MULTIPLEX CRISPR/CAS SYSTEM FOR MODIFYING CELL GENOMES

TECHNICAL FIELD

[0001] The invention relates to methods of modifying cell genomes using multiple CRISPR/Cas systems. The invention also relates to compositions, crRNAs, Cas and vectors for carrying out such methods as disclosed herein.

BACKGROUND

[0002] The state of the art describes vectors and uses of these that employ CRISPR/Cas systems. For example, reference is made to W02020078893, WO2019185551, W02019105821, WO2017118598, US20180140698, US20170246221, US20180273940, US20160115488, US20180179547, US20170175142, US20160024510, US20150064138, US20170022499, US20160345578, US20180155729, US20180200342, WO2017112620, W02018081502, PCT/EP2018/066954, PCT/EP2018/066980, PCT/EP2018/071454, EP3356533, EP3307872, W02020072253, W02020072254, W02020072250, W02020072248, WO2019236566, W02019144061,

WO2017112620, W02015066119, EP16804164, W02019227080, EP3362571, EP3356533, WO2016205623, EP3307872, US2016/0324938 and US2019/0160120 and equivalent publications by the US Patent and Trademark Office (USPTO) or WIPO, the disclosures of which are incorporated herein by reference.

SUMMARY OF THE INVENTION

[0003] The invention provides the following configurations.

[0004] In a First Configuration

A method of modifying the genome of a cell, the method comprising

(a) using a first CRISPR/Cas system to modify a first protospacer of the genome; and

(b) using a second CRISPR/Cas system to modify a second protospacer of the genome, wherein the second protospacer is different to the first protospacer; wherein the systems comprise different Cas and are provided simultaneously in the cell.

[0005] In a Second Configuration

A method of modifying the genome of one or more cells, the method comprising introducing into each cell components (a), (b), (c) or (d):-

(a) first and second crRNAs;

(b) nucleic acid encoding first and second crRNAs, wherein the nucleic acid is expressed in the cell for producing the crRNAs; (c) a first nucleic acid encoding a first crRNA, and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressed in the cell for producing the crRNAs; or

(d) a first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressed in the cell for producing the second crRNA; wherein for each cell

(e) the first crRNA (crRNA 1) is capable of guiding a first Cas (Cl) to a protospacer sequence (PS1) comprised by the cell genome to modify PS1; and

(f) the second crRNA (crRNA2) is capable of guiding a second Cas (C2) to a protospacer sequence (PS2) comprised by the cell genome to modify PS2;

(g) C 1 and C2 are different;

(h) PS 1 and PS2 are different; and

(i) crRNA 1, crRNA2, Cl and C2 are provided in the cell, whereby the genome of the cell is subjected to Cas modification.

In one aspect the invention uses the method to kill target cells. In another aspect the invention uses the method to edit the genomes of cells.

[0006] In a third Configuration

A composition for use in a method treating or preventing a disease or condition in a human or animal subject that is mediated by target cells, the composition comprising components (a), (b) or (d):-

(a) first and second crRNAs;

(b) nucleic acid encoding first and second crRNAs, wherein the nucleic acid is expressible in a target cell for producing the crRNAs;

(c) a first nucleic acid encoding a first crRNA, and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressible in a target cell for producing the crRNAs; or

(d) a first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressible in a target cell for producing the second crRNA; wherein

(e) the first crRNA (crRNA 1) is capable of guiding a first Cas (Cl) to a protospacer sequence (PS1) comprised by a target cell genome to modify PS1; and

(f) the second crRNA (crRNA2) is capable of guiding a second Cas (C2) to a protospacer sequence (PS2) comprised by the target cell genome to modify PS2;

(g) C 1 and C2 are different;

(h) PS 1 and PS2 are different; and wherein the method comprises administering the composition to the subject whereby said components of the composition are introduced into target cells wherein crRNA 1, crRNA2, Cl and C2 are provided in each cell and the genome of each cell is subjected to Cas modification and the disease or condition is treated or prevented. [0007] In a fourth Configuration

A composition comprising components (a), (b) or (d):-

(a) first and second crRNAs;

(b) nucleic acid encoding first and second crRNAs, wherein the nucleic acid is expressible in a target cell for producing the crRNAs;

(c) a first nucleic acid encoding a first crRNA, and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressible in a target cell for producing the crRNAs; or

(d) a first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressible in a target cell for producing the second crRNA; wherein

(e) the first crRNA (crRNA 1) is capable of guiding a first Cas (Cl) to a protospacer sequence (PS1) comprised by a target cell genome to modify PS1; and

(f) the second crRNA (crRNA2) is capable of guiding a second Cas (C2) to a protospacer sequence (PS2) comprised by the target cell genome to modify PS2;

(g) C 1 and C2 are different;

(h) PS 1 and PS2 are different; and wherein when said components of the composition are introduced into a target cell whereby crRNA 1, crRNA2, Cl and C2 are provided in the cell, the genome of the cell is subjected to Cas modification.

[0008] Aspects provide :- The method of the invention for

(a) producing synergistic Cas nuclease cutting of a cell genome;

(b) reducing a population of cells of a first species or strain by at least 100,000, 1,000,000 or 10,000,000-fold;

(c) killing at least at least 99%. 99.9%. 99.99%, 99.999%, 99.9999% or 99.99999% cells of a first species or strain comprised by a microbiome;

(d) producing synergistic Class 1 Cas modification of a cell genome; or

(e) reducing bacterial cells of a first species or strain (eg, E coli cells) in a cell population by at least 105, 106 or 107 -fold, wherein the population comprises at least 100,000; 1,000,000; or 10,000,000 cells respectively.

[0009] Aspects also provide pharmaceutical compositions, methods of making such compositions and medical methods using such compositions.

BRIEF DESCRIPTION OF THE DRAWINGS

[00010] Figure 1. Type I CRISPR-Cas system of E. coli and C. difficile targeting E. coli MG1655. Layout of the CRISPR Guided Vector™, CGV™. (A) E. coli CRISPR-Cas CGV: ColEl ori, cas3 and cascade of E. coli, CRISPR array. (B) C. difficile CRISPR Cas CGVs. Plasmid 1: pSClOl ori, cas3 and cascade of C. difficile. Plasmid 2: pCloDF13 ori, CRISPR array of C. difficile.

[00011] Figure 2. Killing of E. coli MG1655 with type IE CRISPR-Cas system of E. coli and type I-B CRISPR-Cas system of C. difficile. E. coli MG1655 harboring cas genes of C. difficile was transformed with cognate CRISPR array and E. coli CRISPR-Cas CGV. Both CRISPR systems together surprisingly synergistically killed 7 log ₁₀ E. coli MG1655, compared to empty vectors. Additionally, single transformations with the CGVs were tested. E. coli CRISPR-Cas system resulted in ~4-log ₁₀ reductions; C. difficile CRISPR-Cas system resulted ~3-logio (n=3).

DETAILED DESCRIPTION

[00012] The invention relates to methods of modifying cell genomes using multiple CRISPR/Cas systems. The invention also relates to compositions, crRNAs, Cas and vectors for carrying out such methods as disclosed herein.

[00013] The invention is useful to provide one or more of the following advantages: -

(a) producing synergistic Cas nuclease cutting of a cell genome;

(b) reducing a population of cells of a first species or strain by at least 100,000, 1,000,000 or 10,000,000-fold;

(c) killing at least at least 99%. 99.9%. 99.99%, 99.999%, 99.9999% or 99.99999% cells of a first species or strain comprised by a microbiome;

(d) producing synergistic Class 1 Cas modification of a cell genome; or

(e) reducing bacterial cells of a first species or strain in a cell population by at least 10 ⁵ , 10 ⁶ or 10 ⁷ -fold, wherein the population comprises at least 100,000; 1,000,000; or 10,000,000 cells respectively.

[00014] Advantageously, by reducing the number of target cells in a cell population, this may be beneficaial where the cells are undesirable (eg, detrimental to the health of a subject to which the method is applied, or detrimental to an ex vivo environment or in vitro cell sample to which the method is applied or the composition is administered). For example, the cells are cancer cells comprised by a patient and the multiple Cas cutting of the invention synergistically kills a very high number (eg, at least 99.999% or 10 ⁵ -fold) of the cells. By reducing the cells in this way, the number of seeder cells to re-grow the cancer is reduced. In another example, the cells may be bacterial or archaeal cells and by reducing the cells in this way, the number of seeder cells to re-grow an undesirable cell population will be reduced.

[00015] In a configuration, the invention provides in one aspect: -

A method of modifying the genome of a cell, the method comprising

(a) using a first CRISPR/Cas system to modify a first protospacer of the genome; and (b) using a second CRISPR/Cas system to modify a second protospacer of the genome, wherein the second protospacer is different to the first protospacer; wherein the systems comprise different Cas and are used simultaneously.

[00016] Another aspect of the configuration provides:-

A method of modifying the genome of one or more cells, the method comprising introducing into each cell components (a), (b), (c) or (d):-

(a) first and second crRNAs;

(b) nucleic acid encoding first and second crRNAs, wherein the nucleic acid is expressed in the cell for producing the crRNAs;

(c) a first nucleic acid encoding a first crRNA, and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressed in the cell for producing the crRNAs; or

(d) a first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressed in the cell for producing the second crRNA; wherein for each cell

(e) the first crRNA (crRNA 1) is capable of guiding a first Cas (Cl) to a protospacer sequence (PS1) comprised by the cell genome to modify PS1; and

(f) the second crRNA (crRNA2) is capable of guiding a second Cas (C2) to a protospacer sequence (PS2) comprised by the cell genome to modify PS2;

(g) C 1 and C2 are different;

(h) PS 1 and PS2 are different; and

(i) crRNA 1, crRNA2, Cl and C2 are provided in the cell, whereby the genome of the cell is subjected to Cas modification.

[00017] Optionally, Cl and/or C2 is a Cas nuclease, eg, Cl and C2 each is a Cas3. Optionally, Cl and/or C2 is a Cascade Cas, eg, CasA, CasB, CasC, CasD or CasE. Optionally, Cl is a Cas3 that operates in the cell with Cascade Cas, eg, one, more or all of CasA, B, C, D and E.

