16: 57-66; Thorpe, P. E. and Burrows, F. J. (1995) Breust Cancer Res. Treat.

36 : 237-51; Burrows, F. J. and Thorpe, P. E. (1994) Pharmacol. Ther. 64: 155-74). In a nude mouse model, for instance, introduction of a wild type VHL gene into 786-0 cells, a RCC tumor cell line, inhibited tunzor growth (Iliopoulos et al. (1995) Nat. il, fed. 1: 822-26) and angiogenesis The growth of solid ttm1ors beyond a few mm3 depends on the formation of new blood vessels (Follcmm, J. (1971) N. Engl. J. Med. 285: 1182-86). Numerus studies have shown that both primary tumor and metastatic growth are angiogenesis-dependent (Folkman, J. (1971) N. Engl. J Allecl. 285: 1182-86 ; Folkman, J. (1972) Ann. Surg. 175: 409-16; Folkman, J. and Shing, Y. (1992) J Biol.

Chez. 267: 10931-34 ; Folkman, J. (1996) Sci. A) 7ç. 275: 150-54). A number of angiogenesis inhibitors have been identified. Certain ones, such as platelet factor-4 (Maione et al. (1990) Scie7, 7ce 247: 77-79; Gupta et al. (1995) Prov. Natl. Acad. Sci.

(USA) 92: 7799-7803), interferon oc, interferon-inducible protein-10, and PEX (Angiolillo et cil. (1995) J Exp. Mccl. 182: 155-62; Strieter et al. (1995) Biochem.

Biophys. Res. Commun. 210: 51-57; Brooks et al. (1998) Cell 92 :391-400). are not "associated with tumors:@whereas two others, angiostatia and endostatin, are "tumor-associated" (O'Reilly et al. (1994) Cell 79 :315-28 ; O'Reilly et al. (1997) Cell apoteniendogenousinhibitorofangiogenesisgenerated88:277-85). Angiostatin, by tumor-infiltrating macrophages that upregulate matrix metalloélastase (Dong et al. (1997) Cell 88: 80@-10), inhibhs the growth of a wide variety of primary and metastatic tumors (Lannutti et al. (1997) Cancer Res. 57 : 5277-80; O'Reilly et al.

(1994) Cold Spring Harb. Symp. Qnom. Biol. 59: 471-82; O'Reilly, M. S., (1997) FxKs. etal.(1997)CancerRes.57:1329-34;Wuetal.(1997)Biochem.79:273- 94:Sim Commun.236:651-54).Biophys.Res.

Recently, O'Reilly, et crl. ( (1997) Cell 88: 277-85) isolated endostatin, an angiogenesis inbibitor from a murine hemangioendothelioma cell line (EOMA).

Circulating levels of a fragment of human endostatin have ben detected in patients with chronic renal insufficiency with no detectable tumor, but this fragment had deletions, and no anti-angiogenic activity (Standker et al. (1997) FEBS Lett.

420: 129-33). The amino terminal sequence of endostatin corresponds to the carboxy terminal portion of collages XVIII. Endostatin is a specific inhibiwr of endothelial proliferation and angiogenesis. Systemic administration of non-refolded precipitated protein expressed in Eschesflichia coli caused growth égression of Lewis lung carcinoma, T241 fibrosarcoma, B16 melanoma and EOMA (O'Reilly et al. (1997) Cell 88: 277-85) cells in a xenograft model. Moreover, no drug resistance was noted in three of the tumor types stndied. Repeated cycles of administration with endostatin have been reporte to result in tumor dormancy (Boehm et al. (1997) Nahtre390:404-407).

The results from these studies open new avenues for treatment of cancer and provide promising routes for overcoming the drug resistance often seen during chemotherapy. floweves. in all of these investigations, a non-refolded precipitated form of the inhibitor protein was administered in the form of a suspension to tumor

bearing animals. In addition, large amounts of protein were required to cause tumor regression and to lead to tumor dormancy. As pointed out by Kerbel ( (1997) Natm^e 390:335-36), oral drug equivalents ofthese proteins are needed. Mechanistic investigations could be undertaken if recombinant forms of these proteins were available in soluble form. Moreover, initial testing could be done is1 vitro with soluble protein before studying its efficacy under in vivo conditions. Furthermore, there have been reports that desdite the great promise held by these proteins, evaluation of their clinical potential is stymied due to difficulties in producing enough of the protein to test, and inconsistent test results regarding their anti- angiogenic properlies (King, R.T. (1998) Wail Street.I., page 1 Nov. 12; Leff, D. N.

(1998) BioYVorld Todcry 9: 1. Oct. 20) There clearly exists at tlae prcsent time a grenat need for a method of producing soluble forts of anti-angiegenic proteins in large amonts, ancl wlaich have reliable properties in vitro and in vivo.

SUMMARY OF THE INVENTION Described herein are novel mutants of endostatin, one of wich, designated "EM 1,"has anti-angiogenic activity similor or superior to that of wild type endostatin.

The invel1tiol1 relates to the discovery of an isolated anti-angiogenic peptide, wherein the C-terminal end of the peptide comprises the amino acid sequence SYIVLCIE, which has anti-angiogenic properties. Designated"EM I,"this protein comprises a mutated endostatin protein, where the mutation comprises a deletion of nine consecutive amino acids from the C-terminus of the mutated endostatin protein (e. g., NSFMTSFSK). EM : terminates in the amino acid sequence SYIVLCIE. The invention also comprises isolated polynucleotides encoding EM 1, operably linked to expression sequences, and host cells transformed with such a construct. Amibodies to EM 1 are also disclosed.

The invention also relates to processes for producing EM 1, fusion proteins containing EM 1, and compositions comprisina EM 1 or fusion products thereof.

The invention also discloses methods of procuding polypeptides encoding EM 1.

In addition, the invention comprises methods for inhibiting angiogenic activity in mammalian tissue, comprising coratacting the tissue with a composition comprising the EM 1, particularly to inhibit angiogenesis, which occurs in many diseases and conditions, including cancer.

The invention also discloses use of EM 1 to induce apoptosis, or antibodies of EM preventapoptosis.TheinventionfurtherdiselosesuseofEM1into methods of gene therapy. The cells targeted may be any mammalian cells, particularly lymphocytes, blood cells, TIL cells, bone marrow cells, vascular cells, tumor cells, liver cells, muscle cells, and fibroblast cells.

BRIEF DESCRIPTION OF THE DRAVJINGS Fig. 1 is a diagram of the endostatin nucleotide sequence (SEQ ID NO: 1).

The polymteleotide encoding EM 1 comprises the polynucleotide sequence thlough nticleotide 525. Tlze polynucleotide encoding EM 2 comprises the polynucleotide sequence through nucleotide 501.

Fig. 2 is a diagram of the translation (SEQ ID NO : 2) of the nucleic acid sequence of Fig. 1. EM 1 comprises the amino acid sequence through amino acid 175. EM 2 comprises the amino acid sequence through amino acid 167.

Fig. 3 is a graph showing the results of elution from an NI-NOTA column.

The fraction number is shown along the x-axis, and the absorbance at 280 nm for each fraction (#) is on the left y-axis. For each fraction, the pH of the eluting buffer (M) is shown on the rigt y-axis.

Fig. 4 shows a 12 % non-reducing SDS-PAGE gel of protein produced from the prokoryotic expression system. Sizes in kDa are shown on the left, and the first lane contains size nzarkers. Lane 2 contains crude protein, langes 3 and 4 contain samples from fractions 7 and 8, which were eluted at pH6. 3. Lanes 5 and 6 contains samples from fi actions 21 and 22, eluted at pH 4.0. Lane 7 contais a sample from fraction 22 reduced with DTT.

Fig. 5 is a graph showing the purification of soluble mouse endostatin expressed in yeast using a heparin-agarose column. The fraction number is shows along the Y-axis, and the absorbance at 280 nm for each fraction (0) is on the left y-

axis, and the concentration of NaCl used to clute each fraction (M) is shown on the right y-axis.

Fig. 6 shows a 12% non-reducing SDS-PAGE gel of purifie recombinant soluble mouse endostatin from a heparin-agarose column. Sizes in kDa are shown on tue left, and the first lane contains size markers. Lane 2 contains crude protein, lane 3 contains unbound protein, lane 4 contains wash, and lanes 5 and 6 contain samples from fractions 9 and 10, respectively, whieb were both eluted witl1 0.3ml NaCl. Lanes 7 and 8 contain samples from fractions 21 and 22, respectively, which were both eluted with 0.6 M NaCl.

Fig. 7 is a graph showing the elution profile of soluble His. endostatin expressed in yeast using a Ni-NTA colunln. The fraction nimber is shown along the x-axis, and the absorbance at 280 nm for each fraction (#) is on the left y-axis, and the concentration of imidazole (mM) used to elute each fraction (ici) is shown on the righty-axis.

Fig. 8 shows a 12% non-reducing SDS-PAGE gel of selected fractions of soluble His. endostatin expressed in yeast. Sizes in kDa are shown on the left, and the first lane contains size markers. Lane 2 contains crude protein, lange 3 contains fiowlhrough (i. e., unbound protein), and lane 4 contains wash. Lane 5 contains a sample of fraction 9, which was eluted at 10 mM imidazole. Lanes 6 and 7 contain samples from fractions 35 and 36, respectively, which were eluted with 50 mM imidazole, and lanes 8 and 9 contains samples of fractions 53 and 54, respectively, wl1icll were eluted with 100 mM imidazole.

Fig. 9 shows a Western blot analysis of recombinant mouse endostatin expressed from bacteria and yeast. Lane @ contains bacterially-expressed His. endostatin, lane 2 contains endostatin expressed in yeast, and lane 3 contains yeast-produced His. endostatin.

Fig. 10 is a graph depicting the results of an endothelial cell proliferation assay. The purifie mouse endostatin expressed from yeast was tested for its ability to inhibit (methyl-3H) thymidine incorporation in C-PAE cells. The conce11tratio11 of endostatin (100 ng to 10000 ng) is shown on the x-axis, and the incorporation of

3H-thymidine is shown on the y-axis. Incorporation for yeast-derived soluble endostatin (O) and yeast-derived soluble His. endostatin (IN) dropped steadily with increasing concentration of endostatin.

Fig. 11 is a bar chart showing the effects of recombinant mouse endostatin on non-endothelial cells. Open bars refer to 786-0 cells, and shaded bars refer to A498 cells. Both are renal carcinoma cell lines, stimulaied with bFGF (3 ng/ml) in 2% serum.

Figes. 12A and 12B are a pair of pllotographs showing inhibition of endothelial cell (ECV304) migration by soluble mousse endostatin using bFGF (25 nb/ml) as a stimulus. Fia. 12A shows nnigrated endothelial cells in the control (+ bFGF, no endostatin). and Fig. 12B shows migrated endothelial cells treated with endostatin (20 µg/ml) with BFGF.

Fig. 13 is a bar chart showing iWibition of endotlielial cell migration with different concentrations of endostatin. Relative cell migration is shown on the y- axis, and treatment (control, 25 ng/ml bFGF, and endostatin at 20,10,5,2.5, and 1 thex-oxis.µg/ml)on Figes. 14A, 14 B, and 14C are photomicrographs showing the inbibition of angiogenic response mediated by VEGF (250 ng/pellet) in the presence of endostatin. Fig. 14A is the negative control, Fig. 14B is the positive control (VEGF), and Fig. 14C shows the effect of endostatin plus VEUF.

Figs. 15A and 15B are a pair of bar chalts showing the inhibition of VEGF (top panel) and bFGF (bottom panel) mediated angiogenic response by endostatin (20,10,5,1, and 0 µg/mesh) in the CAM assay. Both charts show a steady increase of inhibition of angiogenesis in response to increasing concentrations of endostatin.

Fig. 16 is a bar chart showing neutralization of the inhibiton effect of mouse endostatin by polyclonal antiserum in the endothelial proliferation assay.

Incorporation of 3H-thymidine is shown on the y-axis, and treatment (control, 10 zig endostatin, 10 zig endostatin + antiserum, 5 yg endostatin, 5 yg endostatin + antiserum, pre-immune serum, endostatin antiserum, and endostatin IgG) on the x- axis).

Figs. 17A and 17B are a pair of photographs showing the results of a CAM assay, demon. strating neutralization of endostatin inhibitory activity by polyclonal antiserum. Fig. 17A shows the effect of VEGF and endostatin (10 µg/pellet), and Fig. 17B shows the effect of endostatin (10 µg/pellet) plus polyclonal antiserum plus VEGF.

Fig. 18 is a graph showing the inhibition of 786-0 tu1nor growth by systemic treatment with recombinant endostatin. Time in days after treatment is shown on the x-axis and tumor volume in mm3 is shown on the y-alis. Intraperitoneal injection of <BR> <BR> <BR> <BR> givenat10mg/kg/day,startingonday@(arrow).Eachtimepointendost atinwas represents the average of five mice in each group and the error bar represents S. E. M.

Treatments are centroi PBS fromyeast(#).His.endostatinfromendostatin yeastHis.endostatinfrombacteria(#).and Figs. 19A through 19E are a set of photographs of 786-0 tumors treated with recombinant endostatin. At the end of the treatnaent period, tmnors from control and treated groups were examine grossly under a dissecting nzicroscope. Figs. 1 9A and 19B are control tumors, Fig. 19C shows a tumor treated with yeast-derived endostatin, Fig. 1 9D shows the effect of His. endostatin from bacteria, and Fig. 19E sllows 2 tumor treated with His. endostatin from yeast.

Fig. 20 is a graph showing the effects of endostatin mutants on atl-iymic nude mice 786-0 tumors. Days after treatment is shown on the x-axis, and tumor volume on the y-axis. Each time point represents the average of five mice in each group.

Treatments were control PBS (#), wild type His. endostatin from bacteria (dotted line, #), EM 1 from bacteria (A), and EM 2 from bacteria (solid line, ). EM 1 and EM 2 both contain N-terminus His. tags. Intraperitoneal injection was starter on day 1(arrow).

Fig. 21 is a bar graph showing increased caspase 3 activity due to endostatin treatment. Absorbance at 405 nm is shown on the y-axis, and treatrnents (control, TNE-α (10 ng/ml), endostatin (10 µg/ml) are shown on the x-axis. The pairs of bars for each treatment the A40, reading in the presence (open bars) or absence (shaded bars) of the inhibitor DEVD-frnk.

Fig. 22 is a bar graph showing caspase 3 activity in non-endothelial cells.

Absorbance at 405 lu-n is shown ol-i the y-axis, and x-axis displays treatments +DEVD,endostatin(10µg/ml),endostatin(10µg/ml)+DEVD)(contro l,control for NIH3T3 and 1-19c2 (2-I)-myoblast cells, repectively.

Fig. 23 is a bar graph showing quantitative determination of apoptosis, as derermined by the TUNEL assay. The treatments are shown on the x-axis, and are endostatin-treatedendostatin-treatedadherent cells, cells,controlsuspension adherent cells, and TNF-a-treted adherent cells. Percentage of apoptotic cells are shown on the y-axis.

Figes. 24A and 24B are a Western blot analyses of C-PAE cell lysate for Bcl-2 protein levels, and an immunoblot detecting total cell lysate for Bax expression levels, respectively. C-PAT cells were treated with either no endostatin (-) or endostatin (10 µg/ml) (+) for the indicated period of time 0,12,24,28 houris).

Action probing is also show.

Figs 25A, 25B, 25C and 25D are a set of two Western blot cslalyses (Figs.

25A and 25B) and two immunoblots (Figs. 25C and D) of non-endothelial cell lysate for Bax protein levels. Cells were treated with either no endostatin (-) or endostatin (10 µg/ml) (+) fol trie indicated period of time 0,12,24,2 8,-') 2 hours). Actin probing is also shown. Fig. 25A: NIH3T3 cell lysate; Fig. 25B : IMR-90 cell lysate; Fig. 25C: C-PAT cell lysate; Fig. 25D: NIH3T3 cell lysate.

Figure 26A-B is a chart showing the constructs, primers, cloning sites, and vectors, used to clone and express various anti-angiogenic proteins. The amino acid sequences of the expressed proteins are also given.

DETAILED DESCRIPTION OF THE INVENTION A wide variety of diseases are the result of undesirable angiogenesis. Put another way, many diseases and undesirable conditions could be prevented or alleviated if it were possible to stop the growth and extension of capillary blood vessels under some conditions, at certain times, or in particular tissues. Several anti- angiogenic proteins have been discovered (e. g., angiostatin, endostatin), problems

have been reported regardi1lg (1) the ability to produce the proteins in sufficient quantity to alow for proper testing of their properties, and (2) the reproducibility of tlze anti-angiogenic properties attributed to these proteins.

The present invention encompasses endostatin mutants, referred to herein as EMs. Specifcally encompassed are two mutants of endostatin, designated "EM 1' and"EM 2". These mutants were tested against whole endostatin. The mutants showed very different activity. Unexpectedly, one mutant ("EM 1") performed as well or better than whole endostatin, and the other ("EM 2") showed loss of anti- angiogenic activity. In a nude mouse 1nodel, growth of renal cell cancer (RCC) was suppressed by systemic administration of EM @ at a rate of 20 mg/kg body weight.

The inhibitiotl of tumor growtl1 is comparable to the inhibition obtained with wild- type endostatin. The diflerence in acíivity between EM l and EM 2 is surprising, given that there is a difference betwecn the1n of only eight amino acid residues.

