New compounds and their use as anti-aging agent or as exercise enhancer The present invention relates to new compounds and their use as anti-aging agent or as exercise enhancer. A rapidly aging global population has led to increasing prevalence of age-related ailments such as frailty and neurodegeneration. This development raises issues related to quality of life for the elderly and will likely represent a significant financial burden for global health systems in future. Therefore, there is a strong unmet need for the identification and development of small molecules which proactively counteract the aging process. Resveratrol is a terpenoid which is mainly contained in grape skin, peanut, pineapple, and knotweed rhizome. Resveratrol is known as an antioxidant, and has been found to decrease blood viscidity, suppress platelet-coagulation, enhance vasodilation, and thus promote blood circulation. Because of its hypolipidemic feature, resveratrol plays an important role in preventing atherosclerosis and ischemic heart diseases. Resveratrol also has antineoplastic effect and is a natural substitute of estrogen. Further functionalities of resveratrol include anti-aging effect, preventing oxidation of low-density lipoprotein (LDL) cholesterol, anti- inflammation and anti-allergic effect. US9610255B2 discloses a dietary supplement comprising lycopene and resveratrol as an agent for anti-aging or for use as an anti-oxidative. However, the stability of resveratrol is strongly dependent on temperature and pH. The problem of the present invention is to provide a stable compound that counteracts the ailments associated with or positively influences the aging process. The problem is solved by the compounds according to claim 1. Further preferred embodiments are subject of the dependent claims. The compounds of the present invention are suitable to alleviate the negative effects of aging and improve quality of life for the aging human population. In particular, the compounds of the present invention provide several positive effects such as a short-term increase in ROS (reactive oxygen species), activation of Nrf2, transient drop of ATP levels and activation of AMPK. Therefore, the compounds of the present invention are useful as a non-therapeutic active ingredient for prevention, stabilization and/or reduction of age-related ailments and/or degenerative ailments. Thus, the present application relates to a compound of formula (I) wherein X is selected from the group consisting of oxo, sulfanyl and hydroxy, and if X is hydroxy, the stereocenter in position (3) is in S configuration; R ₁ is selected from the group consisting of hydroxy, a linear or branched C ₁ to C ₂₀ alkyl residue optionally containing 1 to 5 hydroxyl groups, a cycloalkyl, a cycloalkylalkyl, cycloalkylalkenyl and a linear or branched C ₁ to C ₈ alkoxy residue, which may optionally form together with R ₂ a ring system if R ₂ is a linear or branched C ₁ to C ₈ alkoxy residue; R2 is selected from the group consisting of hydrogen, hydroxy, a linear or branched C ₁ to C ₂₀ alkyl residue optionally containing 1 to 5 hydroxyl groups, a cycloalkyl, a cycloalkylalkyl, A23418WO cycloalkylalkenyl and a linear or branched C ₁ to C ₈ alkoxy residue, which may optionally form together with R ₁ a ring system if R ₁ is a linear or branched C ₁ to C ₈ alkoxy residue; and R ₃ is selected from the group consisting of hydrogen, a linear or branched C ₁ to C ₂₀ alkyl residue optionally containing 1 to 5 hydroxyl groups, a cycloalkyl, a cycloalkylalkyl, cycloalkylalkenyl, a linear or branched C ₂ to C ₂₀ alkenyl residue, a linear or branched C ₂ to C ₂₀ oxirane group containing alkyl or alkenyl residue, a linear or branched C ₂ to C ₂₀ alkoxy residue, and a linear or branched C ₂ to C ₂₀ alkynyl residue. The term “linear or branched C ₁ to C ₂₀ alkyl” as a residue refers to a linear or branched hydrocarbon chain containing 1 to 20 of carbon atoms. Said linear or branched C ₁ to C ₂₀ alkyl residue may optionally comprise 1 to 5 hydroxyl groups resulting in polyols. Examples of said term as used herein include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, 3-methylbutyl, sec-pentyl, 2-methylbutan-2-yl and 2,2-dimethylpropyl and 1,2- dihydroxyoctyl, 3,4-dihydroxyoctyl, 1,2-dihydroxynonyl, 3,4- dihydroxynonyl, preferably 1,2-dihydroxyoctyl. The term “linear or branched C ₁ to C ₂₀ alkoxy” as a residue refers to a linear or branched hydrocarbon chain containing preferably 1 to 20 of carbon atoms, of which 1 to 5 may be singularly bonded to oxygen. Examples of said term as used herein include methoxy, ethoxy, propoxy, 1-methylethoxy, butoxy, 1-methylpropoxy, 2-methylpropoxy, 1,1-dimethylethoxy, n-pentyloxy, 1-methylbutoxy, 2-methylbutoxy, 3- methylbutoxy, 1,2-dimethylpropoxy, 1,1-dimethylpropoxy, 2,2- dimethylpropoxy and 1-ethylpropoxy. Two adjacent alkoxy residues may form together a ring system, namely a cyclic acetal. Examples are isopropylidene acetal, benzylidene acetal, cyclohexylidene acetal and cyclopentylidene acetal. A23418WO The term “linear or branched C ₂ to C ₂₀ alkenyl” as a residue refers to a linear or branched hydrocarbon chain containing 2 to 20 of carbon atoms which contains at least one double bond. The chain may additionally contain one or more triple bonds and/or oxygen atoms. Preferably, at least one double bond is in the positions 1 and 2 of the alkenyl chain, thus the double bond is directly adjacent to the carbon atom in position (9) of compound of formula (I) as shown for example in compounds 1 to 4 below. In one embodiment of the present invention, the C ₂ to C ₂₀ alkenyl residue contains only one double bond. Examples of said term as used herein include 1-octenyl, 3- octenyl, 1-nonenyl and 8-nonenyl, preferably 1-octenyl. The term “linear or branched C ₂ to C ₂₀ oxirane group containing alkyl or alkenyl residue” a residue refers to a linear or branched hydrocarbon chain containing 2 to 20 carbon atoms which contains at least one epoxy group, i.e. the oxygen atom of the one epoxy group is directly attached to two adjacent carbon atoms of the chain. Examples of said term as used herein include 1,2-epoxyoctyl, 3,4- epoxyoctyl, 1,2-epoxynonyl, 8,9-epoxynonyl, preferably 1,2- epoxyoctyl. The term “linear or branched C ₂ to C ₂₀ alkynyl” as a residue refers to a linear or branched hydrocarbon chain containing 2 to 20 of carbon atoms which contains at least one triple bond. The chain may additionally contain one or more double bonds and/or oxygen atoms. Examples of said term as used herein include 1-heptinyl, 6-heptinyl and 1-en-6-heptinyl, preferably 1-en-6-heptinyl. The term "cycloalkyl" means a non-aromatic monocyclic ring system comprising 3 to 10 carbon atoms, preferably 5 to 10 carbon atoms. Preferred cycloalkyl rings contain about 5 to about 7 ring atoms. Non-limiting examples of suitable monocyclic cycloalkyls include cyclopentyl, cyclohexyl, cycloheptyl and the like. The term “cycloalkylalkyl” means a residue —R _a R _b where R _a is an A23418WO alkylene group having 1 to 8 carbon atoms and R _b is cycloalkyl group as defined above. The term “cycloalkylalkenyl” means a residue —R _a’ R _b where R _a’ is an alkenylene group having 2 to 8 carbon atoms and R _b is cycloalkyl group as defined above. In a preferred embodiment, the compound of the present invention is compound of formula (Ia) Compound of formula (Ia) is a compound of formula (I), wherein X is hydroxy and the stereocenter in position (3) is in S configuration. R ₁ , R ₂ and R ₃ have the same definition as indicated above. It has been shown that the S configuration in position (3) has a significant impact on the activity. In contrast thereto, compounds having an R configuration in position (3) are almost inactive (see Figure 13). In a preferred embodiment R ₁ and/or R ₂ are hydroxy, and R ₃ has the same definition as indicated above. Another embodiment relates to compound of formula (Ib) ) Compound of formula (Ib) is a compound of formula (I), wherein X is oxo. R ₁ , R ₂ and R ₃ have the same definition as indicated above. A23418WO In a preferred embodiment, the compound of the present invention is compound of formula (Ia(i))

Compound of formula (Ia(i)) is a compound of formula (la), wherein Ri and R2 are both hydroxy. R3 has the same definition as indicated above. In a preferred embodiment R3 is a linear or branched Ci to C20 alkyl residue or a linear or branched C2 to C20 alkenyl residue, most preferably a C2 to C20alkenyl residue. The stereocenters in positions (8) and (9) can have the following configurations:

In a preferred embodiment of the present invention, the compound is selected from the group consisting of compounds 1 to 12, most preferably selected from the group of compounds 1, 2, 3 and 4, and ideally compound 3:

In particular, compounds 1, 2, 3, and 4 show excellent results with regard to inhibition of mitochondrial Fi-Fo ATP synthase.

Compound 3 is especially preferred since it is contained in common carrots. It has a high stability, especially in acidic aqueous media at elevated temperatures. Extraction of whole orange table carrots with ethyl acetate or ethanol gave oily residues containing roughly 5*1CT ⁴ mg/mg and 2*1CT ⁵ mg/mg of compound 3, respectively. Extracting exclusively the peel with ethyl acetate resulted in a red oil containing l*10~ ³ mg/mg of compound 3. Hence, large-scale extractions of compound 3 out of carrots, and in particular out of carrot peels, is possible.

Another embodiment of the present invention relates to the method for preparing said compounds. As outlined below in detail, the synthesis involves the preparation of intermediates XVI and XIV which are coupled subsequently.

For example, the compounds according to the present invention can be obtained by the following reaction steps (Scheme 1):

Scheme 1: wherein

Y is selected from the group consisting of hydrogen and CH2OR21;

R21 is selected from the group consisting of hydrogen and a hydroxy protecting group and if R21 is hydrogen it can form the corresponding hemiacetal, such as

R22 is selected from the group consisting of hydrogen and a hydroxy protecting group; or

R21 and R22 may form together a 1,2-diol protecting group,

R23 is selected from the group consisting of hydrogen and a hydroxy protecting group;

R24 is selected from the group consisting of hydrogen and a hydroxy protecting group; or

R23 and R24 may form together a 1,2-diol protecting group, preferably R23 and R24 form together an acetal, most preferably an isopropylidene acetal;

R25 is selected from the group consisting of hydroxy, alkoxy and N- alkoxyamine;

R26 is selected from the group consisting of hydrogen, chloro, bromo and iodo;

R27 is selected from the group consisting of hydrogen and Ci to Cis alkyl, preferably CgHis;

