NOVEL METHODS AND FORMULATIONS FOR ORTHOPEDIC CELL THERAPY

This application claims priority to U.S. Provisional Application No. 61/507,041 filed on July 12, 201 1 and U.S. Provisional Application No. 61/601,499 filed on Febniaiy 21, 2012 both of which are incorporated by reference in their entirety.

Field of the Invention

The invention relates to the filed of pluripotent ceil biology and to clonal progenitor cell lines and methods of making the same.

BACKGROUND

Advances in stem cell technology, such as the isolation and propagation in vitro of primordial stem cells, including embryonic stem cells ("ES" cells including human ES cells ("hES" cells)) and related primordial stem cells including but not limited to, iPS, EG, EC, ICM, epiblast, or ED cells (including human iPS, EG, EC, ICM, epiblast, or ED cells), constitute an important new area of medical research. hES cells have a demonstrated potential to be propagated in the undifferentiated state and then to be induced subsequently to differentiate into likely any and all of the cell types in the human body, including complex tissues. In addition, many of these primordial stem cells are naturally telomerase positive in the undifferentiated state, thereby allowing the cells to be expanded indefinately. This expansion potential allows these primordial cells to be genetically modified followed by clonal expansion, thus pennittting the production of numerous homogeneous populations of genetically modified primordial stem cells. Since the telomere length of many of these cells is comparable to that observed in sperm DNA (approximately 10-18 kb TRF length), differentiated cells derived from these immortal lines once they begin differentiation (generally associated with the repression of the expression of the catalytic component of telomerase (TERT)) display a long initial telomere length providing the cells with a long implicative capacity compared to fetal or adult-derived tissue. This has led to the suggestion that many diseases resulting from the dysfunction of cells may be amenable to treatment by the administration of hES-derived cells of various differentiated types (Thomson et al. _s Science 282: 1 145- 1 147 (1998)). Nuclear transfer studies have demonstrated that it is possible to transform a somatic differentiated cell back to a primordial stem ceil state such as that of embryonic stem ("ES") cells (Cibelli et al. _t Nature Biotech 16:642-646 (1998)) or embryo-derived ("ED") cells. The development of technologies to reprogram somatic cells back to a totipotent ES cell state, such as by the transfer of the genome of the somatic cell to an enucleated oocyte and the subsequent culture of the reconstructed embryo to yield ES cells, often referred to as somatic ceil nuclear transfer ("SCNT") or through analytical reprogramming technology, offers methods to transplant ES-derived somatic cells with a nuclear genotype of the patient (Lanza et at, Nature Medicine 5:975-977 (1999)).

hi addition to SCNT, other techniques exist to address the problem of transplant rejection, including the use of gynogenesis and androgenesis (see U.S. application nos. 60/161,987, filed October 28, 1999; 09/697,297, filed October 27, 2000; 09/995,659, filed November 29, 2001 ; 10/374,512, filed February 27, 2003; PCT application no. PCT/USOO/29551 , filed October 27, 2000; the disclosures of which are incorporated by reference in their entirety). In the case of a type of gynogenesis designated parthenogenesis, pluripotent stem cells may be manufactured without antigens foreign to the gamete donor and therefore useful in manufacturm g cells that cati be transplanted without rejection. In addition, parthenogenic stem ceil lines can be assembled into a bank of cell lines homozygous in the I-ILA region (or corresponding MHC region of nonhuman animals) to reduce the complexity of a stem cell bank in regard to HLA haplotypes.

In addition, cell lines or a bank of said cell lines can be produced that are hemizygous in the HLA region (or corresponding MHC region of nonhuman animals; see PCT application Ser. No.

PCT/US2006/040985 filed October 20, 2006 entitled "Totipotent, Nearly Totipotent or Pluripotent Mammalian Cells Homozygous or Hemizygous for One or More Histocompatibility Antigen Genes", incorporated herein by reference). A bank of hemizygous cell lines provides the advantage of not only reducing the complexity inherent in the normal mammalian MHC gene pool, but it also reduces the gene dosage of the antigens to reduce the expression of said antigens without eliminating their expression entirely, thereby not stimulating a natural killer response.

In addition to SCNT, parthenogenesis, and the construction of banks of cells with homozygous or hemizygous HLA alleles, other techniques exist to address the problem of transplant rejection, including the use of technologies to reprogram somatic cells using transcriptional regulators (see PCT application Ser. No. PCT US2006/030632 filed on August 3, 2006 and titled "Improved Methods of Reprogramming Animal Somatic Cells", incorporated herein by reference).

In regard to differentiating primordial stem cells into desired cell types, the potential to clonally isolate lines of human embryonic progenitor (liEP) cell lines provides a means to propagate novel highly purified cell lineages useful in the production of diverse secreted factors, for research, and for the manufacture of cell-based therapies (see PCT application Ser. No. PCT/US2006/0 I 35 I filed on April 1 1 , 2006 and titled "Novel Uses of Cells With Prenatal Patterns of Gene Expression"; U.S. patent application Ser. No. 1 1/604,047 filed on November 21 , 2006 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; and PCT application Ser. No. PCT/US201 1/037969 filed on May 25, 201 1 and entitled "Improved Methods of Screening

Embryonic Progenitor Cell Lines", each incorporated herein by reference),

Nevertheless, there remains a need for improved methods to discover the differentiation potential of said hEP cell lines when exposed to diverse differentiation-inducing factors or other differentiation conditions that induce such differentiation under conditions which are compatible in either a general laboratory setting or in a good manufacturing processes ("GMP") cell manufacturing facility where there is adequate documentation as to the purity and genetic normality of the cells at advanced passages (>18- 21 doublings of clonal expansion). In particular, there remains a need for improved methods of differentiating said liEP cell lines using BMP growth factor family members.

SUMMARY OF THE INVENTION

We have previously demonstrated that the long initial telomere length of hES cells, together with the unexpected robust proliferative capacity of primitive hES-derived progenitor ceil types, facilitates the industrial expansion and characterization of >140 diverse and scalable clonal lineages with diverse defined homeobox gene expression as well as diverse transcriptional regulators (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, incorporated herein by reference, including supplemental information; and U.S. patent application Ser, No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety). The robustness of these clonally-purified lines, their ability to expand for >40 passages while maintaining their pattern of gene expression, lack of tumorigenicity, and their embryonic pattern of gene expression offers novel compositions and methods for modeling numerous differentiation pathways for the first time hi vitro, and for the manufacture of purified product not existing in such a purified state in nature or using other manufacturing modalities. We disclose novel compositions and methods related to these cells, including novel screening methods and conditions that differentiate human embryonic progenitors into numerous terminally-differentiated cell types of use in medical research and therapy in the presence of BMP factor family members including TGFB3, BMP2, BMP4, BMP6, BMP7, and GDF5, and combinations thereof. Suitable concentrations for each of the following factors TGFB3, BMP2, BMP4, BMP6, BMP7, and GDF5, range from about 1 ng ml to about 200 ng/ml, from about 5 ng ml to about 150 ng/ml; from about 10 ng/ml to about 100 ng ml. In some embodiments a suitable concentration of TGFP3 is about 1 -20 ng/ml. In some embodiments a suitable concentration of BMP2 is about 10-200 ng/ml. In some embodiments a suitable concentration of BMP4 is about I -I 00 ng/ml. In some embodiments a suitable concentration of BMP6 is about 1-200 ng/ml. In some embodiments a suitable concentration of BMP7 is about 20-300 ng ml. In some embodiments a suitable concentration of GDRF is about 20-300 ng ml.

Li some embodiments the invention provides an isolated progenitor ceil line chosen from the cell lines disclosed in Table 1 .

In certain embodiments the invention provides an isolated clonal cell progenitor line expressing one or more markers expressed by chondrocytes. The clonal cell progenitor line may be the in vitro differentiated progeny of a pluripotent stem cell.

hi some embodiments the invention provides an isolated cell progenitor line expressing the markers COL2A 1 and CCRTAC1. The cells may express little or no COL10A.

In other embodimets the invention provides the cell line 4D20.8,

In certain embodiments the invention provides an isolated cell progenitor line expressing one or more markers expressed by tendons,

In some embodiments the invention provides an isolated cell progenitor line expressing the marker TNMD. The cells may express little or no COL2A1.

In other embodimets the invention provides the cell line 7PE D24.

In certain embodiments the invention provides an isolated cell progenitor line expressing one or more markers expressed by bone forming cells.

In some embodiments the invention provides an isolated cell progenitor line expressing the markers Bone sialoprotein IT.

In other embodimets the invention provides the cell line SM30.

In other embodimets the invention provides the cell line MEL2.

In certain embodiments the invention provides a method of making chondrocyte progenitor cell comprising obtaining a clonal progenitor cell differentiated from a pkiripotent stem cell and contacting the clonal progenitor cell with a differentiation cocktail comprising one or more BMP family members thereby making a chondrocyte progenitor cell.

In other embodiments the invention provides a method of making progenitor cell expressing one or more markers chosen from COL2A1 and CRTAC1 comprising obtaining a clonal progenitor cell differentiated from a pkiripotent stem cell and contacting the clonal progenitor cell with a differentiation cocktail comprising one or more BMP family members thereby making a progenitor ceil expressing one or more markers chosen from COL2A1 and CRTAC .

In still other embodiments the invention provides a method of making a chondrocyte progenitor cell comprising contacting the clonal progenitor cell line 4D20.8 with one or more members of the BMP family thereby making a chondrocyte progenitor cell.

In yet other embodiments the invention provides a method of making a progenitor cell expressing one or more markers chosen from COL2A I and CRTAC 1 comprising contacting the clonal progenitor cell line 4D20.8 with one or more members of the BMP family thereby making a progenitor cell expressing one or more markers chosen from COL2A1 and CRTAC 1 ,

In certain embodiments the invention provides a method of making tendon progenitor cell comprising obtaining a clonal progenitor cell di ferentiated from a pkiripotent stem cell and contacting the clonal progenitor cell with a differentiation cocktail comprising one or more BMP family members thereby making a tendon progenitor cell.

!n other embodiments the invention provides a method of making progenitor cell expressing TM D comprising obtaining a clonal progenitor cell differentiated from a pkiripotent stem cell and contacting the clonal progenitor cell with a differentiation cocktail comprising one or more BMP family members thereby making a progenitor cell expressing TMND.

In still other embodiments the invention provides a method of making a tendon progenitor cell comprising contacting the clonal progenitor cell line 7PEND24 with one or more members of the BMP family thereby making a chondrocyte progenitor cell. In yet other embodiments the invention provides a method of making a progenitor cell expressing TMND comprising contacting the clonal progenitor cell line 7PEND with one or more members of the BMP family thereby making a progenitor cell expressing TMND.

fn certain embodiments the invention provides a method of making bone progenitor cell comprising obtaining a clonal progenitor cell differentiated from a piuripotent stem cell and contacting the clonal progenitor cell with a differentiation cocktail comprising one or more BMP family members thereby making a bone progenitor cell.

In other embodiments the invention provides a method of making a progenitor cell expressing one or more markers chosen from IBSP, COL2A 1 and COLIOA comprising obtaining a clonal progenitor cell differentiated from a piuripotent stem cell and contacting the clonal progenitor cell with a differentiation cocktail comprising one or more BMP family members thereby making a progenitor cell expressing one or more markers chosen from IBSP, COL2A 1 and COL IOA .

In still other embodiments the invention provides a method of making a bone progenitor cell comprising contacting the clonal progenitor cell line chosen from MEL2 and SM30 with one or more members of the BMP family thereby making a bone progenitor cell.

In yet other embodiments the invention provides a method of making a progenitor cell expressing one or more markers chosen from IBSP, COL2AI and COLIOA comprising contacting a clonal progenitor cell line chosen from MEL2 and SM30 with one or more members of the BMP family thereby making a progenitor cell expressing one or more markers chosen from IBSP, COL2A1 and COLIOA .

Iri some embodiments the invention provides a method of making a progenitor cell chosen from a chondrocyte progenitor, a tendon ceil progenitor and a bone cell progenitor comprising obtaining at least one clonal ceii line recited in table I and contacting the one clonal cell line with one or more members of the BMP family thereby making a progenitor cell chosen from a chondrocyte progenitor, a tendon cell progenitor and a bone cell progenitor.

In other embodiments the invention provides a method of making a progenitor cell expressing one or more markers chosen from COL2A, CRT AC 1 , TNMD and IBSP comprising obtaining at least one clonal cell line recited in table I and contacting the one clonal cell line with one or more members of the BMP family thereby making a progenitor ceil expressing one or more markers chosen from COL2A, CRTAC 1,TNMD and IBSP.

In still other embodiments the invention provides a kit for making a progenitor cell chosen from a chondrocyte progenitor cell, a bone progenitor cell and a tendon progenitor ceil comprising at least one clonal progenitor cell recited in Table I and at least one member of the BMP family.

In yet other embodiments the invention provides a system for generating progenitor cells comprising a piuripotent stem cell, such as an iPS cell, an hES cell or the like and a differentiated clonal progenitor cell. The differentiated clonal progenitor cell may, under appropriate conditions be induced to differentiate into a progenitor cell chosen from a chondrocyte progenitor cell, a bone progenitor cell and a tendon progenitor cell. The BMP family member suitable for use in the methods recited infra may include one or more of TGFp3 , TGFp i 0, BMP4, BMP6, BMP7 and GDF5.

The cell lines and cell progenitors described above may be the in vitro progeny of a pliii ipotent stem cell such as an iPS cell or a human embryonic stem cell, such as an established human embryonic stem cell line obtained fiom a commercial cell bank. As such the cell lines and progenitor cell lines may have essentiaiiy the same genome as their parental cell. Thus the cells may have a genome that is at least 95%, at least 96%, at least 97% at least 99%, at least 99.5%, at least 99.9% identical to its parental cell, such as an established line of pluripotent stem cells, such as human embryonic stem cells (hES cells) or an induced pluriptotent stem cell (iPS cell).

The cell lines and cell progenitors descrbied above may proliferate in culture for at least 20 passages. The cell lines and cell progenitors described above may proliferate in culture for about 20 passages.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 A, B and C: Levels of induction of genes in control MSCs and the clonal embryonic progenitor celt line 4D20.8 in the presence of diverse BMP family members. Values shown are relative expression compai'ed to cultured normal human articular chondrocytes (NHACs) as determined by qPCR.

A) Levels of COL2A1 expression. B) Levels of COLI0A1 expression. C) Levels of CRTAC1 expression.

Figures 2 provides graphical representations of theexpression level of Tenomodulin in cell progenitor lines treated with BMP family members as determined by qPCR.

Figures 3 provides graphical representations of the expression level of bone sialoprotein II in cell progenitor lines treated with BMP family members as determined by qPCR

Figure 4 shows a graphs showing the expression of a variety of genes (noted in bold at the top of each graph) and a variety of clonal progenitor cell lines (each line is noted just below the gene name at the top of the individual graphs. The cells were cultured with BMP family members to induce differentiation and gene expression. B2=BMP2; B2T+ BMP2/TGFP; B4=BMP4; B4T=BMP4/TGFP;

B6=BMP6; B6T= BMP6/TGFp; B7=BMP7; B7T=BMP7/TGFp; G5=GDF5; G5T=GDF5/TGFp;

T=TGFp. The factors were used at tfie following concentrations: BMP2- 50 ng/ml; BMP4- 10 ng/mi;

BMP6- 30 ng/ml; BMP7- 100 ng/ml; TGFp 10 ng ml; GDF5 100 ng ml, With the exception of the

7PEND24 cell line treated with G5, the absence of a bar indicates the specific marker was not detectible. In the case of G5 treated 7PEND24 the cells were not treated, thus no result is reported,

Figure 5 shows histological sections of pellet cultures of various clonal progenitors cultured with

BMP family members. Sections on the left side of each row are stained with hemotoxylin and eosin; the middle column is stained with safranin O (detecting glyocosamuio glycan found on chondrocytes) and collagen 2 staining is shown on the far right.

Figure 6 shows the relative expression of COL2A1 as determined by qPCR in the human clonal embryonic progenitor cell line EN7 in the control undifferentiated state vs differentiation in HyStem pellets supplemented with the shown concentrations of TGF beta family members. Values shown are fold-expression relative to cultured NHACs.

DETAILED DESCRIPTION OF THE INVENTION

Abbreviations

AFP Alpha fetoprotein

BMP Bone Morphogenic Protein

BRL Buffalo rat liver

BSA Bovine serum albumin

CD Cluster Designation

cGMP Current Good Manufacturing Processes

CNS Central Nervous System

DMEM Dulbecco's modified Eagle's medium

DMSO Dimethyl sulphoxide

DPBS Dulbecco's Phosphate Buffered Saline

EC Embryonal carcinoma

EC Cells Embryonal carcinoma cells; iiEC cells are human embryonal carcinoma cells

ECAPCs Embryonic cutaneous adipocyte progenitor cells

ECM Extracellular Matrix

ED Cells Embryo-derived cells; hED cells are human ED cells

EDTA Ethylenediamine tetraacetic acid

EG Cells Embryonic germ cells; hEG ceils are human EG cells

EP Cells Embryonic progenitor cells are cells derived from primordial stem cells that are more differentiated than primordial stem cells, in that they no longer display markers such as SSEA4, TRA 1-60 or TRA- 1-81 seroposiliviiy in the case of the human species, but have not fully differentiated. Embryonic progenitor cells correspond to the embryonic stages as opposed to the postnatal stage of development.

ES Cells - Embryonic stem cells; hES cells are human ES cells

FACS - Fluorescence activated cell sorting

FBS - Fetal bovine serum

GFP - Green Fluorescent Protein

GMP - Good Manufacturing Practices

hED Cells - Human embryo-derived cells

hEG Cells - Human embryonic germ celts are stem cells derived from the primordial germ cells of fetal tissue.

hEP Cells - Human embryonic progenitor cells are embryonic progenitor cells from the human species. hiPS Cells - Human induced pluripotent stem cells are cells with properties similar to hES cells obtained f om somatic cells after exposure to liES-specific transcription factors such as SOX2, KLF4, OCT4, MYC _> or NANOG, L1N28, OCT4, and SOX2,

HSE - Human skin equivalents are mixtures of cells and biological or synthetic matrices manufactured for testing purposes or for therapeutic application in promoting wound repair.

HUVEC - Human umbilical vein endothelial cell

ICM - Inner ceil mass of the mammalian b!astocyst-stage embryo.

iPS Cells - Induced pluripotent stem cells are cells with properties similar to hES cells obtained from somatic cells after exposure to ES-specific transcription factors such as SOX2, KLF4, OCT4, MYC, or NANOG, LIN28, OCT4, and SOX2.

LOH - Loss of Heterozygosity

MEM - Minimal essential medium

miRNA - Micro RNA

MSC - Mesenchymal Stem Cell

NHACs - Cultured Normal Human Articular Chondrocytes

N - Nuclear Transfer

PBS - Phosphate buffered saline

PEGDA - Polyethylene glycol diacrylate

PS fibroblasts - Pre-scarring fibroblasts are fibroblasts derived from the skin of early gestational skin or derived from ED cells that display a prenatal pattern of gene expression in that they promote the rapid healing of dermal wounds without scar formation.

RA - Retinoic acid

RFU - Relative Fluorescence Units

SCNT - Somatic Cell Nuclear Transfer

SFM - Serum-Free Medium

SPF - Specific Pathogen-Free

SV40 - Simian Virus 40

Tag - Large T-antigen

T-EDTA - Trypsin EDTA Definitions

The term "analytical reprograniming technology" refers to a variety of methods to reprogram the pattern of gene expression of a somatic cell to that of a more pluripotent state, such as that of an iPS, ES, ED, EC or EG cell, wherein the reprogramming occurs hi multiple and discrete steps and does not rely simply on the transfer of a somatic cell into an oocyte and the activation of that oocyte (see U.S.

application nos. 60/332,510, fiied November 26, 2001 ; 10/304,020, filed November 26, 2002; PCT application no. PCT/US02/37899, filed November 26, 2003; U.S. application no. 60/705625, filed August 3, 2005; U.S. application no. 60/729173, filed August 20, 2005; U.S. application no. 60/818813, filed July 5, 2006, PCT US06/30632, filed August 3, 2006, the disclosure of each of which is incorporated by reference herein).

The term "biastomere/morula ceils" refers to blastomere or morula cells in a mammalian embryo or blastomere or morula cells cultured in vitro with or without additional cells including differentiated derivatives of those cells.

The term "cell expressing gene X", "gene X is expressed in a cell" (or cell population), or equivalents thereof, means that analysis of the cell using a specific assay platform provided a positive result. The converse is also true (i.e., by a cell not expressing gene X, or equivalents, is meant that analysis of the ceil using a specific assay platform provided a negative result). Thus, any gene expression result described herein is tied to the specific probe or probes employed in the assay platform (or platforms) for the gene indicated.

The term "cell line" refers to a mortal or immortal population of cells that is capable of propagation and expansion in vitro.

The term "cellular reconstitutton" refers to the transfer of a nucleus of chromatin to cellular cytoplasm so as to obtain a functional cell.

The term "clonal" refers to a population of cells obtained the expansion of a single ceil into a population of cells all derived from that original single cells and not containing other cells.

The term "colony in situ differentiation" refers to the differentiation of colonies of cells (e.g., liES, hEG, hiPS, liEC or hED) in situ without removing or disaggregating the colonies from the culture vessel in which the colonies were propagated as undifferentiated stem cell lines. Colony in situ differentiation does not utilize the intermediate step of forming enibryoid bodies, though embryoid body formation or other aggregation techniques such as the use of spinner culture may nevertheless follow a period of colony in situ differentiation.

The term "cytoplasmic bleb" refers to the cytoplasm of a cell bound by an intact or permeabilized but otherwise intact plasma membrane, but lacking a nucleus.

The term "differentiated ceils" when used in reference to cells made by methods of this invention from pluripotent stem cells refer to cells having reduced potential to differentiate when compared to the parent pluripotent stem cells. The differentiated cells of this invention comprise cells that could differentiate further (i.e., they may not be terminally differentiated).

The term "direct differentiation" refers to process of differentiating: blastomere cells, morula cells, ICM cells, ED cells, or somatic cells reprogrammed to an undifferentiated state (such as in the process of making iPS ceils but before such cells have been purified in an undifferentiated state) directly without the intermediate state of propagating isolated undifferentiated stem cells such as liES cells as undifferentiated ceil lines. A nonlimiting example of direct differentiation would be the culture of an intact human blastocyst into culture and the derivation of ED cells without the generation of a human ES cell line as was described (Bongso et al, 1994. Human Reproduction 9:21 10). The term "embryonic stem cells" (ES cells) refers to cells derived from the inner cell mass of blastocysts, blastomeres, or monilae that have been serially passaged as cell Hues while maintaining au undifferentiated state (e.g. expressing TERT, OCT4, and SSEA and TRA antigens specific for ES cells of the species). The ES cells may be derived from fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate liES cells with hemizygosity or homozygosity in the MHC region. While ES cells have historically been defined as cells capable of differentiating into all of the somatic cell types as well as germ line when transplanted into a preimplantation embryo, candidate ES cultures from many species, including human, have a more flattened appearance in culture and typically do not contribute to germ line differentiation, and are therefore called "ES-like cells." It is commonly believed that human ES cells are in reality "ES-like", however, in this application we will use the term ES cells to refer to both ES and ES-like cell lines.

The term "histotypic culture" refers to cultured cells that are aggregated to create a tliree- dimensional structure with tissue-like cell density such as occurs in the culture of some cells over a layer of agar or such as occurs when cells are cultured in tliree dimensions in a collagen gel, sponge, or other polymers such as are commonly used in tissue engineering.

The term "human embryo-derived" ("hED") cells refers to blastomere-derived cells, morula- derived cells, blastocyst-derived cells including those of the inner cell mass, embryonic shield, or epiblast, or other totipotent or pluripotent stem cells of the early embiyo, including primitive endode m, ectoderm, mesoderm, and neural crest and their derivatives up to a state of differentiation correlating to the equivalent of the first eight weeks of normal human development, but excluding cells derived from hES cells that have been passaged as cell lines (see, e.g., U.S. Patents 7,582,479; 7,217,569; 6,887,706; 6,602,71 1 ; 6,280,718; and 5,843,780 to Thomson, incorporated herein by reference). The hED cells may be derived from preimplantation embryos produced by fertilization of an egg cell with sperm or DNA, nuclear transfer, or chromatin transfer, au egg cell induced to form a partheuote through parthenogenesis, analytical reprogramming technology, or by means to generate liES cells with hemizygosity or homozygosity in the HLA region.

The term "human embryonic germ cells" (liEG cells) refer to pluripotent stem cells derived from the primordial germ cells of fetal tissue or maturing or mature germ cells such as oocytes and spermatogonia! cells, that can differentiate into various tissues in the body. The liEG cells may also be derived from pluripotent stem cells produced by gynogenetic or androgenetic means, i.e., methods wherein the pluripotent cells are derived from oocytes containing only DNA of male or female origin and therefore will comprise all female-derived or male-derived DNA (see U.S. application nos. 60/161 ,987, filed October 28, 1999; 09/697,297, filed October 27, 2000; 09/995,659, filed November 29,2001 ;

10/374, 12, filed February 27, 2003; PCT application no. PCT/US/00/29551 , filed October 27, 2000; the disclosures of which are incorporated herein in their entirety).

The term "human embryonic stem cells" (hES cells) refers to human ES cells. The term "human iPS cells" refers to cells with properties similar to hES cells, including the ability to form all three germ layers when transplanted into immunocompromised mice wherein said iPS ceils are derived from ceils of varied somatic cell lineages following exposure to de-differentiation factors, for example hES cell-specific transcription factor combinations: KLF4, SOX2, MYC, and OCT4 or SOX2, OCT4, NANOG, and LIN28. Any convenient combination of de-differentiation factors may be used to produce iPS cells. Said iPS cells may be produced by the expression of these genes through vectors such as retroviral, lentiviral or adenoviral vectors as is known in the art, or through the introduction of the factors as proteins, e.g., by permeabilization or other technologies, For descriptions of such exemplary methods see: PCT application number PCT US2006/030632, filed on August 3, 2006; U.S. Application Ser. No. 1 1/989,988; PCT Application PCT US2000/018063, filed on June 30, 2000;

U.S. Appiciation Ser. No. 09,736,268 filed on December 15, 2000; U.S. Applciation Ser. No, 10/831 ,599, filed April 23, 2004; and U.S. Patent Publication 20020142397 (App. Ser. No. 10/015,824, entitled "Methods for Altering Cell Fate"); U.S. Patent Publication 20050014258 (App. Ser. No. 10/910,156, entitled "Methods for Altering Cell Fate"); U.S. Patent Publication 20030046722 (App. Ser. No.

10/032, 191 , entitled "Methods for cloning mammals using reprogrammed donor chromatin or donor cells"); and U.S. Patent Publication 20060212952 (App. Ser. No. 1 1/439,788, entitled "Methods for cloning mammals using reprogrammed donor chromatin or donor cells") all of which are incorporated herein by reference in their entirety.

The term "1CM ceils" refers to the cells of the inner cell mass of a mammalian embryo or the cells of the inner cell mass cultured in vitro with or without the surrounding trophecto dermal cells.

The term "oligocional" refers to a population of cells that originated from a small population of cells, typically 2- 1000 cells, that appear to share similar characteristics such as morphology or the presence or absence of markers of differentiation that differ from those of other cells in the same culture. Oligocional cells are isolated from ceils that do not share these common characteristics, and are allowed to proliferate, generating a population of ceils that are essentially entirely derived from the original population of similar cells.

The term "organotypic culture" refers to cultured cells that are aggregated to create a three- dimensional structure with tissue-like cell density such as occurs in the culture of some cells over a layer of agar, cultured as teratomas in an animal, otherwise grown in a three dimensional culture system but wherein said aggregated cells contain cells of different cell lineages, such as, by way of nonlimiting examples, the combination of epidermal keratinocytes and dermal fibroblasts, or the combination of parenchymal cells with their corresponding tissue stroma, or epithelial cells with mesenchymal cells.

The term "p!uripotent stem cells" refers to animal cells capable of differentiating into more than one differentiated cell type. Such cells include hES cells, blastomere/morula cells and their derived liED cells, liiPS cells, liEG cells, liEC cells, and adult-derived cells including mesenchymal stem cells, neuronal stem cells, and bone marrow-derived stem cells. Pluripotent stem cells may be genetically modified or not genetically modified. Genetically modified cells may include markers such as fluorescent proteins to facilitate their identification within the egg.

The term "pooled clonal" refers to a population of cells obtained by combining two or more clonal populations to generate a population of cells with a uniformity of markers such as markers of gene expression, similar to a clonal population, but not a population wherein all the cells were derived from the same original clone. Said pooled clonal lines may include cells of a single or mixed genotypes. Pooled clonal lines are especially useful in the cases where clonal lines differentiate relatively early or alter in an undesirable way early in their proliferative lifespan.

The term "primordial stem cells" refers to animal cells capable of differentiating into more than one differentiated cell type. Such cells include hES cells, blastomere/morula cells and their derived iiED ceils, iPS cells, hEG cells, hEC cells, and adult-derived ceils including mesenchymal stem cells, neuronal stem cells, and bone marrow-derived stem cells. Primordial stem cells may be genetically modified or not genetically modified. Genetically modified cells may include markers such as fluorescent proteins to facilitate their identification in vitro or in vivo.

Before the present invention is described in greater detail, it is to be understood that this invention is not iimited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be iimited only by the appended claims.

Where a range of values is provided, it is understood that each inter veiling value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

Certain ranges are presented herein with numerical values being preceded by the term "about." The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number t!iat the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are now described. All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by inference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

It is noted that, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention, Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

METHODS

In addition to the methods described below, methods that find use in the production and use of the ceil lines described herein can be found in the following: U.S. Patent Publication 20080070303, entitled "Methods to accelerate the isolation of novel cell strains from pluripotent stem celts and cells obtained thereby"; U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; U.S. provisional application Ser. No. 61/226,237 filed on July 16, 2009 and titled "Methods and Compositions Useful for In Vitro and In Vivo Chondrogenesis Using Embiyonic Progenitor Celi Lines"; PCT Application PCT/US2006/OI3519, filed on April I I, 2006, entitled "NOVEL USES OF CELLS WITH PRENATAL PATTERNS OF GENE EXPRESSION"; and PCT application Ser. No. PCT/US201 1/037969 filed on May 25, 201 1 and entitled "Improved Methods of Screening Embiyonic Progenitor Cell Lines", each of which is incorporated by reference herein in its entirety. hES cell culture and generation of candidate cultures.

The hES cell lines used were previously described H9 {National Institutes of Health-registered as

WA09) and the line (MA03) derived at Advanced Celi Technology (West et al., 2008, Regenerative Medicine vol. 3(3) pp, 287-308). hES cells were routinely cultured in hES medium (KO-DMEM

(Invitrogen, Carlsbad, CA), I X nonessential amino acids (invitrogen, Carlsbad, CA), I X Glutainax-1 (Invitrogen, Carlsbad, CA), 55 uM beta-mercaptoethanol (Invitrogen, Carlsbad, CA), 8% Knock-Out Serum Replacement (Invitrogen, Carlsbad, CA), 8% Plasmanate, 10 ng ml LiF (Miliipore, Billerica, MA), 4 ng/ml bFGF (Miliipore, Billerica, MA), 50 unit/ml Penicillin - 50 units/ml Streptomycin

(Invitrogen, Carlsbad, CA). The hES cell lines were maintained at 37deg C in an atmosphere of 10% C02 and 5% 02 on Mitomycin-C treated mouse embryonic fibroblasts (MEFs) and passaged by trypsinization or periodic manual selection of colonies. For the production of clonal embryonic progenitors, hES cells were plated at 500-10,000 cells per 1 cm dish and then differentiated under a two-step protocol, the first step being the differentiation of hES cells under an array of conditions to yield diverse heterogeneous cultures of cells called "candidate cultures." The generation of candidate cultures was performed with either adherent hES cells grown on MEFs (colony in situ differentiation) or with iiES-derived embryoid bodies (EB). For colony in situ differentiation experiments, hES cells were allowed to grow to confluence and differentiated by a variety of methods (as described in Supplementary Table I from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety). By way of nonlimiting example, in the case of colony in situ differentiation in DMEM with 10% FCS, culture medium was aspirated from cultures of hES cell colonies on mouse feeders, and the media was replaced with DMEM medium containing 10% FBS for differentiation and after various time periods (1, 2, 3, 4, 5, 7, and 9 days in differentiation medium), The ceils were then dissociated with 0.25% trypsin (Invitrogen, Carlsbad, CA) and plated in 150 cm ² flasks for expansion. The candidate cells from each . time point in the 1 0 cm ² flasks were plated out for cloning and expansion as described below. For EB differentiation experiments, confluent liES cultures were treated for 15 minutes at 37 deg C with 1 mg/ml Collagenase IV (in DMEM, Invitrogen, Carlsbad, CA) to release the colonies. The detached, intact colonies were scraped and collected by centrifugation ( 150xg for 5 minutes), resuspended in

differentiation medium described in Supplementary Table 1 (from West et a!., 2008, Regenerative

Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) and transferred to a single well of a 6-well Ultra-Low Binding plate (Corning, distributed by Fisher Scientific, Pittsburgh, PA) containing the same differentiation medium. The Ebs were allowed to differentiate, depending on the experiment, from 4-7 days and the differentiated Ebs dissociated with 0.25% tiypsin, plated in 6-well plates containing various expansion medium. The candidate cultures in the 6 well plates are allowed to grow to confluence and plated out for cloning and expansion as described below.

Isolation and expansion of clonal cell lines.

The partially differentiated candidate cell cultures described above were dissociated with 0,25% trypsin to single cells and plated onto duplicate 15 cm gelatin coated plates at cloning densities of approximately 500 and/or 1 ,000 and/or 2,000 and/or 5,000 cells per plate for further differentiation and expansion in a variety of growth media shown in Supplementary Table I (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety). The clonal density cells were allowed to grow, undisturbed, for 10-14 days and colonies that develop were identified and collected with cloning cylinders and trypsin using standard techniques. The cloned colonies were transferred onto gelatin-coated 24 well plates for expansion. As the clones become confluent in the 24 well plates (but without letting the cells remain confluent for more than 2 days), they were sequentially expanded to 12 well, 6 well, T-25 flask, T-75 flask, T- 150 or T-225 flasks and, finally, roller bottles. Clonal cell lines that expand to the roller bottle stage ate assigned a unique ACTC identification number, photographed and cryopreserved in aliquots for later use. Once cells reached a confluent 6 well dish, they were passaged to a T-25 flask and a fraction of the cells (5 x 10 ⁵ ) were removed for plating in a gelatinized 6 cm dish for gene expression profile analysis. Alternatively, some cells were first passaged to T-225 flasks, then a fraction of the cells (5 x 10 ⁵ ) were removed for plating in a gelatinized 6 cm dish for gene expression profile analysis. The population doublings that the cells had undergone were therefore determined to be 18-21 PDs, Following removal of the cell clones from the cloning plates, remaining colonies were visualized by Crystal violet staining (Sigma HT9132- 1 L) in 100% ethanol per manufacturer's instructions. Cell Culture media utilized in experiments and described in text: Smooth muscle cell basal medium (Cat# C-22062B) and growth supplement (Cat# C-39267), Skeletal muscle basal medium (Cat# C-22060B) and growth supplement (Cat# C-39365), Endothelial cell basal medium (Cat# C-22221) and growth supplement (Cat# C-39221), Melanocyte cell basal medium (Cat# C-24010B) and growth supplement (Cat# C-39415) were obtained from PromoCell GmbH (Heidelberg, Germany). Epi-Life, calcium free/phenol red free medium (Cat# M-EPIcf/PRF-500) and low serum growth supplement (Cat# S-003-10) were purchased from Cascade Biologies (Portland, Oregon). Mesencult basal medium (Cat# 05041 ) and supplement (Cat# 5402) were obtained from Stem Cell Technologies (Vancouver, BC). Dulbecco's modified Eagle's medium (Car# 1 1960-069) and Fetal bovine serum (Cartf SH30070-03) were purchased from Invitrogen (Carlsbad, CA) and Hyclone (Logan, UT) respectively. Medium and supplements were combined according to manufacturer's instructions.

Clonal Embryonic Progenitor Line Nomenclature:

The cell lines of the present invention along with their alternative designations are listed in Table ill along with synonyms that represent minor modifications that result from the manipulation of the names resulting from bioinformattcs analysis, including the substitution of"-" for "." and vice versa, the inclusion of an "x" before cell line names beginning with an arabic number, and suffixes such as "biol " or "bio2" that indicate biological replicates of the same line which are examples of cases where a frozen ampule of the same line was thawed, propagated, and used in a parallel analysis and "Rep l " or "Rep2" which indicate technical replicates wherein RNA isolated from a given cell line is utilized a second time for a repeat analysis without thawing or otherwise beginning with a new culture of cells. Passage number (which is the number of times the cells have been trypsinized and replated) for the cell lines is usually designated by the letter "P" followed by an arabic number, and in contrast, the population doubling number (which refers to the number of estimated doublings the ceil lines have undergone in clonal expansion from one cell) is designated by the letters "PD" followed by an arabic number. The number of PDs in a passage varied from experiment to experiment but generally each trypsinization and replating was at a 1 :3 to 1 :4 ratio (corresponding to an increase of PDs of 1.5 and 2 respectively). In the expansion of clones, the original colonies were removed from tissue culture plates with cloning cylinders, and transferred to 24-well plates, then 12-weil _; and 6-well as described above. First confluent 24 well is designated PI, the first confluent 12 well culture is P2, the first 6-well culture is P3, then the six well culture was then split into a second 6 well plate (P4) and a T25 (P4). The second 6 well at P4 is utilized for RNA extraction (see U.S. patent application Ser. No. 12/504,630 filed on July 1 , 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells

Obtained Thereby", incorporated herein by reference in its entirety) and represents about 18-21 PD of clonal expansion. Typical estimated subsequent passages and PDs are the following split to a T75 flask (19.5-22.5 PD), the P6 passage of the cells to a T225 flask (21-24 PD), then P7 being the transfer of the cells to a roller bottle (850cm ² , 23-26 PD), and P8 the split into 4 rollers (25-28 PD). The ranges shown above in parenthesis represent estimated ranges in cell counts due to cell sizes, attachment efficiency, and counting error.

Propagation of Clonal, Pooled Clonal, Oligoclonal, and Pooled Oligoclonal Cell Lines.

Aspects of the invention provide methods for identifying and differentiating embryonic progenitor cell lines that are derived from a single cell (clonal) or cell lines that are "pooled clonal" meaning that ceil lines cloned have indistinguishable markers, such as gene expression markers, and are combined to produce a single cell culture often for the purpose of increasing tlie number of cells in a culture, or are oligoclonal wherein a line is produced from a smaii number, typically 2-1 ,000 similar cells and expanded as a cell line, or "pooled oligoclonal" lines which are lines produced by combining two or more oligoclonal cell lines that have indistinguishable markers such as patterns of gene expression. Said clonal, pooled clonal, oligoclonal, or pooled oligoclonal cell lines are then propagated in vitro through removal of the cells from the substrate to which they are affixed, and the re-plating of the cells at a reduced density of typically 1/3 to 1/4 of the original number of cells, to facilitate further proliferation. Examples of said cell lines and their associated cell culture media is disclosed in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; and West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, both of which aree incorporated herein by reference, including supplemental information. The compositions and methods of the present invention i'elate to said cell lines cultured as described but for greater than 21 doublings of clonal expansion.

Gem Expression Analysis To reduce variations in gene expression due to cell cycle artifacts, and to capture an early gene expression profile of the cells, upon being expanded to six well plates, on the day the cells reached confluence, the cells were placed in media with a reduction of serum to 0.5% in the case where the original serum concentration was >5%. In all other cases, serum and/or other growth factors was reduced to 10% of their original values. These quiescence conditions were imposed for Ave days and all cultures were re-fed two days prior to harvest to reduce feeding difference artifacts. So, by way of example, if the original media was DME medium with 10% FCS, then the quiescence synchronization media was DMEM with 0.5% FCS. Total RNA was extracted directly from cells growing in 6-well or 6 cm tissue culture plates using Qiagen Rneasy mini kits according to the manufacturer's instructions. RNA concentrations were measured using a Beckman DU530 or Nanodrop spectrophotometer and RNA quality determined by denaturing agarose gel electrophoresis or an Agilent 2100 bioanalyzer. Whole- genome expression analysis was carried out using Affymetrix Human Genome U133 Plus 2.0

GeneChip® system, Illumina Human-6 vl and HumanRef-8 vl Beadchips (Illumina 1), and Illumina Human-6 v2 Beadchips (Illumina 2), and RNA levels for certain genes were confirmed by quantitative PCR. For Illumina BeadArrays, total RNA was linearly amplified and biotin-labeled using Illumina TotalPrep kits (Ambion), and cRNA was quality controlled using an Agilent 2 [ 00 Bioanalyzer, cRNA was hybridized to Illumina BeadChips, processed, and read using a BeadStation array reader according to the manufacturer's instructions (Illumina), Relative Fluorescence Unit (RFU) values for all of the cell lines with common probe sets were quantile normalized, in Supplementary Tables Il-IV (from West et al,, 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which are incorporated by reference herein in their entirety) the genes are displayed in rank order (highest-lowest) for the ratio of (highest RFU value observed for the gene in the entire set of cell lines - Average RFU va!ue)/Ave RFU value. In

Supplementary Table V (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is i corporated by reference herein in its entirety) the top 45 differentially expressed genes rank ordered (highest-lowest) for the ratio of (highest RFU value observed for the gene in the individual cell line/A ve RFU value for all cell lines. In Supplementary Table VI (from West et al, 2008, Regenerative Medicine vol, 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) the genes corresponding to recognized CD antigens are displayed in rank order (highest-lowest) and also (lowest to liighest) for the ratio of highest RFU value observed for the gene in the entire set of cell lines/A ve RFU value and lowest RFU value observed for the gene in the entire set of cell lines/Ave RFU value respectively. In

Supplenientaty Table VII (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) the genes corresponding to secreted proteins are displayed in rank order (highest-lowest) for the ratio of highest RFU value observed for the gene in the entire set of cell lines/Ave RFU value.