EManadvan@ageintreatmentofangiogenicdiseasesinthatincreas inglyprovides smaller peptides are more potent on a weight basis, and may be able to better penetrate tissues.

In the present invemion, EM 1, a novel and-angiogenic protein, and a deletion mutant of endostatin, is described, as well as fragments, derivatives, fusion proteins and antibodies thereof. Methods of mal : ing the above are also described.

Also disclosect are therapeutic compositions comprising EM 1, and metlzods for using those compositions. Polynucleotides encoding EM 1 are also described, a well as vectors and host cells comprising those polynucleotides. Compositions containing EM 1 as a biologically active ingredient are also described, as well as usingEM1toinhibitangiogeicactivityinmammaliaotissues,suchasi nsthodsfor diseasesandconditionscharacterizedbyangiogenesis.Thepresenti ntreating compositionsandmethodsforthedetectionandtreatmentofinvention ineludes diseases and conditions that are mediated by or associated with aligiogenesis. In addition, the invention inclues use of EM @ to indue apoptosis in a cell or tissue, and antibodies to EM 1 to inhibit apoptosis in a cell or tissue.

Specifically, EM 1 is a deletion mutant of endostatin, where the last nine a1nino acid residues have been deleted. EM 1 exists naturally as part of the collagen Type XVII molecule, but it can be produced recombinantly, e. g., the polynucleotide sequence (Fig. 1, SEQ ID NO: 1) encoding FM 1 protein (Fig. 2, SEQ ID Nô: 2) can amplifie, e. g., witb the forward and reverse primers listed in Table 1, belon. te template nucleic acid used for the amplification can be from any mammal. Also thepresentinventionismammalianEM1,fragmenis,mutants.encompas sedby derivatives or fusion proteins thereof.

Table 1. Constructs and primer sequences used to amplify anti-angiogenic proteins.

Construct Na1ne Primer Sequence pET17bhis. mendo 5'-GGC ATA TGC ATA CTC ATC AGG ACT TT-3' (up) (SEQ ID NO.:) 5'AAC TCG AGC TAT TTG GAG AAA GAG GT-3' (down)(SEQ ID NO.:) pET28a/mendo 5'-GGC ATA TGC ATA CTC ATC AGG ACT TT-3, (up) 5'-AAG CGU CCG CCT ATT TGG AGA AAG AGG T-3' (don) (SEQ ID NO:) pET28a/EM-1 5'TTC CAT ATG CAT ACT CAT CAG GAC TTT CAG CCA-3' (up) (SEQ ID NO:) 5'TTA GCG GCC GCC TAC TCA ATG CAC AGG ACG ATG TA-3' (down) (SEQ ID NO:) pET28a/EM-2 5'TTC CAT ATG CAT ACT CAT CAG GAC TTT CAG NO:)CCA-3'(up)(SEQID GCCGCCTAGTTGTGGCAGCTCGCA5'TTAGCG GCT TTC TG-3' (down) (SEQ ID NO:) AATTCCATACTCATCAGGACTTT-3'(up)pPICZαA/mendo5'GGG (SEQ ID NO :)

5'AAG CGG CCG CCT WATT TGG AGA AAG AGG T-3' (down) (SEQ ID NO:) pPICZaA/His. men 5'AAG AAT TCC ARC ARC ATC ATC ATC ACA GCA do GC-3' (up) (SEQ ID NO:) 5'AAG CGG CCG CCT ATT TGG AGA AAG AGGT-3' (down) (SEQ ID NO:) pPICZαa/Bendo 5'TTT GAA TTC GCC CAC AGC CAC CGC GAC TTC CAG CCG GTG CTC CA-3' (up) (SEQ ID NO:) 5'AAA AGC GGC CGC CTA CTT GGA GGC AGT CAT GAA GCT GTT CTC Axa-3' (down) (SEQ ID NO :) pPICZαA/Restin 5'TTT TTT GAA TTC ATT TCA AGT GCC ART TAU GAG AAG CCT GCT CTG CAT-3' (up) (SEQ ID NO : 5'AAG AAT GCG GCC GCT TAC TTC CTA GCG TCT GTC ATG AAA CTG TTT TCG AT-3' (down) (SEQID NO :) pPICZαA/HIS. Res 5'AAT TCC ATC ACC ATC ACC ATC ACG-3' (up) tin (SEQ ID NO : 5'AAT TCG TGA TGG TGA TGG TGA TGG-3' (down) NO:)(SEQID pET28a/M2 5'TTT CAT'E1T'G ATA TAC TCC TTT GA'F GGT CGA GAC ATA (up)(SEQIDNO:)ACA-3' 5'AAT GCG GCC GCT TAC TTC CTA GCG TCT GTC ATG AAA CTG TI"F TCG Art-3' (down) (SEQ ID NO :) pPICZαA/M2 5'AAG AAT TCC ATC ATC ATC ATC ATC ACA GCA GC-3' (up) (SEQ ID NO:) 5'AAT GCG GCC GCT TAC TTC CTA GCG TCT GTC ATG AAA CTG TTT TCG Art-3' (down) (SEQ ID NO:)

The resulting amplification product can then be clone into a suitable vector.

The term"primer"denotes a specific oligonuelcotide sequence complementary to a

target liucleotide sequence and used to hybridize to the target nucleotide sequence and serve as an initiation point for nucleotide polymerization cataiyzed by either DNA polymerase, RNA polymerase or reverse transeriptase. "EM 1," as used serein, refers to a deletion mutant of endostatin, wherein té last nine amino acid residues have been deleted (i.e., NSFMTSFSK). and the term is intended to include fragments, mutants, homologs, analogs, and allelic variants of the amino acid sequence of SEQ ID NO:). Although EM 1 was originally clonecl from mouse nucleic acid, it performs better than intac@ type endostatin (i. e., endostatin that has not been mutated) in standard assays. Tire ter EM 1 is therefore intended to include any mammalian sequence substantially similar to EM 1 as described herein, as well as mammalian EM 1 fragments, routants, homologs.l analogs and allelic variants of the mammalian EM 1 amino acid sequence. Also, specifically encompassed by tlse present invention are humas endostatin mutants, and more humandeletionmutautequivalentofEM1.specifcal#y,the It is to be understood that the present invention is contemplated to include any derivatives of EM 1 that have endothelial inhibitory activity (e. g., the capability of a composition to inlaibit angiogenesis in general and, for example, to il1hibit the growtll or migration of bovine capillary endothelial cells in culture in the presence of fibroblast growth factor, angiogenesis-associated factors, or other lu1own growth factors). The present invention inclues the entire EM # protein. derivatives of the EM I protein and biologically-active fragments of the EM 1 protein. These include proteins with EM 1 activity that have amino acid substitutions or have sugars or other nzolecules attacl1ed to amino acid functional groups. The pressent invention also inclues genes that code for EM 1 and the EM 1 receptor, and to proteins that are expressed by those genes.

The invention also encompasses a composition comprising an isolated polynucleotide encoding EM 1, as well as vectors and host cells containing such a polynucleotide, and processes for producing EM 1 and iis fiagments, mutants, homologs, analogs and alielic variants. The terrn "vector" as used serein means a carrier into which pieces of nucleic acid may be inserted or cloned, which carrier

functions to transfer the pieces of nucleic acid into a host cell. Such a vector may also bring about the replication and/or expression of the transfened nucleic acid pieces. Examples of vectors include nueleic acid molecules derived, e. g., from a plasmid, bacteriophage, or 1nanlmalian, plant or insect virus, or non-viral vectors such as ligand-nucleic acid conjugates, liposomes, or lipid-nucleic acid complexes.

It may be desirable that the transferred nucleic molecule is operatively Ili-iked to an expression control sequence to form an expression vector capable of expressing the uansferred nucleic acid. Such transfer of nucleic acids is generally called "transformatiom,"and refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion. For exemple, direct uptake, transduction or f-mating are included. The exogenous polynticleotide may be maintained as a non-integrated vector, for example, a plasid, or alternatively, nay be integrated into the host genome."Operably linked" refers to a situation wl-ierein the components described are in a relationship permitting thym to fonction in their intendecl manner, e. g., a control sequence "operably linked" to a coding sequence is ligoted in such a 1nanner that expression of the coding sequence is conditionscompatiblewiththecontrolseqoence.A"codingachievedu nder sequence"is a polynucleotide sequence which is transcribed into MRNA and translate into a polypeptide when placed under the control of (e. g., operably linked to) appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. Such boundaries can be naturally-oce@rring, or can be introduced into or added the polynucleotide sequence by 1nethods known in the art.

A coding sequence can inclue, but is not limited to, mRNA, cDNA, and recombinant polynucleotide sequences.

The vector into which the cloned polynucleotide is cloned may be chosen because it functions in a prolcaryoticorganism, or alternatively, it is chosen because it functions in a eukaryotic organism. Two examples of vectors which allow for both the cloning of a polynucleotide encoding the EM @ protein, and the expression of that protein from the polynucleotide, are the pET28 (a) vector (Novagen, Maison,

Wisconsin, USA) and a modifie pPICZaA vector (InVitrogen, San Diego, California, USA), which allow expression of the protein in bacteria and yeast, espectively.

Once a polynucleotide has been cloned into a suitable vector, it can be transformed into an appropriate host cell. By"host cell"is meant a cell which has been or can be used as the recipient of transferred nucleic acid by means of a vector.

Host cells can prokaryotic or eukaryotic, mammalian, plant, or insect, and can exist as single celles, or as a collection, e. g., as a culture, or in a tissue culture, or in a tissue or an organism. 14ost cells can also be derived from normal or diseased tissue from a multicellular organism, e. g.. a mammal. Host cell, as used herein, is intended to include not only the original cell which was transformed with a nucleic acid, but also descendants of such a cell. which still contain the nucleic acid.

In one embodiment. the isolated polynucleotide encoding the anti-angiogenic protein additionally comprises a polynucleotide linter encoding a peptide. Such linkers are known to those of skill in trie au and, for example the linker can comprise at least one aditional codon encoding at least one additional amino acid. Typically the linter comprises one to about twenty or thirty amino acids. The polynucleotide linker is translated, as is the polynucleotide encoding the anti-angiogenic protein, resulting in the expression of an anti-angiogenic protein with at least one additional amino acid residue at the amino or carboxyl terminus of the anti-angiogenic protein.

Some linters attache to anti-angiogenic proteins are illustrated in Figure 26.

Importa1ltly, the additional amino acid, or amino acids, do not compromise the activity of the anti-angiogenic protein.

After inserting, the selected polynucleotide into the vector, the vector is transformed into an appropriate prokaryotic strain and the strain is cultured (e. g., maintained) under suitable culture conditions for the production of the biologically active anti-antiogenic protein. thereby producing a biologically active anti-angiogenic protein. or mutant, derivative, fragment or fusion protein thereof. In one embodiment. the invention comprises cloning of a polynucleotide encoding an anti-angiogenic protein into the vectors pET1 7b or pET28a. which are then transformed into bacteria. The bacterial host strain then expresses the anti-

angiogenic protein. Typically the anti-angiogenic proteins are produced in quantities of about 10-20 milligrams. or more, per liter of culture fluid.

In another embodiment of the present invention, tlle eukaryotic vector comprises a yeast vector. As described serein, one method uses a pPICza plasmid wherein the plasmid contains a multiple cloning site. The multiple cloning site inserted into the multiple cloning site a Iris. Tag motif. Additionally the vector can be modifie to add a NdeI site, or other suitable restriction sites. Such sites are well known to those of skill in the art. Anfi-angiogeic proteins produced by this embodiment comprise a histidine tag motif (His. tag) comprising one, or more histidines ? typically about 5-20 istidines, Surprisiogly, this His. tag does not compromise anti-angiogenic activity.

In this embodiment. a preferred yeast expression system is Pichia paslores.

Gain, the biologically active protein is typically produced at concentrations of about 10-20 milligrams per liter of culture medium (fluid).

One method of producing EM 1, for example, is to amplify the polynucleotide of SEQ ID NO: 1, clone it into an expression vector. e. g., pET28 (a), pPICZaA. or some other expression vector, transform the vector containing the poly@ucleotide of SEQ ID NO: 1 into a host cell capable of expressing the polypeptide encoded by the polynucleotide, culturing the transformed host cell under culture conditions suitable for expressing the protein. and then extracting and purifying the protein from the culture. Exemplary metbods of producing anti- angiogenic proteins in general, and EM I in particular, are provided in the Examples below. and also in U. S. S. N. XX/XXX, XXX,"Methods of Producing Anti- Angiogenic Proteins."by Villas P. Sulcllahne, filed December 8.1998, the entire teachings of all of which are herein incorporated by reference. The EM 1 protein may also be expressed as a product of transgenic animals, e. g., as a component of the mille of transgenic cows. goats, sbeep or pigs, or as a product of a transgenic plant, e. combined or linked with starch molecules in maize.

EM 1 may also be produced by conventional. known methods of chemical synthesis. Methods for constructing the proteins of the present invention by synthetic jeans are known to those skilled in the art. The synthetically-constructed EM @

protein sequences, by virtue of shirino, primary, secondary or tertiary structural and/or withe.g.,recombinantly-producedEM1,maycharacteristies possess biological properties in common tlzerewitll, including biological activity.

Thus, the synthetically-construeted EM 1 protein sequences may be employed as biologically active or immunological substitutes for e. g. recombillalltly-produced, purif ed EM 1 protein in screening of tllerapeutic compounds and in immunological thedevelopmentofantibodies.processesfor 1TheEM protein is inhibitiugangiogenesis,asdeterminedinin standard assays, and provided in the Examples below. EM 1 does not inhibit the growth of other cells types, e. g., IMR-90 cells, or IC-21 cells.

As used herein, the term "angiogenesis" means the generation of new blood vessels into a tissue or origan, and involves endothelial cell proliferation. Under normal physiological conditions, humans or animals undergo angiobenesis only in very specific restricted situations. For example, angiogenesis is normally observe in wound healing, fetal and embryonal development, and formation of the corpus @oteum, endometrium and placenta. The term"endotheliun1"means a thin layer of flat epithelial cells that lines serous cavities, lymph vesses, and blood vesses.

"Anti-angicgenic activity" therefore refers to the capability of a composition to growthofbloodvessels.Thegrowthofbllodvessetsisacomplexseries inhibitthe of events, and inclues localized breakriown of the basement membrane lying under the individual endothelial cells, proliferation of those cells, migration of the cells to the location of the future blood vessel, reorganization of the cells to form a new vessel membrane, cessation of endothelial cell proliferation, and, incorporation of pericytes and other cells that support the new blood vessel wall, "Anti-angiogenic activity"as used serein therefore inclues interruption of any or all of these stages, witl1 the end result that formation of new blood vessels is inhibited.

Anti-angiogenicAnti-angiogenicactivity may include endothelial whichactiviry, refers to the capability of a composition to inhibit angiogenesis in general and, for exemple, to inhibit the growth or migration of bovine capillary endothelial cells in culture in the presence of fibrobiast growth factor, angiogenesis-associated factors,

or other known growth factors. A "growth factor"is a composition that stimulates the growth, reproduction, or synthetie activity of cells. An"angiogenesis-associated factor"is a factor hich either inhibits or promotes angiogenesis. An exemple of an angiogenesis-associated factor is an angiogenie growth factor. such as basic fibroblastic growth lactor (bFGF), which is an angiogenesis promoter. Anothcr example of an angiogenesis-associated factor is an angiogenesis inhibiting factor such as e. g., angiostatin (see, e. g., U. S. Pat. No. 5,801, 012, U. S. Pat. No. 5, 8') 7,682, U. S. Pat. No. 5,733, 87d, U. S. Pat. No. 5,776,704, U. S. Pat. No. 5,639,725. U. S. Pat.

No. WO95/29242,WO96/41194,WO97/23500)orWO96/35774, endostatin (see, e. g., WO 97/15666).

By-"substantially the same biological activity"or"substantially the same or superiot biological activity"is mea1lt that a composition has anti-angiogenic activity, and behaves similarly as does EM 1, as determined in standard assays. "Standard assays"include, but are not limited to, those protocols used in tlze molecular biological arts to assess ami-angiogertie activity, cell cycle arrest, and apoptosis.

Such assays inclue, but are not limited to, assays of endothelial cell proliferation, endothelial cell migration, cell cycle analysis, and endothelial cell tube formation, detection of apoptosis, e. g., by apoptoric cell morphology or Annexin V-FITC assay, chorioatlantoic membrane (CAM) assay, and inhibition of renal cancer tumor growth in nude mice. Such assays are provided in the Examples below, and in U. S. S. N.

60/067,888, filed December 8, 1997, U. S. S. N. 60/082, 663, 1led April 22,1998, U. S. S. N. 60/108,53d, filed November 16,1998, and in U. S. S. N. XX/XXX, XXX, "Restin and Methods of Use'Thereof,"by Vikas P. Sulchatme, filed December 8, 1998, and l J. S. S. N. XX/XXX, XXX,"Methods of Producing Anti-Angiogenic Proteins,"by Vidas P. Sukhatme, filed December 8,1998, the entine teachings of all of which are herein incorporated by reference. Such methods are also included in Dhanabal et al. (1998) ("Endostatin Induces Endothelial Cell Apoptosis,"J. Biol.

