NOVEL EXPRESSION VECTORS FOR PRODUCTION OF

FOREIGN PROTEINS AS SOLUBLE FORMS

Field of the Invention

The present invention relates to novel expression vectors which can

produce foreign proteins as soluble forms by using lysyl tRNA synthetase

and a process for preparing foreign proteins by using the expression vectors.

More particularly, the present invention relates to the expression

vectors which can provide foreign proteins as fused and soluble forms by

exploiting the structure and expression pattern of lysyl-tRNA synthetase

and the process for preparing foreign proteins in E. coli effectively, which

can be utilized industrially to produce active proteins in mass.

Background of Invention

With the advance of genetic engineering, heterologous proteins

which are used industrially as medicine and the like, have been produced by

utilizing animal cells, yeasts and prokaryotes such as E. coli. Especially

E. coli has been exploited as a popular host cell to produce foreign proteins

since it grows fast and has been studied more thoroughly than any other

organisms.

Unfortunately, E. coli lacks cellular components necessary for

posttranslational modification processes like glycosylation, disulfide-

crosslinking or the like. And foreign proteins produced massively and

excessively in E. coli are sequestered into inclusion bodies, which can be

easily separated. But in order to obtain active proteins, these inclusion

bodies should be solubilized to form primary structure by using high

concentration of urea, guanidium HCI or the like and then refolded

removing the above reagents.

Generally, the refolding process for preparing a active protein can

not be always performed successfully since its result varies according to the

cases. For example, proteins having high molecular weight, such as

antibodies, tissue plasmingen activator, factor VIII and so on, are not

refolded easily to become active proteins. And, it is difficult to produce a

recombinant protein on a large scale.

Therefore, it is very important to express foreign proteins as soluble

forms in E. coli for improving the problems caused in above cases.

Presently, following methods have been exploited to express

foreign proteins as soluble forms effectively.

First, there is a method in which N-terminus of foreign protein is

linked to signal peptide so as to secrete foreign protein into periplasm of E.

coli as a soluble form (Stader, J. A. and Silhavy, T. J., 1970, Methods in

Enzymol, 165 : 166-187). Since the foreign proteins are not expressed

effectively by the process, this method is not useful industrially.

Second, there is a method in which foreign proteins are expressed

with chaperone genes such as groES, groEL, dnaK and the like to obtain

soluble proteins (Goloubinoff, P., Gatenby, A. A. and Lorimer, G. H.,

1989, Nature, 337 : 44-47). But this method is not general to prevent the

formation of inclusion body since it is available on only specific proteins.

Third, there is a method in which target proteins are fused at the C-

terminus with fusion partner proteins which can be expressed highly in E.

coli. Since the target proteins are linked at the C-terminus of fusion

partners, translation initiation signal of the fusion partner protein can be

exploited usefully. And the solubility of the fused foreign protein

increases so that large amount of foreign proteins can be obtained as soluble

forms in E. coli.

Lac Z or Trp E protein have been utilized as a fusion partner

protein in order to produce fusion proteins in E. coli. But active-form

proteins can not be obtained easily since most fusion proteins were

expressed in the forms of inclusion body. Therefore, many researches

have been accomplished to obtain novel fusion partner proteins which

facilitates the production of active-form proteins. Practically, some fusion

partner proteins have been developed, such as glutathione-S-transferase

(Smith, D. B. and Johnson, K. S., 1988, Gene, 67 : 31-40), maltose-binding

protein (Bedouelle, H. and Duplay, P., 1988, Euro. J. Biochem., 171 : 541-

549), protein A (Nilsson, B. et al., 1985, Nucleic Acid Res., 13 : 1151-

1162), Z domain of protein A (Nilsson, B. et al., 1987, Prot. Eng., 1 :

107-113), protein Z (Nygren, P. A. et al., 1988, J. Mol. Recog., 1 : 69-

74) and thioredoxin (Lavallie, E. R. et al., 1993, Bio/Technology, 11 :

187-193) .

Although foreign proteins have been expressed by linking the

fusion partner described above and prepared as soluble forms, some were

expressed as inclusion body or partly as soluble proteins according to the

fusion partner protein.

Particularly, thioredoxin has been known to be the most successful

protein as a fusion partner. However, in the case of thioredoxin E. coli

transformant should be cultured at low temperature such as 15°C in order to

express most fusion proteins as soluble forms. Since E. coli grows very

slowly at that temperature, the process using the thioredoxin may be

inefficient.

Lysyl-tRNA synthetase (hereinafter it refers to "Lys RS") and its

gene have been investigated as described below, which is preferable for the

fusion partner protein and expressed highly in E. coli.

