Background to the Invention: Many Bt strains are known which show toxic or insecticidal activities towards pest insects species, particularly Lepidoptera. In a number of cases, the toxin proteins have been purifie by crystallisation and the genes isolated and sequenced. In work leading to the present invention, the inventors selected for analysis a Bt strain (i. e. JW 3.2.5) which had previously demonstrated toxicity towards Helicovelpa armigela. a major pest species of crops such as corn, cotton, tomato and tobacco. After crystallising the toxin protein and obtaining the N-terminal sequence, the inventors sought to isolate a DNA molecule encoding the toxin protein. However, sequencing of the subsequently isolated DNA molecule revealed that the DNA molecule did not encode the toxin protein or, at least, did not encode a toxin protein that is present in the crystal in high concentration. Nevertheless. the putative amino acid sequence of the Bt protein encoded by the isolated DNA molecule predicts toxicity towards insects.

Disclosure of the Invention: In a first aspect, the present invention provides a substantially purifie polypeptide, the polypeptide having a sequence selected from: (i) a sequence of amino acids shown in SEQ ID NO: 3; (ii) a mutant, allelic variant or species homologue of (i) : (iii) a polypeptide having a sequence which is at least 90% identical to (i) or (ii); or

(iv) a biologically active fragment of any of (i) to (iii) which is least 15 amino acids in length.

The polypeptide disclosed in SEQ ID NO: 3 (see Figure 3) is a Bt toxin. having a molecular weight of approximately 130 kDa and the N-terminal amino acid sequence: MEIINNQNQC.

More preferably, the polypeptide of the present invention shares at least 95% identity to the sequence shown in SEQ ID NO : 3.

Notably, the amino acid sequence shown in Figure 3 is only 87. 7% and 85. 5% identical to the Bt toxin proteins Cry1Ha1 and CIlZ1Hbl. respectively.

By"substantially purified"we mean a polypeptide that has been separated from lipids, nucleic acids, other polypeptides, and other contaminating molecules.

Mutant polypeptides will possess one or more mutations which are deletions, insertions, or substitutions of amino acicl residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis on the DNA).

It is thus apparent that polypeptides of the invention can be either naturally occurring or recombinant (that is to say prepared USillg recombinant DNA techniques).

An allelic variant will be a variant that is naturally occurring within an individual organism.

Protein sequences are homologous if they are related by divergence from a common ancestor. Consequently, a species homologue of SEQ ID NO : 3 will be the equivalent polypeptide which occurs naturally in another species or trains. Within any one species a homologue may exist as numerus allelic variants, and these will be considered homologues of the polypeptide. Allelic variants and species homologues can be obtained by following standard techniques known to those skilled in the art. Preferred species homologues include those obtained from representatives of the same Order, more preferably the same Family and even more preferably the same Genus.

A protein at least 90% identical, as determined by BESTFIT (Smith, T. F. and Waterman, M. S. (1981)) analysis (GCG program). to that af the present invention are included in the invention, and more preferably at least 95% identical to the protein of the present invention. This will generally be over a region of at least 20, preferably at least 30, contiguous amino acids.

Amino acid sequence mutants can be prepared by introducing appropriate nucleotide changes into DNA, or by in vitro synthesis of the desired polypeptide. Such mutants inclue, for example. deletions, insertions or substitutions of residues within the amhlo acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the desired characteristics.

In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic (s) to be modifie. The sites for mutation can be modifie individually or in series, e. g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.

Amino acid sequence deletions generally raye froc about 1 to 30 residues.. more preferably about 1 to 10 residues ancl typicallv about 1 to 5 contiguous residues.

Amino acid sequence insertions include amillo and/or carboxyl- terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues.

Substitution mutants have at least one amino acid residue in the protein molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identifie as the active site (s). Other sites of interest are those in which particular residues obtained from various species are identical. These

positions may be important for biological activity. Tliese sites, especially those falling within a sequence of at least three other identically conserve sites, are preferably substituted in a relatively conservative manier. Such conservative substitutions are shown in Table 1 wl (ler the heading of "exemplary substitutions".

By"biologically active fragment"we mean a fragment of a sequence shown in SEQ ID NO: 3 which retains at least one ouf tue activities of the native polypeptide as defined in SEQ ID NO: 3.