R28 is selected from the group consisting of hydrogen, chloro, bromo and iodo; R ₃₀ is selected from the group consisting of hydrogen and alkyl silane, preferably trimethylsilane; and R ₃₁ is selected from the group consisting of hydrogen and a hydroxy protecting group; R ₃₂ is selected from the group consisting of hydrogen, chloro, bromo and iodo; R ₃₃ is a C ₁ to C ₁₈ alkyl, preferably C ₆ H ₁₃ . The reaction shown above can involve for example the following reaction steps: Reactions: a) Protection of the hydroxy groups of a sugar or of a sugar- derived molecule leading to compound X, wherein Y is CH ₂ OR ₂₁ ; b) Conversion of primary alcohol to aldehyde via selective oxidation leading to compound X, wherein Y is hydrogen; c) Conversion of carbonyl compound to aldehyde via selective reduction leading to compound X, wherein Y is hydrogen; d) If R26 in compound XI is hydrogen by C1 olefinations; R ₂₆ in compound XI is E-halogen (E-Hal): Takai-Utimoto olefination (CHZ ₃ , Cr ^II , wherein Z is selected from the group consisting of chloro, bromo and iodo); e) If R ₂₇ in compound XII is hydrogen by terminal alkyne synthesis, R ₂₇ in compound XII is alkyl by modified Corey-Fuchs reaction (PPh ₃ , CBr ₄ , BuLi, alkylium cation-electrophile) or by lithiation of the corresponding R ₂₇ = hydrogen derivative and SN ₂ on C ₆ -electrophile or by electrophilic halogenation of terminal alkyne of the corresponding R ₂₇ = hydrogen derivative and cross couplings; f) If R ₂₆ in compound XI is hydrogen by cross-metathesis such as Ru catalyzed cross-metathesis of the terminal olefin with excess 1-octene R ₂₆ in compound XI is E-halogen by cross couplings g) Direct E-selective olefinations h) If R ₂₇ in compound XII is hydrogen by alkyne-metalations/ cross couplings/ cross couplings R ₂₇ in compound XII is alkyl by E-selective alkyne reductions i) If Y in compound XIII is hydrogen by selective R ₂₂ deprotection, followed by oxidation, followed by terminal alkyne synthesis, and if R ₂₈ in compound XIV is halogen, the preceding steps followed by electrophilic halogenation of terminal alkyne. Y in compound XIII is CH ₂ OR ₂₁ by selective R ₂₁ and R ₂₂ deprotection, followed by 1,2-diol-cleavage, followed by terminal alkyne synthesis, and if R ₂₈ in compound XIV is halogen the preceding steps are followed by electrophilic halogenation of terminal alkyne. j) optional protection of the hydroxy group, followed by R ₃₀ deprotection, if R ₃₂ in compound XVI is halogen the preceding steps are followed by electrophilic halogenation of terminal alkyne. k) Coupling reaction followed by optional deprotection of R ₂₃ , R ₂₄ and R ₃₁ unless R ₂₃ , R ₂₄ and/or R ₃₁ are hydrogen. A23418WO In order to obtain the corresponding alkyl derivative XX, compound XIII can be converted to compound XVIII (step 1) by reducing the double bond before carrying out steps i) and k)(Scheme 2). Suitable reaction conditions for step 1 are known to the skilled person. Scheme 2:

One aspect of the present invention comprises the coupling of intermediate XIV or intermediate XVIII with intermediate XVI in the presence of a metal catalyst:

wherein,

R23 is selected from the group consisting of hydrogen and a hydroxy protecting group;

R24 is selected from the group consisting of hydrogen and a hydroxy protecting group;

R23 and R24 may form together a 1,2-diol protecting group, preferably

R23 and R24 form together an acetal, most preferably an isopropylidene acetal;

R28 is selected from the group consisting of hydrogen, chloro, bromo and iodo;

R31 is selected from the group consisting of hydrogen and a hydroxy protecting group; R32 is selected from the group consisting of hydrogen, chloro, bromo and iodo; R ₃₃ is a C ₁ to C ₁₈ alkyl, preferably C ₆ H ₁₃ . Examples of such coupling reactions are the Cadiot-Chodkiewicz heterocoupling in the presence of a Cu ^I catalyst and a base, or a Pd catalyzed heterocoupling (Pd ⁰ , Cu ^I , base). Another aspect of the present invention relates to the preparation of compound of formula XIV or XIX starting from compound XIIIa or compound XVIIa involving the following steps: ^ selective deprotection of OR ₂₂ if R ₂₂ is not hydrogen, ^ oxidation, ^ terminal alkyne synthesis, and then ^ electrophilic halogenation of terminal alkyne if R ₂₈ is selected A23418WO from the group consisting of chloro, bromo and iodo. Possible oxidation reactions are for example Dess-Martin oxidation (DMP) or Swern oxidation (Me ₂ SO, (COCl) ₂ , base). The terminal alkyne synthesis can be carried out by a Seyfert-Gilbert reaction (Ohira- Bestmann reagent, Base, MeOH), or Corey-Fuchs (PPh ₃ , CBr ₄ , BuLi) reaction. Another aspect of the present invention relates to the preparation of compound of formula XIV or XIV starting from compound XIIIb or XVIIIb involving the following steps: ^ selective deprotection of R ₂₁ and R ₂₂ if they are not hydrogen, ^ 1,2-diol cleavage, ^ terminal alkyne synthesis, and then ^ electrophilic halogenation of terminal alkynes if R ₂₈ is selected from the group consisting of chloro, bromo and iodo. The 1,2-diol cleavage can be carried out for example by periodate cleavage (NaIO ₄ ). The terminal alkyne synthesis can be carried out by a Seyfert-Gilbert reaction (Ohira-Bestmann reagent, Base, MeOH), or a Corey-Fuchs reaction (PPh ₃ , CBr ₄ , BuLi). Another aspect of the present invention relates to the preparation of compound Xb. Compound Xb can be obtained for example by selectively protecting sugar 41. Another aspect of the present invention relates to the preparation of compound Xa. Compound Xa can be prepared by oxidation of compound XIII using for example Dess-Martin oxidation conditions (DMP) or Swern oxidation conditions (Me ₂ SO, (COCl) ₂ , base). Alternatively, compound Xa can be prepared by reduction of compound IX, for example with DIBAL-H. Compound IX can be for example a carboxylic acid (if R ₂₅ is hydroxy), an alkyl ester (if R ₂₅ is alkoxy) or a Weinreb amide (if R ₂₅ N-alkoxyamine). Another aspect of the present invention relates to the preparation of compound XIII starting from compound X. Compound XIII can be prepared via intermediate XI using compound X as starting material for example by C1 olefinations such as Wittig (CH ₃ PPh ₃ Br, base) or Tebbe/Petasis (Cp ₂ TiCH ₂ ) (R ₂₆ = hydrogen) followed by cross-metathesis (Grubbs Catalyst, 1-ocetene; or by Takai-Utimoto olefination (CHZ ₃ , Cr ^II ) (R ₂₆ is E-halogen) followed for example by sp ² -sp ³ cross couplings: e.g., one-pot borylation/Suzuki-Miyaura (Pd, B ₂ (NMe ₂ ) ₄ , base, C ₆ -halogen). Alternatively, compound XIII can be prepared by direct E-selective olefinations such as Wittig-Schlosser (C ₇ -phosphonium salt, PhLi, HCl, KOt-bu), Julia-Lythgoe (C ₇ -phenylsulfone, base, sodium amalgam) or Takai-Utimoto (C ₇ -dihalide, Cr ^II ). Alternatively, compound XIII can be prepared via intermediate XII using compound X as starting material for example A23418WO ^ by a terminal alkyne synthesis, e.g., by Seyfert-Gil- bert (Ohira-Bestmann reagent, Base, MeOH), Corey- Fuchs (PPh ₃ , CBr ₄ , BuLi), followed for example by alkyne-metalations/sp ² -sp ³ cross couplings such as Suzuki-Miyaura (Cy ₂ BH, TMAO, pinacol, Pd, base, C ₆ - halogen) or zirconium-Negishi (Cp ₂ Zr(H)Cl, Pd, LiBr, C ₆ -halogen); or ^ by a modified Corey-Fuchs (PPh ₃ , CBr ₄ , BuLi, C ₆ -elec- trophile) which results in an alkyne that needs to be reduced; or ^ from R ₂₇ = H (obtained for example by Seyfert-Gilbert (Ohira-Bestmann reagent, Base, MeOH), Corey-Fuchs (PPh ₃ , CBr ₄ , BuLi); followed by electrophilic halo- genation of terminal alkyne and sp-sp ² or sp-sp ³ cross couplings such as Copper-catalyzed Grignard cross-couplings (CuCl ₂ , C ₆ -Grigniard reagent) ^ from R ₂₇ = H (obtained for example by Seyfert-Gilbert (Ohira-Bestmann reagent, Base, MeOH), Corey-Fuchs (PPh ₃ , CBr ₄ , BuLi); followed by lithiation and SN ₂ on C ₆ -electrophile, followed by E-selective alkyne re- ductions if the conditions above do not directly result in the corresponding olefin, e.g., hydrosi- lylation/protodesilylation (Ru, silane, TBAF, CuI). A further aspect of the present invention relates to new intermediates in the process for preparing compound of formula I. Preferably, the intermediate is selected from the group consisting of compounds XI, XIa, XIb, XIc, XId, XIe, XIf, XII, XIIa, XIIb, XIII, XIIIa, XIIIb, XIIIc, XIIId, XIV, XIVa, XIVb, XIVc, XIVd, XIVe, XIVf, XIVg, XIVh, XV, XVI, XVIa, XVIb, XVIc, XVId, XVIII, XVIIIa, XVIIIb, XVIIIc, XVIIId, XIX, XIXa, XIXb, XIXc, XIXd, XIXe, XIXf, A23418WO XlXg and XlXh: wherein Y is selected from the group consisting of hydrogen and CH ₂ OR ₂₁ ; R ₂₁ is selected from the group consisting of hydrogen and a hydroxy protecting group; R ₂₂ is selected from the group consisting of hydrogen and a hydroxy protecting group; or R ₂₁ and R ₂₂ may form together a 1,2-diol protecting group, R ₂₃ is selected from the group consisting of hydrogen and a hydroxy protecting group; R ₂₄ is selected from the group consisting of hydrogen and a hydroxy protecting group; or R ₂₃ and R ₂₄ may form together a 1,2-diol protecting group, preferably R ₂₃ and R ₂₄ form together an acetal, most preferably an isopropylidene acetal; R ₂₆ is selected from the group consisting of hydrogen, chloro, bromo and iodo; R ₂₇ is selected from the group consisting of hydrogen and C ₁ to C ₁₈ alkyl, preferably C ₆ H ₁₃ ; R ₂₈ is selected from the group consisting of hydrogen, chloro, bromo and iodo; R ₃₀ is selected from the group consisting of hydrogen and alkyl silane, preferably trimethylsilane; and R ₃₁ is selected from the group consisting of hydrogen and a hydroxy protecting group; R ₃₂ is selected from the group consisting of hydrogen, chloro, bromo and iodo; R ₃₃ is a C ₁ to C ₁₈ alkyl, preferably C ₆ H ₁₃ . A further aspect of the present invention relates to the non- therapeutic use of a composition for prevention, stabilization and/or reduction of age-related ailments and/or degenerative ailments and/or inducing an exercise mimetic effects and/or inducing an exercise enhancing effects, wherein said composition comprises a compound of the present invention in an effective amount. As intended herein, "non-therapeutic" means that the individual receiving or consuming the composition according to the invention is not treated for a disease by the composition. In other words, within the frame of the non-therapeutic uses and methods according to the invention, the composition according to the invention is neither a medicament nor a pharmaceutical composition. The term “effective amount” means an amount of the compound that provides the desired benefit to an individual. It was shown that the compounds of the present invention positively influence the aging process. Said compounds have a life span extending effect of up to +17% in mean life span and +20% in maximum life span when supplemented to the model organism C. elegans. In addition, the compounds of the present invention increased oxidative stress resistance of up to +28% of C. elegans which indicates better adaptation properties and consequently increased health. In view of the present invention, age-related ailments or A23418WO complaints, degenerative dysfunctioning and/or degenerative ailments or complaints include but are not limited to muscular weakness, decreased muscular strength, neuro-muscular degeneration, impaired mobility, impaired immune response, metabolic imbalance, general weakness, and frailty. In a particular aspect, and in view of the present invention, age-related ailments, degenerative dysfunctioning and/or degenerative ailments are selected from muscular weakness, decreased muscular strength, neuro-muscular degeneration, impaired mobility. In another particular aspect, and in view of the present invention, the age-related complaint is general weakness. General weakness and in particular muscle weakness (or "lack of strength") is a direct term for the inability to exert force with one's muscles to the degree that would be expected given the individual's general physical fitness. The compounds of the present invention can prevent of at least reduce general weakness and in particular muscular weakness. The term “individual” used herein includes any human or non-human animal. The term “non-human animal” includes all mammals, such as non-human primates, sheep, dogs, cats, cows, or horses. The compounds of the present invention result in increased bending/ movement of up to 7% of C. elegans as a measure of increased fitness and health (1 nM in the agar). Furthermore, it could be shown that the mitochondrial mass in cells and C. elegans was significantly increased (+28%) (+17%) as a measure of muscle strength. In addition, the compounds of the present invention resulted in an increased running endurance in wild-type mice on high fat diet of up to 56%, indicating an exercise-mimetic effect of the compound, increased fitness, and health. Thus, the general fitness, and in particular muscular strength can be significantly improved. Preferably, the present invention relates to the non-therapeutic use A23418WO of such a compound for reducing a loss of muscle functionality in individuals, increasing muscle functionality in individuals, and/or improving recovery of muscle functionality after muscle atrophy in individuals.