Although in E. coli aminoacylation is performed by using a specific

aminoacyl-tRNA synthetase, two lysyl-tRNA synthetases which are

encoded from lys S gene and lys U gene are involved in the aminoacylation

independently, lys S gene is expressed constitutively in normal condition

and lys U gene is induced by heat shock, low pH, anaerobiosis, L-alanine,

L-leucine, L-leucyldipeptide. And amino acid sequences derived from the

two genes show 88% of homology.

In addition, the X-ray crystallographical structure of lysyl-tRNA

synthetase which is expressed from lys U gene (hereinafter it refers to

"Lys U") was illucidated at the 2.8 A° resolution level (Onesti, S., Miller.

A. D. and Brick, P., 1995, Structure, 3 : 163-176). Lys U protein is

composed of homodimer which has N-terminal domain contacting with

tRNA and C-terminal domain of dimer interface showing the enzyme

activity (see Fig. 1).

In addition, nuclear magnetic resonance (NMR) structure of N-

terminal domain (31-149 amino acid residues) of lysyl-tRNA synthetase

which is expressed from lys S gene (hereinafter it refers to "Lys S") was

revealed by Frederic Dardel group (Stephane, C. et al., J. Mol. Biol., 253 :

100-113). As Lys U protein and Lys S protein share a high degree of

identity in the amino acid sequences, the N-terminal structures of the two

enzymes are identified to be very similar.

In detail, the N-terminal domain of lysyl-tRNA synthetase has

secondary structure of five stranded antiparallel β barrel which is composed

of α-helix (H4) located between 3rd and 4th β-sheet and contiguous 3 α-

helices. The post-part of N-terminal domain corresponds to OB fold

(A1A2A3H4A4A5) which is found in proteins binding with

oligosaccharides or oligonucleotides commonly. It has been reported that

OB fold was discovered in aspartyl-tRNA synthetase of yeast, β-subunit of

heat labile enterotoxin, berotoxin and staphylococcal nuclease (Murzin, A.

G., 1993, EMBO J., 12 : 861-867).

The N-terminal domain of Lys RS protein of which the structure is

described above shows the following characteristics as a fusion partner

protein.

When lys S gene was expressed in E. coli, Lys S protein has

accumulated to 80% of total soluble proteins. Since Lys S protein is

composed of homodimer of which the contact region is located at the C-

terminus of monomer, the fusion protein using intact Lys S protein or C-

terminal domain of Lys S protein as a fusion partner makes heterodimer

with Lys S protein of E. coli.

But such a heterodimer is fatal to E. coli . Thus the C-terminal

domain of Lys S protein is not appropriate as a fusion partner protein and

only the N-terminal domain can be exploited as a fusion partner protein.

Practically, only N-terminal domain of Lys S protein (hereinafter it refers to

"Lys N") can be used to express foreign proteins well, to approximately

40% of the total proteins and produced mostly as a soluble form.

As mentioned above, OB fold located in the N-terminal domain of

Lys RS protein has a secondary structure which facilitates protein folding

and increases the solubility of fusion proteins expressed.

The present inventors have researched to develop a fusion partner

protein which is useful to produce heterologous proteins by recombinant

DNA technology. Thus we have demonstrated that the N-terminal domain

of lysyl-tRNA synthetase can be utilized as a fusion partner protein to

produce foreign proteins massively in a soluble form. And by using the

lysyl-tRNA synthetase, we have developed novel E. coli expression vectors

and a process for preparing active foreign proteins effectively.

Summary of the Invention

The object of the present invention is to provide expression vectors

containing total or part of aminoacyl-tRNA synthetase gene. The

aminoacyl-tRNA synthetase gene can be obtained from all kinds of cells.

The expression vectors of the present invention are composed of

linker peptide sequence, tag sequence, protease recognition site, restriction

enzyme recognition site for inserting foreign gene or the like, in addition to

the aminoacyl-tRNA synthetase gene.

In addition, the object of the present invention is to provide the E.

coli expression vectors containing total or part of lysyl-tRNA synthetase

gene. The lysyl-tRNA synthetase gene can be selected among lys S gene

or lys U gene.

Particularly, the present invention provides the expression vector

pGE-lysRS containing intact lys S gene.

In addition, the object of the present invention is to provide the

expression vectors containing the N-terminal domain gene of lysyl-tRNA

synthetase.

The present invention provides the expression vectors containing

the N-terminal domain of lysyl-tRNA synthetase which is deleted at the

amino acid residues 1 to 13. And the present invention also provides the

expression vectors containing the N-terminal domain gene of lysyl-tRNA

synthetase which is deleted at the amino acid residues 1 to 29.