Low Throughput Screening and qPCR The clonal, oligoclonal, or pooled clonal or pooled oligoclonai embryonic progenitor cell lines of the present invention at either <21 or preferably >2 i doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, or 70 doublings of clonal expansion (since before 29 doublings of clonal expansion the cells are available only in limited quantities, and beyond 70 doublings the cells normally approach senescence) ate screened simultaneously in I , 2, 3, 4, 5, or preferably 10 or more diverse differentiation conditions. Said differentiation conditions may include without limitation, all combinations of the human embryonic progenitor cell lines listed in Table I (showing gene expression markers at 18-21 doublings of clonal expansion), together with culture conditions as listed in Table II, exposed to the culture media listed and supplemented factors described herein. The cells are cultured in said differentiation conditions for 1-6 weeks, most preferably two to four weeks.

The readout of the assay can be mRNA markers of differentiation, e.g., as measured by hybridization to arrayed target sequences, including but not limited to microarrays or by PCR. Detection can also be at the level of peptides or proteins that may be detected through the use of specific antibodies, through the use of enzyme assays, mass spectroscopy, or other similar means well known in the art.

In the case of qPCR, protocols may vary and are well-known in the art. By way of noniimiting example, samples for testing are prepared in standard Optical 96-well reaction piates (Applied

Biosystems Carlsbad, CA, PN 4306737) consisting of 30ng of RNA equivalent of cDNA, 0.4uM per primer, Ultra-Pure distilled water (Invitrogen), diluted 1 : 1 with 12.5ul of Power SYBR Green PCR Master Mix (Applied Biosystems Carlsbad, CA, Cat# 4367659) incorporating AmpliTaq Gold DNA polymerase in a total reaction volume of 25ul. Real-Time qPCR is run using Applied Biosystems 7500 Real-Time PCR System employing SDSvl .2 software. Amplification conditions are set at 50°C for 2 mill, (stage 1), 95°C for 10 min. (stage 2), 40 cycles of 95°C for 15 sec then 60°C for 1 min (stage 3), with a dissociation stage at 95°C for 15 sec, 60°C for 1 min, and 95°C for 1 5 sec (stage 4). Ct values for amplification products of genes of interest are normalized to the average Ct value of 3 housekeeping genes (GAPD, RPS 10, and GUSB).

Medium Throughput Screen of the Fate Space of Clonal or Oligoclonal Embryonic Progenitors.

The clonal, oligoclonal, or pooled clonal or pooled oligoclonal embryonic progenitor cell lines of the present invention at either <2I or preferably >21 doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, or 70 doublings of clonal expansion (since before 29 doublings of clonal expansion the cells are available only in limited quantities, and beyond 70 doublings the cells normally approach senescence) are screened simultaneously in 10, 20, 30, 40, 50, or preferably 100 or more diverse differentiation conditions. Said differentiation conditions may include without limitation, all combinations of the human embryonic progenitor cell lines listed in Table I (showing gene expression markers at 18-21 doublings of clonal expansion), together with culture conditions that include BMP family members including TGFB I, TGFB2, TGFB3, BMP2, BMP4 (1 -100 ng mL, preferably lOng mL), BMP6 (3-300 ng mL, preferably 30ng mL)„ BMP7 (10-1,000 ng mL, preferably 100ng/mL)„ and GDF5 (10-1,000 ng/mL, preferably lOOng mL) or combinations of these BMP family members. The cells ate cultured in said differentiation conditions for 1-6 weeks, most preferably two weeks.

The readout of the assay can be tnRNA markers of differentiation, e.g., as measured by hybridization to arrayed target sequences, including but not limited to microarrays or PCR. Detection can also be at the level of peptides or proteins that may be detected through the use of specific antibodies, through the use of enzyme assays, mass spectroscopy, or other similar means well known in the art.

Medium Throughput qPCR Screen of EP Cell Differentiation

The clonal, oligoclonal, or pooled clonal or pooled oligoclonal embryonic progenitor cell lines of the present invention, including but not limited to those shown in Table I, at either <21 or preferably >2I doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 doubiings of clonal expansion are plated in 6 well culture plates with each well having 10 microiiiasses of 250,000 cells (i.e. 2,5 million ceils per well). Aitematively the cells are treated with other culture conditions as listed in Table II using the same number of cells, exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V. The cells are cultured in said differentiation conditions for 1-6 weeks, most preferably four weeks.

RNA is prepared from cell lysates using the Rneasy mini kits (Qiagen) according to the manufacturer's instructions. Briefly, cell cultures (micromasses) are rinsed in PBS, then lysed in a minimal volume of the RLT lysis buffer, After incubation on ice, the celi debris is removed by ceutrifugation and the lysate is mixed with RLT buffer, after which ethanol is added to the mixture. The combined mixture is then loaded onto the Rneasy spin column and centrifuged; the loaded column is then washed and the purified RNA is released from the column with a minimal volume of DEPC-treated water (typically 30 ul or less). The concentration of RNA in the final eluate is determined by absorbance at 260 nm.

cDNA synthesis is performed using the Superscript First Strand cDNA kit (InVitrogen; Carlsbad, CA). Briefly, 2,5 ug of purified RNA is heat denatured in the presence of random hexamers. After cooling, the First strand reaction is completed using SuperSript reverse transcriptase enzyme and associated reagents from the kit. The resulting product is further purified using QIAquick PCR

Purification kits (Qiagen) according to the manufacturer's instructions. Briefly, PB buffer is added to the first strand cDNA reaction products, then the mixture is loaded onto the QIAquick spin column and centrifuged. The column is washed with PE buffer and the purified cDNA is eluted from the column using a minima! volume of water (20 ul).

qPCR primer pairs are synthesized for each target gene. Briefly, primer pairs for a target gene are designed to amplify only the target inR A sequence and optimally have annealing temperatures for their target sequences that lie in the range of 65-80 °C and unique amplification products in the size range of 100-500 bp. Primer pairs are supplied at working concentrations (10 uM) to BioTrove, Inc. (Wobii ii, MA) for production of a custom qPCR Open Array plate. OpenArray plates are designed to accommodate 56-336 primer pairs and the final manufactured plate with dried down primer pans is provided to the service provider. Purified cDNA reaction products (2.) and Syber green master mix are loaded into individual weils of the OpenArray plate using OpenArray autolader device (BioTrove). The plate is sealed and the qPCR and loaded into the NT Iinager/Cycier device (BioTrove) for amplification. Ct values for each sample are calculated using the OpenArray application software.

Markers of differentiation are not those present in embryonic progenitor cell lines, but are present in later stages of differentiation, it is not obvious to what an effective array of such markers would be. For example, COL2A1 is not expressed in the clonal embiyonic progenitor cell lines, but is markedly induced >100-fold in a subset of the cell lines of the present invention. Previous attempts to invent an array of differentiation markers were not useful in the context of the present invention because they included a majority of markers that were expressed in both embryonic progenitor cell types and in terminally- differentiated cell types (Luo, Y., Cai, J,, Ginis, I., Sun, Y,, Lee, S., Yu, S.X., Hoke, A., and Rao, M. 2003. Designing, testing, and validating a focused stem cell microarray for characterization of neural stem cells and progenitor cells. Stem Ceils, 21 :575-587). An example of a list of said markers useful in determining that a particular differentiation condition induced terminal differentiation in embiyonic progenitor cell lines a majority of which are not expressed in embryonic progenitor cell lines are shown in Table III.

Isolation of secreted or extracellular matrix proteins

Secreted Protein Isolation Protocol I - Conditioned medium

Cells were grown in eit!ier their normal propagation medium (West et a!., 2008, Regen Med vol. 3(3) pp. 287-308) or the differentiation conditions described herein. To obtain conditioned medium on a smaller scale (typically 1-2 L or less), the cells were grown in monolayer cultures in T150, T175 or T225 flasks (Coming or BD Falcon) in a 37°C incubator with 10% C0 ₂ atmosphere. For larger volume medium collections, the cells were typically grown either in 2 L roller bottles, on microcaiTier suspensions (porous such as Cytodex varieties from Sigma- Aid rich, St, Louis, MO, or non-porous such as from SoloHill Engineering, Ann Arbor, MI) in spinner flasks or other bioreactors, or in hollow fiber cartridge bioreactors (GE Healthcare, Piscataway, NJ). Prior to conditioned medium collection, the cultures were rinsed twice with PBS and then incubated for 2 hours at 37°C in the presence of serum-free medium wherein the medium is the same basal medium as described herein for the propagation or differentiation of the cells, in order to remove fetal serum proteins. The serum-free medium was then removed and replaced with f esh medium, followed by continued as described herein at 37°C for 24-48 hours.

The culture-conditioned medium was then collected by separation from the cell-bound vessel surface or matrix (e.g., by pouring off directly or after sedimentation) and processed further for secreted protein concentration, enrichment or purification, As deemed appropriate for the collection volume, the culture medium was fust centrifuged at 500 to 10,000 xg to remove residual cells and cellular debris in 15 or 50 ml centrifuge tubes or 250 ml bottles. It was then passaged through successive 1 μηι or 0.45 μηι and 0.2 μιη filter units (Corning) to remove additional debris, and then concentrated using 10,000 MW cutoff ultrafiltration in a stirred cell or Cent icon centrifuge filter (Amicon- illipore) for smaller volumes, or using a tangential flow ultrafiltration unit (Amicon-Millipore) for larger volumes. The retained protein concentrate was then dialyzed into an appropriate buffer for subsequent purification of specific proteins, and further purified using a combination of isoelectric focusing, size exclusion chromatography, ion exchange clu'omatography, hydrophobic or reverse phase chromatography, antibody affinity chromatography or other well-known methods appropriate for the specific proteins. During the various steps in the purification process, collection fractions were tested for the presence and quantity of the specific secreted protein by ELISA (e.g., using BMP- 2 or BMP-7 ELISA kits from R&D Systems, Minneapolis, MN). The purified proteins were then kept in solution or lyophilized and then stored at 4 or minus 20-80°C.

Secreted Protein Isolation Protocol 2 Urea-mediated protein extraction

In the case of some secreted proteins, interactions with the cell or ECM components may reduce the simple diffusion of factors into the medium as described above in Secreted Protein Isolation Protocol 1. A simple comparison of the yield in the two protocols will suffice to determine which protocol provides the highest yield of the desired factors. In the case of Secreted Protein Isolation Protocol 2, a low concentration of urea is added to facilitate the removal of factors, hi the case of the examples provided, all urea extractions were performed two days subsequent to feeding. On the second day, cell monolayers in T- 150 cell culture flasks were rinsed twice with CMF-PBS and then incubated for two hours at 37°C in the presence of serum-free medium. The rinse with CMF-PBS and the incubation in serum-free medium together aid in the removal of fetal serum proteins from the surface of the cells. The serum-free medium was then removed and 10 ml /T1 0 of freshly made 200 niM urea in CMF-PBS was added. The flasks were then placed on a rocker at 37°C, for 6.0 hours. The \irea solution was then removed and immediately frozen at -70°C.

Extracellular Matrix Isolation Protocol 1 - DOC-Mediated Preparation '

Extracellular matrix proteins can be extracted using the method of Hedman et at, 1979 (Isolation of the pericellular matrix of human fibroblast cultures. J. Cell Bioi. 81 : 83-91 ). Cell layers are rinsed three times with CMF-PBS buffer at ambient temperature and then washed with 30 mL of 0.5% sodium deoxycholate (DOC), 1 niM phenylmethylsulfonylfluride (PMSF, from 0.4M solution in EtOH), CMF- PBS buffer 3 10 min. on ice while on a rocking platform. The flasks were then washed in the same manner with 2mM Tris-HCI, pH 8.0 and I m PMSF 3 5 min. The protein remaining attached to the flask was then removed in 2 niL of ge! loading buffer with a rubber policeman. Screening of secreted or extracellular matrix proteins for biological activity

The ceil lines of the present invention are also useful as a means of screening diverse embryonic secretomes for varied biological activities. The ceil lines of the present invention cultured at 18-21 doublings of clonal expansion express a wide array of secreted soluble and extracellular matrix genes (see US Patent Application Publication 2010/0184033 entitled "METHODS TO ACCELERATE THE ISOLATION OF NOVEL CELL STRAINS FROM PLURIPOTENT STEM CELLS AND CELLS OBTAINED THEREBY" filed on July 16, 2009, incorporated herein by reference). At 21 or more doublings of clonal expansion, the cells of the present invention differentially express secreted soluble and extracellular matrix genes. These proteins, proteoglycans, cytokines, and growth factors may be harvested from the cell lines of the present invention by various techniques known in the art including but not limited to Secreted Protein Isolation Protocol 1 or 2. These pools of secreted and extracellular matrix proteins may be further purified or used as mixtures of factors and used in varied in vitro or in vivo assays of biological activity as is known in the art.

Applications

The disclosed methods for the culture of animal cells and tissues at e useful in generating cells or progeny thereof in mammalian and human ceil therapy, such as, but not limited to, generating human cells useful in treating orthopedic disorders in humans and nonhunian animals.

hi certain embodiments of the invention, single cell-derived and oligoclonal cell-derived cells derived by methods of this invention, are utilized in research and treatment of disorders relating to cell biology, cell-based drug discovery and in cell therapy. The single cell-derived cell populations derived using the methods of the present invention may already have received the requisite signals to be directed down a differentiation pathway. For example, some paraxial or somatopleuric single cell-derived populations of cells may express genes consistent with dermal fibroblast gene expression, in particular, a prenatal pattern of gene expression useful in promoting scarless wound repair and in promoting elastogenesis. Such cells include, for example, including but not limited to: cells of the heart; cells of the musculoskeletal system; cells of the nervous tissue; cells of the respiratory system; ceils of the endocrine system including preadipocytes or adipocytes including but not limited to cutaneous white and brown preadipocytes or adipocytes capable of causing weight loss, increasing insulin sensitivity, lowering blood glucose, and thereby reducing the risk of vascular disease a other symptoms of Type II diabetes, in a human or nonhunian mammal; cells of the vascular system; cells of the hematopoietic system; cells of the integumentary system; cells of the urinary system; cells of the joint such as articular chondrocytes, tendons, synovial membrane, and meniscus; or cells of the gastrointestinal system. Such cells may be stably grafted iti a histocompatible host when the cells are grafted into the tissue into which the cells would normally differentiate. Such tissues include, but are not limited to: endoderm-embryonic tissues; mesoderm -embryonic tissues; ectoderm-embryonic tissues; or extraembryonic cells.

In certain embodiments of the invention, single cell-derived and oligoclonal cell-derived cells are introduced into the tissues in which they normally reside in order to exhibit therapeutic utility. In certain embodiments of the invention, single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, are utilized in inducing the differentiation of other pluripotent stem cells. The generation of single cell-derived populations of cells capable of being propagated in vitro while maintaining an embryonic pattern of gene expression is useful hi inducing the differentiation of other pluripotent stem cells. Cell-cell induction is a common means of directing differentiation in the early embryo. Many potentially medically-useful cell types are influenced by inductive signals during normal embryonic development, including spinal cord neurons, cardiac cells, pancreatic beta cells, and definitive hematopoietic cells. Single cell-derived populations of cells capable of being propagated in vitro while maintaining an embryonic pattern of gene expression can be cultured in a variety of i vitro, in ovo, or in vivo culture conditions to induce the differentiation of other pluripotent stem cells to become desired cell or tissue types. Induction may be carried out in a variety of methods that juxtapose the inducer ceil with the target cell. By way of nonlimiting examples, the inducer cells may be plated in tissue culture and treated with mitomycin C or radiation to prevent the cells from replicating further. The target cells are then plated on top of the mitotically-inactivated inducer cells. Alternatively, single cell-derived inducer cells may be cultured on a removable membrane from a larger culture of cells or from an original single cell-derived colony and the target cells may be plated on top of the inducer ceils or a separate membrane covered with target cells may be juxtaposed so as to sandwich the two cell layers in direct contact. The resulting bilayer of cells may be cultured in vitro, transplanted into a SPF avian egg, or cultured in conditions to allow growth in three dimensions while being provided vascular support (see, for example, international patent publication number WO/2005/068610, published July 28, 2005, the disclosure of which is hereby incorporated by reference). The inducer cells may also be from a source of pluripotent stem cells, including hES or ItED cells, in which a suicide construct has been introduced such that the inducer cells can be removed at will. Cell types useful in single cell-derived and oligoclonal cell-derived induction may include cases of induction well known in the art to occur naturally in normal embryonic development. In certain embodiments of the invention, single cell-derived cells and oligoclonal cell- derived cells, derived by methods of this invention, are used as "feeder cells" to support the growth of other cell types, including pluripotent stem cells. The use of single cell-derived ceils and oligoclonal cell- derived cells of the present invention as feeder cells alleviates the potential risk of transmitting pathogens from feeder cells derived from other mammalian sources to the target cells. The feeder cells may be inactivated, for example, by gamma ray irradiation or by treatment with mitomycin C, to limit replication and then co-cultured with the pluripotent stem cells. In certain embodiments of the invention, the extracellular matrix (ECM) of single cell-derived and oligoclonal cell-derived ceils, derived by methods of this invention, may be used to support less differentiated cells (see Stojkovic et al., Stem Cells (2005) 23(3):306-14). Certain cell types that normally require a feeder layer can be supported in feeder-free culture on a matrix (Rosier et al., Dev Dyn. (2004) 229(2):259-74). The matrix can be deposited by preculturing and lysing a matrix-forming ceil line (see WO 99/20741 ), such as the STO mouse fibroblast line (ATCC Accession No. CRL-1503), or human placental fibroblasts.

In certain embodiments of the invention, the conditioned media of single ceii-derived and oligoclonal cell-derived cell cultures may be collected, pooled, filtered and stored as conditioned medium. This conditioned medium may be formulated and used for research and therapy. The use of conditioned medium of single cell-derived and oligoclonal cell-derived cell cultures may be advantageous in reducing the potential risk of exposing cultured cells to non-human animal pathogens derived from other mammalian sources (i.e. xenogeneic free).

Our discovery that various single cell-derived and oligoclonal cell-derived ceils in early embryonic lineages may be propagated without the loss of their embryonic phenotype allows numerous types of embryonic mesodermal and neural crest-derived mesenchymal cells with a prenatal pattern of gene expression to be cryogenically stored, retrieved, scaled, and used in assays as described herein to discover novel differentiation protocols for these novel and site-specific cell types. Uses for the derived cells and the differentiation methods described herein may also be used for research, ding discovery, and cell-based therapy.

In certain embodiments of the invention, the single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, may be used to generate skin equivalents, as well as to reconstitute full-thickness human skin, according to the methods described in U.S. application nos. 09/037, 191 , filed March 9, 1998 (U.S. publication no. 2001/0048917, published December 6, 2001 ); 10/013 124, filed December 7, 2001 (U.S. publication no. 2002/0120950, published August 29, 2002); 10/982,186, filed

November 5, 2004 (U.S. publication no. 2005/01 18146, published June 2, 2005); the disclosure of each of which is incorporated herein by reference. For example, the single cell-derived and oligoclonal cell- derived cells may be incorporated into a layered cell sorted tissue that includes a discrete first cell layer and a discrete second cell layer that are formed in vitro by the spontaneous sorting of cells from a homogenous cell mixture, The first cell layer may include any cell type, but preferably includes epithelial cells, in particular, keratinocytes. Other cell types that may be used in the first cell layer are CaCo2 cells, A43 1 cells, and HUC 18 cells. The second cell layer may also include cells of any type, but preferably includes mesenchymal cells, in particular, fibroblasts. The layered cell sorted tissue possesses an epidermal-dermal junction that is substantially similar in structure and function to its native counterpart. That is, the tissue expresses the necessary integral proteins such as hemidesmosomes and collagen 1, collagen IV, and collagen VII, to attach the epidermal aud dermal layers with the proper basement membrane morphology. The single cell-derived and oligoclonal cell-derived cells may then sort to form an epidermal layer thai contacts the connective tissue component. The layered cell sorted tissues comprising the single cell-derived and oligoclonai cell-derived cells may be used as a skin graft that could _, be used on graft sites such as traumatic wounds and burn injury.

In another embodiment of the invention, single cell-derived and oligoclonai cell-derived cells of this invention may be used as a means to identify and characterize genes that are transcriptionally activated or repressed as the cells undergo differentiation. For example, libraries of gene trap single cell- derived or oligoclonai cell-derived cells may be made by methods of this invention, and assayed to detect changes in the level of expression of the gene trap markers as the cells differentiate in vitro and in vivo. The methods for making gene trap cells and for detecting changes in the expression of the gene trap markers as the cells differentiate are reviewed in Durick et al. (Genome Res, ( 1999) 9: 1019-25), the disclosure of which is incorporated herein by reference), The vectors and methods useful for making gene trap cells and for detecting changes in the expression of the gene trap markers as the cells differentiate are also described in U.S. pat. no. 5,922,601 (Baetscher et al.), U.S. pat. no. 6,248,934 (Tessier-Lavigne) and in U.S. patent publication No. 2004/0219563 (West et al.), the disclosures of which are also incorporated herein by reference. Methods for genetically modifying cells, inducing their differentiation in vitro, and using them to generate chimeric or nuclear-transfer cloned embryos and cloned mice are developed and known in the art. To facilitate the identification of genes and the characterization of their physiological activities, large libraries of gene trap cells having gene trap DNA markers randomly inserted in their genomes may be prepared. Efficient methods have been developed to screen and detect changes in the level of expression of the gene trap markers as the cells differentiate in vitro or in vivo. In vivo methods for inducing single cell-derived or oligoclonai cell-derived cells to differentiate further include injecting one or more cells into a blastocyst to form a chimeric embryo that is allowed to develop; fusing a stem cell with an enucleated oocyte to form a nuclear transfer unit (NTU), and culturing the NTU under conditions that result in generation of an embryo that is allowed to develop; and implanting one or more clonogenic differentiated cells into an immune-compromised or a histocompatible host animal (e.g., a SCID mouse, or a syngeneic nuclear donor) and allowing teratomas comprising differentiated cells to form. In vitro methods for inducing single cell-derived or oligoclonai cell-derived celts to differentiate further include culturing the cells in a monolayer, in suspension, or in three-dimensional matrices, alone or in co-culture with cells of a different type, and exposing them to one of many combinations of chemical, biological, and physical agents, including co-culture with one or more different types of cells, that are known to capable of induce or allow differentiation.

In another embodiment of the invention, ceil types that do not proliferate well under any known cell culture conditions may be induced to proliferate such that they can be isolated cionally or oligoclonally according to the methods of this invention through the regulated expression of factors that overcome inhibition of the cell cycle, such as regulated expression of SV40 virus large T-antigen (Tag), or regulated El a and/or El b, or papillomavirus E6 and/or E7, or CD .4 (see, e.g., U.S, patent application Ser, No. 1 1/604,047 filed on November 21, 2006 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Ceils and Cells Obtained Thereby", incorporated herein by reference).

In another embodiment of the invention, the factors that override cell cycle arrest may be fused with additional proteins or protein domains and delivered to the cells. For example, factors that override cell cycle arrest may be joined to a protein transduction domain (PTD). Protein transduction domains, covalently or non-covalently linked to factors that override cell cycle arrest, allow the translocation of said factors across the ceil membranes so the protein may ultimately reach the nuclear compartments of the cells, PTDs that may be fused with factors that override cell cycle arrest include the PTD of the HIV transactivating protein (TAT) (Tat 47-57) (Schwarze and Dowdy 2000 Trends Pharmacol Sci. 21 : 45-48; osl et ai. 2003 Nature Medicine (9): 1428- 1432). For the HIV TAT protein, the amino acid sequence conferring membrane translocation activity corresponds to residues 47—57 (Ho et al, 2001 , Cancer Research 61 : 473-477; Vives et al., 1997, J Biol. Client. 272: 16010- 16017). These residues alone can confer protein translocation activity.

In another embodiment of the invention, the PTD and the cycle cycle arrest factor may be conjugated via a linker. The exact length and sequence of the linker and its orientation relative to the linked sequences may vaiy. The linker may comprise, for example, 2, 10, 20, 30, or more amino acids and may be selected based on desired properties such as solubility, length, steric separation, etc. In particular embodiments, the linker may comprise a functional sequence useful for the purification, detection, or modification, for example, of the fusion protein.

In another embodiment of the invention, single cell-derived or oligoclonal cell-derived cells of this invention may be reprogrammed to an undifferentiated state through novel reprogramming technique, as described in U.S. application no. 60/705,625, filed August 3, 2005, U.S. application no, 60/729, 173, filed October 20, 2005; U.S. application no. 60/818,813, filed July 5, 2006, the disclosures of which are incorporated herein by reference. Briefly, the cells may reprogrammed to an undifferentiated state using at least a two, preferably three-step process involving a first nuclear remodeling step, a second cellular reconstitution step, and finally, a third step in which the resulting colonies of cells arising from step two are characterized for the extent of reprogramming and for the normality of the karyotype and quality. In certain embodiments, the single cell-derived or oligoclonal cell-derived cells of this invention may be reprogrammed in the first nuclear remodeling step of the reprogramming process by remodeling the nuclear envelope and the chromatin of a differentiated cell to more closely resemble the molecular composition of an undifferentiated or a germ-line cell, hi the second cellular reconstitution step of the reprogramming process, the nucleus, containing the remodeled nuclear envelope of step one, is then fused with a cytoplasmic bleb containing requisite mitotic apparatus which is capable, together with the transferred nucleus, of producing a population of undifferentiated stem ceils such as ES or ED-like cells capable of proliferation, In the third step of the reprogramming process, colonies of cells arising from one or a number of cells resulting from step two are characterized for the extent of reprogramming and for the normality of the kaiyotype and colonies of a high quality are selected. While this third step is not required to successfully reprogram cells and is not necessary in some applications, the inclusion of the third quality control step is preferred when reprogrammed cells are used in certain applications such as human transplantation. Finally, colonies of reprogrammed cells that have a normal karyotype but not sufficient degree of programming may be recycled by repeating steps one and two or steps one through three.

hi another embodiment of the invention, the single cell-derived and oligoclonai cell-derived ceils may be used to generate ligands using phage display technology (see U.S. application no. 60/685,758, filed May 27, 2005, and PCT US2006/020552, filed May 26, 2006, the disclosures of which are hereby incorporated by reference).

In another embodiment of the invention, the single cell-derived or oligoclonai cell-derived cells of this invention may exhibit unique patterns of gene expression such as high levels of factors, e.g. secreted factors, that promote the development or formation of specific tissue types either in vitro or in vivo (e.g., angiogenic factors, neurotrophic factors, etc).

As another example, a cell produced by the methods of this invention could produce large amounts of BMP2, BMP7, BMP3b or other members of the BMP family, and this cell could therefore be useful in inducing bone formation (as described below).

The expression of genes of the ceils of this invention may be determined. Measurement of the gene expression levels may be performed by any known methods in the art, including but not limited to, microarray gene expression analysis, bead array gene expression analysis and Northern analysis. The gene expression levels may be represented as relative expression normalized to the ADPRT (Accession number NM 001618.2), GAPD (Accession number NM_002046.2), or other housekeeping genes known in the art. The gene expression data may also be normalized by a median of medians method. In this method, each array gives a different total intensity. Using the median value is a robust way of comparing cell lines (arrays) in an experiment. As an example, the median was found for each cell line and then the median of those medians became the value for normalization. The signal from the each cell line was made relative to each of the other cell lines. Based on the gene expression levels, one would expect the expression of the corresponding proteins by the cells of the invention. For example, in the case of cell clone ACTC60 (or B-28) of Series 1 , relatively high levels of DKK 1 , VEGFC and IL1 R1 were observed. Therefore, the ability to measure the bioactive or growth factors produced by said cells may be useful in research and in the treatment of disease.

In another embodiment of the invention, the single celi-derived or oligocloual cell-derived cells of this invention may express unique patterns of CD antigen gene expression, which are cell surface antigens. The differential expression of CD antigens on the cell surface may be useful as a tool, for example, for sorting cells using commerically available antibodies, based upon which CD antigens are expressed by the cells. The expression profiles of CD antigens of some ceils of this invention are shown in West et al,, 2008, Regene Med vol. 3(3) pp. 287-308, incorporated herein by reference, including supplemental information. For example, there are CD antigens that are expressed in ES cells and not (or in some cases, at reduced levels) in the relatively more differentiated cell lines of this invention. This could be a very useful tool for selecting, sorting, purifying and/or characterizing ES cells. Since the CD antigens are expressed on the cell surface and antibodies to them are, generally speaking, commercially available, antibodies (or specific combinations of them) can be used to purify pure populations of ES cells or cells of this invention out of a heterogeneous mixture of cells. This could be useful in various strategies to grow ES cells or cells of this invention, or prepare these cells for various commercial purposes. There are several CD antigens that are robustly expressed in the relative more differentiated cells of this invention, but are not expressed in ES cells (or in some cases at markedly reduced levels). The antigens that fail into this category include: CD73, CD97, CD 140B, CD 151 , CD I 72A, CD230, CD280, CDw210b. These antigens may be useful in a negative selection strategy to grow ES cells.

Li another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, may be injected into mice to raise antibodies to differentiation antigens. Antibodies to differentiation antigens would be useful for both identifying the cells to document the purity of populations for cell therapies, for research in cell differentiation, as well as for documenting the presence and fate of the cells following transplantation. In general, the techniques for raising antibodies are well known in the art.

In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived ceils may be used for the purpose of generating increased quantities of diverse cell types with less pluripotentiality than the original stem cell type, but not yet fully differentiated cells. mRNA or miRNA can then be prepared from these cell lines and microarrays of their relative gene expression can be performed as described herein. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells may be used in animal transplant models, e.g. transplanting escalating doses of the cells with or without other molecules, such as ECM components, to determine whether the cells proliferate after transplantation, where they migrate to, and their long-term differentiated fate hi safety studies.

In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived ceils generated according to the methods of the present invention are useful for harvesting mRNA, microRNA, and cDNA from either single cells or a small number of cells (i.e., clones) to generate a database of gene expression information. This database allows researchers to identify the identity of cell types by searching for which cell types in the database express or do not express genes at comparable levels of the cell type or cell types under investigation. For example, the relative expression of mRNA may be determined using microarray analysis as is well known in the art. The relative values may be imported into a software such as Microsoft Excel and gene expression values from the different cell lines normalized using various teclmiques weii known in the art such as mean, mode, median, and quantile normalization. Hierarchical clustering with the single linkage method may be performed with the software such as The R Project for Statistical Computing as is well known in the art. An example of such documentation may be found at http(colon)//seklion(dot)berkeley(dot)edu/stats/html hclust.litml. A hierarcliical clustering analysis can then be performed as is well known in the art. These software programs perform a hierarchical cluster analysis using a group of dissimilarities for the number of objects being clustered. At first, each object is put in its own cluster, then iteratively, each similar cluster is joined until there is one cluster, Distances between clusters are computed by Lance- Williams dissimilarity update formula (Becker, R. A., Chambers, J. M. and Wilks, A. R. (1988) The New S Language. Wadsworth & Brooks/Cole. (S version,); Everitt, B. (1974). Cluster Analysis. London:

Hetnemann Educ. Books). Typically the vertical axis of the dendograms displays the extent of similarity of the gene expression profiles of the cell clones. That is, the farther down they branch apart, the more similar they are. The verticle axis is a set of n-1 non-decreasing real values. The clustering height is the value of the criterion associated with the clustering method for the particular agglomeration. In order to determine if a new cell line is identical to existing cell lines, two types of replicates are performed: biological and technical replicates. Biological replicates require that new cell lines be grown, mRNA harvested, and then the analysis compared, Technical replicates, on the other hand, analyze the same RNA twice. A line cutoff is then drawn just above where the replicates branch such that cells branching below the cutoff line are considered the same cell type. Another source of data for the database described above may be microR A profiles of the single cell-derived and oligoclonal cell-derived cells generated according to the methods of the present invention, icroRNAs (iniRNA) are endogenous RNAs of -22 nucleotides that play important regulatory roles in animals & plants by targeting mRNAs for cleavage or translational repression. More than 700 niiR As have been identified across species, Their expression levels vary among species and tissues. Low abundant miRNAs have been difficult to detect based on current technologies such as cloning, Northern hybridization, and the modified Invade! ¹ ® assay. In the present invention, an alternative approach using a new real-time quantitation method termed looped-primer RT-PCR was used for accurate and sensitive detection of miRNAs as well as other non- coding RNA (ncRNA) molecules present in human embryonic stem cells and in cell lines differentiated from human embryonic stem cells.

In another embodiment of the invention, gene expression analysis may be used to identify the developmental pathways and cell types for n vitro differentiated liES cells. Gene expression analysis of single cells or a small number of cells from human or nonhuman embryonic or fetal tissues provides another means to generate a database of unique gene expression profiles for distinct populations of cells at different stages of differentiation. Gene expression analysis on single cells isolated from specific tissues may be performed as previously described by Kurimoto et al., Nucleic Acids Research (2006) Vol. 34, No. 5, e42. Thus, cellular miRNA profiles on their own or in conjunction with gene expression profiles, hnmunocytochemistry, and proteomics provide molecular signatures that can be used to identify the tissue and developmental stage of differentiating cell lines. This technique illustrates that the database may be used to accurately identify cell types and distinguish them from other cell types. The cells of the present invention are also useful in providing a subset of gene expression markers that are expressed at relatively high levels in some ceil lines while not be expressed at all in other cell lines as opposed to genes expressed in all cell lines but at different levels of expression, This subset of "all-or none" markers can be easily identified by comparing the levels of expression as measured for instance through the use of oligonucleotide probes or other means know in the art, and comparing the level of a gene's expression in one line compared to all the other lines of the present invention. Those genes that are expressed at relatively high levels in a subset of lines, and not at all in other lines, are used to generate a short list of gene expression markers. When applied to the cells and gene expression data described herein, where negative expression in Illumina 1 is <70 RFU and positive expression is >100 RFU.

Safi'cmin O Staining Assay

The well-known techniques of staining of formalin-fixed, paraffin- embedded tissue sections with Safranin O are commonly used in the detection of cartilage-related proteoglycans, however, the assay is not absolutely specific to cartilage since it also stains mucin, mast cell granules, and likely other substances in other cell types. A nonlimiting example of the protocol where cartilage and mucin will be stained orange to red, and the nuclei will be stained black and the background stained green uses formal in- fixed micromasses, pellets, or similar aggregations of cells, Reagents used include Weigert's Iron Hematoxylin Solution: in winch Stock Solution A composed of ί gram of Hematoxyim in 100 ml of 95% Alcohol; Stock Solution B composed of 4 ml of 29% Ferric chloride in water diluted in 95 ml of Distilled water and 1.0 ml of concentrated Hydrochloric acid; Weigert's Iron Hematoxylin Working Solution composed of equal parts of stock solution A and B and used within four weeks; 0.001% Fast Green (FCF) Solution composed of 0.01 gram of Fast green, FCF, C.I. 42053 in 1000 ml Distilled water; 1 % Acetic Acid Solution composed of 1.0 ml glacial acetic acid in 99 ml Distilled water; and 0. 1 % Safranin O Solution composed of 0.1 gram Safranin O, C.I. 50240 hi 100 ml Distilled water. Samples are Deparaffinized and hydrated with distilled water. They are stained with Weigert's iron hematoxylin working solution for 10 minutes, then washed hi running tap water for 10 minutes, stained with fast green (FCF) solution for 5 minutes, rinsed quickly with 1% acetic acid solution for no more than 10 -15 seconds, stained in 0.1% safranin O solution for 5 minutes, dehydrated and cleared with 95% ethyl alcohol, absolute ethyl alcohol, and xylene, using 2 changes each, 2 minutes each, mounted using resinous medium, and imaged and analyzed for stains as described above. C rtilage-related proteoglycan stains dark red-orange.

Human Embryonic Cfiondrogetiic Progenitor Line Markers

The gene expression markers of the human embryonic progenitor cell lines capable of differentiating into chondroblasts and then chondrocytes expressing higher levels of COL2A1 than normal early passage cultured human articular chondrocytes when said human embryonic progenitor cell lines have undergone 18-21 doublings of clonal expansion following isolation from human ES or similar human primordial stem cell-derived cells are described in: International application PCT/US2006/045352 published as WO/2007/0621 8; United States Application No.60/981,424; United States application No. 61/128,497 and United States Application No.12/504,630 published as 2010-0184033; the dislcosures of which applications are herein incorporated by reference.

The cell line S 30 is positive for the markers: COL15A1, CRYAB, DYSF, FST _} GDF5, HTRA3, TMEMI 19, MMPI, MSX1, MSX2, YL4, POSTN, SE PINA3, SRCRB4D and Z1C2 and is negative for the markers: ACTC, AGC1, A R1C1, ALDH I A i , ANXA8, APCDD1, AQPI, ATP8B4, CFB, C3, C6, C7, C20orfl03, CD24, CDH3, CLDNI I, CNTNAP2, COMP, DI02, METTL7A, DKK2, DL 1 , DPT, FGFR3 , TMEM 100, FMO 1 , FM03 , FOXF2, GABRB 1 , GJB2, GSC, HOX A5, HS D 11 B2, HSPA6, ID4, 1FI27, IL1R1, CNMB1, KIAA0644, KRTI4, KRTI7, RT34, IGFL3, LOC92196, MEOXI, MEOX2, GP, MYBPH, MYH3, MYHl 1, NLGN4X, NPPB, OGN, OLRl, OSR2, PAX2, PAX9, PDEIA, PENK, PRG4, PROMI, PRR i, PTN, ARRES1, RASD1, RELN, RGS I , SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and W1SP2.

The cell line 4D20.8, sometimes referred to as X4D20.8 is positive for the markers: BARX1, CNTNAP2, COL21A1, CRIP I, CRYAB, DI02, D K2, GAP43, ID4, LAMC2, LHX8, MMPI, MSX2, S100A4, SOX11 and THY I and is negative for the markers: AGC1, ALDH1 Al, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDNll, COPl, CRLFI, DLKl, DPT, FMOl, FM03, GDF10, GJB2, GSC, HOXA5, HSD1 iB2, HSD17B2, HSPA6, HSPB3, ICAM5, 1FI27, IGF2, KRT14, KRT17, KRT34,

MASP1, MEOX2, MSX1, MX1, MYBPH, MYH3, MYHl I, TAGLN3, NP A SI, NPPB, OGN, OLRl, PAX2, PDEIA, PRG4, PROMI, PTN, PTPRN, RARRES1, RGS1, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4, W1SP2, Z1C1 and ZIC2,

The cell line SKI 1 is positive for the markers: BEX1, COL21 Al, FST, ICAM5, IL1R1, TMEMI 19, PTPRN, SERP1NA3, SFRP2 and ZICI and are negative for the markers: ACTC, AGC1, ALDH1A1, AQPI, ATP8B4, C6, C20orfl03, CCDC3, CDH3, CLDNI 1, CNTNAP2, DI02, DKK2, EMID1, GABRB 1, GSC, HOXA5, HSPA6, IFI27, INA, KRT14, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MMPI, MX1, MYH3, MYHl 1, IL32, NLGN4X, NPPB, OLRl, PAX2, PAX9, PDEIA, PENK, PROMI, PTN, RARRESi, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH and TUBB4.

The cell line MEL2 is positive for the markers: AKR1C1, AQPI, COL2I Al, CRYAB, CXADR, DI02, METTL7A, DKK2, DLKl, DLX5, HAND2, HSD17B2, IISPB3, MGP, MMPI, MSX2, PENK, PRRXI, PRRX2, S100A4, SERPINA3, SFRP2, SNAP25, SOX11, TFPI2 andTHYl and is negative for the markers: ACTC, ALDH1 Al, AREG, CFB, C3, C20orfl03, CD24, CDI-I3, CDH6, CNTNAP2, COL15A1, COMP, COPl, CRLFI, FGFR3, FMOl, FM03, FOXF2, FST, GABRB 1, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD! 1B2, HSPA6, ICAM5, KCNMB1, KRT14, KRT17, KRT19, KRT34, MASP1, MEOXi, MEOX2, MYBPH, MYH3, MYHl 1, TAGLN3, NPAS1, NPPB, OLRl, PAX2, PDE1A, P1TX2, PRG4, PTN, PTPRN, RASD1, RELN, RGS 1, SMOC1, STMN2, TAC1 , TNFSF7, TRH, TUBB4, WISP2, ZIC 1 and Z1C2.