Muscle atrophy may be of different grades, such as severe muscle atrophy as in extreme frailty elderly persons. These elderly persons will have difficulty in carry on everyday activities and taking care of themselves. Muscle atrophy, but of a less severe degree, will allow some movement and some muscle activity, but insufficient to sustain the complete muscle tissue.

A further aspect of the present invention relates to the non- therapeutic use in stimulating muscle strength in individuals, in particular elderly, since the compound of the present invention can increase muscle mass of individuals. In addition, the compounds of the present invention also increase muscle functionality (e.g. muscle strength, gait speed, etc.) in individuals, relative to the muscle functionality (e.g. muscle strength, gait speed, etc.) that would be present from consumption of a diet lacking the compound of the present invention.

In one aspect, the invention thus pertains to the non-therapeutic use of the composition having the aforementioned characteristics in in stimulating muscle strength in individuals, in particular elderly and/or for treating/preventing malnutrition (thus controlling dietary management) of elderly.

Another advantage of the present disclosure is to provide a compo- sition comprising the compound of the present invention, such as a food product or a food supplement, that improves recovery of muscle functionality (e.g. muscle strength, gait speed, etc.) after muscle atrophy in elderly individuals, relative to the recovery that would be present from consumption of a diet lacking the compound of the present invention. In one aspect of the present invention the composition comprising the compound of the present invention in an effective amount is nutritionally complete pet or human food or a dietary supplement for animal or human consumption. Preferably, the composition is administered orally which means that the composition is in any form that can be eaten or drunk by individuals or put into the stomach of an individual via the mouth/jaw.

Thus, the composition is preferably selected from the group of dietary supplements, food additives, functional food, feed additives, functional feed, food premixes, feed premixes, and beverages.

Examples of forms of dietary supplements are tablets, pills, granules, dragees, capsules, instant drinks and effervescent formulations.

Examples of food/feed additives are any composition/formulation added to food/feed during its manufacture or its preparation for consumption.

Examples of functional food are dairy products (yoghurts), cereal bars and bakery items such as cakes, cookies, and bread. Clinical nutrition is also encompassed.

Examples of functional feed including pet food compositions are feed intended to supply necessary dietary requirements, as well as treats (e.g., dog biscuits) or other feed supplements. The animal feed comprising the composition according to the invention may be in the form of a dry composition (for example, kibble), semi-moist composition, wet composition, or any mixture thereof.Alternatively, or additionally, the animal feed is a supplement, such as a gravy, drinking water, yogurt, powder, suspension, chew, treat (e.g., biscuits) or any other delivery form. Examples of food premixes are premixes for manufacture of dairy products, cereal bars, and bakery items such as cakes and cookies, and soups.

Beverages encompass non-alcoholic and alcoholic drinks as well as liquid preparations to be added to drinking water and liquid food. Non-alcoholic drinks are e.g., instant drinks, soft drinks, sport drinks or sport beverages in general, fruit juices such as e.g., orange juice, apple juice and grapefruit juice; vegetable juices such as tomato juice; smoothies, lemonades, functional water, near- water drinks (i.e., water-based drinks with a low-calorie content), teas and milk-based drinks. Alcoholic drinks are especially beer. Liquid food is e.g. soups and dairy products (e.g. muesli drinks).

The dietary supplements according to the present invention may further contain protecting hydrocolloids, binders, film forming agents, encapsulating agents/materials, wall/shell materials, matrix compounds, coatings, emulsifiers, surface active agents, solubilizing agents (oils, fats, waxes, lecithins etc.), adsorbents, carriers, fillers, co-compounds, dispersing agents, wetting agents, processing aids (solvents), flowing agents, taste masking agents, weighting agents, jellyfying agents, gel forming agents, antioxidants and antimicrobials.

A further aspect of the present invention relates to the non- therapeutic use of a composition for retarding aging processes in animals, for improving age-related physiological deficits in animals and for promoting a healthy aging in animals wherein said composition comprises a compound of the present invention.

"Retarding aging processes in animals" in the context of the present invention means reducing the prevalence of age-related ailments at a given age, and thereby increasing the likelihood to live longer; delaying optical signs of the aging process, such as but not limited to hair graying, wrinkles, loss of hearing function, loss of muscle mass, loss of bone density and loss of proper cardiac function; reducing the risk of lifestyle diseases, which accelerate the aging process.

"Improving age-related physiological deficits in animals" in the context of the present invention means reducing the (average) risk of developing age-related ailments (at a given age).

"Promoting a healthy aging in animals" in the context of the present invention means increasing the healthy life expectancy, i.e., increasing the chance to stay healthy longer.

Figures 1A to ID show that compound 3 acts through ROS signaling;

Figures 2A to 2C show that compound 3 causes a drop of ATP and activates AMPK;

Figures 3A to 3D show that compound 3 impairs respiration in cells after injection;

Figures 4A to 4D show that compound 3 affects basal respiration in cells after pre-incubation overnight;

Figures 5A to 5C show that compound 3 affects basal respiration in C. elegans after pre-incubation overnight;

Figures 6A and 6B (female mice) and Figures 6C and 6D (male mice) show that the compounds of the present invention affect the respiration in young mice on chow diet;

Figures 7A to 7D show that compound 3 positively affect the glucose metabolism in young mice on high-fat diet;

Figures 8A to 8D show that compound 3 positively affect the glucose metabolism in aged mice on chow diet;

Figures 9A to 9B show that compound 3 increases the mitochondrial mass; Figure 10 shows that compound 3 increases motility in C. elegans;

Figure 11 shows that compound 3 acts as exercise mimetic / exercise enhancer in young mice on high-fat diet;

Figure 12 shows that compound 3 acts as exercise mimetic / exercise enhancer (by trend) in aged mice on chow diet.

Figure 13 shows the impact of the S configuration in position (3) on the activity.

Figures 14A and 14B show that compound 3 decreases the overall clinical frailty index in aged male mice.

Figures 15A and 15B show that compound 3 decreases the overall clinical frailty index in aged female mice.

Figures 16A (male mice) and 16B (female mice) show that compound 3 decreases the phenotype of frailty as calculated via Frailty Inferred Geriatric Health Timeline (FRIGHT) in aged mice.

Figure 17A shows that the "grimace" score is reduced upon compound

3 treatment (by trend) in aged mice (both sexes).

Figure 17B shows that respiration impairments (increased depth and frequency of breathing) are reduced upon compound 3 treatment in aged mice (both sexes).

Figures 18A, 18B, and 18C show that ocular frailty parameters are decreased upon compound 3 treatment in aged male mice.

Figures 19A, 19B, and 19C show that ocular frailty parameters are decreased upon compound 3 treatment in aged female mice.

Figures 20A, 20B, 20C, and 20D show that physical/musculoskeletal frailty parameters are decreased upon compound 3 treatment in aged male mice. Figures 21A, 21B, and 21C show that parameters of cardiovascular health are improved upon compound 3 treatment in aged female mice.

Figures 22A and 22B show that the number of white blood cells and in particular the number of lymphocytes is reduced upon compound 3 treatment which might indicate reduced inflammation in aged female mice.

Examples

Materials and Methods

General:

Unless otherwise noted, all reactions were carried out under an ambient atmosphere, and all reagents were purchased from commercial suppliers and used without further purification. Analytical thin layer chromatography (TLC) was performed on Merck silica gel 60 F254 TLC glass plates and visualized with 254 nm light and potassium permanganate or cerium ammonium molybdate solution followed by heat- ing. Purification of reaction products was carried out by flash chromatography using Sigma-Aldrich silica gel, 60A, 230-400 mesh under 0.3-0.5 bar pressure. Additional reagents were added for in- complete reactions indicated in the respective specific procedures. Tert-butyl(((4A,5A)-2,2-dimethyl-5-vinyl-1,3-dioxolan-4-yl)m eth- oxy)dimethylsilane ((4R,5R)-101) and tert-butyl(((4S,5S)-2,2-dime- thyl-5-vinyl-l,3-dioxolan-4-yl)methoxy)dimethylsilane ((4S,5S)- 101) were prepared in 5 steps from dimethyl-tartrate according to Brook et al (Org. Biomol. Chem. 2013, 11, 3187). (R)-1-((4R,5S)-

2,2-dimethyl-5-vinyl-1,3-dioxolan-4-yl)ethane-1,2-diol ((4A,5S)- 105) and (S)-1-((4S,5A)-2,2-dimethyl-5-vinyl-l,3-dioxolan-4- yl)ethane-1,2-diol ((4S,5A)-105) were prepared from ribose in 2 steps according to Moon et al. (Tetrahedron Asymmetry 2002, 13, 1189). (S)-1-(trimethylsilyl)pent-l-yn-3-ol ((S)-108) was prepared by enzymatic resolution of 1-(trimethylsilyl)pent-l-yn-3-ol ac- cording to Lian et al (Angew. Chem. Int. Ed. 2008, 47, 8255).

Synthesis

General Procedure A:

To a degassed solution of 101 (1.0 equiv) in CH2CH2 (0.15 M) were added freshly distilled 1-octene (3.0-15 equiv) and GRUBBS 2 ^nd Gen. catalyst (4.0-7.0 mol%). The reaction mixture was sparged with argon and the reaction mixture was stirred at 40 °C. After 40-140 h the reaction mixture was directly loaded on a column and purified by flash column chromatography using silica impregnated with silver nitrate (pentane/diethyl ether 20:1. Conditions derived from: J. Org. Chem. 2016, 81, 290 and silica impregnated with silver nitrate: J. Chromatogr. A 1995, 715, 372).

General Procedure B:

To a solution of 102 (1.0 equiv) in THE (0.15 M) at 0 °C TBAF (2.0 equiv) was slowly added. The reaction was allowed to reach room temperature and after complete consumption of the starting material the reaction was stopped by addition of sat. aq. NH4CI solution. The crude reaction mixture was extracted with ethyl acetate. The com- bined organic layers were dried over Na2SO4, filtered and concen- trated under reduced pressure. The crude mixture was purified by flash column chromatography (hexanes/ethyl acetate 4:1) (Conditions derived from: Org. Biomol. Chem. 2012, 10, 6186).