[00018] Optionally, the crRNAs of component (a) are introduced simultaneously or sequentially. Optionally, the nucleic acid and crRNA of component (c) are introduced simultaneously or sequentially. Optionally, the nucleic acids of component (d) are introduced simultaneously or sequentially. The method, however, includes the presence of crRNA 1, crRNA2, Cl and C2 at the same time in each cell, whereby multiple CRISPR/Cas systems are used to modify the genome. crRNA 1, crRNA2, Cl and C2 are provided in the cell, whereby PS1 and PS2 are subjected to Cas nuclease modification wherein the genome of the cell is modified.

[00019] Preferably, the first and second protospacers are different or comprised by different genes or intergenic sequences of the genome. [00020] Modification of the genome may be cutting of nucleic acid of the genome, repression of transcription or translation of a gene comprised by the genome, upregulation of transcription or translation of a gene comprised by the genome, or editing of the genome (eg, to insert and/or delete one or more nucleic acid sequences). The invention may advantageously be useful for synergistically or efficiently cutting, modifying or editing the genome of each cell. In an example, DNA comprised by the genome is cut, modified or edited and/or RNA comprised by the genome is cut, modified or edited. In an example, DNA comprised by the genome is degraded (eg, in a process comprising Cas exo- or endonuclease activity) and/or RNA comprised by the genome is cut, modified or edited (eg, in a process comprising Cas exo- or endonuclease activity).

[00021] In an example, the component is comprised by a nucleic acid vector. In an example the component (a), (b), (c) or (d) is introduced into each cell by transfection, electroporation, transduction or conjugative transfer. For example, the vector is a virus or phage and the component is introduced by transduction. For example, the vector is a plasmid and the component is introduced by conjugation, transfection or electroporation. For example, the vector is a phagemid (optionally a phagemid comprised by a virus or phage) and the component is introduced by conjugation, transduction, transfection or electroporation. For example, the nucleic acid(s) of the component is(are) introduced by electroporation thereof. For example, a phage herein is a tailed phage. For example a phage herein is a lytic phage. For example, a phage herein is a non-lytic phage.

[00022] Optionally, the method is a recombineering method carried out in vitro, and for example the cell is an E coli cell.

[00023] Optionally, each said crRNA is encoded by a CRISPR array comprising first and second repeat sequences and a spacer sequence joining the repeat sequences. Optionally, the nucleic acid of

(b) comprises a CRISPR array encoding crRNA 1 and crRNA2. Optionally, the first nucleic acid of

(c) comprises a first CRISPR array encoding crRNA 1 and the second nucleic acid comprises a second CRISPR array encoding crRNA2. Optionally, the nucleic acid of (b) comprises a CRISPR array encoding crRNA2.

[00024] In an example each repeat sequence is GAGTTCCCCGCGCCAGCGGGGATAAACCG or GTTTTATATTAACTAAGTGGTATGTAAAT. In an example, each protospacer or spacer sequence consists of from 15 to 70, 20 to 50, 17 to 45, 18 to 40, 18 to 35 or 20 to 40 contiguous nucleotides. [00025] Optionally, Casl and/or Cas2 are not introduced into each cell. Optionally, each nucleic acid is devoid of nucleic acid sequence encoding Casl and/or Cas2. Optionally, additionally Cas4 is not introduced into each cell, or each nucleic acid is devoid of a Cas4-encoding nucleic acid sequence. Optionally, said introducing comprises (i) introducing into each cell an operon comprising nucleotide sequences encoding a type I Cas3 (wherein the Cas3 is Cl) and Cascade proteins under the control of a common constitutive promoter and/or introducing into each cell an operon comprising nucleotide sequences encoding a type I Cas3 (wherein the Cas3 is C2) and Cascade proteins under the control of a common constitutive promoter. In an example, Cl is a Type-IB Cas3 and/or C2 is a Type-IE Cas3. Examples of suitable operons are disclosed in W02020078893 or US20200115716, the disclosures of which are expressly incorporated herein by reference for possible use in the present invention. The term “operon” is known to the skilled person such as relating to a functioning unit of DNA containing at least expressible 2 nucleotide sequences respectively encoding for an expression product (eg, a respective translatable mRNA), wherein the sequences are under common promoter control.

[00026] In an example, Cl is a Cas disclosed in WO2019002218 and optionally the first crRNA is encoded by a CRISPR array comprising cognate repeat sequences, such as when Cl is a Cas (eg, Cas3) disclosed in WO2019002218 the repeat sequences are the cognate repeat sequence disclosed in W02019002218. Additionally or alternatively, In an example, C2 is a Cas disclosed in WO2019002218 and optionally the first crRNA is encoded by a CRISPR array comprising cognate repeat sequences, such as when C2 is a Cas (eg, Cas3) disclosed in WO2019002218 the repeat sequences are the cognate repeat sequence disclosed in W02019002218. In an example, the first crRNA is encoded by an array comprising a repeat sequence disclosed in WO2019002218 and/or the second crRNA is encoded by an array comprising a repeat sequence disclosed in WO2019002218. For example, one or more nucleotide sequences encoding one or more Cascade Cas (eg, which are cognate to C 1 or C2) are introduced into the cell, wherein the Cascade Cas are Cascade Cas disclosed in W02019002218. All of these disclosures in W02019002218 are expressly incorporated herein by reference for possible use in the present invention.

[00027] Optionally,

(a) Cl is a Class 1 Cas and C2 is a Class 1 Cas;

(b) Cl is a Class 1 Cas and C2 is a Class 2 Cas;

(c) Cl is a Class 2 Cas and C2 is a Class 2 Cas;

(d) Cl is a Type I Cas (optionally Type I-A, B, C, D, E, F or U) and C2 is a Type I Cas

(optionally Type I-A, B, C, D, E, F or U);

(e) Cl is a Type I (optionally Type I-A, B, C, D, E, F or U) or II Cas and C2 is a Type II Cas;

(f) C 1 is a Type I (optionally Type I-A, B, C, D, E, F or U) or II Cas and C2 is a Type III Cas

(optionally Type I-A or B);

(g) Cl is a Type I (optionally Type I-A, B, C, D, E, F or U) or II Cas and C2 is a Type IV Cas;

(h) Cl is a Type I (optionally Type I-A, B, C, D, E, F or U) or II Cas and C2 is a Type V Cas; or

(i) Cl is a Type I or II Cas and C2 is a Type VI Cas.

[00028] Optionally, Cl and C2 are different Class 1 Cas selected from the Cas disclosed in Table 2. Optionally, Cl is an E coli Cas (eg, Cas3) and C2 is a Cas selected from the Cas disclosed in Table 2. Optionally, Cl is an C dificile Cas (eg, Cas3) and C2 is a Cas selected from the Cas disclosed in Table 2.

[00029] Optionally, Cl is a Type I-A, B, C, D, E, F or U Cas. Optionally, C2 is a Type I-A, B, C, D, E, F or U Cas. [00030] Optionally, Cl is a Type I-A Cas and C2 is a Type I-B, C, E, F or U Cas. Optionally, Cl is a Type I-B Cas and C2 is a Type I-B, C, E, F or U Cas. Optionally, Cl is a Type I-C Cas and C2 is a Type I-B, C, E, F or U Cas. Optionally, Cl is a Type I-D Cas and C2 is a Type I-B, C, E, F or U Cas. Optionally, Cl is a Type I-E Cas and C2 is a Type I-B, C, E, F or U Cas. Optionally, Cl is a Type I-F Cas and C2 is a Type I-B, C, E, F or U Cas. Optionally, Cl is a Type I-U Cas and C2 is a Type I-B,

C, E, F or U Cas.

[00031] Optionally,

(a) C 1 is a Type IB or C Cas and C2 is a Type I-E or F Cas (optionally C 1 is a Type IB Cas3 and C2 is a Type IE Cas);

(b) C 1 is a Type IC or C Cas and C2 is a Type I-E or F Cas (optionally C 1 is a Type IC Cas3 and C2 is a Type IE Cas3); or

(c) Cl is a Type II Cas9 and C2 is a Type I Cas3 (optionally C2 is an E coli Type IE or F Cas3; or a C difficile Cas IB).

[00032] Optionally,

(a) Cl is a Cas3 (optionally a Type I-A, B, C, D, E, F or U Cas3) and C2 is a Cas3 (optionally a Type I-A, B, C, D, E, F or U Cas3);

(b) Cl is a Cas9 and C2 is a Cas3 (optionally a Type I-A, B, C, D, E, F or U Cas3);

(c) Cl is a Cas3 (optionally a Type I-A, B, C, D, E, F or U Cas3) and C2 is a Cas 10 (optionally CaslO subtype A, B, C or D);

(d) Cl is a Cas9 and C2 is a CaslO (optionally CaslO subtype A, B, C or D);

(e) Cl is a Cas9 and C2 is a Cas 12 (optionally Cas 12a);

(f) Cl is a Cas3 (optionally a Type I-A, B, C, D, E, F or U Cas3) and C2 is a Cas 12 (optionally

Cas 12a);

(g) Cl is a Cas9 and C2 is a Cas 13 (optionally Cas 13a, Cas 13b, Cas 13c or Cas 13d); or

(h) Cl is a Cas3 (optionally a Type I-A, B, C, D, E, F or U Cas3) and C2 is a Cas 13 (optionally

Casl3a, Casl3b, Casl3c or Cas13d).

[00033] Optionally, PS 1 and PS2 are protospacers comprised by

(a) RNA and RNA respectively;

(b) DNA and RNA respectively;

(c) RNA and DNA respectively; or

(d) DNA and DNA respectively.

[00034] Optionally, Cl is a Clostridiaceae Cas3 (optionally a C difficile Cas3, such as a Type I-B Cas3) and C2 is an Enterobacteriaceae Cas3 (optionally an E coli Cas3, such as a Type I-E Cas3). [00035] In an alternative, C1 and C2 are the same. In an alternative, C1 and C2 are the same type of Cas, eg, each is a Cas9, or each is a Cas3, or each is a Cas12, or each is a Cas13, or each is the same type of Cascade Cas.

