-1-

Field Of The Invention The present invention is directed to a murine monoclonal antibody (Mab) OP-G2 which, when added to blood, helps to prevent clotting. The present invention is specifically directed to the use of the monoclonal antibody OP-G2 and derivatives of OP-G2 that incorporate information inherent in its primary amino acid sequence and/or structure. The antibody competes with fibrinogen and other adhesive proteins for RGD recognition site(s) on the platelet membrane glycoprotein (GP) Ilb-IIIa protein.

Description of the Prior Art Background of the Invention Mammalian blood contains small cells known as platelets. In the "resting" phase, platelets circulate freely though blood vessels. They are generally non- adhesive and exhibit little or no interaction with tissue or with other blood cells. However, in the process of hemostasis, i.e., blood stoppage, platelets can be transformed from free floating, resting cells to an activated adhesive and aggregated mass. The transformation is generally in response to an insult to the blood vessel, which requires the aggregation of platelets at the point of damage in order to prevent blood loss.

The activation of blood platelets is generally initiated by a change in the protein structure of the platelet cell surface. This change can be stimulated by exposure of the cell to various blood components, such as adenosine-5'-diphosphate (ADP) , epinephrine, thro bin, collagen or serotonin acting on certain proteins on the platelet cell surface. One such protein in the platelet membrane, glycoprotein (GP) Ilb- Ilia complex, is a noncovalently associated, divalent cation-dependent heterodimer, and a member of the supergene family of adhesive protein receptors called

integrins (Hynes, R.O., 1987, "Integrins: A Family of Cell Surface Receptors," Cell, 48:549-554; Ruoslahti, E. , and M.D. Pierschbacher, 1987, "New Perspectives in Cell Adhesion: RGD and Integrins," Science 238:491- 497) . GPIIb-IIIa serves as a receptor for fibrinogen, von Willebrand factor, fibronectin and other adhesive proteins (Phillips, D.R. , et al. , 1988, "The Platelet Membrane Glycoprotein Ilb-IIIa Complex," Blood, 71:831- 843) . Each of these adhesive proteins contains an Arg- Gly-Asp (RGD) sequence, and the interaction of these proteins with GPIIb-IIIa appears to be mediated, at least in part, by this RGD recognition sequence (Gartner, T.K. , and J.S. Bennett, 1985, "The Tetrapeptide Analogue of the Cell Attachment Site of Fibronectin Inhibits Platelet Aggregation and Fibrinogen Binding to Activated

Platelets," J. Biol . Chem. 260:11891-11894; and Plow, E.F., et al., 1985, "The Effect of Arg-Gly-Asp- Containing Peptides on Fibrinogen and von Willebrand Factor Binding to Platelets," Proc. Natl . Acad. Sci . U.S.A. , 82:8057-8061.)

In comparison to other integrins, GPIIb-IIIa has two unique features. First, GPIIb-IIIa is an activation-dependent receptor. Although it is present on the surface of non-stimulated platelets, its receptor function becomes apparent only after stimulation of platelets with agonists, such as ADP, epinephrine, collagen and thrombin (Bennett, J.S., 1985, "The Platelet-Fibrinogen Interaction," In Platelet Membrane Glycoproteins, J.N. George, A.T. Nurden, and D.R. Phillips, editors, Plenum Press, New York, 193-214) . Little is known, however, about the mechanisms by which this receptor becomes exposed, that is, its conversion from an inert complex to a high affinity receptor. Two hypotheses are that agonists either induce a conformational change in GPIIb-IIIa itself or induce changes in the microenvironment such that a hidden receptor already in the proper conformation becomes

accessible to macromolecular ligandε (Coller, B.S., 1986, "Mechanism(s) of Exposure of the GPIIb/IIIa Complex Receptor for Adhesive Glycoproteins." In Monoclonal Antibodies and Human Blood Platelets. J.L. McGregor, editor, Elsevier, Amsterdam, 93-102).

Second, GPIIb-IIIa is the only integrin that also recognizes an amino acid sequence at the carboxy- ter inus of the fibrinogen γ _A chain (Kloczewiak, M. , et al., 1984, "Platelet Receptor Recognition Site on Human Fibrinogen. Synthesis and Structure-Function

Relationship of Peptides Corresponding to the Carboxy- Terminal Segment of the Chain," Biochemistry 23:1767- 1774) . Although this sequence is not present in the other proteins that bind to GPIIb-IIIa, peptides containing this sequence inhibit fibronectin, von

Willebrand factor, as well as fibrinogen binding to activated platelets (Plow, E.F., et al., 1984, "Evidence That Three Adhesive Proteins Interact With a Common Recognition Site on Activated Platelets." J. Biol . Chem . 259:5388-5391).

The interaction of fibrinogen with the GPIIb- IIIa complex is essential for platelet aggregation, and receptor function becomes apparent only after stimulation with appropriate agonists. Activated GPIIb-IIIa recognizes not only the RGD sequence but also the amino acid sequence at the carboxy-terminus of the fibrinogen γ _A chain, HHLGGAKQAGDV (hereinafter referred to as "H12") .

While the aggregation of activated platelets is indeed necessary to perform many beneficial blood clotting functions, there are instances in which the blood clot can be detrimental and even fatal. It is for these reasons that researchers have been studying ways to prevent the interaction of platelets during the activated stage. It was mentioned previously that GPIIb-IIIa has recognition sites that bind to adhesive proteins, such as fibrinogen. GPIIb-IIIa mediates the binding of

fibrinogen, which is necessary for the aggregation (cohesion) of platelets. Fibrinogen has an arginine- glycine-aspartic acid (RGD) amino acid sequence which is a binding site recognized by Ilb-IIIa. In order to inhibit platelet aggregation, one can block the RGD recognition site of GPIIb-IIIa. This can be done by the introduction of a peptide which competes for the RGD recognition site on GPIIb-IIIa. If it is successful, it will inhibit GPIIb-IIIa from interacting with fibrinogen thus preventing the platelet aggregation phenomenon.

There are a variety of "anti-thrombotic" proteins which will react with GPIIb-IIIa to inhibit fibrinogen-mediated platelet aggregation. Currently, a promising class of anti- thrombotic proteins are in the form of monoclonal antibodies having the proper amino acid sequence for effectively binding to the RGD recognition site of GPIIb- IIIa in order to competitively inhibit fibrinogen binding and, thus, platelet aggregation. Examples of these monoclonal antibodies include AP2, PAC-1 and 7E3.