The cell line X7SM0032 is positive for the markers: ACTC, BEX1, CDH6, COL21A1, CRIPI , CRLF i , DI02, DLK1, EGR2, FGFR3, FOXF1, FOXF2, FST, GABRB 1, IGFBP5, IAA0644, RT19, LAMC2, T EM1 19, MGP, MMP1, MS I , SX2, PODN, POSTN, PRG4, PRRX2, PTN, RGMA, S 100A4, SERPINA3, SOX1 1 and SRCRB4D and is negative for the markers: AGC I , AKRICI, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CLDN1 1, CNTNAP2, COL15A1, COP1, CXADR, ETTL7A, DKK2, DPT, E IDl,

T EM I 00, FMOl, FM03, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 I B2, HSD ! 7B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, IL1 R1, INA, KCNMB 1 , RT14, KRT17, KRT34, IGFL3,

LOC92196, MFAP5, MASP1, MEOX1 , MEOX2, MYBPH, MYH3, YH1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1 A, PITX2, PRELP, PROM1 , PTPRN, RASD1 , RGS1 , SFRP2, S OC1 , SMOC2, SOD3, STMN2, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZICI and ZIC2.

The ceil line E15 is positive for the markers: ACTC, BEX1, PRSS35, CRIPI , CRYAB, GAP43,

GDF5, HTRA3, KRT19, MGP, MMP 1 , POSTN, PRRX1, S 100A4, SOX1 1, SRCRB4D and THY 1 and are negative for the markers: AGCI , AKRI CI, ALDHiAl, ANXA8, APCDD 1 , AQP 1 , AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COP1 , CXADR, METTL7A, DLKi, DPT, EGR2, EMIDl, TMEM100, FMOi , FM03, FOXF1 , FOXF2, GABRB 1, GDF10, GJB2, GSC, HOXA5, HSD 1 1 B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, ΓΝΑ, KRTI4, TMEM1 Ϊ 9, IGFL3,

LOC92196, MFAP5, MASP1, MEOXi , MEOX2, MSXI, MXi, MYBPH, MYH3, MYL4, NLGN4X, TAGLN3, NPAS1 , NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PTPRN, RARRES 1, RASDI, RELN, RGS1 , SLITRK6, SMOC1 , SMOC2, SNAP25, STMN2, TAC 1 , TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZICI .

The cell line EN7 in the undifferentiated state propagated in media such as P omocell

MV2 endothelial medium is positive for the mRNA markers: RGS1, NEFM, KBTBDIO, CLDN5, GPR44, ATP1A2, KCND2, DLKI, FOXF1, and ZIC2, with most distal HOX gene expression being HOXB2, HOXA2, and is negative for the markers: ACTC, AJAPl, ALDHI Al, ALDHI A2, ANXA8, BARX1, C3, CCDC3, CD24, CD74, CDH3, CNTNAP2, COMP, CRYAB, DKK2, GSC, HAND2, HOXA5, HSD11B2, HSPB3, INA, KRT14, KRT17, LHXl, LHX8, MFAP5, MEOXI, MEOX2, MGP, MMP1, MYH3, MYH11, NPAS1, NPPB, OLR1, PAX2 (IU ina Probe

6450767), PAX9, PENK, PITX1, P1TX2, PROM1, RELN, SFRP2, SMOC2, STMN2, TAC1, TBX15, TRH, and TUBB4 as determined by IUumina microarray analysis described herein.

Below is a list of exemplary human embryonic chondrocyte progenitor cell lines according to aspects of the present invention and certain gene expression markers of interest {positive and negative - markers), These human embryonic progenitor cell lines are capable of differentiating into chondrocytes expressing higher levels of C0L2A1 than normal early passage cultured human articular chondrocytes (NHACs) when the progenitors have undergone 22 or more doublings of clonal expansion following isolation from human ES or similar human primordial stem cell-derived cells.

Gene expression markers of the cell line MEL2 in the range of P22-28 include the genes: PIP, ENPP2, DLX5, CXADR, NPTX2, CLDN23, SFRP2, HSPB3, HAND2, HSD17B2, RCAN2, EBF3, GPM6B, RNF1 75, PPARGCIA, RGS1 6, GPM6B, SOXl 7, EPHB6, and BAPXi. The most specific of these markers being expressed in the cell line MEL2 in the range of P22-28 are: PIP (Illumina probe ID 4010519), SOX 17 (Illumina probe ID 3610193), DLX5 (Illumina probe ID 3370767), GPM6B (Illumina probe ID 2630279), RGS16 (Illumina probe ID 1030102), EPHB6 (Illumina probe ID 7400017), and HAND2 (Illumina probe ID 4640563) and negative expression of: TBXI 5 (Illumina probe ID 60601 13), H0XA2 (illumina probe ID 2060471), AJAPl (Illumina ID 1300647), and H0XB2 (llluniina probe ID 3460097).

Gene expression markers of the cell line SM30 in the range of P 13- 15 include the genes:

COL15A 1 , DYSF, FST, ITGB4, TMEMI 19, MSX1, NDST3, NTR I, and ZIC2. The most specific of these gene expression markers being expressed in cell line SM30 in the range of PI 3- 15 are: NTR l (Illumina probe ID 70501 13), NDST3 (Illumina probe ID 670537), ZIC2 (Illumina probe ID 510368), ITGB4 (Illumina probe ID 3940 ⁽ 32), and negative expression of PIP (Illumina probe ID 4010519), NNAT (Illumina probe ID 4010709), Η0ΧΛ2 (Illumina probe ID 2060471), TBXI 5 (Illumina probe ID 60601 13), and HAND2 (Illumina probe ID 4640563).

Gene expression markers of the cell line 7SM0032 in the range of PI 1-18 include the genes:

EGFL6, FGF13, BEX2, CHRNA3, NCAM2, BBOX1, and DLK1. The most specific of these gene expression markers being expressed in 7SM0032 are; EGFL6 (Illumina probe ID 6330079), FGF13 (Illumina probe ID 7380239), CHRNA3 (Illumina probe ID 4280180), BBOX1 (Illumina probe ID 3400386), and negative for the expression of the genes: TBXI 5 (Illumina probe ID 60601 13), NNAT (Illumina probe ID 4010709), NTRKl (Illumina probe ID 70501 13), HAND2 (Illumina probe ID

4640563), and H0XA2 (Illumina probe ID 2060471).

Gene expression markers of the cell line SK 1 1 in the range of P 12- 17 include the genes: PITXI, TBXI 5, NCAM1, COL2 I A l, CYYRl, LAMP3, MEGFIO, RNF165 and GDFIO. The most specific of these gene expression markers being expressed in SKI I are: TBXI 5 (Illumina probe ID 60601 13), COL21 A I (Illumina probe ID 3440747), GDFIO (Illumina probe ID 5690095), PITXl (Illumina probe ID 2000373), and negative for the expression of the genes: NNAT (Illumina probe ID 4010709), HAND2 (Illumina probe ID 4640563), F0XF2 (Illumina probe ID 1660470), FOXGl (Illumina probe ID 4200458), H0XA2 (Illumina probe ID 2060471) H0XB2 (Illumina probe ID 3460097), and AJAPl (Illumina ID 1300647).

Gene expression markers of the cell line 7PEND24 in the range of PI 5-26 include the genes:

TBX15, PAX9, CA9, SPAG16, SUSD2, TBXASl, AlFl, SLITRK5, F0XF2, AADAC, and FOXGl. The most specific of these gene expression markers being expressed in 7PEND24 are: AADAC (Illumina probe ID 6200619), TBX15 (Illumina probe ID 60601 13), SPAG16 (Illumina probe ID 4390537), AIFi (Illumina probe ID 3800047), and negative for the expression of the genes: NNAT (Illumina probe ID 4010709), PITXl (Illumina probe ID 2000373), SOX 17 (Illumina probe ID 3610193), and AJAPl (Illumina ID 1300647).

Gene expression markers of the cell line E15 in the range of P14-15 include the genes: ENPP2,

ABCA6, TBX 15, BAB, CNTN3, TSPYL5, GAP43, AJAPl, CYFIP2, H0XA2 (Illumina probe ID 2060471) H0XB2 (Illumina probe ID 3460097), and NNAT The most specific of these gene expression markers being expressed in El 5 are: AJAPl (Illumina probe ID 1300647), BAB (Illumina probe ID 5690301), NNAT (Illumina probe ID 4010709), ABCA6 (Illumina probe ID 5810209), and negative for the expression of the gene: PITXl (Illumina probe ID 2000373) and is negative for the gene expression markers: HAND2 (Illumina probe ID 4640563) and SOX 17 (Illumina probe ID 3610193).

Gene expression markers of the cell line 4D20.8 in the range of PI 2- 17 include the genes: LHX8, HAPLNl, LING02, FGF18, GPR126, BBOXl, ITGA4, SHISA3, and BARX l and is negative for the gene expression markers: NNAT and HAND2. The most specific of these gene expression markers being expressed in 4D20.8 are: SHISA3 (Illumina probe ID 5670286), LHX8 (Illumina probe ID 2900343), BARXl (Illumina probe ID 6450040), LLNG02 (Illumina probe ID 1 1 10291 ), and negative for the expression of the genes: PITXl (Illumina probe ID 2000373), SOX17 (Illumina probe ID 3610193), and AJAPl (Illumina ID 1300647).

Gene expression markers of the cell line EN7 in the range of P 12 include: Expression of RGS1, NEFM, KBTBDIO, CLDN5, GPR44, ATP1A2, KCND2, DLK1, FOXFl, and ZIC2, with most distal HOX gene expression being HOXB2, OXA2, and no expression as determined by Illumina microarray for the expression of the genes: CD74 Illumina Probe ID (1240070), TBX15 (Illumina probe ID 60601 13), LHXI, LHX8 (Illumina probe ID 2900343), PITXl (Illumina probe ID 2000373), HAND2 (Illumina probe ID 4640563), or AJAPl (illumina ID 1300647).

As noted above, the embryonic chondrocyte progenitor cells of the present invention find use in methods for generating differentiated cells in the presence of BMP family members and are described below and in the Examples section).

Tissue Engineered Constructs

In certain embodiments, cells of the present invention are employed in therapeutic applications to repair, replace, or enhance tissue function in a subject (e.g, a mammal, e.g., a human patient). A number of therapies that employ cells incorporated in engineered matrices have been described, a few of which are summarized below. The cells of the present invention may be embedded in such matrices to prvide form and function as is well-known in the art.

In certain embodiments, synthetic matrices or biological resorbable immobilization vehicles

(sometimes referred to as "scaffolds") may be impregnated with cells of the present invention. A variety of synthetic carrier matrices have been used to date and include: three-dimensional collagen gels (U.S. Pat. No. 4,846,835; Nishimoto (1990) Med. J. Kinki University 15; 75-86; Nixon et al. (1993) Am. J. Vet. Res. 54:349-356; Wakitani et al. (1989) J. Bone Joint Surg, 71B:74-80; Yasui ( 1989) J. Jpn. Ortho. Assoc. 63:529-538); reconstituted fibrin-thrombin gels (U.S, Pat. Nos. 4,642, 120; 5,053,050 and 4,904,259); synthetic polymer matrices containing polyanhydride, polyorthoester, polyglycolic acid and copolymers thereof (U.S. Pat. No. 5,041 , 138); hyaluronic acid-based polymers (Robinson et al. (1990) Caicif. Tissue Int. 46:246-253); and hyaluronan and collagen-based polymers such as HyStem-C (BioTime), e.g., as described in U.S. Patent Nos 7,981 ,871 and 7,928,069, the dislcosures of which are herein incorporated by reference. HyStem-C may be employed in numerous applications where the prevention of undesired inflammation or fibrosis is desired, such as in the repair of traumatic orthopedic injuries such as tears to rotator cuff tendons, carple tunnel syndrome, and trauma to tendons generally.

For example, the cells of the present invention may be employed in tissue reconstruction as described in Methods of Tissue Engineering (2002), edited by Anthony Atala and Robert P. Lanza and published by Academic Press (London), incorporated by reference herein for its description of tissue reconstruction (see, e.g, pages 1027 to 1039). As described therein, cells may be placed into a molded str cture (e.g., by injection molding) and transplanted into an animal. Over time, tissue produced by the cells of the present invention will replace the molded structure, thereby producing a formed structure (i.e., in the shape of the initial molded structure). Exemplary mold materials for the molded structure include hydrogels (e.g., alginate, agarose, poiaxomers (Pluronics)) and natural materials (e.g., type I collagen, type II collagen, and fibrin).

In certain embodiments, cells of the present invention may be cultured in vitro to form a synthetic tissue-like material. The resulting tissue may be implanted subsequently into a subject at the site of the defect. This type of approach has the advantage that the development of the synthetic tissue may be monitored prior to implantation, fn addition, the resulting tissue may be characterized biochemically and morphologically prior to implantation. Numerous different procedures have been developed for growing synthetic tissue in vitro, including growing cells in an anchorage-dependent or an anchorage-independent manner.

In the anchorage-independent maimer, cells may be cultured as colonies within an agarose gel. See for example: Benya et a(. (1982) Cell 30:215-224; Aydlotte et at. (1990) in Methods and Cartilage Research Chapter 23:pp. 90-92; Aulthouse et al. (1989) In Vitro Cellular and Developmental Biology 25:659-668; Delbruck et al. ( 1986) Connective Tissue Res. 15: 1550- 172; and Bohme et al. (1992) J. Cell Biol. 1 16: 1035-1042. Alternatively, in another anchorage-independent method, cells may be cultured as colonies in suspension culture. See for example, Franchitnont et l. (1989) J. Rheumatol. 16:5-9; and Bassieer et al. (1990) in "Methods and Cartilage Research", Academic Press Ltd., Chapter 24.

In the anchorage- dependent method, primary cultures of cells may be grown as monolayers attached to the surface of a cell culture flask. See for example: Yoshihashi ( 1983) J. Jpn. Ortho. Assoc. 58 :629-641 ; and U.S. Pat. No. 4,356,261, incorporated by reference herein in its entirety. In certain embodiments, a cartilage therapy of the invention includes those described in U.S. Patents 5,723,331 and 5,786,217 (entitled "Methods and compositions for the repair of articular cartilage defects in mammals", both of which are incorporated by reference herein in their entirety). These patents describe methods for preparing in vitro a synthetic cartilage patch for the repair of a cartilage defect. When the cartilage-producing cells of the present invention are employed, the methods include the steps of: (1 ) seeding cartilage-producing cells of the present invention into a pre-shaped well having a cell contacting, cell adhesive surface; and (2) cuttiiring the cartilage-producing cells of the present invention in the well for a time sufficient to permit the cells to secrete an extracellular matrix, thereby to form a three-dimensional, multi cell-layered patch of synthetic cartilage. The resulting synthetic cartilage (e.g., synthetic articular cartilage), contains cartilage-producing cells of the present invention dispersed within an endogenously produced and secreted extracellular matrix, The resulting synthetic cartilage patch may be used subsequently for the repair (or replacement) of a cartilage defect in a subject (e.g., a mammal),

The cells of the present invention thus find use in numerous therapeutic applications for treating diseases or conditions characterized by tissue damage or degeneration as well as for complete replacement of those tissues. Diseases and conditions include, but are not limited to :osteoarthritis, chondromalacia, chondromalacia patella, hallux rigidiis, hip labial tear, torn meniscus, cartilage replacement (ear, nose), nervous disorders, endocrine disorders, muscle disease, injuries to tendons and ligaments, etc. Direct injection of cells to impart tissue regeneration

Direct injection of ceils, such as the cell lines of the present invention are also of therapeutic utility. Doses and formulation will vary depending on the route of administration, tissue type, and nature of the pathology to be treated as is known in the art, but in the case of humans and most veterinary animals species, the dosage will be between 10 ² - 10 ⁶ cells and the formulation can be, by way of nonlimiting example, a cell suspension in isosmotic buffer or a monolayer of cells attached to an layer of extracellular matrix such as contracted gelatin. Cellular compositions of the present invention may further comprise an acceptable carrier, such as a hydrophilic, e.g., pharmaceutically acceptable, carrier.

SYSTEMS AND KITS

Also provided by the subject invention are systems and kits that include the cells of the invention for use in various applications, as described herein. The systems and kits may further include reagents and materials for the propagation and use of the cells for research and/or therapeutic applications as described herein. Biological Deposits Cell lines described in this application have been deposited with the American Type Culture Collection ("ATCC"; P.O. Box 1549, Manassas, VA 20108, USA) under the Budapest Treaty. The ceil line 4D20.8 (also known as ACTC84) was deposited at the ATCC at passage 1 1 on July 23, 2009 and lias ATCC Accession No. PTA- 10231. The cell line SM30 (also known as ACTC256) was deposited at the ATCC on July 23, 2009 at passage 12 and has ATCC Accession No. PTA- 10232. The cell line

7SM0032 (also known as ACTC278) was deposited at the ATCC at passage 12 on July 23, 2009 and has ATCC Accession No. PTA- 10233. The cell line E15 (also known as ACTC98) was deposited at the ATCC at passage number 20 on September 15, 2009 and has ATCC Accession No. PTA-10341. The cell line MEL2 (also known as ACTC268) was deposited at the ATCC at passage number 22 on July 1, 2010 and has ATCC Accession No. PTA-1 1 150. The cell line SKI 1 (also known as ACTC250) was deposited at the ATCC at passage number 13 on July 1 , 2010 and has ATCC Accession No. PTA- 1 1 152. The cell line 7PEND24 (also known as ACTC283) was deposited at the ATCC at passage number 1 1 on July 1 , 2010 and has ATCC Accession No. PTA- 1 1 149. EXPERIMENTAL

The following examples are put forth so as to provide those of ordinaiy skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are ail or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.

Example 1. Cartilage markers in differentiating 4D20.8 cells in the presence of diverse BJvlPs as determined by qPCR

MSCs at passage 10 (Lonza) were differentiated in HyStem hydrogel which is a PEGDA cfosslinked polymer of hyaluronic acid and gelatin according to manufacturers instructions (Glycosan) for 14 days in the presence of lOng/mL of TGFB3 and the cell line of the present invention designated 4D20.8 was expanded in vitro > 2 ! doublings of clonal expansion since they were isolated from hES- derived cells, synchronized in quiescence by growing to confluence and replacing the media with media supplemented with a 10-fold reduction in serum or other mitogens as described herein (CTRL), or differentiated in micromass conditions as described herein (MM), or differentiated in HyStem hydrogel which is a PEGDA crosslinked polymer of hyaluronic acid and gelatin according to manufacturers instructions (Glycosan) for 14 days in the presence of either 1 Ong mL of TGFB3, 25 ng/mL TGFB3, 10 ng/mL BMP4, 30 ng mL BMP6, 100 ng mL BMP7, 100 ng/mL GDF5, or combinations of these growth factors. RNA was extracted from these cells, the RNA was converted to cDNA and then examined for expression of genes commonly associated with chondrogenesis desired in the joint (i.e. COL2A1, COL10A1, and CRTACl). Gene-specific primer pair probes were obtained from Invitrogen. Samples for testing were prepared in standard Optical 96-well reaction plates (Applied Biosystems Carlsbad, CA, PN 4306737) consisting of 30ng of RNA equivalent of cDNA, 0.4uM per primer, Ultra-Pure distilled water (Invitrogen), diluted 1 : t with 12.5ul of Power SYBR Green PCR Master Mix (Applied Biosystems Carlsbad, CA, Cat# 4367659) incorporating AmpliTaq Gold DNA polymerase in a total reaction volume of 25ul. Real-Time qPCR was run using Applied Biosystems 7500 Real-Time PCR System employing SDSvi .2 software. Amplification conditions were set at 50°C for 2 min. (stage 1), 95°C for 10 min. (stage 2), 40 cycles of 95°C for 15 sec then 60°C for 1 min (stage 3), with a dissociation stage at 95°C for 15 sec, 60°C for 1 min, and 95°C for 15 sec (stage 4). Ct values for amplification products of genes of interest were normalized to the average Ct value of 3 housekeeping genes (GAPD, RPS 10, and GUSB), and gene expression analyzed relative to that of early passage knee-Normal Human Articular

Chondrocytes (Lonza) and cultured human bone marrow mesenchymal stem cells.

The primer sets used to detect chondrogenic genes were ("f ¹ is forward primer; "r" is reverse primer):

GAPDH f2 GGCCTCCAAGGAGTAAGACC 21

GAPDH r2 AGGGGTCTACATGGCAACTG 22

RPS10 f1 ATTTGGTCGTGGACGTGGT 23

RPS10 r1 TTTGGCTGTAAGTTTATTCAATGC 24

GUSB f1 AAACGATTGCAGGGTTTCAC 25

GUSB Π CTC TCGTCGG TGACTGTTC A 26

COL2A1 f1 TCTACCCCAATCCAGCAAAC 27

COL2A1 r1 GTTGGGAGCCAGATTGTCAT 28

COL2A1 f2 CACACTGGTAAGTGGGGCAAGACCG 29

COL2A1 r2 ACG AGGTC CTC ACTGGTGAA 30

ACAN f1 TG AGTCC TCAAG CCTCCTGT 31

ACAN Π TGGTCTGCAGCAGTTGATTC 32

ACAN f2 ACAGCTGGGGACATTAGTGG 33

ACAN r2 GTGGAATGCAGAGGTGGTTT 34

COL10A1 f1 GCTAAGGGTGAAAGGGGTTC 35

COL10A1 r1 CTCCAGGATCACCTTTTGGA 36

BGN f1 GGACTCTGTCACACCCACCT 37

BGN Π AGC TCGGAGATG TCGTTGTT 38

COL9A2 f1 AGCATCATTCGGCTGTTACC 39

COL9A2 r1 CTGAGGGGTGGAACTGTAGC 40

CDMP1 f1 CCCATCAGCATCCTCTTCAT 41

CDMP1 r1 TGTAGATGCTCCTGCCACAG 42

VERSICAN f1 ACCACGCTTCCTATGTGACC 43 y/ERSICAN r1 TGTTGTAACTG G GTGGC AAA 44

C0L11A1 f1 TCGAGGGTTTGATGGACTTC 45

C0L11A1 r1 CATCTTCTCCCCTCATTCCA 46

DCN f1 TGGCAACAAAATCAGCAGAG 47

DCN r1 GCCATTGTCAACAGCAGAGA 48

FMOD f1 CCTCCAAGGCAATAGGATCA 49

FMOD Π GCTGCGCTTGATCTCGTTC 50

LUM f1 TGATCTG C AGTGGC TCATTC 51

LU r1 AAAAG AGCCC AGCTTTG TGA 52

COL1A1 f1 GTG CTAAAGGTGC C AATGGT 53

COL1A1 r1 ACC AGGT TCACCG CTGTT AC 54

COL1A1 f2 GTGC TAAAG GTGCCAATG GT 55

COL1A1 Γ2 TCCTCGCTTTCCTTCCTCT 56

PRELP f1 rCCCAATCT TG CCTTCATTC 57

PRELP r1 3TCATG GAACGCCAC TAGGT 58

ACAN f3 rCGAGGACAGCGAGGCC 59 r3

f2

r2

f2

r2 64 f2 65 r2

f2

r2

f3

r3

f1 71 r1

f4

r4

f1

r1

f2 77 r2

f5

r5

f6

r6

f7

r7

f2

r2

f1

r1

f2

r2

f1 91 r1

As shown in Figure 1 A-C, combinations of BMPs with TGFB3 increased COL2A1 expression. In the case of treating joint disease, it is desirable to identify conditions that increase COL2A1 expression while minimizing COLWAl expression to minimize the conversion of chondrocyte progenitors into hypertrophic cells leading to bone formation. Also, it is desirable to increase CRTAC1 expression which is a marker of definitive cartilage. The combination of TGFB3 at 10 ng/mL together with GDF5 at 100 ng/riiL in HyStem matrix optimized COL2A1 and CRTAC1 expression while minimizing COL10A 1 expression. This optimized differentiation protocol in useful in preconditioning cells with a pattern of gene expression similar to 4D20.8 such that the preconditioned ceils when implanted in vivo will differentiate into cells useful in reconstituting joint histology.

Example 2, Tendon markers in differentiating 7PEND24 cells in the presence of diverse BMP4 as determined by iliumina gene expression microarrays

The cell line 7PEND24 (passage 22) was differentiated in HyStem hydrogel which is a PEGDA crosslmked polymer of hyaluronic acid and gelatin according to manufacturers instructions (Glycosan) for 14 days in the presence of l Ong/inL of TGFB3 and the cell line of the present invention designated 7PEND24 was expanded in vitro > 21 doublings of clonal expansion since they were isolated from hES- derived cells, synchronized in quiescence by growing to confluence and replacing the media with media supplemented with a 10-fold reduction in serum or other mitogens as described herein (CTRL), or differentiated in micromass conditions as described herein (MM), or differentiated in HyStem hydrogel which is a PEGDA crosslinked polymer of hyaluronic acid and gelatin according to manufacturers instructions (Glycosan) for 14 days in the presence of either lOng mL of TGFB3, 25 ng/mL TGFB3, 10 ng/mL BMP4, 30 ng/mL BMP6, 100 ng/niL BMP7, 100 ng mL GDF5, or combinations of these growth factors. In brief, the hydrogel/cell formulation was prepared as follows: HyStem (Glycosan, Salt Lake, UT, Hystem-CSS Cat #GS319) was reconstituted following manufacturer's instructions. Briefly, Hystem (thiol modified hyaluronan, lOmg) was dissolved in 1 ml degassed deionized water (taking about 20 minutes) to prepare a 1% solution. Gelin-S (thiol modified gelatin, lOmg) was dissolved in 1 ml degassed deionized water to prepare a 1% solution, and PEGSSDA (disulfide-containing PEG diaciylate, lOmg) was dissolved in 0,5 ml degassed deionized water to prepare a 2% solution. Then HyStem (I ml, 1 %) is mixed with Gelin-S (1ml, 1%) without creating air bubbles, immediately before use. Pelleted cells were resuspeiided in recently prepared HyStem Gelin-S (1 : 1) mix described above. Upon the addition of crosslinker PEGSSDA (disulfide containing polyethelene glycol diaciylate), lOOul of the ceil suspension, at a final concentration of 20xl0e6 ceiis/ml, is aliquoted into multiple 24 well plate, 6,5mm

polycarbonate (0.4uM pore size) transwell inserts (Corning 3413). Following gelation in about 20 minutes, chondrogenic medium is added to each well. Plates are then placed in humidified incubator at 37°C, ambient 02, 10% C02, and cells are fed three times weekly. RNA was extracted from these cells, the R A was converted to cDNA and hybridized to Iliumina gene expression microarrays. As can be seen in Figure 2, the 7PEND24 cell line unexpectedly, in the presence of 10.0 ng mL BMP4, expressed relatively high levels of tenomodulin (TNMD), a molecular marker of tendon ceils (tenocytes). Lesser, but nevertheless elevated levels of TNMD expression were observed in parallel cultures incubated in the presence of 100 ng/mL BMP7, Therefore, unlike when cultured in the presence of other BMP family members where COL2A 1 expression is induced, little or no COL2A 1 expression, but relatively high TNMD expression was observed when 7PEND24 was differentiated as described herein in HyStem hydrogels and in the presence of 1 Ong/mL B P4.

Example 3. Bone markers in differentiating SM30 cells in the presence of diverse BMPs as determined by Ilitimina gene expression microarrays

The cell line SM30 (passage 22) was differentiated in HyStem hydrogel which is a PEGDA crosslinked polymer of hyaluronic acid and gelatin according to manufacturers instructions (Glycosan) for 14 days in the presence of l Ong/mL of TGFB3 and the cell line of the present invention designated SM30 was expanded in vitro > 21 doublings of clonal expansion since they were isolated from hES- derived ceils, synchronized in quiescence by growing to confluence and replacing the media with media supplemented with a 10-fold reduction in serum or other mitogens as described herein (CTRL), or differentiated in micromass conditions as described herein (MM), or differentiated in HyStem hydrogel which is a PEGDA crosslinked polymer of hyaluronic acid and gelatin according to manufacturers instructions (Glycosan) for 14 days in the presence of either 1 Ong mL of TGFB3, 25 ng mL TGFB3, 10 ng/niL BMP4, 30 ng/mL BMP6, 100 ng mL BMP7, 100 ng mL GDF5, or combinations of these growth factors. In brief, the hydrogel/cell formulation was prepared as follows: HyStem (Glycosan, Salt Lake, UT, Hystem-CSS Cat #GS3 19) was reconstituted following manufacturer's instructions. Briefly, Hystem (thiol modified hyalurouan, l Omg) was dissolved in 1 ml degassed deionized water (taking about 20 minutes) to prepare a 1% solution. Ge!in-S (thiol modified gelatin, l Omg) was dissolved in i mi degassed deionized water to prepare a 1 % solution, and PEGSSDA (disulfide-containing PEG diacrylate, l Omg) was dissolved in 0.5 ml degassed deionized water to prepare a 2% solution. Then HyStem ( I ml, 1%) is mixed with Gelin-S (1 ml, 1 %) without creating air bubbles, immediately before use. Pelleted cells were resuspended in recently prepared HyStem Gelin-S (1 : 1 ) mix described above. Upon the addition of crosslinker PEGSSDA (disulfide containing polyethelene glycol diacrylate), l OOul of the ceil suspension, at a final concentration of 20 10e6 cells/ml, is aliquoted into multiple 24 well plate, 6.5mm

polycarbonate (0.4uM pore size) transwell inserts (Corning 3413). Following gelation in about 20 minutes, chondrogenic medium is added to each well. Plates are then placed in humidified incubator at 37°C, ambient 02, 10% C02, and cells are fed three times weekly, RNA was extracted from these cells, the RNA was converted to cDNA and hybridized to Illumina gene expression microarrays. As can be seen in Figure 3, the cell line SM30 like bone marrow MSCs, unexpectedly, in the presence of 50,0 ng/mL BMP2 and 10 ng/mL TGFB3, and 10 ng/mL BMP4 and 10 ng mL TGFB3 expressed relatively high levels of bone sialoprotein U (IBSP) a molecular marker of bone-forming cells and very high levels of COL2A1 and COLIOAI, suggesting intermediate hypertrophic chondrocyte formation (i.e, endochondral ossification). Lesser, but nevertheless elevated levels of IBSP expression was also observed in the cell line MEL2 in pellet culture in 10 ng/mL TGFB3. Since IBSP is a molecular marker and a component of bone mineralization, SM30 and MEL2 have utility in studying novel molecular mechanisms of bone embryology, in the case of SM30 in particular, of ZIC2+ bone forming cells of the head and face, and in bone repair therapies.

Example 4: qPCR analysis of progenitor cell lines treated with BMP family members

Progenitor cells lines used as starting material in this experiment were derived from NIH registered hES cell line H9 as described by West et al., 2008 (The ACTCellerate initiative: large- scale combinatorial cloning of novel human embryonic stem cell derivatives, Regen. Med., 3(3), 287-308). They were cultured in Corning tissue culture treated polystyrene culture-ware coated with 0.1% gelatin prepared from 2% gelatin, (Sigma Cat # G 1393) using appropriate growth media supplemented with 2mM ghitamax and penicilli streptomycin (100IU/ml: 100ug/ml). They were placed in a humidified incubator at 37°C, 5% 02, and 10% C02. Cells were fed by replacing media every 2-3 days and split 1 :3 at or near confluence using 0.25% Trypsin/EDTA (Invitrogen 25200- 1 14) diluted 1 :3 with PBS, Ca Mg free.

The progenitor cell lines obtained according to the previous paragraph were cultured in the following media supplemented with BMP family members: line 4D20.8 was grown in

DMEM 20% FBS; the El 5 progenitor line was also cultured in DMEM supplemented with 20% FBS; the SM30 progenitor cell line was cultured in PromoCell smooth muscle media; the SKI 1 progenitor cell line was cultured in PromoCell skeletal muscle media; the MeI2 progenitor cell line was cultured in PromoCell melanocyte media; 7SM0032 was cultured in PromoCell smooth muscle media; the MSC progenitor cell line was cultured in Promocell mesenchymal media. All of the above media were supplemented with penocyliin streptomycin and glutamine.

The specific BMP factors along with their respective concentrations are provided in the brief description of Figure 4.

Hystem C (Glycosan Biosystems, subsidiary of BioTime Inc), hydrogei components consists of 3 primary reagents: (1) Hystem (thiol modified hyaluronan, lOmg) which is dissolved in 1 ml degassed deionized water (taking about 20 minutes) to prepare a 1% solution. (2) Gelin-S (thiol modified gelatin, l Omg) which was dissolved in 1 ml degassed deionized water to prepare a 1% solution, and PEGDA extraiink crosslmker (PEG diaciylate, l Omg) which was dissolved in 0.5 m! degassed deionized water to prepare a 2% solution. Hystem (lml, 1 %) was mixed with Gelin-S (1 ml, 1 %) without creating ah' bubbles, immediately before use. After suspending cells, to gelate, 0.5ml extraiink crosslinker is added.

Cultured cells were detached from the 0.1% gelatin coated surfaces of T225 flasks (Corning) using Trypsin, which was deactivated using growth medium containing FBS. The cells were counted, and then spun at 150g for 5 min. They were resuspended at 20x10e6- 30x l0e6 cells/ml in Hystem-C:Gelin-S ( 1 : 1). Extralink was added and the evenly distributed cell suspension gradually became more viscous. Before gelation 25 ul aliquots were placed in multiple wells of a 6 well plate. Following complete gelation in about 5 min the encapsulated cells were fed chondro media, and re-fed every other day. On day 14 ceils were lysed and RNA harvested.

For total RNA extraction Qiagen RNeasy Mini Kits (Qiagen, Cat # 74106) was used. On day 14, the medium was removed, hydrogel-cell constructs are washed with PBS, then exposed to lysis buffer RLT (Qiagen, Valencia CA Cat #79216) with 1% beta mercaptoethanol following manufacturers instructions, placed in labeled RNase DNase free 1.5ml eppendorf tubes and frozen at -80°C. Later, thawed samples, were vortexed, briefly spun, and further homogenized using QlAshredder (Cat # 79694). RNA was then extracted using the RNeasy mini-kits following manufactures instruction and RNA concentration measured using a Nanodrop 1000. cDNA was prepared using Superscript III first strand kits with random hexamers (invitrogen, Carlsbad CA, Cat. 18080-051), following manufacturer's instructions. cDNA clean- up to remove nucleotides, primers, salts and polymerases was carried out using QIAquick PCR purification kits (Qiagen, Valencia CA Cat. #28104) following manufacturer's instructions.

Samples for testing (template) were prepared in standard Optical 96-well reaction plates (Applied B systems Carlsbad, CA, PN 4306737) consisting of 30ng of RNA equivalent of cDNA, O.811M per gene-specific custom oligonucleotide primer set (Invitrogen), ultra-pure distilled water (Invitrogen Cat. # 10977015), diluted 1 : 1 with 12.5ul of Power SYBR Green PCR Master Mix (Applied Biosystems Carlsbad, CA, Cat. # 4367659) incorporating AmpliTaq Gold DNA polymerase in a total reaction volume of 25ul. Real-Time qPCR was run using Applied Biosystems 7500 Real-Time PCR System employing SDSvl .2 software. Amplification conditions were set at 50°C for 2 min. (stage 1), 95°C for 10 min. (stage 2), 40 cycles of 95°C for 15 sec then 60°C for 1 min (stage 3), with a dissociation stage (stage 4) at 95°C for 15 sec, 60°C for 1 min, and 95°C for 15 sec. Ct values of amplicons were normalized to the average Ct value of 3 housekeeping genes (GAPD, RPS 10, and GUSB), and normalized gene expression of samples calculated relative to that of early passage knee-Normal Human Articular Chondrocytes (Lonza).

Primers Used:

COL2A1 (NM 001844.4) f. TGGCCTGAGACAGCATGA

r. AGTGTTGGGAGCCAGATTG (373 bp) ACAN HMJil 3227.2) f. TGAGTCCTCAAGCCTCCTGT

r. CCTCTGTCTCCTTGCAGGTC (185bp) CEP-68 (CRTAC1) (N _018058.4) f. ATCCGTAGAGAGCACGGAGA

r. GGACTCTCCATGGGACAAGA (144bp)

COL10A1 (NM_000493.3) f. G GGCCTCAATG G ACCC ACCG

r. CTGGGCCTTTGGCCTGCCTT ( 150bp)

G^ DH(NM_002046.3) f. GGCCTCCAAGGAGTAAGACC

r. AGGGGTCTACATGGCAACTG (147bp)

RPS10 (NM_001014.3) f. ATTTGGTCGTGGACGTGGT

r. TTTGGCTGTAAGTTTATTCAATGC (77bp)

GUSB (NM_000181.2) f. AAACGATTGCAGGGTTTCAC

r. CTCTCGTCGGTGACTGTTCA (171 bp)

The results are presented in Table 4 and show that BMP family members effectively induce chondrocyte associated gene expression in many of the tested clonal progenitor lines.

Example 5: Histological analysis of chondrocytes obtained from various progenitor cell lines

Progenitor cells lines were derived from NTH registered hES cell line H9 as described by West et al., 2008 (The ACTCellerate initiative: large-scale combinatorial cloning of novel human embryonic stem cell derivatives, egen. Med., 3(3), 287-308). They were cultured in Corning tissue culture treated polystyrene culture-ware coated with 0.1 % gelatin prepared fiom 2% gelatin, (Sigma Cat # G1393) using appropriate growth media supplemented with 2mM glutamax and penicillimstreptomycin (100iU/ml: I00ug/mi), They were placed in a humidified incubator at 37°C, 5% 02, and 10% C02. Cells are fed by replacing media every 2-3 days and split 1 :3 at or near confluence using 0.25% Trypsin/EDTA (Invitrogen 25200-1 14) diluted 1 :3 with PBS, Ca Mg fi'ee. Progenitor cell lines so obtained were treated as described below to induce differentiation to chondrocytes or chondrocyte progenitors.

Pellets were prepared according to the method described by Johnstone 1 98 (Johnstone, B., Hering T. M., Caplan A. I., Goldberg, V.M. and Yoo J. U. In Vitro Chondrogenesis of Bone Marrow-Derived Mesenchymal Progenitor Cells. Exptl. Cell Res. 238, 265-272, 1998). Briefly, pellet micromasses were prepared by aliquoting 500,000 cells in 500ul (i.e. lxlO ⁶ cells/ml) chondrogenic media into individual 15ml sterile conical tubes, spinning at 150xg for 5 minutes at 23°C, and placing pellets in a humidified incubator at 37° C, 10%CO ₂ , 5%0 ₂ with tube caps loosened. Pellets are fed eveiy other day over a 5 day period (i.e. 3 times).

Chondrogenic media was DMEM (CellGro Cat. No. 15-013-CV, or PromoCell, Heidelberg Germany C-71219), high glucose, Pyruvate, I mM (Gibco Cat. 1 1360), Pen: Strep 100U/ml: 100ug mi (Gibco Cat. No. 504284), Glutamax 2mM (Gibco Cat. No. 35050),

Dexameiliasone O. l uM (Sigma, St. Louis, MO, Cat. No.D 1756- 100), L-Proline 0.35mM (Sigma Cat. No. D49752), 2-phospho-L-Ascorbic Acid 0.17niM (Sigma, Cat. No. 49792, Fluka),

ITS Premix (BD, Franklin Lakes, NJ, sterile Cat. No. 47743-628) final concentration 6.25ug/ml insulin, 6,25ug/ml transferrin, 6.25ng/ml selenious acid, serum albumin 1.25mg/ml, 5.35 ug/ml linoleic acid and TGFb3 lOng/mi (R&D systems, Minneapolis MN, Cat. No. 243-B3-010). Supplements of other BMP family members was as shown in captions of Figure 5

All samples were fixed with 10% neutral buffered formalin. Fixed samples are paraffin embedded, sectioned 4-5um, deparaffi ized, hydrated and stained with H&E, Safraiiin-O, and COL2 immtmostam ( illipore, Cat. # MAB8887 Anti-Collagen Type II, clone 6B3).

The results of the histological analysis are shown in Figure 5 and indicate that clonal progenitor cells were induced to differentiate to chondrocytes as measured by Saf O staining and collagen 2 staining.

Example 6: Chondrogenic potential of a ZIC2, RGS l positive clonal embryonic progenitor cells line in response to BMP4 but not TGFB3.