Chenz., subrnitted), and in Dhanabal et al. (1999) ("Cloning, Expression and in vitro Activity of Human Endostatin,"Ca7lCer Res, in press). Evaluating the ED50 of a

mutant in one of the assays described herein is a useful method of comparing activities.

As used herein,"ED50"is an abbreviation lor the a1nount of a composition w@ich reduces a biological effect by one-half, relative to the biological effect seen in the absence of the composition The invention also describes fragments, mutants, homologs and analogs of EM 1. A"frag1nent"of EM 1 any amino acid sequence shorter that the EM @ molecule, co1nprising at least 25 consecutive amino acids of the EM @ polypeptide.

Such mutants may or may not also comprise additional amino acids derived fromthe process of cloning, e. g., amino acid residues or amino acid sequences corresponding to full or partial lioker sequences. To be encompassed by the present invention, such mutants, withoutsuchadditionalaminoacidresidues,mustbaveor substantially the same biological activity as the natural ou full-lengtlmersion of tlze reference polypeptide.

By"mutant"of EM 1 is meant a polypeptide that inclues any change in the amino acid sequence relative to the amino acid sequence of the equivatent reference EM 1 polypeptide. Such changes can arise either spontaneously or by manipulations by man, by chemical energy (e. g., X-ray), or by other forms of chemical mutaganesis, or by genetic engineering, or as a result of mating or other forms of exchauge of genetic information. Mutations inclue, base changes, deletions, insertions, inversions, translocations, or duplications. Mutant forms of EM 1 may display either increased or decreased anti-angiogenic activity relative to the equivalent reference EM 1 polynucleotide, and such mutants may or may not also comprise additional amino acids derived from the process of cloning, e. g., amino acid residues or a1nino acid sequences corresponding, to full or partial linter sequences. ofEM1ismeantanon-naturalmoleculesubstantiallysimilartoBy"ana log" either the entire EM @ moieoule or a fragment or allelic variant thereof, and shaving substantially the same or superior biological activity. Sach analogs are intended to incluse derivatives (e. g., chemical derivatives, as defined above) of the biologieally

active EM 1, as well as its fragments, mutants, hoznologs, and allelic variants, which derivatives exbibit a qualitatively similar agonist or antagonist effect to that of the 1tmmodifiedEM polypeptide, homolog,oralielicvariant.mutant, By"allele"of EM I is meant a polypeptide sequence containing a naturally- occurring sequence variation relative to tt-ic polypeptide sequence of the reference EM1 polypeptide. By"allele"of a polynucleotide encoding the EM 1 polypeptide is meant a polynucleotide confaining a sequence variation relative to the reference polynucleotide sequence encoding the reference EM1 polypeptide, where the allele of the polynucleotide encoding the EM1 polypeptide encodes an allelic form of the polypeptide.EM1 It is possible that aiven polypeptide m1y be either a fragment, 1 mutant, an analog, or allelic variant of EM @, or it may be two or rome of those thiogs, e. g., a polypeptide may be both an analog and a mutant of the EM I polypeptide. For cxample, a shortened version of the EM 1 molecule (e. g., a-fragment of EM 1) may be created in the laboratory. If that fragment is then mntated througb means known in tlae art, a molecule is created that is both a fragment and a mutant of EM1. In another example, a mutant of EM I may be created, which is later discovered to exist as an allelic of EM I in some orollunaiian individuals. Such a mutant EM1 molecule would therefore be both a mutant and an allelic variant of EMF 1. Such combinations of fragments, mutants, allelic variants, and analogs are intended to be encompassed in the present invention.

Encompassed by the present invention are proteins that have substantially the sa1ne a1nino acid sequence as EM 1, or polynucleotdes that have substantially tu-ive same nucleic acid sequence as the polynucleotide encoding EM 1."Substantially the same sequence"means a nucleic acid or polypeptide tliat exhibits at least about 70 % sequence identity with a reference sequence, e. g., another nucleic acid or polypeptide, typically at least about 80% sequence identity with the reference sequence, preferably at least about 90% sequence identity, more preferably at least about 95% identity, and most preferably at least about 97% sequence identity with the reference sequence. The length of comparison for sequences will generally be at

least 75 nucleotide bases or 25 amino acids, more preferably at least 150 nucleotide bases or 50 amino acides. and most preferably 243-264 nucleotide bases or 81-88 amino acids."Polypeptide"as used serein indicates a molecular chain of amino acids and does not refer to a specific length of the product. Thus, peptides, oligopeptides and proteins are included within the definition of polypeptide. This term is also intended to include polypeptide that have been subjected to post- expression modi-tications such as, for example, glycosylations, acetylations, phosphorylations and the like. ME 1, in general, has less thaii 70% amino acid witheodostatin.sequenceidentity asusedherei,referstothesubunitsequencestrnilarity"Sequenceid entity," between two polymeric molecules, e. g., two polynucleotides or two polypeptides.

When a subunit position in bots of the two molecules is occupied by the same monomeric subunit, e. g., if a position in each of two peptides is occupied by serine, then they are identical at that position. The identity between two sequences is a direct-function of the number of matching or identical positions, e. g., if half (e. g., 5 positions in a polymer 10 subunits in iength), of the positions in two peptide or compound sequences are identical, then the two sequences are 50% identical ; if 90% of the positions, e. g., 9 of 10 are matche, the two sequences share 90% sequence identity. By way of example, the amino acid sequences VRGLQP and HAFLQP have 3 of 6 positions in common, and therefore share 50% sequence identity, while the sequences AFLQPhave3of5positionsincommon,andthereforeand share 60% sequence identity. The identity between two sequences is a direct function of the number of matching or identical positions. Thus, if a portion of the reference sequence is deleted in a particular peptide, that deleted section is not counted for purposes of calculating sequence identity, e. (,, VRGLQP and VRGLP have S out of 6 position in common, and tllerefore share 83.5% sequence identity.

Identity is often measmed using sequence analysis software e.g., BLASTN or BLASTP (available at http://www.ncbi.plrp.nih.gov/BLAST/). The default parameters for comparing two sequences (e. g., "Blast"-iiig two sequences against each other, http://www. ncoi.nim. nih. gov/gorf-/bl2. html) by BLASTN (for nucleotide

sequences) are reward for match = 1, penalty for mismatch =-2, open gap = 5, extension gap = 2. When using BLASTP for protein sequenees, the default parameters are reward for match = 0, penalty for mismatch = 0, open gap = 11, and extension gap= 1.

When two sequences share "sequence homology,"it is 1neant that the two sequences differ from each other only by conservative substitutions. For polypeptide sequences, such conservative substitutions consist of substitution of one amino acid at a given position in the sequence For another amino acid of the same aminoaoidsthatsharecharacteristiesofhydrophobicity,charge,pK orclass(e.g., other conformational or chemical properties, e. g., valine for leueine, arginine for lysine), or by one or more non-conservative amino acid substitutions, deletions, or insertions, located at positions of the sequence that do not altei, the conformation or folding of the polypeptide to the entent that the biological activity of the polypeptide is destroyed. Examples of "conservative substitutions" include substitution of one non-polar (hydrophobic) residue sucs as isoleucine, valine, leucine or metlionine fon another; the substitution of one polar (hydrophilic) residue-for another such as between arginine and lysine, between glutmnine and asparagine, between glycine thesubstitotionofonebasicresiduesuchaslysine,arginineorhisti dineandserine; for another ; or the substitution of one acidic residue, such as aspartie acid or glutamic acid for another: ; or the use of a chemically derivatized residue in place of a non-derivatized residue; provided that the polypeptide displays the requisite biological activity. Tz, vo sequences which scare sequence homology nzay called "sequence homologs." Ho1nology, for polypeptides, is typically measured using sequence analysis software (e. g., Sequence Analysis Software Pacage of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Maison, WI 53705). Protein analysais software matches similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications. Conservative substitutions typieally include substitutions within the following groups: glyeine, alanine; valine, isoleucine, leucine; aspartic acid,

glutamic ocid, asporagioe, glutamine ; serine threonine; lysine, arbinine; and phenylalanine,tyrosine.

Also encompassed by the present invention are chemical derivatives of EM 1. "Chemical derivative" refers to a subject polypeptide having one or more residues chemically derivatized by rection of a functional side group. Such derivatized residues include for elample, tllose molecules in which free a1nino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free c,-trboxvl groups may be derivatized to form salts, methyl and ethylesters or other types of esters or hydrazides. Free hydroxyl groups inlay be formO-acylorO-alkyldervatives.Theimidazolenitrogenofderivati zedto histidine may be derivatized to form N-imbenzylhistidine. Also included as chemical derivatives are those peptides which coption one or more naturally occorring aroino acid derivatives of the twenty standard amino acids. For examples: #-hydroxyproline may be substituted for proline; 5-hydroxylyaine may be substitute for lysine; 3-metliyllzistidine may be substituted for histidine; homoserine may be substituted for serine; md ornithine may be substituted for lysine.

Polynucleotides encoding EM 1 can be cloned out of isolated DNA or a cDNA library. Nucleic acids polypeptides, referred to serein as"isolated"are nucleic acids or polypeptides substantially free (i. e., separated away from) the n1aterial of the biological source frotn which they were obtained (e. as existes in a mixture of 1lucleic acids or in cells), which may have undergone further processing.

"Isolated"nucleic acids or polypeptides include nucleic acids or polypeptides obtained by herein,similarmethods,orothersuitablemethods,desoribed including essentially pure nucleic acids or polypeptides, nucleic aeids or polypeptides produced by chemical synthesis, by combinations of chemical or andrecumbinantlyproducednucleicacidsorpolypeptideswhichbiolo gicalmethods, are isolated. An isolated polypeptide therefore neans one which is relatively free of other proteins, carbohydrates. lipids, and other cellular components with which it is normally associated. An isolated nucleic acid is not immediately contiguous with

(i.e., covalently linked to) both of the nucleic acids with which it is immediately contiguous in the naturally-occurring genome of the organism from which the nucleic acicl is derived. The term, therefore, inclues, for example, a nucleic acid which is incorporated into a vector (e. g., an autonomously replicating virus or plasmid), or a nucleic acid which exists as a separaie molecule independent of other nucleic acids such as a nucleic acid fragtment produced by chemical means or restriction endonuclease treatment.

Tlle polynucleotidcs and proteins of the present invention can also be used to design probes to isolate other ati-angigenic proteins. Exceptiollal 1nethods are provided in U. S. Pat. No. 5, 837. 490, by Jacobs et al., the entire teochings of which are herein incorporated by reference in their entirety. Tue design of the oligonucleoticle probe should preferably follow tllese parameters: (a) It should be designed to an area of the sequence which has the fewest ambiguous bases ("N's"), if any, and (b) It should be designed to have a T", of approx. 80°C (assuming 2°C for each A or T and 4 degrees for each G or C).

The oligonucleotide should preferably be labeled with g-32P ATP (specific activity 6000 Ci/mmole)nd T4 polynucleotide lcinase using commonly employed teclmiques fon labeling oligonucleotides. Other labeling techniques can also be used.

Unincorporated label should preferably be removed by gel filtration chromatography or other established mathods. The amount of radioactivity incorporated into the probe should be quantitated by measurement in a scintillation conter. Preferably, specific activity of the resulting probe should be approxinzately 4 x 106 dp1n/pmole.

The bacterial culture containing the pool of full-length clones should preferably be thawed and 100 yl of'the stock used to inoculate a sterile culture flask containing 25 ml of sterile L-broth containing ampicillin at 100 µg/ml. The culture should preferably be grown to saturation at 37°C, and the saturated culture should preferably be diluted in fi-est L-broth. Aliquots of these dilutions should preferably be plated to determine the dilution and volume which will yield approximately 5000 distinct and well-separated colonies on solid bacteriological media containing L-broth containing ampicillin at 100 µg/ml and agar at 1.5% in a 150 1nm petri dish

wi-ien grown overnight ot 37°C. Other known methods of obtaining distinct, well-separated colonies can also be employed.

Standard colony hybridization procedures should then be used to transfer the colonies to nitrocellulese filters and lyse, denture and bake thent. Hlghly stringent conclition are those that are at least as stringent as, for example, I x SSC at 65 °C, or Ix SSC and 50% formamide at 42°C. Moderate stringency conditions are those that are at least as stringent as x SSC at 65°C, or 4x SSC and 50% formamide at 42°C.

Reduced stringency conditions are tu-rose that are at least as stringent as 4x SSC at 6xSSCand50%formamideat40°C.50°C.or Té filtrer is then areferably incubted at 65 °C for 1 hour with gentle agitation in 6. times. SSC (20x stock is 175.3g NaCl/Hter, 88. 2 g Na citrate/liter, adjusted to pH 7.0 with NaOH) containing 0.5% SDS, 100 b/ml of yeast RNA, and 10 (approximately10mLper150mmfilter).Preferably,theprobeisEDTA then added to the hybridizttlon mix at a concentration greater than or equal to 1 x 106 dpm/mL. The filter is then preferably incubated at 65'C with gentle agitation ovemight, The filter is tl-ien preferably washed in 500 mL of 2x SSC/0.5% SDS at room temperature without agitation, prererably followed by 500 mL of 2x SSC/0.1% SDS at room tenzperature witll gentle shaking for 15 minutes. A third wash with 0.1x SSC/0.5% SDS at 65°C for 30 minutes to 1 hour is optional. The filter is then preferably dried and autoradiographyforsufficienttimetovisualizetheto positives on the X-ray film. Otlier lcnown hybridization methods can also be employed. The positive colonies are then picked, grown in culture, and plasmid DNA isolated using standard procedures. The clones can then be verified by restriction analysis, orDNAsequenciog.analysis, The present invention also includes fusion proteins and chimeric proteins comprising EM l, its fragments, mutants, llomologs. aoalogs, and allelic variantes. A fosion or chimeric protein can consist of a multimer of a single protein, e. g., repeats of EM 1 or repeats of apomibren, or the fusion and chimeric proteins can be made up of several proteins, e. g., EM 1 and apomigren. The fusion proteins can comprise a combination of two or more known anti-ongionenic proteins (e. g., anglostatin,

orapomigren,orbiologicallyacitvefragmentsthereof),oranendost atin,restin, anti-angiogenic protein in combination witll a targeting ageut (e. g., endostatin with epidermal growth factor (EGF) or RGD peptides), or an ardl-angiogenic protien in combination with an immunoglobulin molecule (e. g. endostatin and IgG, specifically with the Fc portion removed). As used herein,"restin"is a protein comprising about 170 to about 200 amino acid residues, and has at least 70% sequence identity with the C-ter1ninus of the NC 10 domain of the α1 chain of human Type XV collagen. As used herein, "apornigren" is a fragment of restin, and comprises the last 80 to 90 contiguous amino acids corresponding to tu-ive C-terminus of the NC10 domain of the cll chain of human Type XV collage. The fusion and canalsoicludeEM1,itsfragments,mutants,homologs,analogs.chier icproteins and allelic variants, and other anti-angiogenic proteins, e. g., endostatin or angiostarin. The term "fusiou protein" as used serin can also encotupass additonal components for e. g., delivering a chemothertl) eutic agent, wherein a polynucleotide encoding agentislinkedtothepolynucleotideencodingthechemotherapeutic aoti-angiogenic protein. Fusion proteins can also encompass multimers of the anti-angiogenic protein, e. g., a dimer or trimer of endostatin. Such fusion proteins can be linkecl together via post-transtational modification (e.g.,chemically liked), or the entire: fusion protein may be made recombinontly Also included in the inventions are compositions containuig, as a biological ingredient, EM 1, as well as its fragments, mutants, homologs, analogs, and allelic variants to inhibit or enfance angiogenesis in mammalian tissues, and use of such compositions in the diagnosis, prognosis, and treatment of diseases and conditions characterized by, or associated with, anglogenic activity or lack thereof. Such methods can involve administration by oral, topical, injection, iyplantation, orotherdeliverymethods.sustainedrelease, The invention inclues use of EM 1, and its fragments, mutants, homologs, analogs, allelic variantes, and fusion and chimeric proteins as blologically-active agents in compositions for the purpose of treating diseases or conditions that are associated with angiogenic activity. Methods of treating such diseases include

affectedtissuewithacompositioncornprisingEM1,itsfragments,co ntactingthe mutants, homologs, analogs, or allelic variards.

The present invention ineludes the method oftreating an angiogenesis- mediated disease with a therapeutically effective amount of EM 1, or a biologically active fiagment thereof, or combinations of EM 1 fragments that possess anti- angiogenic activity, or EM 1 agonists and antagonists, Angiogenesis#mediated butarenotlimitedto,cancers,solidtumors,blood-brontumorsdisea sesinclude, tumermetostasis,benigntumors(e.g.,hemangiomas,acoustic(e.g., leakemios), trachomas,andpyogeincgranulomas),rheumatoidneuromas,neurofib romas, arthritis, psorialsis, diseases(e.g.,diabeticretinepathy,retinopathyangiogenic of prematurity, macular degeneration, corneal graft rejection, peovascular glaucome, rubeosis),Osler-WebberSyndrome,myocardialretrotenral(ibropla sia, neovascniarization,telangiectasia,hemopholiacjoints,angiogen esis,plaque woundgranulation.EM1isusefulinthetreatmentofdiseasesofangiof ibroma,and excessive or abnormal stinnilation of endothelial cells. These diseases inclue, but are not limited to, intestinal adhesions, Crohn's disease, atherosclerosis, scleroderma, and hypertrophie scars (i. e.. keloids). EM 1 can be used as a birth control agent by pleventing vascularization required for embryo implantation. EM @ is useful in the treatment of diseases that have angiogenesis as a pathologic consequence such as cat scratch disease (Rochele minalia quintosa) and ulcers (Heliobacier pylori). ME 1 can also be used to prevent dialysis kraft vascular access stenosis, and obesity, e. g., by inhibiting capillary formation in adipose tissue, thereby preventing its expansion.