In addition, the present invention provides the expression vector

containing only OB fold gene of lysyl-tRNA synthetase. For the purpose,

the expression vectors contain the N-terminal domain gene of lysyl-tRNA

synthetase which is deleted at the amino acid residues 1 to 65.

Particularly, the present invention provides the E. coli expression

vector pGE-lysN. E. coli HMS 174 strain was transformed by the

expression vector pGE-lysN and the transformant has been deposited with

Korea Research Institute of Bioscience and Biotechnology, Korea, on

September 26, 1997 (accession number : KCTC 0388 BP).

The object of the present invention is to provide a process for

preparing useful foreign proteins as soluble forms of fusion protein by

inserting the foreign genes into the above expression vectors.

Particularly, the present invention provides the expression vector

plysN-GMcsf by inserting GMcsf (human granulocyte and macrophage

colony stimulating factor) gene into the expression vector pGE-lysN. Host

cell was transformed with the expression vector and induced to express

GMcsf protein as a fusion protein.

At that time, all kinds of E. coli strain can be used, which is

appropriate for the expression of the fusion protein. Preferably, E. coli

HMS 174 strain can be used as a host cell.

Particularly, the present invention provides the expression vector

plysN-Gcsf by inserting Gcsf (human granulocyte colony stimulating

factor) gene into the expression vector. By using the above process, Gcsf

protein is prepared.

Particularly, the present invention provides the expression vector

plysN-TIMP2 by inserting TIMP2 (human tissue inhibitor of

metalloprotease 2) gene into the expression vector. By using the above

process, TIMP2 protein is prepared.

Brief Description of the Drawings

Fig. 1 depicts the secondary structure of lysyl-tRNA synthetase

(Lys U).

Stick is helix structure and arrow is β-sheet structure.

Fig. 2 depicts a strategy for constructing the expression vector

pGE-lysRS into which lys S gene is inserted.

Fig. 3 depicts the expression of Lys S protein by performing SDS-

polyacrylamide gel electrophoresis, which used E. coli HMS 174 strain

transformed with the expression vector pGE-lysRS of the present invention,

lane 1 : standard protein marker;

lane 2: total proteins of E. coli induced for the protein expression ;

lane 3: total proteins of E. coli transformant;

lane 4: total proteins of E. coli transformant induced for the protein

expression ;

lane 5: supernatant of disrupted E. coli induced ;

lane 6: supernatant of disrupted E. coli transformant;

lane 7: supernatant of disrupted E. coli transformant induced;

lane 8: precipitate of disrupted E. coli induced;

lane 9: precipitate of disrupted E. coli transformant;

lane 10: precipitate of disrupted E. coli transformant induced

Fig. 4 depicts a strategy for constructing the expression vector

pGE-lysN which uses the N-terminal domain of Lys S protein as a fusion

partner protein.

Fig. 5 depicts a strategy for constructing the E. coli expression

vector pLysN-GMcsf which expresses GMcsf protein by using the

expression vecotr pGE-lysN.

Fig. 6 depicts the expression of GMcsf protein by performing

SDS-polyacrylamide gel electrophoresis, which used E. coli HMS 174

strain transformed with the expression vector pLysN-GMcsf of the present

invention.

lane 1 : standard protein marker;

lane 2: total proteins of E. coli transformant;

lane 3: total proteins of E. coli transformant induced for the

expression;

lane 4: precipitate of disrupted E. coli transformant;

lane 5: precipitate of disrupted E. coli transformant induced;

lane 6: supernatant of disrupted E. coli transformant;

lane 7: supernatant of disrupted E. coli transformant induced;

Fig. 7 depicts the expression of GMcsf protein for comparison by

performing SDS-polyacrylamide gel electrophoresis, which used

thioredoxin as a fusion partner protein and E. coli GI724 strains

transformed with the expression vector pTRXFUS-GMcsf and pTRXFUS

respectively.

lane 1 : standard protein marker;

lane 2: supernatant of disrupted E. co/z/pTRXF S-GMcsf

transformant induced for the protein expression;

lane 3: precipitate of disrupted E. < >///pTRXFUS-GMcsf

transformant induced;

lane 4: supernatant of disrupted E. co///pTRXFUS transformant

induced;

lane 5: precipitate of disrupted E. co///pTRXFUS transformant

induced;

Fig. 8 depicts a strategy for constructing the E. coli expression

vector pLysN-Gcsf which expresses Gcsf protein by using the expression

vector pGE-lysN.