The cell line EN7 in the undifferentiated state propagated in media such as Promocell MV2 endothelial medium is positive for the mRNA markers: RGSl, NEFM, KBTBDIO, CLDN5, GPR44, ATP1A2, KCND2, DLK1, FOXF1, and ZIC2, with most distal HOX gene expression being HOXB2, ΗΟΧΛ2, and is negative for the markers: ACTC, AJAP1, ALDH1A1, ALDH1A2, ANXA8, BARX1, C3, CCDC3, CD24, CD74, CDH3, CNTNAP2, COMP, CRYAB, DKK2, GSC, HAND2, HOXA5, HSD11B2, HSPB3, IN A, KRT14, KRT17, LHXl, LHX8, MFAP5, MEOX1, MEOX2, MGP, MMP1, MYH3, MYHJ1, NPAS1, NPPB, OLR1, PAX2 (IH mina Probe

6450767}, PAX9, PENK, PITX1, PITX2, PROM1, RELN, SFRP2, SMOC2, STMN2, TAC1, TBX15, TRH, and TUBB4 as determined by ilhimina microarray analysis described herein. The Gene RGS1 (NM_002922.3) was not observed to be expressed in cultured norma! human articular chondrocytes (NHACs), human dermal fibroblasts, Adipose stem cells (cultured stromal fraction), human dental pulp stem cells (DPSCs), human bone marrow-derived mesenchymal stem cells (MSCs), or the other chondrogenic cell lines described herein such as 4D20.8, 7PEND24, SM30, E l 5, MEL2, 7SM0032, or SKI 1. The cell line was differentiated in the presence of TGF beta family members in HyStem pellets as described herein and the resulting RNAs were analyzed by Il imina microariay and qPCR as described herein for the presence of chondrogenic, osteogenic, and tendon markers (Figure 6). Surprisingly, while there was no evidence of COL2A1 expression in EN7 in the presence of to TGFB3 in microniass conditions as described herein (Steinberg et al, A human embryonic stem cell-derived clonal progenitor cell line with chondrogenic potential and makers of craniofacial mesenchyme. Regen Med 2012 Apr 23. [Epub ahead of print], 2012), indeed, only seven of 100 clonal progenitor cell lines responded to TGFB3 in micromass conditions with chondrogenic differentiation, nevertheless, in the presence of 10 ng/mL of BMP4 together with 10 ng/mL of TGFB3, there was an average of 1, 164 tune more COL2A1 expression as determined by qPCR than cultured NHACs, and by 21 days, there was an average of 34,608 fold more COL2A1 than cultured NHACs. In addition to COL2A I , other markers of cartilage were observed by microarray analysis including markedly elevated expression of COL9A2, and CHAD, but unlike other chondrogenic lines described herein, EN7 differentiated for 21 days in the presence of 10 ng/mL of BMP4 together with 10 ng/mL of TGFB3 expressed relatively high levels of transcripts for the secretoiy leukocyte peptidase inhibitor SLPI which is useful as a therapeutic agent in diseases mediated by leukocyte elastase-antielastase imbalances or bacterial-induced inflammation and articular cartilage destruction (J Exp Med. 1999 Aug 16; 190(4):535-42), and the protease legumain (LGMN).

Said cells with gene expression markers of EN7 derived from pluripotent stem cells such as hES or iPS cells, including wherein said cells are expandable populations of cells such as clonal, oligoclonal, or pooled clonal or pooled oligoclonal cell lines, may be used not only to repair injured cartilaginous tissues, but also to secrete proteins such as SLPI or LG 4N to produce a therapeutic effect, such as the prevention of inflammatory arthritic processes or similar inflammatory processes damagingtissues. Other secreted proteins include Cytl l . Nonlimiting examples of such therapeutic applications include osteoarthritis, bacterial and rheumatoid arthritis, and the repair of cartilage particularly susceptible to damage from lack of SLPI such as intervertebral cartilage, Additional uses include formulating it with an injectable matrix such as Hystem as imaging agent and/or a therapeutic.

Table I: Exemplary progenitor cell lines and associated gene expression markers at 18-21 doublings of clonal expansion

The group of cell lines X2.1 (also known as 2.1 and ACTC63), X2.2 (also known as X2.2Repl and X2.2Rep2 and 2.2 and ACTC62) are positive for the markers: CFB, CLDN i 1, COMP, CRLF1, EGR2, FST, KRTI4, KRT19, RT34, MFAP5, MGP, PENK, PITX2, POSTN, PTGS2, RARRES1, S100A4, SOD3, TFPI2, THYI and ZICl and are negative for the markers: AGC i, ALDH 1A 1, APCDD I, AREG, ATP8B4, C6, C7, C20orfi03, CCDC3, CDH3, CDH6, CNTNAP2, COPI, CXADR, DI02, METTL7A, DKK2, DLK 1, E ID 1, FGFR3, FM03, FOXFI, FOXF2, GABRB 1, GDF10, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, IGFBP5, INA, KCNMBI, 1GFL3, LOC92196, MEOXl, MSX2, MX1, MYBPH, MYH11, MYL4, NLGN4X, NPPB, PAX2, PAX9, PDE1A, PRELP, PROM1, RASD1, RELN, RGS1, RPS4Y2, SFRP2, SMOC1 , SMOC2, SNAP25, SYT12, TAC1, RSP03, TUBB4, UGT2B7, W1SP2, ZD52F10 and Z1C2.

The cell line Bl is positive for the markers: CD24, CDH6, HTRA3, ΓΝΑ, KRT17, KRT19, LAMC2, M P1, IL32, TAGLN3, PAX2, RELN, UGT2B7 and Z1C2 and is negative for the markers: ACTC, AGC1, ALDH 1 A 1, APCDD 1 , ATP8B4, BEX1, CFB, C3, C6, C7, PRSS35, C20orfI03, CCDC3, CDH3, CNTNAP2, COL15A 1, COL21A 1 , COPI, CRLF1 , DI02, METTL7A, DKK2, DLKI, DPT, EGR2, EMID 1, FGFR3, TMEM100, F Ol, ; FM03, FOXF I , FOXF2, FST, GABRB I, GAP43, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, iFI27, IGF2, KCNMB I, K1AA0644, KRT14, TMEM1 19, IGFL3, LOC92196, MFAP5, MASPI, MEOX2, MGP, MYBPH, MYH3, MYH1 I, MYL4, NPASI, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, POSTN, PRELP, PRG4, PROM1, PRRX 1 , PRRX2, PTN, PTPRN, RARRES I, RASD1, RGMA, RGSi, SERPINA3, SL1TRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC 1, RSP03, TNNT2, TRH, TSLP, TUBB4, WISP2 and ZICL

The group of cell lines X4.1, X4.3 and BIO are positive for the markers: MMPl, AQP1, CDH6, HTRA3, ΓΝΑ, KRTI 9, LAMC2, IL32, TAGLN3, NPPB and UGT2B7 and are negative for the markers: AGC 1 , ALDH1A 1, APCDD 1 , AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CNTNAP2, COL21A1, COMP, COPI, CRLF1, DI02, METTL7A, DKK2, DLK1, DPT, EMTD I , TMEM 100, FMO l, FM03, FOXFI, FOXF2, GABRB I , GAP43, GSC, HOXA5, HSD I 1B2, HSD 17B2, HSPA6, ID4, IFI27, 1FIT3, IGF2, KRT14, TMEM 11 , L0C92196, MASPI, MEOX2, MGP, MYBPH, MYH3, MYL4, OGN, OSR2, PAX9, PDE1A, PENK, PRELP, PRRX2, PTN,

RARRES I, RGMA, RGSI , RPS4Y2, SERPINA3, SLITRK6, SMOCI, SMOC2, TAC1, RSP03, TNNT2, TRH, TUBB4 and WISP2.

The group of ceil lines Bl 1, B25, B26 and B3 are positive for the markers: AKRIC I , CFB, BMP4, CLDN l l, FST, GDF5, HTRA3, IL1R I, KRT14, KRTI9, KRT34, MGP, MMPl, PODN, POSTN, PRG4, RARRESI, S 100A4, THYI and ZICl and are negative for the markers: ACTC, ALDH IA I, APCDD1, C6, C7, C20orfl03, CCDC3, CD24, CXADR, DI02, DKK2, DLKI, EM1D 1, FGFR3, FMOl, FM03, FOXFI, FOXF2, GABRB I, GDF10, HSDI 1B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, INA, KCNMB I, IGFL3, LOC92196, MEOX 1, MSX1, MYBPH, MYH3, MYH 11, MYL4, NLGN4X, TAGLN3, NPPB, OLR1, PAX2, PAX9, PROM1, RASD1, RGSI, RPS4Y2, SLITRK6, SMOCI, SMOC2, SNAP25, TAC 1, RSP03, TUBB4, UGT2B7, ZD52F 10 and ZIC2.

The group of cell lines B 12 and B4 are positive for the markers: CLDNI 1, FST, GDF5, HTRA3, KRT19, KRT34, MFAP5, MGP, MMPl , POSTN, PTGS2, S100A4, THYI and ZICl and are negative for the markers: AGC1, ALDH 1A 1, APCDD l, AREG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CDII3, CNTNAP2, COP I, CXADR, DI02, DKK2, DLK I, DPT, EMID1, FMOl , FM03, FOXFI, FOXF2, GABRB I, GDF10, HOXA5, HSD1 IB2, HSD17B2, HSPA6, HSPB3, IGFBP5, IGFL3, LOC92196, MEOX1, MYBPH, MYH3, MYH 1 1, MYL4, NPASI, NPPB, OLR1, PAX2, PAX9, PITX2, PROM1, RGSI, SLITRK6, SMOCI , SMOC2, SNAP25, TAC 1, RSP03, TNNT2, TRH, TUBB4, ZD52F10 and ZIC2.

The group of cell lines B20 and B 15 are positive for the markers: BMP4, CD24, CRIP 1, HTRA3, KRTI9, LAMC2, MGP, MM l , POSTN, RELN, S100A4, THY I and UGT2B7 and are negative for the markers: AGC 1, ALDH lA l, ANXA8, AREG, ATP8B4, CFB, C6, C7, C20orfl03, CNTNAP2, DI02, METTL7A, DLKI, DPT, EMID 1, TMEM 100, FMOl, FM03, FOXF2, GABRB I, GSC, HOXA5, 11SD 11B2, HSD 17B2, HSPA6, ID4, IFI27, KRT1 , KRT34, IGFL3, MASP I, MEOX1, MEOX2, MYBPH, MYH3, MYL4, NPASI, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PROM1, PRRX2, RGSI, SL1TRK6, SMOC I, SMOC2, STMN2, TACI, TNNT2, TRH, TUBB4, W1SP2 and ZICL The group of cell lines D16Biolb, B16Bio2b, E72 and E75 are positive for the markers: AKR1 C 1, BMP4, CLDNl 1, FST, GDF5, HTRA3, IL1R1, RT19, KRT3 , MFAPS, MGP, MMPl, OSR2, PODN, POSTN, PRG4, PRRX1, RARRES1, S 100A4, SOD3, THYI and ZIC 1 and are negative for the markers: ACTC, AGC1, ALDH l A l , AREG, C6, C7, C20orfl03, CCDC3, CDI13, CNTNAP2, DKK2, EM1D 1, FGFR3, FM03, FOXFI, FOXF2, GABRB 1, GDF 10, HSD1 1B2, HSD17B2, HSPA6, 1D4, IGF2, INA, LAMC2, IGFL3, LOC92196, MEOX1, MSX1, MYBPH, MYHl 1, MYL4, NLGN4X, NPASl, NPPB, OLRl, PAX2, PAX9, PROM1, PTPRN, RASD1, RGS1 , SLITRK6, SMOC 1, SMOC2, SNAP25, TAC1, RSP03, TNNT2, TUBB4, ZD52F10 and ZIC2.

The group of cell lines B 17Bioib, B 17Bio2c and B 17Bio3c are positive for the markers: BEXl, COL15A 1, CRIPl, CRYAB, HTRA3, KCNMBl, KRT19, MGP, POSTN, S100A4, SFRP2, THYI and TNFSF7 and are negative for the markers: , AGC l, ALDH lAl, APCDD l, AREG, ATP8B4, C6, C7, CNTNAP2, METTL7A, DLKI, DPT, EMID1, FMOI, FM03, FOXF 1 , GAB RBI, GSC, HOXA5, HSD 1 1B2, HSD17B2, HSPA6, IF127, KRT14, KRT34, IGFL3, MASP1, MEOX 1, MEOX2, MYBPH, MYH3, MYL4, NPPB, OGN, PAX9, PDE IA, PENK, PR0M1, RASD 1, RGS1, SLITRK6, SMOCl, SM0C2, STMN2, TAC1 , TRH, TSLP, TUBB4 and ZIC1.

The group of cell lines B2, B7 and X6.1 are positive for the markers: AKR1 C1, CFB, BMP4, C3, CLDNl 1 , C0L21A1, FST, GDF5, HTRA3, ICAM5, IL1 R1, KRT19, MGP, MMPl, PENK, PODN, POSTN, PRG4, RARRES1, RGMA, S 100A4, SERP1NA3, SOD3, STMN2, THYI and WISP2 and are negative for the markers: ACTC, AGCl, ALDH lAl, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CXADR, DI02, DLKI, EMID1, FGFR3, FM03, FOXF1, FOXF2, GABRB 1, GDF 10, HSDI 1B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, INA, IGFL3, LOC92196, MEOX 1 , MYH 11 , MYL4, NLGN4X, TAGLN3, NPASl, NPPB, OLRl, PAX2, PAX9, PITX2, PROM1, PTPRN, RASD 1 , RGS1, RPS4Y2, SLITRK6, SMOC l , SMOC2, SNAP25, SOX1 1, TAC1, RSP03, TUBB4, UGT2B7, ZD52F10 and ZIC2.

The group of cell lines B22, CM30.2 and X6 are positive for the markers: BMP4, CLDNl 1, CRIPl, CRYAB, HTRA3, KRT19, S 100A4, SFRP2, SRCRB4D, THYI and UGT2B7 and are negative for the markers: AGC l, ALDH lA l, APCDD l, AREG, ATP8B4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COL21A 1, COPI, DI02, METTL7A, DKK2, DLKI, DPT, FMO I, FM03, FOXFI, FOXF2, GAB RBI, GSC, HOXA5, HSDI 1B2, IISPA6, IFI27, IFIT3, IGF2, KRT14, MASP1, MEOX2, MYBPH, MYH3, MYHl 1, NPPB, OGN, OLRl, OSR2, PAX9, PDEIA, PENK, PROMI, RGS1, SMOCl, SNAP25, STMN2, TAC1, TRH, TSLP, TUBB4 and WISP2.

The group of cell lines B27, B9, CM 10.1 , X2, X4.2 and X4.4 are positive for the markers: HTRA3, KRT1 , LAMC2, 1L32, TAGLN3, PAX2, RELN and UGT2B7 and are negative for the markers: AGCl, ALDHlA l , APCDDl, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, COL21A 1 , COPI, CRLF1, D102, METTL7A, DL I , DPT, EMTD 1 , TMEM 100, FMO I, FM03, FOXFI, FOXF2, GABRB 1, GAP43, GSC, HOXA5, HSDI 1 B2, HSD 17B2, IISPA6, IFI27, 1GF2, KIAA0644, KRT14, IGPL3, LOC92196, MASP1, MEOX2, MGP, MYH3, MYHl 1, MYL4, NPAS l, OGN, OLRl, OSR2, PAX9, PDEIA, PENK, PRELP, PTN, RARRES 1, RGMA, RGS1, SERPINA3, SLITRK6, SMOCl, SMOC2, SNAP25, SOD3, STMN2, TAC 1 , RSP03, TNNT2, TRH, TUBB4 and WISP2.

The cell line B28 is positive for the markers; CFB, BMP4, COL15A 1, CRIP l, CRYAB, FST, GAP43, IL1R1, KCNMBl, KRT14, KRT19, KRT34, MFAP5, MGP, MMP l, IL32, PODN, POSTN, S100A4, THYI and ZIC1 and are negative for the markers: ACTC, ALDH 1 A 1 , ANXA8, AREG, ATP8B4, BEXl, C3, C6, C7, C20orfl03, CCDC3, CNTNAP2, CXADR, DI02, METTL7A, DKK2, DLKI, EMID1, FGFR3, FMOI, FM03, FOXF I, FOXF2, GAB RBI, GDF10, HOXA5, HSD 1 IB2, HSD17B2, HSPA6, ID4, IFI27, 1GF2, IGFBP5, INA, IGFL3, LOC92196, MASP1, MEOX1, MYBPH, ΜΥΉ3, MYL4, NLGN4X, NPAS l, NPPB, OLRl, PAX9, PDEIA, PITX2, PROMi, PTPRN, RASD1, RGS 1, RPS4Y2, SLITRK6, SMOC l , SMOC2, SNAP25, STMN2, TAC1, TRH, TSLP, TUBB4, ZD52F 1 and ZIC2.

The cell line B29 is positive for the markers: ANXA8, AQP i, CD24, CDH6, CRIP l, GJB2, HTRA3, KRT17, KRT19, LAMC2, IL32, TAGLN3, PAX2, RELN, S 100A4, SFRP2, SRCRB4D, THY 1, TNFSF7, UGT2B7, ;ZD52F10 and ZIC2 and are negative for the markers: AGCl, ALDH lA l, APCDD l, AREG, ATP8B4, BEXl, C3, C6, C7, C20orfl03, CCDC3, CLDN 11, CNTNAP2, COL21A1, COPI, CRLF 1, DI02, METTL7A, DLKI, DPT, EMID1, TMEM 100, FMOI , FM03, FOXF I , FOXF2, GABRB 1, GAP43, GDF10, GSC, HOXA5, HSD 11B2, HSD17B2, HSPA6, HSPB3, IFI27, 1F1T3, IGF2, KRT14, KRT34, IGFL3, MFAP5, MASP l, MEOX2, MMP l, MSX1, MYBPH, MYH3, MYL4, NPAS l, NPPB, OGN, OLRl, OSR2, PAX9, PDEIA, PENK, P1TX2, POSTN, PRG4, PROMI, PRRX2, PTPRN, RARRES1, RASD1, RGS1, RPS4Y2, SERP1NA3, SLITRK6, SMOC l, SMOC2, SNAP25, SOD3, STMN2, TAC1, RSP03, TRH, TSLP, TUBB4, WISP2 and ZIC1. The cell line B30 is positive for the markers: PRSS35, CDH6, COL21A1, CRiPl, CRYAB, DKK2, GAP43, KCNMB1, RTI7, KRT19, PR XI, PTN, RGMA, S100A4, SOX1 1 and ZIC2 and are negative for the markers: ACTC, AGC1, AKR 1C 1, ALDH1A1, ANXA8, APCDD1, AQP 1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CD24, CDH3, CLDNI 1, CNTNAP2, COL15AI, COMP, COP 1, CRLF1, METTL7A, DPT, EGR2, EMID1, TMEM100, FMOl, FM03, FOXF i, FOXF2, GABRB l, GDF10, GJB2, GSC, HOXA5, HSD 11B2, HSD 17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KRT34, LAMC2, IGFL3, LOC92196, FAP5, MASP1, MEOX1, MEOX2, MSXi , MYBPH, MYH3, MYL4, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1 , PTPRN, RARRES1, RASD 1, RELN, RGS1, RPS4Y2, SFRP2, SLITR 6, SMOC1, SNAP25, STM 2, TAC1, TFPI2, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, W1SP2, ZD52F 10 and ZIC1.

The cell line B6 is positive for the markers: CCDC3, CDH6, COL15A 1 , CRIPl, DKK2, FST, GDF10, HTRA3, RT19, LOC92196, YL4, NLGN4X, S100A4, SOX1 1, SRCRB4D, THYl, ZIC1 and ZIC2 and are negative for the markers: AGC 1, A R1C1, ALDH1A1, AREG, ATP8B4, BEXI, CFB, C3, C6, C7, CNTNAP2, COMP, COP1, D102, ME ^' I L7A, DLKI, DPT, EMID1, TME 100, F 03, FOXF I, FOXF2, GABRBl, GSC, HOXA5, HSDi 1B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, KRT14, TMEM1 19, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, NPAS 1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PTPRN, RASD1, RGS 1, RPS4Y2, SL1TRK6, SMOC1 , SNAP25, STMN2, TAC1, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZDS2F10.

The cell line C4ELS5.1 is positive for the markers: AKR1C1, C7, CDH6, COL15A 1, DI02, FMOl, FM03, FOXF2, IGF2, IL1R1, KRT19, LAMC2, TMEM119, PODN, PRRXI , PRRX2, RGMA, SFRP2, TAC1, TFPI2 and RSP03 and arc negative for the markers: ACTC, AGC1, ALDFt l A l, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEXI, CFB, BMP4, C3, C20orfl03, CCDC3, CDII3, CLDN I 1, CNTNAP2, COMP, COPl, CRLF 1, CRYAB, CXADR, DKK2, DLKI, EGR2, EM1D1, FGFR3, FOXFI, GABRB l, GAP43, GDF10, GJB2, HOXA5, HSD 17B2, HSPA6, HSPB3, 1 CAM 5, 1D4, 1FI27, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP1, MSXI, MSX2, MX1, MYBPH, MYH3, MYH1 1 , MYL4, IL32, NLGN4X, TAGLN3, PAS 1, NPPB, OLR1, PAX2, PAX9, PENK, P1TX2, POSTN, PRELP, PROM1, PTPRN, RAR ES1, RELN, RGS 1, RPS4Y2, SMOC 1, SMOC2, STMN2, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2.

The cell line C4ELS5.5 is positive for the markers: BEXI, BMP4, C7, PRSS35, CDH6, DKK2, FM03, FOXF2, FST, GDF!O, HSD 17B2, IGF2, TMEM 1 19, P1TX2, PODN, PRRXI, SERP1NA3, SFRP2, TFPI2 and ZIC2 and are negative for the markers: AGO , ALDH IA 1 , APCDD 1, AQP1, AREG, ATP8B4, C3, C6, C20orfl03, CD24, CDH3, CNTNAP2, COMP, COPl , CRLF1, CXADR, DLKI, DPT, EM1D 1, FGFR3, TMEM100, FOXF I, GJB2, HOXA5, HSDI 1B2, HSPA6, HSPB3, ID4, IFI27, KCNMB 1, KRT14, KRT17, KRT34, IGFL3, MFAP5, MEOX1, MEOX2, MGP, MMP1, MSX2, MX 1 , MYBPH, MYH3, MYH 11, 1L32, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PTPRN, RARRES 1, RASD1, RELN, RGS1, SMOC2, STMN2, TAC 1, THY l, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F 10 and Z1C1.

The cell line C4ELSR.12 is positive for the markers: C7, CDH6, COL21 Al, DI02, FMOl, FM03, FOXF2, FST, IGF2, IL1 R1, TMEM119, PRRXI, PRRX2, PTN, RGMA, SFRP2, SRCRB4D, TAC1, ΊΤΡΙ2, RSP03, UGT2B7 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD 1, AQP1, ATP8B4, C3, C20orH03, CD24, CDH3, CNTNAP2, COMP, COPl, CRLF1, CXADR, DPT, EMID1, FGFR3, TMEM100, FOXFI, GABRB l, GAP43, GJB2, HOXA5, HSPA6, HSPB3, ICAM5, IFI27, 1NA, KRT14, KRT17, KRT34, IGFL3, MFAP5, MEOX 1, MEOX2, MGP, MMP1, MX1, MYBPH, MYH 11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PROM 1, PTPRN, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOC2, STMN2, SYT12, THY l, TNFSP7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F10 and ZIC l.

The group of cell lines C4ELSR2, C4ELSR2Bio2 and C4ELSR2Bio2.1 are positive for the markers: C7, CDH6, COL21A 1, DKK2, FM03, FST, GSC, IGF2, TMEM I 19, PITX2, SFRP2, TFPI2 and ZIC2 and are negative for the markers: ACTC, AGC 1, ALDH1A1, APCDD1, AQP1, ATP8B4, CFB, C3, C6, CCDC3, CD24, CDH3, CLDN I 1 , CNTNAP2, COMP, COPl, CRLF1, CRYAB, DLKI, DPT, EMID 1, FGFR3, TMEMI00, FOXF I, GABRB l , GJB2, HOXA5, HSD 11B2, HSD 17B2, HSPA6, HSPB3, 1D4, IFI27, KIAA0644, KRT14, KRT17, KRT34, 1GFL3, MFAP5, MEOX1, MGP, MSX2, MX 1, MYBPH, MYH3, MYH 11, IL32, NLGN4X, NPAS1, NPPB, OLR 1, PAX2, PAX9, PDEIA, PENK, POSTN, PRELP, PROM1, PTPRN, RARRES1, RASD l, RELN, RGS1, SMOC1, SMOC2, STMN2, THYl, TNFSF7, TRH, TSLP, TUBB4, ZD52F10 and ZICI, The group of cell lines CMO.2 and E31 are positive for the markers: AQP i, CD24, CDH6, HTRA3, KRT19, KRT 4, TAGLN3, RELN, SIO0A4, SFRP2, SRCRB4D and UGT2B7 and are negative for the markers: AGC l, ALDH lA l , APCDD 1, AREG, ATP8B4, CFB, C3, C6, C7, Ο20ΟΓΠ03, CDH3, CNTNAP2, COMP, COP1, CRLF1, DI02, ETTL7A, DLK 1, DPT, EMID 1, TMEM100, FMOl, FM03, FOXF 1, FOXF2, GABRB 1, GAP43, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, RT14, MFAP5, MASP1, MEOX2, MYH3, NPAS 1, OGN, OLRi, OSR2, PAX9, PDE1A, PEN , PRG4, PROM l, PTPRN, RARRESi, RASD1, RGS 1 , SERPINA3, SLITR 6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC1, TRH, TSLP, TUBB4 and WISP2.

The group of cell lines CMO.2, CMO.5 and CM50.5 are positive for the markers: PRSS35, CLDN11, CRIPI, CRYAB, FST, KRT19, KRT34, MFAP5, MEOX2, MGP, MMPi, PODN, POSTN, PRRX1, S 100A4, THY I and ZIC1 and are negative for the markers: ACTC, ALDHlAl, APCDD1, AREG, ATP8B4, BEXl, C3, C6, C7, C20orfi03, CCDC3, CDH3, CNTNAP2, CXADR, DI02, D K2, DL 1, EMID1, TMEM100, FMOl, FM03, FOXF1, 1-0X1*2, GAB R I, GDFIO, GJB2, GSC, HSD1 1B2, HSD17B2, HSPA6, IGF2, IGFBP5, IN A, LAMC2, 1GFL3, LOC92196, MEOX1, MX1, MYBPII, MYL4, NLGN4X, TAGLN3, NPAS1 , NPPB, PAX2, PAX9, PDE1A, PENK, PITX2, PROM 1 , PTPRN, RASD1, RGS 1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSP03, TRH, TSLP, TUBB4, ZD52F 10 and ZIC2.

The group of cell lines CM 10.4, CM20.4, CM30.5 and X2.3 are positive for the markers: CLDNl 1, COMP, CRfPl, FST, KRT1 , KRT34, MFAP5, MGP, PITX2, POSTN, SI00A4 and THY I and are negative for the markers: ACTC, ALDHlA l, AQPI, ATP8B4, C6, C7, C20oif 103, CCDC3, CDH3, CNTNAP2, COPl, CXADR, ME'ITL7A, DLK1, DPT, EMID 1, FGFR3, TMEM100, FMOl, FM03, FOXF1, FOXF2, GABRBT, GDF10, HSD1 1B2, HSD 17B2, HSPA6, HSPB3, IGF2, IGFL3, LOC92I96, MEOX1, MX1, MYBPH, MY1I3, MYHI 1, MYL4, NLGN4X, TAGLN3, NPPB, PAX2, PAX9, PDE1A, PRELP, PROM1, PTPRN, RASD i, RELN, RGS 1, SLITRK6, SMOC2, SNAP25, STMN2, TAC1, RSP03, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC2.

The group of cell lines El 1 1 and El i !Bio2 are positive for the markers: CD24, CDH6, CRIPI, HTRA3, INA, TAGLN3, SFRP2, SRCRB4D, UGT2B7 and ZIC2 and are negative for the markers: AGCl, AKRICI, ALDH lAl, APCDDI, AREG, ATP8B4, CFB, C3, C6, C7, C20orfI03, CDH3, CNTNAP2, COPI, CRLF 1, DI02, METTL7A, DLK 1, DPT, EMID1, TMEM100, FMO l , FM03, FOXF1, FOXF2, GABRB I, GAP43, GSC, HOXA5, HSD1 IB2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, IGF2, KRT14, LAMC2, MASP 1, MEOX2, MXl, MYBPH, MYH3, MYH 11, NPAS1 , OGN, OLRI, PAX9, PDE1A, PENK, PRG4, PROM!, PRRX2, PTPRN, RARRES I, RASD I, RGMA, RGS1 , SL1TRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4 and \ViSP2.

The cell line E120 is positive for the markers: ACTC, BEXl, CLDNl 1, COL 15A1, CRIPI, CRYAB, FST, GDF 10, GJB2, HTRA3, IGFL3, MGP, MX] , IL32, POSTN, S 100A4, SFRP2, THYI, TNFSF7, ZD52F10 and Z1C2 aud are negative for the markers: AGCi, AKRICI, ALDH 1A 1, APCDD 1, AQPI, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20orfl03, CD24, CDH3, CNTNAP2, COL21A 1, COMP, COP l, CRLF1, CXADR, DI02, METTL7A, DKK2, DLK1, EMIDl, FGFR3, FMOl, FM03, FOXF1 , FOXF2, GABRB I, GAP43, GDF5, GSC, HOXA5, HSD1 1B2, HSD 17B2, HSPA6, HSPB3, IFI27, IGF2, INA, KRT14, LAMC2, TMEM1 19, MASP1, MEOX2, MMPI, MSX2, MYBPH, MYH3, ΜΥΉ 1 1 , NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDE 1A, PENK, P1TX2, PODN, PRG4, PROM1, RASD I, RELN, RGMA, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNNT2, TRH, TUBB4, UGT2B7 and WISP2.

The cell line E15 is positive for the markers: ACTC, BEXl, PRSS35, CRIP 1 , CRYAB, GAP43, GDF5, HTRA3, KRT19, MGP, MMPI, POSTN, PRRX1, S100A4, SOXl 1, SRCRB4D and THYI and are negative for the markers: AGC l, AKRIC I, ALDH lA l , ANXA8, APCDDI , AQPI, AREG, ATP8B4, CFB, C3, C6, C7,

C20orfl03, CDH3, CNTNAP2, COPl, CXADR, METTL7A, DLKI, DPT, EGR2, EMID l, TMEM100, FMOl, FM03, FOXF 1, FOXF2, GABRB I, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSDI7B2, HSPA6, IISPB3, F127, IFIT3, IGF2, INA, KRT14, TMEM1 19, IGFL3, LOC92196, MFAP5, MASP i , MEOX1, MEOX2, MSX 1, MXl, MYBPII, MYH3, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLRI, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PTPRN, RARRES I, RASD I , RELN, RGS 1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC 1, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC1. The cell line E164 is positive for (lie markers: AQPl, CD24, CDII6, CR1P1, HTRA3, KRT17, KRT19, IL32, TAGLN3, PAX2, RELN, S100A4, SFRP2, SRCRB4D, THYI, TNFSF7, UGT2B7, ZD52F10 and ZIC2 and are negative for the markers: ACTC, AGCI, ALDH1A f , ANXA8, APCDD1, ARfiG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, COP1, CRLF1, DI02, METTL7A, DKK2, DLKI, DPT, EGR2, EMIDl, TMEMIOO, FMOl, FM03, FOXFl, FOXF2, GABRBl, GAP43, GDF5, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, HSPB3, 1D4, 1FI27, CNMB1, KRT14, RT34, TME 11 , MFAP5, MASP1, MEOX2, MGP, MSX2, MYBPH, MYH3, MYH11, MYL4, NPAS1, NPPB, OGN, OLR1, PAX9, PDEIA, PENK, PITX2, POSTN, PRELP, PRG4, PRRX1, PRRX2, PTGS2, PTPRN, RARRESl, RASDl, RGMA, RGSl, SERP1NA3, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC1, TNNT2, TRH, TUBB4 and WISP2.

The group of cell lines E69 and E169 are positive for the markers: BEX1, CDH6, CRIPl, FST, GDF5, HTRA3, MMP1, POSTN, PTN, S100A4 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AQPl, A REG, ATP8B4, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COMP, CRLF1, CXADR, DL I, DPT, EGR2, EMIDl, FMOl, FM03, FOXFl, FOXF2, GABRBl, GJB2, GSC, II0XA5, HSD11B2, HSD17B2, HSPA6, IISPB3, IFI27, IGF2, ΓΝΑ, KRT14, 1GFL3, LOC92196, MASP1, MEOXl, MEOX2, MYBPH, MYH3, MYH11, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE!A, PENK, PITX2, PROMI, RARRESl, RASDl, RELN, RGSl, SL1TR 6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TACI, RSP03, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10.

The cell line E19 is positive for the markers: ACTC, BEX1, PRSS35, CLDN11, CRIPl, CRYAB, DK 2, 11TRA3, ICAM5, KRT17, KRT19, KRT34, MX1, POSTN, THY 1, ZICI and ZIC2 and are negative for the markers: AGC1, A RIC1, ALDH1A1, APCDD1, AQPl, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COL21A1, COP1, CXADR, METTL7A, DLKI, DPT, EGR2, EMIDl, TME IOO, FMOl, FM03, FOXFl, FOXF2, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, IGF2, IL1R1, KIAA0644, TMEMi 19, IGFL3, LOC92196, MASP1, MEOXl, MEOX2, MGP, MYBPH, MYH3, NLGN4X, TAGLN3, OGN, PAX2, PAX9, PDEIA, PENK, PRG4, PROMI, PRRX2, RARRESl, RASDl, RELN, RGMA, RGSl, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, SYT12, TACI, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZD52F10.

The group of cell lines E3, E30, E20Bio2, E67, E73, E57 and E84 are positive for the markers: KRT19, KRT34, MFAP5, MGP, MMP1, S100A4, THYI and ZICI and are negative for the markers: ALDI11A1, AREG, ATP8B4, C7, C20orfl03, CDH3, CNTNAP2, DKK2, DLKI, DPT, FMOl, FM03, FOX l, FOXF2, GDF10, GSC, HOXA5, HSD17B2, IGF2, MEOXl, TAGLN3, NPPB, PAX9, PROMI, PTPRN, RGSl, SMOC1, SNAP25, STMN2, TACI, TUBB4 and Z1C2.

The cell line E33 is positive for the markers: AQPl, PRSS35, CD24, CDH6, CLDN11, CRIPl, CRYAB, DKK2, HTRA3, KRT17, KRT19, KRT34, LOC9 196, MFAP5, MGP, MYH11, TAGLN3, POSTN, S100A4, SRCRB4D, UGT2B7, ZICI and ZIC2 and are negative for the markers: AGC1, AKRIC1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COMP, COP1, CRLF1, DI02, METTL7A, DLKI, DPT, EMIDl, TME IOO, FMOl, FM03, FOXFl, FOXF2, GABRBl, GDF5, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IF127, IFIT3, IGF2, TMEMI 19, IGFL3, ΜΑδΡΙ,ΜΧΙ, MYBPH, NPAS 1 , NPPB, OGN, OLR1, OSR2, PAX9, PDEIA, PENK, PITX2, PRG4, PROMI, PTPRN, RARRESl, RASDl, RGMA, RGSl, SERPINA3, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP2S, STMN2, TACI, RSP03, TRH, TSLP, TUBB4, WISP2 and ZD52F10.

The ceil line E40 is positive for the markers: BEX1, CDH6, CLDN11, CRIPl, CRYAB, DKK2, FST, HTRA3, KRT17, KRT19, MMP1, POSTN, S100A4, SRCRB4D and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AQPl, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COMP, COPt, CRLF1, CXADR, METTL7A, DLKI, DPT, EGR2, EMIDi, TME IOO, FMOl, FM03, FOXFl, FOXF2, GABRBl, GJB2, GSC, ΗΟΧΛ5, HSDl 1B2, HSD17B2, HSPA6, HSPB3, 1FI27, IFIT3, IGF2, KIAA0644, KRT14, IGFL3, LOC92196, MASP1, MEOXl, MEOX2, MGP, MX1, MYBPH, MYH3, NLGN4X, TAGLN3, NPAS I, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDEIA, PENK, PITX2, PRG4, PROMI, PRRX2, PTPRN, RARRESl, RASDl, RELN, RGSl, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TACI, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F10 and ZICI. The cell line E44 is positive for the markers: BEX 1, CLDN1 1, CRIPl, FST, GDF5, IITRA3, IF127, IF1T3, GP, MMPI, MSXI, MX1, IL32, PRRX2, PTN, S100A4, SOD3 and ZIC2 and are negative for the markers: ACTC, AGCI, ALDH1A 1, AQP 1, AREG, ATP8B4, BMP4, C6, C7, C20orfl03, CDH3, CDH6, CNTNAP2, COL21 A l , COMP, CRLFI, DKK2, DPT, EGR2, EMID l, FGFR3, FMOI , FM03, FOXF2, GABRB l, GDF10, GSC, HOXA5, HSD1 IB2, HSD17B2, HSPA6, HSPB3, IGF2, ΪΝΑ, CNMB I , RT14, RT34, ΤΜΈΜ1 19, IGFL3, L0C92196, MFAP5, MEOX1, MEOX2, MYBPH, MYH3, MYH 11, MYL4, NLGN4X, NPAS 1, NPPB, OGN, OLRI, PAX2, PAX9, PDEIA, PENK, ΡΪΤΧ2, POSTN, PRELP, PRG4, PROMl, RASDI, RELN, RGMA, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOC l, SMOC2, SNAP25, SRCRB4D, STMN2, SYT12, TACl, RSP03, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZIC1.

The cell line E45 is positive for the markers: AQP1, CD24, CDH6, COL21 Al, CRIPl, DKK2, HTRA3, KRT17, KRT1 , MGP, TAGLN3, PRRX1, S100A4, SOX! 1, UGT2B7, ZIC1 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD 1, AREG, ATP8B4, BEX1, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COL15A1, COMP, COP1, CRLFI, METTL7A, DLK1, DPT, EMIDl, TMEM100, FMOI, FM03, FOXFl, FOXF2, GABRB l, GAP43, GJB2, GSC, HOXA5, HSD11B2, IISPA6, HSPB3, 1D4, 1FI27, KRT14, LAMC2, IGFL3, MFAP5, MASP 1, MEOXI, MEOX2, MMP i, MYBPH, MYH3, MYH I 1, NPASI, NPPB, OGN, OLRI, OSR2, PAX9, PDEIA, PENK, PITX2, PRG4, PROMl, PTPRN, RARRESl, RASD I, RELN, RGS 1, SERPINA3, SFRP2, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TACl, RSP03, TRH, TSLP, TUBB4, WISP2 and ZD52F10.

The cell tine E50 is positive for the markers: ACTC, BEX1, CD24, CDH6, COL2I Al, CRIPl, CRYAB, DKK2, FST, KRT17, KRTI9, LOC92196, POSTN, PTN, SIO0A4, SFRP2, SRCRB4D, ZIC1 and ZIC2 and are negative for the markers: AGC 1, AKR1CI, ALDH1A 1 , APCDD1, AQP 1 , AREG, ATP8B4, CFB, BMP4, C6, C7, CDH3, CLDN1 1, CNTNAP2, COMP, COP I , CRLFI, METTL7A, DLK 1 , DPT, EMIDl, TMEM fOO, FM03, FOXF l, FOXF2, GABRB l, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, KRT14, KRT34, LAMC2, TMEM119, IGFL3, MFAP5, MASPI, MEOX I, MEOX2, MMPI, MYH3, NLGN4X, NPAS1, NPPB, OGN, OLRI, PAX2, PAX9, PENK, PRG4, PROMl, PTGS2, PTPRN, RARRES l, RASDI, RELN, RGS1, SERPINA3, SLITRK6, SMOCl, SMOC2, STMN2, SYT12, TACl, TFPI2, RSP03, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZD52F 10.

The cell line E51 is positive for the markers: PRSS35, CCDC3, CDH6, CRIPl , CRYAB, DI02, DKK2, HTRA3, ID4, KCNMB I , KRT 17, KRT1 , KRT34, MGP, MYH11, POSTN, PRRX1, S100A4, SOX1 1 and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AREG, ATP8B4, BMP4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COP I, CRLFI, CXADR, METTL7A, DLK1, DPT, EMID l, FMOI, FM03, FOXFl, FOXF2, GABRBl, GSC, I10XA5, IISD 17B2, HSPA6, I ISPB3, IFI27, IF1T3, 1GF2, 1GFBP5, TMEM1 19, IGFL3, LOC92196, MASPI, MEOX I, MEOX2, MX1, MYBPH, MYH3, MYL4, NLGN4X, TAGLN3, NPAS I , NPPB, OGN, OLR I , PAX2, PAX9, PDEIA, PENK, PRG4, PROMl, PTPRN, RARRESl, RASDI, RELN, RGS1, SFRP2, SMOCl, SMOC2, SNAP25, STMN2, SYT12, TACl, TFPI2, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZD52F10.

The group of cell lines E68 and E68Bio2 are positive for (he markers: CD24, CRIPl, CRYAB, HTRA3, KRT17, KRT 19, TAGLN3, UGT2B7, ZIC1 and ZIC2 and are negative for the markers: AGC1, AREG, ATP8B4, C6, C7, CDH3, COPI, CRLFI, DLK1, DPT, TMEM100, FMOI, FM03, FOXF l, FOXF2, GSC, HOXA5, HSD1 1B2, HSPA6, IISPB3, 1GF2, LAMC2, IGFL3, MEOXI, MEOX2, MMPI, MYBPH, MYH3, NPAS I, OGN, PAX9, P1TX2, PRG4, PROMl, RARRES l, RGS 1, SMOC2, TAC l , RSP03, TRH, TSLP and WISP2.