[00036] Optionally, C1 is a Biostraticola, Buttiauxella, Cedecea, Citrobacter, Cronobacter, Enterobacillus, Enterobacter, Escherichia, Franconibacter, Gibbsiella, Izhakiella, Klebsiella,

Kluyvera, Kosakonia, Leclercia, Lelliottia, Limnobaculum, Mangrovibacter, Metakosakonia, Pluralibacter, Pseudescherichia, Pseudocitrobacter, Raoultella or Rosenbergiella Cas (eg, Cas3 or Cascade Cas).

[00037] Optionally, C1 is a spCas9 (S pyogenes Cas9) or saCas9 (5 aureus Cas9) and C2 is a Type I Cas3 (optionally C2 is an E coli Type I-E or F Cas3).

[00038] Optionally, the modification is cutting of the genome, eg, cutting DNA (eg, ssDNA or dsDNA) of the genome, RNA (eg, mRNA, crRNA, tracrRNA, tRNA, snRNA or rRNA, preferably mRNA), endonuclease cutting or exonuclease cutting, or cutting of one, but not both strands of dsDNA (double-stranded DNA) of the genome, or nicking of dsDNA of the genome.

[00039] Optionally, PS 1 is a chromosomal sequence of the cell. Optionally, PS1 is an episomal (eg, plasmid) sequence of the cell.

[00040] Optionally, PS 1 is a chromosomal sequence of the cell and PS2 is a chromosomal sequence of the cell. Optionally, PS 1 is a chromosomal sequence of the cell and PS2 is an episomal (eg, plasmid) sequence of the cell.

[00041] Optionally, each cell is a human, animal (ie, non-human animal), plant, yeast, fungus, amoeba, insect, mammalian, vertebrate, bird, fish, reptile, rodent, mouse, rat, livestock animal, cow, pig, sheep, goat, rabbit, frog, toad, protozoan, invertebrate, mollusc, fly, grass, tree, flowering plant, fruiting plant, crop plant, wheat, com, maize, barley, potato, carrot or lichen cell. Optionally, each cell is a prokaryotic cell or eukaryotic cell. For example, each cell is a bacterial or archaeal cell, optionally an E coli cell or C difficile cell. In an embodiment, the cell or the cells are of a genus or species disclosed in Table 1. In an embodiment, the cell or the cells are gram positive cells. In an embodiment, the cell or the cells are gram negative cells.

[00042] Optionally, the step of introducing comprises infecting the cell with a vims (optionally a bacteriophage wherein the cell is a bacterial cell) or introducing a plasmid (optionally a conjugative plasmid) or introducing a phagemid into the cell, wherein the vims, plasmid or phagemid encodes the crRNAs. Optionally, the vims, plasmid or phagemid encodes C1 and/or C2. Optionally, the vims, plasmid or phagemid encodes one of said C 1 and C2, and the other Cas is an endogenous Cas encoded by the genome of the cell. Optionally, the each of Cl and C2 is an endogenous Cas encoded by the genome of the cell. In an example, the Cas is encoded by a chromosome of the cell.

[00043] Optionally C1 is a Cas3 and the vims or plasmid encodes a Cas5, Cas6, Cas7 and Cas8 (and optionally a Casl 1) that are cognate to the Cas3. Additionally or alternatively, optionally C2 is a Cas3 and the virus or plasmid encodes a Cas5, Cas6, Cas7 and Cas8 (and optionally a Cas11) that are cognate to the Cas3.

[00044] The Cas are simultaneously present in the cell and the Cas may cut the genome simultaneously or sequentially.

[00045] Optionally, the method comprises introducing into each cell or expressing in each cell at least 3, 4 or 5 different types of crRNAs wherein the types target different protospacer sequences comprised by the cell genome (e,g different chromosomal sequences). In an example, the cell is a bacterial or archaeal cell and the protospacers are comprised by the cell chromosome. For example, at least one or two of said crRNA types targets a respective chromosomal sequence and at least one or more of the crRNA types targets a sequence comprised by an episome (eg, a plasmid) of the cell, wherein the cell is a bacterial or archaeal cell. For example, the cell (eg, a human or mammalian cell) comprises a plurality of chromosomes and the crRNAs target protospacer sequences comprised by two or more of said chromosomes (eg, wherein the chromosomes are not members of the same diploid chromosomal pair).

[00046] For example, the method comprised introducing a nucleic acid into each cell, wherein the nucleic acid comprises, in 5’ to 3’ direction a nucleotide sequence encoding a Cas nuclease (eg, a cas3) and one or more sequences encoding one or more Cascade Cas (eg, cas8e, cas11, cas7, cas5, and cas6; or cas6, cas8b, cas7, and cas5) that are operable with the Cas nuclease to modify a cognate protospacer sequence.

[00047] The nucleic acid(s) is(are) preferably devoid of an adaptation module. Optionally, the module encodes a Cas1 and a Cas2; or a Cas1, a Cas2 and a Cas4

[00048] In an embodiment, a said nucleic acid comprises a CRISPR array encoding crRNAs, such as an array comprising at least 3, 4 or 5 spacer sequences targeting at least 3, 4 or 5 sequences of the cell respectively. For example, a plurality of chromosomal intergenic regions are targeted. Optionally, each spacer sequence consists of from 20 to 50, 20 to 40, 22 to 40, 25 to 40 or 30 to 35 consecutive nucleotides, eg, 32 or 37 nucleotides.

[00049] In an example, the array comprises the following spacer sequences (Spacers 1-3): TGATTGACGGCTACGGTAAACCGGCAACGTTC; GCTGTTAACGTACGTACCGCGCCGCATCCGGC; and CGGACTTAGTGCCAAAACATGGCATCGAAATT separated by repeat sequence (ie, Spacer 1 - repeat - Spacer 2 - repeat - Spacer 3).

[00050] In another example, the array comprises 3, 4 or 5 of the following spacer sequences (Spacers 4-8):

GCCATAATCTGGATCAGGAAGTCTTCCTTATCCATAT;

GGCTTTACGCCAGCGACGTATTGCCACAGGAATAACT;

GGGGATAGCGCGCCTGGAGCGTGCGATAGAGACTTTG; [00051] GGCATTTACCGACCAGCCCATCAGCAGTACAGCAAAC; and TCCTGAATCAAATCCGCCTGTGGCAGGCCATAGCCCG separated by repeat sequence (ie, Spacer 4 - repeat - Spacer 5 - repeat - Spacer 6- repeat - Spacer 7 - repeat - Spacer 8).

[00052] Optionally, each repeat sequence consists of from 20 to 50, 20 to 40, 22 to 40, 25 to 40 or 30 to 35 consecutive nucleotides, eg, 29 nucleotides. For example, each repeat sequence consists of: GAGTTCCCCGCGCCAGCGGGGATAAACCG (and optionally the Cas is/are E coli Cas). In another example, each repeat sequence consists of: (and optionally the Cas is/are C dificile Cas). [00053] Optionally, each crRNA is expressed from the nucleic acid(s) under the control of a common or respective constitutive promoter.

[00054] Optionally, each Cas is expressed from the nucleic acid(s) under the control of a common or respective constitutive promoter. In an embodiment, the first crRNA and C1 are expressed under the control of a common constitutive promoter and/or the second crRNA and C2 are expressed under the control of a common constitutive promoter. For example, the promoters are the same promoter or they are different promoters. In an example, one, more of all of said promoters is a strong promoter.

A promoter may be any promoter disclosed in W02020078893 or US20200115716, the disclosures of such promoters (and nucleic acids, operons and vectors comprising one or more such promoters) being expressly incorporated herein by reference for possible use in the present invention.

[00055] In an embodiment, a first plurality of different crRNAs are expressed in one or more of the in each cell, wherein each crRNA is operable with CS 1 to guide modification of the genome and the plurality targets at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 (preferably, at least 2, 3, 4 or 5; or exactly 2, 3, 4 or 5) different protospacers comprised by the genome of the cell; and/or a second plurality of different crRNAs are expressed in each cell wherein each crRNA is operable with CS2 and the second plurality targets at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 (preferably, at least 2, 3, 4 or 5; or exactly 2, 3, 4 or 5) different comprised by the genome of the cell. For example, the first plurality comprises from 2 to 10, eg, from 2 to 7, different crRNAs. For example, the second plurality comprises from 2 to 10, eg, from 2 to 7, different crRNAs.

[00056] Optionally, one or more or all of said cells are killed by the method. Optionally, the growth or proliferation of one or more or all of said cells is reduced by the method. Usefully, when the cell is a prokaryotic cell (eg, a bacterial or archaeal cell) the chromosome of the cell is cut by Cas. For example, a bacterial cell chromosome is cut by C1 and C2 and the cell is killed.

[00057] Optionally, the first crRNA (or each crRNA of said first plurality) is comprised by a guide RNA wherein the guide RNA further comprises a tracrRNA and/or the second crRNA (or each crRNA of said second plurality) is comprised by a guide RNA wherein the guide RNA further comprises a tracrRNA. Optionally, the first crRNA (or each crRNA of said first plurality) is comprised by a chimaeric guide RNA and/or the second crRNA (or each crRNA of said second plurality) is comprised by a chimaeric guide RNA.

[00058] For example, the genome modification of a plurality of cells is cutting of genomic nucleic acid (eg, chromosomal DNA) and the cells are killed, wherein said killing of the plurality of cells is synergistic compared to killing using C1 or C2 alone.

[00059] An aspect provides

A method of killing or reducing the growth or proliferation of a plurality of cells (optionally prokaryotic cells, such as bacterial cells) of a first species or strain, the method comprising carrying out the method of the invention using the cells, wherein C 1 and/or C2 is a Cas nuclease and the genomes of the cells are cut by Cas nuclease cutting and the cells are killed or the growth or proliferation of the cells is reduced.