Fig. 9 depicts the expression of Gcsf protein by performing SDS-

polyacrylamide gel electrophoresis, which used E. coli HMS 174 strain

transformed with the expression vector pLysN-Gcsf

lane 1 : standard protein marker;

lane 2: total proteins oϊE. coli transformant;

lane 3: precipitate of E. coli transformant;

lane 4: supernatant of E. coli transformant;

lane 5: total proteins of is. coli transformant induced for the protein

expression;

lane 6: precipitate of disrupted E. coli transformant induced;

lane 7: supernatant of disrupted E. coli transformant induced

Fig. 10 depicts a strategy for constructing the E. coli expression

vector pLysN-TIMP2 which expresses TIMP2 protein by using the

expression vector pGE-lysN.

Fig. 11 depicts the expression of TIMP2 protein by performing SDS-

polyacrylamide gel electrophoresis, which used E. coli HMS 174 strain

transformed with the expression vector pLysN-TIMP2.

lane 1 : standard protein marker;

lane 2: total proteins ofE. cø///pGE-lysN transformant;

lane 3: total proteins of is. co///pGE-lysN transformant induced for

the protein expression;

lane 4: precipitate of disrupted E. co///pGE-lysN transformant

induced;

lane 5: supernatant of disrupted E. co// ^' /pGE-lysN transformant

induced;

lane 6: total proteins of E. coli transformant

lane 7 : total proteins of E. coli transformant induced;

lane 8 : precipitate of disrupted E. coli transformant induced;

lane 9 : supernatant of disrupted E. coli transformant induced

Description of The Preferred Embodiments

The present invention provides expression vectors which produce

useful foreign proteins as soluble forms by exploiting the structural

characteristics of aminoacyl-tRNA synthetase. All kinds of aminoacyl-

tRNA synthetase genes can be used to prepare expression vectors of the

present invention as fusion partner proteins.

The present invention provides expression vectors which use lysyl-

tRNA synthetase (Lys RS) which has been studied well as a fusion partner.

At that time, Lys RS protein gene can be selected among lys S gene and lys

U gene.

Lys RS protein gene can be obtained by performing polymerase

chain reaction (PCR) which utilized E. coli chromosomal DNA as a

template.

Particularly, lys S gene obtained by the above process has been

inserted into the plasmid vector such as pGEMEX ^M -l (Promega) so as to

construct the expression vector pGE-lysRS of the present invention (see Fig.

2). E. coli strains proper for the expression have been transformed with

the expression vector pGE-lys RS and induced to express Lys RS protein.

As a result, Lys RS protein was expressed well, to 80% of total soluble

proteins of the host cell. Generally E. coli transformants are cultured at

37°C in order to express Lys RS protein of the present invention. But

soluble proteins are expressed efficiently at low temperature such as 15°C -

30°C which facilitates the increase of the soluble protein ratio.

The present invention provides expression vectors which uses the

N- terminal domain of Lys RS protein as a fusion partner protein.

In order to produce useful foreign proteins effectively, the

expression vector of the present invention contains linker peptide sequence,

tag sequence, protease recognition site, restriction enzyme recognition site

and so forth selectively, in addition to the N-terminal domain of Lys RS

protein. Therefore, fusion proteins expressed by using the expression

vectors can be produced as forms of soluble proteins in the host cells and

separated easily and only the foreign proteins can be purified by digesting

the fusion proteins with specific protease.

Particularly, the N-terminal domain gene of Lys RS protein can be

obtained by performing polymerase chain reaction which utilizes the

expression vector pGE-lysRS as a template. And the N-terminal domain

gene obtained by the above process has been inserted into the plasmid

vector pGEMEX™-ΔNdeI to construct the expression vector pGE-lys N of

the present invention (see Fig. 4).

The E. coli HMS 174 strain was transformed by the expresseion

vector pGE-lysN of the present invention and the transformant has been

deposited with Korea Research Institute of Bioscience and Biotechnology,

Korea, on September 26, 1997 (accession number : KCTC 0388 BP).

The expression vector constructed by the above process has the

following characteristics. The expression vector of the present invention

contains T7 promoter which regulates transcription of the fusion protein.

In addition to T7 promoter, all kinds of promoters which can be used in E.

coli strans, such as tac promoter, λ pL promoter and the like, is available for

the expression vector of the present invention.

The expression vectors of the present invention have been

constructed in order to exploit the N-terminal domain of Lys RS protein as a

fusion partner protein effectively.

In the N-terminal domain of Lys RS protein, helix 1 structure exists.