The group of cell lines C4ELS5.6 and C4ELS5.6Bio2 are positive for the markers: BMP4, COP I, METTL7A, TMEMI00, FOXFl, HSD17B2, HTRA3, IGF2, IGFBP5, IL 1R1, KRT 19, MASPI, OLRI, P1TX2, PODN and TSLP and are negative for the markers: ACTC, AGC 1 , ALDH 1A 1 , AQP 1, CFB, C6, C7, C20orfl03, CDH3, CDH6, CLD 11, CNTNAP2, COL21A 1, COMP, CRLFI, DKK2, DPT, EGR2, EMID l, FM03, FOXF2, GABRB l, GAP43, GDF10, GSC, HOXA5, HSPA6, HSPB3, ID4, IFI27, INA, KRT 17, KRT34, LAMC2, TMEM 119, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MSX1, MYH3, MYHI 1, MYL4, IL32, NLGN4X, TAGLN3, NPASI, NPPB, OGN, PAX2, PAX9, PDEIA, PENK, PRG4, PRO l, PRRXi, PRRX2, PTPRN, RARRES l, RASD I, RELN, RGMA, RGS 1 , SFRP2, SMOCl, SMOC2, SNAP25, SOD3, SYT12, TACl, RSP03, THY 1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The cell line C4ELS5.8 is positive for the markers: AKR1C1, ALDH1A1 , BMP4, C3, COP 1, METTL7A, TMEM100, FOXF1, HSD17B2, HTRA3, ICA 5, IFIT3, IGF2, 1GFBP5, ILIR1, RT19, MASP1, MXl, OLRl, PODN, STMN2, TFPI2 and THY1 and are negative for the markers: ACTC, AGCl, APCDDI, BEXI, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1 , CNTNAP2, COL21A1, COMP, CR1P 1, CRLF1, DKK2, DL 1, DPT, EMID 1, FGFR3, FM03, FOXF2, GABRB l, GAP43, GDF10, GSC, HOXA5, HSDl 1B2, HSPA6, HSPB3, 1D4, 1NA, KCN Bt, KRT14, RT17, TMEM1 19, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, SX2, MYII3, MYH 1 1 , MYL4, IL32, NLGN4X, TAGLN3, NPPB, OGN, PAX2, PAX9, PDEIA, PENK, POSTN, PRRX1, PRRX2, PTPRN, RARRES 1, RASD1, RELN, RGMA, RGS1, SLITRK6, SMOC1, S OC2, SOD3, SOXl 1, SYT12, TACl, RSP03, TNFSF7, TN T2, TRII, TUBB4, UGT2B7, W1SP2, ZD52F10, ZIC1 and ZIC2.

The cell line C4ELSR 13 is positive for the markers; AKR1CI, ANXA8, AREG, BMP4, C3, COP1, METTL7A, FM03, FOXF1, HTRA3, IFI27, IFIT3, IGF2, IL1R1, KRT19, MASP1, MXl, MYBPH, OLRl, PITX2, PODN, S100A4 and TFPI2 and are negative for the markers; AGC1, APCDDI , AQP1, ATP8B4, C6, C20orfl03, CD24, CDH3, CDH6, CLDN 1 1, CNTNAP2, COL15A 1, COL21A1, COMP, CRFP l, CRLF1, CRYAB, DK 2, DL 1 , DPT, EGR2, EM1D 1, FGFR3, TMEMIOO, FMOl, FOXF2, GABRB l, GAP43, GDFIO, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, HSPB3, 1D4, fNA, KIAA0644, KRT14, RT17, IGFL3, LOC92 I96, MFAP5, MEOX1, MEOX2, MGP, MSX1, MSX2, MYH3, MYHl 1, MYL4, IL32, NLGN4X, TAGLN3, PAS 1, NPPB, OGN, OSR2, PAX2, PAX9, PDEIA, PENK, POSTN, PROM 1, PRRX1, PTPRN, RARRES 1, RASD1, RELN, RGMA, RGS 1, RPS4Y2, SERPINA3, SLITRK6, SMOC2, SNAP25, SOD3, SOXl 1, STMN2, SYT12, TACl, RSP03, THY 1, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2.

The cell line C4ELSR18 is positive for the markers: AQP1, BEXI, BMP4, C20orfl03, CDH6, FST, IIOXA5, IGF2, IGFBP5, OLRl, OSR2, PDEIA, PRRX2, S 100A4, SFRP2, SL1TRK6, TFPI2 and ZIC2 and are negative for the markers: AGC1 , ALDHIA1, ΑΝΧΛ8, APCDDI, ATP8B4, CFB, Cfi, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COL15A1 , COMP, COP1, CRLF 1, CRYAB, DLKI, DPT, EGR2, EM1D1, TMEM 100, FOXF1, GABRB l, GAP43, GDFIO, GSC, HSD 11B2, HSD17B2, HSPA6, HSPB3, ID4, 1FI27, IF1T3, KCNMB1, KRT14, KRT17, KRT34, TMEM1 19, IGFL3, LOC92196, MFAP5, MASPl, MEOX1, ΜΈΟΧ2, MSX1, MSX2, M l, MYH3, MYH 11, MYL4, IL32, NPASl, NPPB, OGN, PAX2, PAX9, PENK, PITX2, PODN, PRG4, PTPRN, RARRES I, RASDl, RELN, RGS1, SERPINA3, SMOC1, SMOC2, SOD3, SOX11, STMN2, SYT12, TAC1, THY 1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and Z1C1.

The group of cell lines EN 1 1 and W10 are positive for the markers: DLK I, FOXF I , FST, GABRBl, GDF5, HTRA3, IGF2, IGFBP5, ILIRI, POSTN, PTN, SOXl 1, SRCRB4D and TFPI2 and are negative for the markers: ACTC, AGC 1, ALDH 1A 1 , ANXA8, APCDDI, AQP1, AREG, CFB, BMP4, C3, C6, C7, CCDC3, CD24, CDHG, CLDN1 1 , CNTNAP2, COL 15A1, COMP, COP1, CRYAB, DKK2, DPT, EGR2, EMID 1, FGFR3, FMOl, FM03, FOXF2, GAP43, GDF IO, GSC, HSD11B2, HSD 17B2, HSPA6, HSPB3, ID4, IF127, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MXl , MYBPH, MYH3, MYHl 1, MYL4, IL32, NLGN4X, NPAS 1, NPPB, OLRl, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, RARRES 1 , RASDl, RELN, RGS 1, SMOC 1, SMOC2, STMN2, SYT12, TACl, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC I and ZIC2,

The group of cell lines EN 7, EN 13BioIb, EN13Bio2c and EN13Bio3c are positive for the markers: CDH6, DLKI, FOXFI, FST, HTRA3, IGF2, IL 1R1, MSX1, POSTN, SOD3, ZIC1 and ZIC2 and are negative for the markers: ACTC, ALDH 1 A 1 , ANXA8, ATP8B4, BMP4, C3, C20orfl 03, CCDC3, CD24, CDH3, CLD 11, CNTNAP2, COMP, CRYAB, DI02, DKK2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, HSPB3, 1FI27, INA, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX I , MEOX2, MGP, MMP1, MX l, ΜΎΗ3, MYHl 1, MYL4, IL32, NPAS 1, NPPB, OLRl, PAX2, PAX9, PDEIA, PENK, PITX2, PROM 1, RELN, SFRP2, SMOC2, STMN2, TACl, RSP03, ΤΉΥ 1 , TNFSF7, TNNT2, TRII, TUBB4 and ZD52F 10.

The cell line EN16 is positive for the markers: COL15A 1, DI02, DPT, FM03, FOXFI, FOXF2, FST, HSPB3, HTRA3, IGF2, IL1R1, TMEMI 19, MGP, MMP1, PODN and PRRX2 and are negative for the markers: ACTC, AGC l, AKI lCl, ALDH 1A 1 , ANXA8, AQP1„ AI¾EG, ATP8B4, BEXI, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLD 1 1, CNTNAP2, COMP, CRIPl, CRLF 1, DKK2, EMID1 , FGFR3, TMEMI 00, GABRB l, GAP43, GDF5, GDF 10, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, ID4, 1FI27, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYBPH, MYH3, MYHl 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, PAX2, PAX9, PENK, PITX2, POSTN, PTGS2, PTPRN, RARRES 1, RASD l, RGS 1, SMOC1, SMOC2, SNAP25, STMN2, TACl, RSP03, THY l, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2. The group of cell lines EN1, ENl Bio2 and EN18 are positive for the markers: DI02, DLK1, FOXF1, GDF5, HTRA3, IGF2, 1LIR1, MGP, POSTN, PRRX2 and SRCRB4D and are negative for the markers: ACTC, AGCl, ALDH 1A I , ANXA8, AQPl, CFB, C20orfl03, CCDC3, CD24, CLDN 11, CNTNAP2, CRYAB, CXADR, DKK2, GABRB1, GAP43, GDF10, GSC, HSDl 1B2, IISD 17B2, HSPA6, IF127, INA, KCNMB l, KRT14, KRT17, KRT34, IGFL3, LOC92196, MI' APS, MEOXl, ME0X2, MXl, MYH3, MYH 11, MYL4, NPASl . NPPB, PAX2, PAX9, PENK, PITX2, PROM1 , RASD1, RGS 1, SMOC 1, SMOC2, STMN2, TAC1, RSP03, ΊΉΥ1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2.

The cell line EN19 is positive for the markers: CDH6, COL15A l, COL2IAI, DLK1, FOXFI, FST, GDF5, IGF2, TMEM i 19, MSX1 , RGMA, SERPINA3, SOD3, ZIC1 and ZIC2 and are negative for the markers: ACTC, AGC 1 , ANXA8, AQP 1, ATP8B4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, CRIPl, CXADR, DI02, DKK2, EM1D 1, TMEM I 00, GABRBI, GAP43, GJB2, GSC, HOXA5, HSD 1 IB2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KCNMB l, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MGP, MXl, MYH3, MYH 11, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDEIA, PENK, PROM 1, RARRES 1, RASD1, RELN, RGS1 , SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYTI2, TAC1, RSP03, THY 1, TNFSF7, ΊΓΝΝΤ2, TRH, TUBB4, UGT2B7 and ZD52F10.

The cell line EN2 is positive for the markers: FST, GDF5, HTRA3, IGF2, IGFBP5, IL1R1, PRRX2, PTN, SFRP2, SOX 1 1, SRCRB4D, TFPI2 and RSP03 and are negative for the markers: ACTC, AGCl, AKR1C1, ALDHIAI, ANXA8, APCDD 1 , AREG, ATP8B4, CFB, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH6, CLD 11, COMP, COP 1, CRLF1, CXADR, DKK2, DPT, EGR2, EMID1, TME I 00, FMOl, FOXF2, GAP43, GDF10, GJB2, GSC, I IOXA5, HSDl 1 B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, INA, KRT14, KRTI 7, KRT19, KRT34, TMEMI 19, IGFL3, LOC92196, MFAP5, MEOXl , MEOX2, MXl, MYBPH, MYH3, MYH11, MYL4, NLGN4X, TAGLN3, NPAS 1, NPPB, OGN, OLR1, PAX2, PAX9, PDEIA, PENK, P1TX2, POSTN, PRELP, PRG4, PTGS2, RARRES 1, RASD1, RELN, RGS1, SMOC1, SMOC2, SNAP25, STMN2, SYTI2, TAC1, TIIYI, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2.

The ceil line EN25 is positive for the markers: CDH6, CNTNAP2, COL15A1, COL21 A l, DLK1, FOXFI, FST, HTRA3, 1GF2, SERPINA3, SRCRB4D, TFPI2, ZIC 1 and ZIC2 and are negative for the markers: ACTC, AGCl, AKRIC1, ALDHIAI, AQP 1, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN11, CRIPl, DI02, DKK2, EMID1, FOXF2, GSC, HOXA5, HSDl 1B2, HSD 17B2, HSPA6, IISPB3, IFI27, IFIT3, INA, KCNMBl , KRT14, KRTI7, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MGP, MMPl , MXl, MYBPH, ΜΎΗ3, MYH 1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PRRX1, PTN, RARRES1, RASD 1, RELN, SFRP2, SLITRK6, SMOC2, STMN2, TAC 1, RSP03, THY 1, TNFSF7, ΤΝΝΊΓ2, TRH, TUBB4, UGT2B7 and ZD52F10.

The cell line EN26 is positive for the markers: D102, DPT, FM03, FOXFI, FOXF2, FST, GDF5, HTRA3, IGF2, IL1R1, TMEMI 19, PODN, PRRX1, PRRX2, SFRP2, SOD3 and SRCRB4D and are negative for the markers: ACTC, AGCl, AKRIC I , ALDHIAI, ANXA8, AQP1, ATP8B4, BEX 1 , C3, C6, C7, C20orfI03, CCDC3, CD24, CLDN1 1, CNTNAP2, COL21A1, COMP, CRIP l, CXADR, DKK2, GABRB I, GAP43, GDFIO, GJB2, GSC, HOXA5, HS l 1B2, HSD 17B2, IISPA6, ID4, IF127, INA, KCNMB l , KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MM l, MXl, MYBPH, MYH3, MYH 11, MYL4, NLGN4X, NPAS 1, NPPB, PAX2, PAX9, PENK, PITX2, PROMI, PTGS2, PTPRN, RARRES 1, RASDI , RELN, RGS 1, SLITRK6, SMOC 1 , SMOC2, STMN2, TAC1, RSP03, THY 1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F 10, ZICI and ZIC2.

The celt line EN27 is positive for the markers: DI02, FM03, FOXF I, FOXF2, FST, HSPB3, HTRA3, IGF2, IL1R1, TMEMI 19, MSX2, OGN, PODN, PRELP, PRRX2, SERPINA3 and SLITRK6 and ore negative for the markers: , ACTC, AGCl, ALDHIAI, ANXA8, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, CRIPl, CRLF1, DKK2, EMID1, FGFR3, TMEMI 00, GABR I, GAP43, GDF IO, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, ICAMS, ID4, IFI27, IFIT3, IGFBP5, INA, KCNMB l, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92I 96, MFAP5, MASPl, MEOX l , MEOX2, MMPl, MXl, MYBPH, MYH3, MYHI 1, MYL4, IL32, NLGN4X, NPAS1 , NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PROMI, RARRES1 , RASDI, RELN, RGS1, SFRP2, SMOC 1, SMOC2, STMN2, TAC1, RSP03, THY 1, TNFSF7, TNNT2, TRH, TUBB , UGT2B7, ZD52F 10, ZIC1 and ZIC2. The cell line EN28 is positive for the markers: COL15A 1 , COL21A 1, DI02, FOXFI, FOXF2, FST, HSPB3, HTRA3, IGF2, IGFBP5, ILIRi, T EM1 19, PODN, PRRXl, PTN, SFRP2 and SOX 11 and are negative for the markers: ACTC, AGCI, AKR1C1, ALDH lA i, ANXA8, AQP 1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDN 1 i, CNTNAP2, COP1, CRIP l, DKK2, E ID1, TMEMIOO, GAP43, GDF10, GJB2, GSC, 1IOXA5, HSD1 1 B2, HSD 17B2, HSPA6, ID4, [FI27, INA, KCNMBl, ΚΪΑΑ0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1 , MEOX2, MOP, MMP1, MX1, MYBPH, MYII3, MYH 1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, P1TX2, POSTN, PRELP, PRG4, PROMI, PTGS2, RARRES l, RELN, RGS l, SLITRK6, SMOC1, SMOC2, STMN2, SYT12, TAC1 , RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52FI0, ZIC1 and ZIC2.

The cell line EN31 is positive for the markers: CDII6, COL21A1, DLK 1, FM03, FOXFI, FST, GDF5, HTRA3, IGF2, IL1R1, MSX1, MSX2, OGN, OSR2, PRRX2, SERPINA3, SLITRK6, SOD3, TSLP, ZIC 1 and ZIC2 and are negative for the markers: ACTC, AGCI, ALDH 1A 1 , ANXA8, AQP1, ATP8B , BEXI, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLF1, CRYAB, CXADR, DI02, DKK2, EMTD 1 , TMEMIOO, GAP43, GDF10, GJB2, GSC, HOXA5, HSD I 1B2, HSD17B2, IISPA6, HSPB3, ICAM5, 1D4, IFI27, ΓΝΑ, RT14, RT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX 1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS 1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PROMI, PTGS2, RARRES l, RASD l, RELN, SFRP2, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10.

The cell line EN38 is positive for the markers: BEXI, CDH6, COL21A 1, DLK1, FOXF ! , FST, GDF5, HTRA3, IGF2, ILIRI, TMEM1 19, MGP, MSXI, OGN, PODN, POSTN, PRRXl, PRRX2, RGMA, SERPINA3, SOD3 and TSLP and are negative for the markers: ACTC, AGC I, AKR1C1, ALDH 1A1, ANXA8, AQP 1, AREG, ATP8B4, BMP4, C3, C6, C7, C20orfI03, CCDC3, CD24, CDH3, CLDN1 i, CNTNAP2, CRIP l, DI02, DKK2, DPT, GAB RB I, GAP43, GDF10, GJB2, GSC, H0XA5, HSD11B2, HSD 17B2, HSPA6, HSPB3, ID4, IFI27, ΓΝΑ, KCNMBl, KRT14, KRT17, KRT34, 1GFL3, LOC92196, MFAP5, MEOX1, MEOX2, MXl, MYBPH, MYH3, MYH l l, MYL4, IL32, NLGN4X, NPPB, OL 1, PAX2, PAX9, PDE1A, PENK, P1TX2, PRELP, PRG4, PROM I, RASDl, RELN, RGS l, SFRP2, SLITRK6, SMOC 1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, THY 1, TNFSF7, TNNT2, TRH, TUBB4, ZD52F10, ZIC1 and ZIC2.

The cell line EN4 is positive for the markers: COL21A 1, DLK 1, FMO l, FM03, FOXFI , FOXF2, FST, GDF5, HTRA3, 1GF2, IGFBP5, IL1R1, TMEM1 19, MGP, MSXI, OGN, PODN, PRRXl, PRRX2, PTN, RGMA, SOD3 and TSLP and are negative for the markers: ACTC, AGCI, AKR1C1, ALDH 1A 1, ANXA8, AQP1, AREG, CFB, BMP4, C3, C6, C7, C20orfl 03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, CRIPl, D102, DKK2, DPT, EM1DI, FGFR3, TMEMIOO, GAB RB I, GAP43, GDF10, GJB2, GSC, HOXA5, HSD 11B2, HSD 17B2, HSPA6, HSPB3, 1 4, IFI27, INA, KCNMBl, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASP1, MEOXI, MEOX2, MX 1, MYBPH, MYH3, MYHl l, MYL4, IL32, NLGN4X, NPASl . NPPB, OLR1, PAX2, PAX9, PENK, PROMI, PTGS2, RARRES l, RASDl, RGS l, SFRP2, SMOC1, SMOC2, SNAP25, STMN2, TACI, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10.

The ceii line EN42 is positive for the markers: COL 15A1, COL21A1, FM03, FOXFI, FST, GDF5, HTRA3, IGF2, ILIRI, TMEM1 19, MGP, OGN, PODN, PRRXl, PRRX2, PTN, RGMA, SERPINA3, SNAP25 and SOD3 and are negative for the markers: ACTC, AGCi, AKR1C1, ALDH1A1, ANXA8, AQP1, ATP8B4, BMP4, C3, C6, C7, C20orn03, CCDC3, CD24, CDH3, CLD 1 1, CNTNAP2, COMP, CXADR, DI02, DKK2, DPT, EMID 1 , FGFR3, TMEM IOO, GAP43, GDF10, GSC, HOXA5, HSDI 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB l, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASP1, MEOXI, MEOX2, MMPI, MXi, MYBPH, MYII3, MYHI 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX9, PENK, PITX2, PRG4, PROMI, RARRESl, RASD l, RELN, RGS l, SMOC1, SMOC2, STMN2, RSP03, THY], TNFSF7, TNNT2, TRH, TUBB4, UGT2B 7, ZD52F 10, ZICI and ZIC2.

The cell line EN47 is positive for the markers: CDH6, COP1, DLK 1, FM03, FOXFI , FST, HTRA3, IGF2, ILIRI, MSXI, POSTN, PTPRN, RGS l, SOD3, TFPI2, TSLP, ZICI and ZIC2 and are negative for the markers: AGCI , ALDH1A 1, APCDD1, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, DI02, DKK2, FOXF2, GSC, HOXA5, HSDI 1B2, HSD 17B2, HSPA6, HSPB3, IFI27, INA, KCNMBl, KRT14, KRT17, KRT34, LAMC2, TMEM 1 19, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MXI, MYH3, MYHI 1, MYL4, IL32, NLGN4X, NPAS 1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, RARRES l, SFRP2, SMOC2, STMN2, TAC I, RSP03, TIIY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10. The cell line EN5 is positive for the markers: COL21 A l, DLKl, FM03, FOXF1, FOXF2, FST, HTRA3, 1GF2, ILIRI , KIAA0644, TMEM1 19, MGP, MSX1, MSX2, OGN, PRRX1 and PRRX2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, DMP4, C3, C6, C7, Ο20ΟΓΠ03, CCDC3, CD24, CDH3, CLDNl 1, CNTNAP2, COMP, CRfP l, CRLFl, CRYAB, CXADR, DKK2, GABRB 1, GAP43, GDF 10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ID4, IF127, 1NA, KCNMBl, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MMP1, MX1 , MYH3, MYHI 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, PAX2, PAX9, PENK, PITX2, PRELP, PRG4, PRO I, RASD1, RELN, RGS 1, SMOC 1, SMOC2, STMN2, SYT12, TAC1, TFP12, RSP03, THY 1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZIC1.

The cell line EN50 is positive for the markers: BEX1, CDH6, COL21A1, DI02, FMO l, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, IGFBP5, IL1R1, RTI9, TME 1 I9, MASP1, MGP, MSX1 , PODN, PRRX2, PTPRN, SERPINA3, SOD3, WISP2, Z1C 1 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDII1A1, APCDDI, AQP1, BMP4, C3, C6, C20orfi03, CDH3, CLDNl 1 , CNTNAP2, COMP, DKK2, DPT, EGR2, EMIDl, TMEMIOO, GABRB 1, GAP43, GDF 10, GSC, HOXA5, HSD 11B2, HSPA6, HSPB3, IFI27, KIAA0644, RT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX 1 , MEOX2, MX 1, MYBPH, MYH3, MYH I 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROMI, PRRX 1, RARRES1, RASD 1, RGS1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F10.

The ceil line EN51 is positive for the markers: CDH6, DLKl, FMOl, FM03, FOXFI, FST, HTRA3, IGF2, IL 1 R1, MSX1, MSX2, OGN, SERP1NA3, SOD3, TSLP, ZIC1 and Z1C2 and are negative for the markers: ACTC, AGC1, AKRIC1, ALDH 1A1, ANXA8, APCDDI, AQP1, ATP8B4, CFB, C3, C6, C20orfl03, CCDC3, CD24, CD113, CLDNl 1, CRIPl, CRYAB, CXADR, DI02, DKK2, DPT, EMID l, TMEMIOO, FOXF2, GABRB l, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, IISPB3, FD4, IFI27, INA, KCNMB 1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, L0C92196, MFAP5, MEOXl, MEOX2, MGP, MMP1, MX1, MYH3, MYH1 1, MYL4, 1L32, NLGN4X, NPAS i, NPPB, OL 1 , PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROMI, PTGS2, RARRES 1, RASD 1, RELN, RGS 1, SFRP2, SMOC2, STMN2, TAC 1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F 10.

The ceil line EN53 is positive for the markers: BEX1, COL21A 1, FST, GDF5, HTRA3, ICAM5, KRT19, TMEM1 19, PTPRN, SERP1NA3, SOD3 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH 1A 1 , APCDDI, AQP1, ATP8B4, BMP4, C3, C6, C7, C20orfl03, CCDC3, CDI13, CLDN l I, CNTNAP2; COP 1 , CRYAB, DI02, DKK2, DPT, EMIDl, FGFR3, TMEMiOO, FM03, FOXF2, GABRB l, GAP43, GJB2, GSC, H0XA5, HSPA6, HSPB3, ID4, IFI27, ΓΝΑ, KCNMBl, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYHI 1, MYL4, IL32, NLGN4X, NPPB, OGN, OLR I, OSR2, PAX2, PAX9, PDE1 A, PENK, P1TX2, POSTN, PRELP, PROMI, PTN, RASD1, RELN, RGS 1, SLITRK6, SMOC2, STMN2, SYT12, TAC1, RSP03, TIIYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZICL

The cell line EN55 is positive for the markers: DI02, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, IL 1R1, KIAA0644, MGP, MSX2, PODN, PRRX2, PTN, SLITRK6 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR 1C 1 , ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN H, CNTNAP2, CRIPl, CRYAB, DKK2, FGFR3, FMO l, GABRB l, GAP43, GDF10, GSC, HOXA5, HSD 11B2, HSD I 7B2, HSPA6, IISPB3, ICAM5, TD4, IF127, INA, KCNMB l, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92 I 96, MFAP5, MEOXl, MEOX2, MX1, MYBPH, MYH3, MYH I 1, MYL4, 1L32, NLGN4X, NPAS I, NPPB, OLRI, PAX2, PAX9, PENK, PITX2, POSTN, PROMI, PRRX1, PTGS2, RARRES 1, RASD 1, RELN, RGS 1 , SFRP2, SMOC1, SMOC2, SOD3, STMN2, SYT12, TAC1, RSP03, THY 1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZIC1 and ZIC2.

The group of cell lines H9.Biol and H9.Bio2 are positive for the markers: ACTC, BEX1, CD24, CDH3,

CNTNAP2, CXADR, METTL7A, FGFR3, FST, GAP43, INA, KRT19, NLGN4X, PROMI, PTN, PTPRN, RGMA, SFRP2, SO 11, SRCRB4D, ZD52F 10 and ZIC2 and are negative for the markers: AGC 1, ALDH 1A 1, ANXA8, APCDDI, AQP1, AREG, ATP8B4, CFB, C6, C7, PRSS35, C20orn03, CDH6, CLDN l 1, COL15A 1, COL21A1, COP1, DI02, DKK2, DPT, EGR2, TMEMIOO, FMO l, FM03, FOXF 1, FOXF2, GABRB l, GDF10, GJB2, HSD 17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, IL1R1, KRTI4, KRT17, KRT34, ΤΜΕΜΠ9, IGFL3, LOC92196, MEOX l , MEOX2, MGP, MMP 1, MSXI, MSX2, MX1, MYBPH, MYI13, MYHI 1, OGN, OLRI, OSR2, PAX2, PAX9, PDE1A, PENK, POSTN, PRELP, PRG4, PRR 1, PTGS2, RARRES1, RELN, RGS1 , SERPINA3, SLITRK6, SMOC1, SNAP25, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell tine J13 is positive for the markers; CDH6, CLDN11, FST, GDF5, IGF2, MMPI, PRRX1, PRRX2, RGMA, SLITRK6, TFPI2 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDII1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, C3, C6, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CNTNAP2, COL15A1, COMP, COP1, CRLFI, CRYAB, DI02, METTL7A, DK 2, DL 1, DPT, EGR2, EMID1, FGFR3, TMEM100, FMOl, FOXF1, GABRBl, GAP43, GDF10, GSC, HOXA5, HSDi 1B2, HSD17B2, HSPA6, HSPB3, 1D4, 1FI27, IGFBP5, KCNMBI, IAA0644, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEO l, ΜΕΟΧ2, MGP, MYBPH, MYH3, MYHl 1, MYL4, TL32, NPAS1, NPPB, OGN, OLRI, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PRG4, PR0M1, PTGS2, PTPRN, RARRESI, RASDl, RELN, RGSI, RPS4Y2, SFRP2, SMOCl, SMOC2, SRCRB4D, STM 2, TAC1, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10 and ZlCi.

The ceil line J16Bio2 is positive for the markers: BEX1, BMP4, CCDC3, CDH6, CLDN11, C0L21AI, CRYAB, FM03, FST, ICAM5, IGF2, RT17, TMEM119, POSTN, SERPINA3, SFRP2, SYT12, TFPI2, UGT2B7 and ZIC2 and are negative for the markers: AGCi, ALDH1AI, APCDD1, AQP1, AREG, ATP8B4, C3, C6,

C20orfl03, CD24, CDH3, CNT AP2, COMP, CRLFI, METTL7A, DLK1, DPT, EMID1, FGFR3, TMEM100, FMOl, FOXF1, FOXF2, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSDI 1B2, HSPA6, HSPB3, HTRA3, ID4, 1F127, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MEOXl, MEOX2, MSX1, MYBPH, MYH3, NLGN4X, NPPB, OGN, ΡΛΧ2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROM1, PTPRN, RARRESI, RASDl, RELN, RGSI, SMOCl, SMOC2, STMN2, TAC1, THYl, TNFSF7, TRH, TUBB4, WISP2 and ZD52F10.

The cell line J8 is positive for the markers: BEX1, BMP4, CLDN11, CRYAB, 1GF2, 1NA, KRT1 , MXI, IL32, TAGLN3, SFRP2, TSLP and UGT2B7 and is negative for the markers: AGCI, ALDH1A1, ANXA8, APCDD1, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CDII3, CNTNAP2, COL15A1, COL21A1, COMP, COP1, CRLFI, DI02, METTL7A, DKK2, DL 1, DPT, EGR2, EMID1, FGFR3, TME 100, FMOl, FM03, FOXF1, F0XF2, GABRBl, GAP43, GSC, HOXA5, HSDI 1B2, HSPA6, HSPB3, 1D4, IFI27, IGFBP5, KCNMBI, 1AA0644, KRT14, KRT34, IGFL3, L0C92I96, MFAP5, MASPI, MEOXl, MEOX2, MGP, MMPl, MSX1, ΜΎΗ3, MYH 11, MYL4, NPAS1, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PRRX1, PTGS2, PTN, PTPRN, RARRESI, RGMA, RGSI, SLITRK6, SMOCl, SMOC2, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2 and ZD52F10.

The cell line MW1 is positive for the markers: APCDD1, BEX1, BMP4, C3, CD24, CDII3, CRLFI, CRYAB, D102, METTL7A, TMEMI00, FOXF1, FST, GJB2, IGF2, IGFBP5, IL1R1, KIAA0644, KRT19, TMEM119, OLRI, PODN, PROM1, SERPINA3, SNAP25, SRCRB4D, STMN2, TFP12 and THYl and are negative for the markers: ACTC, AGCI, AKR1CI, ALDH1A1, AQP1, AREG, ATP8B4, C6, C7, PRSS35, C20oifl03, CCDC3, CDH6, CLDN11, CNTOAP2, COL15A1, COL2IAI, COMP, COPi, CXADR, DKK2, DLK1, DPT, EGR2, EM1D1, FGFR3, FMOl, FM03, FOXF2, GABRBl, GAP43, GDF5, GDF10, GSC, HOXAS, HSDI 1B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, 1D4, IFI27, INA, KCNMBI, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXl, MEOX2, MGP, MMPl, MSX2, MYBPH, ΜΎΉ3, MYHl 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PRG4, PRRX1, PRRX2, PTGS2, PTPRN, RARRESI, RELN, RGSI, SFRP2, SLITRK6, SMOCl, SMOC2, SOD3, SYT12,TAC1, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2.

The cell line MW2 is positive for the markers: C6, C7, CRLFI, DI02, METTL7A, FMOl, FM03, FOXF1, FOXF2, HTRA3, 1GF2, IL1RI, TMEM119, MGP, OGN, PRRX2, RGMA, SFRP2, SYTI2 and TFPI2 and are negative for the markers: ACTC, AGCI, AKR1CI, ALDHIA1, ANXA8, AQP1, AREG, CFB, C3, C20orfl03, CCDC3, CD24, CDH3, CNTNAP2, COMP, COPI, CRYAB, CXADR, DKK2, DLK1, EMTD1, FGFR3,

GABRBl, GAP43, GDF5, GDF10, GSC, HOXAS, HSD17B2, HSPA6, HSPB3, 1CAM5, ID4, 27, INA, KCNMBI, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MMPl, MSX1, MXI, MYBPH, MYH3, MYHl 1, MYL4, IL32, NPAS1, NPPB, OLRI, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PROM1, PRRX1, PTPRN, RASDl, RELN, RGSI, SMOCl, SMOC2, STMN2, THYl, TNFSF7, TNNT2, TRJ1, TUBB4, UGT2B7, ZD52FJ0, ZIC1 and ZIC2.

The ceil line M\V6 is positive for the markers: BEX1, C6, C7, D102, DPT, FOXF1, FST, HTRA3, IGF2, IL1R1, TMEM119, PITX2, POSTN, PRRX2, SERP1NA3, SFRP2, SRCRB4D and SYT12 and are negative for the markers: AGCI, ALDH1A1, ANXA8, AQPi, ATP8B4, CFB, BMP4, C20orfl03, CCDC3, CDH3, CNTNAP2, COPI, CXADR, DKK2, DLK1, EMfDI, FGFR3, TMEM100, GABRBl, GDF10, GSC, 11SD11B2, HSD17B2, HSPA6, HSPB3, ID4, 1FI27, IFIT3, INA, KCNMBI, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MMPI, MSXI, MXI, YH3, MYHl t, MYL4, IL32, NLGN4X, NPPB, OLRI, PAX2, PAX9, PENK, PRELP, PROM1, PRRX1, RARRESI, RASDl, RELN, RGSI, SLITRK6, SMOCl, SMOC2, SNAP25, TAC1, TFPI2, THYl, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZIC1 and ZIC2. The cell line Q4 is positive for the markers: AREG, BEX l, CRYAB, FMO l, FST, HTRA3, ICAM5, IGF2 _; IL1R1, K T19, T EM1 19, PTPRN, SERPINA3, SOD3, SRCRB4D, ZD52F10 and ZIC2 and are negative for the markers: ACTC, AGC I, ALDHlA l, ANXA8, APCDD1, ATP8B4, CFB, BMP4, C20orfl03, CCDC3, CDH3, CDH6, CLDN1 1, CNTNAP2, COL15A1, COMP, COP1, DI02, DKK2, DPT, EGR2, E ID1, FM03, GAP43, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, 1D4, IFIT3, INA, KCNMBl, KIAA0644, KRT17, RT3 , IGFL3, LOC92196, MEOXI, MEOX2, MGP, MMPl, MSX2, M i , MYBPH, MYH3, MYH 1 1, NLGN4X, NPPB, OGN, OLR 1, OSR2, PAX2, PAX9, PENK, PROM1, PRRX2, PTGS2, RARRES 1 , RELN, RGMA, RGSI, SL1TR 6, SMOC 1, SMOC2, STMN2, SYT12, TAC1, RSP03, THY l, TNFSF7, TNNT2, T H, TSLP, TUBB4 and UGT2B7.

The cell line Q6 is positive for the markers: AREG, BEXl, COL21A1, DL 1, FMOl, FST, GDF10, ICAM5, IL1R1, TMEM1 19, MYL4, OGN, POSTN, SERPINA3, SFRP2, SOD3, SRCRB4D, ZIC1 and ZIC2 and are negative for the markers: AGCI, ALDHlAl, ANXA8, AQP 1, ATP8B4, CFB, C3, C6, C20orfl03, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COMP, COPI, CXADR, DI02, D 2, DPT, EMiD l, FGFR3, FM03, FOXF1, FOXF2, GABRB 1, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, IFJ27, INA, KCNMB l, K1AA0644, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXI, MEOX2, MMPl, MX1, MYBPH, MYH3, MYH1 1, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PTN, PTPRN, RARRES1, RASD1, RELN, RGS I , SMOC i, SMOC2, SYT12, TAC 1, TFPI2, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4 and WISP2.

The cell line Q7 is positive for the markers: AREG, BEXl, COL15A1, COL21AI, COMP, EGR2, FST, GDF10, IISD 17B2, IGF2, SERPINA3, ZIC1 and ZIC2 and is negative for the markers: ACTC, AGCI, AKRiCl, ALDH lA l, AQP1, ATP8B4, CFB, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, D102, DKK2, DLK1, EMTD 1 , FGFR3, TMEM100, FMOl, FM03, GABRB 1, GDF5, GJB2, GSC, HOXA5, HSD 11B2, HSPA6, HSPB3, ID4, IFI27, KCNMBl, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOXI, MEOX2, MGP, MMPl, MSX2, MX1, MYBPH, MY1I3, MYH 11, IL32, NLGN4X, NPAS 1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, P1TX2, PODN, POSTN, PRELP, PROM1, PRRX2, PTGS2, PTN, RARRES 1, RASD1, RELN, RGMA, RGS I, SLITRK6, SMOC2, SNAP25, STMN2, TAC1, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and W1SP2.

The cell line RAD20.16 is positive for the markers: ACTC, CD24, CRIPl, CRYAB, FST, HOXA5, HTRA3, KRT19, LAMC2, MFAP5, MASPl, MGP, MMPl, MSXl, POSTN, SI00A4, SRCRB4D and THYl and is negative for the markers: AGCI, ALDHlAl, AQPI, AREG, ATP8B4, CFB, C6, C7, C20orfl03, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1 , COL21A1, CRLF1, DLK1, DPT, TMEM100, FMOl , FM03, FOXF2 ₃ GABRB l, GDF 10, GJB2, GSC, HSD1 1B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, KCNMB l, KRT14, TMEM119, IGFL3, LOC92196, MEOXI, MEOX2, MSX2, MX 1, MYH3, MYH 1 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PRRX1, RARRES 1 , RASD I, RGS I, SFRP2, SMOCI , SMOC2, SOD3, STMN2, TAC1, TFPI2, RSP03, TRH, TSLP, TUBB4, UGT2B7, W1SP2, Z1C1 and ZIC2.

The cell line RAD20.19 is positive for the markers; ACTC, BEXl, CD24, CRIP l, CRYAB, FST, H0XA5, INA, KRT19, KRT34, LAMC2, MFAPS, MASPl, MMP l, MSXl, NPPB, PTPRN and THYl and is negative for the markers: AGC I, ALDH lA l, APCDD 1, AQPI, AREG, ATP8B4, CFB, C6, C7, C20orfl03, CDH3, CNTNAP2, COL 15A 1, C0L21A1, COP I, CRLFI, D102, METTL7A, DKK2, DLK1, DPT, EGR2, EMID 1, TMEMI00, FMO l , FM03, FOXF2, GABRB l, GDF10, GJB2, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, NLGN4X, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PROM 1 , PRRX 1, PTN, RARRES 1, RASD1, RGMA, RGS I, SFRP2, SL1TRK6, SMOCI, SMOC2, SNAP25, STMN2, SY 12, TAC 1, RSP03, TNFSF7, TRH, TSLP, TUBB4, WISP2, Z1C 1 and ZIC2.

The cell line RAD20.5 is positive for the markers: AKRiCl, CRIPl, METTL7A, FOXF1, HOXA5, HTRA3, KIAA0644, KRT19, MASPl, MMPl , MSXl, POSTN, PTPRN, S100A4, SRCRB4D and THYl and is negative for the markers: AGCI, ALDHlAl, ANXA8, APCDD1 , AQPI , AREG, ATP8B4, BEXl, CFB, C6, C7, PRSS35, C20orfl03, CCDC3, CDH3, CLDNI 1, CNTNAP2, COL15A1, COL21A1, COMP, CRLF I, CNTNAP2, DKK2, DLK1, DPT, EGR2, EMID 1, TMEM100, FMO l, FM03, FOXF2, GAP43, GDF 10, GSC, HSD1 1B2, HSDI7B2, HSPA6, HSPB3, ID4, IGF2, KCNMB l, KRT14, KRT3 , IGFL3, LOC92196, MEO I, MEOX2, MGP, MSX2, MYBPH, MYH3, MYH l 1, MYL4, IL32, NLGN4X, NPAS 1, NPPB, OGN, PAX2, PAX9, PDEIA, PENK, PRELP, PRG4, PROM1, RARRES1, RGMA, RGSI, SFRP2, SLITRK6, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC 1, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2. The cell line RAPEND17 is positive for the markers: ANXA8, BEX1, C3, CD24, CRIP l, CRYAB, METTL7A, FST, HOXA5, HTRA3, ICAM5, IFIT3, IGF2, IL1R I , RT19, LAMC2, MFAP5, ASP1, OLRI, POSTN, PTN, PTPRN and TFPI2 and is negative for the markers: ACTC, AGC1, APCDD1, AQP1, ATP8B4, CFB, C6, C7, PRSS35, C20orfl03, CCDC3, CDII3, CDH6, CLDN 1 1, CNTNAP2, COL15A 1, COL21A 1, DKK2, DLK1, DPT, EGR2, EMID l, TME l 00, FMO I, FM03, FOXF2, GABRB 1, GAP43, GDF 10, GSC, HSD1 IB2, HSD 17B2, HSPA6, HSPB3, ID4, KCNMB1, RTI 4, RT17, 1GFL3, LOC92196, MEOXl, MEOX2, MGP, MSX2, MYH3, ΜΥΗ Π, NLGN4X, OGN, OSR2, PAX2, PAX9, PDE1A, PEN , PRELP, PROM1, PRRX1, PRRX2, RARRESl, RELN, RGMA, RGS 1, SFRP2, SLITRK6, SMOC1, SMOC2, SOD3, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, Z1C1 and Z1C2.

The cell line RASKEL18 is positive for the markers: A REG, CD24, CRYAB, METTL7A, DPT, FST, GJB2, HTRA3, IGF2, IGFBP5, IL1R1, PTN, PTPRN, SERPINA3, SOX11, SRCRB4D and RSP03 and is negative for the markers: ACTC, A R1C 1, ALDH 1A 1, ANXA8, AQP1, CFB, C7, PRSS35, C20oifl03, CDH6, CLDN1 1, CNTNAP2, COMP, COP 1, DI02, D 2, DLK1, EGR2, EMID l, FGFR3, FMO I, FM03, GAP43, GDF10, GSC, HSD1 1B2, IISD 17B2, HSPA6, HSPB3, FFI27, 1NA, KCNMB 1, KRT14, KRT17, RT34, TMEM1 19, IGFL3, LOC92196, MFAP5, MASP 1, MEOXl, MEOX2, MMP I, MSX2, MYBPH, MYH3, MYHI 1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PRELP, PRG4, PROM 1, PRRX1, PRRX2, PTGS2, RARRES 1, RASD l, RELN, RGMA, RGS1, SLITRK6, SMOC1 , SMOC2, STMN2, SYT12, TAC 1 , TFPI2, THYi, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZIC1 and ZIC2.