[00060] Optionally, as exemplified herein, the method reduces the number of cells of said plurality at least 10 ⁵ , 10 ⁶ or 10 ^{7 -} fold, eg, between 10 ⁵ and 10 ⁷ -fold, or between 10 ⁵ and 10 ⁸ -fold or between 10 ⁵ and 10 ⁹ -fold. The skilled person will be familiar with determining fold-killing or reduction in cells, eg, using a cell sample that is representative of a microbiome or cell population. An illustrative example is given in the Examples below. For example, the extent of killing or reduction in growth or proliferation is determined using a cell sample, eg, a sample obtained from a subject to which the composition of the invention has been administered, or an environmental sample (eg, aqueous, water or soil sample) obtained from an environment (eg, a water source, waterway or field) that has been contacted with the composition of the invention.

[00061] For example, the method reduces the number of cells of said plurality at least 10 ⁵ , 10 ⁶ or 10 ⁷ - fold and optionally the plurality comprises at least 100,000; 1,000,000; or 10,000,000 cells respectively.

[00062] Optionally, the plurality of cells is comprised by a cell population, wherein at least 5, 6 or 7 log 10 of cells of the population are killed by the method, and optionally the plurality comprises at least 100,000; 1,000,000; or 10,000,000 cells respectively.

[00063] When a cell herein is a bacterial cell, it may be of a first species or genus selected from Table 1. Similarly, a plurality of cells herein may be cells which are of a species or genus selected from Table 1.

[00064] Optionally, as exemplified herein, the method kills at least 99%. 99.9%. 99.99%, 99.999%, 99.9999% or 99.99999% cells of said plurality.

[00065] In an example, the method is carried out on a population (or said plurality) of said cells and the method kills, modifies or edits all (or essentially all) of the cells of said population (or said plurality). In an example, the method is carried out on a population (or said plurality) of said cells and the method kills, modifies or edits 100% (or about 100%) of the cells of said population (or plurality). [00066] Optionally, the species is E coli or C difficile.

[00067] An aspect of the invention provides :-

A method of editing the genome of one or more cells, the method comprising

(a) modifying the genome of each cell by carrying out the method of the invention, wherein the genome is subjected to Cas cutting; and

(b) inserting a nucleic acid at or adjacent to a Cas cut site in the genome and/or deleting a nucleic acid sequence from the genome at or adjacent to a Cas cut site in the genome, wherein a cell with an edited genome is produced; and

(c) optionally isolating from the cell a nucleic acid comprising the insertion or the deletion; or sequencing a nucleic acid sequence of the cell wherein the nucleic acid sequence comprises the insertion or the deletion.

[00068] In an example, the method is carried out on a population of said cells, wherein the population comprises at least 100 of said cells and at least 90 or 99% of said cells are edited.

[00069] In an embodiment, the method is a method of recombineering, eg, in one or more E coli cells. [00070] The insertion may be immediately adjacent to, or overlapping the cut site, or the insertion may be within lkb, 2kb or 200, 150, 100, 50, 25, 10 or 5 nucleotides of the cut site. For example, the nucleic acid is inserted by homologous recombination. In an embodiment, the nucleic acid is inserted by homologous recombination and replaces (the sequence is inserted in the place of genome sequence that is deleted) genome sequence of 1 to 100, 90, 80, 70, 60, 50, 40, 30, 20, 10 or 5kb, or 200, 150, 100, 50, 25, 10 or 5 nucleotides of the genome. For example, the deleted genome sequence flanks either side of the cut site, or is at the 5’- or 3 ’-side of the cut site. In an embodiment, the nucleic acid is inserted by homologous recombination and does not replace any genomic sequence.

[00071] The deletion may be immediately adjacent to, or overlapping the cut site, or the deletion may be within lkb, 2kb or 200, 150, 100, 50, 25, 10 or 5 nucleotides of the cut site. For example, deletion is a deletion of 1 to 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2 or lkb, or 200, 150, 100, 50, 25, 10 or 5 nucleotides of the genome. For example, the deleted genome sequence flanks either side of the cut site, or is at the 5’- or 3 ’-side of the cut site.

[00072] For example, the inserted nucleic acid is DNA. For example, the deleted nucleic acid is DNA, eg, chromosomal or episomal DNA).

[00073] For example, the inserted nucleic acid is at least (or no more than) 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2 or lkb; or 200, 150, 100, 50, 25, 10 or 5 consecutive nucleotides in length. For example, the deleted genomic nucleic acid is at least (or no more than) 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2 or lkb; or 200, 150, 100, 50, 25, 10 or 5 consecutive nucleotides in length. [00074] For example, the genomic sequence is DNA. For example, genomic DNA is deleted or replaced. For example, genomic DNA is deleted or replaced and the editing inserts DNA sequence into the genome (eg, at or flanking the cut site).

[00075] For example, the genomic sequence is RNA. For example, genomic RNA is deleted or replaced. For example, genomic RNA is deleted or replaced and the editing inserts RNA sequence into the genome (eg, at or flanking the cut site).

[00076] Optionally, the method further comprises

(a) culturing the modified cell(s) to produce progeny thereof; and optionally isolating the progeny cells; or

(b) inserting a sequence obtained from a cell in step (c) into a recipient cell and growing a cell line therefrom.

[00077] Optionally, the progeny cells or cell line expresses a protein, wherein the protein is encoded (all or in part) by a nucleotide sequence that comprises the inserted nucleic acid sequence, the method further comprising obtaining the expressed protein or isolating the expressed protein from the cells or cell line.

[00078] Optionally, the method further comprises combining the progeny cells, cell line or protein with a pharmaceutically acceptable carrier, diluent or excipient, thereby producing a pharmaceutical composition.

[00079] In an embodiment, the inserted nucleic acid comprises a transcription and/or translation regulatory element for controlling expression of one or more nucleic acid sequences of the edited genome that are adjacent to the insertion. For example, the inserted nucleic acid comprises a promoter, eg, a constitutive or strong promoter. In another example, the element is a transcription or translation terminator, eg, the inserted sequence comprises a stop codon. In this way, transcription of a gene (or a part of a gene) that is adjacent to the inserted sequence in the edited genome is terminated or prevented or reduced.

[00080] In an example, the deleted genomic sequence is a RNA (eg, mRNA) sequence. For example, the deletion of the RNA sequence reduces or prevents expression of an amino acid sequence in the cell, wherein the amino acid sequence is encoded by the deleted RNA sequence. This may be useful for reducing or preventing expression in the cell of a protein comprising the amino acid sequence, such as where the protein is not desirable or required or detrimental to the cell or is a subject or environment that comprises the cell.

[00081] An aspect provides:-

A method of treating or preventing a disease or condition in a human or animal subject, the method comprising (i) administering to the subject a pharmaceutical composition according to the invention wherein the composition comprises said protein, wherein the protein mediates treatment or prevention of the disease or condition; or (ii) administering to the subject a pharmaceutical composition according to the invention, wherein when the composition comprises said progeny cells or cell line, the cells or cell line expresses a protein or RNA in the subject, and wherein the protein or RNA mediates treatment or prevention of the disease or condition.

[00082] Example diseases and conditions are disclosed below.

[00083] For example, the RNA encodes a therapeutic or prophylactic protein that is expressed in the subject. For example, the protein is a therapeutic or prophylactic protein. The protein may exert a therapeutic or prophylactic cell by interacting with a further protein (eg, an endogenously-encoded protein) in the subject, or by interacting with a further cell of the subject.

[00084] Optionally, the protein is an antibiotic, antibacterial agent, enzyme, growth factor, antigen- binding protein (eg, an antibody or fragment thereof), hormone, blood component, cytokine, immune checkpoint modulator (eg, inhibitor or upregulator), analgesic, neurotransmitter, anti-inflammatory agent or anti-neoplastic agent.

[00085] Optionally, the plurality of cells is comprised by a microbiome sample, wherein the method is carried out in vitro and produces a modified cell sample in which cells of the first species or strain have been killed, the method further comprising combining the modified sample with a pharmaceutically acceptable carrier, diluent or excipient, thereby producing a pharmaceutical composition comprising a cell transplant. For example, the transplant may be administered to the gastrointestinal (GI) tract or gut of a human or animal subject, eg, by oral administration, or by rectal administration. For example the transsplant may be administered by vaginal administration.

[00086] Optionally, a microbiome herein is a gut, lung, kidney, urethral, bladder, blood, vaginal, eye, ear, nose, penile, bowel, liver, heart, tongue, hair or skin microbiome.

[00087] An aspect provides :-

A method of treating or preventing a disease or condition in a human or animal subject, the method comprising administering to the subject a pharmaceutical composition of the invention.

[00088] An aspect provides :-

An ex vivo or in vitro method of treating an environment or cell sample, the method comprising exposing the environment or sample to a composition of the invention, wherein cells comprised by the environment or sample are modified, edited or killed, or the growth or proliferation of cells of the environment or sample is reduced.

For example, the cells are killed. For example, the cells are edited by the editing method of the invention. Optionally, the treated sample is administered to a human or animal subject or is contacted with an environment. [00089] Optionally, the plurality of cells is comprised by an environmental sample (eg, an aqueous, water, oil, petroleum, soil or fluid (such as an air or liquid) sample). A suitable environment may be contents of an industrial or laboratory apparatus or container, eg, a fermentation vessel.

[00090] Optionally, the method of the invention is carried out in vitro. Optionally, the method of the invention is carried out ex vivo.

[00091] An aspect provides:-

A composition for use in a method treating or preventing a disease or condition in a human or animal subject that is mediated by target cells, the composition comprising components (a), (b) or (d):-

(a) first and second crRNAs;

(b) nucleic acid encoding first and second crRNAs, wherein the nucleic acid is expressible in a target cell for producing the crRNAs;

(c) a first nucleic acid encoding a first crRNA, and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressible in a target cell for producing the crRNAs; or

(d) a first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressible in a target cell for producing the second crRNA; wherein

(e) the first crRNA (crRNA 1) is capable of guiding a first Cas (C1) to a protospacer sequence (PS1) comprised by a target cell genome to modify PS1; and

(f) the second crRNA (crRNA2) is capable of guiding a second Cas (C2) to a protospacer sequence (PS2) comprised by the target cell genome to modify PS2;

(g) C 1 and C2 are different;

(h) PS 1 and PS2 are different; and wherein the method comprises administering the composition to the subject whereby said components of the composition are introduced into target cells wherein crRNA 1, crRNA2, C1 and C2 are provided in each cell and the genome of each cell is subjected to Cas modification and the disease or condition is treated or prevented.