General Procedure C:

To a solution of 103 (1.0 equiv) in CH2CI2 (0.10 M) was added DESS-MARTIN periodinane (1.2 equiv) at room temperature. After com- plete consumption of the starting material the reaction was stopped by addition of sat. aq. Na2S20s solution and sat. aq. NaHCOs solution. The suspension was stirred vigorously for 10 minutes and extracted with diethyl ether. The combined organic layers were washed with water, dried over MgSO4, filtered and concentrated under reduced pressure (Conditions derived from: J. Org. Chem. 1983, 48, 22, 4155). Ohira-Bestmann reagent (3.0 equiv) and K2CO3 (4.1 equiv) were sus- pended in methanol at 0 °C. After 60 minutes the crude product dissolved in methanol was slowly added resulting in a 50 mM solution. After complete consumption of the starting material the reaction was stopped by addition of brine and the crude reaction mixture was extracted with pentane. The combined organic layers were dried over MgSO4, filtered and concentrated under reduced pressure. The crude mixture was purified by flash column chromatography (pentane/diethyl ether 25:1)(Conditions derived from Synth. Commun. 1989, 19, 561).

General Procedure D:

To a degassed solution of 105 (1.0 equiv) in CH2CH2 (0.10 M) were added freshly distilled 1-octene (5.0-7.0 equiv) and GRUBBS 2 ^nd Gen. catalyst (7.0-10 mol%). The reaction mixture was sparged with argon and the reaction mixture was stirred at 40 °C. After 22-160 h the reaction mixture was directly loaded on a column and purified by flash column chromatography (hexanes/ethyl acetate 1:1) (Conditions derived from: J. Org. Chem. 2016, 81, 290).

General Procedure E:

To a vigorously stirred suspension of silica gel (3.0 g/mmol) in CH2CI2 (50 mM) was slowly added NaTCA (0.65 M in water, 2.0 equiv). After 5 minutes a solution of 106 (1.0 equiv) in methanol was slowly added. After complete consumption of the starting material the re- action was filtered through a MgSO4 plug and concentrated under reduced pressure (Conditions derived from: Synthesis 1989, 1, 64). OHIRA-BESTMANN reagent (3.0 equiv.) and K2CO3 (4.1 equiv.) were suspended in methanol at 0 °C. After 60 minutes the crude product dissolved in methanol was slowly added resulting in a 50 mM solution. After complete consumption of the starting material the reaction was stopped by addition of brine and the crude reaction mixture was extracted with pentane. The combined organic layers were dried over MgSO4, filtered and concentrated under reduced pressure. The crude mixture was purified by flash column chromatography (hexanes/ethyl acetate 20:1) (Conditions derived from Synth. Commun. 1989, 19, 561).

General Procedure F:

To a solution of (S)-108 (1.0 equiv) in MeOH (0.20 M) K2CO3 (2.0 equiv) was added and the reaction was stirred at 40 °C. After com- plete consumption of the starting material the reaction was stopped by addition of sat. aq. NH4CI solution. The crude reaction mixture was extracted with diethyl ether. The combined organic layers were washed with water, dried over MgSO4, filtered and concentrated under reduced pressure.

The crude product was dissolved in CH2CI2 (0.40 M), imidazole (2.2 equiv) and TBS-C1 (1.1 equiv) were added at 0 °C. The reaction was allowed to reach room temperature and after complete consumption of the starting material the reaction was stopped by addition of water. The crude reaction mixture was extracted with CH2CI2. The combined organic layers were washed with water, dried over MgSO4, filtered and concentrated under reduced pressure. The crude product was dissolved in hexanes, filtered through a short silica plug and concentrated under reduced pressure.

The crude product was dissolved in acetone (0.44 M) under light exclusion. N-bromosuccinimide (1.5 equiv) and AgNOs (0.20 equiv) were added. After complete consumption of the starting material the reaction mixture was filtered through a short silica plug and con- centrated under reduced pressure. The crude mixture was purified by flash column chromatography (pentane/diethyl ether 150:1) (For all three steps above: Conditions derived from: Tetrahedron 2012, 68, 262).

General Procedure G:

To a solution of 104 or (1.0 equiv) in diethyl ether (70 mM) at room temperature was added a solution of copper(I) chloride (6.0- 7.0 mol%) in n-BuNH2 (30% in water, 25-35 equiv) resulting in a faint blue solution. After addition the reaction was cooled to 0 °C. A solution of (S)-109 (70 mM, 1.2-1.5 equiv) in diethyl ether was added and the reaction was allowed to reach room temperature. A few crystals of hydroxylamine hydrochloride were added to discharge the blue color (indication of other than copper(I) species). After 3-7 h the reaction was stopped, diluted with water and extracted with diethyl ether. The combined organic layers were dried over MgSO4, filtered and concentrated under reduced pressure. The crude mixture was purified by flash column chromatography (pentane/diethyl ether 40:1) (Conditions derived from: Tetrahedron Lett. 2013, 54, 5616).

General Procedure H:

To a solution of 110 (1.0 equiv) in THF/water (4:1, 20 mM) at room temperature was added TFA (30 equiv). The reaction was caped and stirred at 60 °C. After complete consumption of the starting material the reaction was stopped, diluted with sat. aq. NH4CI so- lution. The crude reaction was extracted with ethyl acetate, the combined organic layers were dried over Na2SO4, filtered and concen- trated under reduced pressure. The crude mixture was purified by flash column chromatography (hexanes/ethyl acetate 2:1) (Conditions derived from: J. Org. Chem. 1986, 51, 789).

General Procedure I:

To a solution of 110 (1.0 equiv) in methanol (10 mM) at room temperature was added HC1 (2.0 M in water, 50 equiv). After complete consumption of the starting material the reaction was stopped, di- luted with brine and water. The crude reaction was extracted with ethyl acetate, the combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure. The crude mixture was purified by flash column chromatography (hexanes/ethyl acetate 1:1). (Conditions derived from: J. Org. Chem. 2011, 76, 2029)

Synthesis of tert-butyl(((4S,5S)-2,2-dimethyl-5-((E)-oct-l-en-l- yl)-1,3-dioxolan-4-yl)methoxy)dimethylsilane (4S,5S)-102:

The corresponding compound was prepared from (4S,5S)-101 (0.93 g, 3.4 mmol, 1.0 equiv) following general procedure A using 1-octene (5.0 equiv) and GRUBBS 2 ^nd Gen. catalyst (3.0 mol%). After 22 h 1- octene (10 equiv) and GRUBBS 2 ^nd Gen. catalyst (2.0 mol%) and after 46 h GRUBBS 2 ^nd Gen. catalyst (2.0 mol%) were added. The reaction was stirred for 110 h resulting in title compound as a light-brown oil

(1.0 g, 84% yield)

Synthesis of ((4S,5S)-2,2-dimethyl-5-((E)-oct-l-en-l-yl)-1,3-diox- olan-4-yl)methanol (4S,5S)-103: The corresponding compound was prepared from (4S,5S)-102 (1.0 g, 2.9 mmol, 1.0 equiv) following general procedure B. The reaction was stirred for 60 min resulting in title compound as colorless oil (0.52 g, 76% yield).

Synthesis of (4S,5S)-4-ethynyl-2,2-dimethyl-5-((E)-oct-l-en-l-yl)- 1,3-dioxolane (4S,5S)-104:

The corresponding compound was prepared from (4S,5S)-103 (0.36 g, 1.5 mmol, 1.0 equiv) following general procedure C. The reactions were stirred for 40 min and 2.5 h respectively resulting in title compound as pale-yellow oil (0.34 g, 72% yield).

Synthesis of tert-butyl(((4R,5R)-2,2-dimethyl-5-((E)-oct-l-en-l- yl)-1,3-dioxolan-4-yl)methoxy)dimethylsilane (4R,5R)-102:

The corresponding compound was prepared from (4R,5R)-101 (8.2 g, 30 mmol, 1.0 equiv) following general procedure A using 1-octene (3.0 equiv) and GRUBBS 2 ^nd Gen. catalyst (4.0 mol%). The reaction was stirred for 40 h resulting in title compound as a light-brown oil

(7.9 g, 73% yield).

Synthesis of ((4R,52?)-2,2-dimethyl-5-((E)-oct-l-en-l-yl)-1,3-diox- olan-4-yl)methanol (4R,5R)-103:

The corresponding compound was prepared from (4R,5R)-102 (7.9 g, 22 mmol, 1.0 equiv) following general procedure B. The reaction was stirred for 90 min resulting in title compound as colorless oil (5.2 g, 96% yield). Synthesis of (4R,5R)-4-ethynyl-2,2-dimethyl-5-((E)-oct-1-en-1-yl)- 1,3-dioxolane (4R,5R)-104: The corresponding compound was prepared from (4R,5R)-103 (0.43 g, 1.8 mmol, 1.0 equiv) following general procedure C. The reactions were stirred for 30 min and 90 min respectively resulting in title compound as pale-yellow oil (0.32 g, 76% yield). Synthesis of (R)-1-((4R,5S)-2,2-dimethyl-5-((E)-oct-1-en-1-yl)- 1,3-dioxolan-4-yl)ethane-1,2-diol (4R,5S)-106: The corresponding compound was prepared from (4R,5S)-105 (57 mg, 0.30 mmol, 1.0 equiv) following general procedure D using 1-octene (5.0 equiv) and GRUBBS 2 ^nd Gen. catalyst (10 mol%). The reaction was stirred for 22 h resulting in title compound as a light-brown oil (76 mg, 93% yield). Synthesis of (4R,5S)-4-ethynyl-2,2-dimethyl-5-((E)-oct-1-en-1-yl)- 1,3-dioxolane (4R,5S)-107: The corresponding compound was prepared from (4R,5S)-106 (0.23 g, 0.84 mmol, 1.0 equiv) following general procedure E. The reac- tions were stirred for 2.5 h and 60 min respectively resulting in title compound as pale-yellow oil (90 mg, 46% yield). Synthesis of (S)-1-((4S,5R)-2,2-dimethyl-5-((E)-oct-1-en-1-yl)- 1,3-dioxolan-4-yl)ethane-1,2-diol (4S,5R)-106: A23418WO The corresponding compound was prepared from (4S,5.R)-1O5 (0.46 g, 2.4 mmol, 1.0 equiv) following general procedure D using 1-octene (5.0 equiv) and GRUBBS 2 ^nd Gen. catalyst (5.0 molt). After 62 h 1- octene (2.0 equiv) and GRUBBS 2 ^nd Gen. catalyst (2.0 mol%) were added. The reaction was stirred for 160 h resulting in title compound as a light-brown oil (0.28 g, 42% yield).

Synthesis of (4S,5R)-4-ethynyl-2,2-dimethyl-5-((E)-oct-l-en-l-yl)- 1,3-dioxolane (4S,5R)-107:

The corresponding compound was prepared from (4S,5A)-106 (0.23 g, 0.85 mmol, 1.0 equiv) following general procedure E. The reac- tions were stirred for 2.5 h and 60 min respectively resulting in title compound as pale-yellow oil (.0.10 g, 50% yield).

Synthesis of (S)-((l-bromopent-l-yn-3-yl)oxy)(tert-butyl)dime- thylsilane (S)-109:

The corresponding compound was prepared from (S)-108 (4.6 g, 30 mmol, 1.0 equiv) following general procedure F. The reactions were stirred for 20 min, 80 min and 90 min respectively resulting in title compound as pale-yellow oil (4.8 g, 59% yield).