In a second aspect, the present inventioll proicles an isolated polynucleotide, the polvnucleotide having a sequellce selected from: (i) a sequence of nucleotides shown in SEQ ID NO : 1: (iii) ofnucleotidesshowninSEQIDNO:1formnucleotidesequence 649 to nucleotide 4173; (iii) a sequence capable of selectively hybridising to (i) or (ii) under stringent conditions; or (iv) a sequence encoding a polypeptide as defined above for the first aspect of the present invention.

The polynucleotide disclosed in SEQ ID NO : 1 (see Figure 2) encodes a Bt protein of the first aspect of the present invention.

Preferably the isolated polynucleotide molecule encoding tlie Bt protein has at least 90tho, more preferably 95°0, identitv to the nucleotide sequence shown in Figure 2, especially from nucleotide 649 to 4173.

In a preferred embodiment, the polynucleotide sequence is less than 5000 nucleotides, however, they can be less than 1000 or even 500 nucleotides in length. Preferrably, the polynucleotides of the present invention are at least 18 nucleotides in length.

The polynucleotide sequence of the present iuventiom may hybridise to the sequence set out in SEQ ID NO : 1 under high stringency. As used herein, stringent conditions are those that (1) employ low ionic strength and liigh temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0. 1% NaDodSO4 at 50°C ; (2) employ during hvbricisation a denaturing TABLE 1 Original Exemplary Residue Substitutions Ala (A) val; leu; ile Arg (R) lys; gln; asn Asn (N) gln; Ilis; lys : arg Asp (D) glu Cys (C) ser Gln (Q) asn Glu (E) asp Gly (G) pro His (H) asn; gln; lys; arg Ile (I) leu; val; met; ala: phe norleucine Leu (L) norleucine. ile: val: met; ala; phe Lys (K) arg; gln ; asn Met (M) leu; phe; ile; Phe (F) leu; val ; ile: ala Pro (P) gly Ser (S) Thr (T ser Trp (W) tyr Tyr (Y) trp : phe; thr: ser Val (V) ile: leu: met: plie ala;norleucine

agent such as formamide, for example, 50% (vol/vol) formamide with 1%0. bovine serum albumin. 0.1% Ficoll, 0. 1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C : or (3) employ 50% formamide, 5 x SSC (0.75 Ii NaCl. 0.075 M sodium citrate), 50 phosphate(pH6.8).0.1%sodiumsodium pyrophosphate, 5 x Denhardt's solution. sonicated salmon sperm DNA (50 g/ml), 1%0. SDS and 10% dextran sulfate at 42') C in 0.2 x SSC and 0. 1% SDS Polynucleotides which will hybridize to SEQ ID NO: 1, or parts thereof, may possess one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performillg site-directed mutagenesis on the DNA). It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant (that is to say prepared using recombinant DNA techniques).

Polynucleotides at least 90% identical, as determined bv BESTFIT (Smith, T. F. and Waterman, M. S. (1981)) analysis (GCG program). to that of the present invention are included in the invention. and more preferably at least 95% identical to the protein of the present invention. This will generally be over a region of at least 20, preferably at least 30, contiguous nucleotide residues.

In a third aspect, the present invention provides a suitable vector for the replication and/or expression of a polynucleotide of the second aspect of the present invention. The vectors may be, for example, plasmid. virus or phage vectors provided with an origin of replication, and preferrably a promotor for the expression of the polynucleotide and optionally a regulator of the promotor. The vector may contain one or more selectable markers, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammaliall expression vector. The vector

may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.

A fourth aspect of the invention relates to host cells transformed or transfected with the vector of the third aspect.

Suitable host cells for cloning or expressing the proteill (s) disclosed herein are the prokarvote, yeast, or higher eukaryote cells. Suitable prokaryotes include eubacteria, such as Gram-negative or Gram-positive organisms, for example. E. coli, Bacilli such as B. S11I7f1I1SOTB,fItLI111ig1811S1S, suchasP.aeruginosa,SalmonellatyphimuriumorPseudornonasspecie s Serratiamarcescens.

Eukaryotic microbes such as filamentous fungi or yeast are suitable hosts for expressing the protein (s) of the present inventiou. Saccharomyces cerevisiae, or common baker's yeast, is the most conunonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein. such as Schizosaccharomyces pombe ; Kluyveronnyces hosts such as e. g. K. lactis; filamentous fungi such as, e. g. Neurospora, or Penicillium : and Aspergillus hosts such nidulansandA.niger.A.