Since the helix 1 structure is very close to linker peptide, it may prevent

enteropeptidase from digesting fusion protein and affect protein folding.

Ln order to provide the suitable expression vector for the production of

foreign proteins, helix 1 structure can be removed from the expression

vector.

The present invention provides the expression vector removed at the

helix 1 structure to prepare foreign proteins more efficiently.

Preferably, the expression vector of the present invention contains

the N-terminal domain of Lys RS protein which is deleted at the amino acid

residues 1 to 13. Preferably the expression vector also contains the N-

terminal domain of LysRS protein which is deleted at the amino acid

residues 1 to 29.

In addition, preferably the expression vector of the present

invention contains OB fold gene which is involved in folding process of Lys

RS protein. Particularly, the expression vector contains the N-terminal

domain of Lys RS protein which is deleted at the amino acid residues 1 to

65 corresponding to helix structure 1, 2 and 3. The expression vectors

above are suitable for the production of fusion proteins as soluble forms.

The expression vector of the present invention can also contain OB

fold domain gene of other proteins in addition to the N-teπninal domain

gene of Lys RS protein. In detail, OB fold genes found in aspartyl-tRNA

synthetase of yeast, B subunit of thermolabile enterotoxin, berotoxin and

Staphylococcal nuclease can be utilized for the construction of the

expression vector.

The expression vector of the present invention contains linker

peptide connecting fusion partner protein and foreign protein. Particularly,

the amino acid residues 147 to 154 of Lys RS protein is used as a linker

peptide. This linker peptide is very useful since it is protruded on the

protein surface and the length of linker peptide can be controlled according

to the foreign proteins expressed. The expression vector can also contain

useful linker peptides of other proteins in addition to Lys S protein

described above.

The expression vector of the present invention also contains

histidine tag of 6 histidine residues after the above linker peptide. This

histidine tag enables the fusion proteins expressed with the expression

vector to be purified easily. Practically, histidine tagged fusion protein can

be separated and purified easily by using nickel chelating column

chromatography and the like.

In addition to hisitidine tag, polyarginine or consensus biotinylation

sequence can be inserted into the expression vector. Fusion proteins

produced by using the above expression vector can be separated and

purified from various affinity column chromatographies. The tag

sequences described above can be located in any available region of C-

terminus or N-teπninus of the fusion protein.

The expression vector of the present invention contains protease

recognition site in order to separate only foreign protein from fusion protein

expressed and purified. In detail, the expression vector of the present

invention contains enteropeptidase recognition site (DDDDK sequence)

after 6 histidine residues, which enables fusion protein to be separated into

fusion partner protein and foreign protein easily. At that time,

enteropeptidase digests the C-terminus of the above enteropeptidase

recognition site.

In addition, the above protease recognition site can be substituted

with thrombin recognition site (LVPRGS sequence) or Xa factor

recognition site (IEGR sequence) in order to produce foreign proteins

efficiently.

The expression vector of the present invention contains restriction

enzyme sites after the above protease recognition site in order to insert

foreign protein genes conveniently. In detail, the expression vector pGE-

lysN of the present invention contains restriction enzyme recognition sites

Kpnl - BamHI - EcoRI - Sail - Hindlll. All kinds of restriction recognition

sites which is used conveniently in cloning foreign genes can be inserted in

addition to the above reconition sites.

Various foreign proteins which are expressed as inclusion bodies in

E. coli can be prepared as soluble forms efficiently by using the expression

vectors of the present invention.

Particularly, the present invention provides the expression vectors

which uses the N-terminal domain of lysyl-tRNA synthetase (Lys N) in

order to produce human granulocyte and macrophage colony stimulating

factor (GMcsf), human granulocyte colony stimulating factor (Gcsf) and

human tissue inhibitor of metalloprotease (TIMP 2) and the like massively.

The present invention constructs the expression vector which

produces GMcsf protein as a soluble form by using Lys N protein. In

detail, GMcsf gene was obtained by performing polymerase chain reaction

which utilized the expression vector pTRXFUS-GMcsf as a template. And

the GMcsf gene obtained above has been inserted into the expression vector

pGE-lysN to construct the expression vector plysN-GMcsf of the present

invention (see Fig. 5).

In order to examine the availability of Lys N as a fusion partner

protein, GMcsf protein fused with Lys N protein has been compared with

GMcsf protein fused with thioredoxin according to their expression. For

the previous comparison, the expression vector pTRXFUS-GMcsf which

contains GMcsf gene and thioredoxin gene and produces their fusion

protein has been constructed (see Fig. 7).