Synthesis of tert-butyl(((S)-7-((4S,5S)-2,2-dimethyl-5-((E)-oct-l- en-l-yl)-1,3-dioxolan-4-yl)hepta-4,6-diyn-3-yl)oxy)dimethyls ilane ((S,4S,5S)-110):

The corresponding compound was prepared from (4S,5S)-104 (87 mg,

0.37 mmol, 1.0 equiv) and (S)-109 (0.11 g, 0.41 mmol, 1.1 equiv) following general procedure G. After 2 h additional copper(I) chlo- ride (2.0 mol%) in n-BuNH ₂ (30% in water, 10 equiv) and (S)-109 (0.20 equiv) were added. The reaction was stirred 3 h resulting in title compound as pale-yellow oil (0.10 g, 61% yield). Synthesis of (3S,8S,9S,E)-heptadeca-10-en-4,6-diyne-3,8,9-triol ((3S,8S,9S)-1): The corresponding compound was prepared from (S,4S,5S)-110 (37 mg, 90 Pmol, 1.0 equiv) following general procedure H. The reaction was stirred 26 h resulting in title compound as pale-yellow oil (24mg, 99% yield). Synthesis of tert-butyl(((S)-7-((4R,5R)-2,2-dimethyl-5-((E)-oct-1- en-1-yl)-1,3-dioxolan-4-yl)hepta-4,6-diyn-3-yl)oxy)dimethyls ilane ((S,4R,5R)-110): The corresponding compound was prepared from (4R,5R)-104 (1.2 g, 5.2 mmol, 1.0 equiv) and (S)-109 (1.6 g, 5.7 mmol, 1.1 equiv) fol- lowing general procedure G. After 75 min additional copper(I) chlo- ride (1.0 mol%) in n-BuNH ₂ (30% in water, 5.0 equiv) and (S)-109 (0.10 equiv) were added. The reaction was stirred 4.5 h resulting in title compound as pale-yellow oil (2.1 g, 91% yield). Synthesis of (3S,8R,9R,E)-heptadeca-10-en-4,6-diyne-3,8,9-triol ((3S,8R,9R)-3): A23418WO The corresponding compound was prepared from (S,4R,5R)-110 (1.1 g, 2.6 mmol, 1.0 equiv) following general procedure I. The reaction was stirred 23 h resulting in title compound as pale-yellow oil (0.67 g, 94% yield). Synthesis of tert-butyl(((S)-7-((4R,5S)-2,2-dimethyl-5-((E)-oct-1- en-1-yl)-1,3-dioxolan-4-yl)hepta-4,6-diyn-3-yl)oxy)dimethyls ilane ((S,4R,5S)-110): The corresponding compound was prepared from (4R,5S)-107 (30 mg, 0.18 mmol, 1.0 equiv) and (S)-109 (59 mg, 0.21 mmol, 1.2 equiv) following general procedure G. After 2 h additional copper(I) chlo- ride (2.0 mol%) in n-BuNH ₂ (30% in water, 10 equiv) and after 3 h (S)-109 (0.20 equiv) were added. The reaction was stirred 6 h re- sulting in title compound as pale-yellow oil (37 mg, 49% yield). Synthesis of (3S,8R,9S,E)-heptadeca-10-en-4,6-diyne-3,8,9-triol ((3S,8R,9S)-2): The corresponding compound was prepared from (S,4R,5S)-110 (30 mg, 70 Pmol, 1.0 equiv) following general procedure H. The reaction was stirred 17 h resulting in title compound as pale-yellow oil (12 mg, 60% yield). Synthesis of tert-butyl(((S)-7-((4S,5R)-2,2-dimethyl-5-((E)-oct-1- en-1-yl)-1,3-dioxolan-4-yl)hepta-4,6-diyn-3-yl)oxy)dimethyls ilane ((S,4S,5R)-110): A23418WO The corresponding compound was prepared from (4S,5R)-107 (40 mg, 0.17 mmol, 1.0 equiv) and (S)-109 (57 mg, 0.21 mmol, 1.2 equiv) following general procedure G. After 3 h additional copper(I) chlo- ride (2.0 mol%) in n-BuNH ₂ (30% in water, 10 equiv) and after 4 h (S)-109 (0.30 equiv) were added. The reaction was stirred 7 h re- sulting in title compound as pale-yellow oil (44 mg, 60% yield). Synthesis of (3S,8S,9R,E)-heptadeca-10-en-4,6-diyne-3,8,9-triol ((3S,8S,9R)-4): The corresponding compound was prepared from (S,4S,5R)-110 (13 mg, 30 Pmol, 1.0 equiv) following general procedure H. The reaction was stirred 40 h resulting in title compound as pale-yellow oil (5.8 mg, 67% yield). Synthesis of (S)-7-((4R,5R)-2,2-dimethyl-5-((E)-oct-1-en-1-yl)- 1,3-dioxolan-4-yl)hepta-4,6-diyn-3-ol ((S,4R,5R)-7): To a solution of (S,4R,5R)-110 (96 mg, 0.22 mmol, 1.0 equiv) in THF (0.10 M) at 0 °C TBAF (1.0 M in THF, 0.44 ml, 0.44 mmol, 2.0 equiv) was slowly added. After complete consumption of the starting mate- rial (40 h) the reaction was stopped by addition of sat. aq. NH ₄ Cl solution. The crude reaction mixture was extracted with diethyl A23418WO ether. The combined organic layers were dried over Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude mixture was pu- rified by flash column chromatography (hexanes/ethyl acetate 2:1)re- sulting in title compound as pale-yellow oil (61 mg, 87% yield) (Conditions derived from: Org. Biomol. Chem. 2012, 10, 6186). Synthesis of 7-((4R,5R)-2,2-dimethyl-5-((E)-oct-1-en-1-yl)-1,3-di- oxolan-4-yl)hepta-4,6-diyn-3-one ((4R,5R)-111): To a solution of (S,4R,5R)-7 (34 mg, 0.11 mmol, 1.0 equiv) in CH ₂ Cl ₂ (40 mM) was added DESS–MARTIN periodinane (55 mg, 0.13 mmol, 1.2 equiv) at room temperature. After complete consumption of the starting material (30 min) the reaction was stopped by addition of sat. aq. Na ₂ S ₂ O ₃ solution and sat. aq. NaHCO ₃ solution. The suspension was stirred vigorously for 15 min and extracted with diethyl ether. The combined organic layers were washed with water, dried over MgSO ₄ , filtered and concentrated under reduced pressure resulting in title compound as pale-yellow oil (30 mg, 88% yield) (Conditions derived from: J. Org. Chem. 1983, 48, 22, 4155). Synthesis of (8R,9R,E)-8,9-dihydroxyheptadeca-10-en-4,6-diyn-3-one ((4R,5R)-6):

To a solution of (4R,5R)-111 (5.6 mg, 18 Pmol, 1.0 equiv) in methanol (20 mM) at room temperature was added HCl (2.0 M in water, 0.44 ml, 0.89 mmol, 50 equiv). After complete consumption of the starting material (18 h) the reaction was stopped and quenched with aq. NaHCO ₃ solution. The crude reaction was extracted with diethyl ether, the combined organic layers were dried over MgSO ₄ , filtered and concentrated under reduced pressure. The crude mixture was pu- rified by flash column chromatography (hexanes/ethyl acetate 1:1)re- sulting in title compound as pale-yellow oil (4.2 mg, 86% yield) (Conditions derived from: J. Org. Chem. 2011, 76, 2029). Synthesis of ((4R,5R)-2,2-dimethyl-5-octyl-1,3-dioxolan-4-yl)meth- anol ((4R,5R)-112): To a solution of (4R,5R)-103 (31 mg, 0.13 mmol, 1.0 equiv) in hexane (13 mM) at room temperature was added palladium on carbon (10% wt., 14 mg, 13 Pmol, 10 mol%) and the reaction was stirred under an atmosphere of hydrogen. After complete consumption of the A23418WO starting material (80 min) the reaction was stopped. The crude re- action was diluted with dichloromethane, filtered over celite and concentrated under reduced pressure resulting in title compound as pale-yellow oil (25 mg, 79% yield) (Conditions derived from: Carbo- hydr. Res. 2010 345, 1663). Synthesis of (4R,5R)-4-ethynyl-2,2-dimethyl-5-octyl-1,3-dioxolane ((4R,5R)-113): The corresponding compound was prepared from (4R,5R)-112 (25 mg, 0.10 mmol, 1.0 equiv) following general procedure C using DESS–MARTIN periodinane (1.5 equiv), OHIRA–BESTMANN reagent (2.0 equiv) and K ₂ CO ₃ (2.7 equiv). The reactions were stirred for 85 min and 60 min re- spectively resulting in title compound as pale-yellow oil (17 mg, 71% yield). Synthesis of tert-butyl(((S)-7-((4R,5R)-2,2-dimethyl-5-octyl-1,3- dioxolan-4-yl)hepta-4,6-diyn-3-yl)oxy)dimethylsilane ((S,4R,5R)- 114): A23418WO

The corresponding compound was prepared from (4R,5R)-113 (13 mg, 53 Pmol, 1.0 equiv) and (S)-109 (22 mg, 79 Pmol, 1.5 equiv) following general procedure G. After 45 min additional (S)-109 (0.30 equiv) was added. The reaction was stirred 60 min resulting in title com- pound as pale-yellow oil (21 mg, 93% yield). Synthesis of (3S,8R,9R)-heptadeca-4,6-diyne-3,8,9-triol ((3S,4R,5R)-9): The corresponding compound was prepared from (S,4R,5R)-114 (21 mg, 49 Pmol, 1.0 equiv) following general procedure I. The reaction was stirred 22 h resulting in title compound as pale-yellow oil (12 mg, 84% yield). Synthesis of (1S,2R,7S)-1-(3-hexyloxiran-2-yl)nona-3,5-diyne- 1,2,7-triol ((1S,2R,7S)-10): A23418WO

To a solution of (3S,8R,9R)-3 (21 mg, 74 (irnol, 1.0 equiv) in dichloromethane (50 mM) at 0 °C was added m-CPBA (50 mg, 0.22 mmol, 3.0 equiv). At 90 min the reaction was allowed to reach room tem- perature. After complete consumption of the starting material (3 h) the reaction was stopped by addition of sat. aq. Na2S20s solution and sat. aq. NaHCOs solution. The suspension was stirred vigorously for 15 min and extracted with diethyl ether. The combined organic layers were washed with water, dried over Na2SO4, filtered and concentrated under reduced pressure. The crude mixture was purified by flash column chromatography (hexanes/ethyl acetate 1:1 resulting in title compound as pale-yellow oil (17 mg, 78% yield, dr 2:1) (Conditions derived from: J. Am. Chem. Soc. 1990, 112, 9439). Synthesis of (3S,BR,9S)-heptadeca-4,6-diyne-3,8,9,10,11-pentaol

((3S,8R,9S)-11):

To a solution of (IS,2R,JR)-10 3.1 mg, 10 (irnol, 1.0 equiv, dr

2:1) in dioxane (10 mM) at 0 °C was added H2SO4 (2.5 M in water, 0.21 ml, 0.53 mmol, 50 equiv). The reaction was stirred at 60 °C, after 21 h additional H2SO4 (2.5 M in water, 0.21 ml, 0.53 mmol, 50 equiv) was added and the temperature increased to 80 °C. After complete consumption of the starting material (92 h) the reaction was diluted with water and extracted with ethyl acetate. The combined organic layers were dried over Na2SO4, filtered and concentrated under re- duced pressure. The crude mixture was purified by prep TLC (hex- anes/ethyl acetate l:8r esulting in two separatable anti-diol dia- stereoisomers (3S,8R,9S)-11 major as yellow oil (1.6 mg, 48% yield) and (3S,8R,9S)-11 minor as yellow oil (0.8 mg, 24% yield) (Condi- tions derived from: Org. Lett. 2013, 15, 4350).