[00092] Optionally, the treating or preventing comprises carrying out the method of the invention. [00093] Optionally, the method is for reducing an infection of the subject by target cells (optionally wherein the target cells are pathogenic cells, such as pathogenic prokaryotic cells, such as pathogenic bacterial cells).

[00094] Optionally, the components are comprised by one (or one or more) nucleic acid vectors. In an example, each vector is a virus, phage, plasmid (eg, a conjugative plasmid), cosmid, phagemid or nanoparticle (eg, a liposome). [00095] In an example, any method herein is carried out on a population (or said plurality) of said cells, wherein the population comprises at least 100 of said cells and the genome of at least 90, 99, 99.9, 99.99, 99.999, 99.9999, 99.99999, 99.999999, 99.9999999, 99.99999999 or 99.999999999% of said cells are modified, eg, subjected to Cas nuclease cutting. In an embodiment, the population (or said plurality) comprises at least 1000 of said cells. In an embodiment, the population (or said plurality) comprises at least 10,000 of said cells. In an embodiment, the population (or said plurality) comprises at least 100,000 of said cells. In an embodiment, the population (or said plurality) comprises at least 1,000,000 of said cells. In an embodiment, the population (or said plurality) comprises at least 10,000,000 of said cells. In an embodiment, the population (or said plurality) comprises at least 100,000,000 of said cells. In an embodiment, the population (or said plurality) comprises at least 1000,000,000 of said cells. In an embodiment, the population (or said plurality) comprises at least 10,000,000,000 of said cells.

[00096] In an example, the population or said plurality is comprised by a microbiome of a human, animal (eg, a livestock animal or companion pet), plant or environment (eg, a waterway, soil, fluid microbiome).

[00097] An aspect provides

A composition comprising components (a), (b) or (d):-

(a) first and second crRNAs;

(b) nucleic acid encoding first and second crRNAs, wherein the nucleic acid is expressible in a target cell for producing the crRNAs;

(c) a first nucleic acid encoding a first crRNA, and a second nucleic acid encoding a second crRNA, wherein the nucleic acids are expressible in a target cell for producing the crRNAs; or

(d) a first crRNA and a nucleic acid encoding a second crRNA, wherein the nucleic acid is expressible in a target cell for producing the second crRNA; wherein

(e) the first crRNA (crRNA 1) is capable of guiding a first Cas (C1) to a protospacer sequence (PS1) comprised by a target cell genome to modify PS1; and

(f) the second crRNA (crRNA2) is capable of guiding a second Cas (C2) to a protospacer sequence (PS2) comprised by the target cell genome to modify PS2;

(g) C 1 and C2 are different;

(h) PS 1 and PS2 are different; and wherein when said components of the composition are introduced into a target cell whereby crRNA 1, crRNA2, Cl and C2 are provided in the cell, the genome of the cell is subjected to Cas modification.

[00098] Optionally, the genome of each cell is edited or the cell is killed.

[00099] Optionally, each cell is a prokaryotic cell (optionally bacterial or archaeal cell). [000100] Optionally, said nucleic acid(s) is(are) comprised by a vims (eg, an AAV, or cytomegalovirus, optionally wherein each cell is a mammalian cell, such as a human cell), phage (eg, wherein each cell is a bacterial cell), plasmid (optionally a conjugative plasmid, eg, wherein each cell is a bacterial cell), nanoparticle (eg, a liposome or gold particle) or phagemid (eg, wherein each cell is a bacterial cell).

[000101] When the nucleic acid is comprised by a vims, the cell may be a mammalian (eg, human or rodent, mouse or rat) cell, a bacterial cell, an archaeal cell or an amoeba cell. When the nucleic acid is comprised by a phage, the cell may be a bacterial cell.

[000102] Optionally, said nucleic acid(s) encode C1 and/or C2.

[000103] Optionally, C1 is a Type I Cas and said nucleic acid(s) encode one or more Cascade Cas that are operable with C1 and/or wherein C2 is a Type I Cas and said nucleic acid(s) encode one or more Cascade Cas that are operable with C2.

[000104] An aspect provides:-

A pharmaceutical composition which is a composition according to the invention, wherein the composition comprises a pharmaceutically acceptable excipient, diluent or carrier.

[000105] The composition may be an aqueous composition. The composition may be a lyophilised or freeze-dried composition, eg, in a formulation that is suitable for inhaled delivery to the patient.

[000106] Optionally, the composition is comprised by a sterile medicament administration device, optionally a syringe, IV bag, intranasal delivery device, inhaler, nebuliser or rectal administration device). Optionally, the composition is comprised by a cosmetic product, dental hygiene product, personal hygiene product, laundry product, oil or petroleum additive, water additive, shampoo, hair conditioner, skin moisturizer, soap, hand detergent, clothes detergent, cleaning agent, environmental remediation agent, cooling agent (eg, an air cooling agent) or air treatment agent. [000107] In an example the composition is comprised by a device for delivering the composition as a liquid or dry powder spray. This may be useful for administration topically to patients or for administration to large environmental areas, such as fields or waterways.

[000108] Optionally, the cells are comprise by a gut, lung, kidney, urethral, bladder, blood, vaginal or skin microbiome of the subject.

[000109] Optionally, the method is carried out on a human or animal subject, wherein the cells are killed by the method and the killing upregulates or downregulates immune cells (optionally (i) upregulating CD8 ⁺ , CD4 ⁺ ,TH1, TH2, TH17, NK cells, TILS. T regulatory or T effector cells; or (ii) downregulating CD8 ⁺ , CD4 ⁺ ,TH1, TH2, TH17, T regulatory or T effector cells) in the subject, thereby treating or preventing a disease or condition in the subject. In one preferred embodiment, CD8 ⁺ , NK or TILS cells are upregulated, eg, wherein the disease or condition is a cancer. In one preferred embodiment, CD8 ⁺ or NK cells are upregulated, eg, wherein the disease or condition is a viral infection. In one preferred embodiment, TH1, TH2 or TH17 cells are downregulated, eg, wherein the disease or condition is an autoimmune or inflammatory disease or condition. For example, the disease or condition is a cancer or an autoimmune disease or condition. For example, the disease or condition is a cancer and CD8 ⁺ or T effector cells are upregulated in the subject and/or T regulatory cells are downregulated in the subject. For example, the disease or condition is an autoimmune disease or condition and CD8 ⁺ or T effector cells are downregulated in the subject and/or T regulatory cells are upregulated in the subject.

[000110] Optionally, the method comprises introducing into each cell or expressing in each cell at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 (preferably, at least 2, 3, 4 or 5; or exactly 2, 3, 4 or 5, or exactly 8, or at least 8) different types of crRNAs wherein the different types target different protospacer sequences comprised by the cell genome; and optionally wherein Cl and C2 are Class 1 Cas nucleases, eg, Cas 3 nucleases.

[000111] Optionally, the method comprises introducing into each cell a nucleic acid encoding a Cas3, Cas8e, Casl 1, Cas7, Cas5, and Cas6 (optionally, the Cas are E coli Cas) and/or a nucleic acid encoding a Cas3, Cas6, Cas8b, Cas7, and Cas5 (optionally, the Cas are C dificile Cas).

[000112] In another example, the method comprises introducing into each cell a nucleic acid encoding a Cas3, Cas8e, Casl 1, Cas7, Cas5, and a nucleic acid encoding a Cas9. In another example, the method comprises introducing into each cell a nucleic acid encoding a Cas3, Cas6, Cas8b, Cas7, and Cas5 and a nucleic acid encoding a Cas9.

[000113] An aspect provides:

A method of modifying the genome of a cell, the method comprising

(a) using a first CRISPR/Cas system to modify a first protospacer of the genome; and

(b) using a second CRISPR/Cas system to modify a second protospacer of the genome, wherein the second protospacer is different to the first protospacer; wherein the systems comprise different Cas and are provided simultaneously in the cell.

[000114] Optionally, the method comprises using a third CRISPR/Cas system to modify a third protospacer of the genome, wherein the third protospacer is different to the first and second protospacers. For example, 3 different Cas3 are used; 3 different Cas9 are used; a Cas3 and two different Cas9 are used; or two different Cas3 and a Cas9 are used.

[000115] The method of claim 51, wherein the method is according to any one of claims 1 to 35.

[000116] In certain aspects:-

The method of the invention is a method of (a) producing synergistic Cas nuclease cutting of a cell genome;

(b) reducing a population of cells of a first species or strain by at least 100,000, 1,000,000 or 10,000,000-fold;

(c) killing at least at least 99%. 99.9%. 99.99%, 99.999%, 99.9999% or 99.99999% cells of a first species or strain comprised by a microbiome;

(d) producing synergistic Class 1 Cas modification of a cell genome; or

(e) reducing bacterial cells of a first species or strain (eg, E coli cells) in a cell population by at least 10 ⁵ , 10 ⁶ or 10 ⁷ -fold, wherein the population comprises at least 100,000; 1,000,000; or 10,000,000 cells respectively.