In addition, the present invention constructs the expression vector

which produces Gcsf protein as a soluble form. In detail, Gcsf gene was

obtained by performing polymerase chain reaction which utilized the

expression vector pTRXFUS-Gcsf as a template. And the Gcsf gene has

been inserted into the expression vector pGE-lysN to construct the

expression vector plysN-Gcsf of the present invention (see Fig. 8).

In addition, the present invention constructs the expression vector

which produces TIMP 2 protein as a soluble protein. In detail, TIMP 2

gene was obtained by performing polymerase chain reaction which utilized

the vecor pGETIMP 2 as a template. And the TIMP 2 gene has been

inserted into the expression vector pGE-lys N to construct the expression

vector pGElysN-TIMP 2 of the present invention (see Fig. 10).

The E. coli strains proper for the expression have been transformed

with the above expression vectors. Transformants have been cultured at

37°C and as results foreign proteins fused with Lys N protien, namely, Lys

N-GMcsf protein, Lys N-Gcsf protein and Lys N-TIMP 2 protein as soluble

forms were expressed at the ratio of 5 - 30% of total soluble proteins (see

Fig. 6, Fig. 9 and Fig. 11). On the other hand, when thioredoxin was used

as a fusion partner protein, fusion protein was expressed as an inclusion

body (see Fig. 7). Therefore, Lys N protein of the present invention is

identified to be a more outstanding fusion partner protein than thioredoxin.

Practical and presently preferred embodiments of the present

invention are illustrative as shown in the following Examples.

However, it will be appreciated that those skilled in the art, on

consideration of this disclosure, may make modification and improvements

within the spirit and scope of the present invention.

Examples

<Example 1> Cloning of lys S gene and construction of the expression

vector pGE-lysRS

In order to clone lys S gene which is necessary to construct the

expression vector of the present invention, polymerase chain reaction (PCR)

was performed, which utilized primer 1 of SEQ ID. NO: 1, primer 2 of SEQ

ID. NO: 2 and E. coli chromosomal DNA as a template (see Sequence

Listing). Amplified lys S gene was digested with resctriction enzyme Ndel

and Hindlll .

For the convenience of cloning process, among two Ndel sites of

plasmid pGEMEX™-l (Promega) Ndel site located on DNA sequence 3251

was removed from the plasmid as shown in Fig. 2 to construct the plasmid

_P GEMEX™-ΔNdeI. The plasmid pGEMEX™-ΔNdeI was digested with

restriction enzyme Ndel and Hindlll. The plasmid and PCR product

digested above were electrophoresed on 1% agarose gel and the gel which

contained the DNA fractions appearing at long wavelenth of UV was cut.

Each DNA fraction was eluted from the gel by Jetsorb Kit (GENOMED)

and was ligated.

As a result, the expression vector pGE-lysRS containing lys S gene

was constructed.

<Example 2> Expression of Lys S protein

is. coli HMS 174 strain was transformed with the expression vector

pGE-lysRS constructed in Example 1. The E. coli transformant selected

was inoculated into 1.5 ml of LB medium containing ampicillin 100 μg/ml,

chloramphenicol 30 μg/ml. The transformant was cultured overnight at

37°C, and the growing culture was again inoculated into 50 ml of LB media.

When the concentration of is. coli was 0.5 at OD ₆₀ o, IPTG was added into

the E. coli culture in order to induce the expression of protein and again the

E. coli culture was incubated for more 5 hours. The above culture broth

was centrifuged for 10 minutes at 5,000g, and cell pellet was suspended in

10 ml of phosphate buffered saline (PBS) buffer. The cells were disrupted

and the crude exrtact prepared in the above process was centrifuged for 15

minutes at 15,000g in order to separate supernatant from precipitate. This

precipitate was again suspended in 10 ml of PBS buffer. 28μl of above

each sample was mixed with 7μl of 5 X SDS loading buffer, and boiled for

5 minutes. 10 μl of the above mixture was loaded onto 12% SDS-

polyacrylamide gel, electrophoresed at 120 V and identified with the

protein band by using Coomasie blue dye.

As a result, as is shown in lane 7 of Fig. 3, the expression vector of

the present invention expresses Lys S protein highly at the ratio of 80% of

total soluble proteins (see Fig. 3).

<Example 3> Construction of the expression vector pGE-lysN

In order to construct the expression vector using the N-terminal

domain of Lys S protein as a fusion partner protein, polymerase chain

reaction was performed, which utilized primer 1 of SEQ ID. NO: 1, primer

3 of SEQ ID. NO: 3 and the expression vector pGE-lysRS constructed in

Example 1 as a template (see Sequence Listing).