Synthesis of (3S,BR,9S)-heptadeca-4,6-diyne-3,8,9,10,11-pentaol

((3S,8R,9S)-12):

To a solution of (3S,8R,9R)-3 (8.6 mg, 25 (irnol, 1.0 equiv) in tert-butanol/water (2.4:1, 0.50 M) at 0 °C was added osmium tetrox- ide (2.5% wt. in tert-butanol, 32 |il, 2.5 (irnol, 10 mol%) and 4- methylmorpholine 7V-oxide (4.6 mg, 38 (irnol, 1.5 equiv). After 2 h at room temperature additional osmium tetroxide (2.5% wt. in tert- butanol, 32 |il, 2.5 (irnol, 10 mol%) and 4-methylmorpholine N-oxide

(2.3 mg, 19 (irnol, 0.75 equiv) were added. Following complete consumption of the starting material (3 h) the reaction was stopped by addition of 40% wt. aq. NaHSO4 solution. The suspension was stirred vigorously for 30 min and extracted with diethyl ether. The combined organic layers were washed with water, dried over Na2SO4, filtered and concentrated under reduced pressure. The crude mixture was purified by flash column chromatography (hexanes/ethyl acetate 1:8). Resulting in title compound as grey wax (5.6 mg, 71% yield, dr 8:1) (Conditions derived from: J. Org. Chem. 1996, 61, 4944).

Extraction of (3S,8R,9R,E)-heptadeca-10-en-4,6-diyne- 3,8,9-triol ((3S,8R,9R)-3)

Commercial orange table carrots were purchased at a local grocer ("Coop Supermarkt Zurich Eleven", "Karotten PG", Lot: 7297251197). According to the supplier the carrots were grown by "Fehr Gebruder A & P, 8478 Thalheim an der Thur, CH". The prewashed carrots were separated in different batches at ran- dom. Some of the carrots were dissected resulting in core (~17% w/w), flesh (~57% w/w) and peel (~26% w/w) fractions. All batches were cut into thin slices (~2 mm) employing a food processor, extracted overnight with either ethyl acetate or ethanol (2 ml/g carrots). The solid mater was removed by fil- tration and the resulting extract was dried over Na2SO4, fil- tered and concentrated in vacuo. Resulting in extracted frac- tions as seen below. For the quantification of 3 in the crude extracts a Liquid chromatography-mass spectrometry method (LC-MS) was developed. Towards this end, penta-deuterated (3S,8R,9R,E)-heptadeca-10- en-4,6-diyne-l,1,1,2,2-cb-3,8,9-triol (3-cfe) was synthesized from commercial bromoethane-cfe according to the previously de- scribed method to be used as internal standard and for peak identification in complex matrices. For each sample a solution (water-acetonitrile 98:2) containing 5.0 mg/ml extract and 1.25*10~ ² mg/ml 3-cfe as internal standard was prepared. Quan- tification was conducted via standard addition method. In short, to 200 pl of the aforementioned solution external stand- ard 3 was added and the samples were filled up to 250 pl solution. Resulting in 4-6 samples each with final concentra- tions of 4.0 mg/ml extract and 1.0*10~ ² mg/ml 3-cfe internal standard and ranging from 1.0*10~ ⁴ to 5.0*10~ ³ mg/ml of 3 for standard addition (appropriately chosen to the observed abun- dance of 3). All dilutions were verified gravimetrically and corrected accordingly for data analysis. Samples (4 ml in- jected) were separated on an Agilent LC system (1290 series, Bruker Compass Hystar 5.0 service pack 1) using an Agilent Eclipse Plus C18, 3.0x1500, 3.5pm column at room temperature connected to a Bruker maXisII - ESI-Qq-TOF-MS. The LC mobile phase (0.6 ml/min flow) consisted of water-acetonitrile (98:2), after two minutes changed with a linear gradient up to (50:50) over 14 minutes and as modifier 0.1% formic acid was employed. Chromatograms were processed and analyzed using Bruker Compass DataAnalysis 5.3. The measured area counts were corelated by linear regression using GraphPad Prism 9.3.0.

Experiment: Compound 3 acts through ROS signaling

ROS quantification by DCF-DA

The agent DCF-DA (Sigma Aldrich; #D6883) was used to measure ROS in cells. 25,000 HepG2 cells were seeded per well of a black clear bottom 96- well plate (Greiner Bio-One, #655090). After overnight incubation, the cells were washed once with phenol-free and FBS- free DMEM media to avoid interference of auto fluorescence of these substances. DCFDA in phenol-free and FBS-free DMEM was added to each sample with a final concentration of 25 pM and incubated for 45 min at 37°C, 5% CO2. The cells were washed once with media and then treated with 10 pM compound 3, solvent control, or 1 pM rotenone (Sigma Aldrich; #R8875) as positive control for 15 min (37°C, 5% CO2). Fluorescence was measured at Ex/Em: 485/535 nm with a CLARIOstar microplate reader (BMG LABTECH). Raw data were normalized to cell-free wells and/or DCF-DA-free cells to ensure specificity of the signal. As shown in Figure 1A compound 3 clearly increases the ROS content in the cells.

ROS quantification by Arnplex Red

The Arnplex Red Assay was performed as previously described Ravichandran, M., et al., Impairing L-threonine catabolism promotes healthspan through methylglyoxal-mediated proteohormesis. Cell Metab, 2018. 27(4): p. 914-925 e5. In short, synchronized worms were washed from 3 plates with S-buffer, pH 6 and incubated in an Eppendorf tube in lOOpl of 50mM sodium-phosphate buffer, pH 7.4 with lOOpM Arnplex Red (Invitrogen, Carlsbad, USA) and 0.2U/ml of horseradish peroxidase. Following incubation in the dark for 3 hours with occasional mixing, fluorescence intensity was measured in the supernatant (FLUOstar Omega, BMG Labtech, Offenburg, Germany; excitation: 544-10 nm, emission: 590-10 nm). The worms were washed with S-buffer, sonicated on ice and centrifuged at 12000g for 15 minutes at 4°C. The protein continent was determined for normalization using BCA assay (Pierce BCA protein assay, ThermoFisher Scientific) according to standard protocols using appropriate standards. Three biological replicates of the assay were measured. A higher concentration of compound 3 results in a higher concentration of ROS (Figure IB)

Paraquat stress assay

Synchronized L4 stage worms were treated with 1 nM compound until day 3 of adulthood. After that, the nematodes were transferred to fresh plates that contained additionally 10 mM paraquat (Sigma Aldrich; # 856177-1G) besides the compound of interest. Since paraquat is highly toxic, dead worms were counted in 10-14 h steps until all of them died. The raw data were visualized in a survival curve. Analysis and statistics were done with JMP. Worms treated with compound 3 have a higher survival rate than untreated worms (Figure 1C).

Life span assay with Ctll Oex

Life span assays with C. elegans were performed as previously described, by omitting FUdR [Rozanov, L., et al., Redox-mediated regulation of aging and healthspan by an evolutionarily conserved transcription factor HLH-2/Tcf3/E2A. Redox Biol, 2020. 32: p. 101448]. Briefly, adult nematodes were allowed to lay eggs for four to nine hours and the resulting eggs incubated for 64 h at 20 °C on NGM agar plates inoculated with OP50 to obtain a synchronized population of young adult nematodes. For a typical lifespan assay, 100 young adult nematodes per condition were manually transferred to NGM agar plates (30-35 nematodes per 55 mm petri dish) that were inoculated with the respective bacteria as indicated. For the first 10-12 days, nematodes were transferred daily and afterwards every 2-3 days. Nematodes showing no reaction to gentle stimulation were scored as dead. Nematodes that crawled off the plates, displayed internal hatching, or a protruding vulva were censored.

As shown in Figure 1 D, overexpression of catalase 1 prevents life span extention of nematodes treated with compound 3, thereby suggesting a crucial role of reactive oxygen species in compound 3- dependent longevity.

Experiment: Compound 3 is localized in mitochondria

Cell staining by using click chemistry

HepG2 cells were seeded onto sterile coverslips in 6 well plates with a density of 24,000 cells per well and incubated for 1-2 days. The cells were then treated with 10 pM of compound 8 overnight. Before staining, the cells were washed twice with PBS. Afterwards, a final concentration of 250 nM MitoTracker deep red (Thermo Fisher Scientific; #M22426) diluted in media was added and plates incubated 30 min at 37°C/5% CO2. The cells were washed twice with PBS and fixed by addition of 4% PFA for 15 min at 37°C. After another two washing steps, the cells were permeabilized with 0.2% Triton X in PBS for 5 min at RT. After three washing steps, 24 pM of Azide-488 (Click Chemistry Tools #1275-1) in click chemistry buffer was added and incubated 30 min at 37°C to allow labelling with the fluorophore and later detection of the compound of interest. The cells were washed 3 times with PBS. Finally, the coverslips were carefully removed with a tweezer and positioned upside down in a drop of DAPI- containing mounting media (Thermo Fisher Scientific; #36966/2 ml) on top of a glass dish. The samples were allowed to dry overnight in the dark. Microscopy pictures were taken with an Olympus FluoView 3000 confocal microscope and analyzed with the software Fiji. Experiment: Compound 3 might interact with the mitochondrial ATP synthase

Biotin Pulldown - HEK293

80% confluent HEK293 cells were harvesting by scraping and pelleted by centrifugation (500 x g for 5 min at 4°C). The cell pellet was dissolved in 250 pl lysis buffer (20 mM HEPES pH 7.3, 50 mM KC1, 5 mM MgC12, 0.01 % NP40, 2 mM NaF, 2 mM Na3VO4) and incubated for 15 min on ice. Samples were disrupted by sonication (3x for 2 s; 50% amplitude). Samples were left on ice for 15 min and afterwards centrifuged at 13,000 x g for 5 min at 4°C. The protein supernatant was collected and quantified by BCA (Pierce BCA protein assay, ThermoFisher Scientific). 2 pl of a 2 mM stock of Biotin-linker negative control having the following formula was added to 80 pl Dynabeads™ M-280 Streptavidin (ThermoFisher, #11205D) in lysis buffer and incubated in an end-over-end rotator for 30 min at RT. The lysis buffer was removed from the beads and 500 pg of protein per condition was added to the beads and incubated for 4 h at 4°C on an end-over-end rotator. Meanwhile, new beads were prepared by including both, biotin-linker negative control and biotin-tagged Compound 3 (2 pl of a 2 mM stock concentration per condition) having the following formula When 4 h have passed, the samples were put on the magnetic holder and the supernatant collected in a new tube. The freshly prepared bead-compound mix was mixed with the protein supernatant and incubated another 4 h at 4°C on an end-over-end rotator. After this incubation time, the beads were washed 5 times with lysis buffer without protease inhibitor and without detergent. Dry beads were frozen in liquid nitrogen until further processed.

Biotin Pulldown - HepG2

3.5 million HepG2 cells per 10 cm culture dish were seeded and incubated until reaching 80% confluency. Cells were then treated with 10 pM biotin-tagged Compound 3 compound or solvent control (Biotin-linker) for 20 min. Cells were harvested by scraping and pelleted by centrifugation (500 x g for 5 min at 4°C). The supernatant was removed and the cell pellet flash-frozen in liquid nitrogen and stored at -80°C until further needed. Prior to the pull-down assay, the cell pellet was thawed on ice and dissolved in lysis buffer (20 mM HEPES pH 7.3, 50 mM KC1, 5 mM MgC12, 0.01 % NP40, 2 mM NaF, 2 mM Na3VO4) in a ratio of 4:1 (vol:wt). Afterwards, the samples were disrupted by one freeze and thaw cycle. To degrade nucleic acids, the samples incubated with 0.1 % Benzonase (250 U/ul) (Sigma Aldrich #E1014-5KU) for 30 min on an end-over-end rotator at 4°C. After this incubation time, the tubes were centrifuged for 20 min at 16,100 x g at 4°C and the protein quantified by BCA (Pierce BCA protein assay, ThermoFisher Scientific). After determination of the protein concentration, 500 pg of protein per condition was taken and mixed with 40 pl of the Streptavidin beads in lysis buffer by gentle snipping. The samples were incubated on an end-over-end rotator for 4 h at 4°C to allow binding to the beads. Beads were washed 5 times with lysis buffer without protease inhibitor and detergent. Dry beads were frozen in liquid nitrogen until further processed.

