parental or Bme: :Tn7 wi c/R AwbkC are studied (FIG. 3)

2.3.3. Attenuation of Tn7wbdR AwbkC constructs

To investigate whether biological properties other than those related to the specificity of the LPS antibodies become altered by Tn7wbdR AwbkC, the constructs were analyzed in the mouse model (Grillo et al. 2012). Briefly, animals were inoculated by the intraperitoneal route with 5 x 10 ⁴ CFU/mouse of B. melitensis parental, Bme::Tn7wi c/R or Bmevln fwbdRAwbkC, and the CFU/spleen was determined at 2 and 8 weeks post-inoculation. As can be seen in FIG. 4, Bmevln fwbdRAwbkC carrying a complete LPS with N-acetyl-perosamine was attenuated at weeks 2 and 8 postinoculation. This result was unexpected because Bmevln fwbdRAwbkC carries a complete O-chain LPS, a feature that thus far has been shown to be essential in virulence, but no defect in critical virulence genes. The attenuation is linked to Tn7wbdRAwbkC (i.e. full acetylation and new epitope(s)) and not to the mere presence of wbdR because the single Bme::Tn7wbdR was able to reach the chronic infection phase (i.e. at 8 weeks) at levels similar to those of the Bme parental strain. This not obvious result shows that the Tn7 wbdRAwbkC strategy is useful not only to tag existing vaccines but also to generate attenuation for developing new vaccines. The different bacterial strains prepared and used in the previous sections as well as other modified bacterium strains which can analogously be developed are summarized in Table 3 below.

Table 3. Bacterial strains and plasmiis ¹

Strain/plasmMs Relevant characteristics Reference /Source

Brucella abortus

Ba-parental Nal* spontaneous mutant of strain B. abortus 2308, S- Culture Collection of the Department of

LPS Microbiology, University of Navarra (see

Monreal et al„ 2003)

BaAwbkC Ba-parental wMC^., _! , Construction described in the text

Ba::Tn7w « S, abortus with miniTn? transposon, carrying the Construction described in the text wbdR gene from C. coli, inserted in the chromosome

Ba::Tn7kvbci«A m B. abortus with miniTn? transposon, carrying the Construction described in the text gene from E coll, inserted in the chromosome. It

carries an internal deletion in t e fcanamyctn resistance

gene

arJnlwUm bK Ba- arental kC _M , _n mutant with miniTn? Construction described in the text transposon carrying the wbdR gene from £ call,

inserted in the chromosome. Sensitive to kanamydn

Ba::TnSper Ba-parental harboring the Tn5 inserted in per Culture Collection of the Department of

Microbiology, University of Navarra (see Monreal et al. _» 2003)

Bme-parental B. melitensis 16 Wild ty e, virulent, S-LPS Culture Collection of the Department of

Microbiology, University o Navarra (see Monreal et al., 2003)

Bme::Tn7wW« B. melitensis with miniTn? transposon, carrying the Construction on a B. melitensis 16M wbdR gene from £. col), inserted in the chromosome background as described for its f . abortus

2308 counterpart (this Table)

8. meHensis with miniTn? transposon, carrying the Construction on a 8. melitensis 16M wbdR gene from f. coli, inserted in the chromosome. It background as described for its B. abortus carries an internal deletion in kanamycin resistance 2308 counterpart (this Table) gene

B. melitensis i*iAt _iJ(MU mutant with miniTn? Construction on a B. melitensis 16M transposon, carrying the wbdR gene from £ coli, background as described fo its B. abortus inserted in the chromosome. 2308 counterpart (this Table)

S. abortus S19 Commercially available Oil vaccine strain (Nicoletti.P.l . 1990, Vaccination, p. 283-

299. In K.H.Nielsen and J.R.Duncan (ed.),

Animal Brucellosis, CRC Press, Boca Raton)

Culture Collection of the Department of

Microbiology, University of Navarra (see

Monreal et al., 2003)

S19::ln7wbdR&wbkC S19 WM BM _I I mutant with miniTn? transposon, Construction on a B. abortus 519

carrying the wbdR gene from f. co/f, inserted In the background as described for its B. abortus chromosome. 2308 counterpart (this Table)

B. melkensis Revl Commercial^ available CHE vaccine strain Culture Collection of the Department of

Microbiology, University of Navarra (see

Gonzalez et al. 2008)

Revl wbk _{li 2 i} mutant with miniTn7 transposon, Construction on a B. melitemls Revl carrying the wbdR gene from £, coli, inserted in the background as described for its B. abortus chromosome. 2308 counterpart (this Table)

Ba-parental wadCMn- t Culture Collection o the Department of

Microbiology, University of Navarra (see

Gonzalez et al. 2008) (see Conde- Alvarez et al. 2012).