[000117] DISEASES AND CONDITIONS

Optionally, the disease or condition is selected from

(a) A neurodegenerative disease or condition;

(b) A brain disease or condition;

(c) A CNS disease or condition;

(d) Memory loss or impairment;

(e) A heart or cardiovascular disease or condition, eg, heart attack, stroke or atrial fibrillation;

(f) A liver disease or condition;

(g) A kidney disease or condition, eg, chronic kidney disease (CKD);

(h) A pancreas disease or condition;

(i) A lung disease or condition, eg, cystic fibrosis or COPD;

(j) A gastrointestinal disease or condition;

(k) A throat or oral cavity disease or condition;

(l) An ocular disease or condition;

(m) A genital disease or condition, eg, a vaginal, labial, penile or scrotal disease or condition;

(n) A sexually-transmissible disease or condition, eg, gonorrhea, HIV infection, syphilis or Chlamydia infection;

(o) An ear disease or condition;

(p) A skin disease or condition;

(q) A heart disease or condition;

(r) A nasal disease or condition

(s) A haematological disease or condition, eg, anaemia, eg, anaemia of chronic disease or cancer;

(t) A viral infection;

(u) A pathogenic bacterial infection;

(v) A cancer;

(w) An autoimmune disease or condition, eg, SLE; (x) An inflammatory disease or condition, eg, rheumatoid arthritis, psoriasis, eczema, asthma, ulcerative colitis, colitis, Crohn’s disease or IBD;

(y) Autism;

(z) ADHD;

(aa) Bipolar disorder;

(bb) ALS [Amyotrophic Lateral Sclerosis];

(cc) Osteoarthritis;

(dd) A congenital or development defect or condition;

(ee) Miscarriage;

(ff) A blood clotting condition;

(gg) Bronchitis;

(hh) Dry or wet AMD;

(ii) Neovascularisation (eg, of a tumour or in the eye);

(jj) Common cold;

(kk) Epilepsy;

(11) Fibrosis, eg, liver or lung fibrosis;

(mm) A fungal disease or condition, eg, thrush;

(nn) A metabolic disease or condition, eg, obesity, anorexia, diabetes, Type I or Type II diabetes

(oo) Ulcer(s), eg, gastric ulceration or skin ulceration;

(pp) Dry skin;

(qq) Sjogren’s syndrome;

(rr) Cytokine storm;

(ss) Deafness, hearing loss or impairment;

(tt) Slow or fast metabolism (ie, slower or faster than average for the weight, sex and age of the subject);

(uu) Conception disorder, eg, infertility or low fertility;

(vv) Jaundice;

(ww) Skin rash;

(xx) Kawasaki Disease;

(yy) Lyme Disease;

(zz) An allergy, eg, a nut, grass, pollen, dust mite, cat or dog fur or dander allergy;

(aaa) Malaria, typhoid fever, tuberculosis or cholera;

(bbb) Depression;

(ccc) Mental retardation;

(ddd) Microcephaly;

(eee) Malnutrition;

(fff) Conjunctivitis; (ggg) Pneumonia;

(hhh) Pulmonary embolism;

(iii) Pulmonary hypertension;

(jjj) A bone disorder;

(kkk) Sepsis or septic shock;

(111) Sinusitus;

(mmm) Stress (eg, occupational stress);

(nnn) Thalassaemia, anaemia, von Willebrand Disease, or haemophilia;

(ooo) Shingles or cold sore;

(ppp) Menstruation;

(qqq) Low sperm count.

NEURODEGENERATIVE OR CNS DISEASES OR CONDITIONS FOR TREATMENT OR PREVENTION

[00113] In an example, a neurodegenerative or CNS disease or condition is selected from the group consisting of Alzheimer disease , geriopsychosis, Down syndrome, Parkinson's disease, Creutzfeldt- jakob disease, diabetic neuropathy, Parkinson syndrome, Huntington's disease, Machado-Joseph disease, amyotrophic lateral sclerosis, diabetic neuropathy, and Creutzfeldt Creutzfeldt- Jakob disease. For example, the disease is Alzheimer disease. For example, the disease is Parkinson syndrome.

[00114] In an example, wherein the method of the invention is practised on a human or animal subject for treating a CNS or neurodegenerative disease or condition, the method causes downregulation of Treg cells in the subject, thereby promoting entry of systemic monocyte-derived macrophages and/or Treg cells across the choroid plexus into the brain of the subject, whereby the disease or condition (eg, Alzheimer’s disease) is treated, prevented or progression thereof is reduced. In an embodiment the method causes an increase of IFN-gamma in the CNS system (eg, in the brain and/or CSF) of the subject. In an example, the method restores nerve fibre and//or reduces the progression of nerve fibre damage. In an example, the method restores nerve myelin and//or reduces the progression of nerve myelin damage. In an example, the method of the invention treats or prevents a disease or condition disclosed in WO2015136541 and/or the method can be used with any method disclosed in WO2015136541 (the disclosure of this document is incorporated by reference herein in its entirety, eg, for providing disclosure of such methods, diseases, conditions and potential therapeutic agents that can be administered to the subject for effecting treatement and/or prevention of CNS and neurodegenerative diseases and conditions, eg, agents such as immune checkpoint inhibitors, eg, anti- PD-1, anti-PD-Ll, anti-TIM3 or other antibodies disclosed therein). CANCERS FOR TREATMENT OR PREVENTION

[00115] Cancers that may be treated include tumours that are not vascularized, or not substantially vascularized, as well as vascularized tumours. The cancers may comprise non-solid tumours (such as haematological tumours, for example, leukaemias and lymphomas) or may comprise solid tumours. Types of cancers to be treated with the invention include, but are not limited to, carcinoma, blastoma, and sarcoma, and certain leukaemia or lymphoid malignancies, benign and malignant tumours, and malignancies e.g., sarcomas, carcinomas, and melanomas. Adult tumours/cancers and paediatric tumours/cancers are also included.

[00116] Haematologic cancers are cancers of the blood or bone marrow. Examples of haematological (or haematogenous) cancers include leukaemias, including acute leukaemias (such as acute lymphocytic leukaemia, acute myelocytic leukaemia, acute myelogenous leukaemia and myeloblasts, promyeiocytic, myelomonocytic, monocytic and erythroleukaemia), chronic leukaemias (such as chronic myelocytic (granulocytic) leukaemia, chronic myelogenous leukaemia, and chronic lymphocytic leukaemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent and high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myeiodysplastic syndrome, hairy cell leukaemia and myelodysplasia.

[00117] Solid tumours are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid tumours can be benign or malignant. Different types of solid tumours are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumours, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumour, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous eel! carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumour, cervical cancer, testicular tumour, seminoma, bladder carcinoma, melanoma, and CNS tumours (such as a glioma (such as brainstem glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocytoma, CNS lymphoma, germinoma, medulloblastoma, Schwannoma craniopharyogioma, ependymoma, pineaioma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma, retinoblastoma and brain metastases).

[00118] AUTOIMMUNE DISEASES FOR TREATMENT OR PREVENTION

• Acute Disseminated Encephalomyelitis (ADEM)

• Acute necrotizing hemorrhagic leukoencephalitis

• Addison’s disease Agammaglobulinemia Alopecia areata Amyloidosis Ankylosing spondylitis Anti-GBM/Anti-TBM nephritis Antiphospholipid syndrome (APS)

Autoimmune angioedema Autoimmune aplastic anemia Autoimmune dysautonomia Autoimmune hepatitis Autoimmune hyperlipidemia Autoimmune immunodeficiency Autoimmune inner ear disease (AIED)

Autoimmune myocarditis

Autoimmune oophoritis

Autoimmune pancreatitis

Autoimmune retinopathy

Autoimmune thrombocytopenic purpura (ATP)

Autoimmune thyroid disease

Autoimmune urticaria

Axonal & neuronal neuropathies

Balo disease

Behcet’s disease

Bullous pemphigoid

Cardiomyopathy

Castleman disease

Celiac disease

Chagas disease

Chronic fatigue syndrome

Chronic inflammatory demyelinating polyneuropathy (CIDP) Chronic recurrent multifocal ostomyelitis (CRMO) Churg-Strauss syndrome

Cicatricial pemphigoid/benign mucosal pemphigoid

Crohn’s disease

Cogans syndrome

Cold agglutinin disease

Congenital heart block • Coxsackie myocarditis

• CREST disease

• Essential mixed cryoglobulinemia

• Demyelinating neuropathies

• Dermatitis herpetiformis

• Dermatomyositis

• Devic’s disease (neuromye litis optica)

• Discoid lupus

• Dressier’ s syndrome

• Endometriosis

• Eosinophilic esophagitis

• Eosinophilic fasciitis

• Erythema nodosum

• Experimental allergic encephalomyelitis

• Evans syndrome

• Fibromyalgia

• Fibrosing alveolitis

• Giant cell arteritis (temporal arteritis)

• Giant cell myocarditis

• Glomerulonephritis

• Goodpasture’s syndrome

• Granulomatosis with Polyangiitis (GPA) (formerly called Wegener’s Granulomatosis)

• Graves’ disease

• Guillain-Barre syndrome

• Hashimoto’s encephalitis

• Hashimoto’s thyroiditis

• Hemolytic anemia

• Henoch-Schonlein purpura

• Herpes gestationis

• Hypogammaglobulinemia

• Idiopathic thrombocytopenic purpura (ITP)

• IgA nephropathy

• IgG4-related sclerosing disease

• Immunoregulatory lipoproteins

• Inclusion body myositis

• Interstitial cystitis

• Juvenile arthritis • Juvenile diabetes (Type 1 diabetes)

• Juvenile myositis

• Kawasaki syndrome

• Lambert-Eaton syndrome

• Leukocytoclastic vasculitis

• Lichen planus

• Lichen sclerosus

• Ligneous conjunctivitis

• Linear IgA disease (LAD)

• Lupus (SLE)

• Lyme disease, chronic

• Meniere’s disease

• Microscopic polyangiitis

• Mixed connective tissue disease (MCTD)

• Mooren’s ulcer

• Mucha-Habermann disease

• Multiple sclerosis

• Myasthenia gravis

• Myositis

• Narcolepsy

• Neuromye litis optica (Devic’s)

• Neutropenia

• Ocular cicatricial pemphigoid

• Optic neuritis

• Palindromic rheumatism

• PANDAS (Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus)

• Paraneoplastic cerebellar degeneration

• Paroxysmal nocturnal hemoglobinuria (PNH)

• Parry Romberg syndrome

• Parsonnage -Turner syndrome

• Pars planitis (peripheral uveitis)

• Pemphigus

• Peripheral neuropathy

• Perivenous encephalomyelitis

• Pernicious anemia

• POEMS syndrome Polyarteritis nodosa

Type I, II, & III autoimmune polyglandular syndromes

Polymyalgia rheumatica

Polymyositis

Postmyocardial infarction syndrome

Postpericardiotomy syndrome

Progesterone dermatitis

Primary biliary cirrhosis

Primary sclerosing cholangitis

Psoriasis

Psoriatic arthritis

Idiopathic pulmonary fibrosis

Pyoderma gangrenosum

Pure red cell aplasia

Raynauds phenomenon

Reactive Arthritis

Reflex sympathetic dystrophy

Reiter’s syndrome

Relapsing polychondritis

Restless legs syndrome

Retroperitoneal fibrosis

Rheumatic fever

Rheumatoid arthritis

Sarcoidosis

Schmidt syndrome

Scleritis

Scleroderma

Sjogren’s syndrome

Sperm & testicular autoimmunity

Stiff person syndrome

Subacute bacterial endocarditis (SBE)

Susac’s syndrome Sympathetic ophthalmia Takayasu’s arteritis Temporal arteritis/Giant cell arteritis Thrombocytopenic purpura (TTP)

Tolosa-Hunt syndrome • Transverse myelitis

• Type 1 diabetes

• Ulcerative colitis

• Undifferentiated connective tissue disease (UCTD)

• Uveitis

• Vasculitis

• Vesiculobullous dermatosis

• Vitiligo

• Wegener’s granulomatosis (now termed Granulomatosis with Polyangiitis (GPA).