While these monoclonal antibodies may be effective in certain circumstances, there is a need for an antibody which will effectively competitively bind exclusively to GPIIb-IIIa. Further, there is a need for producing a monoclonal antibody which can also reversibly combine with GPIIb-IIIa, such that the monoclonal antibody may be allowed to dissociate from the GPIIb-IIIa when necessary to permit platelet aggregation. Another problem with monoclonal antibodies presently known are that they may not be specific enough to recognize epitopes precisely at or in very close proximity to the RGD-recognition site of GPIIb-IIIa.

Summary of the Invention

The present invention is directed to a monoclonal antibody or derivative thereof which is

specific for the GPIIb-IIIa complex. The monoclonal antibody, known as OP-G2, binds to GPIIb-IIIa. Its binding ability is inhibited by RGD peptides. With respect to non-activated or resting platelets, OP-G2 has a binding affinity or dissociation constant (Kd) of about 25 nanomolar (nM) . Approximately 50,000 molecules of OP- G2 bind per non-activated platelet. The antibody exhibits roughly a five-fold higher affinity (Kd = 5 nM) for activated platelets. The antibody has been characterized as having an isotype of IgG. _] , kappa.

The monoclonal antibody OP-G2 has several advantages over other known monoclonal antibodies. For example, the differences between OP-G2 and the monoclonal antibody PAC-1 relate to size of the monoclonal antibody, binding efficiency and binding location. The PAC-1 monoclonal antibody is an IgM molecule having a molecular weight of approximately 900,000. On the other hand, OP- G2 is an IgG molecule, which is much smaller having a molecular weight of approximately 150,000. There are certain advantages in using a smaller molecule for therapeutic purposes.

PAC-1, an IgM mAb, shows a most dramatic increase in binding to GPIIb-IIIa on activated platelets compared to nonactivated platelets, although the apparent affinity of PAC-l does not change after thrombin- activation (Shattil, S.J., J.A. Hoxie, M. Cunningham, and L.F. Brass, 1985, "Changes in the Platelet Membrane Glycoprotein Ilb-IIIa Complex During platelet Activation," J. Biol . Chem . 260:11107-11114). In this case, one could argue that the inability of PAC-l to bind to nonactivated platelets is simply a result of physical exclusion of this bulky molecule.

7E3, an IgG mAb, binds equally to nonactivated and ADP-activated platelets after an one hour incubation. However, 7E3 exhibits an enhanced rate of binding following ADP-activation (Coller, B.S., 1985, "A New Murine Monoclonal Antibody Reports an Activation-

Dependent Change in the Conformation and/or Microenvironment of the Platelet Glycoprotein GPIIb-IIIa Complex," J. Clin . Invest. 76:101-108). 7E3 Fab fragments bind more readily to activated platelets than does the intact antibody, while cross-linked multimers bind more slowly (Coller, B.S., 1986, "Mechanism(s) of Exposure of the GPIIb/IIIa Complex Receptor for Adhesive Glycoproteins," Jn Monoclonal Antibodies and Human Blood Platelets, J.I _* . McGregor, editor, Elsevier, Amsterdam, 93-102) . Thus, size-dependent exclusion may contribute to the kinetics of binding of mAbs. The binding of PAC- 1, but not 7E3, is inhibited by RGD peptides.

PAC-l also requires prior activation of GPIIb-IIIa before the PAC-l monoclonal antibody will bind to the glycoprotein. This may have something to do with the larger size of the PAC-l monoclonal antibody. On the other hand, OP-G2 has no requirement for prior activation possibly because it is a smaller molecule.

The location of binding also differs between the two antibodies. It is known that there exists a second site on GPIIb-IIIA which is termed a fibrinogen gamma chain dodecapeptide recognition site. It has been determined that PAC-l is blocked by both the dodecapeptide and the RGD peptide. On the other hand, OP-G2 is only blocked by the RGD peptides.

Another advantage of OP-G2 is its lower affinity compared to other known monoclonal antibodies. For example, OP-G2 has an affinity (Kd) of about 25 nM as opposed to the monoclonal antibody AP2, which has an affinity (Kd) of about 0.5 nM - 1.0 nM.

Further, it has been found that OP-G2 contains, within the amino acid sequence of the variable region of its heavy chain, the tripeptide sequence arginine-tyrosine-aspartic acid (RYD) , which likely mimics the RGD binding sequence. Therefore, if 0P-G2 is present in the blood system, adhesive proteins, like fibrinogen, that contain the RGD peptide cannot bind and

platelet aggregation will not occur. While the same region of the PAC-l heavy chain also contains RYD, the upstream and downstream flanking sequences within the OP- G2 D gene region are different from those of PAC-l. These amino acids differences may contribute to the differences in binding behavior of OP-G2 compared to PAC- 1.

A further advantage is that the OP-G2 monoclonal antibody is easier to remove from GPIIb-IIIa because of its lower affinity relative to other antibodies. Once the GPIIb-IIIa is freed of OP-G2, the platelets can resume clotting. On the other hand, the monoclonal AP2, once bound to GPIIb-IIIa, remains on the platelet surface until the platelet is removed from the circulation.

One proposed use for the monoclonal antibody is as a therapeutic to inhibit thrombosis. Because OP-G2 has a relatively modest affinity, compared to other monoclonal antibodies, it can be bound to GPIIb-IIIa for a set period of time after which it can be removed. It thus serves as a better potential antithrombic agent because it sufficiently inhibits the binding of fibrinogen, but the effect can be reversed. The monoclonal antibody can be placed into an antithrombotic kit containing a sterile package with the monoclonal antibody and a known pharmaceutically acceptable carrier. OP-G2 has another advantage which relates to the current lack of insight into the three-dimensional structure of GPIIb-IIIa. The three-dimensional structure of a protein, like GPIIb-IIIa, can be determined after X- ray crystallography. However, while X-ray crystallo¬ graphy has been used to successfully determine the three- dimensional structure of small or simple proteins, like myoglobin or lysozyme or the thrombin-hirudin complex, very large protein complexes, like GPIIb-IIIa, remain difficult to analyze by this approach. One other class of proteins that has been and can be successfully

analyzed by X-ray crystallography is antibody proteins (immunoglobulins) . Since it is now difficult to resolve the complete 3-D structure of GPIIb-IIIa, it may be possible to ascertain the structure of a portion of GPIIb-IIIa, namely, the portion that functions as the RGD recognition site. Since OP-G2, a protein that can be readily resolved by X-ray crystallography, contains a sequence that acts like RGD, the structure of OP-G2 can help to deduce the structure of that part of GPIIb-IIIa that recognizes and binds to RGD and RGD-containing peptides or proteins, e.g., fibrinogen. In other words, the RGD-recognition region or site of GPIIb-IIIa should be a mirror image of the RGD-like sequence of OP-G2. Once the 3-dimensional shape of 0P-G2 is determined, the corresponding RGD recognition site of GPIIb-IIIa can be inferred.