Ba&wadC wbkC double mutant carrying the wbdR Construction on a BaAwadC background as gene from E. coli, inserted in the chromosome. described for its 0. abortus 2308

counterpart (this Table)

Ba-parental wadC _Mb . p dXu -Ks Construction on a a&wadC background by

PCR overlap (see text) as described in Zuftiga-Ri a et al (2014).

Ba&wadC&ppdK::Tn7wbdRbwbkC Bz&wadChppdK&wbkC triple mutant carrying the Construction on a BaAwadC ppdK

wbdR gene from E. coli, inserted in the chromosome. background as described for its B, abortus

2308 counterpart (this Table)

BmeAwadC Bme- arental wadC^ _M , _xt Construction on a B. melitensis 16M

background as described for its B. abortus 2308 counterpart (this Table)

BmeAwodC&wbkC carryin the wbdR gene from £ co/i, Construction on a BmebwadC background inserted in the chromosome. as described for its B. abortus 2308

counterpart (thi Table)

Bme- parental wedC/ut- * PflffKmf,.»» Construction on a B e&wadC background

as described for Its 8, abortus 2308 counterpart (this Table)

ma&w(HlC ppdKvJn7wlMimwb C Bme&wadCAppdmwbkC triple mutant carrying the Construction on a Bs&wadC&ppdK wbdR gem from £ coll, inserted in the chromosome. background as described for its B. abortus

2308 counterpart {this Table) f. cell

$17-1 Ipir Mating strain with piasmid RP4 inserted into the Culture Collection of the Department of

chromosome Microbiology, University of Navar a (see

Monreal et al., 2003)

Top 10 P F - iaclq Tn 10 (Tetr) mcrA A{mrr-hsdRMS-mcr BC) Commercially available (invitrogen)

SOiacZAMlS .\ 74 recAlalaD139 Δ (ara-leu)7697

galU galK rpsL endAl nupG

HB101 (pR 2013) HB101: F - hsdSIO recAU ara-14 proA2 lacVl galK2 Culture Collection of the Department of rpst20 xyl-5 rntt-1 sup£4 Microbiology. University of Navarra pRK2013: KmR, oriT helper ( provided by prof Schweeer; see Choi

2005).

SM 10 Xpir (pTNS2) SM10 Xpir: th-i thr Seo tonA lac? sup€, recA::RP4-2- Culture Collection of the Department of

Tc:: u KmR ( pir> Microbiology, University of Navarra pTNS2: ApR; helper piasmid encoding the site-specific (provided by prof Schweizer; see Choi TnsASCD Tn7 transposition pathway 2005).

REFERENCES CITED IN THE APPLICATION

Llobet E, et al., "Klebsiella pneumoniae OmpA confers resistance to

antimicrobial peptides", 2009,. Antimicrob Agents Chemother, 53, 298-302.

Choi, K.H. et al., "A Tn7-based broad-range bacterial cloning and expression system", 2005, Nat. Methods, 2, 443^148.

Choi K-H. et al., " Mini-Tn7 insertion in bacteria with single attTn7 sites:

example Pseudomonas aeruginosa", 2006, Nature Protocols, 1 , 153-161 .

Alton GG et al., Techniques for the brucellosis laboratory. Paris, France:

INRA, 1988. Leong D et al., "Some structural and biological properties of Brucella endotoxin", 1970, Infect Immun, 1 , 174-82.

Aragon V. et al., "Characterization of Brucella abortus and Brucella melitensis native haptens as outer membrane O-type polysaccharides independent from the smooth lipopolysaccharide", 1996, J Bacterid. ,178:1070-9.

Reeves, P. R. et al., ""Bacterial polysaccharide synthesis and gene

nomenclature", 1996, Trends Microbiol, 4, 495-503.

Nicoletti, P. L. 1990. Vaccination, p. 283-299. In K.H.Nielsen and J.R.Duncan (ed.), Animal Brucellosis, CRC Press, Boca Raton.

Elberg S.S. et al., "Immunization against Brucella infection. VI. Immunity conferred on goats by a nondependent mutant from a streptomycin-dependent mutant strain of Brucella melitensis", 1957, J. Bacterid., 73, 21 1 -217. Velasco J. et al., "Brucella abortus and its closest phylogenetic relative, Ochrobactrum spp., differ in outer membrane permeability and cationic peptide resistance", 2000, Infect Immun., 68, 3210-3218.