On bead Trypsin digest and preparation for MS analysis As previously described [Grigolon, G., et al., A druggable transcriptional regulator to promote longevity in humans (PDF attached). 2021.], proteins on beads were eluted and digested by adding 20 pl 50 mM Tris-HCl buffer (pH 8.0) supplemented with 2M urea, 5 mM DTT and 100 ng Sequencing Grade Trypsin (Promega, #V5111) and incubated for 15 min. Digested protein were reduced by adding more DTT to a final concentration of lOmM, and alkylated with 3mM iodoacetamide. The digestion was continued at 32 °C for 6 hours or overnight. pH was checked to ensure that they were within the pH range of 7-9 as it is critical for the optimal trypsinization. All incubation steps were carried out on thermoshaker with gentle shaking at 400 rpm.

The trypsinization was stopped by adding 5% trifluoroacetic acid in several steps until it reached 0.5% TEA, the pH was monitored to ensure it was around. Tryptic peptides were centrifuged at max speed before desalting with self-packed C18 Stage-Tips [ Rappsilber, J., M. Mann, and Y. Ishihama, Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat Protoc, 2007. 2(8): p. 1896-906]. Desalted tryptic peptides were vacuum dried and resolubilized in 20 pl 3% acetonitrile, 0.1% formic acid, with the help of 10 min on thermoshaker and sonication each. Four microliters of digested peptides were injected for shotgun liquid chromatography with tandem mass spectrometry (LC-MS/MS) as described below.

Liquid chromatography-tandem mass spectrometry (MS) analysis

All MS experiments were done at the Functional Genomics Center Zurich (FGCZ). As previously described [Grigolon, G., et al., A druggable transcriptional regulator to promote longevity in humans (PDF attached). 2021.], peptide mixtures were separated by reversed phase chromatography using Acquity UPLC M-Class system (Waters Inc.) on HSS C18 T3 Col 100 A column (1.8 pm, 75 pm x 250 mm, Waters Inc.). Peptides were separated on a multistep acetonitrile gradient (5-35% in 135 min, 40% in 5 min, and 80% in 1 min) with 0.1% formic acid at a nanoflow rate of 300 nl/min. Eluting peptides were directly ionized by electrospray ionization Orbitrap Fusion Lumos mass spectrometer (Thermo Fisher Scientific) equipped with a Digital PicoView nanospray source (New Objective) in a data-dependent mode.

All raw data were further analysed with MaxQuant software suite version 1.6.3.3 (Max Planck Institute of Biochemistry, Munich) supported by the Andromeda search engine [Cox, J., et al., Andromeda: a peptide search engine integrated into the MaxQuant environment. J Proteome Res, 2011. 10(4): p. 1794-805]. Data were searched against a UniProt Human proteime database encompassing 75,004 protein entries, downloaded from UniProt (Proteome ID: UP000005640, https://www.uniprot.org/proteomes/UP000005640).

Peptides were searched with carbamidomethylation as a fixed modification and protein N-terminal acetylation and methionine oxidation as variable modifications. A maximum of two or four missed cleavages were allowed while requiring strict trypsin specificity, and only peptides with a minimum sequence length of six were considered for further data analysis. Data were search with concatenated target/decoy (forward and reversed) version of the libraries. Only proteins identified with at least 2 peptides were included for quantification. Proteins with b 1.5-fold intensity over negative control were considered as the interaction partner.

Experiment: Compound 3 affects ATP metabolism

ATP Assay

Cells: HepG2 cells were seeded into a white clear bottom 96- well plates (Greiner Bio-One, #655098) with 30,000-40,000 cells per well in 100 pl DMEM medium. After 24 h, treatment of 15 min, 30 min, or 24 h was performed in at least triplicates by the addition of the 5 pg/ml (initial screening) or 10 pM (validation experiments) of compound, or 10 pM of positive controls including oligomycin (Apollo; #APOBIO1002), piceatannol (Sigma Aldrich; #P0453), and bz- 423 (Sigma Aldrich; #SML1944). The CellTiter-Glo® Luminescent Cell Viability Assay (Promega; #G7571) was conducted according to manufacturers' instruction. In addition, an ATP standard row was processed in parallel, and the sample protein quantified via BCA assay (Pierce BCA protein assay, ThermoFisher Scientific). The chemiluminescence of ATP standard plates and cell plates was measured with a CLARIOstar microplate reader (BMG LABTECH). The calculation of ATP/protein values was done by using Microsoft Excel and was visualized as relative terms normalized to DMSO and protein.

C. elegans: 200-500 pl of 4M G-HC1 (99°C) were added to previously prepared worm powder and boiled at 99°C, 1400 rpm for 15 min in a thermo mixer. Afterwards, samples were centrifuged at 4 °C, 13,200 rpm for 30 min. Meanwhile, ATP standards were prepared and pipetted as a 4-fold determination into a white clear bottom 96- well plates (Greiner Bio-One, #655098) with a volume of 100 pl each. After centrifugation of the samples, the supernatant was transferred to a fresh Eppendorf tube and kept on ice until further needed. In addition, samples were diluted 1:100 with MilliQ water and subsequently added to the 96 well plate with 100 pl and as 4-fold determination. 50 pl of CellTiter-Glo® Luminescent Cell Viability Assay (Promega; #G7571) reagent was added to each well and incubated on a shaker for 40 min in the dark. Meanwhile, undiluted samples were used for protein determination via BCA assay (Pierce BCA protein assay, ThermoFisher Scientific). Chemiluminescence of the ATP standard and sample plate was measured in a CLARIOstar microplate reader (BMG LABTECH). The analysis was performed by using Microsoft Excel. The concentration of ATP per well and protein was calculated by using the ATP and protein standard curve, normalized to DMSO, and visualized.

As shown in Figures 2A and 2B compound 3 causes an initial drop of ATP.

Life span assay with aak-2

Life span assays with C. elegans were performed as previously described, by omitting FUdR [Rozanov, L., et al., Redox-mediated regulation of aging and healthspan by an evolutionarily conserved transcription factor HLH-2/Tcf3/E2A. Redox Biol, 2020. 32: p. 101448]. Briefly, adult nematodes were allowed to lay eggs for four to nine hours and the resulting eggs incubated for 64 h at 20 °C on NGM agar plates inoculated with OP50 to obtain a synchronized population of young adult nematodes. For a typical lifespan assay, 100 young adult nematodes per condition were manually transferred to NGM agar plates (30-35 nematodes per 55 mm petri dish) that were inoculated with the respective bacteria as indicated. For the first 10-12 days, nematodes were transferred daily and afterwards every 2-3 days. Nematodes showing no reaction to gentle stimulation were scored as dead. Nematodes that crawled off the plates, displayed internal hatching, or a protruding vulva were censored.

The strain RB754 aak-2 (ok524) was obtained from Caenorhabditis Genetics Center (University of Minnesota, USA).

As shown in figure 2C, aak-2/AMPK functionality is essential for compound 3-mediated life span extension in C. elegans

Immunoblotting

Cells were harvested by scraping and lysed in standard protein isolation buffer. Afterwards, the samples were sonicated once with a 50% amplitude for 10 s and centrifuged at 14,000 x g at 4°C. The protein supernatant was collected and the protein concentration determined by BCA assay (Pierce BCA protein assay, ThermoFisher Scientific).

The protein purification of C. elegans samples as well as immunoblotting was performed as previously described with minor adaptations [Ravichandran, M., et al., Impairing L-threonine catabolism promotes healthspan through methylglyoxal-mediated proteohormesis. Cell Metab, 2018. 27(4): p. 914-925 e5]. Frozen worm pellets were ground in a liquid nitrogen chilled mortar along with phosphate buffer containing protease and phosphatase inhibitors (Roche, Penzberg, Germany) with addition of 2mM sodium fluoride, 2mM sodium ortho-vanadate, ImM PMSF and 2mM EDTA. The extracts were centrifuged at 12000g for 7 minutes at 4°C. The supernatant was used to determine the protein concentration.

Both cell and C. elegans samples were boiled in Laemmli buffer and used for SDS-PAGE. Antibodies against phospho-AMPKa (Thrl72) (40H9) (Cell signaling; #2535) were used in a dilution of 1:1000, AMPKa (Cell signaling; #2532) in a dilution of 1:1000 and actin (20-33) (Sigma Aldrich; #A5060) was used in a dilution of 1:3000. The HRP linked secondary antibody against rabbit (Cell Signaling, #7074S) was used at recommended dilutions. The signal was visualized using ECL substrate (Clarity Western ECL Substrate, Biorad).

As shown in Figures 2D compound 3 activates AMPK.

Experiment: Compound 3 affects respiration in cells

Respirometry by Seahorse assay

100 pl HepG2 cells were seeded with a density of 30,000 cells per 96 well into a Seahorse XF 96 cell culture plate (Agilent; #102416- 100). After an overnight incubation, cells were pre-treated with 10 pM of the compound of interest, solvent control, positive control (10 pM piceatannol, 10 pM bz-423, 5 pM oligomycin) or untreated culture media. At least 4 h before starting the measurement, a Seahorse XF96 cartridge plate (Agilent; #102416-100) was calibrated with 200 pl calibration buffer per well and was incubated in a CO2 free incubator at 37°C. Meanwhile, 50 ml Seahorse medium was prepared and the pH adjusted to 7.40-7.45 at 37°C. In a next step, the cell culture growth media was removed and cells were washed twice with 150 pl Seahorse medium. For pre-treatment samples, 150 pl Seahorse medium with the compound of interest or solvent control was added in the last step. In case of injection samples, 150 pl Seahorse medium only was added in the last step. The cartridge plate was loaded with 25 pl per injection well. Port A was loaded with compound (for injection samples) or with Seahorse medium (for pre- treated cells), port B with oligomycin (Apollo; APOBIO1002), port C with FCCP (Cayman; CAY15218), and port D with antimycin (Sigma Aldrich; A8674-25MG) and rotenone (Sigma Aldrich; #R8875). The cartridge plate was inserted into the Agilent Seahorse XF96 Analyzer for calibration at 37°C. After calibration, the cell plate was inserted and the measurement started. After the run, the media was removed and the cell plate incubated with 10 pl NaOH for 1 h at RT for cell lysis and later protein quantification via BCA (Pierce BCA protein assay, ThermoFisher Scientific). Raw data were then normalized to pg of protein.

Figures 3A to 3D show that compound 3 causes a drop of respiration in cells. Figures 4A to 4D show that compound 3 affects basal respiration in cells.

Experiment: Compound 3 affects basal respiration in C. elegans

The protocol for Seahorse measurements with C. elegans was based and adapted from previous publication [Koopman, M., et al., A screening-based platform for the assessment of cellular respiration in Caenorhabditis elegans. Nat Protoc, 2016. 11(10): p. 1798-816.]. Synchronized and treated nematodes were washed and diluted in a final volume of 650 pl/well M9 buffer + 25 pM tetramisole hydrochloride (Sigma Aldrich; #L9756) and distributed equally to the Seahorse XF24 culture plate (Agilent; #102340-100), receiving approx. 40 worms per well. The nematodes were allowed to equilibrate for 10 min. Meanwhile, the cartridge plate was prepared with 130 pl per injection well using 0.05 pM-10 pM FCCP (Cayman; CAY15218) and 4 mM NaN3 and calibrated at 20°C. The measurement was performed with an Agilent Seahorse XF24 Analyzer. Raw data were normalized to the number of nematodes per well.