EM @ can also be used to treat localized (e.g., nontrietastisized) diseases."Cancer" means neoplastic growtll, hyperplastic or proliferative growth or a pathological state of anormal cellular development and inclues solid tumors, non-solid tumors. and celiuiarproliferation,suchasthataeaninlenkernia.Asusedherein ,andabnormal meansangiogenesis-dependentcancersandtomors.i.e.,tumorsthat" cancer"also theirgrowth(expansioninvoiumeand/ormass)anincreaseintherequi vefor densityofthebloodvesselssupplyingthemwithblood."Regression"n umberand refers to the reduction of tumor mass and size. As used herein, the term

"therapeutically effective a1nount"1neans the total amont of each active component compositionormethodthatissufficienttoshowameaningfulpatientb enefit,ofthe i. e., treatment, healing, prevention or anaelioration of tlle relevnt medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to a combination, the term refers to combined amoumts of the active ingredients that result in the tlerapeutic effect, whether administered in combination, serially or simultaneously, Alternatively, where an increase in angiogenesis is desired, e.g., in wound healing, or in post-infarct heart tissue, antibodies or attisera to the EM @ protein can be used to block localized. native anti-angiogenic proteins and processes, and thereby increase fornmtion of new blood vessels so as to inhibit atrophy of tissue.

EM 1 may be used in combination with other compositions and procedures for the treatment of diseases. For example, a tumor muy be treated conventionally radiation,clterootherapy,orimmunotherapycombinedwithEM1andwi thsurgery, the1l EM 1 may be subsequently administered to the patient to extend the dormancy of micrometastases and to stabilize and inhibait the growth of any residual primary 1,EM1fragments,EM1antisera,EM1receptoragonisis,EM1tumor.EM receptor antagonists, or combinations thereof. can also be combine with other anti- angiogenic compounds, or proteins, frag1nents ? antisera, receptor agonists, receptor antagonists of other anti-angiogenic proteins (e. (y itin, eiidostatin, restin, apomigren). Additionally, EM 1, EM 1 fragments, EM l antisera, EM 1 receptor agonists, EM 1 receptor antagonists, or combinations thereof, are combine with pharmaceutically acceptable excipients, and optionally$sastained-release matrix, such as biodegradable polymers, to form therapeutic compositions. The thepresentinventionmayalsocontainotheranti-angiogeniccomposi tionsof ehemicalcompounds,suchasendostatin,angiostatin,restinandprot einsor gren (both of which are described in in U. S. S. N. XX/XXX, XXX. "Restio and Methods of use Thereof', by Villas P. Sukhatme, filed December 8, 1998, the entire teachings of which are herein incorporated by reference), and mutants, fragments, thereof,Thecompositionsroayforthercordainotheragentswhichand analogs

either enfance the activity of the protein or compliment its activity or use in treatment, such as chemotherapeutic or radioactive agents. Such additional factors and/or agents may be included in the composition to produce a synergistic effect with protein of the invention, or to minimize side effects. Additionally, administration of the composition of the present invention may be administered concurrently with other therapies, e. g., administered in colijunction with a radiationtherepyregimen.chemotherapyor The invention includes methods for inlzibiting angiogenesis in mammalian tissues by contacting the tissue with a composition comprising the proteins of the invention. By"contacting"is meant not only topical application, but also those modes of delivery that introduce the composition into the tissues, or into the cells of the tissues.

Use of timed release or sustained release delivery systems are also included in the invention. Such systems are highly desirable in situations where surgery is difficult or impossible, e. g., patients debilitated by age or the disease course itself, or wllere the risk-benefit analysis dictates control over cure.

A sostained-release matrix, as used serein, is a matrix made of materials, usually polymers, which are degradable by enzyroatic or acid/base hydrolysis or by dissolution. Once inserted into the body, the matrix is acted jupon by enzymes and borth fiuids, matrixdesirablyischosenfrombiocompatiblesustained-release materials such as liposomes, polylactides (polylactic acid), polyglycolide (polymer of glycolic acid), polylactide co-glycolide (co-polymers of lactic acid and glycolic acid) polyanhydrides, poly (ortho) esters, polyproteins, hyaluronic acid, collagen, chondroitin sulfate, carboxylic acids, fatty acids, phospholipids, polysaccharides, nucleic acids, polyamino acids, amino acids such as phenylalanine, tyrosine, ispleucine, propylene,polyvinylpyrrolidoneandsilicone.polyvinyl A preferred biodegradable matrix is a matrix of one of either polylactide, polyglycolide, or polylactide co-glycolide (co-polymers of lactic acid and glycolic acide.

The angiogenesis-modulating therapeutic composition of the present invention may be a solid, liquid or aerosol and may be administered by any known route of administration. Examples of solid compositions include pills, creams, a1ld implantable dosage units. The pills may be administered orally, lhe creams may be adroirdstered topically. The implantable dosage unit may be administered locally, for example at a tumor site, or which may be implante for systemic release of the angiogenesis-modulating composition, for example subcutaneously. Examples of liguid composition include iormulations adapted for injection subcutaneously, loutravenously, intraarterially, and formulstions for topical and intraocular administration. Examples of aersol formulation include inhaler formulation for administration to the lungs.

The EM @ proteins and protein fragments with the anti-angiogenic activity described above can be provided as isolated and substantially purifie proteins and protein fragments in pharmaceutically acceptable formulations using formulation methods known to tu-rose of ordinary skill in the art. These formulations cai-i be administered by standard routes. In general, the combinations may be administered by the topical, transdermal, intraperitoneal, intracranial, intracerebroventricular, intracerebral, intravaginal, intrauterine, oral, rectal or parenteral (e. g., intravenous, intraspinal, subcataneous or intramuscular) route. In addition, the EM 1 may be incorporated into biodegradable polymers allowing for sustained release of the compound, the polymers being implante in the vicinity of where drug delivery is desired, for example, at the site of a tumor or implante so tu-rat the EM 1 is slowly released systemically. Osmotic minipumps may also be used to provide controlled delivery of high concentrations of EM 1 through canulae to the site of interest, such as directly into a metastatic growth or into the vascular supply to that tumor. The biodegradable polymers and their use are described, for example, in detail in Brem e al. (1991) 74:441-446),whichisherebyincorporatedbyreferenceinnourosurg. its entirety.

The compositions containing a polypeptide of this invention can be asbyinjectionofaunitdose,forexample.Thetermadministeredintra venously,

"unit dose"when used in reference to a therapeutic composition of the present inventiol1 refers to physically discrete units suitable as unitary dosage for tlze subject, each unit containing a predetermined quantity of active material calculated to produce the desiired therapeutie effect in association with the required diluent; i. e., carrier or vehicle.

Modes of adnfinistration of the compositions of the present inventions include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion. Pharmaceutical compositions for ptrenteral injection comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or mulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.

Exan1ples of suitable aqueous and nonaqueous carriers, diluent, solvents or vehicles include water, etllanol, polyois (e. g., glycerol, propylene glycol, polyethylene glycol and the lilce), carboxymethylcellulose and suitable mixtures thereof, vegetable oils olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity lnay be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by tile use of surfactants. These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents cmd dispersing agents. Prevention actionofmicroorganismsmaybeensuredbytheinclusionofvariousoft he antibacterial and antiftingal agents such as paraben, chlorobutanol, phenol sorbic acid and the lice. It may also be desirable to include isotonie agents such as sugars, sodium chloride and the live. Prolonge absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents, such as aluminum monostearate and geiatin, which delay absorption. Injectable depot forms are made by forming microencap@ule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide, poly (orthoesters) and poly (anhydrides). Depending upon the ratio of drug to. polymer and the nature of the particulw polmer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions wlaich are

compatible with body tissues. The injectable formulations may be sterilized, for exemple, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the-form of sterile solid compositions which can be dissolve or disperse in sterile water or other sterile injectable media just prior to use.

The therapentic compositions of the present invention can include pharnzaceutically acceptable salts of the components therein, e.g., which may be derived from inorganic or organic acids. By"pharmaceutically acceptable salt"is meant those salts which are, within the scope of sound medical jugement, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like and are com1nensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well-Icnown in the art. For example, S. M. Berge, et al. describe pharnzaceutically acceptable salts in detail in@ @harmaceutical Sciences (1977) 66: 1 el seq. which is incorporated serein by reference. Pharmaceutically acceptable salts include tlae acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for exemple, hydrochloric or phosphoric acids, or sucez organic acids as acctic, tartaric, mandelle and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidiiie., procaine and the lilee. The salts may be prepared in situ during the final isolation and purification of the compound of the invention or separately by reacting a free base function with a suitable organic acid. Representative acid addition salts inclue, but are not limited to acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsufonate, digluconate, hepto@ate,hexanoate,fumarate,hydrochioride.glycerophosphate, hemisulfate, hydrobromide, hydroiodide, 2-hydroxymethanesulfonate (isethionate), lactate, 1naleate, methanesulfollate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, <BR> <BR> <BR> 3-phenylpropionare,picrate,pivalate,propionate,succinat@e,pe ctinate,persulfate, <BR> <BR> <BR> <BR> <BR> <BR> <BR> phosphate,glot@@ate,bicarbonate,p-toluenesulfonateandtartate .@@@ocyanate,

undecanoate. Also, the basic nitrog@n-contairung groups can be quaternized with such agents as lower alkyl halides such as inethyl, ethyl, propyl, and butyl chlorides, bromides and iodides; dialkyl sulfates like dimethyl, diethyl, dibutyl, and diamyl sulfates; long chain halides such as decyl, lauryl, niyristyl and steal-yl chlorides, bromides and iodides; arylalkyl halides like benzyl and phenethyl bromides and others. Water or oil-soluble or dispersible products are thereby obtained. Examples of acide which may be employez to form pharmaceutically acceptable acid addition salts include such inorganic acids as hydrochloric acid, hydrobromic acid, sulphuric acid and phosphoric acid and such orga@ic acids as oxalic acid, maleic acid, succin@ acid and citric acid.

As used terns"pharmaceuticailyocceptable,@@physiologicallythe tolerable"and grammatical variations thereof as they refer to compositions, carriers, diluents and reabents, are used interchgeably and represent that tlle materials are capable of administration to or upon a mamnzal with a minimum of undesirable suchasnausea,dizziness,gastricupsetandthelike.Thephysioligic aleffects prepartion of a pharmacological composition that contains active ingredients dissolvez or dispersed therein is well understood in tulle art and need not be limited based on formulation. Typically such compositions are prepared as injectables either as liquid solutions or suspensions, however, solid forms sutable for solution, or suspensions, in liquid prior to use can also be prepared. The preparation can also be emulsified.

The active ingredient can be mixed with excipeints which are pharmaccutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapetltic methods described herein. Suitable excipients inclue, tor example, water, saline, dextrose, glycerol, ethanol or the like and combinations thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like which enhaoce the effectiveness of the active ingredient.

The EM 1 polypeptides of the present invention can also be included in a composition comprising a prodrug. As used herein, the term"prodrug"refers to

compound which are rapidly transforroed in vivo to yield the parent compound, for exemple, by enzynzatic hydrolysis in bloom. A thorough discussion is provided in T.

I-liguchl and V. Stella, Prodrugs as Novel Delivery Systems, Vol. 14 of the ACS Symposium Series and in Edward B. Roche, ed., bioreversible Carriers inj Drug Design, American Pharmacentical Association and Permagon Press, 1987, both of which are incorporated herein by reference. As used herein, the term "pharmaccutically acceptable prodrug" refers to (l) those prodrugs of the con1pounds of the present invention which are, within the scope of sound medical jugement, suitable for use in contact with the tissues of humans and animals witllout undue toxicity, irritation, allergic response and the lice, commensurate with a suitable benefit-to-risk ra@@o and effective for their intended use and (2) zwitterionic forms, where possible, of the parent compound.

Tlae closage of the EM 1 of the present invention will depend on the disease state or condition being treated and other clinical factors such as weight and condition of tlze human or animal and the route of administration of the compound.

For treating humaus or animales, about 10 mg/kg of body weight to about 20 mg/kg of body weight of the @M 1 protein or the apomigren protein can be administered.

In combination therapies, e. a., the EM 1 protein of the invention in combination with radiotherapy, chemotherapy, or i@@@@otherapy, it may be possible to reduce the dosage,@ g., to about 0.1 @ng/kg of body weight to about 0.2 mg/kg of body weiglit. Depending upon the half-life of the EM 1 in the particular animal or human, the EM 1 can be administered between several times per day to once a week. It is to be understood that the present invention has application for both human and veterinary use. The methods of the present invention contemplate single as well as multiple administrations, given either simultaneously or over an extended period of time. In addition, EM 1 can be administered in conjuntion with other forzms of cbemotherapy,radiotherapy,ormmunotherapy.therapy,e.g., The EM 1 formulations include those suitable for oral, rectal, ophthalmic (including intravitreal or intracameral), nasal, topical (including buccal and sublingual), intrauterine, vaginal or parenteral (including suboutaneous,

intraperitoneal, intramuscular, intravenous, intradermal, intracranial, intratracheal, and epidural) administration. The EM 1-formulations may conveniently be presented in unit dosage form and may be prepared by conventional pharmaceutical techoiques, Such techoiques include the step of bringing into association the active inbredient and the pharmaceutical carrier (s) or excipient (s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

Formulations suitable for parenteral administration inclue aqueous and non- aqueous sterile injection solutions which may contain anti-oxidants, buffers, bo@@eriostats and solutes which render the forn1ulation isotonic with the blood of the intended recipient ; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose dose or multi-dose containers, for example, sealed ampules and vials. and may be store in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kiod previously described.

When a therapeutically effective amount of protein of the present invention is administered orally, the EM 1 protein of the present invention will be in the form of a tablet, capsule, powder, solution or elixir. When administered in tablet form, the pharmaceutical composition of the invention may additionally contain a solid carrier sucez as a gelatin or an adjuvant. The tablet, capsule, and powder contain from bout 5 to 95% protein of the present invention, and preferably from about 25 to 90% protein of the present ioveotion. When administered in liquid fors, a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added. The liquid form of the phamnaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as etllylene glycol, propylene

glycolglycolor polyethylene administeredinliquidform,theWhen pharmaceutical composition contains from about 0.5 to 90% by weight of protein of the present invention, and preferably from about 1 to 50% protein of the present invention.

Wlzen a therapeutically effective amont of protein of the present invention is administered by intravenous, cutaneous or subcutaneous injection, protein of the present invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such parenterally accepttble protein solutions, shaving due regard to pH, isotonichy, stability, and the like, is within the skill in the art. A preferred phmaceutical composition for intravenous, cutaneous, or subcutaneous injection slould contai, in addition to protein of the present invention, @n suchasSodiumchioride@njection,Ringer'sInjection,vehicle Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactate Ringer's Injection or other vehicle as know@ in the art. The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, lwffers, antioxidants, or other additives know@@ to those of skill in the art.

The amount of protein of the present invention in the ghermacetr@ical composition of the present invention will depend upon the nature and severity of the condition being treated, and on té nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide tue amont of protein of the present invention with which to treat each individual patient. Initially, the attending physician will administer low doses of protein of the present invention and observe the patient's response. Larger doses of protein of the present invention may be administered until the opthnal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further.

The duration of intravenous therapy using the pharmoceutical composition of the present invention will vary. depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the protein of the present invention will be in the range of 12 to 24 hours of contim@ous intravenous

administration. Ultimately the atrending physician will decide on the appropriate duration of intravenous therapy using the pharu@@ceutical composition of the present invention.

Preferred unit dosage formulations are those containing a daily dose or unit, daily sub-dose, or an appropriate-fraction thereof, of the administered ingredient. It should be understood that in addition to the ingredients, particularly menttioned above, the formulations of the present invention may include other agents conventional in the art shaving regard to the type of formulation in question.

Optionally, cytotoxic agents may be incorporated or otherwise combine with EM 1 proteins, or biologically functional protein fragements tllereof, to provide dual therapy to the patient.

The therapeutic compositions are also presently valable for veterinary applications. Particularly domestic animals and thoroughbred horses, in addition to humans. are desired patients for such treatment with proteins of the present invention.

Cytotoxic agents such as ricin, are linked to EM 1, and high affinilty EM ? protein fragments, thereby providing a tool for destruction of cells that bind EM 1.

These cells may be found in nwany locations, including but not limited to, micrometastases and mimary @mors. Proteins linked to cytotoxic agents are infused in a manner designed to maximize delivery to the desired location. For example, ricin-linked high affinity EM 1 fragments are delivered through a cannula into vessels supplying the taret site or directly into the target. Such agents are also delivered in a controlled malmer through osmotic pumas coupled to infusion cannulae. A combination of EM 1 antagonists ray be co-applied with stimulators of angiogenesis to increase vascularization of tissue. This therapeutic regimen provides an effective means of destroying metastatic cancer.