Tsai CM et al.,"A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels", 1982, Anal Biochem. 1 ,1 19(1 ),1 15-1 19. Grillo M.J. et al. "Increases of efficacy as vaccine against Brucella abortus infection in mice by simultaneous inoculation with avirulent smooth bvrS/bvrR and rough wbkA mutants", 2006, Vaccine, 24, 2910-2916.

Grillo, M. J. Et al., "What have we learned from brucellosis in the mouse model?". 2012, Vet Res 43, 1-35.

Diaz R et al., "The Rose Bengal Test in human brucellosis: a neglected test for the diagnosis of a neglected disease", Negl Trop Dis. 19;5:e950.

Diaz R, et al., "Differences between Brucella antigens involved in indirect hemagglutination tests with normal and tanned red blood cells", 1967, J Bacterid., 94(3), 499-505.

Kronvall, G. "A rapid slide-agglutination method for typing pneumococci by means of specific antibody adsorbed to protein A-containing staphylococci", 1973 J. Med. Microbiol. 6:187-190.

Hoang, T. T. et al., "Integration-proficient plasmids for Pseudomonas aeruginosa: site-specific integration and use for engineering of reporter and expression strains" Plasmid, 43, 59-72. de Lorenzo, V. et al., "Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria", J Bacteriol, 1990, 172, 6568-72.

Conde-Alvarez R. et al., "The Lipopolysaccharide Core of Brucella abortus Acts as a Shield Against Innate Immunity Recognition", 2012, Pathog

8:e100267.

Figurski, D.H. et al., "Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans", 1979, Proc. Natl.

Acad. Sci. U.S.A. 76, 1648-1652. Gonzalez, D. et al., "Brucellosis vaccines: Assessment of Brucella melitensis lipopolysaccharide rough mutants defective in core and O-polysaccharide synthesis and export", 2008, PLoS One 3.

Miller, V.L. et al., "A novel suicide vector and its use in construction of insertion nmutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR", 1988, J. Bacteriol. 170: 2575-2583.

Monreal D. et al., "Characterization of Brucella abortus O-polysaccharide and core lipopolysaccharide mutants and demonstration that a complete core is required for rough vaccines to be efficient against Brucella abortus and Brucella ovis in the mouse model", 2003, Infect Immun, 71 , 3261 -3271 .

Sangari F. J. et al, "Mutagenesis of Brucella abortus: comparative efficiency of three transposon delivery systems", 1991 , Microb Pathog, 1 1 : 443-446.

Scupham A. J. et al., "Isolation and characterization of the UDP-glucose 4'- epimerase-encoding gene, galE, from Brucella abortus 2308", 1997, Gene 202: 53-59.

Simon R. et al., "A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria", 1983, Nat Biotechnol, 1 , 784e91 . Zuhiga-Ripa, A. et al., "Brucella abortus depends on pyruvate phosphate dikinase and malic enzyme but not on Fbp and GlpX fructose-1 ,6- bisphosphatases for full virulence in laboratory models", 2014 J Bacteriol 196, 3045-3057.

Diagnostic procedures and reagents. In Coleman, HA (ed.), Techniques for the laboratory diagnosis and control of communicable diseases. Chapter 12.

American Public Health Association Inc., New York. 1963.

Gil-Ramirez, Y. 201 1 . Thesis with the title: Role of ethanolamine-phosphate transferase and a glycosyltransferase in the synthesis of a lipopolysaccharide of Brucella and use of an acetyltransferase for the epitope modification of the O chain, pages 1 19-139. University of Navarra. Moriyon I. et al., "Rough vaccines in animal brucellosis: Structural and genetic basis and present status", 2004, Vet. Res., vol. 35, pages 1-3.

Conde-Alvarez R. et al., "Lipopolysaccharide as a target for brucellosis

5 vaccine design", Microb. Pathog, 2013, vol. 58, pages 29-34.

Conde-Alvarez R. et al., "Synthesis of phosphatidylcholine, a typical eukaryotic phospholipid, is necessary for full virulence of the intracellular bacterial parasite Brucella abortus", Cell Microbiol., 2006, vol. 8, pages 1322- 10 1335.

Alton G. G. et al., Techniques for the brucellosis laboratory. Paris, France: INRA; 1988.

15 Diagnostic procedures and reagents. In Colennan, HA (ed.), Techniques for the laboratory diagnosis and control of communicable diseases. Chapter 12. American Public Health Association Inc., New York. 1963.