Another advantage is related to the preceding. OP-G2 is an effective RDG-like ligand whose complete structure (in 3-D) can be determined readily by X-ray crystallography. The complete structure of 0P-G2 represents an effective framework that can then be used to engineer RGD-like ligands which, differ in specificity for different integrins, affinity for a given integrin, and relative efficacy in vivo, taking into consideration such factors as half-life in vivo, target of action, etc.

Further objects, features and advantages of the invention will be apparent from the following detailed description when taken in conjunction with the accompanying drawings.

Brief Description of the Drawings Figure 1 is an indirect immunoprecipitation of platelet surface proteins. The total protein in a Triton X-100 extract of ¹²⁵ I-labeled platelets is illustrated in lane 1. Surface-labeled platelets were incubated with 0P-G2 (lane 2) or nonimmune mouse IgG (lane 3) , washed, then incubated with goat anti-mouse

IgG. The position of MW markers (in Kd) is indicated at the left. Bands corresponding to glycoprotein lb, lib and Ilia are indicated.

Figure 2 is crossed immunoelectrophoresis of Triton X-100-solubilized platelet protein. Depicted are a Coomassie blue-stained gel (A) , and autoradiographs of identical gels wherein the second dimension contained: ¹²⁵ I-OP-G2 (B) ; ^I25 l-Hil-1 (C) ; or ¹²⁵ I-AP3 (D) in the intermediate gel. PMI-1 and AP-3 are murine monoclonal antibodies that bind to GPIIb-IIIa, respectively.

Figure 3 illustrates four graphs showing the effect of OP-G2 Fab fragments on platelet aggregation. Citrated platelet-rich plasma (3 x 10 ⁸ platelets/ml) was preincubated with the indicated concentration (μg/ l) of OP-G2 Fab for 3 min at 37°C with stirring prior to addition (arrow) of ADP (5 μM) , epinephrine (10 μM) , collagen (1 μM) or ristocetin (1.3 mg/ml) . Percent light transmission (ordinate) as a function of time (abscissa) is plotted. Bars indicate one minute. Figure 4 illustrates two graphs showing the inhibition of fibrinogen binding to ADP-activated platelets by 0P-G2 Fab fragments. Figure 4A illustrates suspensions of washed platelets that were preincubated with buffer (o) or OP-G2 Fab fragments at a concentration of 40 μg/ml (•) for 5 min. Various concentrations of

¹²⁵ I-fibrinogen (abscissa) and 10 μM ADP were then added to the suspensions. After an additional 5-min incubation, bound fibrinogen (ordinate) was measured. Figure 4B illustrates double-reciprocal plots of the data from (A) . Figure 5 illustrates two graphs showing the effect of synthetic peptides on OP-G2 and AP2 binding to purified GPIIb-IIIa. Microtiter wells coated with purified GPIIb-IIIa were incubated with 50 μl of a solution containing peptide for 60 min. The concentration of peptide is indicated on the abscissa. Fifty μl of OP-G2 (A) or AP2 (B) was then added to the well, the plates were incubated an additional 60 min, and

the extent of binding of OP-G2 or AP2 was quantitated by addition of alkaline phosphate-conjugated goat anti-mouse IgG and appropriate color development. Absorbance at 405 nm is plotted on the ordinate. o, buffer; t, (+)RGDW; A, CG(+)RGDWGY;τ, YAVTGRGDSPASSK; D, HHLGGAKQAGDV; O, RGEW;

Δ, ALPLGS

Figure 6 illustrates four graphs showing the binding of 0P-G2 to nonactivated and activated platelets, as determined by flow cytometry. The binding of 0P-G2 was detected with FITC-goat anti-mouse IgG. Figure 6A illustrates the binding of nonimmune mouse IgG (40 μg/ml) (open peak) and OP-G2 IgG (40 μg/ml) (solid peak) to nonactivated platelets. Figures 6 B, C, and D illustrate the binding of 0P-G2 IgG (40 μg/ml) (Figure 6B) , 0P-G2 Fab (40 μg/ml) (Figure 6C) , or AP2 IgG (2 μg/ml) (Figure 6D) to nonactivated platelets (open peaks) or thrombin- activated platelets (solid peaks) . Log fluorescence is plotted on the abscissa.

Figure 7 illustrates two graphs showing the binding of ¹²⁵ I-OP-G2 to nonactivated and activated platelets. Figure 7A illustrates various concentrations of ¹²⁵ I-OP-G2 (μg/ml; abscissa) were added to nonactivated (o) and thrombin-activated (§) platelets while the final platelet concentration was maintained at 2.5 x 10 ⁸ /ml. After a 60 min incubation at ambient temperature, bound ¹²⁵ I-OP-G2 was measured (ordinate) . Figure 7B illustrates the analysis of the binding data shown in Figure 7A by the method of Scatchard.

Figure 8 illustrates the sequence of the heavy chain variable gene region of OP-G2 identified as: SEQ ID NO:l. Complimentary-DNA (cDNA) corresponding to the heavy chain variable gene region was obtained using 0P-G2 messenger RNA and the polymerase chain reaction (PCR) . Individual codons are indicated and the deduced amino acid is noted above each codon using the single letter amino acid code. The regions corresponding to the Variable-Heavy (V _H ) gene sequence, the D-gene sequence.

and the J-heavy (J _H ) gene sequence are shown. All three contribute to the total variable domain of the heavy chain. The three regions of hypervariability or complementarity-determining regions (CDR) are also indicated. Within the center of the D gene region is the sequence RYD.

Detailed Description of the Invention We have characterized an IgG monoclonal antibody, 0P-G2, which reacts specifically with the complex formed by GPIIb and GPIIIa and recognizes an epitope on the GPIIb-IIIa complex that is at or in very close proximity to the RGD-recognition site. OP-G2 Fab fragments inhibit fibrinogen-mediated platelet aggregation induced by ADP, epinephrine, collagen and thrombin in a dose-dependent manner, but do not inhibit ristocetin-induced platelet agglutination which involves the interaction of von Willebrand factor with GPIb. OP- G2 Fab fragments competitively inhibit ADP-induced binding of ¹²⁵ I-fibrinogen to washed platelets, and 0P-G2 binding to purified GPIIb-IIIa is inhibited by RGD- containing peptides. Within the sequence of its heavy chain variable domain, OP-G2 contains the tripeptide RYD which likely mimics RGD.