[00119] INFUAMMATORY DISEASES FOR TREATMENT OR PREVENTION

• Alzheimer's

• ankylosing spondylitis

• arthritis (osteoarthritis, rheumatoid arthritis (RA), psoriatic arthritis)

• asthma

• atherosclerosis

• Crohn's disease

• colitis

• dermatitis

• diverticulitis

• fibromyalgia

• hepatitis

• irritable bowel syndrome (IBS)

• systemic lupus erythematous (SUE)

• nephritis

• Parkinson's disease

• ulcerative colitis.

[000120] Optionally, the cells are C dificile, P aeruginosa, K pneumoniae (eg, carbapenem- resistant Klebsiella pneumoniae or Extended-Spectrum Beta-Lactamase (ESBL)-producing K pneumoniae), E coli (eg, ESBL-producing E. coli, or E. coli ST131-025b:H4), El pylori, S pneumoniae or S aureus cells.

[000121] A vector herein may be a high copy number plasmid or phagemid comprising a constitutive promoter for controlling the expression of crRNAs and optionally one or more Cas proteins [000122] In an example, promoter is a medium strength promoter. In another example, the promoter is a repressible promoter or an inducible promoter cell. Examples of suitable repressible promoters are Ptac (repressed by lacl) and the Leftward promoter (pL) of phage lambda (which repressed by the λcI repressor). In an example, the promoter comprises a repressible operator (eg, tetO or lacO) fused to a promoter sequence. Optionally, the promoter has an Anderson Score (AS) of 0.5>AS >0.1.

GENERALLY APPLICABLE FEATURES:

[000123] Any cell herein may be a bacterial cell, archaeal cell, algal cell, fungal cell, protozoan cell, invertebrate cell, vertebrate cell, fish cell, bird cell, mammal cell, companion animal cell, dog cell, cat cell, horse cell, mouse cell, rat cell, rabbit cell, eukaryotic cell, prokaryotic cell, human cell, animal cell, rodent cell, insect cell or plant cell. Preferably, the cell is a bacterial cell. Alternatively, the cell is a human cell.

[000124] Optionally, Cl and C2 is any Cas (eg, a Cas2, 3, 4, 5, or 6) of a Type I system. In this example, in an embodiment, the Cas may be fused or conjugated to a moiety that is operable to increase or reduce transcription of a gene comprising the target protospacer sequence. For example the nucleic acid encoding the Cas that is introduced into a cell may comprise a nucleotide sequence encoding the moiety, wherein the Cas and moiety are expressed in the host cell as a fusion protein. In one embodiment, the Cas is N-terminal of the moiety; in another embodiment it is C-terminal to the moiety.

[000125] In an example, a vector herein is a DNA vector, eg, ssDNA vector or dsDNA vector. Optionally, the vector comprises a second nucleotide sequence encoding one or more Cascade proteins. For example, the Cascade protein(s) are cognate with the C1 or C2, which is a Cas3. [000126] In an example, Casl or Cas2 is a Cas3 that is cognate with Cascade proteins encoded by the cell.

[000127] Optionally, the Cas3 is a Cas3 encoded by a CRISPR/Cas locus of a first bacterial or archaeal species, wherein in the locus the Cas3-encoding sequence is 3’ of Cascade protein-encoding sequences (ie, the latter are between the Cas3 and the 5 ’-most promoter of the locus). Optionally, the Cas3 is a ygcB protein.

[000128] Optionally, the Cascade proteins comprise or consist of cas5 (casD, csy2), cas6 (cas6f, cse3, casE), cas7 (csc2, csy3, cse4, casC) and cas8 (casA, cas8al, cas8bl, cas8c, caslOd, cas8e, csel, cas8f, csyl).

[000129] Optionally herein the promoter and the Cas3-encoding or crRNA-encoding sequence are spaced no more than 150, 100, 50, 40, 30, 20 or lObp apart, eg, from 30-45, or 30-40, or 39 or around 39bp apart. Optionally herein a ribosome binding site and the Cas3 -encoding or crRNA- encoding sequence are spaced no more than 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 4 or 3bp apart, eg, from 10-5, 6 or around 6bp apart. [000130] In an example, a promoter herein is in combination with a Shine-Dalgamo sequence comprising the sequence 5’- aaagaggagaaa-3 ’ (SEQ ID NO: 5) or a ribosome binding site homologue thereof. Optionally the promoter has an Anderson Score (AS) of AS ≥0.5; or an Anderson Score (AS) of 0.5>AS >0.1; or an Anderson Score (AS) of ≤0.1.

[000131] Optionally, the first crRNA-encoding nucleic acid sequence, the second crRNA- encoding nucleic acid sequence or operon is comprised by a mobile genetic element. Suitable mobile genetic elements, eg, transposons, are disclosed in WO2016177682 and US20170246221, the disclosures of which are explicitly incorporated herein for possible use in the invention and for providing one or more features for the claims herein.

[000132] Optionally, the vector is devoid of nucleotide sequence encoding one, more or all of a Cas1, Cas2, Cas4, Cas6 (optionally Cas6f), Cas7 and Cas 8 (optionaly Cas8f). Optionally, the vector is devoid of a sequence encoding a Cas6 (optionally a Cas6f). Optionally, tlhe vector comprises (optionally in 5’ to 3’ direction) nucleotide sequence encoding one, more or all of Casl 1, Cas7 and Cas8a1. Optionally, the vector comprises nucleotide sequence encoding Cas3’ and/or Cas3”. In one embodiment, the vector comprises nucleotide sequences (in 5 ’ to 3 ’ direction) that encode a Cas3 (eg, Cas3’ and/or Cas3”), Cas11, Cas7 and Cas8al.

[000133] Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Casl 1 sequence. Optionally, the vector comprises a Type IA CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[000134] Optionally, each cell comprises a Type IA CRISPR array that is cognate with the Cas3 (Cl or C2). Optionally, each cell comprises an endogenous Type IB, C, U, D, E or F CRISPR/Cas system. Optionally, the vector comprises (optionally in 5’ to 3’ direction) nucleotide sequence encoding one, more or all of Cas8bl, Cas7 and Cas5. In one embodiment, the vector comprises nucleotide sequences (in 5’ to 3’ direction) that encode a Cas3, Cas8bl, Cas7 and Cas5. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas8bl sequence. Optionally, the vector comprises a Type IB CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[000135] Optionally, the cell comprises a Type IB CRISPR array that is cognate with the Cas3. Optionally, the cell comprises an endogenous Type IA, C, U, D, E or F CRISPR/Cas system. Optionally, the vector comprises (optionally in 5’ to 3’ direction) nucleotide sequence encoding one, more or all of Cas5, Cas8c and Cas7. In one embodiment, the vector comprises nucleotide sequences (in 5’ to 3’ direction) that encode a Cas3, Cas5, Cas8c and Cas7. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas5 sequence. Optionally, the vector comprises a Type IC CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[000136] Optionally, the host cell comprises a Type IC CRISPR array that is cognate with the Cas3. Optionally, the host cell comprises an endogenous Type IA, B, U, D, E or F CRISPR/Cas system. Optionally, the vector comprises (optionally in 5’ to 3’ direction) nucleotide sequence encoding one, more or all of Cas8U2, Cas7, Cas5 and Cas6. In one embodiment, the vector comprises nucleotide sequences (in 5’ to 3’ direction) that encode a Cas3, Cas8U2, Cas7, Cas5 and Cas6. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas8U2 sequence.

[000137] Optionally, the vector comprises a Type IU CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[000138] Optionally, the host cell comprises a Type IU CRISPR array that is cognate with the Cas3. Optionally, the host cell comprises an endogenous Type IA, B, C, D, E or F CRISPR/Cas system. Optionally, the vector comprises (optionally in 5’ to 3’ direction) nucleotide sequence encoding one, more or all of CaslOd, Cas7 and Cas5. Optionally, the vector comprises a nucleotide sequence encoding Cas3’ and/or Cas3”. In one embodiment, the vector comprises nucleotide sequences (in 5’ to 3’ direction) that encode a Cas3, Cas10d, Cas7 and Cas5. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the CaslOd sequence. Optionally, the vector comprises a Type ID CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[000139] Optionally, the host cell comprises a Type ID CRISPR array that is cognate with the Cas3.

[000140] Optionally, the host cell comprises an endogenous Type IA, B, C, U, E or F CRISPR/Cas system.

[000141] Optionally, the vector comprises (optionally in 5’ to 3’ direction) nucleotide sequence encoding one, more or all of Cas8e, Cas11, Cas7, Cas5 and Cas6. In one embodiment, the vector comprises nucleotide sequences (in 5’ to 3’ direction) that encode a Cas3, Cas8e, Casl 1, Cas7, Cas5 and Cas6. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Casl 1 sequence. Optionally, the vector comprises a Type IE CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[000142] Optionally, the host cell comprises a Type IE CRISPR array that is cognate with the Cas3.