Suitable higher eukaryotic host cells can be ciilttired vertebrate. invertebrate or plant cells. Insect host cells from species such as Spodoptera aegypti,Aedesalbopictus,Drosophilamelanogaster,andfrugiperda ,Aedes Bombyx moii can be used. Plant cell cultures of cotton. corn, potato, soybean, tomato, and tobacco can be utilized as hosts. Typically, plant cells are transfected by incubation with certain strains for the bacterium Agrobacterium tumefaciens.

Propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years. Examples of usefml mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7. ATCC CRL 1651) : hmnan embyyonic kidney line (293 or 293 cells subcloned for growth in suspension culture): baby hamster kidney cells (BHK ATCC CCL 10) ; Chinese hamster ovary cells/-DHFR (CHO); mouse sertoli cels. monkey

kidney cells (CV1 ATCC CCL 70): human cervical carcinoma cells (HELA.

ATCC CCL 2); canine kidney cells (MDCK ATCC CCL 34). and a huma hepatoma cell line (Hep G2). Preferred host cells are human embryonic kidney 293 and Chinese hamster ovary cells.

Host cells are transfected and preferably transformed with expression or cloning vectors of this invention and cultured in conventional nutrient media modified as appropriate for inducing promoters. selecting transformallts. or amplifying the genes encoding the desired sequences, Transformation means introducing DNA into an organism so that the DNA is replicable, eitlier as an extrachromosomal element or b cllromosomal integration. Depending on the host cell used, transformation is done using standard techniques appropriate to such cells.

Thus a fifth aspect of the present invention provides a process for preparing a polypeptide according to the invention xvhicii inclues cultivating a host cell transformed or transfected with an (expression) vector of the third aspect under conditions providing for expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide. Such cells can be used for the production of commercially useful quantities of the encoded protein.

The polynucleotide molecule of the invention. mav also be introduced into insecticidal recombinant viruses (e. g. recombinant baculoviruses or entomopoxviruses) to improve their toxicity on pest insect species.

Thugs. in a sixth aspect, the present invention provides an insecticidal recombinant virus including the polynucleotide molecule of the second aspect such that said polynucleotide molecule is expressed in infecte host cells.

In a seventh aspect, the present invention provides an insecticidal recombinant bacterium including the polynucleoticle molecule of the second aspect such that said polynucleotide molecule is expressed bv the recombiuant bacterium. Suitable bacteria for the production of an

insecticidal bacterium of the present invention include B. thuringiensis and<BR> <BR> <BR> <BR> <BR> <BR> Pseudomonas fluorescens.

In an eighth aspect, the present invention provides an oligonucleotide probe or primer, the oligonucleotides having a sequence that hybridizes selectively to a polynucleotide of the present invention, In a further preferred embodiment the oligonucleotide inclues at least 8 nucleotides, more preferably at least 18 nucleotides and more preferably at least 25 nucleotides.

In a further preferred embodiment the oligonucleotide is used as a probe where the oligonucleotide is conjugated with a label such as a radioisotope, an enzyme, biotili, a fluorescent molecule or a <BR> <BR> <BR> <BR> cherniluminescent molecule.<BR> <BR> <BR> <BR> <BR> <BR> <P> Furthermore, the polynucleotide of the invention, may be introduced to crop plants such that the crop plants produce insecticidal amounts of the encoded protein. Methods for introducing and achieving expression of Bt toxin genes in plants are described in Australian patent specification No 51630/90 and United States patent specification No 5,380,831. The entire disclosure of both of these specifications is incorporated herein by reference.

Thus, in a ninth aspect, the present invention provides a crop plant transformed with the polynucleotide molecule of the second aspect such that said crop plant is capable of expressing said polynucleotide.

The term"plant"refers to whole plants, plant organs (e.g. leaves, stems roots, etc), seeds, plant cells and the like. Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. Exemplary dicotyledons include coton, corn, tomato. tobacco, potato, bean, soybean, and the like.

Transgenic plants, as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modifie using recombinant DNA techniques to cause or enhance production of at least one protein of the present invention in the desired plant or plant origan.

The polypeptide of the present invention may be expressed constitutively in the transgenic plants during all stages of development.

Depending on the use of the plant or plant organs, the proteins may be expressed in a stage-specific manner. Furthermore. depending on the use, the proteins may be expressed tissue-specifically.

The choie of the plant species is determinecl by the intended use of the plant or parts thereof and the amenability of the plant species to transformation.

Regulatory sequences which are known or are found to cause expression of a gene encoding a protein of interest ill plants may be used in the present invention. The choice of the regulatory sequences used depends on the target crop and/or target organ of interest. Such regulatory sequel1ces may be obtained from plants or plant viruses, or nzav be chemically synthesized. Such regulatory sequences are well klloxvn to those skilled in the art.