Examples

Monoclonal Antibodies

The murine mAbs OP-G2, AP2 (anti-GPIIb-IIIa complex) and AP3 (anti-GPIIIa) were developed according to the procedures described in Newman, P.J., et al. , 1985, "Quantitation of Membrane Glycoprotein Ilia on Intact Human Platelets Using the Monoclonal Antibody, AP3," Blood 65:227-232; Pidard, D. , 1983, "Interaction of AP2, a Monoclonal Antibody Specific for the Human Platelet Glycoprotein Ilb-IIIa Complex, With Intact Platelets," J. Biol . Chem . 258:12582-12586; and

Tomiyama, Y., 1988, "A New Monoclonal Antibody, OP-G2, Against Platelet Glycoprotein Ilb-IIIa That Induces

Platelet Aggregation," Blood & Vessel 19:257-259, all of which are incorporated herein by reference. PMI-1 (anti- GPIIb heavy chain) (Shadle, P.J., et al., 1984, "Platelet-Collagen Adhesion: Inhibition by a Monoclonal Antibody That Binds Glycoprotein lib," J. Cell Biol .

99:2056-2060) was a gift from Dr. M. Ginsberg (La Jolla, CA) . Monoclonal IgG was purified from ascites fluid by affinity chromatography on Protein A Sepharose CL 4B (Pharmacia, Piscataway, NJ) . Protein concentrations of purified IgG were estimated by absorbance at 280 nm, assuming an E ^1% of 14.3.

Purified IgG was labeled with ¹²⁵ I using the chloramine T method. Free ¹²⁵ I was separated from the sample by filtration through a Biogel P2 column. A specific activity of 400 - 800 cpm/ng IgG was routinely obtained.

For the preparation of OP-G2 Fab fragments, monoclonal IgG was dialyzed against 0.01 M PBS (pH 7.4) and adjusted to a concentration of 4 mg/ml. After adding 10 ml cysteine and 2 mM EDTA, 0P-G2 was digested with mercuripapain (Sigma Chemical Company; St Louis, MO) at a 1:99 ratio of papain to protein for 4 hr at 37°c. The reaction was terminated by adding iodoacetamide to a final concentration of 10 mg/ml. The Fab fragments were separated from Fc fragments and undigested IgG by chromatography on Protein A-Sepharose CL-4B.

Enzyme-Linked Immunosorbent Assay

ELISA was performed as described in Kunicki, T.J., et al., 1990, "Human Monoclonal Autoantibody 2E7 is Specific for a Peptide Sequence of Platelet Glycoprotein lib. Localization of the Epitope to Hb ₂₃ i_ ₂₃₈ with an Immunodominant Trp ₂₃₅ ," J. Autoimmunity (In press), which is incorporated herein by reference. Microtiter wells coated with purified GPIIb-IIIa were incubated with 50 μl of a solution containing peptide for 60 min at ambient temperature. Fifty μl of OP-G2 or AP2 was then added to

the wells, and the plates were incubated an additional 60 min. The wells were washed 6 times with PBS-0.05% Tween, 50 μl of alkaline phosphatase-conjugated goat anti-mouse IgG (1:1000 dilution in PBS-0.05% Tween) was added to each well, and the plates were incubated for 60 min at ambient temperature. The wells were washed 6 times, the substrate (p-nitrophenylphosphate in 100 mM Tris, 100 mM NaCl, 5 mM MgCl ₂ , pH 9.5) was added, and absorbance at 405 nm was recorded.

Experiment 1 Experiment 1 was designed to determine to molecular weights of proteins to which 0P-G2 binds by indirect immunoprecipitation. Indirect immunoprecipitation was performed as described in Tomiyama, Y., et al., 1990, "Identification of the Platelet-Specific Alloantigen, Nak ^a , on Platelet Membrane Glycoprotein IV," Blood 75:684-687, which is incorporated herein by reference, with minor modifications. In brief, eight μg of OP-G2 IgG were incubated with 100 μl ¹²⁵ I-labeled platelet suspension (10 ⁸ platelets per ml) for 60 min at ambient temperature. The platelets were washed three times, and then 10 μl of goat anti-mouse IgG, (Cooper Biomedical Inc. , Malvern, PA) diluted 1:100, was added. After a 60 min incubation, the antibody-sensitized platelets were washed three times and solubilized in 1.2 ml of 0.01 M TBS containing 1% Triton X-100, 2.5 mM KI, 10 mM EDTA and 1 mM PMSF (Sigma) at 4°C. One ml of each radiolabeled platelet lysate was incubated with 50 μl of washed protein A-bearing

Staphylococcus aureus (EcSorb; E«Y Laboratories, San Mateo, CA) for 20 min at 4°C. The S . aureus were then washed five times, and the immune complexes absorbed by S. aureus were subjected to electrophoresis in a 7.5% polyacrylamide slab gel according to the method of

Laemmli, U.K., 1970, "Cleavage of Structural Proteins During the Assembly of the Head of Bacteriophage T4,"

Nature 227:680-685. The gels were dried and subjected to autoradiography.

Reference is now made to Fig. 1, which illustrates that 0P-G2 binds to two radiolabeled proteins having apparent molecular weights of 140 and 92 kD under nonreduced electrophoretic conditions. These proteins correspond to GPIIb and GPIIIa.

Experiment 2 Experiment 2 was designed to further characterize the OP-G2 epitope on GPIIb-IIIa. Triton X- 100-soluble platelet protein was prepared in the presence or absence of 5 mM EDTA and was analyzed by Crossed Immunoelectrophoresis (CIE) employing radiolabeled 0P-G2, PMI-1 or AP3 in the intermediate gel.

CIE was performed as described in Kunicki, T.J. , et al., 1981, "The Formation of Ca ²⁺ -Dependent Com¬ plexes of Platelet Membrane Glycoproteins lib and Ilia in Solution as Determined by Crossed Immunoelectrophoresis," Blood 58:268-278, which is incorporated herein by reference. Briefly, 100 μg of Triton X-100 solubilized platelet protein were electrophoresed at 10 V/cm at 16°C for 75 min in a first dimension gel consisting of 1% agarose dissolved in 38 mM Tris, 0.1 M glycine, 0.5% Triton X-100, pH 8.7. Second dimension electrophoresiε was performed at 2 V/cm for 18 h against an intermediate gel containing 1 x 10 ⁶ cpm of ¹²⁵ I-monoclonal IgG followed by an upper gel containing rabbit anti-whole platelet antibody. Precipitin arcs containing ¹²⁵ I- monoclonal IgG were revealed by autoradiography of the CIE plate.