The cell line RASKEL6 is positive for the markers: A REG, BEX 1, C3, CRLF1, CRYAB, METTL7A, FST, HTRA3, IGF2, IL1R1, TMEMl 1 , P1TX2, SERPINA3 and TFPI2 and is negative for the markers: ACTC, A R1C1, ALDH 1A1, ANXA8, AQP 1, CFB, BMP4, C6, CCDC3, CDH3, CDH6, CLDN11, CNTNAP2, COL 15 A 1 , COMP, COP 1 , CXADR, DKK2, DLK I , EGR2, EMTD I , FMO t , FM03, FOXF2, GAP43 , GDF 10, GSC, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGFBP5, IN A, KIAA0644, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASP1, MEOXl, MEOX2, MMPI, MSX2, MYBPH, MYH3, MYHI 1, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PROM1, PRRX1, PRRX2, RARRES 1, RELN, RGMA, RGS 1, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TAC 1, RSP03, THY i , TNFSF7, TRH, TUBB4, UGT2B7, WISP2, ZFC1 and ZIC2.

The cell line RASKEL8 is positive for the markers: AREG, BEX1, C7, CRIPl, CRLF 1, CRYAB, FST, HOXA5, HTRA3, ICAM5, IGF2, ILlRi, KRT19, LAMC2, PITX2, POSTN, PTPRN, SERP1NA3 and TFPI2 and is negative for the markers: ACTC, AGC I, ALDH 1A 1 , AQP 1, ATP8B4, CFB, C6, PRSS35, C20orfl03, CCDC3, CDII3, CDH6, CLDN11, CNTNAP2, COMP, COP1, DKK2, DLK1, DPT, EMIDl, FMOI, FM03, FOXF2, GABRB 1, GAP43, GDF 10, GSC, HSD 1 1B2, HSD17B2, HSPA6, IISPB3, LFI27, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOXl, MEOX2, MGP, MMPI , MSX2, MXl, MYH3, MYH I 1, NLGN4X, TAGLN3, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROM1, PRRX1, PRRX2, PTN, RARRES 1, RELN, RGMA, RGSI, SFRP2, SL1TRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZIC1 and ZIC2.

The ceil line SK I is positive for the markers; AKR1CI, BEX1, C6, C7, COL21A1, CRTP1, METTL7A, DLK 1, TMEMI00, FMOI, FM03, FOXF2, FST, IISD l 1B2, HTRA3, ICAM5, K3F2, IL1R1, TME l 19, MGP, MSX 1, PRG4, PTN, PTPRN, S 100A4, SERPINA3, SFRP2, SOD3, SOXl 1, WISP2 and ZICI and is negative for the markers: AGCI, ALDH 1A1, ANXA8, AQP 1, ATP8B4, BMP4, C20orfl03, CD24, CDH3, CDH6, CLDN 1 1, CNTNAP2, COMP, COP 1, CRLFI, DKK2, EGR2, EMID l, FGFR3, GABRB 1 , GAP43, GDF 10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, ID4, IFI27, 1FIT3, INA, KCNMB 1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASP1, MEOXl, MEOX2, MMPI, MSX2, MXl , MYBPH, MYH l i, IL32, NLGN4X, NP AS I , NPPB, OLRI, PAX2, PAX9, PENK, P1TX2, POSTN, PRELP, PRO 1, RARRES 1 , RGS I, SMOC2, SYT12, TFPI2, RSP03, THY I, TNNT2, TRH, TSLP, TUBB4 and ZIC2.

The group of cell lines SKlOBiol and SK 10Bio2 are positive for the markers: BEX1, COL21A1, FST, ICAM5, IL1R1, TMEMl 19, SERPINA3 and ZIC2 and are negative for the markers: ACTC, AGCI, ALDH 1 A 1, AQP1, CFB, BMP4, C3, C6, C20orfI03, CDH3, CLDN1 1, CNTNAP2, DKK2, DPT, EMID l, TMEMl 00, FM03, GAB RB I, GAP43, GSC, HOXA5, HSPA6, 1D4, IFI27, KIAA0644, KRT14, KRT34, IGFL3, LOC92I96, MFAP5, MEOXl, MEOX2, MXl, MYBPH, MYH3, MYII11, NLGN4X, NPPB, OLRI, PAX2, PAX9, PDE1A, PENK, PROM 1, RARRES1, RASDl, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TAC1, RSP03, THY 1, TNNT2 and TUBB4. The group of ceil lines SKI 1, SK44, SK50 and S 52 are positive for the markers: BEX 1, COL2IA 1, FST, ICAM5, IL1R1, ΤΜΈΜ1 19, PTPRN, SERP1NA3, SFRP2 and ZICI and are negative for the markers: ACTC, AGC1, ALDH 1A 1, AQP 1, ATP8B4, C6, C20orfl03, CCDC3, CDH3, CLDN11, CNTNAP2, D102, DKK2, EMID 1, GABRB1, GSC, HOXA5, HSPA6, IF127, ΓΝΑ, KRT14, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MMP1, MX1, MYH3, MYHl 1 , 1L32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PROM1, PTN, RARRES 1, RASD l , RELN, RGSI, SMOCI, SMOC2, STMN2, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH and TUBB4.

The group of cell iines SK14, SK53, SK60 and SK61 are positive for the markers: C7, COL21 Al, CRYAB, HTRA3, IL 1 R1, MGP, PTPRN, RGMA, SERPINA3 and SFRP2 and are negative for the markers: ACTC, AGC 1, ALDHi A l, ANXA8, AQP1, ATP8B4, CFB, BMP4, CCDC3, CDH3, CNTNAP2, COP1, CXADR, DK 2, GAB RB I, GAP43, GDF10, GJB2, GSC, HOXA5, HSDI7B2, IFI27, IFIT3, KRTH, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH 11, IL32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PENK, PROM1 , RASD l, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, TAC1, RSP03, TNNT2, TRH, TUBB4, UGT2B7, ZICI and ZIC2.

The cell line SKI7 is positive for the markers: ACTC, APCDD1, BEX l, COL21A 1, METTL7A, DLK1 , FST, HOXA5, HSPB3, HTRA3, 1GF2, IL1RI, KIAA0644, MASP 1, MGP, MYBPH, MYH3, NLGN4X, PDE1A, PTN, RGMA, SRCRB4D, STMN2, RSP03 and TNNT2 and is negative for the markers: AGC1, AKR1C1, ALDI11A1, ANXA8, AQP 1 , CFB, C6, C20orfl03, CCDC3, CDH3, CDH6, CLDN11, CNTNAP2, COL15A 1, COMP, COP1, CRLF I , DKK2, DPT, TMEM 100, FMOl, FM03, FOXF2, GAB RBI, GDF 10, GSC, I1SD17B2, IISPA6, 1D4, 1FI27, INA, KCNMB 1, KRT14, KRT34, LAMC2, TMEM1 19, IGFL3, LOC921 6, MFAP5, MEOXI , MEOX2, MMPI, MX1, MYH l 1, IL32, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PRELP, RASDl, RELN, RGSI, S 100A4, SLITRK6, SMOC i, SMOC2, TAC 1, THYl, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, W1SP2, ZIC I and ZIC2.

The cell line SK18 is positive for the markers: APCDD I , COL21A 1, METTL7A, FMOl, FOXF 1, FST, HTRA3, IGF2, IL 1 R1, TMEM119, OGN, PITX2, PRRX1, RGMA, SERPINA3, SFRP2, SOD3 and TSLP and is negative for the markers: ACTC, AGCl, AKR1C1, ALDH1AI, ANXA8, AQP 1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CNTNAP2, COP 1, CXADR, DI02, DKK2, DLK1, DPT, EMID1, ΤΜΈΜ 100, GABRB 1, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, ΚΙΛΑ0644, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX I, MEOX2, MMP1, MSX1, MX1, MYBPH, MYH3, MYH 1 1 , MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROM 1, RARRES I, RASDl , RELN, RGSI, SLITRK6, SMOC I, SMOC2, STMN2, TAC1, TFPI2, RSP03, THYl, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZICI and ZIC2.

The cell line SK26 is positive for the markers: APCDDI, BEXl, COL21A1, CRYAB, FMOl, FOXF2, FST, HTRA3, ICAM5, ILIR1, TMEM 1 19, PRRX 1, PTPRN, SERPINA3 and SFRP2 and is negative for the markers: ACTC, AGCI, ALDHI Al, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfi03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COP1, CXADR, DKK2, DLK1, DPT, EGR2, EMID 1, FGFR3, GABRB 1, GAP43, GDF 10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, IFI27, IF1T3, KIAA0644, KRTH, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEO I, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH l 1, MYL4, IL32, NLGN4X, NPPB, OLR1 , OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PROM1, PTN, RARRESI, RASD l, RELN, RGS I , SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, AC1, FP12, RSP03, THY l, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZIC 1.

The group of cell lines SK27 and T7 are positive for the markers: BEXl, PRSS35, CCDC3, CDH6, COL21 Ai, CRIPl, CRYAB, GAP43, IGF2, KRT19, LAMC2, POSTN, S100A4, SFRP2, SOX11 and ZIC2 and are negative for the markers: AGCl, ALDH IA 1, APCDDI, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1 1, CNTNAP2, COP1, CXADR, DLK1, DPT, EGR2, EMID1, GDF 10, GJB2, GSC, HOXA5, HSD1 1B2, HSD 17B2, HSPA6, HSPB3, IF127, INA, KRT14, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMPI, MYBPH, MYH3, MYL4, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PRO I, RARRESI, RASD l, RELN, RGSI, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TACl, TFP12, RSP03, TNNT2, TRH, TUBB4 and ZIC I .

The group of cell Iines SK28 and SK57 are positive for the markers: BEXl, COL21AI, CRYAB, HTRA3, 1CAM5, IGF2, ILIR !, PTPRN and SERPINA3 and are negative for the markers: AGCl, ALDH 1A 1, AQP1, ATP8B4, CFB, BMP4, C20orfI03, CCDC3, CDH3, CDII6, CLDN11, CNTNAP2, COP1, CXADR, DI02, DKK2, EMID1, GABRB 1, GAP43, GDFIO, GSC, HOXA5, HSD 17B2, HSPA6, HSPB3, ID4, IFI27, KCNMB I , KIAA0644, KRT14, KRTI7, KRT34, IGFL3, LOC92 I 96, MFAP5, MEOX I , MEOX2, MMP I, MSX2, MX 1, ΜΎΗ3, MYHl 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PROM I, PTN, RARRESI , RASDl, RELN, RGS I, SLITRK6, SMOCI, SMOC2, STMN2, TACl, ΊΤΡΙ2, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. The group of celi lines S 30 and W4 are positive for the markers:DEXl, FST, HTRA3, 1GF2, TMEMI 19, POSTN, SOX1 i, SRCRB4D, ZIC1 and ZIC2 and are negative for the markers: AGC1, ALDH 1A 1, ANXA8, AQP 1, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CDH3, CLDN11, CRYAB, DI02, METTL7A, EGR2, EMID1, FM03, FOXF2, GABRB1, GSC, HOXA5, HSD 1 1 B2, HSPA6, HSPB3, ID4, IFI27, INA, KRT14, KRT17, RT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1 , MEOX2, MMP1, MX1, MYH3, MYH 1 1, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROMI, RARRES 1, RASD1, RELN, SMOC2, STMN2, SYT12, TACl, RSP03, TNFSF7, TNNT2 and TUBB4.

The group of cell lines S 31 and SK.54 are positive for the markers: BEXl, COL21A1, CRIP 1, CRYAB, TMEM100, FMOl, FM03, FOXF1, FOXF2, IGF2, IGFBP5, 1L 1R1, KRT19, LAMC2, TMEMI 19, NPAS1 , PDE1A, PRRX2, S 100A4, SERPINA3, SNAP25, SOX 11, SRCRB4D and WISP2 and are negative for the markers: ACTC, AGCl, A R1C1, ALDII 1A1, ANXA8, AQP 1, AREG, ATP8B4, CFB, BMP4, C3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COMP, COP1, CXADR, DKK2, DLK1, DPT, EMID 1, FGFR3, GAB RB I, GAP43, GDF10, GSC, HSD17B2, I1SPA6, HTRA3, ID4, IFI27, INA, CNMB 1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMPI, MYH3, MYII 1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, 0SR2, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PRRX1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TACl, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, ZIC 1 and ZIC2,

The cell line SK32 is positive for the markers: AKR1C1, BEXl, C6, C7, C20orfl 03, COL21A1, CRYAB, METTL7A, DPT, GDF5, HTRA3, ICAM5, IL 1 R1, TMEM I 19, MGP, OGN, POSTN, PTPRN, RGMA, SERP1NA3, SFRP2, SOD3, WISP2 and ZIC 1 and is negative for the markers: ACTC, AGC l, ALDH 1A 1, ANXA8, AQP 1, AREG, ATP8B4, CFB, BMP4, C3, CCDC3, CD24, CDH3, CDH6, CLDN11 , CNTNAP2, COL15A1, COMP, COP i, CXADR, DI02, DKK2, EGR2, EMID1, FGFR3, FM03, FOXF1 , FOXF2, GABRB 1, GAP43, GDF10, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, INA, KIAA0644, KRT14, RT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MMPI, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROM1, PTGS2, RASD 1, RELN, RGS 1 , SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TFPI2, RSP03, THY1 , TNFSF7, T NT2, TRH, TSLP, TUBB4 and ZIC2.

The group of cell lines SK40 and SK40Bio2 are positive for the markers: BEXl, COL21A 1, CRYAB, FMOl, FST, ICAM5, IGFBP5, TMEM I 19, MSXl, MYL4, PTPRN, SERPI A3, SOD3, ZIC1 and ZIC2 and are negative for the markers: AGC l , AKR1C1, ALDH1A1, AQP1, ATP8B4, BMP4, C3, C20orfI03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, COPI, DI02, DKK2, DPT, TMEMI 00, FM03, GABRB I, GAP43, GSC, IIOXA5, IISPA6, HSPB3, ID4, IFI27, INA, KCNMB 1, KJAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEO 1, MEOX2, MX1, MYBPH, MYH1 1, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROM1, RARRES1, RASD1, RELN, RGS I, SMOC2, SNAP25, SYT12, TACl, TFPI2, RSP03, THY 1, TNFSF7, TRI-I, TSLP and TUBB4

The cell iine SK46 is positive for the markers: APCDD 1, COL21A 1, DI02, METTL7A, FMOl, FM03, FOXF1, FOXF2, FST, IITRA3, IGF2, IL1R 1 , TMEMI 19, OGN, PRR 1 , PRRX2, SERPINA3, SFRP2, SLITRK6, TSLP and ZIC2 and is negative for the markers: ACTC, AGCl, ALDH lA i, ANXA8, AQP 1 , ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COP I, CRIP ! , CXADR, DKK2, DPT, EMID 1 , FGFR3, GABRB I, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, IFI27, INA, KRTI4, KRT17, KRT19, KRT34, LAMC2, IGFL3, L0C92I96, MFAP5, MEOX1, MEOX2, MMPI, MX1, MYBPH, MYH3, MYII11, MYL4, IL32, NLGN4X, TAGLN3, NPAS I, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PROM1, RARRES 1, RASD1, RELN, RGSI, SMOCI, SMOC2, STMN2, TFPI2, RSP03, ΤΉΥ1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZIC1.

The cell line SK47 is positive for the markers: BEXl, COL 1 A 1, METTL7A, FMO 1 , FOXFl, FOXF2, FST, HTRA3, ICAM5, IGF2, ILIRl, KRT19, TMEMI 19, MSXi, PRRX2, PTPRN, SERP1NA3, SOD3 and ZiCl and is negative for the markers: AGC l, ALDHIAI, AQP1 , ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDII3, CLDN11, CNTNAP2, COL15A 1 , COP I, CRLF1, DKK2, DPT, EGR2, EMID1, FGFR3, GABRB I, GAP43, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNiviB l, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, ME OX2, MGP, MMPI, MX1, MYBPH, MYH3, MYH l 1, IL32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PROMI, RARRES1, RASD 1, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TACl , TFPI2, RSP03, THY I, TNFSF7, TNNT2, TRH, TUBB4 and ZD52F10. The group of cefl lines SKS.Biol, S 5.Bio2, S 5Bio3 and S 5BioUT are positive for the markers: ACTC, C7, CRLF 1, CRYAB, FST, HTRA3, IL1R1, TMEM1 19, MOP, PTPRN, SERPINA3, SFRP2 and ZICl and are negative for the markers: ALDH lA l, ANXA8, CFB, BMP4, C3, C20orn03, CDH3, CLDNI I, CNTNAP2, COPl, DKK2, EM1D1, FM03, GAB RBI, GDF10, GSC, HSD17B2, HSPB3, IFI27, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEO 1, MEOX2, MYHl 1, IL32, NPPB, OLRl, OSR2, PAX2, PAX9, PENK, PRELP, PROM 1, RARRES1, RELN, RGS 1 , SLITRK6, SMOC1, S OC2, STMN2, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and ZIC2.

The cell line SK8 is positive for the markers: APCDDl, BEX1, COL21A1, CRLF1, FMO l, FM03, FOXF2, FST, IITRA3, ICAM5, IGF2, IL1R 1, TMEM1 19, MASP1 , PTPRN, SERPINA3 and SFRP2 and is negative for the markers; ACTC, AGC l, ALDHlA l, ANXA8, AQP1, ATP8B4, CFB, B P4, C7, PRSS35, C20orfl03, CD24, CDH3, CDH6, CLDN I I, CNTNAP2, COPl, DKK2, EMID1, GAB RBI, GAP43, GDF10, GJB2, GSC, IIOXA5, HSD17B2, HSPA6, HSPB3, 1FI27, IF1T3, INA, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, EOX2, MMPl, MX1, MYBPH, MYH3, MYH 11, MYL4, IL32, NLGN4X, NPPB, OLRl, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROM1, PTN, RARRES 1, RASDi, RELN, RGS1, SMOC1, SMOC2, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZICl and ZIC2.

The cell line SM17 is positive for the markers: BEX 1, CD24, CRYAB, EGR2, FOXF 1, FST, GDF5, HTRA3, IGFBP5, KRT19, MMP l, MSXl , MSX2, IL32, PODN, POSTN, PRELP, PRRX2, SRCRB4D, TFPI2, TSLP and ZIC l and is negative for the markers: AGCl, AKR1C1, ALDHlA l, ANXA8, APCDDl , AQP 1, AREG, ATP8B4, CFB, BMP4, C6, C7, C20orfl03, CCDC3, CDH3, CLDNI 1, CNTNAP2, COL15A1, DI02, METTL7A, DKK2, DLK1, DPT, FGFR3, TMEM100, FMO l, FM03, GABRB 1, GAP43, GDF 10, GSC, HOXA5, HSD11B2, 1ISDI7B2, HSPA6, IFI27, IGF2, KCNMB 1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MYBPH, MYH3, MYH 1 1 , NLGN4X, NPPB, OLRl, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, RARRES1, RASDI, RELN, RGS1, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZIC2.

The cell line SM19 is positive for the markers: BEX1, CNTNAP2, CRYAB, FST, GDF5, MMP l, POSTN, PRRX2, SERPINA3 and SFRP2 and is negative for the markers: ACTC, AGCl, AKR! Cl, ALDHlA l, ANXA8, AQP 1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CDH3, CDH6, CLDNI 1, COL21A1, COMP, COPl, CRLF1, DI02, METTL7A, DKK2, DLK1, DPT, EMID 1, FGFR3, TMEMIOO, FMOl, FM03, FOXF2, GABRB 1, GDF10, GSC, HOXA5, HSD1 1B2, HSD 17B2, 11SPA6, 1D4, 1F127, IGF2, IGFBP5, IL1R1, KCNMB 1, IAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MXl, MYBPH, MYH3, MYH l 1, NLGN4X, NPPB, OGN, OLRl, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, RARRES 1, RASD I, RGS 1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, TFPI2, RSP03, THYl , TNFSF7, TNNT2, TRH, UGT2B7, W1SP2, ZICl and Z1C2.

The cell line SM2 is positive for the markers: CDH6, CNTNAP2, COL15A 1, C0L21A 1, FST, GDF5, TMEM 1 19, MMPl, MSXl, POSTN, PRRXl, SOD3, ZICl and ZIC2 and is negative for the markers: ACTC, AGCl, AKRICl, ALDH lAl, ANXA8, APCDD l, AQP 1, AREG, ATP8B4, BEX 1 , BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDNI 1, COMP, CRiP l , CRYAB, DI02, DPT, EMTD 1 , FGFR3, TMEMIOO, FM03, GDF 10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB 1, KIAA0644, KRT14, KRTI7, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MX l , MYBPH, MYH3, MYHl 1, MYL4, IL32, NLGN4X, NPASl, NPPB, OLRl , OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROM1, RARRES 1, RASD I, RELN, RGS 1, SFRP2, SLITRK6, SMOCI , SMOC2, STMN2, SYT12, TACI, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7.

The cell line SM22 is positive for the markers: CDH6, CRLF1 , DLK1, FOXF i, FST, GDF5, HTRA3, IGFBP5, ILIRI, MGP, MMP l, MSXl, MSX2, OGN, POSTN, PRRX2, PTN, RGMA, S0D3, SRCRB4D, STMN2, TSLP, ZD52F 10 and ZIC l and is negative for the markers: AGCl, ALDH lAl, ANXA8, APCDD l, AQP1, AREG, BMP4, C3, C6, C7, C20orH03, CCDC3, CDH3, CLDN I 1, CNTNAP2, COL15A1, CRIPl, CXADR, DI02, DKK2, DPT, TMEMIOO, FMOl, FOXF2, GDF 10, GJB2, GSC, HOXA5, HSD1 1 B2, HSD 17B2, HSPA6, HSPB3, ICA 5, IPI27, INA, KRT14, KRT17, KRT34, LAMC2, TMEM1 19, IGFL3, LOC92196, MFAP5, MASP 1 , MEOXl, MEOX2, MXl, MYBPH, MYH3, MYH l i, MYL4, IL32, NLGN4X, NPASl, NPPB, OLR l, OSR2, PAX2, PAX9, PENK, PITX2, PRG4, PROM1, PTPRN, RARRESi, RASDI, RELN, RGS 1 , SFRP2, SMOC I, SMOC2, SNAP25, TACI, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZIC2. The group of cell lines SM25 and Z8 are positive for the markers: FOXF1, FST, GDF5, HTRA3, MSX1, MSX2, PRRX2 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP 1 , AREG, ATP8B4, BMP4, C6, C7, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, METTL7A, DKK2, E ID1 , T EM100, FMOl, GABRB l, GDF10, GSC, HOXA5, HSD i lB2, HSD17B2, HSPA6, ID4, IFI27, KCNMBl , KRT14, T17, KRT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MYBPH, MYH3, MYH 11, YL4, NLGN4X, NPPB, OLR 1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROM1, RARRES1 , RASD1, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOC I, SMOC2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7.

The cell line SM28 is positive for the markers: COMP, CRLF1, DI02, EGR2, FOXF1, FOXF2, FST, HSPB3, 1NA, TME l 19, MGP, MMP 1 , MSX2, POSTN, PRELP, PRRX2, PTN and SYT12 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A 1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEX1, CFB, C3, C6, C7, C20orfl03, CD24, CDH6, CLDNI 1, CNTNAP2, COL21A 1 , CXADR, METTL7A, DKK2, DLK1, FGFR3, TMEM 100, FMO l, GABRBl, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD 17B2, HSPA6, ID4, IFI27, IFIT3, KCNMB l, KRT1 , KRT17, KRT1 , KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MXl, MYBPH, MYH3, MYII l 1, IL32, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PTGS2, PTPRN, RARRES I, RASD1, RGS 1, RPS4Y2, SERPINA3, SFRP2, SMOCi, SMOC2, SNAP25, STMN2, TACl, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, W1SP2, ZD52F 10, ZIC1 and ZIC2.

The cell line SM29 is positive for the markers: FOXF1, FOXF2, FST, HTRA3, IGF2, IGFBP5, 1L1R1, MASP 1, MGP, MMP 1, MSX2, OGN, PODN, POSTN, PRELP, PRRX2, PTN, SRCRB4D and TSLP and is negative for the markers: ACTC, AKR1C1, ALDH 1 A 1, ANXA8, APCDD 1, AQP1, CFB, C6, C7, CCDC3, CDH3, CLDNI 1, CNTNAP2, COL 15A1, COL21A 1, CRIP l, CRLF1, CRYAB, DKK2, DPT, FGFR3, TMEM 100, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, ID4, 1FI27, INA, KCNMB l, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1 , MEOX2, MXl, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX9, PDE1A, PENK, PITX2, PROM1, RARRES I, RASD1, RELN, RGS1, S100A4, SMOCI, SMOC2, SNAP25, TACl, RSP03, TNFSF7, TN T2, TRH, TUBB4, UGT2B7, WISP2, ZIC1 and Z1C2.

The cell line SM30 is positive for the markers: COLI5A I, CRYAB, DYSF, FST, GDF5, HTRA3, TMEM1 19, MMP1, MSX1, MSX2, MYL4, POSTN, SERP1NA3, SRCRB4D and ZIC2 and is negative for the markers: ACTC, AGC 1, AKR1C1, ALDH1A 1 , ΛΝΧΑ8, APCDD 1, AQP1, ATP8B4, CFB, C3, C6, C7, C20orfl03, CD24, CDH3, : CLDN I 1, CNTNAP2, COMP, DI02, METTL7A, DKK2, DLK1 , DPT, FGFR3, TMEM 100, FMO l, FM03, FOXF2, GABRB l, GJB2, GSC, HOXA5, HSD 1 1B2, HSPA6, ID4, IFI27, 1L1R1, KCNMBl, KIAA0644, KRT14, _: KRT17, KRT34, IGFL3, LOC92196, MEOX1, ΜΈΟΧ2, MGP, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PRO I, PRRX1, PTN, RARRESI, RASD1, RELN, RGSI, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TACl, RSP03, TNFSF7, TNNT2, TRH, TUBB4,

UGT2B7 and W1SP2.

The cell line SM33 is positive for the markers: BEX1, CD1I6, CRLF1, EGR2, FOXF1, FST, IGFBP5, MSX 1, MSX2, PRELP, SERPINA3, SRCRB4D, SYT12, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1CI, ALDH1AI, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl 03, CD24, CDH3, CLDNI I, CNTNAP2, COL 1A1 , CRIP I, D102, METTL7A, DLK1, DPT, EMID 1, FGFR3, TMEM 100, FMOl, GABRB l, GAP43, GSC, HOXA5, HSD1 1B2, HSPA6, HSPB3, ID4, IFI27, IL1R1, KCNMB l , KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXl, MEOX2, MXl, MYBPH, MYH3, MYHl 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PTGS2, RARRES I, RASD1 , RELN, RGSI , RPS4Y2, SFRP2, SMOCI, SMOC2, SNAP25, STMN2, TACl, RSPOS HIY l, TNFSF7, TRH, TUBB4, UGT2B7, WISP2 and ZIC 1.

The cell line SM4 is positive for the markers: BEX1, CCDC3, CDH6, CRLFI , EGR2, FST, GABRBl, GAP43, GDF5, 1ISPB3, HTRA3, MMP 1 , MSX1 , MSX2, PRELP, PRRX l, PRRX2 and SRCRB4D and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD 1, AQP 1 , AREG, ATP8B4, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CD24, CDH3, CLDNI 1, CNTNAP2, COL15A1, COL21A1, COP1, CXADR, METTL7A, DKK2, DLK1, DPT, EM1D1, FGFR3, TMEM 100, FMO l, FM03, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, 1CA 5, ID4, IFI27, IGF2, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASP 1, MEOX l, MEOX2, MXl, MYBPH, MYH3, MYH 11, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR 1, OSR2, PAX2, PAX9, PDE1A, PENK, P1TX2, PRG4, PROM I, RARRES I , RASD1, RELN, RGSI, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TACl, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F 10 and ZICI. The cell line SM40 is positive for the markers: BEXi, CD24, CRYAB, FST, 1ISPB3, IGFBP5, RT19, MMPI, MYL4, POSTN, PRELP, SRCRB4D and ZD52F 10 and is negative for the markers: AGC1, AKR1C 1, ALDH 1A1, ANXA8, APCDD i, AQP 1, AREG, CFB, C6, C7, CDH3, CDII6, CLDNI 1, CNTNAP2, COL15A 1, COL21A1, COMP, CRLF1, DI02, METTL7A, D 2, DLKI, DPT, EMID1, FGFR3, TMEM100, FMO l, FM03, GABRB1, GAP43, GDF10, GJB2, GSC, H0XA5, HSDI 1B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, KRT14, KRT17, KRT34, IGFL3, LOC92I96, MEOX I, MEOX2, MGP, MX 1, MYBPH, MYII3, MYH 1 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROM1, PRRX1, RARRES 1, RASD 1, RELN, RGMA, RGS 1, RPS4Y2, SFRP2, SLITR 6, SMOC1, SMOC2, SOXI 1, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZICI and ZIC2.

The ccti line SM42 is positive for the markers: COL15A I, EGR2, FST, GDF5, TMEM 11 , MMPI, MSX1, MSX2, PRELP, PRRX 1, PRRX2, SFRP2, SRCRB4D, ZICI and ZIC2 and is negative for the markers: ACTC, AGC1, A R1C1, ALDH 1A 1, ANXA8, APCDD I , AQP l , ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDNI 1, CNTNAP2, CRIP 1 , CRYAB, DI02, METTL7A, D K2, DL 1, DPT, EMID1, FGFR3, TMEM I00, FOXF2, GABRB i, GAP43, GJB2, GSC, HOXA5, HSDI 1B2, HSPA6, ID4, IF127, K1AA0644, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, ΡΪΤΧ2, PRG4, PROM1, RARRES1, RASD 1, RELN, RGS1, SLITRK6, SMOC 1, SMOC2, SNAP25, STMN2, TAC1 , RSP03, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7.

The cell line SM44 is positive for the markers; CDH6, COMP, CRLF1, CRYAB, EGR2, FOXFl , FST, GDF5, HTRA3, MGP, MMPI, MSX2, POSTN, PRELP, PRRX2, SYT12 and TSLP and is negative for the markers: ACTC, AGC1, A R1C1, ALDH lA i, ANXA8, APCDDI, AQPl, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDNI 1, CNTNAP2, COL15A 1, COL21A1, COP1, CXADR, METTL7A, DKK2, DLKI, DPT, EMIDl, FGFR3, TMEM100, FMOl, FM03, FOXF2, GABRB I, GDF10, GJB2, GSC, HOXA5, HSDI 1B2, HSD 17B2, HSPA6, 1D4, IFI27, IFIT3, IGF2, KRT14, KRT17, KRT19, KRT34, 1GFL3, LOC92196, MFAP5, MEO I , MEOX2, MX1, MYBPH, MYH3, YH11, MYL4, NLGN4X, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROM 1, PTN, PTPRN, RARRES1, RASDI, RELN, RGS 1, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC I and Z1C2.

The cell line SM49 is positive for the markers: FOXFl, FOXF2, FST, GAP43, GDF5, HSPB3, HTRA3, IGFBP5, MGP, MMP I, MSX2, POSTN, PRELP, PRRX2, PTN, RGMA, SOD3, SRCRB4D and SYT12 and is negative for the markers: ACTC, AGC1, AKR1C I , ALDH 1A 1 , ANXA8, APCDD I, AQPl, Al EG, CFB, BMP4, C6, C7, C20oi-fl03, CD24, CDH3, CLDN I 1, CNTNAP2, COL15A 1, COL21A1, DI02, METTL7A, DPT, EM1D 1, FGFR3, TMEM 100, FMO l, GABRB I, GDF10, GJB2, GSC, HOXA5, HSDI 1B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, KIAA0644, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYBPH, MYH3, MYH 1 1, MYL4, NLGN4X, TAGLN3, NPAS 1, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, RARRES1, RELN, RGS1, SMOC1, SMOC2, SNAP25, TAC1, RSP03, THY l, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC I and ZIC2

The cell line SMS is positive for the markers: BEXl, CDI16, FOXFl, FST, GDF5, GDF 10, IGF2, IGFBP5, MMPI, MSX1, TFP12, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1 , AKR1C1, ALDH 1A 1, ANXA8, APCDD I, AQPl, ATP8B4, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CDH3, CLD I 1, COL21A 1, COMP, CRYAB, DI02, METTL7A, DKK2, DLKI, DPT, OMID I, FGFR3, TMEM 100, FMO l , FM03, FOXF2, GABRBi, GJB2, GSC, HOXA5, HSD 11B2, HSD 17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, KCNMBl, KIAA0644, KRT14, KRT17, KRT34, TMEMi 19, IGFL3, LOC92196, MFAP5, MASP1 , MEOX I , MEOX2, MGP, MX1, MYBPH, MYII3, MYH11, MYL4, NLGN4X, NPAS1, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDE1A, PENK, P1TX2, POSTN, PRELP, PRG4, PROM1, PRRX1, PTGS2, RGMA, RGS1, S 100A4, SFRP2, SLITRK6, SMOC2, STMN2, TAC 1 , RSP03, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZD52F10.

The cell line T14 is positive for the markers: BEXl, PRSS35, CCDC3, COL15A1, CRTPI, CRYAB, FST, HTRA3, IGF2, KCNMB l, KRT17, KRT19, LAMC2, PITX2, POSTN, S100A4, SOXI 1 , THYl and TNNT2 and is negative for the markers: AGC1, ALDH1A1, AQPl, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CDH3, CLDNI 1, CNTNAP2, COP 1, CXADR, METTL7A, DLKI, DPT, EGR2, EMID1, TMEM 100, FMO l, FM03, FOXFl, FOXF2, GABRBI, GDF10, GJB2, GSC, HOXA5, HSDI 1 B2, HSD 17B2, HSPA6, 11SPB3, IFI27, 1GFBP5, KIAA0644, KRT14, IGFL3, LOC92196, MASP 1, MEOXI, MEOX2, MGP, MX1, MYH3, 1L32, NLGN4X, TAGLN3, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDE 1A, PENK, PRG4, PROM1, PTGS2, PTPRN, RARRES I , RASDI, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC1, TFPI2, RSP03, TNFSF7, TRH, TUBB4, WISP2, ZD52F10, ZICI and ZIC2, The group of cell lines T4 and T23 are positive for the markers: BEXl, CCDC3, D K2, KRT19 and LAMC2 and are negative for the markers: ALDH IAI, APCDD 1, AQP1, CFB, C3, C6, C20orfl03, CDH3, CLDN11,

CNTNAP2, COL15A1, COMP, CRLF1, METTL7A, DPT, EMID 1, TMEMIOO, FM03, FOXF2, GDF10, GJB2, GSC, HOXA5, HSDl 1 B2, HSPA6, 1FI27, IL1R1, KRT14, IGFL3, LOC92196, MASP 1, MEOX1, MEOX2, MGP, MX1, MYBPH, ΜΎΗ3, MYH1 1 , NLGN4X, NPAS1, OGN, OLRi, PAX2, PAX9, PDE1A, PENK, PROM1, PRRX2, PTPRN, RARRES 1, RASD 1, RGMA, RGS 1, RPS4Y2, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, TNFSF7, TRH, WFSP2, ZD52F10 and ZIC L

The group of cell lines T36 and T42 are positive for the markers: BEXl, CCDC3, CDH6, CRIPI, FST, HTRA3, KRT17, PTN, S100A4, SRCRB4D, THY1 and ZlC2 and are negative for the markers: AGCI , ALDH IA I, APCDD1, AREG, ATP8B4, C3, C6, C7, PRSS35, C20orfl 03, CDH3, CLDN1 i, CNTNAP2, CRLF1 , METTL7A, DLKI, DPT, EMID1, FMOI, FM03, FOXF2, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, HSPB3, IFI27, KRT14, IGFL3, LOC92196, MFAP5, MASP 1, MEOX1, MEOX2, MGP, MMPl, MYBPH, MYH3, NLGN4X, TAGLN3, NPAS 1, NPPB, OGN, OLRI, PAX9, PDB1A, PENK, PRG4, PROM1, PTPRN, RARRES1, RASD 1, RELN, RGS1, SLITRK6, SMOC2, SNAP25, STMN2, TAC1, RSP03, TRH, TUBB4 and WISP2.

The group of cell lines T43 and T44 are positive for the markers: BEXl, PRSS35, CCDC3, CDI16, COL21A 1, CRIPI, CRYAB, 1CAM5, KRT17, LAMC2, POSTN, S 100A4, SFRP2 and THY 1 and are negative for the markers:

AGCI , ALDHIAI, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C7, C20orfl03, CDH3, CNTNAP2, COP1, METTL7A, DLKI, DPT, EM1D1, FMO I, FM03, FOXF1, FOXF2, GAB RBI, GDF10, GJB2, GSC, HOXA5, HSD l 1B2, HSDI7B2, HSPA6, IFI27, IGFBP5, IGFL3, LOC92196, MEOX1, MEOX2, MGP, NLGN4X, TAGLN3, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDE1A, PRG4, PROM1, RARRESl, RASD1, RELN, RGS 1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1 , TRH, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC2.

The cell Hne U 18 is positive for the markers: ANXAS, BEX l, PRSS35, CCDC3, CDH6, CRYAB, DKK2, KRT19, MYH 11, NPPB, TNNT2 and ZIC2 and is negative for tiie markers: ACTC, AGC I, ALDH 1A 1, APCDD 1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COL15A1, COP1, CRLF 1, DI02, METTL7A, DPT, EGR2, EMTD I , TMEM100, FMO I, FM03, FOXF1, FOXF2, GABRB1, GDF 10, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, HSPB3, IF127, 1GF2, 1GFBP5, K1AA0644, KR 14, TMEM119, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MXI, MYBPH, MY1I3, NLGN4X, OGN, OLRI, PAX2, PAX9, PDEIA, PENK, PROM1, PTPRN, RARRES l, RASD1, RELN, RGS1, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, TAC 1, TFPI2, RSP03, THY l, TNFSF7, TRH, TUBB4, WISP2 and ZICL

The group of cell lines U30, U30 and U31 are positive for the markers: BEXl, CDH6, CRYAB, KCNMB 1, KRT17, MYTH 1, ZIC1 and Z1C2 and are negative for the markers: ALDH IA I, ATP8B4, C3, C7, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, COP1, CRLF 1, METTL7A, DPT, FMO I, FM03, FOXF1, FOXF2, GABRB 1, GSC, HOXA5, HSD 11B2, HSD 17B2, HSPA6, IFI27, KIAA0644, KRT14, MEOX2, MGP, ΜΎΗ3, OGN, OLRI, PAX2, PAX9, PDEIA, PROM 1, PTPRN, RASD1, RGS1, SFRP2, SMOC1 , SNAP25, TAC1, TNNT2, TRH, TUBB4 and WISP2.

The cell fine Wl 1 is positive for the markers: COL15AI, COL21A 1, DI02, DLKI, FMO I, FOXF1, FOXF2, FST, HTRA3, 1GF2, IL1R1, TMEM119, OGN, PRRX2, PTN, SERP1NA3, SLITRK6, SOD3, TFPI2 and WISP2 and is negative for the markers: ACTC, AGCI, AKR1C1, ALDHIAI, ANXA8, APCDD1, AQP1, ATP8B4, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, CRIPI, CRYAB, CXADR, DKK2, EMID1, FGFR3, GAP43, GDF10, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MGP, MMP 1, MXI, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLRI, PAX2, PAX9, PENK, P1TX2, POSTN, PRG4, PROM 1, RASD1, RELN, RGS1, SMOC1, SMOC2, STMN2, TAC1 , RSP03, THY I, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F10, ZTC1 and Z1C2.

The cell line W2 is positive for the markers: BEXl, CD24, COL21A 1, FST, IITRA3, ICAM5, IGF2, IGFBP5, IL 1 R1, KRT19, LAMC2, TMEMl 19, MSX 1, MSX2, PTN, SERP1NA3, SFRP2, SOD3, SOX11, SRCRB4D and ZIC2 and is negative for the markers: AGCI , AKRICi, ALDH IAI, APCDD1, ATP8B4, BMP4, C6, C7, C20orfl03, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A 1 , COMP, COP 1 , CRLF1, DKK2, DLKI, DPT, EGR2, EMID 1 , TMEMl 00, FM03, FOXF2, GAP43, GDF10, GSC, HOXA5, HSDl 1B2, HSPA6, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOXl, MEOX2, MGP, MYBPH, MYH3, MYH ! 1, NLGN4X, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDEIA, PENK, PITX2, PRG4, PROM1, PTGS2, RARRES l, RASD1, RELN, RGMA, RGS 1, SLITRK6, SMOC 1, SMOC2, STMN2, SYT12, TAC 1, TNFSF7, ™NT2, TRH, TSLP, TUBB4 and ZICL The cell line W3 is positive for the markers: BEXl, CRIPI, FOXF I, FST, GDF5, HSPA6, HTRA3, IGF2, IGFBP5, KRT19, LAMC2, M P1, MS l, POSTN, PTPRN and TFPI2 and is negative for the markers: ACTC, AGC1, ALDH 1A 1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, BMP4, C6, C7, PRSS35, C20orfl03, CCDC3, CDH3, CLDN1 1, CNTNAP2, COH5A 1, COL21A1, COMP, D102, ETTL7A, DK 2, DLK1, DPT, EGR2, EMID 1, FGFR3, FMOl, FM03, FOXF2, GAP43, GDF 10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, IFI27, IFIT3, INA, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYH1 I, MYL4, 1L32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROM1, PRRX1, RARRES i, RELN, RGMA, RGS 1, SL1TRK6, SMOC1, SMOC2, SOX1 1 , SYT12, TAC1, RSP03, THY 1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZIC1 and ZIC2.