Additional treatment metllods include administration of EM 1, EM 1 fragments, EM @ analogs, EM 1 anisera, or EM 1 receptor agonistes and antagonists linked to cytotoxic agents. It is to be understood that the EM @ can be human or animal in origin. EM I can also be produced synthetically by chenfical rection or

techniquesinconjunctionwithexpressionsystems.EM1canalsobyrec ombinant be produced by enzymatically cleaving isolated plasnfinogen or plasmin to generate proteins having anti-angiogenic activity. EM 1 mamy also be produced by con1pounds t11a1 mimic lé action of endogenous enzymes that cleave glasminogen to EM 1.

EM 1 production may also be modulated by compound that affect the activity of plasminogen cleaving enzymes.

The present invention also encompasses gene therapy whereby a polynucleotide encoding EM 1, or a mutant, fragment, or fusion ptotein thereof, is introduced and regulatedin patient. Various transferringordeliveringof DNA to cells for expression of the gene product protein, otherwise referred to as gene therpy, are disclosed in Geue Transfer into Mommalian Somalic Cells ijz vivo, N Yang (1992) cr@@. Rev. Bio@ec@@ 12 (4) @335-356, which is hereby incorporated by reference. Gene therapy encompasses incorporation of DNA sequences into somatic cells or cerna line cells for use in either ex vivo or in vivo therapy. Gene therapy functions to replace genes, augnzent normal or anormal gene function, and to combat infectious diseases md otlzer pathologies.

Strategies for treating these medical problems with gene therapy include therapeutic strategies such as identifying the defective gene and then adding a fimctional gene to either replace the function of the defective gene or to augment a slightly functional gene; or prophylactic strategies, such as adding a gene for the product proteio that will treat the condition or that will 1nake the tissue or organ more susceptible to a treatment regimen. As an example of a prophylactic strategy, a gene such as EM 1 may be placed in a patient and thus prevent occurrence of angiogenesis ; or a gene that makes tamor cells more susceptible to radiation could be inserted and then radiation of the tumor would cause increased killing of the tomorcelis.

Many protocols for transfer of EM 1 DNA or EM 1 regulatory sequences are envisioned in this invention. Transfection of promoter sequences, other than one normally found specifically associated with EM l, or other sequences wlzich would increase production of EM @ protein are also envisioned as methods of gene therapy.

An example of this technology is found in Transkaryotic Therapies, Inc., of Cambridge, Mass., using howologous recombination to insert a"genetic switch"that tuons on an erythropoietin gene in cells. See Genetic Engineering News, Apr. 15, 1994. Stlch'genetic switches"could be used to activate EM 1 (or the EM 1 receptor) in cells not normally expressing EM 1 (or tlle EM 1 receptor).

Gene transfer methods for gene therapy fall into three broad categories: physical (e. g., electroporation, direct gene transSer and particle bombardment), chemical (e. g., lipid-based carriers, or other non-viral vectors) and biological (e. g. virus-derived vector and receptor uptake). For example, non-viral vectors may be used which include liposomes coated with DNA. Such liposome/DNA complexes may be directly injecte intravenously into the patient. It is believed that the liposome/DNA complexes are concentrated in the liver where they deliver the DNA to macrophages and Kupffer cells. These cells are long lived and thus provide long term expression of the delivered DNA. Additionally, vectors or the "naked" DNA of the gene may be directly inj ected into the desired organ, tissue or tumor for targeted delivery of the therapeutic DNA.

Gene therapy methodologies can also be described by delivery site.

Pundamental ways to deliver genes include ex vivo gene transfer, in vivo gene transie, and in vitro gene transfer. In ex vivo gene transfer, cells are taken from t)-ie patient and grown in cell culture. The DNA is transfected into the cells, the transfected cells are expallded in number and then reimplanted in the patient. In in vitro gene transfer, the transformed cells are cells growing in culture, such as issue culture cells, and not particular cells from a particular patient. These "labora@ory cells"are transfected, the transfected cells are selected and expanded for either implantation into a patient or for other uses.

In vivo gene transfer involves introducing the DNA into the cells of the patient wlien the cells are within the patient. Methods include using virally mediated gene transfer using a noninfectious virus to deliver the gene in the patient or DNAintoositeinthepatientandtheDNAistakenupbyainjectingnaked percentage of cells in which the gene product protein is expressed. Additionally, the

other methods described herein, such as use of a"gene gun,"may be used for in vitro insertion of EM 1 DNA or EM 1 regulatory sequences.

Chemical methods of gene therapy may involve a lipid based compound, not necessarily a liposome, to transfer the DNA across the cell membrane. l, ipofectins or cytofectins, lipid-based positive ions that bind to negatively charged DNA, make a compiex that can cross the cell membrane and provide the DNA into the interior of the cell. Another chemical method uses receptor-based endocytosis, which involves binding a specific ligand to @ cell surface receptor and enveloping and transporting it across the cell membrane. The ligand binds to the DNA and the whole complex is transported into the cell. The ligand gene complex is injecte into tlie Ulood stream and then target cells that have the receptor will specifically bind tue ligand and transport tlle ligand-DNA complex into the cell.

Many gene therapy methodologies cmploy viral vectors to insert genes into cells. For example, altered retrovirus vectors have been used in ex vivo methods to intoperipheralandtumor-infiltratinglymphocytes,hepatocytes,i ottoducegenes epidermal cells, myocytes, or other somatic cells. These altered cells are then introduced into the patient to provide the gene product froc té inserted DNA.

Viral vectors have also been used to insert genes into cells using in vivo protocols. To direct the tissue-specific expression of foreign genres, cis-acting regulatory elements or promoteurs that are known to be tissue-specific can be used.

Alternatively, this can be achieved using in sit-ll delivery of DNA or viral vectors to specific anatomical sites in vivo. For example, gene transfer to blood vessels in vivo was achieved by implanting in vitro transduced endothelial cells in chosen sites on Thevirusinfectedsurroundingcellswhichalsoexpressedthegeneart erialwalls. product. A viral vector can be delivered directly to the in vivo site, by a catheter for exarople, @@@s allowing only certain areas to be infecte by the virus, and providing long-term, site specific gene expression. In vivo gene transfer using retrovirus vectors has also been demonstrated in mammary tissue and hepatic tissue by injection of the altered virus into blood vessels leading to the organs.

Viral vectors that have been used for gene therapy protocols include but are not limited to, retroviruses, other RNA viruses such as polioviras or Sindbis virus, adenovirus, adeno-associated virus, herpes viruses, SV 40, accinia and other DNA viruses. Replication-defective murine retroviral vectors are the 1nost widely utilized gene transfeu vectors. Murine leukemia retroviruses are compose of a single strand RNA complexe with a nuclear core protein and polymerase (pol) enzymes, encased by a protein core (gag) and surrounded by a glycoprotein envelope (env) that determines host range. The genomic structure of retroviruses include the gag, pol, and en genets enclose at by the 5'and 3'long terminal repeats (LTR). Retroviral vector systems exploit the fact that a minimal vector containing the S' and 3' LTRs and the packagillg signal are sufficient to allow vector packaging, inFection and integration into target cells providing that the viral structural proteins are supplie in trans in the packaging cell line. Pwndawental avantages of retroviral vectors for gene transfer include efficient infection and gene expression in most cell types, precise single copy vector integration into target cell chrotnosomal DNA, and ease of manipulation of the retroviral genome.

The adenovirus is composed of linear, double stranded DNA complexed with core groteins and surrounded with capsid proteins. Avances in molecular virology have led to the ability to exploit the biology of these organisms to create vectors capable of transducing novel genetic sequences into target cells in vivo. Adenoviral- based vectors will express gene product proteins at high levels. Adenoviral vectors have high oficiencies of infectivity, even with low titers of virus. Additionally, the virus is fully infective as a cell free virion so injection of producer cell lines are not necessary. Another potential avantage to adenoviral vectors is the ability to achieve long term expression of heterologous genes in vivo.

Mechanical methods of DNA delivery include fusogenic lipid vesicles such as liposomes or other vesicles for membrane fusion, lipid particles of DNA incorporating cationic lipid such as lipofectin, polylysine-mediated transfer of DNA, ofDNA,suchasmicroinjectionofDNAintogermorsoroaticcells,direc tinjection pneumatically delivered DNA-coated particles, such as the gold particles used in a

"gene gun,"and inor,, anic chemical approaches such as calcium phosphate transfection. Particle-mediated gene transfer methods were first used in transforming plant tissue. With a particle bombardment device, or"gene gun,"a motive force is generated to accelerate DNA-coated high density particles (sucez as gold or tungsten) to a lZiblh velocity that allows penetration of the target organs, tissues or cells. Particle bombardment can be used in in vitro systems, or with ex vivo or in vivo techniques to introduce DNA into cells, tissues or organs. Another <BR> <BR> genetherapy,involvescomplexingtheDNAwi@@specificmethod,ligan d-mediated ligands to form ligand-DNA conjugates, to direct the DNA to a specific cell or tissue.

It has been-found that injecting plasmid DNA into muscle cells yields high percentage of the cells w@ich are transfected and have sustained expression of marker genes. The DNA of the plasmid may or may not integrate into the gnome of the cells. Non-integration of the transfected DNA would allow the transfection and expression of gene product proteins in terminally differentiated, non-proliferative tissues for a prolonge period of time withour fear of mutational insertions, deletions, or alterations in the cellular or mitochondrial genome. Long-term, but not necessarily permanent, transfer of therapeutic genes into specific cells may provide treatments for genetic diseases or for prophylactic use. The DNA could be reinjected periodically to maintain the gene product level without mutations occurring in the genomes of the recipient cells. Non-integration of exogenous DNAs may allow for the presence of several different exogenous DNA constructs withii-i one cell with all of the constructs expressing various gene products.

Electroporation for gene transfer uses an electrical current to make cells or tissues susceptible to electroporation-mediated mediated gene transfer. A brief electric impulse with a given field strength is used to increase the permeability of a membrane in such a way that DNA molecules can penetrate into the cells. This technique can be used in in vitre systems, or with ex vivo or in vivo techniques to introduce DNA into cells, tissues or organs.

Carrier mediated gene transfer iJZ vivo can be used to transfect foreigu DNA into cells. The carrier-DNA complex can be conveniently introduced into body fluids or the bloodstream and then site-specifically directe to the target organ or ti. ssue in the body. Both liposomes and polycotions, such as polylysine, lipofectins or cytofectins, can be used. Liposomes can be developed which are cell specific or onglon specific and thus the foreign DNA carried by the liposome will be taken up by taret cells. Injection of immunoliposomes that are targeted to a specific receptor on certain cells can be used as a convenient methocl of inserting the DNA into the cells bearing the receptor. Another carrier system that has been used is the asialoglycoporteiupolylysine conjugate system for carrying DNA to hepatocytes for in vivo gene transfer.

The transfected DNA may also be complexe with other kinds of carriers so that the DNA is carried to the recipient cell and tlen resides in the cytoplasm or in the nucleoplasm. DNA can be coupled to carrier nuclear proteins in specifically engineered vesicle complexes and carried directly into the nucleus.

Gene regulation of EM 1 mamy be accomplished by administering compound that bind to the EM 1 gene, or control renions associated with the EM I gene, or its corresponding RNA transcrit to modify the rate of transcription or translation.

Additionally, cells transfected with a DNA secluence encoding EM 1 may be administered to a patient to provide an in vivo source of EM 1. For example, cells may be transfected with a vector containing a nucleic acid sequence encoding EM 1.

Tlle transfected cells may be cells derived from the patient's normal tissue, the patient's diseased tissue, or may be non-patient cells.

For example, tumor cells removed from a patient can be transfected with a vector capable of expressing the EM 1 protein of the present invention, and re- introduced into the patient. The transfected tumor cells produce EM 1 levels in the patient that inhibit the growth of the tumor. Patients may be human or non-human animals. Cells may also be transfected by non-vector, or physical or chemical methods known in the art such as electroporation, ionoporation. or via a"gene gun."

Additionally, EM 1 DNA may be directly injecte, without the aid of a carrier, into a patient. In particular, EM 1 DNA may be injecte into skin. muscie or blood.

The gene therapy protocol for transfecting EM I into a patient may either be through integration of the EM 1 DNA into the genome of the cells, into minichromosomes or as a separate replicating or non-replicating DNA condstruct in the cytoplasm or nucleoplasm of the cell. EM 1 expression may continue for a long- period ouf time or may be reinjected periodically to maintain a desired level of the EM 1 puotein in the cell, the tissue or organ or a determined blood level.

In addition, the invention encompasses antibodies and antisera, wl1icll can be used ior testing of novel anti-angiogenic proteins, and can also be used in diagnosis, prognosis, or treatment of diseases and conditions clmactenized by, or associated with, angiogenic activity or lack thereof. Such antibodies and antisera can also be used to up-regulate angiogenesis where clesired, e. g., in post-infarct heart tissue, aufibodies or attisera to the EM 1 protein can be used to block localized, native anti- augiogenic proteins and processes, and increase formation of new blood vessels and inhibait atrophy of heart tissue.

Such antibodies and antisera can be combine with pharmaceutically- acceptable compositions and carriers to form diagnostic, pronostic or therapeotic compositions. The term "antibody" or "antibody inolecule" refers to a population of and/orimmunologicallyactiveportionsofimmunoglobulinmolecules immunoglobalin molecules, i. e., molecules tliat contain an antibody combining site or paratope.

Passive antibody therapy using antibodies that specifically bind EM 1 can be employed to modulate angiogenic-dependent processes such as reproduction, development, and wound healing and tissue repair. In addition, antisera, antisera directe to the Fab regions of EM 1 antibodies can be administered to block the ability of endogenous EM 1 attisera to bind EM 1.

The EM 1 of the pressent invention also can be used to generate antibodies that are specific for the inhibitor and its receptor. The antibodies can be either polyclonal antibodies or monoclonal antibodies. These antibodies that specifically

bind to the EM l or EM 1 receptors can be used in diagnostic methods and kits khat are well known to those ordinary skill in the art to detect or quantify the EM 1 or EM 1 receptors in a body fluid or tissue. Results from these tests can be used to diagnose or predict the occurret1ce or recurrence of a cancer and other angiogenic mediateddiseoses.

The invention also inclues use of EM 1, antibodies to EM 1, and compositions comprising EM 1 and/or its antibodies in diagnosis or prognosis of diseases cheracterized by angiogellic activity. As used herein, the term"prognostic method"means a method that enables a prediction regarding the progression of a disease of a humas or animal diagnose with the disease, in particular, an angiogenesis dependent disease. The term"diagnostic method"as used serein means a 1nethod that enables a determination of the presence or type of angiogenesis-dependent disease in or on a human or animal.

The EM 1 cas be used in a diagnostic method and kit to detect and quantify antibodies capable of binding EM 1. These kits would permit detection of 1antibodieswhichindic@esthespreadofmicrometastasesinthecirou latingEM presence of EM 1 secreted by primary tumors in situ. Patients that have sucs circulating anti-EM 1 an@bodles may be more likely to develop multiple tumors and cancers, and may be more likely to have recurrences of cancer atter treatments or periods of remission. Tlle rab fragments of these anti-EM i antibodies may be used as antigens to generate anti-EM 1 Fab-fragment antisera wllich can be used to neutralize @nti-EM @ antibedies. Such a method would reduce the removal of circulating EM 1 by anti-EM 1 antibodies, thereby effectively elevating circulating EM levels.

The present invention also inclues isolation of receptors specific for EM 1.

Protein fragments that possess high affinity binding to tissues can be used to isolate the EM 1 receptor on affinity col. umns. Isolation and purification of th. e EM 1 receptor is a fundamental step towards elucidating the mechanism of action of EM 1.

Isolation of an EM 1 receptor and identification of EM 1 agonists and antagonists will facilitate development of drugs to modulate the activity of the EM 1 receptor,

the final pathway to biological activity. Isolation of the receptor enables the construction ol nucleotide probes to monitor the location and synthesis of the receptor, using in, sitar and solution hybridization technology. Further, the gene for the EM I receptor can be isolated, incorporated into an expression vector and transfected into cells, sucs as patient tumor cells to increase the ability of a cell type, tissue or tumor to bind FM 1 ancl inlzibit local angiogenesis.

EM 1 proteins are employed to develop affinity colmms for isolation of the EM 1 receptor from cultured tumor cells. Isolation and purification of the EM 1 receptor is followeci by amino acid sequencing. Using this information the gene or bennes coding for the EM 1 receptor can be identifie and iselated. Next, cloned nucleic acid sequences are developed for insertion into vectors capable of expressing the receptor. These techniques are well l : nown to those skilled in the art.

Transfection of the nucleic acid sequence (s) coding for EM 1 receptor into tumor cells, and expression of the receptor by the traiisfected tumor cells enfances the responsiveness of these cells to endogenous or exogenous EM l and thereby rateofmetastaticgrowth.decreasingthe Angiogenesis-iuubiting proteins of the present invention can be synthesized in a standard microcliemical facility and purity checked with HPLC and mass spectropllotometry. Methods of protein synthesis, HPLC purification and mass spectrophotometry are commonly knowll to those skilled in these arts. EM 1 proteins and EM 1 receptors proteins are also produced in recombinant E coli or yeast expression systems, and purified with column chromatograplzy.