[000143] Optionally, the host cell comprises an endogenous Type IA, B, C, D, U or F CRISPR/Cas system.

[000144] Optionally, the vector comprises (optionally in 5’ to 3’ direction) nucleotide sequence encoding one, more or all of Cas8f, Cas5, Cas7 and Cas6f. In one embodiment, the vector comprises nucleotide sequences (in 5’ to 3’ direction) that encode a Cas3, Cas8f, Cas5, Cas7 and Cas6f. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas8f sequence. Optionally, the vector comprises a Type IF CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.

[000145] Optionally, the host cell comprises a Type IF CRISPR array that is cognate with the Cas3.

[000146] Optionally, the host cell comprises an endogenous Type IA, B, C, D, U or E CRISPR/Cas system.

[000147] Optionally, the Cas and Cascade are Type IA Cas and Cascade proteins.

[000148] Optionally, the Cas and Cascade are Type IB Cas and Cascade proteins.

[000149] Optionally, the Cas and Cascade are Type IC Cas and Cascade proteins.

[000150] Optionally, the Cas and Cascade are Type ID Cas and Cascade proteins.

[000151] Optionally, the Cas and Cascade are Type IE Cas and Cascade proteins.

[000152] Optionally, the Cas and Cascade are Type IF Cas and Cascade proteins.

[000153] Optionally, the Cas and Cascade are Type IU Cas and Cascade proteins.

[000154] Optionally, the Cas and Cascade are E coli (optionally Type IE or IF) Cas and Cascade proteins, optionally wherein the E coli is ESBL-producing E. coli or E. coli ST13 l-025b:H4. [000155] Optionally, the Cas and Cascade are Clostridium (eg, C dificile) Cas and Cascade proteins, optionally C dificile resistant to one or more antibiotics selected from aminoglycosides, lincomycin, tetracyclines, erythromycin, clindamycin, penicillins, cephalosporins and fluoroquinolones.

[000156] Optionally, the Cas and Cascade are Pseudomonas aeruginosa Cas and Cascade proteins, optionally P aeruginosa resistant to one or more antibiotics selected from carbapenems, aminoglycosides, cefepime, ceftazidime, fluoroquinolones, piperacillin and tazobactam.

[000157] Optionally, the Cas and Cascade are Klebsiella pneumoniae (eg, carbapenem-resistant Klebsiella pneumoniae or Extended-Spectrum Beta-Lactamase (ESBL)-producing K pneumoniae )

Cas and Cascade proteins.

[000158] Optionally, the Cas and Cascade are E coli, C difficile, P aeruginosa, K pneumoniae, Pfuriosus or B halodurans Cas and Cascade proteins.

[000159] Optionally, each crRNAs or gRNAs comprises a spacer sequence that is capable of hybridising to a protospacer nucleotide sequence of the cell, wherein the protospacer sequence is adjacent a PAM, the PAM being cognate to the Cl or C2, wherein Cl or C2 is a Cas nuclease, eg, a Cas3. Thus, the spacer hybridises to the protospacer to guide the Cas3 to the protospacer. Optionally, the Cas3 cuts the protospacer, eg, using exo- and/or endonuclease activity of the Cas3. Optionally, the Cas3 removes a plurality (eg, at least 2, 3,4, 5, 6, 7, 8, 9 or 10) nucleotides from the protospacer. [000160] Optionally, the vector is a phage or non-replicative transduction particle. The phage or particles comprise phage coat proteins encapsidating DNA, wherein the DNA comprises the vector. Suitable examples of phage and particles are disclosed in US2019/0160120 the disclosures of which are incorporated herein by reference for possible use in the invention and for providing one or more features that may be included in gthe claims herein. Phage or particle is capable of infecting the cell, thereby introducing the vector into the cell.

[000161] It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine study, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims. All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications and all US equivalent patent applications and patents are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Reference is made to the publications mentioned herein and equivalent publications by the US Patent and Trademark Office (USPTO) or WIPO, the disclosures of which are incorporated herein by reference for providing disclosure that may be used in the present invention and/or to provide one or more features (eg, of a vector) that may be included in one or more claims herein.

[000162] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

[000163] As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[000164] The term "or combinations thereof' or similar as used herein refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

[000165] Any part of this disclosure may be read in combination with any other part of the disclosure, unless otherwise apparent from the context.

[000166] All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

[000167] The present invention is described in more detail in the following non-limiting Examples.

EXAMPLES

EXAMPLE 1. Combination of Type I CRISPR-Cas systems to synergistically target multiple genomic protospacers

[000168] A plasmid (which we call a CRISPR Guided Vector™, CGV™) was constructed comprising an operon with nucleotide sequences encoding a type I Cas3 and Cascade proteins under the control of a constitutive promoter. E. coli type IE Cas3 and Cascade was used. A cognate CRISPR array comprising E. coli direct repeat sequences and spacers for targeting an E. coli host cell chromosome was also cloned in the vector. An adaptation module containing Cas 1 and Cas2 was omitted in the vector (see Figure 1A).

[000169] A plasmid was constructed comprising an operon with nucleotide sequences encoding a type I Cas3 and Cascade proteins under the control of constitutive promoters. C. difficile type IB Cas3 and Cascade was used. An adaptation module containing Casl, Cas2 and Cas4 was omitted in the vector (see Figure IB). A cognate CRISPR array comprising C. difficile repeat sequences and spacers for targeting an E. coli host cell chromosome was cloned in a second vector, under the control of constitutive promoters (see Figure IB).

[000170] The CGV encoding C. difficile type IB Cas3 and Cascade was transformed into E. coli MG 1655. Subsequently, the vector encoding C. difficile array and the CGV encoding E. coli type IE CRISPR-Cas system were transformed into the cells. CFU assays are shown in Figure 2. In Figure 2 there is shown CRISPR killing of target strain E. coli MG1655 by C. difficile CRISPR-Cas system in combination with E. coli CRISPR-Cas system. Killing of essentially 100% of the population was achieved when combining both systems (a bit more than 7- log ₁₀ reduction in viable cells of E. coli MG 1655). However, transformation of E. coli CRISPR-Cas system alone resulted in ~4-log ₁₀ reduction in the bacterial population, and transformation of C. difficile array in a bit less than 3-logio reduction _. These results indicate that E. coli CRISPR-Cas system and C. difficile CRISPR-Cas system are compatible, and their combination synergistically improves the killing efficiency of target strain greatly, hampering the growth of escapers.

Materials and methods

[000171] E. coli MG1655 was grown in lysogeny broth (LB) with shaking (250 rpm) at 37 °C. When necessary, cultures were supplemented with tetracycline (10 μg/mL), kanamycin (50 μg/mL), and spectinomycin (100 μg/mL).

[000172] To construct a plasmid containing E. coli CRISPR-Cas system under a constitutive promoter, cas3, cas8e, casll, cas7, cas5, and cas6 genes from E. coli were amplified and cloned in a ColEl-type plasmid, pZE21 (Lutz and Bujard, 1997. Nucleic Acids Research, 25, 1203-1210) under the control of a promoter . cas3 was located in the beginning of the operon followed by cas8e, casll, cas7, cas5, and cas6. The adaptation module (consisting of casl and cas2) was omitted in the vector. Additionally, a 3 -spacer array targeting 3 chromosomal intergenic regions in E. coli MG 1655 was included in the CGV under the control of a promoter. It contained 32 nucleotides from the genome of E. coli MG1655 per target locus (TGATTGACGGCTACGGTAAACCGGCAACGTTC; GCTGTTAACGTACGTACCGCGCCGCATCCGGC; and

CGGACTTAGTGCCAAAACATGGCATCGAAATT) separated by 29 bp direct repeats (each repeat was GAGTTCCCCGCGCCAGCGGGGATAAACCG). Additionally, the 3'-AAG protospacer adjacent motif (PAM) is located adjacent to the selected target sequences in the genome of E. coli MG1655 (Figure 1A).

[000173] C. difficile CRISPR-Cas system was constructed in a two-plasmid system. To construct a plasmid containing C. difficile cas genes, cas3, cas6, cas8b, cas7, and cas5 genes from C. difficile were amplified and cloned in a pSC 101 backbonep under the control of a promoter . The cas3 was located in the beginning of the operon followed by cas6, cas8b, cas7, and cas5. The adaptation module (consisting of casl, cas2, and cas4) was omitted in the vector (Figure IB). A second plasmid containing a 5 -spacer array was cloned in a CloDF13 ori backbone under the control of a promoter J23100. It contained 37 nucleotides from the genome of E. coli MG 1655 per target locus (GCCATAATCTGGATCAGGAAGTCTTCCTTATCCATAT; GGCTTTACGCCAGCGACGTATTGCCACAGGAATAACT; GGGGATAGCGCGCCTGGAGCGTGCGATAGAGACTTTG; GGCATTTACCGACCAGCCCATCAGCAGTACAGCAAAC; and TCCTGAATCAAATCCGCCTGTGGCAGGCCATAGCCCG) separated by 29 bp direct repeats (each repeat was GTTTTATATTAACTAAGTGGTATGTA AAT) . Additionally, the 3'-CCT protospacer adjacent motif (PAM) is located adjacent to the selected target sequences in the genome of E. coli MG 1655 (Figure IB).

[000174] To perform killing assays, the plasmid harboring cas3 and cascade genes of C. difficile was transformed into E. coli MG1655 by electroporation. Transformants were grown in liquid LB with the antibiotic to mid-log phase, and further electroporated with a plasmid harboring C. difficile array and a plasmid with E. coli CRISPR-Cas system. Controls with empty vectors, and with each CGV separately were performed. Killing efficiency was determined by plating the transformations onto LB with antibiotics. Viability was calculated by counting colony forming units (CFUs) on the plates and data were calculated as viable cell concentration (CFU/ml).

T

O

s

f y f

m

Table 2: Example Cas

Cl may be a Cas (eg, a Cas3 or a Cascade Cas) selected from the following types. Additionally or alternatively, C2 may be a Cas (eg, a Cas3 or a Cascade Cas) selected from the following types. Cascade Cas may be selected from the following types.

Table 3: Example Cas. Types and Classes