Amplified gene in the above reaction was digested with restriction

enzyme Ndel and Hindlll and the plasmid vector pGEMEX™-ΔNdeI was

also digested with Ndel and Hindlll. And above products were ligated

after elution (see Fig. 4).

As a result, the expression vector containing the N-terminal domain

gene of Lys S protein was constructed and named as the expression vector

pGE-lysN (accession number : KCTC 0388 BP).

<Example 4> Construction of the expression vector plysN-GMcsf and

expression of fusion protein LysN-GMcsf

In order to express human GMcsf protein as a soluble protein in E.

coli, which has been expressed independently as an inclusion body in E.

coli, GMcsf gene was cloned into the expression vector pGE-lysN of the

present invention (see Fig. 5).

In order to obtain GMcsf gene, PCR was performed by utilizing

primer 4 of SEQ ID. NO: 4, primer 5 of SEQ ID. NO: 5 and the expression

vector pTRXFUS-GMcsf as a template (see Sequence Listing).

Amplified gene by the above reaction was digested with restriction

enzyme Kpnl and Hindlll and the expression vector pGE-lysN of the

present invention was also digested with Kpnl and Hindlll. And the above

products were ligated after elution. As a result, the expression vector

which produces GMcsf protein fused with LysN protein was constructed

and named as the expression vector plysN-GMcsf.

In addition, E. coli was transformed with the expression vector

plysN-GMcsf. As a result, fusion protein was expressed as is shown in

Fig. 6 and the size is 33kDa as is predicted. In addition, most LysN-

GMcsf fusion protein was expressed highly at the ratio of 10% of total

soluble proteins (see Fig. 6).

<Example 5> Construction of the expression vector pTRXFUS-GMcsf

and expression of thioredoxin-GMcsf

In order to examine the availability of Lys N of the present

invention as a fusion partner protein, as a control experiment the effect of

fusion partner protein, thioredoxin on the expression of GMcsf fusion

protein was examined,

The expression vector pTRXFUS-GMcsf which expresses GMcsf

fusion protein was constructed by subcloning GMcsf gene into Kpnl and

BamHI site of the expression vector pTRXFUS using thioredoxin as a

fusion partner protein (see Fig. 7).

When the E. coli transformed with the expression vector of the

present invention was cultured at 37°C, fusion proteins were expressed as

inclusion bodies (see Fig. 7, lane 3).

As a result, thioredoxin was less effective than Lys N protein as a

fusion partner protein.

<Example 6> Construction of the expression vector plysN-Gcsf and

expression of LysN-Gcsf fusion protein

In order to express human Gcsf (granulocyte colony stimulating

factor) as a soluble protein, which has been expressed as an inclusion body

independently in E. coli, Gcsf gene was cloned by performing the same

method as Example 4.

Polymerase chain reaction was performed by utilizing primer 6 of

SEQ ID. NO: 6, primer 7 of SEQ ID. NO : 7 and the plasmid vector

pTRXFUS-Gcsf as a template (see Sequence Listing). Gcsf gene

amplified by the above reaction was phosphorylated by T4 polynucleotide

kinase, and the expression vector pGE-lysN was also digested with EcoRV,

and then treated by CIP (calf intestine phosphatase). The two resultants

were ligated after elution by performing the same method of Example 1.

As a result, the expression vector plysN-Gcsf was constructed which

expresses Gcsf-LysN fusion protein (see Fig. 8).

In addition, fusion protein was expressed by fransfoiming E. coli

with the expression vector plysN-Gcsf. As a result, fusion protein was

expressed as is shown in Fig. 9, and the size of protein is 36kDa as is

predicted. Particularly, Lys-Gcsf fusion protein was expressed as a

soluble protein, and occupied 30% of total soluble proteins.

<Example 7> Construction of the expression vector plysN-TIMP2 and

expression of fusion protein LysN-TIMP2

In order to express human TIMP2 (tissue inhibitor of

metalloprotease 2) as a soluble protein, which has been expressed as an

inclusion body in E.coli, TIMP2 gene was inserted into the expression

vector pGE-lysN of the present invention.

In order to clone TIMP2 gene, polymerase chain reaction was

performed by utilizing primer 8 of SEQ ID. NO: 8, primer 9 of SEQ ID.

NO: 9 and the plasmid vector pGE-TIMP2 (see Sequence Listing).

Amplified TIMP2 gene by the above reaction was digested with restriction

enzyme EcoRV and Hindlll, and the expression vector pGE-lysN of the

present invention was also digested by EcoRV and Hindlll. Above two

resultants were ligated after elution by performing the same method as

Example 1. As a result, the expresion vector plysN-TIMP2 which

expresses fusion protein LysN-TIMP2 was constructed (see Fig. 10).