Different protein fragments of té intact EM 1 molecule can be synthesized for use in several applications including, but not limited to the following; as antigens for the development of specific antisera, as agonists and antagonists active at EM 1 bioding sites, as proteins to be linked to, or used in combimation witll, cytotoxic agents for targeted killing of cells that bind EM 1. The amino acid sequences that comprise these proteins are selected on the basis of their position on the exterior regions of the molecule and are accessible for binding to anisera. The amino and

carboxyl termini of EM 1, as well as the mid-region of the molecule are represented separately among the fragments to be synthesized.

The synthetic protein fragments of EM @ have a variety of uses. The protein that binds to the EM 1 receptor with high specificity and avidity is radiolabeled and employed for visualization and quantitation of binding sites using autoradiographic and membrane binding techniques. This application provides important diagnostic and research tools. Knowledge of the binding properties of the EM 1 receptor facilitates investigation of the transduction mechanisms linked to the receptor. andEM1derivedEM1 proteins coupiedtootherinoieculesusingbe standard methods. The amino and carboxyl terminai of EM 1 both contain tyrosine ancl lysine residues and are isotopically and nonisotopically labeled with many techniques, for example radiolabeling using conventional techniques (tyrosine residues-chloramine T, iodogen, lactoperoxidase, lysine residues-Bolton-Hunter ragent). These coupling techniques are well known to those skilled in the art.

Alte1natively, tyrosine or lysine is added to fragmeots tbat do not have these residues to facilitate labeling of reactive amino and hydroxyl groups on the protein. The coopling technique is chosen on the basis of the functional groups available on the ai-lino acids incltlding, but not limited to amino, sulfhydral, carboxyl, amide, phenol, and imidazole. Various reagents used to effect these couplings include among others. glataraldehyjde, diazotized benzidine, carbodiimide, and p-benzoquinone.

EM 1 proteins are chemically coupled to isotopes, enzymes, carrier proteins, cytotoxic agents, fluorescent molecules, chemiluminescellt, bioluminescent and other compounds for a variety of applications. The efficiency of the coupling rection is determined using different techniques appropriate for the specific rection. For example, mdiolabeling of an EM 1 protein with 125 I is accomplished using chloramine l' and No 135I of higl@ specific activity. The rection is terminated metabisulfiteandtheraixtureisdesaltedondisposablecolumns.The withsodium iselutedfromthecolumaandfractionarecollected.Aliguotsarelabe ledprotein removed from each fraction and radioactivity measured in a gamma conter. In this manner, the umeacted Nal25I is separated from the labeled EM 1 protein. Tulle

protein fractions with the highest specific radioactivity are stored for subsequent use such as allalysis of the ability to bind to EM 1 antisera.

In addition, labeling EM 1 proteins with short lived isotopes enables visualization of receptor binding sites in vzvo usinb positron emission tomography or radlographictechniquestolocatetumorswithEM1bindingsites.othe rmodern Systematic substitution of amino acids within these synthesized proteins yields high aff1nity protein agonists and antagonists to the EM 1 receptor that enhance or diminish EM l binding to its receptor. Such agonists are used to suppress the browtll of micrometatases, thereby limiting the spread of cancer.

Antagonists to EM 1 are applied in situations of inadequate vascularization, to block the inhibitory effects of EM 1 and promote angiogenesis. For example, this treatment may have therapeutic effects to promote wound healing in diabetics.

The EM 1 protein of the present invention can also be used as a nutritional source or supplement. Such uses include without limitation use as a protein or amino acid supplement, use as a carbon source, use as a nitrogen source and use as a source of carbohydrate. In such cases, the EM i protein of the invention can be added to the food of a yarticular organism, or can be administered as a separate solid or liquid preparation, sucs as in the form of powder, pills, solutions, suspensions or capsules.

In the case of microorganisms, the protein or polynucleotide of the invention can be added to the medium in or on which the microorganism is culture.

The invention is further illustrated by the following examples, which are not meant to be construed in any way as imposing limitations upon the scope thereof.

On the contrary, it is to be clearly understood that resort may be had to various other embodiments, modifications, and equivalents thereof, whicb. after reading the description herein, may suggest themselves to those skilled in the art without departing from the spirit of the present invention and/or the scope of the appende claims.

EXAMPLES Example l: Cells and Cell vines Cell litre 786-0 (ATCC No. CRL-1932). a renal clear cell carcinoma line; C-PAE (ATCC No. CCL-209), a bovine pulmonary arterial endothelial cell line and ECV304 (ATCC No. CRI-1998). a hulllan endothelial cell line were all obtained from ATCC (American Type Culture Collection, 10801 University Bnoolevard, Manassas, Virginia, 20110-22l09, USA). The cell lines were maintained in either DMEM (786-0 and C-PAE) or M199 (ECV304), supplemented with 10% fetal calf setuin. 100 U/ml of µg/mlo9fstroptoinycinand2mML-giutamine.100 The cDNA clone for mouse endostatin #BACPak 8 was kindly provided by B. R Olsen, Department of Cellular Biology, Harvard Medical School. Boston. The prokaryotic expression vector pETl7b was purchased from Novagen (Madison, Wisconsin, USA). The yeast expression system, Pichia pastoris (pPICZαA) was purchased fi-om InVitrogen (San Diego, Callfornia, USA). Restriction enzymes and Vent DNA polymerase were purchased from New England Biolabs (Beverly, Massachusetts, USA).

Example 2: Cloning and expression of mouse endostatin and mutabrs into a prokarvoticsvstern The () ene encoding mouse endostatin was amplifie from the pBACP ak 8 plasmid and expressed initially in the pET expression system. The sequence encoding the carboxy terminal portion of mouse collagen XVIII was amplifie by amplification using Vent DNA polymerase, with the endostatin pBACPak 8 vector as a template. The primers used were 5'-GGCATA TGC ATA CTC ATC AGG ACT TI'-3' (SEQ ID NO:3) and 5'-AAC TCG AGA TTT GGA GAA AGA GGT-3'. Amplification was carried out for 30 cycles with the following parameters: 94°C for denaturation, 60°C for annealing, and 72°C for extension, each for 1 minute. The amplified DNA Cragment (555 bp) was purified using a QFAqntck purification kit, digested with NdeI and Xhol (these restriction sites are underlined in the primers above), and ligated into the expression vector pHTITobis (Dbansbal et al (1995). #

182:165-175).Initialtransformationwascarriedoutwiththeimmuno l.Methods. host strain HMSJ 74 (Novagcn, Maison, Wisconsin, USA). Positive clones were sequenced on both strands. The desired clones were finally transformed into BL21 (DE3) (Novagen, Maison, Wisconsin, USA) for expression. The expression of recombinant protein in the pET system was carried out as recotrometuied by the manufacturer (Novageo, Madisod, Wisconsin, USA).

A Ni-NTA agarose column was used to puriïy the recombinant protein.

Protein present in inclusion bodies was solvbi. lized in 8 M urea and purified under denaturing conditions as described by O'Reilly et al. (1997) (Cell 88: 277-285). The showninPig.I,whichisagraphshowingtheabsorbanceat280nmofresul tsare the eluted fractions (0). Also plotted is the pH of the elution buffer (#). Fig. @ shows a small peak around fiactions 7-8, a sharp peak aroand fractions 21-22, and anotller small peak around fi-action'j5.

SDS-PAGE analysis of 10-ml samples of selected fractions showed a discrete band at 22-24 kDa under non-reducing conditions. Results are shown in Fig, 2, which shows a 22-24 kDa band for fractions 7 and 8 (lanes 3 aud 4, respectively), and also for fractions 21 and 22 (lanes 5 and 6, respectively). In addition, higher molecular weight complexes of 46 and 69 kDa were also observed, which npon reduetion with DTT resulted in a discrete band at 22-24 kDa (lane 7 of Fig. 2). The peaks at differen@ pH lutions (pH 4.2 and 3. 0) were pooled and dialyzed against decreasing concentrations of urea, and final dialysis was performed in PBS buffer (pH 7.4), at wl-tich time most of the proteins precipitated out of solution. Since non-refolded precipitated protein expressed from a simila@ system had shown biological activity in Vi120 the exact procedure for"protein refoldinga was done as described by O'Reilly et cil. (1997) (Cell 88: 277-285). The precipitated protein was used in suspension form for iM vivo experiments only, with the concentration of protein measured by BCA assay (Pierce Chemical Co., Rockford, Illinois, USA) (solubilized in urea witll a suitable blanc) and stored at-70°C in small aliquots.

Since mouse and human endostatin are conserve at the C-terminus, two small deletions were made. Primers were designed auch that either 9 or 17 amino acids

were delered from the C-terminus of endostatin, resulting in two mutants, designated EM 1 and EM 2, respectively. 15 or EM 1, all 4 of the cysteine residues were left intact. Por EM 2, the most C-terminal cysteine was also deleted. Tulle upstream primer for theM 1 mulant was 5'-TTC CAT ATG CAT ACT CAT CAG GAC TTT CAG IDNO:7),andthedownstreamprimerwas5'-TTAGCG(SEQ GCC GCC T'AC TCA ATG CAG AGG ACG ATG TA-3' (SEQ ID NO: 8). The upstream primer for the EM 2 mutant was 5'-TTC CAT ATG CAT ACT CAT CAG GAC TTT CAG CCA-3' (SEQ ID NO : 9), and the downstleam primer was 5'-ta GCG GCC GCC TAG TTG TGG CAG CTC GCA GCT TTC Tu--)' (SEQ ID NO: 10).

The amplifie DNA fragments (528 bp for EM 1, 504 bp for EM 2) were purified, digeste with NceI and Noff. and ligated into a precligested pET28 (a) expression vector. The rest of the protocol was carried out as described above.

Induction conditions and processing of the bacterial pellet were as described by O'Reilly et al. (1997) (Cell 88: 277-285). The purification of recombillant protein was performed usine a Ni-NTA column in the presence of 8 M urea as described in maruat(Qiagen,Hilden,Germany)./Briefly,thebacterialtheQIAexp ressionist pellet was solubilized in equilibration buffer (8 M urea, 10 mM Tris and 100 mM sodium phosphate buffer, pH 8.0) for one hour at room temperature. The suspension was sonicated 3-4 times, centrifuged at 10,000x g and the soluble fraction was loaded on a Ni-NTA column pre-equilibrated with the above buffer at a flow rate of 10-20 ml per hour. The column was washed extensively with equilibration buffer.

Bound proteins were eluted by lowering the pH of the buffer from 8.0 to 6.3, then to 4.2, and finally tao 3.0. For the in vivo experiments utilizing endostatin mutants, non-specifie proteins binding to the column were removed by an equilibration buffer wash, followed boy 10 mM and 25 mM imidazole washes. Bound proteins were eluted in equilibration buffer containing 0.2 M acetic acid. The purifie fractions were analyzed by SDS-PAGE and the fractions containing purifie endostatin (pH 4.2 rand 3.0 foí wild type endostatin and equilibration buffer comairang 0.2 M acetic acid for endostatin mutants) were pooled and refolded slowly. The final dialysis was

carried out against PBS (pH7. 4) at 4 ° C. During dialysis the protein precipitated out of solution. It was further concentrated and stored at-70 ° C in small aliquots. The concentration of protein was determined by the BCA assay (Pierce Chemical Co., fRockiord, Illinois, USA).

Exemple 3: Expression of mouse endostatin in Pichia pastoris ametbanotropicyeaststrain,hosmanyadvantagesofaPichiapastoris , higher etlkaryotic expression system: (a) the presence of alpha factor signal sequence facilitates secretion of the expressed protein into the medium, (b) the yeast strain (GS 115) secrets only very low levels of endogenous host protein which further simplilies the purification process, (c) endotoxin contamination is not an issue, and (d) glycosylation can occur.'I'he pPICZu. A vector was selected for expression of mammalian endostatiu and its mutants and fragments, because tl-iis system produces onti-angiogenie proteins in hich titer, and with excellent biological activity, as is described in detail in U. S. S. N. XX/XXX, XXX,"Methods of Producing Anti-angiogenic Proteins,"by Villas P. Sulchatme, filed December 8,1998, the entire teachings of which are incorporated serein by reference. When this expression system was used, mammalian endostatin was found to be expressed as a soluble protein (20 kDa) with a pealc level of expression noted on the second day after induction.

The sequence encoding. mouse endostatin was further modifie by amplification using Vent DNA polymerase on a template of pETl7bhis construct, which contained the mouse endostatin described above. The upstream primer used was 5'-GGG AAT TCC ATA CTC ATC AGG ACT TT-3' (SEQ ID NO: 11), and the downstream primer was 5'-AAG CGG CCG CCT ATT TGG AGA AAG AGG T-3' (SEQ ID NO: 12). The amplified fragment containing EcoRl and AToll restriction sites was subcloned into a predigested yeast expression vector. The pPICZaA vector carries an alpha factor secretion signal sequence with a Zeocin marlcer for antibiotic selection. Initial transformation was done in the Top 10' host strain (InVitrogen, San Diego, California, USA). The resultant clones were screened for

the presence of an insert and positive clones were sequenced. The plasmid was then linearized witlz Sacl and used for hotoologous recoinbination into the yeast host strain GS 115 (InVitrogen, San Diego, California, USA). The transformation was carried out by the lirhium chloride roethod as described in tlle Pichia expression manual. Reco1nbinants were selected by platine on YPD plates containing 100 pLmg/ml of Zeocin. Clones wllich grew on YPD/Zeocin plate were tested for expression.

Initial screening was used to identify yeast clones witll high levels of expression. The expression of mouse endostatin in large scalpe wus carried out in 2- liter baffled shalker flasks. The overnight culture (A600, 2-6) was used to inoculate 2- liter flaslcs, witll addition of 500 ml of buffered glycerol medium. Cells were grown at 250 rpm at 30°C until A600, 16-20 (2 days). Subsequently, cells were centrifuged at 5000 rpm for 10 minutes, and the yeast resuspended in 300-400 ml of buffered mediu.thesupernatantcontainingthesecretedrccombinantmetbanol induction protein was harvested on the second, third, and fourth day after induction. Aster the final harvest, tulle cell free supernatant was processed immediately.

ExampleExample4: Pinlfication of viaheparin-agarosechromatography.endostatin A heparin-agarose column was used for purification, based on data of O'Reilly et cll. (1997) (Cell 88: 277-285). The crude supernaitnt containing recombinant protein was concentrated by ammonium sulfate precipitation (70%).

The precipitared protein was dissolve in 10 mM Tris buffer pH 7.4 containing 150 mM NaCl and dialyzed overnight at 4 ° C with three changes at 6-8 hour intervals.

The dialyzed sample was further concentrated by ultra-filtration using an A1nicon concentrator (YM10). A disposable polyprep column (BioRad, hercules. California, USA) was packed with heparin-agarose resin and eanilibrated with 10 mM Tris, 150 mM NaCl, ph 7.4. The concentrclted sample was loaded on the colunm at a flow rate of 20 ml/hour using a peristaltic pump. The column was washed with equilibration buffer until the A280 was greater then 0.001. Bound proteins were eluted in 2-ml fractions by a step-wise gradient of NaCl at 0.3 M, 0.6 M, 1 M and 2

M NaCl). The peak fractions from 0.6 M to 1 M were pooled and dialyzed against PBS, pll 7.4. Protein concentration was measured by the BCA assay (Pierce Chemical Co., Rockford, Illinois, USA). The purification process was performed at 4°C in a cold room. Recombinant soluble endostalin expressed from the Pichia systesn was used in hall the in vitro assays.

Pigs. 3 and 4 show the elution profile and SDS-PAGE analysis, respectively. of protein.Fig.3showsthefractionnumber(x-axis),plottedagipstthe purified abserbance at 280 nm (O) (left y-axis) and against concentration of NaCI (8) (right toelutethefraction.Twodistinotpealkswereobtainedwithincreasi ngy-axis)used concentration of NaCI. Tlle first peak at 0.3 M NaCl was small when compare to the major peak at 0.6 M NaCI. Most of the endostatin protein bound t-o the column as shows by the lack of the protein in the flow-through fraction (Fig. 4, lane 4). The recombinant protein bound tightly and washing with the iow salt Tris buffer removed other yeast derived proteins. Protein the0.3MNaClfractionfrom had a trace amont of endostatin but was contaminated with other host derived high molecular weight protein. The putified protein migrated at 20 kDa which upon reduction migrated at 22 ka. te protein fractions eluted at 0.6 M and 1 M NaCl were pooled, concentrated and dialyzed against PBS (pH 7.4). The purifie protein was further separated by FPLC using a Superpose 12 (Pharmacia Biotech, Inc., Piscataway, New Jersey, USA) size separation column. The elution profile fi-om this colmlm showed a single peau. Aliquots of 10 ml from selected fractions were analyzed on a 12% SDS-PAGE gel, and tulle results are shown in Fig. 4. SDS-PAGE analysis showed the presence of single discret band of 22-24 kDa corresponding to endostltin. The level of expression was estimated to be in tlie range of 15-20 mg per liter of culture.

To further characterize the recombillant protein, N-termina1 microsequencing was carried out for seven cycles. It showed that the yeast alpha factor signal peptide was processed and cleaved at alanille. The first seven residues (EFHTHQD) of tulle purifie protein after signal peptide cleavage matched exactly the published

sequence of endostatin protein, with the first two residues (EF) derived from clinker sequence.