Other regulatory sequences such as terminator sequences and polyadenylation signals include any such sequence functioning as such in plants, the choice of which would be obvious to the skilled addressee. An example of such sequences is the 3'flanking region of the nopaline synthase (nos) gene of Agrobacteuum turnefaciens.

Several techniques are available for the introduction of the expression construct containing a DNA sequence encoding a protein of interest into the target plants. Such techniques include but are not limited to transformation of protoplasts calcium/polyethyleneglycolmethod,electroporationthe and microinjection or (coated) particle bombardment. In addition to these so- called direct DNA transformation methods, transformatiou svstems involving vectors are widely available, such as viral and bacterial vectors (e, g. from the genus Aglobactelitml). After selection and/or screening. the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art. The choice of the transformation and/or regeneration techniques is not critical for this invention.

The Bt protein, host cell, insecticidal recombinant virus and insecticidal recombinant bacterium of the invention mav be used for the control of, for example, Lepidoptera species. Thus. the invelltioll also extends to methods for controlling the proliferation of pest insectes, including applying to an area the Bt protein of the first aspect and/or the host cell of the fifth aspect and/or the insecticidal recombinant virus of the sixth aspect and/or the insecticidal recombinant bacterium of the seventh aspect. optionally in admixture with an agriculturally acceptable carrier, The invention further extends to biologically active (e. g. insecticidally active) fragments of the Bt protein of the first aspect and io polynucleotide molecules encoding said fragments. Such fragments may be identifie by, for example, deletion mutagenesis.

The concentration of the insect control agent that will be required to produce insecticidally effective compositions for the control of an insect pest will depend on the type of organism and the formulation of the composition.

The insecticidally effective concentration of the insect control agent within the composition can readily be determined experimentally, as will be understood by the skilled artisan. For example, the insecticidally effective concentration of a virus can be readily determined using techniques known to the art.

Agriculturally suitable and/or environmentally acceptable compositions for insect control are known in the art. Agricultural compositions for control of insect pests of plants must be suitable for agricultural use and dispersal in fields. Similarly, compositions for the control of other insect pests must be environmentally acceptable. Generally ! components of the composition must be non-phytotoxic and not detrimental to the integrity of the protein, host cell of the fifth aspect. insecticidal recombinant virus of the sixth aspect, or the insecticidal recombinant bacterium of the seventh aspect. Foliar applications must not damage or injure plant leaves. In addition to appropriate solid or more preferablv, liquid carriers agricultural compositions may incluse sticking and adhesive

agents, emulsifying and wetting agents, but no components which deter hlsect feeding or any insect control agent functions. It may also be desirable to add components which protect the insect control agent from LJV inactivation or components which serve as adjuvants to increase the potency and/or virulence of an entomopathogen. Agricultural compositions for insect pest control may also include agents which stimulate insect feeding.

The "comprises"and"comprising"asused"comprise", throughout the specification are intended to refer to t lie inclusion of a stated component or feature or group of components or features with or without the inclusion of a further component or feature or group of components or features.

The invention is hereinafter described by wav of the following non- andwithreferencetotheaccompanyingfigures.limitingexample Brief Description of the Accompanying Figures: Figure 1 shows the inserts of clones identifie from Bt strain JW 3.2.5 genomic library by hybridisation with PCR product. Shaded areas indicate regions for which initial sequence data were obtainedr the light shadow indicates regions of holllology to crylad Figure 2 provides the nucleotide sequence of laAM2. The open reading frame (ORF) starts at nucleotide 649 (underlined), the stop codon (at nucleotide 4173) is double underlined.

Figure 3 provides the putative amino acid seqnence of the protein encoded by the ORF of pAM2.

Figure 4 shows the binding of activated pAM2 toxin to Helicoverpa armigeraBBMVs.

Example: Isolation of JW 3.2.5 Strain JW 3.2.5 was isolated from a sample of soil collecte from Maimuru, NSW. One gram of soil was suspended in 10mL sterile water and

shaken for 1 min. The suspension was heated at 70"C for 1h. serially diluted in sterile water and plated onto Luria-Bertani (LB) agar (maniais et al. 1982).

JW 3.2.5 was one of eight colonies seen after 4d incubation at 30"C. It was identifie as Bacillus thuringiensis on the basis of having a bipyramidal crystal associated with the spore.