As illustrated in Fig. 2, autoradiograms of the gels indicate that all of these antibodies bind, as expected, to the GPIIb-IIIa complex. When platelets were solubilized in the presence of 5 mM EDTA, most of the GPIIb-IIIa complex

dissociates into free GPIIb and GPIIIa, as illustrated in Fig. 2D.

Referring now to Fig. 2C, autoradiograms of the gels in which EDTA-treated proteins were analyzed indicate that ¹²⁵ I-PMI-1 bound to the residual GPIIb-IIIa complex and dissociated GPIIb, while ¹²⁵ I-AP3 bound to the residual GPIIb-IIIa complex and dissociated GPIIIa, as illustrated in Fig. 2D.

In contrast, ¹²⁵ I-OP-G2 bound only to the residual GPIIb-IIIa complex as illustrated in Fig. 2B.

Experiment 3 Experiment 3 was performed to determine whether the portion of 0P-G2 that binds to its antigen, i.e., the Fab fragment, inhibits platelet aggregation.

Aggregation was monitored using a model PAT-4 NKK platelet aggregation tracer (Nikou Bioscience Inc. , Tokyo, Japan) at 37°C and a stirring rate of 1000 rp . To prepare platelet-rich plasma (hereinafter also referred to as "PRP") , blood (9 vol) was anticoagulated with 1 vol 3.8% trisodium citrate, centrifuged at 250 g for 10 min, and adjusted to 300,000 platelets/μl by addition of platelet-free plasma. To prepare washed platelets, PRP was obtained from blood (9 vol) anticoagulated with 1 vol ACD-A and washed twice with ringer's citrate dextrose (hereinafter also referred to as "RCD") containing 20 ng/ml of PGE _lf pH 6.5. The platelets were resuspended in 5 mM Hepes, 0.3 mM NaH ₂ P0 , 12 mM NaHC0 ₃ , 5.5 mM glucose, 1 mM MgCl ₂ , 2 mM CaCl , 2 mM KC1, 137 mM NaCl, pH 7.4.

The effect of 0P-G2 Fab fragments or synthetic peptides on platelet aggregation was measured by preincubating the PRP with antibody or peptides for three min at 37°C with stirring before the addition of aggregation-inducing agents. ADP, epinephrine, collagen and ristocetin were used as aggregating agents.

Thrombin, 0.1 u/ml, was added to washed platelet suspension without added fibrinogen.

As illustrated in Fig. 3, 0P-G2 Fab fragments were found to inhibit ADP (5 μM)-, epinephrine (10 μM)- or collagen (1 μg/ml)-induced platelet aggregation in a dose-dependent manner. 0P-G2 Fab fragments also were found to inhibit thrombin-induced platelet aggregation (data not shown) . A slight inhibitory effect of OP-G2 Fab fragments upon ristocetin-induced aggregation was also observed probably reflecting inhibition of secondary, secretion-dependent aggregation.

When PRP was preincubated with 5 mM EDTA for 2 min, 0P-G2 Fab had no effect on ristocetin-induced agglutination (data not shown) . 0P-G2 Fab fragments did not affect shape change of platelets and did not themselves induce platelet aggregation or agglutination.

Experiment 4 Experiment 4 was designed to examine the effect of 0P-G2 Fab fragments on fibrinogen binding to ADP-stimulated platelets.

Fibrinogen binding to washed platelets was measured as described in Kunicki, T.J., et al.,1985, "Human Platelet Fibrinogen: Purification and Hemostatic Properties," Blood 66:808-815, which is incorporated herein by reference. To initiate fibrinogen binding, 10 μM ADP was added to the suspension. After 5 minutes without stirring at ambient temperature, the platelets were sedimented through 30% sucrose dissolved in resuspension buffer as described above for binding of monoclonal antibodies. Nonspecific binding was determined in parallel tubes that contained 10 mM EDTA. The effect of 0P-G2 Fab fragments on ADP-stimulated fibrinogen binding was determined by preincubating platelets with OP-G2 Fab at a concentration of 40 μg/ml for 5 min before initiating the fibrinogen binding assay. Suspensions of washed platelets were incubated with 0P-G2

Fab at a concentration of 40 μg/ml at ambient temperature for 5 min. Various concentrations of ¹²⁵ I-fibrinogen and 10 μM ADP were then added to the suspensions. After an additional 5-min incubation at ambient temperature, the bound fibrinogen was measured.

As illustrated in Fig. 4A, prior incubation of platelets with 0P-G2 Fab resulted in specific inhibition of fibrinogen binding. As illustrated in Fig. 4B, the examination of the binding data by using double- reciprocal plots revealed that 0P-G2 Fab fragments are a competitive inhibitor of fibrinogen binding. The mean Ki from two experiments using platelets from different normal donors is 68 nM.

Experiment 5

Since peptides containing the RGD sequence and peptides containing the carboxy-terminal amino acid sequence of the fibrinogen γ _A chain can inhibit fibrinogen binding to activated platelets in a competitive manner, experiment 5 was designed to determine the effect of synthetic peptides on OP-G2 binding to purified GPIIb-IIIa. The RGD-containing peptides (dextrorotatory-Arg)-Gly-Asp-Trp (hereinafter referred to as "(+)RGDW", CG(+)RGDWGY (hereinafter also referred to as "(+)RGD-8") and YAVTGRGDSPASSK

(hereinafter also referred to as "Fnl4") , and the dodecapeptide, HHLGGAKQAGDV (referred to hereinafter as "H12") , corresponding to the carboxy-terminal sequence of the γ _A chain of fibrinogen, were tested. The peptides were synthesized using a Milligen/BioResearch Labs 9050 Automated Pepsynthesizer (San Rafael, CA) employing PepSyn KA resins and F oc-amino acids. Peptides were cleaved from the resin with trifluoroacetic acid and purified by reverse-phase high performance liquid chromatography (Beckman System Gold, Beckman Instruments, Inc. , Alex Division, San Ramon, CA) using Vyadec C18

preparative columns (The Sep/a/ra/tions Group, Hesperia, CA) .

RGEW and an irrelevant sequence from GPIIIa, ALPLGS, were used as negative controls. Reference is now made to Table I, which shows the inhibitory effect of these peptides on ADP-induced platelet aggregation. The order of potency with respect to inhibition of aggregation was: (+)RGDW > (+)RGD-8 > Fnl4 - H12:

Table I

Inhibitory Effect of Synthetic Peptides on ADP-induced Platelet Aggregation*

(+JRGD-8 = CG(+)RGDWGY;

² Fnl4 = YAVTGRGDSPASSK

3 H12 = HHLGGAKQAGDV

* Citrated platelet-rich plasma was preincubated with various amounts of peptides for 3 min at 37°C with stirring before the addition of 5 μM ADP.