The cell line \V8 is positive for the markers: AQP1, CDH6, DI02, DL 1, EMIDl, FOXFI, FOXF2, FST, HTRA3, IL1R1, MSXl, MSX2, PRRX2, PTN, SLITRK6, SRCRB4D, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, AKR ICi, ALDH1A 1, A XA8, APCDD1, BMP4, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, CNTNAP2, CRLFl, CRYAB, CXADR, DKK2, DPT, EGR2, FGFR3, TMEM100, GABRB l, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD 17B2, HSPA6, HSPB3, ID4, 1FI27, 1FIT3, INA, CNMB 1, KRT14, KRT17, RT34, IGFL3, LOC92196, MFAP5, MEOX1, MEOX2, MX1 , MYBPH, MYH3, MYIII 1, MYL4, NLGN4X, NPPB, OLR1 , PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROM1, PRRXI, RARRES I, RASD 1, RGMA, RGS1 , SMOC1, SMOC2, STMN2, SYT12. TAC1 , RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC1,

The cell line X4 is positive for the markers: ACTC, AQP1, BE l, BMP4, CD24, CDH6, CLDN11

CRYAB, CXADR, IITRA3, INA, KRT17, KRT19, LAMC2, MMP1, IL32, NLGN4X, TAGLN3, NPPB, PAX2, PROM1, RASDl, RELN and UGT2B7 and is negative for the markers: AGC1, ALDHI A 1, APCDD1, ATP8B4, CFB, C3, C6, C7, C20orn03, CCDC3, CDH3, CNTNAP2, COL15A 1, COL21A1, COMP, COP1, CRLF l, DI02, METTL7A, DKK2, DLK1, DPT, EGR2, EMID1, TMEMI00, FMO i, FM03, FOXFI, FOXF2, FST, GABRBl, GAP43, GDF iO, GJB2, GSC, HOXA5, HSD 11B2, HSD17B2, HSPA6, ID4, 1F127, IF1T3, IGF2, ILIRI, KCNMB 1, KIAA0644, TMEM119, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MGP, MX1, MYBPH, MYH3, MYL4, OGN, OSR2, PAX9, PDE1A, PENK, P1TX2, PRELP, PRR I, PRRX2, PTGS2, PTN, RARRES I, RGMA, RGS1, SERPINA3, SL1TRK6, SMOC1, SMOC2, SOD3, TACi, RSP03, TNNT2, TRH, TUBB4, WISP2, ZD52F10, Z1C1 and ZIC2.

The cell line X5.4 is positive for the markers: ACTC, CD24, CLDN1 1, CRIPI, CRYAB, IITRA3, KRT19, KRT34, LAMC2, MMP1, IL32, NLGN4X, TAGLN3, NPPB, PAX2, POSTN, RELN, S100A4, SFRP2, SRCRB4D, THY! and UGT2B7 and is negative for the markers: AGC1, ALDH 1A 1, APCDD 1, AREG, ATP8B4, CFB, C3, C6, C7, C20orfl03, CNTNAP2, COL2 I A l , COMP, COP1, CRLF l, DI02, METTL7A, DKK2, DLK1, DPT, EM1D1, TMEM100, FMOl, FM03, FOXFI, FOXF2, GABRB l, GAP43, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGF2, KIAA0644, TMEM1 19, IGFL3, MASP1, MEOX2, MSXl , MX 1, MYBPH, MYH3, MYL4, NPASI, OGN, OSR2, PAX9, PDE1A, PENK, PRELP, PRRX I, PRRX2, PTPRN, RARRES I, RGMA, RGS !, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, TACI, RSP03, TNNT2, TRH, TUBB4, WISP2, ZD52F10, ZIC 1 and ZIC2.

The cell line XS is positive for the markers: ACTC, AKRICI, BEXl, CLDN11, COMP, CRIPI, CRYAB, GDF5, HTRA3, KIAA0644, KRT14, KRT19, KRT34, LA C2, MFAP5, MEOX2, MGP, MMPl , PENK, PITX2, POSTN, PTGS2, S 100A4 and THY l and is negative for the markers: AGC1, ALDH1A 1, ANXA8, APCDD 1, AQP1, AREG, ATP8B4, C6, C7, C20orfl03, CCDC3, CDH6, CNTNAP2, COL15A1, COL21A1 , COPI, CXADR, DI02, DKK2, DLK1, DPT, EMID 1, FGFR3, TMEM 100, FMOl, FM03, FOXFI, FOXF2, GAP43, GDF10, HSD11B2, HSD17B2, HSPA6, IFI27, IFIT3, IGF2, IGFL3, LOC92196, MEOX1 , MSX l, MSX2, MYBPH, MYH3, MYH1 1, MYL4, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PROM 1, PTPRN, RASD l, RELN, RGSi, SERPINA3, SFRP2, SMOC2, SNAP25, STMN2, SYT12, TAC I, RSP03, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52FI0, Z1C 1 and ZIC2.

The group of cell lines X7PEND12 and X7PEND24 are positive for the markers: AQP1, BEXl, CDH3, DI02, DLK1, FOXFI, FST, GABRBl, IGF2, IGFBP5, ILIRI, KIAA0644, MSXl, PODN, PRRX2, SERPINA3, SOX11, SRCRB4D and TFPI2 and are negative for the markers: ACTC, AGC1, AKRIC I, ALDH 1A 1, ANXA8, APCDD 1, AREG, CFB, C3, C6, C7, PRSS35, CCDC3, CD24, CLDN 11, COMP, COPI , CXADR, DKK2, EMID1, FGFR3, FMOl, FM03, GAP43, GDFIO, GSC, HOXA5, HSDI 1B2, HSPA6, HTRA3, 1 CAM 5, ID4, IFI27, IFIT3, INA, KCNMB 1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPi , MEOX1, MEOX2, MMPl, MX1, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PENK, P1TX2, PRELP, PRG4, PRRX I, RARRES I, RELN, RGMA, SFRP2, SMOC 1, SMOC2, SOD3, SYTI2, TAC i, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2. The group of cell lines X7PEND9 and X7PEND16 are positive for the markers: BEX1, CDH6, DL l, TME IOO, FOXFl, FOXF2, IGF2, IGFBP5, IL1R1, KIAA0644, TMEM119, MGP, MSX1, MSX2, PDE1A, PODN, PRRX2, PTN, S100A4, SERPINA3, SNAP25, SOX11 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1CI, ALDH1A1, ANXA8, AREG, ATP8B4, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CNTNAP2, COP1, CRYAB, CXADR, METTL7A, DK 2, EMID1, FGFR3, FMOI, GDF10, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, 1NA, KCNMBl, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPi, MEOXl, MEOX2, MMPl, MYBPH, MYH3, MYHl 1, MYL4, IL32, NLGN4X, NPASl, NPPB, OLRl, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PRG4, PROM1, PTPRN, RASD1, RELN, RGS1, SFRP2, SMOC1, SMOC2, SOD3, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F10,ZlCi andZIC2.

The cell line X7PEND30 is positive for the markers; BEX1, PRSS35, CDII6, COL15A1, DI02, DLKl, DPT, TMEMIOO, FMOI, FM03, FOXFl, FOXF2, FST, HSPB3, IGF2, IGFBP5, IL1R1, KIAA0644, KRT19, LAMC2, TMEM119, MGP, MSX1, PDE1A, PODN, PRRX2, S100A4, SERP1NA3, SOX11 and SRCRB4D and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C3, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COP1, CXADR, DKK2, EMIDI, FGFR3, GAP43, GDF5, GDFIO, GJB2, GSC, HOXA5, HSD1 IB2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, 1F127, INA, KCNMBl, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXl, MEOX2, MMPl, MYBPH, MYH3, MYHl I, MYL4, IL32, NLGN4X, NPPB, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PRRX1, PTGS2, PTPRN, RELN, RGS1, SFRP2, SMOC1, SMOC2, SOD3, STMN2, SYT1 , TACI, RSP03, THYI, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2.

The cell line X7SKEL2 is positive for the markers: APCDD1, BEX1, C6, C7, PRSS35, COL21 Al, CRIPl, CRLF1, CRYAB, DLKl, TMEMIOO, FMOI, FOXF2, GDF5, HSD11B2, IGF2, IGFBP5, KRTI9, LAMC2, TMEM119, MGP, NPASl, PRRX2, PTPRN, RGMA, S100A4, SERPINA3, SNAP25 and SOX11 and is negative for the markers: ACTC, AGC1, AKR1CI, ALDHIA1, ANXA8, AQPI, AREG, ATP8B4, CFB, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDNI1, CNTNAP2, COMP, COP1, CXADR, DI02, METTL7A, DKK2, DPT, EGR2, EMIDI, FGFR3, FOXFl, GAB RBI, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HTRA3, ID4, IF127, ΠΤΤ3, KCNMBl, Κ1ΛΑ0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXl, MEOX2, MMPl, MSX2, MXt, MYBPH, MYH3, MYHl 1, MYL4, IL32, NLGN4X, PPB, OGN, OLRl, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROM1, PRRX1, PTGS2, PTN, RARRES1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TACI, TFP12, RSP03, THYI, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZIC1 and ZIC2.

The ceil line X7SKEL22 is positive for the markers: ACTC, BEX1, C7, PRSS35, COL21A1, CRIPl, CRYAB, DI02, DPT, EGR2, FM03, FOXFl, FOXF2, FST, GJB2, HSPB3, 1GF2, 1GFBP5, IL1R1, KRT19, LAMC2, TMEM119, MGP, NPASl, PODN, PRRX2, SERPINA3, SOX11 and SRCRB4D and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, AQPI, AREG, ATP8B4, CFB, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CDII6, CLDN11, CNTNAP2, COL15A1, COMP, COP1, CXADR, METTL7A, DKK2, DLKl, EMIDI, FGFR3, TMEMIOO, GAB RBI, GAP43, GDF5, GDF10, GSC, HOXA5, HSD17B2, HSPA6, I1TRA3, ICAM5, ID4, IFI27, IFIT3, KCNMBl, KRTI4, KRT17, KRT34, IGFL3, LOC92I96, MFAP5, MASPI, MEOXl, MEOX2, MMPl, MSX1, MSX2, MX1, MYBPH, MYH3, MYHl I, IL32, NLGN4X, NPPB, OGN, OLRl, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PRG4, PROMI, PRRXI, PTN, RARRES1, RASD1, RELN, RGS1, SFRP2, SL1TRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TACI, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F 10, ZIC 1 and ZIC2.

The group of cell lines X7SKEL4, X7SKEL6 and X7SKEL7 are positive for the markers: BEX1, COL21AI, CRLF1, DLKl, FMOI, FM03, FOXFl, FOXF2, HSD11B2, IGF2, IGFBP5, ILIRI, TMEM119, PRRX2, RGMA, SERPINA3, SNAP25, SOX11 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH 1 Al, ANXA8, AQPI, AREG, ATP8B4, CFB, BMP4, C3, C20orfl03, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COMP, COP1, CXADR, DKK2, EMTD1, FGFR3, GDF10, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HTRA3, ID4, IFI27, IF1T3, INA, KCNMBl, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXl, MEOX2, MMPl, MYBPH, MYH3, MYHl 1, MYL4, IL32, NLGN4X, NPPB, OLRl, OSR2, PAX2, PENK, PITX2, POSTN, PRELP, PROMI, RELN, RGSI, SFRP2, SLITRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TACI, TFPI2, RSP03, THYI, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and ZIC1. The cell line X7SM0012 is positive for the markers: BEX1 , CDH6, COL2 IA 1 , CRIP I , D102, DLKl, EGR2, FOXFl, FOXF2, FST, 1GF2, IGFBP5, TMEM119, MSX1, MSX2, MX1, PODN, POSTO, PRRX2, PTN, S100A4, SERPINA3, SOX1 1, TFPI2, W1SP2 and ZIC2 and is negative for the markers: ACTC, AGCI, AKRICI, ALDH 1A I, ANXA8, APCDD l, AQP 1, AREG, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDNl l, CNTNAP2, CO P, COP l , CRYAB, CXADR, METTL7A, DKK2, EMiDl, FGFR3, TMEM100, GABRB1, GAP43, GDF 10, GJB2, GSC, 1IOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, FL1 R1 , KCNMB I, KRT1 , KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MYBPH, MYH3, YH 1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PTGS2, RARRES1, RGS1, SFRP2, SMOC1, S OC2, SOD3, SYT12, TAC1, RSP03, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F10 and ZIC1.

The cell line X7SM0019 is positive for the markers: BEX1, CDH6, COL15A 1, COL21A1 , COMP, CRIPI , DLKl, EGR2, FMOl, FM03, FOXFl, FOXF2, FST, HSPA6, IGF2, IGFBP5, KIAA0644, KRT19, LAMC2, TMEM119, MSX1, MSX2, OGN, PODN, PRRX2, RGMA, S 100A4, SERPINA3, SNAP25, SOXl 1, SRCRB4D, TNNT2 and Z1C2 and is negative for the markers: ACTC, AGCI , AKRICI, ALDH 1A 1 , ANXA8, APCDDl, AREG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDN11, COP l, CXADR, DI02, METTL7A, DKK2, DPT, EMID I , TMEM 100, GABRB 1, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HTRA3, ICAM5, ID4, IFI27, IL1 R1, TNA, KCNMB 1 , KRT14, RT17, KRT34, IGFL3, LOC92196, MFAP5, MAS I, MEOXI, MEOX2, MMP1 , MYBPH, MYH3, MYH 11, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRG4, PROM1, PTPRN, RARRES 1, RELN, RGS1, SFRP2, SL1TRK6, SMOC1, SMOC2, SOD3, STMN2, SYT12, TAC 1, RSP03, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, W1SP2, ZD52F10 and Z1C1.

The cell line X7SM0025 is positive for the markers: AQP1, ATP8B4, BEX1, CDH3, COL21A1, CRIPI, DLKl, FOXFl, FOXF2, FST, GABRB , HSPB3, IGF2, IGFBP5, IL1R1, KRT1 , LAMC2, TMEM1 19, MSX1, MSX2, PODN, POSTN, PRRX2, PTN, RGMA, S100A4, SERPINA3, SLITRK6, SOXl 1, SRCRB4D, TFPI2, RSP03 and TIIY1 and is negative for the markers: ACTC, AGCI, AKRICI, AN A8, APCDD l, AREG, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CLDN 11, COL15A 1, COPl, CXADR, METTL7A, DKK2, EGR2, EMiDl, FGFR3, TMEM 100, FMO l, FM03, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, INA, KCNMB i, KRT1 , KRTI7, KRT34, IGFL3, LOC92196, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH1 1, MYL4, 1L32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, P1TX2, PRELP, PRG4, PROM1, PRRX1, PTPRN, RASD 1, RELN, RGS i, SFRP2, SMOC1, SMOC2, SOD3, SYT12, TAC1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC 1 and ZIC2.

The cell line X7SM0026 is positive for the markers: BEX1 , CCDC3, CDH6, COL15A1, COL21A 1, COMP, CRIP I, CRLFl, CRYAB, DI02, EGR2, FOXFl, FOXF2, FST, GDF10, HSPB3, IGF2, IGFBP5, KRT19, LAMC2, TMEM 119, MSXi, MSX2, NPAS1, PODN, POSTN, PRRX2, S100A4, SERPINA3, SOXl 1, SRCRB4D, TNNT2 and Z1C2 and is negative for the markers: ACTC, AGC I , AKRICI, ALDH 1A1, ANXA8, APCDDl, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN1 1, COPl, METTL7A, DLKl, DP T, EMiDl, FGFR3, TMEM 100, FMO l, FM03, GJB2, GSC, HOXAS, HSDl 1B2, HSPA6, HTRA3, ICAM5, 1D4, 11T27, 1L1R1, KCNMBI, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, ΜΥΉ3, IL32, NLGN4X, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROM I , PTGS2, PTN, PTPRN, RARRES1, RASD1, RELN, RGSI, SFRP2, SLITRK6, SMOC1, SMOC2, SNAP25, SOD3, STMN2, SYT12, TAC1, TFPI2, RSP03, THY1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC 1.

The group of cell lines X7SM009 and X7SM0029 are positive for the markers: BEXI, COL21A 1, CRIP I, CRLFl, DI02, DLKl, FOXFl, FOXF2, FST, IGF2, IGFBP5, KIAA0644, TMEM1 19, MSXI, PODN, POSTN, PRRX2, RGMA, S100A4, SERP1NA3, SNAP25, SOX l 1 and SRCRB4D and are negative for the markers: ACTC, AGCI, AKR ICI , ALDH1A1, ANXA8, APCDD l, AQP 1, AREG, ATP8B4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDN1 1, COPl, CXADR, METTL7A, DKK2, EMID 1, GDF10, GJB2, GSC, HOXAS, HSDl 1B2, HSD 17B2, HSPA6, HTRA3, ICAM5, 1D4, 1FI27, 1L1R1, INA, KCNMB I, KRT14, KRT17, KRTI9, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROM 1, PTPRN, RASD 1, RELN, RGSI, SMOC1, SMOC2, SYT12, TAC1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F10 and ZIC L The cell line X7SM0032 is positive for the markers: ACTC, BEX1, CDH6, COL21A 1, CR1P 1, CRLFI, DI02, DL I, EGR2, FGFR3, FOXF1 , FOXF2, FST, GAB RBI, IGFBP5, KJAA0644, RT19, LAMC2, TMEM1 19, GP, MMPl, MSXI, MSX2, PODN, POSTN, PRG4, PRRX2, PTN, RGMA, S 100A4, SERP1NA3, SOX11 and SRCRB4D and is negative for the markers: AGCl, AKRICI, ALDHlAl, ANXA8, APCDD1, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20oifl03 ₅ CCDC3, CD24, CLDN 1 1, CNTNAP2, COL15AI, COP 1, CXADR, METTL7A, D 2, DPT, EMID 1, T EM100, FMOl, FM03, GDF5, GDFIO, GJB2, GSC, H0XA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, HTRA3, 1 CAMS, ID4, IFI27, IL1 R1, INA, KCNMBI, KRT14, KRT17, KRT34, IGFL3, L0C92196, MFAP5, MASP l, MEOXI, MEOX2, MYBPH, MYII3, MYII11, MYL4, IL32, NLGN4X, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDEIA, PITX2, PRELP, PROM1, PTPRN, RASD1, RGS l, SFRP2, SMOCl, SMOC2, SOD3, STMN2, SYT12, TACI, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZIC1 and ZIC2.

The cell line X7SM006 is positive for the markers: ACTC, BEX1, CNTNAP2, COL15A1, COL21A 1, CRIPl, CRLF I, CRYAB, DLK l, EGR2, FMOl, FM03, FOXF1, F0XF2, FST, HSPB3, IGF2, IGFBP5, KRT19, LAMC2, TMEM1 19, MGP, MSXi, MSX2, NPAS1, OGN, PODN, POSTN, PRRX2, RGMA, S100A4, SERPINA3, SNAP25, SOX 1 1, SRCRB4D, STMN2 and TNNT2 and is negative for the markers: AGCl, AKRICI, ALDH lAl, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDN 11, COP1, CXADR, DI02, METTL7A, DKK2, EMIDI, TMEM 100, GAP43, GDF 10, GJB2, GSC, HOXA5, HSD 11B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, 1L1RI, INA, KCNMBI, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPl, MEOX I, MEOX2, MYBPH, MYH3, MYH 1 1, MYL4, IL32, NLGN4X, TAGLN3, NPPB, OSR2, PAX2, PAX9, PDEIA, PENK, PITX2, PRG4, PRRX1, PTGS2, PTPRN, RASD!, RELN, RGSl, SFRP2, SMOCl, SMOC2, SYTI2, TACI, RSP03, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F 10, Z1C1 and ZIC2.

The cell line X7SM007 is positive for the markers: ACTC, BEX1, CDII6, CRIPl, CRLF I, CRYAB, DLKl, EGR2, FOXF l , FOXF2, FST, HSPA6, IGF2, IGFBP5, INA, LAMC2, MMPl, MSXI, MSX2, TAGLN3, POSTN, PRRX2, PTGS2, PTPRN, RASD 1 , RELN, S 100A4, SNAP25, SOX11, SRCRB4D, TAC1, TFPI2 and RSP03 and is negative for the markers: AGCl, AKRICI, ALDH lAl, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C3, C6, C7, C20orfJ03, CCDC3, CDH3, CLDN 11, CNTNAP2, COL15A1, COL21A1, COP 1, CXADR, METTL7A, DKK2, DPT, EMIDI, FM03, GAP43, GDF5, GDF10, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPB3, HTRA3, 1D4, IFI27, IFIT3, KCNMB I, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MFAP5, MASPl, MEO I, MEOX2, MGP, MYBPH, MYH3, MYH1 1, MYL4, IL32, NLGN4X, NPPB, OGN, OLRI, OSR2, PAX2, PAX9, PDEIA, PENK, PITX2, PRELP, PRG4, PROM1, PRRX1, PTN, RGMA, RGS l, SFRP2, SLITRK6, SMOC2, SOD3, STMN2, SYTI2, TNNT2, TRH, TSLP, TUBB4, WISP2 and ZIC L

The group of cell lines ZI, Z6 and Z7 are positive for the markers: FST, GDF5, MMPl , MSXI , SRCRB4D, ZIC1 and ZIC2 and are negative for the markers: ACTC, AGCl, AKRICI, ALDH lA l, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CDH3, CLD 1 1 , CNTNAP2, CRLF I, DI02, METTL7A, DKK2, DLKI, DPT, EMTDl, FGFR3, TMEM100, FMOl, FM03, FOXF2, GABRB l, GJB2, GSC, H0XA5, USD 1 1B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KCNMB I, KIAA0644, KRT14, IGFL3, L0C92196, MFAP5, MASPl, MEOXi, MEOX2, MGP, MYBPH, MYH3, MYH1 1, NLGN4X, NPPB, OGN, OLRI , PAX2, PAX9, PDEIA, PENK, PITX2, PRG4, PROM 1 , RARRES I, RASDl, RELN, RGS l, SFRP2, SMOCl , SMOC2, SNAP25, STMN2, SYT12, TACI, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and W1SP2.

The cell line Zl 1 (also known as Z HRepl and Zl lRep2 atid ACTC I94) is positive for the markers: ATP8B4, CD24, DLK l, FOXFl, FST, HTRA3, IGF2, IGFBP5, 1L1RI, MSX1, NLGN4X, OSR2, PODN, PROM1, PRRX2, PTN, SOD3, SOX I I, SRCRB4D, STMN2 and TFPI2 and are negative for the markers: ACTC, AGCl, AKRICI, ALDH lA l , ANXA8, APCDD1, AREG, CFB, C6, C7, PRSS35, CCDC3, CDH3, CLDNI 1, CNTNAP2, COMP, CRIPl, CRLF I , DI02, DKK2, DPT, EMIDI, FMOl, FM03, GAP43, GDFIO, GJB2, GSC, IIOXAS, USD! IB2, HSPA6, HSPB3, IFI27, INA, KCNMBI, KIAA0644, KRTI4, KRTI7, KRT34, LAMC2, IGFL3, LOC92I96, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYHI 1, MYL4, IL32, NPPB, OLRI, PAX2, PITX2, RARRES I, RASDl, RGS l, SMOCl, SMOC2, SNAP25, TAC I, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZIC1 and ZIC2.

The cell line Z2 is positive for the markers: BEX1, CCDC3, EGR2, FOXFl, FOXF2, FST, GDF5, IISPB3, IGFBP5, INA, TMEM 1 19, ASP 1 , MMP 1 , MSX2, POSTN, PRELP, PRRX2, PTN, SRCRB4D, TFPI2 and TSLP and is negative for the markers: ACTC, AGCl, AKRICI, ALDH lA l, ANXA8, APCDD1, AQPI, AREG, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN I 1, CNTNAP2, COL21A1, DI02, DKK2, DLKl, DPT, FGFR3, TMEM 100, FMOl, FM03, GABRB l, GAP43, GDF10, GJB2, GSC, HOXA5, HSD 11B2, HSD17B2, HSPA6, ID4, IFI27, KCNMB I , KIAA0644, KRT14, KRT17, KRT3 , IGFL3, LOC92 I96, MFAP5, MEOXI, MEOX2, MYBPH, MYII3, MYHI 1, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDEI A, PENK, PITX2, PRG4, PROM1, RARRESI, RASD l, RGSl, SMOC l, SMOC2, SNAP25, STMN2, TAC I, RSP03, TNFSF7, TNNT2, TRH, TUBB4, WISP2, ZICi and ZIC2. The cell line MEL2 is positive for the markers: AKRIC I, AQP1, COL21A1, CRYAB, CXADR, DI02,

METTL7A, DKK2, DLK l, HSD 17B2, HSPB3, MGP, MMP1, SX2, PENK, PRRX1, PRRX2, S 100A4, SERPINA3, SFRP2, SNAP25, SOX1 1, TFPI2 and THY1 and is negative for the markers: ACTC, ALDH1A1, AREG, CFB, C3, C20orfl03, CD24, CDII3, CDH6, CNTNAP2, COL15A1, COMP, COP1, CRLFl, FGFR3, FMOI, FM03, FOXF2, FST, GABRB 1, GAP43, GDF5, GDFtO, GJB2, GSC, HOXA5, HSD 1 1B2, HSPA6, ICAM5, KCNMB l, KRTI , KRT17, KRT1 , KRT34, MASPl, MEOXl, MEOX2, MYBPH, MYH3, MYH 1 1, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PDE1A, PITX2, PRG4, PTN, PTPRN, RASD1 , RELN, RGS 1, SMOC 1, STMN2, TACl, TNFSF7, TRH, TUBB4, WISP2, ZIC1 and Z1C2.

The cell line C4ELSR10 is positive for the markers: AKRICI, ALDH1A1, ANXA8, AREG, CDH6, COP 1, DI02, METTL7A, EGR2, FOXF 1, HSD I7B2, IGFBP5, K1AA0644, KRT19, KRT34, OLR1, PITX2, S 100A4, STMN2 and TFPI2 and is negative for the markers: ACTC, AQP1, C7, C20orfl03, CD24, CDH3, CLDN 1 1, CNTNAP2, COMP, CRIPl, CRLFl, DKK2, DLKl, DPT, FGFR3, FMO I, GABRB l, GAP43, GDF iO, GJB2, GSC,

HSDI 1B2, HSPA6, HSPB3, ICAM5, ID4, KRT1 , KRT17, LA C2, MFAP5, MASPl, MEOXl, MEOX2, MGP, MMP1, MSX1, MYBPH, MYII3, MYH 1 1, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PENK, PRELP, PRG4, PRRX1, PRRX2, PTN, RELN, RGS 1, SERPINA3, SFRP2, SMOC1, SNAP25, SOX1 1 , TAC1, TNNT2, TUBB4, W1SP2, ZIC1 and ZIC2.

The cell line Z3 is positive for the markers: BEXl, CDH6, COL21A1, CXADR, EGR2, FOXF1 , FST, HSD17B2, LAMC2 _; MMP 1, MSX 1 , MSX2, SERPINA3, ZFCl and Z1C2 and is negative for the markers: ACTC, ALD1I1A1, AQP 1, ATP8B4, CFB, C3, C7, C20orn03, CDH3, CLDN1 , CNTNAP2, COMP, CRIPl, CRLFl, DI02, ME TL7A, DKK2, DLKl, DPT, FGFR3, FMO I, FM03, GABRB l, GJB2, GSC, H0XA5, HSD ! 1B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB l , ΚΙΑΛ0644, KRT14, KRT17, MFAP5, MASPl, MEOXl, MEOX2, MGP, MX1, MYBPH, MYH 3, MYH1 1, NPAS1, OGN, OLR1, PAX2, PAX9, PDE1 A, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRES l, RASDl, RGS 1, S100A4, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TNFSF7,

TUBB4 and WISP2. .

The cell line SK15 is positive for the markers: AREG, BEXl, FOXF1, KRTI9, LAMC2, MSX 1, PITX2, S 100A4, SERP1NA3 and THY1 and is negative for the markers: AGC 1, ALDH 1A 1, AQP1, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CDH6, CLDN 1 1 , CNT AP2, COL15A1, COMP, CRTPl , CRLFl, DLKl, DPT, FMOI, FM03, GABRB l, GDF10, GJB2, GSC, HOXA5, HSD1 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IGF2, IGFBP5, KCNMB l, ΚΙΛΑ0644, KRT1 , KRT17, MFAP5, MASP l, MEOXl, MEOX2, MGP, MSX2, MX1, MYBPH, MYH3, MYH1 1, OGN, OLR 1 , PAX2, PAX9, PDEIA, PRG4, PROM1, PRRX2, PTN, RARRES1, RGS1, SFRP2, SMOC1, SNAP25, STMN2, TAC 1, TNNT2, TRH, TUBB4, WISP2, Z1C I and ZIC2.

The cell line \V8Rep2a is positive for the markers: AQP1, AREG, BEXl, CDH6, COL21A1, COP 1, DI02, METTL7A, DLKl, FMO I, FM03, FOXF1, FOXF2, MMP 1, MSX1, MSX2, PDEIA, PRRX2, SERPINA3, SNAP25, SOX 1 1, TFPI2 and ZIC2 and is negative for the markers: ALDH1A1, ATP8B4, C3, C7, C20orfl03, CD24, CLDN 1 1, CNTNAP2, COMP, CRIP l, CRLFl, CXADR, DKK2, DPT, EGR2, GAP43, GDF10, GJB2, GSC, HOXA5, HSDI IB2, HSD 17B2, HSPA6, HSPB3, ICAM5, ID4, 1F127, KCNMBl, KRT14, KRT17, KRT34, MFAP5, MASPl, MEOX l, MEOX2, MGP, MX1 , MYBPH, MYH3, MYH1 1, NPAS 1, NPPB, OLR1, PAX2, PAX9, P1TX2, PRG4, PROM 1, PRRX1, PTGS2, PTN, PTPRN, RGS1, SFRP2, STMN2, TAC1, THY 1, TNNT2, TRH, TUBB4 and ZIC 1.

The cell line E55 is positive for the markers: AKRICI, BEXl, CDI16, COL21A 1, DI02, DKK2, EGR2, GAP43, KRT1 , MSX2, PRRX1, S100A4, SOX 1 1, THY 1, TNNT2 and Z1C2 and is negative for the markers: ALDH 1A 1, AQP 1, AREG, ATP8B4, C3, C7, C20orfl03, CLDN1 1, CNTNAP2, COMP, CRLF l, CXADR, DLKl, DPT, FMO I, FM03, FOXF2, GABRB l, GDF10, GJB2, GSC, HOXAS, HSDI 1B2, HSD17B2, HSPA6, HSPB3, 1FI27, IGF2, KRT 14, KRT34, LAMC2, MFAP5, MASPl, MEOX l, MEOX2, MGP, MYBPH, MYH3, NPAS1, NPPB, OGN, OLRI, PAX2, PAX9, PDEIA, PENK, PITX2, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRES 1, RGS1, SFRP2, SMOC 1 , SNAP25, STMN2, TAC 1 , TRH, TUBB4, WISP2 and ZIC I,

The cell line T20 is positive for the markers: ACTC, AKRIC I, BEX l, CDH6, COL21A 1, CRYAB, DKK2, EGR2, GAP43, LAMC2, MMP l, MSX2, P1TX2, SOX 1 1 , THY 1 and Z1C2 and is negative for the markers: ALDH 1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CD113, CLDN 1 1, CNTNAP2, COMP, CRLF l, METTL7A, DPT, FMOI, FM03, FOXF2, GDFiO, GJB2, GSC, HOXAS, HSDI 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, KIAA0644, KRT14, MASP l, MEOX2, MGP, MX 1, MYBPH, MYH3, TAGLN3, NPAS1, NPPB, OGN, OLRI, PAX2, PDEIA, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRES l, RASD l, RGS1, SFRP2, SMOC 1, SNAP25, STMN2, TAC I , TFPI2, TNFSF7, TRH, TUBB4, WISP2 and, ZIC1. The cell line X4D20.8 is positive for the markers: BEX1, CDH6, CNTNAP2, COL21A1, CRIP 1, CRYAB, DI02, DKK2, GAP43, ID4, LAMC2, MMPl, MSX2, S100A4, SOXI 1 and THY 1 and is negative for the markers; AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN11, COP1, CRLF1, DLK1, DPT, FMOl, FM03, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, KRT14, KRT17, RT34, MASPl, MEOX2, MSX1, MXl, MYBPH, MYH3, MYHH, TAGLN3, NPASl, NPPB, OGN, OLRI, PAX2, PDEIA, PRG4, PROM1, PTN, PTPRN, RARRESl, RGS1, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2, ZIC1 and ZIC2.

The cell line X4D20.3 is positive for the markers: ACTC, A RIC1, AQP1, BEX1, CDH6, COL21A 1, CRYAB, D K2, DLK1, GJB2, HSD17B2, KRT17, LAMC2, MYL4, ΡΓΓΧ2, S100A4, SOX11, THY1, TNNT2, ZIC1 and ZIC2 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN1I, CNTNAP2, COMP, COP1, CRLFl, METTL7A, DPT, FGFR3, FMOl, FM03, FOXF1, GABRBI, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ICAM5, 1D4, 1FI27, IGF2, IGFBP5, IAA0644, KRT14, KRT34, MASPl, MEOX2, MGP, MSX2, MXl, MYBPH, MYH3, MYHI 1, NPASl, OGN, OLRI, PAX9, PDEIA, PENK, PRG4, PROM1, PRRX2, PTN, RARRESl, RGS1, SFRP2, SNAP25, STMN2, TAC1, TRH, TUBB4 and WISP2.

The cell line E132 is positive for the markers: ACTC, A R1C1, AQP1, CD24, CDH6, COL21A1, CRYAB, D 2, RT19, TAGLN3, RELN, S100A4, SFRP2, SO I 1, THY 1 and ZIC2 and is negative for the markers: AGCI, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CLDN11, CNTNAP2, COL15A1, COMP, COP1, CRLFl, D102, METTL7A, DLK1, DPT, FMOl, FM03, FOXF1, FOXF2, FST, GABRBI, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSDI7B2, HSPA6, HSPB3, ID4, IFI27, 1GF2, K.CNMB1, RT14, MFAP5, MASPl, MEOX2, MGP, MYBPH, MYH3, MYHI 1, NPASl, NPPB, OGN, OLRI, PDEIA, PRG4, PROM1, PRRX2, PTGS2, PTN, PTPRN, RARRESl, RASD1, RGS1, SERPINA3, SMOC1, SNAP25, STMN2, TAC1, TRH,

TUBB4, WISP2 and ZIC1.

The cell line MI3 is positive for the markers: ACTC, ANX A8, BEX I , CDH6, COL 15 A I , EGR2, GDF 10, G JB2, RT19, LAMC2, MYL4, TAGLN3, S100A4, SFRP2, SOXI 1, THY1, ZIC1 and ZIC2 and is negative for the markers: ALDHiAl, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD1J3, CLDN11, CNTNAP2, COMP, COP1, CRLFl, DI02, DLK1, DPT, FGFR3, FMOl, FM03, FOXF1, GABRBI, GAP43, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, 1GF2, KIAA0644, KRT14, MFAP5, MEOX2, MGP, MMPl, MSX2, MYBPH, MYH3, NPAS 1, OGN, OLRI, PDEIA, PRELP, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRESl, RASDl, RELN, RGS1, SMOC1, SNAP25, STMN2, TAC1, TRH, TUBB4 and WISP2.

The cell line M10 is positive for the markers: ACTC, BEXi, CDH6, COL21A1, DI02, D K2, EGR2, IGFBP5, PRRX1, S100A4, SFRP2, THY1 and Z1C2 and is negative for the markers: A R1C1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orfi03, CD24, CDH3, CLDN11, CNTNAP2, COMP, COPl, CRLFl, CXADR, METTL7A, DPT, FMOl, FM03, FOXF1, GABRBI, GJB2, GSC, HOXA5, HSD11B2, IISD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, K1AA0644, RT14, MEOX1, MEOX2, MGP, MYBPH, MYH3, MYHI 1, TAGLN3, NPASl, OGN, OLRI, PAX2, PAX9, PDEIA, PITX2, PRG4, PROM1, PRRX2, PTN, PTPRN, RELN, RGS1, SERPINA3, SMOC1, SNAP25, STMN2, TAC1, TNFSF7, TNNT2, TRH, TUBB4, W1SP2 and ZICI.

The cell line E109 is positive for the markers: ACTC, AKR1C1, BEXI, CDH6, COL15AI, COL21A1, CRFP1, CRYAB, DI02, DKK2, GAP43, GDF5, ID4, KRT14, RTI9, KRT34, MFAP5, MEOX2, MGP, MMPl, MYHI 1, S100A4, TFPF2, THY1 and ZICI and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, C3, C7, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRLFl, CXADR, METTL7A, DLK1, DPT, FMOl, FM03, FOXF1, FOXF2, GDF 10, GJB2, GSC, HSD11B2, HSD17B2, HSPA6, ICAM5, IGF2, KIAA0644, MASPl, MEOX1, MYBPH, MYH3, TAGLN3, NPASl, NPPB, OGN, PAX2, PAX9, PD IA, ΡΪΤΧ2, PRG4, PROM1, PRRX2, PTN, RARRESl, RASDl, RGS1, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TRH, TUBB4 and WISP2.

The cell line E34 is positive for the markers: ACTC, AGCI, AQP1, CDH6, COL15AI, COL21A1, CRYAB, D 2, GAP43, RT14, RT17, KRT19, RT34, MFAP5, MEOX1, MEOX2, MGP, MYHI 1, TAGLN3, S100A4, THY1, TNNT2, ZICI and ZIC2 and is negative for the markers: ALDH1A1, AREG, ATP8B4, C3, C7, C20oriT03, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLFl, CXADR, DI02, METTL7A, DPT, FMOl, FM03, FOXF1, FOXF2, FST, GABRBI, GDF 10, GJB2, GSC, HOXA5, I1SD11B2, HSPA6, IFI27, IGF2, KIAA0644, LAMC2, MASPl, MSX2, MXl, MYBPH, MYH3, NPASl, OLRI, PAX9, PDEIA, PRG4, PROM1, PRRX2, PTN, RARRESl, RASDl, RGS1, SERPINA3, SFRP2, SMOCI, SNAP25, STMN2, TACI, TFPI2, TRH, TUBB4 and WISP2. The cell line E122 is positive for the markers: ACTC, AGC1, AKR1C1, BEX1, CDH6, COL21A1, CRIP1, CRYAB, DI02, DKK2, GAP43, ID4, RT19, MFAP5, ΜΥΗί 1, MYL4, OGN, PRRXl, PTGS2, S100A4, SOX11 and THYl and is negative for the markers: ALDH1A I, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COP1, CRLF!, METTL7A, DLK1, DPT, FMOl, FM03, FOXF2, GABRBl, GDFIO, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, HSPB3, ICAMS, IFI27, 1GF2, IAA0644, RT14, KRTI7, RT34, LAMC2, MASP1, MEOX1, MEOX2, MYBPH, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRG4, PROM1, RARRESl, RASD1, RGS1, SERPINA3, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TUBB4, WISP2 and ZIC2.

The cell line E65 is positive for the markers: ACTC, A R1C1, AQPl, BEX1, CD24, CDH6, COL21A1, CRYAB, D K2, GAP43, KRT17, KRT19, RT34, TAGLN3, RELN, S100A4, SFRP2, SOX11, THYl and ZIC2 and is negative for the markers: AGC1, ALDH1A1, ATP8B , CFB, C3, C7, C20orfl03, CDH3, CLDNi 1, CNTNAP2, COMP, COP1, CR1P1, CRLF1, CXADR, METTL7A, DLK1, DPT, FMOl, FM03, FOXF2, FST, GABRBl, GDFIO, GJB2, GSC, IIOXA5, HSDl 1B2, HSD17B2, IISPA6, HSPB3, ICAMS, IFI27, IGF2, IAA0644, RT14, MFAP5, MASP1, MEOX2, MGP, MYBPH, MYH3, NPAS1, OGN, OLR1, PAX9, PDE1A, PITX2, PRG4, PROM1, PRRX2, PTGS2, PTN, RARRESl, RASD1, RGS1, SMOC1, SNAP25, STMN2, TAC1, TRH, TUBB4, W1SP2 and ZIC1.

The cell line E76 is positive for the markers: ACTC, BE 1, COL21A1, CRIPl, CRYAB, DI02, DKK2, EGR2, GAP43, KRT17, RT19, MMPI, MSX2, PTGS2, S100A4 and THYl and is negative for the markers; ALDHI A 1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDNI 1, CNTNAP2, COPI, CRLF1, METfL7A, DPT, FMOl, FM03, FOXF1, GABRBl, GDFIO, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, ICAMS, IFI27, IGF2, KRT14, MEOX2, MGP, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRESl, RGS1, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TPPI2, TNNT2, TRH, TUBB4, 1SP2 and ZiCl.