ProteinCharacterisation Preliminary characterisation of the crystal was made by SDS-PAGE analysis after the crystals were purifie from spores. JIA7 3.2.5 was grown on LB agar at 28"C for 3d and harvested into distille water. Twice the suspension was centrifuged at 1600g, 4°C, 10 min ancl the pellet resuspended in distille water. OD, ;"" of the final suspension was adjusted to 2.0 and the suspension sonicated on ice for 2 min before being layered onto a linear sucrose gradient (60-9O'Y,) and centrifuged in a Beckman SW28 rotor at 25K for 17h at 4°C. The crystals were removed with the aid of a peristaltic pump, washed three times in distille water and freeze-dried.

The crystals were suspende in SDS-PAGE loading buffer, denatured by boiling and run on a 10% SDS-polyacrylamide gel with a 4 (Yo stacking gel.

A single band of ca 130ka was detected. The bancl was transferred to PVDF membrane by standard procedures and sent to the Australian Proteome Analysis Facility for sequencing. The N-terminal sequence wus fond to be MNRNNQNEYE, which is 100% identical to the N-terminal sequence of the B. thuringiensis insecticidal crystal protein (ICP) Cry9Cal. (Lambert et al., 1996).

Characterisation of IN 3.2.5 by PCR analysis JW 3.2.5 was analyse by PCR using primers specific for various ICP genes. A loopful of cells from the vegetative growth phase was suspende in deionisedwaterandboiledfor2min.Thesuspensionwas50µLsterile centrifuged at 14,000rpm for 5 min. in an Eppendorf 5415 centrifuge. Five AL of the supernatant was added to the reagent mixture (5 units Taq DNA polynerase (Gibco BRL). 25pool of the primers, 200KtM of each of dATP,

dTTP, dGTP and dCTP. and 1x Taq DNA polymerase rection buffer to 95>L).

The rection mixture was covered with 50µL of light mineral oil. PCR amplification was carried out using a Corbett FT320 thermal sequencer with a pre-denaturation step of 90"C for 2 min followed ly 35 cycles of denaturation at 95"C for 1 min annealing at the appropriate temperature for the primer pair (Table 2) for 1 loin and extension ai 72"C for 1.25 min: an extra period of 5 min at 72"C was added after the final cycle to ensure complete extension. For each PCR reaction, 20yL was mixed with 2KlL loading dye and electrophoresed on a 1. 5% Tris-acetate-agarose gel (Sambrook et al. 1989).

A product was produced with only one pair of primer) the Lep2A/2B set of Carozzi et al. (1991). Bands, slightly larger than the 908 and 986 bp obtained with the positive control strain (crylAa, crvlAb, crylAc) were detected. The finding that the bands did not match the controls and that this primer set is non-specific for cryl genes, suggested that JW 3.2.5 carries a novel ICP genre.

Cloning and sequencing of the PCR produit The PCR rection was electrophoresed on a 1'Ms low melting point agarose gel. The gel was sliced to separate the two l'CR products and the DNA recovered by USillg the Geneclean Bio 101 kit. The products were ligated into pGEM-T (Promega) and transformed into E. coli TG1. Dye terminator sequencing and the ABI 373A automatic DNA sequencer were used to determine the DNA sequences of two clones of each PCR product size. Sequence analysis showed that the smaller PCR product was a part of the larger and that there was 85-89% sequence homology with the corresponding regions of the crylA (a-e) and cry1G genes.