Experiment 6

Experiment 6 was designed to evaluate the effect of the peptides described in experiment 5 on OP-G2 and AP2 binding to purified GPIIb-IIIa. In this assay, to ensure that antibody was present in limiting amounts, OP-G2 and AP2 was used at concentrations of 2 μg/ml and 20 ng/ l, respectively. These were the antibody concentrations which resulted in roughly 50% of maximum binding to GPIIb-IIIa in the same ELISA.

As illustrated in Fig. 5B, none of these synthetic peptides had an effect on AP2 binding to GPIIb- IIIa. In contrast, OP-G2 binding to GPIIb-IIIa was inhibited by the RGD-containing peptides, but not by RGEW or ALPLGS, as illustrated in Fig. 5A. The order of potency with respect to inhibition of OP-G2 binding was exactly the same as the order of potency with respect to inhibition of ADP-induced aggregation. It is noteworthy that H12 did not inhibit OP-G2 binding to GPIIb-IIIa, although the inhibitory effects of H12 and Fnl4 on ADP- induced aggregation were of the same order of magnitude.

This experiment examined whether the dodecapeptide of the fibrinogen γ _A chain, H12, inhibited OP-G2 binding to purified GPIIb-IIIa. Although the inhibitory effect of H12 and Fnl4 on ADP-induced aggregation is of the same order of magnitude (Table I) , H12 did not inhibit OP-G2 binding to GPIIb-IIIa, even at a concentration of 2.5 mM. There is precedent for differential inhibition of antibody binding by RGD peptides and the fibrinogen γ _A peptide. Bennett, J.S., et al. (1983, "Inhibition of Fibrinogen Binding to Stimulated Human Platelets By a Monoclonal Antibody," Proc . Natl . Acad. Sci . U.S.A. 80:2417-2421) demonstrated different effects of RGDS and LGGAKQAGDV on the binding to ADP-stimulated platelets of two monoclonal antibodies specific for the GPIIb-IIIa complex, PAC-l and A2A9. The epitopes recognized by these antibodies are also in close proximity to the fibrinogen binding site(s) Shattil, S.J., et al., 1985, "Changes in the Platelet Membrane Glycoprotein Ilb-IIIa Complex During Platelet Activation," J ^" . Biol . Chem . 260:11107-11114).

These findings suggest that the binding sites on GPIIb-IIIa for RGD peptides and the fibrinogen γ _A chain peptide are spatially separate and that the epitope recognized by 0P-G2 is closer to the RGD-recognition site than to the γ _A chain peptide recognition site. However, RGD peptides and the fibrinogen γ _A chain peptide compete

with each other for binding to GPIIb-IIIa (Bennet et al., 1983, "Inhibition of Fibrinogen Binding to Stimulated Human Platelets by a Monoclonal Antibody," Proc. Natl . Acad. Sci . U.S.A. 80:2417-2421; and Santoro, S. A. and W. J. Lawing, Jr., 1987, "Competition for Related but

Nonidentical Binding Sites on the Glycoprotein Ilb-IIIa Complex by Peptides Derived From Platelet Adhesive Proteins," Cell 48:867-873). One possible explanation for this apparent discrepancy is that the binding of one peptide induces a conformational change in GPIIb-IIIa that then excludes the binding of the other (Bennett, J. S. et al. , supra . , 1983). Since the binding affinity of 0P-G2 (Kd= 5 nM for thrombin-activated platelets) is at least 15-fold higher than that of fibrinogen (Kd= 81-540 nM) (1,11), OP-G2 may be able to overcome such an allosteric, conformational change induced by H12.

Experiment 7 Experiment 7 was designed to compare the binding of 0P-G2 to nonactivated and activated platelets.

Six volumes of blood were mixed with one volume of acid-citrate-dextrose solution (ACD, NIH formula A) and centrifuged at 250 g for 10 min to obtain platelet-rich plasma (PRP) . Prostaglandin E_ (PGE- _j ^ Sigma) was added to the PRP to a final concentration of 20 ng/ml. After a 15 min incubation, the PRP was centrifuged at 750 g for 10 min to sediment platelets. After three washes with Ringer's citrate-dextrose (RCD) containing PGE _lf pH 6.5, the platelet pellet was resuspended in an appropriate buffer.

Quantitative binding of ¹²⁵ I-OP-G2 to nonactivated or thrombin-activated platelets was performed as described in Kunicki, T.J. ,1990, "A Human Monoclonal Autoantibody Specific for Human Platelet Glycoprotein lib (integrin α _IIb ) Heavy Chain," Hum. Antibod. Hybridomas 1:83-95, which is incorporated herein by reference, with slight modifications. Washed

platelets were resuspended in 15 mM Hepes, 150 mM NaCl (Hepes/NaCl) , 1 mg/ml glucose, 1% BSA, 20 ng/ml of PGE _χ , PH 7.4. Thrombin activation of platelets was performed by incubating 2.8 x 10 ⁸ platelets with 1 u/ml of human α- thrombin (Sigma) at 37°C for 15 min, and the reaction was stopped by adding hirudin (Sigma) at a final concentration of 2 u/ml. Various concentrations of ¹²⁵ ι- 0P-G2 were added to the platelet suspension while the final platelet concentration was maintained at 2.5 x 10 ⁸ /ml. After a 60 min incubation, triplicate 100 μl samples were layered onto 200 μl of 30% sucrose in buffer, in 400 μl microcentrifuge, polypropylene tubes. Tubes were centrifuged at 7000 g for 10 min. The supernatants were aspirated and the radioactivity of both supernatants and pellets was measured in a gamma counter.

Thrombin activation of platelets was performed as described above, except that platelets were resuspended in RCD-PGE^ After thrombin activation, the platelets were washed once more with RCD-PGE _lf and the platelet count was adjusted to 5 x 10 ⁸ /ml. The platelet suspension was incubated with OP-G2 (40 μg/ml) , AP2 (2 μg/ml) or nonimmune mouse IgG (40 μg/ml) for one hour at ambient temperature.

The platelets were then pelleted, resuspended in RCD-PGE- _L , and incubated with a 1:20 dilution of FITC- conjugated goat anti-mouse IgG (Zymed Laboratories Inc., South San Francisco, CA) for 1.5 hours. The platelet suspension was then fixed with 1% paraformaldehyde and analyzed in a flow cytometer (Becton-Diσkinson FACS Star ^pluB , Mountain View, CA) .

0P-G2 bound to nonactivated platelets as illustrated in Fig. 6A.