Figures 5A to 5C show that compound 3 affects basal respiration in C. elegans.

Experiment: Compound 3 affects respiration in mice

PhenoMaster (TSE Systems, Bad Homburg, Germany) open-circuit calorimetry system was used to measure oxygen consumption and carbon dioxide production over several days following a 24-h acclimation period. Analysis was done via CalR, a web-based analysis tool for calorimetry experiments [Mina, A.I., et al., CalR: A Web-Based Analysis Tool for Indirect Calorimetry Experiments. Cell Metab, 2018. 28(4): p. 656-666 el].

Figures 6A and 6B (female mice) and Figures 6C and 6D (male mice) show that the compounds of the present invention affect the respiration in mice.

Interpretation of the results in the tables below

Experiment: Compound 3 affects glucose metabolism in mice

Experiments were performed as described previously [Merry, T.L., et al., Impairment of insulin signalling in peripheral tissue fails to extend murine lifespan. Aging Cell, 2017. 16(4): p. 761-772.] with some adaptations. In short, fed and fasted blood was collected via submandibular bleeding, and blood glucose was determined using a hand-held glucose meter (Bayer Contour XT Meter). Glucose (GTT) tolerance tests were performed in 4-h-fasted mice, by intraperitoneally injecting a bolus of d-glucose (1-2 mg g-1), and tail blood glucose was measured at 0, 15, 30, 60, and 120 minutes post-injection.

As shown in Figure 7 compound 3 positively affects the glucose metabolism in young mice on high-fat diet.

As shown in Figures 8 compound 3 positively affects the glucose metabolism in aged mice on chow diet.

Experiment: Compound 3 increases mitochondrial mass

Real-time PCR

Total DNA for mtDNA quantification was extracted from cells or grinded nematodes by standard proteinase K and phenol-chloroform extraction. mtDNA/nDNA levels were quantified from at least three biological and technical triplicates using SYBR Green select master mix (Applied Biosystems) fluorescence on a 96-well format in CFX96 real time system (Biorad). After an initial denaturation step (95°C for 2 min), amplification was performed using 40 cycles of denaturation (95°C for 15 s) and annealing (58°C for 1 min). mtDNA/nDNA ratios were calculated by 2x2 dCT method [Venegas, V. and M.C. Halberg, Measurement of mitochondrial DNA copy number. Methods Mol Biol, 2012. 837: p. 327-35.]. qPCR primer sequences used:

C. elegans nDNA (act-3) SEQ ID NO. 1: TGC GAG ATT GAT for ATC CGT AAG G

C. elegans nDNA (act-3) SEQ ID NO. 2: GGT GGT TCT CCG rev GAA AGA A

C. elegans mtDNA (nd-1) SEQ ID NO. 3: AGO GTC ATT TAT for TGG GAA GAA GAG

C. elegans mtDNA (nd-1) SEQ ID NO. 4: AAG CTT GTG CTA rev ATC CCA TAA ATG T

Human nDNA (b2M) for SEQ ID NO. 5:

TGCTGTCTCCATGTTTGATGTATCT

Human nDNA (b2M) rev SEQ ID NO. 6:

TCTCTGCTCCCCACCTCTAAGT

Human mtDNA (16S rRNA) SEQ ID NO. 7: for

GCCTTCCCCCGTAAATGATA

Human mtDNA (16S rRNA) SEQ ID NO. 8: rev

TTATGCGATTACCGGGCTCT Figures 9 shows that compound 3 increases the mitochondrial mass in cells and C. elegans.

Experiment: Compound 3 increases motility of C. elegans

Trashing assay/ Motility assay

Synchronized L4 nematodes were transferred to lOx OP50 life span plates containing 1 nM of compound or solvent control and were treated for 5 days at 20°C. To measure the bending activity on day 5 of adulthood, a drop of S-Buffer (approx. 200 pl) was pipetted on top of an empty NGM life span plate. 10-20 worms were transferred into that liquid drop and were allowed to adapt to that new environment for 30 s. After that, their bending movement was recorded for another 30 s with a Leica system (Leica M165FC microscope with Leica camera DFC 3000G). At least 220 nematodes per condition were analyzed during two independent experiments via automatized analysis using the Imaged plugin "wrMTrck" as described [Hahm, J.H., et al., C. elegans maximum velocity correlates with healthspan and is maintained in worms with an insulin receptor mutation. Nat Commun, 2015. 6: p. 8919.].

Figure 10 shows that compound 3 increases motility of C. elegans

Experiment: Compound 3 acts as exercise mimetic / exercise enhancer

Treadmill acclimatization and endurance capacity

The mice were familiarized with the treadmill (Panlab/Harvard Apparatus, Holliston, MA) in 4 single training sessions within 10 days. Each session was separated from each other by at least one day. In session 1, animals were allowed to discover the stopped treadmills for 5 min. Session 2-4 consisted of additional low to moderate intensity exercise at 10° incline with increasing duration and speed (session 2: 5 min at 7 m/min; session 3: 10 min at 10 m/min; session 4: 15 min at 12 m/min). In case of lacking motivation to run, the animals were motivated with air puffs. This familiarization training was completed at least one week before the endurance exercise capacity experiment. Prior to the experiment, a 5 min warm-up at 8 m/min and 10% incline was performed. The endurance capacity experiment was conducted with 5 % incline at 12-15 min/min until exhaustion or a maximum of 2 h and 2.5 h for males and females, respectively.

Figures 11 shows that compound 3 acts as exercise mimetic / exercise enhancer in young mice on high-fat diet.

Figures 12 shows that compound 3 acts as exercise mimetic / exercise enhancer (by trend) in aged mice on chow diet.

General information about culture/holding conditions

Cell culture conditions

If not otherwise stated, cells were cultured with DMEM (Sigma Aldrich; #D6429) and 4.5 g/1 glucose, phenol red, 10% FBS, and 1% penicillin/streptomycin with pH 7.4 and were incubated at 37°C, 5% CO2, and 95% relative humidity. Cells were subcultured every 2-3 days. Wild-type HepG2 (#300198) and HEK293 (#300192were derived from CLS Cell Lines Service GmbH,

C. Elegans culture & maintenance

If not otherwise stated, C.elegans was cultured at 20°C on 10 cm culture dishes, containing nematode growth media (NGM) seeded with E. coli OP50 [Brenner, S., The genetics of Caenorhabditis elegans. Genetics, 1974. 77(1): p. 71-94.]. Strains that were obtained from Caenorhabditis Genetics Center (University of Minnesota, USA) included Bristol N2 (wild type), RB754 aak-2 (ok524), MIR257 risls28[hsp-16.2p::CTL1::GFP + uncll9(+)] was previously generated by us (Grigolon et al., in preparation).

Bacteria preparation

Bacteria were prepared as previously describe [Rozanov, L., et al., Redox-mediated regulation of aging and healthspan by an evolutionarily conserved transcription factor HLH-2/Tcf3/E2A. Redox Biol, 2020. 32: p. 101448]. Briefly, bacteria were cultured overnight at 37°C with constant shaking in flasks with appropriate media (OP50 in DYT medium, and E. coli HT115 (DE3) in LB medium containing 100 pg mL-1 Ampicillin). Overnight cultures were concentrated by centrifugation for 30 min at 3,200 x g and 4 °C. Concentrated bacteria prepared were spotted on NGM plates and left overnight before use.

Heat inactivated (HIT) OP50 were prepared as previously described [Grigolon, G., et al., A druggable transcriptional regulator to promote longevity in humans 2021.]. In short, the overnight OP50 culture was pelleted by centrifugation as above, all DYT media removed, and bacteria resuspended in S-buffer supplemented with 1 M MgSO4 and 5 mg/ml Cholesterol to have a 10-fold concentrated culture. Afterwards, the bacterial suspension was placed in a 65 °C waterbath for 45 min. HIT OP50 were spotted on NGM agar plates on the day of use and dried for 30 min before adding the worms.

Plate preparation

NGM compound plates were prepared and autoclaved. The compound or DMSO (solvent control) was added afterwards into the liquid hot agar (50°C) prior to pouring. The maximum end concentration did not exceed 0.5% DMSO. All compound life spans were performed on HIT OP50. Mouse housing conditions

The studies were carried out on male and female C87BL/6NRj mice (Janvier Labs). The animals were hold at 22 °C and 12h/12h light/dark cycle with ad libitum excess to water and food. The animals were either fed with chow diet (young animals: Granovit; #10343700PXL15), aged animals: Ssniff Spezialdiaten GmbH; #S8022-S005) or young animals on high fat diet (Ssniff Spezialdiaten GmbH; #E15744-34; 45 kJ% Fat). In case of the latter, 6-week-old mice were put on high fat diet 6 weeks before the start of compound treatment until their sacrifice. Compound supplementation was started with 13 weeks of age (chow and high-fat diet study with young animals) or 60 weeks of age (study with aged animals) by applying 0.1 mg/kg body weight per day of Compound 3 or solvent control (DMSO with and end concentration of < 0.008 %) via the drinking water.All interventions were performed during a random time point of the dark cycle representing the active phase of mice.

Experiment: Influence of Compound 3 on age-related symptoms

Clinical Frailty Index / FRIGHT calculation:

The clinical frailty index evaluation based on 31 parameters was performed as disclosed in Whitehead JC, Hildebrand BA, Sun M, et al. A clinical frailty index in aging mice: comparisons with frailty index data in humans. J Gerontol A Biol Sci Med Sci 2014;69:621-32. The Frailty Inferred Geriatric Health Timeline was calculated at http://frailtyclocks.sinclairlab.org/ as described in Schultz MB, Kane AE, Mitchell SJ, et al. Age and life expectancy clocks based on machine learning analysis of mouse frailty. Nat Commun 2020;11:4618.

A treatment with compound 3

- decreases the overall clinical frailty index in aged mice (Figures 14A, 14B, 15A and 15B; both sexes). - decreases the phenotype of frailty as calculated via Frailty Inferred Geriatric Health Timeline (FRIGHT) in aged mice (Figures 16A and 16B, both sexes).

- reduces (by trend) the "grimace" score in aged mice, which is an indicator of pain (Figure 17A, both sexes).

- reduces respiration impairments (increased depth and fre- quency of breathing) in aged mice (Figure 17B, both sexes).

- decreases ocular frailty parameters in aged mice (Figures 18A, 18B, 18C, 19A, 19B, and 19C, both sexes).

- decreases physical/musculoskeletal frailty parameters in aged male mice (Figures 20A, 20B, 20C, and 20D).

Electrocardiograms in awake mice:

Mice were placed onto the arm of the ECGenie machine (Mouse Specifics, Boston MA, USA) and allowed to acclimatize for up to 10 minutes. After that, the measurement was started, and the mouse was continuously recorded for up to 20 minutes. Upon completion of the recording, the animal was returned to the home cage. The data were analyzed with EMouse software. Parameters of cardiovascular health are improved upon compound 3 treatment in aged female mice (Figures 21A, 21B, and 21C).

Blood collection:

Fasted blood samples were collected at a random time point during the dark cycle after a fasting period of 4-6 hours by submental bleeding. Whole blood samples were used for hematological analyses. The number of white blood cells and in particular the number of lymphocytes is reduced upon compound 3 treatment which might indicate reduced inflammation in aged female mice (Figures 22A and 22B).