Table 2. Primers used for analysis of JW 3.2.5 Primer Sequence Genes recognised PCR product size (bp) Reference Predicted Actual 5'CCGGTGCTGGATTTGTGTTA3' Cry1Aa,b,c,d,e 492 n1 Carozzi et al. 1991 5'AATCCCGTATTGTACCAGCG3' 5'CCGAGAAAGTCAAACATGCG3' Cry12 988 -1000 Carozzi et al. 1991 5'TACATGCCCTTTCACGTTCC3' cry1Ab 908 -940 5'CAAGCCGCAAATCTTGTGGA3' Cry4A, cry4B 797 n Carozzi et al. 1991 5'ATGGCTTGTTTCGCTACATC3' 5'GGTGCTTCCTATTCTTTGGC3' Cry4B 1395 n Carozzi et al. 1991 5'TGACCAGGTCCCTTGATTAC3' 5'GTCCGCTGTATATTCAGGTG3' Cry3A 649 n Carozzi et al. 1991 5'CACTTAATCCTGTGACGCCT3' 5'AGGTGCCAACTAACCATGTT3' Cry3A, (Cry3B??) 1060 n Carozzi et al. 1991 5'GATCCTATGCTTGGTCTAGT3' 5'GATGCCTTATCAGATGAAGT3' Cry5Aa,b, Cry12A 745(5A), 748 n This study 5'ATATCTGAACGAATAGAACC3' (12A) 5'ATGATTTTAGGGAATGGAAA3' Cry6B 1185 n This study 5'AGGAGTATAAGCATTTAGTA3' 5'CAGCCGATTTACCTTCTA3' Cry1Ad 173 n Ceron et al. 1994 5'TTGGAGCTCTCAAGGTGTAA3' Primer Sequence Genes recognised PCR product size (bp) Reference Predicted Actual 5'CTTCATCACGATGGAGTAA3' Cry1B 367 n1 Ceron et al. 1994 5'CATAATTTGGTCGTTCTGTT3' 5'AAAGATCTGGAACACCTTT3' Cry1Ca 130 n Ceron et al. 1994 5'CAAACTCTAAATCCTTTCAC3' cry1Cb 1744 (v. faint) 5'CTGCAGCAAGCTATCCAA3' Cry1Da 290 n Ceron et al. 1994 5'ATTTGAATTGTCAAGGCCTG3' 5'TACAATTGTTTAAGTAATCC3' Cry1Da,b 601 n This study 5'TTATACGTATCCACACAATG3' 5'CAGATACCCTTGCTCGTGTAA3' Cry2Aa,b 1072 n Asano et al. 1993 5'ATAGGCCCGTGCTCCACCAGG3' 5'GGATCCTTGTGTTGAGATA3' Cry11 1145 n Gleave et al. 1993 5'ATGAAACTAAAGAATCCAGA3' 5'AACAATCGAAGTGAACATGA3' Cry3C 1047 n This study 5'TGAAGAGCATTGAGTGTAAA3' 5'ATATGAAATATTCAATGCTC3' Cry10A 613 n This study 5'ATAAATTCAAGTGCCAAGTA3' 5'TCTAATGTTAATGCGTTGGT3' Cry14A 742 n This study 5'ACTCTTTGTGTATATTCATT3' 1n=no product 2These primers produce a 986bp band with the cry1Aa, c, d:1Ca,b; 1Db; 1Ea,b;1Fa,b; 1Ga; and 1Ha,b genes

Library Construction Genomic DNA prepared from strain JW 3.2.5 was partially digeste and fractionated on a sucrose gradient. Sucrose solutions (10.20.30 and 40%) in 40mM Tris-HC1 (pH8.5), 40mM KCl, and 10mM Mg (OAc) z were prepared and autoclaved. The gradients were established by snap-freezing 2mL aliquots sequentially in Beckman SW-41 tubes and allowed to thaw overnight at 4') C.

Genomic DNA was partially digeste with Aluni, the rection quenched by the addition of EDTA to 20iiiM and the DNA precipitated by NaOAc and ethanol.

The DNA was resuspended in TE buffer and overlaved on the sucrose gradient which was then centrifuged at 25, 000rpm at 20"C for 19h. The gradient was drained off in fractions and samples of each fraction run on an 0.5% agarose gel to estimate DNA fragment size. Fractions containing fragments of 4-10kb were pooled and dialyse overnight in TE buffer.

The genomic fragments were ligated to Phariiiacia EcoRI/NotI adaptors and phosphorylated by kinase. The inserts were then ligated into , gtio with EcoRI ends (Promega) and packaged with the Epicentre MaxPlax Packaging Extract.

Library screening A 1kb PCR fragment was excised from the vector by digestion with SacII/Spel and labelle with 32P by the random-priming method (NEBlot kit, New England BioLabs). The labelle fragment was separated from the unincorporated label by ethanol precipitation.

The library was titred and plated onto E. coli C600Hf1 and plaques lifted onto 82mm Nitrobind membranes (Micron Separations Inc.). The membrane was baked in vacuo for 2h, prehybridised for 5h and then probed with the 32P-labelled PCR fragment. The membranes were washed at 63"C as follows: 30min/2xSSC/0.1% SDS, 30min/1xSSC/0.1% SDS. and then Autoradiographywasconductedat-80°C.30min/0.5%SSC/0.1%SDS.