The expression of the OP-G2 epitope was then evaluated after treatment of platelets with thrombin. As illustrated in Fig. 6B, thrombin-activation of platelets markedly increased the binding of OP-G2 IgG to platelets. However, as illustrated in Fig. 6D, the binding of AP2 to

nonactivated platelets was essentially the same as that to activated platelets. These data suggest that the increase in the binding of OP-G2 is not due solely to the increase in total number of GPIIb-IIIa molecules seen after thrombin activation. The marked increase in the binding of 0P-G2 to activated platelets was also observed when 0P-G2 Fab fragments were used instead of IgG, as illustrated in Fig. 6C.

Experiment 8

Experiment 8 was designed to evaluate the increase in OP-G2 binding more precisely. Direct binding assays using ¹²⁵ I-OP-G2 IgG were performed. First, the binding of 0P-G2 to nonactivated platelets was examined. Equilibrium was reached in 60 min at ambient temperature, and saturation was achieved at about 40 μg OP-G2 per 2.5 x 10 ⁸ platelets per ml, as illustrated in Fig. 7A. Binding data were analyzed by the method of Scatchard, G., 1949, "The Attractions of Proteins for Small Molecules and Ions," Ann. N. Y. Acad . Sci . 51:660-672, which is incorporated herein by reference. Based on an analysis of six normal donors, the number of. OP-G2 molecules bound per platelet was determined to be 49800 ± 8180 (mean ± SD) with a dissociation constant (Kd) of 25.4 ± 5.6 nM (mean ± SD) . Parallel experiments using ¹²⁵ I-AP2 indicated that 50600 ± 4849 (mean ± SD) molecules of AP2 were bound per platelet at saturation.

It is known that thrombin activation of platelets increases the total number of GPIIb-IIIa molecules expressed on the platelet surface (Wencel- Drake, J.D., et al. , 1986, "Localization of Internal Pools of Membrane Glycoproteins Involved in Platelet Adhesive Responses," Am. J. Pathol . 124:324-334). The increases in the number of OP-G2 and AP2 molecules bound per platelet after thrombin activation were 67.2 ± 8.9% (mean ± SD, n=4) and 46.5 ± 6.4% (mean ± SD, n=4) , respectively. Despite the increase of OP-G2 binding

sites per platelet, saturation was achieved at about 15 μg OP-G2 per ml.

Scatchard analysis demonstrates that the apparent affinity of AP2 for nonactivated and thrombin activated platelets remained the same (nonactivated, Kd = 0.39 ± 0.05 nM; activated, Kd = 0.42 ± 0.05 nM; mean ± SD; n=3). However, the affinity of 0P-G2 for activated platelets was roughly five-fold higher than that for nonactivated platelets (nonactivated, Kd = 24.8 ± 1.3 nM; activated, Kd = 4.9 ± 1.6 nM; mean ± SD; n=4) as illustrated in Fig. 7B.

Direct binding assays demonstrated that OP-G2 IgG binds to approximately 50,000 sites per nonactivated platelet, and that this value is essentially the same as that for AP2. This suggests that 0P-G2 IgG fully interacts with GPIIb-IIIa expressed on nonactivated platelets. After thrombin stimulation, the binding sites for 0P-G2 and AP2 increased by 67% and 46%, respectively.

Experiment 9

Experiment 9 was designed to explore the basis for the apparent increased affinity of 0P-G2 by kinetic binding studies. After 5 min. incubation of nonactivated or thrombin-activated platelets with 1 μg/ml of ¹²⁵ I-OP-G2, the dissociation rate constant (K ₂ ) was determined by measuring the displacement of ¹²⁵ I-0P-G2 from the platelets at 1 min after adding a 100-fold excess of unlabeled 0P-G2. The value of the association rate constant (K-^ was determined by measuring ¹²⁵ I-0P-G2 binding after 1 min. K ₂ for thrombin-activated platelets was calculated to be 2.66 x 10 ^"2 min ^-1 . No radioactivity was, however, eluted from nonactivated platelets during a one hour follow-up. Reference is now made to the following Table II which shows that K_ for thrombin- activated platelets was roughly 4-fold greater than that for nonactivated platelets:

Table II

Kinetics of the Binding of ¹²⁵ I-OP-G2 to Nonactivated and Thrombin-Activated Platelets

___ _ __

(M^min ^"1 ) (min ^-1 ) (nM) Nonactivated 11..3388Xx1l00 ⁶⁶ NNDD NNDD

Thrombin-activated 5.74xl0 ⁶ 2.66xl0~ ² 4.6

The value for the association rate constant

(K ) was determined by measuring ¹²⁵ I-OP-G2 binding after 1 min. The dissociation rate constant (K ₂ ) was determined by measuring the displacement of ¹²⁵ I-OP-G2 from the platelet at 1 min after adding a 100-fold excess of unlabeled OP-G2. Results represent the mean value from two experiments using platelets from different donors. The Kd is calculated using the formula Kd = K ₂ /K_.

Although the Kd for nonactivated platelets could not be determined, the Kd for thrombin-activated platelets determined from kinetic studies was 4.6 nM, in excellent agreement with the value determined from the equilibrium binding studies.

Although the apparent affinity of AP2 remains the same after thrombin stimulation, the equilibrium binding studies demonstrate that the apparent affinity of OP-G2 increases roughly five-fold. Kinetic studies demonstrate that the association rate constant is roughly 4-fold greater than that for nonactivated platelets. Thus, the increase in affinity of OP-G2 for activated platelets can be completely attributed to an increase in the on-rate of its binding to GPIIb-IIIa. The increased on-rate of binding to GPIIb-IIIa likely reflects a conformational change or changes that occurs within the GPIIb-IIIa complex during activation.

It is conceivable that the conformational change in the GPIIb-IIIa complex is a direct result of

changes in the microenvironment surrounding the GPIIb- IIIa complex. In contrast to OP-G2, fibrinogen certainly does not bind with appreciable affinity to nonactivated platelets. One possible explanation for this discrepancy is that the ligand binding is size-selective (Coller, B.S., 1986, "Activation Affects Access to the Platelet Receptor for Adhesive Glycoproteins," J. Cell Biol . 103:451-456), and that the microenvironment contributes to this selectivity.

Experiment 10 Experiment 10 was designed to ascertain the nucleotide sequence of the gene that encodes the variable region of the heavy chain of OP-G2. Experience with other antibody molecules has led to the consensus that antigen recognition and hence antibody specificity resides in the variable region of either or both the heavy and light chains of the antibody molecule. The extent to which either or both the heavy and light chains contribute to antigen binding is empirical and variable from one antibody to the next. Regardless, antigen binding is known to be inherent in one or more of three sequence regions in each of the heavy chain and light chain variable regions. These are areas of hypervariability that are the sequences most unique to any given heavy or light chain. These sequence regions are commonly called complementarity-determining regions and are each abbreviated CDR.