In addition, fusion protein was expressed by transforming E. coli

with the expression vector plysN-TIMP2. As a result, fusion protein was

expressed as is shown in Fig. 1 1, and the size of protein is 41kDa as is

predicted. Particularly, Lys N-TIMP2 fusion protein was expressed as a

soluble protein, to 5% of total soluble proteins (see Fig. 11, lane 9).

The expression vectors of the present invention expresses lysyl-

tRNA synthetase and foreign proteins fused with the N-terminal domain of

lysyl-tRNA synthetase as soluble forms, which makes their protein

activities maintained. Thus the present invention is outstanding in view of

recombinant DNA technology.

Practically, the expression vector of the present invention expresses

Lys RS protein highly at the ratio of 80% of total soluble proteins, and also

expresses foreign proteins fused with Lys N protein highly at the ratio of 5-

30%. In addition, Lys N protein is more effective than thioredoxin

developed already.

Particularly, the expression vectors of the present invention can

produce foreign protein efficiently, for example GMcsf, Gcsf and TIMP2

proteins. In addition to the previous proteins, the expression vector of the

present invention is useful to produce foreign proteins which are difficult or

impossible to be obtained as active forms and have high molecular weights,

such as antibodies, tissue plasminogen activator and factor VIII.

In addition, the expression vector of the present invention is

constructed to make foreign proteins genes inserted, fusion proteins purified

easily and protease recognition site digested specifically, which facilitates

the production of intact target proteins. Thus the expression vector is very

useful to produce various foreign proteins.

Sequence Listing

(1) General Information

(iii) Number of sequences : 9

(2) Information for SEQ ID NO: 1 :

(i) Sequence Characteristics :

(A) Length : 36 nucleic acids

(B) Type : nucleic acid

(C) Srrandedness : single

(D) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 1

GACTACCATA TGTCTGAACA ACACGCACAG GGCGCT 36

(2) Information for SEQ ID NO: 2:

(i) Sequence Characteristics :

(A) Length : 42 nucleic acids

(B) Type : nucleic acid

(C) Strandedness : single

(D) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 2

GACTACAAGC TTCTATTATT TTACCGGACG CATCGCCGGG AA 42

(2) Information for SEQ ID NO: 3:

(i) Sequence Characteristics :

(A) Length : 96 nucleic acids

(B) Type : nucleic acid

(C) Strandedness : single

(D) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 3

GACTACAAGCTTGTCGACGATATCGGATCC GGTACCCTTGTCATCGTCATCGTGGTGGTG

60 GTGGTGGTGCGGCAGCGGAC GCAGTGCTTTGGTCAG 96

(2) Information for SEQ ID NO: 4:

(i) Sequence Characteristics :

(A) Length : 33 nucleic acids

(B) Type : nucleic acid

(C) Strandedness : single

(D) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 4

GACAAGGGTACCGCACCCCGCTCGCCCAGCCCC 33

(2) Information for SEQ ID NO: 5:

(i) Sequence Characteristics :

(E) Length : 33 nucleic acids

(F) Type : nucleic acid

(G) Strandedness : single

(H) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 5

GAGCGCAAGC TTTCACTCCT GGACTGGCTC CCAGCA 33

(2) Information for SEQ ID NO: 6:

(i) Sequence Characteristics :

(A) Length : 33 nucleic acids

(B) Type : nucleic acid

(C) Strandedness : single

(D) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 6

GACAAGGGTACCAACCCCCCTGGGCCCTGCCAGC 33

(2) Information for SEQ ID NO: 7:

(i) Sequence Characteristics :

(E) Length : 36 nucleic acids

(F) Type : nucleic acid

(G) Strandedness : single

(H) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 7

GACAAGAAGC TTTCATCAGG GCTGGGCAAG GTGGCG 36

(2) Information for SEQ ID NO: 8:

(i) Sequence Characteristics :

(I) Length : 33 nucleic acids

(J) Type : nucleic acid

(K) Strandedness : single

(L) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 8

GTCATCGATATCTGCAGCTGCTCCCCGGTGCAC 3 ₃

(2) Information for SEQ ID NO: 9:

(i) Sequence Characteristics :

(A) Length : 36 nucleic acids

(B) Type : nucleic acid

(C) Strandedness : single

(D) Topology : linear

(ii) Molecular type : oligonucleotide

(xi) Sequence Description : SEQ ID NO: 9

GTCATCAAGC TTTCATTATG GGTCCTCGAT GTCGAG 36