After plaque purification and confirmation bv hvbridisation to the 32P- labelle PCR fragment, five positive clones were identified. DNA was purifie from each clolle (AM1 plO6), digeste with NotI and electrophoresed on a 0.8% Tris-acetate-agarose gel. The insert bands (1.9.4.2,4.8.4.8 and 6.4kb) were recovered from the gels with the Progen Bandpure kit and cloned into the pBSK (+) Bluescript vector (Stratagene). The vector was transformed into XL-1 Blue MRF' cells (Stratagene).

Sequencing RM26 Dye terminator sequencing and the ABI373A automatic DNA sequencer were used to deternoine the DNA sequences of either end of each insert. No two inserts were identical in the regions sequenced. The Bestfit program of GCG was used to align the sequences to tlle crvlAd gene (Figure 1).

Clone pAM2 was shown by Western Blotting to express a 130kDa protein that reacted with a polyclonal antibody raised against crystals purifie from the JW 3.2.5 strain. It was chosen for sequencing.

A series of nested deletion clones was generated using Exonuclease III (Promega) and the manufacturers protocols. Subclones were sequenced in both directions with the ABI373A automate sequencer.

Sequence analysis The 4180bp pAM2 clone contained a 3524bp full-length open reading frame (Figure 2). BESTFIT analysis (GCG program) showed that the inferred protein product (Figure 3) of the pAM2 ORF has 87. 7% identity (92.7% similarity) to CrylHal and 5%85. identity (90.9% silnilality) to Cry1Hb1.

(ENIBL database Accession No's Z22513 and U35780. respectively).

The N-terminal sequence of the inferred protein product differs from that of the sequence obtained for the crystal protein of JW 3.2.5. indicating t : hat this strain carries at least two potentially functional genes.

Expression The 4180bp pAM2 fragment was cloned into the Bt shuttle vector pHT315 (Arantes and Lereclus. 1991), The plasmid was theu trausformed into the

strainCryBbyelectroporation(Lereclusetal.,1989).Theacrystall iferousBt pAM2-transformed strain produced large bipyramidal crvstals that were purifie on a sucrose gradient as described above. SDS-PAGE revealed the presence of a single 130ka protein. The N-terminl sequence of this protein was found to be MEIIN which is the sequence predicted from the ORF cominencing at nucleotide 649 of AM2.

Insecticidal activity The insecticidal activity of the bipyramidal crystals purifie from the pAM2-transformed Bt strain CryB was tested in feeding bioassaVs with larvae <BR> <BR> <BR> of the diamondback moth, Plutella xylostella. The crvstals were freeze dried. weighed and re-suspended in distille water by sonication so that the dosages could be determined accurately. Aliqllots (50Kll) of each dosage (500- 8000 ng cm-2) were spread on the surface of an artificial diet in 24 well plates.

The artificial diet was prepared as follows; 60g sucrose.'1, 5 g yeast. 2g casing 2g agar, 90 ml water were mixed well and placed in a microwave until boiling, upon cooling to 70°C, 0.5g ascorbic acid, 3g cabbage leaf powder, 1g cellulose powder, 0.5111l edible oil, 0.5 ml 10% formaldehyde, 1ml 15% Nipagen and 10nll of water were added, mixed well and then poured into 24- well plates to depth of ca lcm. Controls consiste of water spread on the diet.

One third instar larva was placed in each well (24 per dosage) and the plates were incubated at 25°C, 45 % RH in a 14hlloh light/dark regime. After 4 days, the nui-abers of living and dead larvae in each treatment were recorde. Three replicate bioassays were conductecl: the data were combine and the LCs (, estimated by probit analysis (POLO-PC. LeORa Software). The and95%confidenceintervalwas1788(1271-2400)ngcm-2.estimatedLC 50 <BR> <BR> <BR> <BR> Toxin binding<BR> <BR> <BR> <BR> <BR> <BR> The ability of the activated product of the pAM2 gene to bind to the midgut, an essential step in toxicity, was tested with Helicoverpa armigera, Crystals purifie from the pAM2-transformed Bt strain CyyB were dissolve

in 100mM Na2CO3, 10mM DTT, pHlO at 37°C. The solution was dialyse overnight at 4°C against 50mM Na2CO3, pH8. 5 to remove the DTT. l'rypsin was added to 1% total protein and the solution incubated at 37°C for 2 hours.

Ammonium sulphate was added to 70% (w/v) and stirred at 4°C overnight.

The activated toxin was recovered by centrifugation at 20. 000g and dissolving the pellet in phosphate buffered saline (PBS). pH7. 4. The solution was dialyse against PBS, pH7.4 overnight. The activated toxin was labelle with NIP (Promega UniTagTMLabelling and Detectioii Svsteiii) as directe by the manufacturer (Promega Technical Bulletin No. 204).