ClouimeandexpressionofHisendostatinimotbePichiaexpyession Exampie5: svstem The coding region of the mouse eiidostatin construct in the pET17bhis expression vector is preceded by a His. Tag of 10 histidine residues. Tlle coding theHisTagsequence,wassimttledintopPICZαAvectorviaregion,Inc luding <BR> BooRIandNot@sites.#inearizationandtecombinationintotheamplif icationwith yeast host strain GS 115 were done as described above. The cell-free medium was precipitated with 70% ammonium sulfate. Precipitated proteins were dissolve in 50 mM sodium phosphate buifer (pH 8.0) contaning 300 mM NaCI and dialyzed in the same buffer of 4°C with three chaoges at 6-8 hour intervals. A Ni-NTA columa was used for purification of the His. endostatin recombinant protein, as described in the QIAexpressioniat manoal (Qiagen, Hilden, Germany). Bound proteins were eluted with a step-wise gradient of imidazole (10 mM, 25 mM, 50 mM, and 100 mu). te peak fractions from 50 mM and 100 mu imidazole lutions were pooled and dialyzed against PBS buffer, pH 7.4.

The results are shown in Figes. 5 and 6. Fig. 5 shows the fraction number (x- axis), plotted against tl1e absorbance at 280 nm (0) (left y-axis) and against concentration of imidazole (*) (right y-axis) used to elute the fraction. Several absorbance packs were observe, tulle first being the larges, followed by three smaller peaks, The ex-lotion profile of His. endostatin fron1 the Ni-NTA column showed that tlie recombinant protein bound tightly. The yeast-derived host proteins in the culture supernatant did not bind to the column and were removed during the rash. Bound proteins were eluted by a stepwise gradient of imidazole. The non-specifically bound host derived proteins eluted with the addition of 10 mM imdiazole (Fig. 5). At 25 mM imidazole, a small fraction of tlze recombinant proteiu alongwithproteinsofhighermoleculerweight.Finalelutionwith50w aseluted mM and 100 mM imidazole showed a distinct peau. SDS-PAGE analysais is shown

-55- in Fig. 6. TIZe flow-tllroualz fraction (lane 3) did not contain any endostatin, indicating that most of the protein bound to the column. Increasing the concentration of imidazole to 10 mM and 25 mM resulted in the elution of non-specific protein. Purifie recombinant His. endostatin migrated as a single band corresponding to 22-24 ka in 50 mM imidazole. A protein with a molecular weight of 22 kDa was seen at 100 mM along with a smaller amount of protein correpotoling to 44-46 kDa. The concentration of purifie protein was determined by the BCA method. The level of expression was estimated at 15 mg per liter of culture.

Cliatactrizationofrecombinantyeastendostatinandpolyclonal Exarple6: antibody generation and Western blot analysais Polyclonal antiserum to mouse recombinant endostatin produced in yeast <BR> <BR> <BR> <BR> W1Sfc11S2CUy111111111111Z111gli'clbblfWllll1lOfplll'1f12CiTO telllC1211VeCfl'0111tlle Pichia expression system. Recombinant endostatin expressed from bacteria and yeast system were separated on a 12% SDS-PAGE gel. The proteins were transferred to PVDF membrane by semai-dry transfer (Trans-blot, BioRad, Hercules, California, USA). The primary antiserur@ was diluted to 1: 4000 in lx TBS buffer containing. 5% non-fut dry mille. Goat anti-rabbit IgG/HRP conjugate was used as a secondary antibody (1: 5000). Immunoreactivity was detected by ChemicalCo.,Rockford,Illinois,USA).chemiluminescence(Pierce The purif1ed enclostati1l expressed from the bacterial and yeast expression systems were run under reducing and non-reducing conditions. Fig. 7 shows immunoreactive bonds corresponding to endostatin. The size of the protein estimated from the western blot ranges from 22-24 kDa. In addition, the recombinant His. endostatin from yeast and bacteria was probed with a Penta His. monocional antibody (Qiagen, Hilden, Gertnany). The monoclonal antibody showed positive response only with the His. endostatin whereas uative endostatin did not show any immunoreactivity. This data confirmed the presence of the His. Tag in the reco1nbinant protein. The antiserum did not show any cross reactivity to human

or mouse angiostatin, demonstrating some degree of immunoreactivity specific to endostatin. Imtounoreactivity of tulle polyclonal antibody was also observe with andEMEMJ 2 proteins.

EndothelialproliferationassayExamlpleu.

The anti-proliferative effect of endostatin produced in the yeast system was tested using bovine pulmonary artery endotllelial cells (C-PAE). Initial experiments were done with different endothelial cell types and various parameters (time of "starvation,"sertun concentration, concentration and type of mitogenic stimulus (e. g., VEGF vs. bFGF)). C-PAE cells gave the most reproducible response.

C-PAF cells were plated in 24-well plates coated with flbronectiu (10 g/ml) at 12,500 cells per well in 0.5 ml DMEM containing 2% FBS. After a 24-hour jncubation themedimnwasreplacedwithfreshDMEMand2%FBS37°C. mg/mlofbFGF(R&Dsystems,Minneopolis,Minnesota,USA)withorconta ining3 without recombinant mouse endostatin. The cells were pulsed with 1 µCi of @H-thymidine for 24 hours. Medium was aspirated, cells were washed three times with PBS, and then solubilized by addition of 1.5 N NaOH (100 pt1 per well) and incubated at 37°C for 30 minutes. Cell-associated radioactivity was determined with a liquid scintillation coûter. The expriment was repeated 5 times under identical conditions, with similar results cach time.

A dose dependent inhibition of bFGF induced proliferation was observe.

The results are shown in Fig. 8, which is a graph showing concentration of yeast- derived soluble endostatin (O) and yeast-derived soluble His. endostatin (#) along the x-axis, and incorporation of 3H-fhymidine on the y-axis. In general, incorporation decreased steadily with increasing concentration of endostatin. The (30-94%ofcontrol)wasseenwithincreasingconcentrationsofinhibi tionrange endostatin (0.1 µg/ml to 10 pLg/ml), with an ED50 value in the range of 600-700 ng/ml. A simiter inhibitory effect on C-PAE cells was seen when His.endoistatin fiom yeast was tested in the above assay, as is shown in the graph in Fig. 8.

Incorporation of 3H-thymidine dropped steadily with increasing concentration of

either yeast-derived soluble endostatin (O) and yeast-derived soluble His. endostatin (@) Tlae recombinant protein did not inllibií the proliferation of the renal cell carcinoma cells (786-0 and A498) at concentrations ranging from 0. /ml to 10 µg/ml. as shown in fäg. 9. fäg. 9 is a bar chant, showing the ineorporation of 'I-thymidine in 786-0 cells (open bars), and A498 cells (shaded bars). The recombinant endostatin also did not have an effect on IMR90 and NII 13T3 fibroblasts.

EndothelialcellmigrationassayExample8: Since C-PAT cells do not migrante in response to bFGF and VEGF, ECV304 cells were used with different concentrations of endostatin nsing bFGF as a stimulus.

To determine the ability of recombinant endostatin to block migration of ECV304 cells towards bFGF, a migration assay was performed using 12-well Boyden chemotaxis ebambers (Neuro-Probe, Inc., Cabin John, Maryland, USA) with a polycarbonate merobrane (25 x 80 mm PVD free, 8 L pores, Poretics Corp., Livermore, California, USA). The non-specific binding of growth factor to the chambers was prevented by coating the cha1nbers with a solution nontalning 0.5% mMCaCl2and150mMNaClat37°Covernight.ECV304cellsweregelatin,I grown in 10% FBS containing 5 ng/ml Dil (1,1-dioctadecyl-3,3,3', DiIC18,MolecuiarProbes,Eugene,3'-tetramethylindocarbocyanine perchlorate Oregon, USA) washedwithPBScontaining0.5%BSA.followingand trypsinization, the cells were counted using Coulter-Countez Zl, (Luton, U. K.) and diluted to 300, 000 cells/ml in Medium 199 (Life Technologies, Gibco/BRL, Gaithersburg. Maryland, USA) containing 0.5% TUBS. The lower chamber was filled 199containing25ng/mlbGFG.TheopperchamberwasseadedwithwithMed ium 15,000 cells/well with different concentrations of recombinant endostatin. Cells were allowd to migrante for 4 hours at 37°C At that time, the cells on the trpper surface of the membrane were removed with a cell scraper and the (migrated) cells on the lower surface were fixed in 3% formaldehyde and washed in PBS. Images of

the fixed membrane were obtained using fluorescence microscopy at 550 nM witll a digital camera and the number of cells on each membrane was detertnined using the OPTIMAS (version 6.0) software (Media Cybernetics, L. P., Silver Spring, MD, USA).

Addition of endostatin resulted in a dose-dependent inhibition of migration, as shown in Figs. 10B,andFig.Li.Figs.10Aand10Bareand photomicro-raphs showing inhibition of codothelial cell (ECV304) mzgration by soluble mouse endostatin using bFGF (25 ng/ml) as a stimulus. Fig. 1 OA shows migrated endothelial cells in the control (+ bFGF, 1zo endostatin), and Fig. 10B shows migrated endothelial cells treated with endostatin (20 L1. 1/ml) with bFGF. iisabarchartshowinginhibitionofendothelialcellmigrationwithF ig.1 different concentrations of endostatin. Relative cell migration is shown on the y- axis, and treatment (control, 25 ng/ml bFGF, and en. dostatin at 20,10,5,2.5, and @ pLg/ml) on the x-axis. Each treatment was done in duplicate. In each well, the number of cells migrated was counted in three different areas and the average obtained. Each value is a mean from representative experimetlts and error bars represent standard deviations. At a concentration less that 1 µg/ml, marginal inhibition of migration was noted, whereas at 10 µg/ml, 60% inhibition of endothelia@ cell migration was observe. These studies are the first to show endostatin's effect on cell migration. Endostatin's action on migration of two non-endothelial cell lines was also assessed. No effect was seen on inner medulary collecting duct rellal cells (IMCD), and some effect (15% at 5 µg/ml and 50% at 20 µg/ml) was noted in the IC-21 macrophage precursor cell line, suggesting that at high concentration, endostatin may block cell migration in some cell types.

Example 9: Choripoliantpic membrane fCAM) assay The ability of mouse endostatin to block bFGF induced angiogenesis in vivo was tested using the chorioallantoic membrane (CAM) assay. Fertilized white Leghorn cbicken eggs (SPAFAS, Inc., Norwich Connecticut, USA) were opened on 100 1nm2 petri dishes and allowed to grow until day 11 in a humidifie incubator at

38 °C. Pellets containing vitrogen (Collagen Biomaterials, Palo Alto, California, aconcentrationof0.73mg/mlwersuppleineptedwitheither:vehicleU SA)at alone; VEGF (250 ug/pellet), VEGF (250 ng/pellet) and endostatin (20 to 0.5 µg/pellet), bFGF (50 ng/pellet), or bFGF (50 ng/pellet) and endostatin (20 to 0.5 llmg/pellet). The pellets were allowed to polymerize at 37°C for 2 hours. The pellets were placed on a nylon mesh and oriente on the periphery of the CAM.

Embryos were returned to the incubator for 24 houris. Invasion of new capillaries on the collagen mesh was assessed by injection of @TTC-dextron into the circulation of the chicken embry@. At the end of the experiment, the messes were dissected and evalvation of vasculr density was done using the program NIH Image v1. 59 themethodaccordingto of al.(1997)(Thromb.haemost.et 78: 672-677). Assays were performed in triplicate and four independent experiments were conducted.

Endostatin was able to suppress the angiogenic response mediated by both bFGF and VEGF, as shown in Figs 12 and 13. Fig. 12 is a set of three photomicrograplls showing the vascular density for vehicle alone (Fig. 12A), VEGF alone (250 ng/pellet, Fig. 12B), and VEGF and endostatin (Fig. 12C). Figs. 13A and thattheinhibitionwasdose-depe@dent.Fig.13Aisabarchartshowing 13Bshow concentration of recombinant protein (x-aais), plotted against angiogenic inhibition in response to VEGF (y-axis). Fig. 13B is a bar chart showing concentration of recombinant protein (x-axis), plotted against angiogenic inhibition in response to @FGF (y-axis). All of the counts were normalized to the negative control. Both cllarts show a steady increase of inhibition of angiogenesis in response to increasing concentrations of endostatin. Blocking of the VEGF response was somewhat more effective (47%) than suppression ofthe bFGF response (39%), both at 20 µg/mesh.

Neattalizationofendostatin'sinhibitoryeffectExample10: The specificity of endostatin's inbibitory effect was demonstrated by neutralization studies using endothelial proliferation and CAM assays. In the endothelial proliferation assay, ílle endostatin was pre-incubated witll an excess of

polyclonal aotiserum or purif1ed antibody (IgG) for 1 hour at room temperature and tllen added to tlie C-PAr cells in the presence of 3 yg/ml brGF. Pre-immune serum was used as negative control. In addition, purifie IgG and endostatin antibody alone were also used as a comroi. DNA synthesis was measured by adding 1 µCi/well 3H-@bymidine for 24 ho@rs and the cell-associated radioactivity was measured as described above. For the CAM assay, endostatia (10 µg) and antiserum (50 g) were pre-incubated overnigbi end-over-end at 4°C prior to preparation of the pellets. Controls for these experiments included IgG alone and pre-immune serum alone. Evaiuation of the angiogenic responses in the two assays were determined as indicated above.

Fig. 14 is a bar chart showing neutralization of the inhibitory effect of mouse endostatin by polyclonal antiserum in the endothelial proliferation assay.

Incorporation of 3H-thymidine is shown on the y-axis, and treatment (control, 10 zig endostatin, 10 zig endostatin + antiserum. 5 gendostatin, 5 yg endostatin + serum.endostatinantiserum,andeodoaiatinIgG)onthex-antiserum. pre-immune axis). Each value is a mean from triplicate culture and error bars represent standard deviation. Fig. 15 is a pair of photomicrographs slzowing the results of the CAM assay. Fig. 15A shows the effect of VEGF and endostatin (10 µg), and Fig. 15B shows the effect of VEGF, endostatin (10 ptg), and polyclonal antiserum (50 yg).

Both Fig. 14 and Fig. 15 demonstrate that tl-ie inhibitory effect of endostatin can be suppressed by incubation with specific antiserum. Anti-endostatin antiserum blocked the suppressive effect by 95%. The pre-itnmune serum and endostatin antibody alone did not have a stimulatory effect, 1lor did normal rabbit IgG.

Example 11: Inbibition of primary 786-0 RCC tumors in nude morse model Male nude mice of 6-8 weeks of age were injected subcutaneously in the with2mi@ion786-0cellsina100mlvolume.TomorsappearedrightBank aproximarely two weeks after implantation. Tumor size was measured using caliers and tumor volume was calculated using the standard formula of: tumor volume = ab2 x 0.52

where a = length of the tumor, and b = width of the tumor (O'Reilly et a. (1994) Theetumorvolumerangeofrom350mm3to400mm3.TheCell79:315-328). animals were raodomized and each group had five mice with comparable tumor size within ancl among the groups. Treatment was started with recombinint endostatin (bacterial or yeast versions) with each mouse receiving 10 mg/lcg body weiglt of recombinant protein daily, administered for a period of ten days via intraperitoneal injection. Control animals received PBS each day. Tumor size in all groups wus measured on alternate days and tutnor volume was calculated. The treatment was terminated on day 10 and animales were sacrifice and tumors from each mouse removed in30%bafferedformalin.fixed The results are shows in Figes. 16,17 and 18. Eig. 16 is a graph showing the inhibition of 786-0 tumor growth by systemic treatment witll recombinant endostatin. Time in days a-fter treat1nent is shown on the x-axis and tumor volume in mm 3is shown on the y-axis. Intraperitoneal injection of endostatin was given at 10 mg/kg/day, starting on elay 1 (arrow). Each time point represents the average of five mice in each group and the error bar represents S. E. M. Treatments are control PBS (O). endostatin from yeast (#). His. endostatin from east (x) and His. endostatin from bacteria (#). On the fifth da), after treatment there was a difference between control () 63 mm') and treated tu1nors. Yeast endostatin-treated tumors were 405 mm', bacterially-produced endostatin-treated tumors were 442 1nm3, and His. endostatin-treated tumors were 462 mm3.