Total RNA was isolated from 5 x 10 ⁶ OP-G2 cells. cDNA of immunoglobulin-specific (IgG) RNA was produced using the reverse transcriptase enzyme and an oligonucleotide primer corresponding to the hinge region of the urine gamma chain gene (ATTGTGCCCAGGGATTGTACTAGTAAGCCT) . OP-G2 heavy chain immunoglobulin cDNA was then amplified using the Taq 1 polymerase chain reaction (PCR) and an oligonucleotide primer corresponding to the consensus sequence of the 5•

fra ework region of the murine variable heavy gene III family (CTGCTCGAGTCTGGAGGAGGCTTG) . Amplified cDNA was prepared such that it contained 5• Xhol and 3• Spel restriction sites (these sites were included in the 5' and 3' oligonucleotide primers employed in the PCR) . OP- G2 heavy chain cDNA was purified, digested with Xhol and Spel and subcloned into the plasmid pGEM-11 (Promega Biotech, Inc., Madison, WI) . The sequence of the subcloned OP-G2 heavy chain was then determined using the Sequenase reaction (Version 2.0, United States Biochemical Corp., Cleveland, OH).

The sequence of the variable region of the heavy chain of OP-G2 is identified as SEQ ID NO:l and is depicted in Figure 8. Of note, the D gene employed by OP-G2, which comprises a large portion of CDR3 of the heavy chain, has in its center the nucleotide sequence that encodes the tripeptide RYD. This sequence, akin to RGD, likely accounts for the specificity of OP-G2.

OP-G2 is the first murine monoclonal IgG antibody to be described that binds so close to the RGD recognition site of GPIIb-IIIa that antibody binding can be completely inhibited by RGD peptides. 0P-G2 itself contains the sequence RYD within CDR3 (D gene) of its heavy chain. This likely accounts for the specificity of 0P-G2. This antibody has permitted us to study more closely the availability of the RGD recognition site as a function of platelet stimulation. Our results with OP-G2 provide strong support for the hypothesis that significant conformational changes occur within the GPIIb-IIIa complex during activation that include the RGD-recognition site.

It is understood that the invention is not confined to the particular construction and arrangement herein illustrated and described. It embraces all such modified forms thereof as come within the scope of the following claims.

SEOUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Kunicki, Thomas J.

Tomiyama, Yoshiaki (ii) TITLE OF INVENTION: MONOCLONAL ANTIBODY OP-G2 AND

METHOD OF USE (iii) NUMBER OF SEQUENCES: 1 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Andrus, Sceales, Starke & Sawall

(B) STREET: 100 East Wisconsin Ave., Suite 1100

(C) CITY: Milwaukee

(D) STATE: Wisconsin

(E) COUNTRY: USA

(F) ZIP: 53202 (V) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Diskette, 5.25 inch, DS, HD, 96TPI

(B) COMPUTER: WYSE

(C) OPERATING SYSTEM: ENHANCED MS-DOS 3.3

(D) SOFTWARE: WORDPERFECT 5.1 (Vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: not available

(B) FILING DATE: 12 December 1990

(C) CLASSIFICATION: not available

(vii) PRIOR APPLICATION DATA: not applicable

(Viϋ) ATTORNEY INFORMATION:

(A) NAME: Sara, Charles S.

(B) REGISTRATION NUMBER: 30,492

(C) REFERENCE/DOCKET NUMBER: F.2733-7 (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (608) 255-2022 (Madison Office)

(B) TELEFAX: (608) 255-2182

(C) TELEX: 26832 ANDSTARK 2. INFORMATION FOR SEQ ID NO: 1

(1) SEQUENCE CHARACTERISTICS

(A) LENGTH: 125 amino acid residues

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: OP-G2 heavy chain gene sequence

(includes V _H gene plus D gene plus J _H gene) ; cDNA sequence obtained by PCR from OP-G2 hybridoma RNA. ' (iii) HYPOTHETICAL: no (iv) ANTI-SENSE: unknown (v) FRAGMENT TYPE: internal fragment (vi) ORIGINAL SOURCE: not available at this time (vii) IMMEDIATE SOURCE: not available at this time (viii) POSITION IN GENOME: not available at this time (ix) FEATURE: not available at this time (x) PUBLICATION INFORMATION: not applicable (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1

SEQ ID NO : 1

OPG2 Heavy Chain Gene Sequence (Includes V _H gene plus D gene plus J _H gene).cDNA sequence obtained by PCR from OPG2 hybridoma RNA. Protein sequence deduced from cDNA.

1 10 16

- - - - - GAG TCT GGA GGA GGC TTG GTG AAC CCT GGA GGG Xaa Xaa Xaa Xaa Xaa Glu Ser Gly Gly Gly Leu Val Asn Pro Gly Gly

I—CDR1- 17 20 30 32

TCC CTG AAA CTC TCC TGT GCA GCC TCT GGA TTC ACT TTC AGT GAC TAT Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr I

33 40 48

GGC ATG TCT TGG GTT CGC CAG ACT CCG GAG AAG AGG CTG GAG TGG GTC Gly Met Ser Trp Val Arg Gin Thr Pro Glu Lys Arg Leu Glu Trp Val

j _CD R2 j

49 50 60 64

GCA GCC ATT AGT GGT GGT GGT ACT TAC ATC CAC TAT CCA GAC AGT GTG Ala Ala lie Ser Gly Gly Gly Thr Tyr lie His Tyr Pro Asp Ser Val

65 70 80

AAG GGG CGA TTC ACC ATC TCC AGA GAC AAT GCC AAG AAC AAC CTA TAC Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Asn Asn Leu Tyr

81 90 96

CTA CAA ATG AGC AGT CTG AGG TCT GAG GAC ACG GCC TTG TAT TAC TGT Leu Gin Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

-D-

97 99 100 110 112

ACA AGA CAC CCC TTC TAT AGG TAC GAC GGG GGA AAT TAC TAT GCT ATG Thr Arg His Pro Phe Tyr Arg Tyr Asp Gly Gly Asn Tyr Tyr Ala Met

i i ,τ I ι ι ^ϋ H i

113 120 125

GAC CAC TGG GGT CAA GGA ACC TCA GTC ACC GTC TCC TCA GCC ...

Asp His Trp Gly Gin Gky Thr Ser Val Thr Val Ser Ser Ala