Brush border membrane vesicles were prepared from the excised midguts of fifth instar II. almigera by the method of Wolfersberger (1990).

BBMVs were centrifuged at 14, 000g for 3 min. at 4°C and resuspended in coating buffer (Promega). A stock solution of the unlabelled toxin was made up in washing buffer (Promega) and was then serially diluted eight times. A constant quantity of labelle toxin was addecl to each dilution of unlabelled toxin and to a buffer control so that nine mixtures containing 4yg ml-1 labelled toxin and 0-128µg ml-1 unlabelled toxin were prepared.

The BBMV suspension (10µg in 100Ll) was pipette into a 96-well microtitre plate and incubated at 4°C overnight. The vvells were emptied and 300tl blocking buffer (Promega) added to each well. After incubation at 37°C for 1 houx. the blocking buffer was removed and tll (, cells rinsed twice with 300µl washing buffer and emptied. The labelled/unlabelled toxin mixtures were added (100µl per well) and incubated in the dark at room temperature for 1 hour. The wells were emptied, rinsed twice with washing buffer and emptied again. Anti-NIP conjugate (lo0Kll) in washing buffer (0. 5µg ml-1) was added and incubated in the dark at room temperature for 1 hour. The wells were emptied and rinsed three times with washing bouffer. Equal volumes of the TMB and peroxidase substrate provided in the Promega kit were mixed thoroughly at room temperature and 100µl added to each well. After 15 mill.

the rection was stopped by the addition of 100µl 1M phosphoric acid to each well and the OD"measured in an ELISA plate reader.

The quantity of labelle toxin bound to the B} 3MVs declined with increasing levels of unlabelled toxin (Figure 4) indicating there is specific theactivatedtoxintomidgutmembraneofH.armigera.bindingof It will be appreciated by persons skilled in the art that numerus variations and/or modifications may be made to the invention as shows in the specific embodiments without departing from the. spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

References: andLereclus,D.,1991.ConstructionofcloningforBacillusArantes, O., thuringiensis. Gene 108, 115-119.

Asano, S., Bando, H. And Iizuka, T. 1993. Amplification and identification of BacillusthuringiensisbyPCRprocedure,JournalofSericulturalcry IIfrom Science of Japan 62, 223-227.

Carozzi, N. B., Ramer, V. C., Warren, G. W., Envola, S.. and Koziel. M. G. 1991.

Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain rection product profiles. Appliecl and Environmental Microbiology 57, 3057-3061.

Ceron, J., Covarrubial. L., Quintero, R., Ortiz, A., Ortiz, M., Aranda, E.. Lina, L., and Bravo, A. 1994. PCR analysis of the cry I insecticidal crystal family genes from Bacillus thuringiensis. Applied and Environmental Microbiology 60,353-356.

Gleave, A. P., Williams. R., and Hedges. R. J. 1993. Screening bv polvmerase chain rection of Bacillus thuringiensis serotypes for tlie presence of cry V- like insecticidal protein genes and characterisation of a cry V gene cloned from B. thuringiensis subsp. kurstaki. Applied and Environmental Microbiology 59,1683-1687.

Lambert. B., Busse. L.. Decock, C., Jansens, S., Piens. C., Saey, B.. Seurinck, J., Van Audenhove, K.. Van Rie, J., van Vliet. A., and Peferoen. M. 1996. A Bacillus thuringiensis insecticidal crystal protein with a high activity against members of the family Noctuidae. Applied and Environmental Microbiology 62,80-86.

Lereclus, D., Arantes, O., Chaufaux, J., and Lecadet. M.-M., 1989.

Transformation and expression of a cloned 6-endotoxill gene in Bacillus thuringiensis. FEMS Microbiology Letters 60,211-218.

Maiiiatis, T., Fritsch. E. F., and Sambrook, J., 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. New York.

Sambrook, J., Fritsch, E. F. and Maniais. T (1989), Molecular Cloning: A Laboratoiy Manual. Second Edition. Cold Spring Harbour Laboratory Press.

New York.

Smith, T. F. and Waterman, M. S. 1981. Comparison of biosequences.

Avances in Applied Mathematics 2,482-489.

Wolfersberger, M. (1990). The toxicity of two Bacillus thuringiensis #- endotoxills to gypsy moth larvae is inversely related to the affinity of binding sites on midgut brush border membranes for the toxins. Experientia 46,475- 477.