Figes. 17A through 17E are a set of five photograpbs of 786-0 tumors treated with recombinant endostatin. Figs. 17A and 17B are control tumors, Fig. 17C shows a tumor treated with yeast-derived endostatin, Fig. 17D shows the effect of His.endostatin from bacteria, and Fig. 17E sbows a tumor treated with His. endostatin from yeast. At the end of the treatment period, tumors from control and treated groups were examine grossly under a dissecting, microscope. Tumors iiom the control group were in general larger and more highly vascularized. A 2.5- fold decrease in tumor volume was observe on the fifth day after treatment between control and treated tumors (Figs. 16 and 17). The growth of tlle tumor was

suppressed in all the treatment groups, and a slower growth rate was seen compare to the control group. Bacterial- (His. Tag) or yeast-cerived (with or without His. Tag) endostatin at a dose of 10 Lg/kg all worked equally well. On the teiith day after treatment, the tumor volume in the control animals was 1490 m1ll3, whereas in the treated group it was in the range of 480-570 mn13 (p value < 0. 005). Eoclostatin notiohibittumorgrowthcompletely;thegrowthofthenumorsadminisb ationdid amarginalincreaseinvolumeduringthetreatmentperiod.slowed,wit h Exmyle 12: Two closelv related C-terminus endostatin mutants £enerated in E. coli show markediy differing in vivo activitv in RCC The RCC tumor model described above was used in a second set of experiments with endostatin aud mutants EM : and EM 2, produced in the prokaryotic system in Example 1 * above. The daily dosage was 20 mg of the protein per leg body weigln, injected intraperitoneally. The initial tumor volume was 150-200 1nm'. Wild type endostatin, also produced in the pET28 (a) vector, was given at 20 mg/kg body weight for the expriment as a positive control and PBS was given as a negative control.

The results are Shown in Pig. 18, which is a graph sllowing days after treatment on the x-axis, and tumor volume on the y-axis. mach time point represents the average of five mice in each group. Treatments were control PBS (O), wild type His. endostatin from bacteria (dotted line, 0), EM @ from bs@eteria (dashed line, A), and EM 2 from bacteria (solid line, +). Intraperitoneal injection was started on day @ (arrow). Nine days after treatment, the difference between groups was apparent (Fig. 18). On the eleventh day after treatment, the tumor volume in the control group (397 mm3) was approximately twice that of the two treated groups: endostatin (182 mm3) or EM 1 (259 mu'). However, on the same day, the tumor volume of the EM 2-treated group (389 mm') ws similar to that of the control group (397 1nm3).

Significance was at the 90% confidence level between tlie EM 2 and endostatin groups and 95% confidence level between endostatin and control groups. Dropping the value of tulle largest and smallest tumors on day @ in each group increased the

confidence level to 95% between EM 2 and EM @ and between EM 2 and eodostatin.

Therefore, the EM 1 protein retained the native biological activity of endostatin, whereas EM 2, with its ftorher deletion os 8 amino acids, did not. In addition, two of the five mice in the endostatin group and one of tulle fiv in the EM @ group hari no detectable tumor at the end of the treatment period.

:AnnexinV-FUCassayExample13 Annexion V, a calciu1n dependent phospholipid binding protein with a high affinity for plzospltidylserine (PS) was used to detect early stage apoptosis. AÍter initiation of apoptosis, most cell types translocate the 1nembrane phosp11olipid phospl » tidylserine (PS) fìo1n the inner surface of tlle plasma membl-ane to the outside. PS can be detected by staining with an FITC conjugate of Annexion V, 38 kDa protein that binais naturally to PS. During PCD, PS externalization typically precedes membrane bleb formation and DNA fragmentation.

Brieily. 200,000 cells were plated onto a fibronectin-coated 6-well plate in DMEM containing 2% PI3S and 3 ng/ml of BFGF. Different concentrations of recombinant mouse endostatin were added to each well, and cells were harvested and processed 18 hours after treatment. For trie time course study, 10 µg/ml of endostatin was added and cells were processed cafter 3,4,6,12, and 18 hours.

Human recombinant TNF-α (40 ng/ml) was used as a positive control. The cells were wasbed in PBS and resuspended in binding buffer (10 mM HEPES/NaOH. pH 7.4,140 mM NaCl, 2.5 mM Cal2). Annexin V-FITC was added to a final concentration of 100 ng/ml, and the cells were incubated in the dark for 10 minutes, then washed agais in PBS and resuspended in 300 ml of binding buffer. 10 µl of propidium Iodide (PI) was added to each sample prior to flow cytometric analysis.

The cells were analyzed using a Becton Dickmson FACStar plus flow cytometer.

Electronic compensation was used to eliminate bleed-througli fluorescence. In each sample, a minimum of 10,000 cells were counted and stored in listmode. Data a1lalysis was performed with standard Cell Quest software (Becton-Dickinson). The quadrant settings were set so that the negative control allowed less than 1%

positivity. Endostatin was added to non-endotlzelial cells (N@H3T3 and 786-0) at 10 µg/ml and the cells were processed and analyzed as described above.

Eiidostatin at 10 µg/ml showed a distinct shift in Amlexin fluorescence intensity. The mean fluorescence intensity difference between control and endostatin treated cell was significant (p = 0.01) at 5 and 10 µg/ml. The shift in fluorescence intensity was similar for endostatin at 10 yg/ml and the positive control TNF-O, (40 ng/ml). Concentrations of endostatin below 0.1 pLg/ml did not show any significant Annexin V positivity. In order to investigate the earliest time point at which endostatin caused exiemalization of PS, we conducted a time course experiment (Fig 2B). The effect of endostatin was signiÍicant (p = 0. 01) at 12 hours after treaument. Time points before 6 hours did not show a difference between treatedsamples.controland Morphological examination of FACS analyzed samples with fluorescence microscopy (Nikon) showed Annexin V staining localized to the cell membrane at 12 hours with no staining in the cytoplasm. During this period, the majority of the cells were negative for PI, implicating the early stage of apoptosis. With increased exposure time (24-36 hours), in addition to 1membrane staining with Annexin V some of the cells turned positive for PI, consistent with a more advanced stage of apoptosis.

Similar levels of Annexion V staining were observe in two other endothelial cell lines studied, BAE and BCE. We have also tested the effect of huma endostatin on these thlee bovine endothelial cell lines. We failed to detect Armexin V staining in the presence of human endostatin added to these cells, whereas when human endothelial cell lines were used (HUVE and HMVE-L), it resulted in a marked shift in Annexion V fluorescence (manuscript in preparation). These data indicate that apoptosis, as assessed by Annexin V staining, occurs in diverse endothelial cells in response to mouse ancl lmman endostatin.

With regard to non endothelial cells, 786-0 and NIH3T3 cells failed to show any distinct annexin positivity. In addition, other non-endothelial cells (IMR-90, A 10 and H9c2 (2-1)-myoblast) were screened and no effect of endostatin was fond.

Based on these results, endostatin's action appears to be selective for endothelial cells.

Eaanyle 14: Caspase 3 assav Caspase 3 (CPP32) is an intracellular protase activated early during apoptosis of 1nammalian cells and initiates cellular breakdown by degrading specific structural, reulatory, and DNA repair proteins. This protase activity can be measured detectionofthechromophore(p-nitroanilide)by atter cleavage from the labeled substrate (DEVD-pNA).

This assay was performed in either a 75-cm' tissue culture flash or in fibronectin-coated 6-well plates. The 6-well plates were seeded with 0.5-1 @ 106 cells per tell, and the flasks were seeded with 2 x 106 cells. The cells were maintaineci overnight in DMEM with 10% FBS. The following day, the old médium was replace witll fresll medium (2% FBS), aud the cells were incvbated overnigllt Followingstarvation,thecellswerestitmulatedwithbFGF(3ng/ml)i no@37°C.

DMEM (2% FBS). Along with bFGF, yeast endostatin (10 pLg/ml final concentration) was added and the cells groin for 24 houris. For the control plate, only the PSS buffer was added. As a positive control, TNF-α was used at a final concentration of 20 ng/ml. After 24 hours, the supernatant cells were centrifuged <BR> <BR> <BR> Thewells(flasks)weretrypsinizedtocollecttheattache@cellsanda ndcoilected. combine with tlle supernatant cells. The cells were comte and resuspended in cell lysis buffer (Clontech, Palo Alto, California, USA) at a concentration of 4 x 107 cells/ml. The rest of the protocol followed the manufacturer's instruction (Clontech, Palo Alto, California, USA). A specific inhibitor of caspasc 3, DEVD-fink, was used to confirm tlle specificity as suggested by the manufacturer. The absorbance was measured in a microplate reader (BioRad, Hercules, Califomia. USA) at 405 nm. Folci-inerease in protase activity (caspase 3) was determined by comparing the results of the induced sample (yeast endostatin or TNF-a) with the aninduced control. Similarly non-endothelial cells (NIH3T3 and H9c2 (2-1)-myoblast were used and analyzed as described above.

A time course expriment was first performed with 10 µg/ml of endostatin, looping for an increase in caspase 3 activity. There was no difference in caspase 3 activity between the treated and the control samples at 2,4, 8, and 14 houris.

However, caspase 3 activity 24 hours after treatment with endosteltin was elevated over controls. The caspase activity of the endostatin and TNF-a (positive control) treatecl samples is shown in Fig. 21. When compared to controls, andostatin treated cells showed a 1.8-fold increase in caspase 3 activity after 24 hours, whereas TNF-α gave a comparable (1.75-fold) increase. The assay was repeated at least five times with similar results. When a specific inhibitor of caspase 3 (DEVD-fink) was thesamesamples.theproteaseacivitywasatbaseline(comparisonofi ncludedin boxtothecor@espoodingwhitebox).indicatingthattheincreaseioth ethedark measured activity was specific for caspase 3. Fig. 22 shows that for NIH3T3 cells only, a marginal increase in caspase-3 was seen, whereas in 1nyoblasí cells there was no difference in caspase-3 levels between treated and control cultures.

Example 15: Microscopic detection of TUNEL stainin Fragmentation of nuclear DNA is one of the distinct 1norphological changes thenucleusofanapoptoticcell.ATUNEL(terminaldeoxynucleotidylo ncu@ringin transferase-=mediated dUTT nick-end-labeling) assay was performed on endostatin, TNF-α treated and control cells. For adlierent cells, C-PAE cells were seeded at a density of 5,000 cells per well on fibronectin coated (10 llg/ml) Lab-Tek chamber slides and grown in 0.4 ml of DMEM medium with 10% FBS. After two days, the old medium was aspirated and fresh DMEM with 2% FBS was added and the cells were starved overnight. The following day, 0.36 ml of new medium (with 2% FBS) ng/mlbFGFwasaddedalongwithyeastendostatin(10µg/ml)orcontain ing3 TNF-α (20 ng/ml). For control samples, fresh mediu1n (2% FBS) containing bFGF (3 ng/ml) was added. Following induction (24 hours), the slides were washed twice with PBS, and subsequently fixed in fresh 4% for1naldehyde/PBS at 4 ° C for 25 minutes. The slides were washed in PBS and the cells permeabilized in 0.2% Triton

S-100/PBS for 5 1ninutes on iceN then washed with fresh PBS twice for 5 minutes each at room temperatureF and the TUNEL assay performed as described below.

T he TUNEL assay was performed as described in the ApoAlert DNA fragmentation assay kit user manual (Clontecll, Palo Alto, Califormia, USA), except that the final concentration of propidiuto iodide (Sigms. St. Louis, Missouri, USA) used was @ µg/ml. After the assay, a drop of anti-fade solution was added and the treated portion of the slide ßivas covered with a glass coverslip with the edges sealed with clear nail polish. Slides were viewed immediately under a fluorescent microscope usina dual filter set for green (520 nm) and red fluorescence (>620 nm). The images were capture using a digital microscope (Nikon Microplzot-SA) and processed using SPOT software version 1.1.02. For the positive control (TNF-cc), 5 fields random were chosen, anal for the samples, 15 random fields were chosen. The number of green and red cells per field were then counted, and the percent of green divided by the number of red cells in a given field was determined.

An average (with S. E. M.) of the different fjelds was then calculated.

For cells in suspension, floating cells were collecte by centrifugation ai 300x g for 10 minutes at 4°C The old medium was aspirated, and the cells were resuspended in 500 ml oTPBS (pH 7.4). Cells were centrifuged again, the PBS removed, and the pellet was resuspended in 75 ml of fresh PBS. Resuspended cells were spread on a poly-l,-lysine coated slide (Jersey lab supply) using a clean slide.

The cells were fixed by immersing the slides in fresh 4% formaldehyde/PBS at 4°C for 25 min. The rest of the protocol was carried out as described above.

In the presence of tulle enzyme TdT, both endostatin and TNF-α treated slides showed numerus positive cells under green fLuorescence, whereas no positive cells were seen in the control. Without the enzyme, the endostatin treated slide showed background cell fLuorescence.

The number of apoptotic cells in several fields were counted, and tulle percent of apoptotic cells (green divided by the number of red cells per field) is plotted in Fig. 23, which is a bar graplz. The apoptosis rate in the control cells was 1.24%. In the endostati@ treated cells, a 0-folk increase in the apoptosis rate was observe in

suspension cells (38.3%). while a 15 fold increase was observe in the attache cells (19.4%). With TNF-α, the apoptosis rate was 6.4%. In contrast, the percent TUNEL-positive in the lngiostatin treated BCE (bovine adrenal cortex capillary endothelial) cells was 2% when compare with the control cells (1.2%), a 1.6 fold thatendostatinisastrongerapoptoticagentthanangiostatin.incre ase.suggesting Example 16: Bol 2 and Bax expression bv western blot analysis C-PAE cells (I X 106) were seeded in 10 cm petri dishes precoated with fibronectin (10 thepresenceof2%FBSco@dai@@log3ng/mlbFGF.in Endostatin was added at 10 yg/ml, and cells were harvested at 12,24, and 28 hours after treatment. Cells were waslled thrice in PBS buffer pH 7.4 and the cells were resuspended in @ ml of lx EBC buffer (50 mM Tris-HCI, pH 8.0,120 mM NaCl, P-40)continingfreshlyaddedcompleteuroteaseinhibitortablet1%N onidet 100mg/mlPefabloc.1mg/mlPepstatin.Theprotein(BoerhingerMannbe im). concentration in whole cell lysate was measured by the BCA metbed. 30 mg of whole cell extract was loaded onto a 4-15% gradient polyacrylamide gel. Transfer was performed using a semi-dry transblot apparats (BioRad, Hercules, California, USA). The membrane was blocked in wash buffer (lx TBS) with 5% non fat dry milk and incubated at 37°C for 1 houer. Goat antibody directe agas sot human Bol-2 (N-19) {sc-492.G} was purchased from Santa Cruz Biotechnology (Santa Cruz, California, USA). Affinity purified mouse polyclonal antibody against Bax (B-9) {sc7490} and Bel-XS/L {sc1690} were purchased from the same manufacturer.

Polyclonal nanti-action antibody (Sigma, St. Louis, Missouri, USA) was used to normalize for protein loading. Secondary antibodies were anti-goat, mouse and rabbit immunolobulin conjagated to horseradish peroxidase (Amersllam Corp., Illinois,USA).TheimmunoreactivitywasdetectedwithaoAtlingtonh eights. enhanced (PierreChernicalCo.,Rockford.Illinois,reagent USA). Images were scanned using a flat bed scanner (Scan-Jet 4C) and quantitated by the NIH Image 1.61 software. Normalization was done by dividing the Bcl-2 thatofactinwithineachexperiment.sigualby

Anti-apoptotic members such as Bcl-2 and Bcl-XL prevent PCD in response to numerus stimuli. Conversely, pro-apoptotic proteins such as Bax and Bak can accelerate cell death ; and in certain cases, they are sufficient to cause apoptosis independent of additional signals. Whole cell extract of endostatin treated and control C-PAL cells were teated For Bcl-2 ancl Bax expression levels. In growth arrested C-PAE cells, Bcl-2 expression was high. It was relatively constant up to 28 hours; in contrast, endostatin treated cells showed marked decrease in Bcl-2, as is show in Fig. 24A. Densitometry revealed that the levels of Bcl-2 compared to control was 1.2,1.5, rand 3 fold less at 12,24, and 28 hours respectively after treatment, witll actin levels used as normalization controls. In contrast, Bax expression was si1nilar between control and treated cultures (Fig. 24B).

Bel-2 protein was not detected in both NIH3T3 and IMR-90 cells. Bax expression levels were not affecte by endostatin treatment in these cell lines, as is Figs.25Aand25B.InC-PAEcells,attheearlytimepoint(12hours),sho wnin Bcl-XL level was reduced by 2 fold, whereas in NIH3T3 cell its expression was undhanged (Figs. 25C and 25D). Interestingly, we have detected only the larger pro-apoptotic form of Bcl-X in C-PAE wllereas, in NIH3T3 both smaller and larges forms were detected.

These findings suggest that endostatin exerts its regulatory activity by alterinb Bcl-2 expression. Interestingly, VEGF has been shown to augment Bol-2 levels in eiadothelial cells. Since endostatin antagonizes VEGF's proliferative effects, Bel-2 appears to be one point of regulation. Recent studies indicate that the Bel-2 protein binds to other proteins, such as Bax, Bel XS, Bik and Bad, which @ltimately enhance cell survival (Newton, K, and Strasser, A. (1998) Cllrr. Opin.

Genel. Dev. 8: 68-75; Jacobson, M. D. (1997) Ca/rr. Biol. 7: R277-81). The function of another Bc1-2 homologue, Bax remains enigmatic. Bcl-2 and BC1-XL function withBax.andoverexpressionofBaxacceleratesthroughheterodimeri zation. apoptosis. Recently, it was shown that FGF-2 inhibited endothelial cell apoptosis by Bol-2 dependent and independent mechanisms. In our study, we did see differences in Bol-2 (and Bel-Xi.) expression in endostatin treated cultures but no difference in

Bax levels. It is possible that Bc1-2 1nay act independently of Bax, as has been shown for T cells.

EQUIVALENTS While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing-from the spirit and scope of the invention as defined by the appende claims.