The cell line E108 is positive for the markers: ACTC, BEX1, CDH6, COL21A1, CRIPl, CRYAB, DI02, DKK2, IGFBP5, RT17, KRT19, MYH11, S100A4, SOX11, THYl and ZIC2 and is negative for the markers:

ALDHI Al, AQPl, AREG, ΛΤΡ8Β4, CFB, C3, C7, C20orfl03, CD24, CDH3, CLDNI 1, CNTNAP2, COMP, COPI, CRLF1, CXADR, METTL7A, DLK1, DPT, FMOl, FM03, FOXF1, FOXF2, GABRBl, GDFIO, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, HSPA6, ICAMS, IFI27, IGF2, KRT14, KRT34, MASP1, MEOX1, MEOX2, MGP, MYBPH, MYII3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PRG4, PROM1, PTN, PTPRN, RARRESl, RASD1, RGS1, SERPINA3, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TFPI2, TNNT2, TRH, TUBB4 and WISP2.

The cell tine E85 is positive for the markers: ACTC, BEX1, CDH6, COL21A1, CRYAB, DI02, DK 2, EGR2, FGFR3, ID4, RT17, KRT19, MFAP5, MGP, MMPI, MYH11, PRELP, S100A4, SOX11, THYl, TNNT2, ZIC1 and ZIC2 and is negative for the markers: ALDHlAl, AQPl, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CNTNAP2, COMP, COPI, CRLF1, METTL7A, DPT, FMOl, FM03, GABRBl, GDF5, GDFIO, GJB2, GSC, IIOXA5, HSDl 1B2, HSD17B2, HSPA6, ICAM5, IFI27, IGF2, KRT14, MASP1, MEOX1, ME0X2, MYBPH, MYH3, NPAS1, OGN, OLR1, PAX9, PDE1A, PITX2, PRG4, PROM1, PRRX2, PTN, RARRESl, RASD1, RGS1, SFRP2, SMOC1, STMN2, TAC1, TFPI2, TRH, TUBB4 and WISP2.

The cell lineMl 1 is positive for the markers: BEX1, CDH6, COL21A1, CRYAB, D K2, GAP43, ID4, MMPI, MYII11, SOX11, THY! and ZIC1 and is negative for the markers: AGC1, ALDHlAl, AREG, ATP8B4, C3, C7, C20orfl03, CD24, CDH3, CLDNI 1, CNTNAP2, COMP, COPI, CRLF1, CXADR, METTL7A, DLK1, DPT, FMOl, FM03, FOXF2, FST, GABRBl, GDFIO, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAMS, IGF2, IGFBP5, KCNMB1, KIAA0644, KRT14, MASP1, MEOXI, MEOX2, MSX2, MX1, MYBPH, MYH3, TAGLN3, NPAS1, OL 1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PRO 1, PRRX2, PTN, PTPRN, RARRESl, RELN, RGSI, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TFPI2, TNFSF7, TNNT2, TRH, TUBB4, WISP2 and ZIC2.

The cell line E8 is positive for the markers: ACTC, BEX1, CDH6, COL21 Al, CRIPl, CRYAB, DI02, DK 2, ID4, CNMB1, KRT14, KRT17, RT19, KRT34, MFAP5, MGP, MYH11, PTGS2, S100A4, SOX11 and THYl and is negative for the markers: ALDH 1 A 1, AREG, ATP8B4, C3, C7, C20orfl03, CDH3, CNTOAP2, COMP, COPI, CXADR, METTL7A, DPT, FMOl, FM03, FOXF1, FOXF2, GABRBl, GDFIO, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, IGF2, IGFBP5, KIAA0644, LAMC2, MASPI, MEOXI, MSX2, MX1, MYBPH, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRELP, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRESl, RASDl, RGSI, SFRP2, SMOC1, SNAP25, STMN2, TAC1, TFPI2, TNFSF7, TRH, WISP2, ZICI and ZIC2. The cell line E80 is positive for the markers: ACTC, BEX1, CDH6, COL21A1, CRYAB, DKK2, 1D4, KRT19, MMP1, MYHl 1, TAGLN3, SOX11 and THY1 and is negative for the markers: ALDH1A1, AQPi, A REG, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CLDN11, CNTNAP2, COMP, CR1P1, CRLF1, METTL7A, DLK1, DPT, FMOl, FM03, FOXFl, FOXF2, GABRB1, GDF10, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, IFI27, IGF2, IAA0644, RT14, RT34, MASPI, MEOX2, MGP, MYBPH, MYH3, NPASl, OGN, OLR1, PAX9, PDEIA, PRELP, PRG4, PROM 1 , PRRX2, PTN, RARRES 1, RASD1, RGS1, SERP1N A3 , SMOC 1 , SNAP25, STMN2, TAC1, TNNT2, TRH, WISP2, ZIC1 and ZIC2.

The ceil line RA.D20.24 is positive for the markers: ACTC, BEX1, CRYAB, CXADR, DKK2, FOXFl, GAP43, HOXA5, IGFBP5, RTI9, LAMC2, MFAP5, MMP1, MSX1, MYL4, PITX2, PTGS2, RELN, THY1 and TNNT2 and is negative for the markers: AGC1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C7, C20orfl03, CDH3, CNTNAP2, COL15A1, COMP, COP1, CRLFI, DLK1, DPT, FGFR3, FMOl, FM03, FOXF2, GDF10, GJB2, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, CNMBI, RT14, MASPI, MEOXl, MEOX2, MGP, MSX2, MXl, MYBPH, MYH3, MYHl 1, NPASl, OGN, PAX2, PAX9, PDEIA, PRG4, PROMl, PRRX2, PTN, PTPRN, RARRES 1, RGS1, SFRP2, SMOC1, SNAP25, STMN2,TAC1, TUBB4, WISP2, ZIC1 and ZIC2.

The cell line RA.D20.6 is positive for the markets: ACTC, CRYAB, CXADR, DKK2, FOX]' 1, GAP43, HOXA5, IGFBP5, KRT19, LAMC2, MFAP5, MMP1, MSX1, P1TX2, PTGS2, SOX! 1 and THY1 and is negative for the markers: ALDH A1, ATP8B4, CFB, C3, C7, C20orfl03, CDH3, CNTNAP2, COL15A1, COMP, CO 1, CRLFI, DI02, DLK1, DPT, FMOl, FM03, FOXF2, GDFiO, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, 1GF2, RT14, MASPI, MEOXl, ME0X2, MGP, MSX2, MXl, MYBPH, MYH3, MYHl 1, NPASl, OGN, PAX2,; PAX9, PDEIA, PRG4, PROMl, PRRX2, PTN, PTPRN, RARRES J , RGS1, SERP1NA3, SFRP2, SMOC1, STMN2, TAC1, TRH, TUBB4, W1SP2, Z1C1 and ZIC2.

The cell fine RA.SMO10 is positive for the markers: ALDI11A1, BEX1, C3, CDH3, COL21 Al, CXADR, METTL7A, EGR2, FM03, FOXFl, HOXA5, KIAA0644, MGP, RARRES 1, SOX11 and STMN2 and is negative for the markers: ACTC, AGC1, ANXA8, AQP1, CFB, C7, C20orfl03, CD24, CDH6, CNTNAP2, COL15A1, COMP, COP1, CRIPl, CRLFI, DPT, FOXF2, GAP43, GDF10, GSC, HSD1 IB2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, FFI27, KRT14, KRT17, KRT34, MASPI, MEOXl, MEOX2, MMPI, MSX2, MYBPH, MYH3, MYHl 1, TAGLN3, NPASl, NPPB, OGN, PAX2, PAX9, PDEIA, P1TX2, PRELP, PRG4, PROMl, PRRX2, PTN, PTPRN, RGS1, S100A4, SERPINA3, SFRP2, SMOC1, TAC1, TFP12, THY1, TNFSF7, TRH, TUBB4, WISP2, ZIC1 and ZIC2.

The cell line RA.SM014 is positive for the markers: ACTC, BEX1, CD24, CXADR, FOXFl, GDF5, GJB2, HO A5, IGFBP5, KRT19, LAMC2, MFAP5, MMPI, RELN, SOX11 and STMN2 and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C7, CDH6, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, COPI, CRIPl, CRLFI, DI02, DL 1, DPT, FGFR3, FMOl, FM03, FOXF2, GABRBl, GDF10, GSC, HSD11B2, IISD17B2, 11SPA6, 11SPB3, ICAM5, ID4, IF127, 1GF2, KCNMBI, KRT14, KRT17, KRT34, MASPI, MEOXl, MEOX2, MGP, MSX2, MYBPH, MYH3, MYHl I, NPASl, NPPB, OGN, PAX2, PAX9, PDEIA, PITX2, PRELP, PRG4, PROMl, PRRX1, PRRX2, PTN, PTPRN, RGS1, SERPINA3, SFRP2, SMOCi, TAC1, TNFSF7, TUBB4, WISP2,ZIC1 andZIC2.

The cell line RA.PEND18 is positive for the markers: C3, CDH3, COL21 Al, METTL7A, DLK1, EGR2, FOXFl, GABRBl, HOXA5, IGF2, KIAA0644, KRT19, MSX1, P1TX2, PROMl, PTGS2, SNAP25 and SOXI 1 and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, BEX1, CFB, C20orfl03, CDH6, CNTNAP2, COL15A1, COMP, CRIP!, CRLFI, CXADR, DPT, FMOl, FOXF2, GAP43, GDF10, GSC, HSD11B2,

HSD17B2, HSPA6, HSPB3, ICAM5, 1D4, IFI27, KCNMBI, KRT14, KRT34, MFAP5, MASPI, MEOXl, MEOX2, MGP, MMPI, MSX2, MYBPH, MYH3, MYHl 1, TAGLN3, NPASl, NPPB, PAX2, PAX9, PENK, PRELP, PRG4, PRRX2, PTN, PTPRN, RARRES 1, RELN, RGS1, SFRP2, SMOCI, STMN2 ₃ TAC1, TNFSF7, TRH, TUBB4, WISP2, ZIC1 and ZIC2.

The cell line RA.PEND10 is positive for the markers: AREG, C3, CDH3, CDH6, COL21A1, METTL7A, DLK1, EGR2, FOXFl, FST, GDF5, HOXA5, IGF2, IGFBP5, KRT19, PDEIA, PITX2, RELN and SOXI 1 and is negative for the markers: ACTC, AGC1, ALDH1AI, ATP8B4, CFB, C7, C20orfl03, CLDNI1, CNTNAP2, COL15A1, COMP, CRIPl, CRLFI, CRYAB, DPT, FOXF2, GAP43, GDF10, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMBI, KRT14, KRT17, KRT34, MASPI, MEOXl, MEOX2, MMPI, MSX2, MYBPH, MYII3, MYHll, TAGLN3, NPASl, NPPB, OGN, PAX2, PAX9, PRELP, PRG4, PROMl, PRRX1, PRRX2, PTN, PTPRN, RGS1..S100A4, SERP1NA3, SFRP2, SMOCI, STMN2, TAC1, TI1Y1, TNFSF7, TRH, TUBB4, WISP2, ZIC1 and ZIC2. The cell line RA.SKEL2 i is positive for the markers: A REG, BEXI, C3, CD24, COL21A1, COP1, METTL7A, FOXF l, KRT19, MSXl, PITX2, SERPINA3, SOX11 and THY I and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C7, C20orfl03, CDH6, CLDN1 1, CNTNAP2, COL 15A1, COMP, CRiPl , CRLF l, DKK2, DPT, FGFR3, FMOl, FM03, FOXF2, GAP43, GDF10, GSC, HSDl 1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMB l, KRT14, KRT17, KRT34, MASPl, MEOX1, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, TAGLN3, NPAS 1, NPPB, OGN, OLR1, PAX2, PAX9, PDEIA, PENK, PRELP, PRG4, PRRX2, PTGS2, PTN, PTPRN, RAR ES l, RASDl, RELN, RGS i, SFRP2, SMOC1, ST N2, TAC1, TNFSF7, TRH, TUBB4 and ZIC2.

The cell line RA.SKEL! 8Rep2a is positive for the markers: AREG, C3, CD24, CDH3, COL21A 1, METTL7A, DPT, GJB2, SERPttJA3, SNAP25 and SOX11 and is negative for the markers: ALDH1A1, ATP8B4, CFB, C7, C20orfl03, CDH6, CLDNl i, CNTNAP2, COMP, COPI, CRJP1, DI02, DKK2, DLKl, FGFR3, FMOl, FM03, GDF10, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBl, KRT14, KRT17, KRT19, KRT34, MASPl, MEOX1, MEOX2, MGP, MMPI, MSX2, MYBPH, ΜΥΉ3, MYH1 1, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PRELP, PRG4, PROM1, PRRX1, PRRX2, PTGS2, PTN, PTPRN, RARRES l, RELN, RGSI, SFRP2, SMOC1, STMN2, TAC 1, THY1 , TNFSF7, TNNT2, TRH, WISP2, ZIC1 and ZIC2.

The cell line C4.4 is positive for the markers: AKR1C1, BEXI, CDH6, COPI, DI02, METTL7A, DKK2, DPT, EGR2, FOXFl, FST, KIAA0644, MMPI, MSXl, RELN, S 100A4, TAC1 and THY 1 and is negative for the markers: AGC 1 , ALDH 1A 1, ΑΝΧΛ8, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, COL21A 1, COMP, CR1P1, CRLF l , CXADR, FGFR3, FMO l, GAP43, GDF 10, G.IB2, GSC, HOXA5, HSD 1 1B2, HSD17B2, HSPA6, HSPB3, 1CAM5, ID4, IFI27, IGF2, KCNMB l, KRTH, KRT17, KRT19, KRT34, LAMC2, MFAP5, MASP l, MEOXl, MEOX2, MGP, MYBPH, MYH3, MYH 11 , TAGLN3, NPAS 1, NPPB, OGN, PAX2, PAX9, PDEIA, PENK, P1TX2, PRG4, PROM 1, PTGS2, PTN, PTPRN, RARRES l, RASD l, RGSI, SERPINA3, SFRP2, SMOC1 , SNAP25, STMN2, TNFSF7, TNNT2, TRH, TUBB4, ZIC1 and Z1C2,

The cell line W7 is positive for the markers: AREG, C3, COL15A1, COL21A1, COP I, CXADR, DI02, DLKl, EGR2, FMOl, FOXFl, GDF5, HOXA5, KIAA0644, ME'ITL7A, P1TX2, PROM1, S 100A4, SERP1NA3 and SOX11 and is negative for the markers: AGC 1, ALDH1AI, AQP1, ATP8B4, C20orfl03, C7, CD24, CDH3, CDH6, CFB, CLDN1 1, CNTNAP2, COMP, CRIPl, DKK2, DPT, FM03, GABRB 1, GAP43, GDF10, GSC, HSD11B2, HSD17B2, HSPA6, ICAMS, ID4, 1FI27, KCNMB l, KRTH, KRT17, KRTI9, KRT34, MASPl, MEOXl, ME0X2, MGP, MMPI, MYBPH, MYTH 1, MYH3, NPAS 1, NPPB, OGN, PAX2, PAX9, PRG4, PRRX2, PTN, PTPRN, RARRES l, RASD l , RELN, RGS I , SFRP2, SMOC1, STMN2, TAC1, TNFSF7, TRH, TUBB4, ZIC1 and ZIC2.

The cell line X4SKEL20 is positive for the markers: AREG, BEXI, C3, C7, COP I , CXADR, FOXFl, FST, KRT19, METTL7A, MGP, MSXl, PITX2, SERP1NA3 and TFPI2 and is negative for the markers: ALDH 1A 1 , AQPI, ATP8B4, C20orfI 03, CD24, CDH3, CDH6, CFB, CLDN1 1, CNTNAP2, COL I5A 1, COMP, DKK2, DL l, DPT, EGR2, FGFR3, FMOl, FOXF2, GABRB 1, GAP43, GDF10, GDF5, GJB2, GSC, HOXA5, HSD l 1B2, HSDI7B2, HSPA6, HSPB3, ICAM5, 1D4, IF127, IGF2, IGFBP5, KCNMB l, KRTH, KRT34, MASPl, MEOXl, MEOX2, MFAP5, MMPI, MSX2, MX1, MYBPH, MYH 11, MYH3, NPAS 1, NPPB, OGN, OLRI, PAX2, PENK, PRG4, PROM1, PRRX1, PRRX2, PTN, PTPRN, RARRESl, RELN, RGSI, SFRP2, SMOC 1, SOX 1 1, STMN2, TAC1, TAGLN3, THY 1, TNFSF7, TNNT2, TRI-l, W1SP2, Z1C 1 and ZIC2.

The cell line C4ELSR6 is positive for the markers: ACTC, BEXI, C7, CDH6, COL21A1, DI02, METTL7A, DKK2, FOXF l , FOXF2, LAMC2, PITX2, PRRX1, S100A4, SFRP2, SNAP25, SOXl 1, TAC1 and TFPI2 and is negative for the markers: AGCI, ALDH1A1, AREG, ATP8B4, CFB, C3, C20orfl03, CD24, CLDNl 1,

CNTNAP2, COMP, CRiPl , CRLFl, CRYAB, DLKl, DPT, FGFR3, FM03, GAP43, GDF5, GDFIO, GJB2, GSC, HOXA5, HSDl 1B2, HSD17B2, 11SPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB l, KRTH, KRT17, KRT34, MFAP5, MASP l, MEOXl, MEOX2, MGP, MMPI, MYBPH, MYH3, MYH! 1, NPAS 1, NPPB, PAX2, PAX9, PENK, PRG4, PTN, PTPRN, RARRESl, RASDl, RGS I, SMOC 1, STMN2, TNFSF7, TRH, TUBB4, W1SP2 and ZIC1.

The cell line J2 is positive for the markers: ACTC, AKR1C 1, BEXI, CDI-I6, COL15A1, COL21A1, D102, METTL7A, DKK2, DLKl, FOXFl, K1AA0644, MGP, PDEIA, PRRX1, SFRP2, SNAP25, TNNT2 and ZIC2 and is negative for the markers: AGCI, ALDH1A I, ATP8B4, CFB, C3, C20orfl03, CD24, CNTNAP2, COMP, CRIPl, CRLFl, DPT, FGFR3, GABRB 1, GDFIO, GSC, HOXA5, HSD l IB2, HSD17B2, HSPA6, ICAM5, 1D4, 1FI27, KCNMB l, KRTH, KRT17, KRT1 , KRT34, LAMC2, MFAP5, MASPl, MEOX l , MMPI, MSX l , MYBPH, MYH3, MYH1 1, NPASI, NPPB, OGN, OLRI, PAX2, PAX9, PENK, PROM1, PRRX2, PTN, PTPRN, RARRESl, RGSI, SMOC 1, STMN2, TAC 1, TNFSF7, TRH and TUBB4. The cell line F15 is positive for the markers: BEX1, CDH6, COL15A1, COL21A1, DKK2, DL 1, FOXFl, FST, GDF5, KRT19, MGP, MMPl, PRRX1, SERPINA3, SNAP25, SOX11, ZIC1 and ZIC2 and is negative for the markers: ACTC, AGC1, ALDH1A1, AQPl, AREG, ATP8B4, CFB, C3, C7, C20orn03, CD24, CDH3,

CNTNAP2, COMP, CRLFI, DI02, DPT, FGFR3, FMOl, FM03, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBI, KIAA0644, KRT14, KRT17, MASP1, MEOXl, MEOX2, MYBPH, MYH3, MYHl 1, NPAS1, NPPB, OGN, OLR1, PAX2, PDE1A, PE K, PITX2, PRG4, PROM1, PRRX2, PTN, PTPRN, RGSI, SFRP2, SMOC1, STMN2, TFPI2, TNNT2, TRH and TUBB4.

The cell line X4SKEL4 is positive for the markers: ANXA8, AREG, BEX1, C3, COL21A1, COP1, CXADR, METTL7A, EGR2, FOXFl, FST, KRT19, LAMC2, MYL4, PITX2 and SERPINA3 and is negative for the markers: ALDHIAI, AQPl, ATP8B4, CFB, C7, C20orfl03, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, CRLFI, DKK2, DL 1, DPT, FGFR3, FM03, FOXF2, GABRBi, GAP43, GDF5, GDFIO, GJB2, GSC, IIOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, 1GF2, IGFBP5, K1AA0644, RT14, R 17, RT34, MASP1, MEOXl, MEOX2, MGP, MMPl, MSX2, MXl, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRES1, RASD1, RGS1, SFRP2, SMOC1, SOXI 1, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2 and ZIC1.

The ceil tine X4SKEL19 is positive for the markers: AREG, COL21A1, COP1, DI02, METTL7A, EGR2, FOXFl, FST, KIAA0644, KRT19, MGP, PDE1A, PITX2, SERPINA3 and TFPI2 and is negative for the markers: ACTC, AGC1, ALDHIAI, AQ l, ATP8B4, CFB, C20oifI03, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, CRIPi, CRLFI, CXADR, DKK2, DLK1, DPT, FGFR3, FMOl, FOXF2, GABRBI, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID 4, IFI27, IGF2, KCNMB1, KRT14, KRTI7, RT34, MFAP5, MASP1, MEO l, MEOX2, MMPl, MSX2, M l, MYBPH, MYH3, MYHl 1, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PRELP, PRG4, PRRX2, PTN, PTPRN, RELN, SFRP2, SMOC1, SOX11, STMN2,TAC1, THY1, TRH, W1SP2, ZIC1 atidZlC2,

The cell line X4SKEL8 is positive for the markers: AREG, BEX1, COL21A1, DI02, METTL7A, DKK2, EGR2, FM03, FOXFl, FST, MYL4, P1TX2, PTGS2, S100A4 and SERPINA3 and is negative for the markers:

ALDHIAI, AQPl, ATP8B , CFB, C3, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPl, CRLFI, DLK1, DPT, FGFR3, FOXF2, GABRBI, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 iB2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KRT14, KRT17, KRT34, MFAP5, MASPi, MEOXl, MEOX2, MGP, MMPl, MSX2, MXl, MYBPH, MYH3, MYHl 1, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PRRX1, PRRX2, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SMOC1, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZIC1 and ZIC2.

The cell line RA.PEND17Bio2a is positive for the markers: AREG, BEX1, CDH6, COL15A1, COL21A1, COP1, METTL7A, DPT, EGR2, FOXFl, FST, GJB2, LAMC2, MSX2, PTGS2, SERP1NA3 and SFRP2 and is negative for the markers: ACTC, ALDHIAI, AQPl, ATP8B4, CFB, C20orfI03, CD24, CDH3, CNTNAP2, COMP, CRIPl, CXADR, FGFR3, FMOl, GABRBI, GAP43, GDF10, GSC, IIOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, 1D4, IFI27, IGF2, KCNMB1, KRT14, K T17, KRT34, MFAP5, MASPI, MEOXl, MEOX2, MGP, MMPl, MXl, MYBPH, MYH3, MYHl 1, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRELP, PRG4, PROM1, PRRX2, PTN, PTPRN, RELN, RGS1, SMOC1, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZIC1 and ZIC2.

The cell tine W9 is positive for the markers: AKR1C1, C7, CDH6, COL21A1, METTL7A, DL 1, EGR2, FOXFl, GDF5, GJB2, HOXA5, IGFBP5, KIAA0644, KRTI , MGP, OGN, PITX2, SERPINA3, SOXI 1, TFPI2 and ZIC2 and is negative for the markers: AGC1, ALDHIAI, AQPl, CFB, C3, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COMP, CRIPl, CRLFI, CRYAB, DKK2, FGFR3, FMOl, FM03, FOXF2, GDF10, GSC, IISD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBI, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXl, MEOX2, MSX2, MXl, MYBPH, MYH3, MYHI1, NPAS1, NPPB, OLRl, PAX2, PAX9, PDE1A, PENK, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRESI, RASD1, RGSI, SFRP2, SNAP25, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4 and ZIC1.

The cell line MW4 is positive for the markers: AKR1CI, AREG, BEX1, C7, COL15A1, COL21A1, DI02, METTL7A, DKK2, EGR2, FM03, FOXFl, FOXF2, PITX2, PRELP, SERPINA3, SFRP2 and TFPI2 and is negaiive for the markers: ALDIllAl, AQPI, ATP8B4, CFB, C3, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, CRIPl, CXADR, DLK1, GABRBI, GDF5, GDF10, GJB2, GSC, HOXA5, HSD1 IB2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMBI, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPI, MEOX 1, MEOX2, MGP, MMPl, MSX1, MXl, MYBPH, MYII3, MYHl I, NPASI, NPPB, OLRI, PAX2, PAX9, PDE1A, PENK, PRG4, PROM I, PRRX1, PTN, PTPRN, RARRESI, RELN, RGSI, SMOC1, STMN2, TAC1, TNNT2, TUBB4, ZIC1 andZIC2, . The cell line SK58 is positive for the markers: AKR1C1, AREG, BEXi, C7, COL15A1, COL21A 1 , METTL7A, EGR2, FMOl, FOXF1, PTGS2, SERPINA3, SFRP2, TAC1 and TFP12 and is negative for the markers; ACTC, AGC1, ALDH1A1, AQPl, ATP8B4, CFB, C3, C20orfl03, CD24, CDII3, CDII6, CLDN11, CNTNAP2, COP1, CRIPl, Di02, DLK l, DPT, GABRB 1, GDF5, GDF10, GSC, HOXA5, HSD1 1B2, I1SD 17B2, HSPB3, ID4, IFI27, IGF2, KCNMB l, KRT14, KRT17, KRT19, KRT34, MFAP5, MASP1, MEOX 1, MEOX2, MMP1, MSX2, MX1, MYBPH, MYH3, ΜΎΗ1 1, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRG4, PROM1, PRRX2, PTN, PTPRN, RARRESl, RELN, RGS 1, SMOC 1, STMN2, TNNT2, TRH, TUBB4, ZIC 1 and ZIC2, .

The cell line SK25 is positive for the markers: BEXl, COL21A 1, METTL7A, FMO 1, FOXF1, LA C2, SERP1NA3, SFRP2 and WISP2 and is negative for the markers: ACTC, ALDH1A1, ANXA8, AQPl, ATP8B4, CFB, C3, C20orfI03, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CR1PI, CRLF 1, CXADR, DI02, DKK2, DPT, EGR2, FGFR3, GABRB 1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD1 1 B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB l, ΚΪΑΑ0644, KRT14, KRT17, KRT34, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, MYH 11, NPAS1 , NPPB, OGN, OLR 1, PAX2, PAX9, PDE1A, PITX2, PRELP, PRG4, PROM1, PTN, RARRES l, RASDl, RGS1, SMOC1, STMN2, TAC 1 , TFPI2, TNFSF7, TNNT2, TRH, ZIC1 and ZIC2.

The cell line SK16 is positive for the markers: AREG, BEX l, COL15A1, COL21A 1 , METTL7A, EGR2, FMO l , FOXF1, LAMC2, MSX1, PITX2, SERPINA3, ZICl and ZIC2 and is negative for the markers: AGC 1, ALDH1A 1, AQPl, ATP8 4, CFB, C3, C20orn03, CD24, CDH3, CLDN 11, CNTNAP2, COMP, CRIPl, CXADR, DI02, DKK2, DPT, FGFR3, GABRB 1, GDF 10, GSC, HSD 11B2, HSD17B2, IISPA6, HSPB3, ID4, IFI27, IGF2, KIAA0644, KRT14, KRT17, KRT19, KRT34, MFAP5, MASP1, MEOX1, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYII3, MYIIi 1, TAGLN3, NPAS1, NPPB, OLRi, PAX2, PAX9, PENK, PRELP, PRG4, PROM1, PRRX2, PTN, RARRESl, RELN, RGS1, STMN2, TAC1, TFPI2, TI1Y 1, TNFSF7, TNNT2, TRH and TUBB4, .

The cell line EN20 is positive for the markers: BEXl, COL21A 1 , METTL7A, DLKl, FMOl, FOXF 1 , FST, GDF5, LAMC2, MGP, PRRX1, S100A4, SERP1NA3, SOX1 1, TFPI2 and WISP2 and is negative for the markers:

ALDH1A1, AQPl, ATP8B , C3, C7, C20orfl03, CD24, CDII3, CNTNAP2, COL 15A1, COMP, CRIPl, CXADR, DI02, DKK2, FGFR3, GABRB1, GAP43, GDF 10, GSC, IIOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMBl, KRT14, KRT17, KRT34, MFAP5, MASP 1, MEOX1, MEOX2, MMP 1 , M 1, MYBPH, MYH3, MYH 1 1, NPAS , NPPB, OLRI, PAX2, PDE1A, PITX2, PRELP, PRG4, PROM1, PTN, PTPRN, RASD l, RGS1, SFRP2, SMOC 1, SNAP25, STMN2, TAC 1, TNFSF7, TNNT2, TRH, TUBB4, ZIC 1 and ZIC2, .

The cell line EN43 is positive for the markers: AKR1C1, BEXl, C7, CDH6, COL21A1, DI02, METTL7A, DLKl, FMOl, FM03, FOXF l, FOXF2, FST, GDF5, MMPI, MSX1, OGN, PRRX1, S 100A4, SERPINA3 and SOX 11 and is negative for the markers: ALDH 1A 1 , ANXA8, AQPl, ATP8B4, C3, C20orfl03, CD24, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPl, CRLF1, DKK2, DPT, GABRB 1, GAP43, GDF 10, GJB2, GSC, HOXA5, IISD l 1B2, HSD 17B2, HSPA6, ID4, 27, IGF2, KCNMB l, KRT14, KRT17, KRT1 , KRT34, MFAP5, MASP1, MEOX1, MEOX2, MGP, MYBPH, MYH3, MYHl i, NPAS 1, NPPB, OLRI, PAX2, PAX9, PDE1A, P1TX2, PRG4, PROM1, PTN, PTPRN, RASDl, RGS 1, SFRP2, SMOC1, STMN2, THY 1, TNNT2, TRH, TUBB4, ZiCI and ZIC2.

Table II

Culture Conditions

Subconfluent Monolayer Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said cells are in a subconcfluent state.

Confluent Monolayer Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said ceils are in a confluent monolayer state.

Micromass Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in tlie exemplary protocols listed in Table V, while said cells are in a highly dense micromass state as described herein. Subconfliient Mixed Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said ceils are in a subconfliient state and juxtasposed (co-cultured) potentially in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention.

Subconfliient Transwel! Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said cells are in transweil vessels or tissue cu!tureware of similar design that allows the physical separation of diverse cell types but allowing a sharing of their media. Such subconfliient transweil culture is where the cell lines of the present invention are subconfliient and share culture media with a cell type of a different differentiated state wherein the cells of a different differentiated state may be themselves in a subconfliient or confluent state.

Confluent Mixed Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said cells ate in a confluent state and juxtasposed (co-cultured) potentially in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention.

Confluent Transweil Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said cells are in transweil vessels or tissue cultureware of similar design that allows the physical separation of diverse cell types but allowing a sharing of their media. Such subconfliient transweil culture is where the cell lines of the present invention are confluent and share culture media with a cell type of a different differentiated state wherein the cells of a different differenti ted state may be themselves in a subconfliient or confluent state.

Micromass Mixed Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said cells are in a highly dense micromass state as described herein and juxtasposed (co- cultured) potentially in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention.

Micromass Transweil Culture: Cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said cells are in transweil vessels or tissue cultureware of similar design that allows the physical separation of diverse cell types but allowing a sharing of their media while said cells are in a highly dense micromass state as described herein. Such subconfliient transweil culture is where the cell lines of the present invention are confluent and share culture media with a ceil type of a different differentiated state wherein the cells of a different differentiated state may be themselves in a subconfluent or confluent state.

10. Culture Exposed to Cell Extracts of Cells of a Different Differentiated State; Tai'get cells are plated and exposed to any combination of culture media and/or supplemented factors, or cultured as described in the exemplary protocols listed in Table V, while said cells are in a subconfluent state and wherein the media for said cells contains extracts of cells of a differing differentiated state and wherein said target cells are exposed to conditions that facilitate the intracellular trafficking of molecules such as described in U.S. patent application Ser. No. 10/910, 156 filed on August 2, 2004 and titled "Methods for Altering Cell Fate", and U.S. patent application Ser. No. 10/015,824 filed on December 10, 2001 and titled "Methods for Altering Cell Fate", both incorporated herein by reference in their entirety.

TABLE III

A03 74 CM -5 CM0.5 lllumina 1 22 86

MA03 75 CMSO-5 CM50.5 lllumina 1 22 87

MA03 76 CM50-2 CM50.2 lllumina 1 NA NA

MA03 77 CMO-2 CM0.2 lllumina 1 21 49

MA03 78 CM30-2 C 30.2 lllumina 1 10 42

MA03 79 CM20-4 CM20.4 lllumina 1 23 93

MA03 80 E26 E26 lllumina 1 NA NA A03 81 E71 E71 lllumina 1 NA NA

WA09 82 4-D20-9 4-D20-9 lllumina 1 NA NA

WA09 S3 4-SKEL-19 4-SKEL-19 Asymetrix NA NA

WA09 84 4-D20-8 4-D20-8 Affymetrix NA NA

MA03 85 E34 E34 Affymetrix NA NA

MA03 86 E61 E51 lllumina 1 36 24

WA09 87 C4.4 C4.4 Affymetrix NA NA

MA03 83 E3 E3 lllumina 1 30 76

MA03 89 E73 E73 lllumina 1 30 80

MA03 90 E93 E93 lllumina 1 NA NA

MA03 91 E57 E57 lllumina 1 30 79

WA09 92 C4 ELSR #14 C4 ELSR #14 lllumina 1 NA NA

MA03 93 E76 E76 Affymetrix NA NA

MA03 94 E17 E17 lllumina 1 NA NA A03 95 E40 E40 lllumina 1 32 28

MA03 96 E8 E8 Affymetrix NA NA

MA03 97 E67 E67 lllumina 1 30 76

MA03 98 E 6 E16 lllumina 1 26 26 A03 99 E45 E46 lllumina 1 34 47

MA03 100 E72 E72 lllumina 1 7 66 A03 101 E69 E69 lllumina 1 28 16

MA03 102 E75 E75 lllumina 1 7 67

MA03 103 M10 M10 Affymetrix NA NA

MA03 104 M13 13 Affymetrix NA NA

MA03 105 E19 E19 lllumina 1 29 27

WA09 106 T44 T44 lllumina 1 114 18

MA03 107 E61 E61 lllumina 1 NA NA

WA09 108 C4 ELSR #18 C4 ELSR #18 lllumina 1 41 97

WA09 109 RA-SKEL-8 RA-SKEL-8 lllumina 1 78 147

WA09 110 4-SKEL-8 4-SKEL-8 Affymetrix NA NA

WA09 111 RA-PEND-15 RA-PEND-15 lllumina 1 NA NA

MA03 112 E108 E108 Affymetrix NA NA

MA03 113 E35 E35 lllumina 1 NA NA

MA03 114 E33 E33 lllumina 1 31 46

MA03 115 E80 E80 Affymetrix NA NA

MA03 116 E84 E84 lllumina 1 30 78 A03 117 E109 E 09 Affymetrix NA NA

WA09 118 C4 ELS5 #6 C4 ELS5 #6 lllumina 1 38 9

MA03 119 J8 J8 lllumina 1 65 96

WA09 120 T43 T43 lllumina 1 114 17 MA03 121 E10 E10 lllumlna 1 NA NA

WA09 122 RA-PEND-6 RA-PEND-6 Illumine 1 NA NA

WA09 123 RA-PEND-10 RA-PEND-10 Affymelrlx NA NA

WA09 124 A-SKEL-3 RA-SKEL-3 lllumlna 1 NA NA

WA09 126 RA-SKEL-21 RA-SKEL-21 Affymetrlx NA NA

WA09 126 4-SKEL-4 4-S EL-4 Affymetrlx NA NA

WA09 127 4-SKEL-20 4-SKEL-20 Affymetrix NA NA

WA09 128 RA-PEND-4 RA-PEND-4 lllumina 1 NA NA

WA09 129 RA-PEND-18 RA-PEND-18 Affymetrix NA NA

WA09 130 C4 ELS5 #1 C4 ELS5 #1 lllumlna 1 16 98

WA09 131 C4 ELSR #12 C4 ELSR #12 lllumlna 1 18 99

MA03 132 E163 E163 lllumlna 1 NA NA

WA09 133 C4 Mesen. #3 C4 Mesen. #3 lllumlna 1 20 45

MA03 134 G6 G6 lllumlna 1 NA NA

WA09 135 C4 ELS5 #6 C4 ELS6 #5 Illumine 1 17 100

MA03 136 J16 J16 Illumine 1 64 95

WA09 137 SK46 SK46 Illumine 1 92 186

WA09 138 SK47 SK47 lllumlna 1 93 184

WA09 139 EN2 EN2 Illumine 1 47 167

WA09 140 EN26 EN26 illumine 1 49 160 A09 141 EN31 EN31 lllumlna 1 52 172

WA09 142 SM2 SM2 lllumlna 1 98 116

WA09 143 SM4 SM4 lllumlna 1 105 109

WA09 144 EN4 EN4 lllumlna 1 54 163

WA09 145 ENS EN5 lllumlna 1 67 162

WA09 146 S 52 SK52 lllumlna 1 81 203

WA09 147 SK43 SK43 lllumlna 1 81 202

WA09 148 SK30 SK30 lllumlna 1 88 176

WA09 149 SM42 SM42 lllumlna 1 107 116

WA09 150 S 28 SM28 lllumlna 1 101 112

WA09 151 SM49 SM49 lllumlna 1 109 114

WA09 152 C4 ELS #10 C4 ELSR #10 Affymetrlx NA NA

WA09 153 RA-SKEL- 1 RA-SKEL-11 lllumlna 1 NA NA

WA09 154 RA-SMO-12 RA-SMO-12 lllumlna 1 NA NA

WA09 165 RA-D20-16 RA-D20-16 lllumlna 1 72 58

WA09 156 SM22 SM22 lllumlna 1 99 110

WA09 157 SK6 SK5 lllumlna 1 94 148

WA09 158 SK18 SK18 lllumlna 1 84 186

WA09 169 SK60 SK50 lllumlna 1 81 199

WA09 160 SK64 SK54 illum!na 2 89 135

MA03 161 J4 J4 lllumlna 1 NA NA

WA09 162 SK17 SK17 lllumlna 1 83 3

WA09 163 SK26 SK26 lllumlna 1 85 198

WA09 164 SK31 S 31 lllumlna 2 89 134

WA09 165 SK32 SK32 lllumlna 1 90 189

WA09 166 S 25 SM26 lllumlna 1 100 107

WA09 167 C4 ELSR #2 C4 ELSR #2 lllumlna 1 19 102 (Βίο ) (Blo )

WA09 167 C4 ELSR #2 C4 ELSR #2 lllumina 1 19 103

{Bio 2) (Bio 2)

WA09 167 C4 ELSR #2 C4 ELSR #2 lllumina 1 19 101

(Bio 3) (Bio 3}

WA09 168 SK3 SK3 lllumlna 1 NA NA

WA09 169 SK63 SK53 lllumina 1 82 193

MA03 170 E44 E44 lllumina 1 33 12

MA03 171 E66 E65 Affymetrlx NA NA

MA03 172 J13 J13 lllumina 1 63 5

WA09 173 EN1 EN1 lllumina 1 45 154

WA09 174 EN13 EN13 . lllumlna 1 43 149

WA09 175 EN42 EN42 lllumina 1 66 164

WA09 176 EN47 EN47 lllumina 1 66 162

WA09 177 SM27 S 27 lllumina 1 NA NA

MA03 178 E60 E50 lllumlna 1 35 56

MA03 179 E30 (Blo1) E30 (Blo1) Affymetrix NA NA A03 179 E30 (Βίο2) E30 (Blo2) lllumina 1 30 77

MA03 180 E 22 E122 Affymetrix NA NA

WA09 181 SK61 SK61 lllumlna 1 82 190

WA09 182 SM17 SM 7 lllumina 1 96 122

WA09 183 SM33 SM33 lllumina 1 104 126

WA09 184 EN7 EN7 lllumina 1 43 60

WA09 185 EN65 EN66 lllumina 1 61 161

WA09 186 T7 T7 lllumlna 2 86 14

WA09 187 EN22 EN22 lllumlna 1 NA NA

WA09 188 SK58 SK58 Affymelrix NA NA

WA09 189 MW2 MW2 lllumlna 1 67 187

WA09 190 SK8 SK8 (llumlna 1 95 195

WA09 191 SK20 SK20 lllumlna 1 NA NA

WA09 192 SK60 SK60 lllumina 1 82 191

WA09 193 MW6 MW6 lllumina 1 68 188

WA09 194 Z11 (Rep 1) Z11 (Re 1) lllumina 1 139 104

WA09 194 Z11 (Rep 2) Z11 (Rep 2) lllumina 1 139 106

WA09 196 Z6 Z6 lllumlna 1 138 120

WA09 196 W10 W10 lllumina 1 42 166

WA09 197 W11 W11 lllumlna 1 117 167

WA09 198 T36 T36 lllumlna 1 113 20

WA09 199 EN27 EN27 lllumlna 1 50 159

WA09 200 Z7 Z7 lllumlna 1 138 118

WA09 201 SM44 SM44 lllumina 1 108 113

WA09 202 EN38 Ems lllumina 1 63 71

WA09 203 SK1 SK1 lllumlna 1 79 182

WA09 204 S 44 SK44 lllumina 1 81 201

WA09 205 SK67 S 67 lllumina 1 87 197 A03 206 J2 J2 Affymetrlx NA NA MA03 207 E68 E68 lllumlna 1 37 11

MA03 208 E169 E169 i!lum!na 1 28 16

MA03 209 E164 E164 !ttumlna 1 27 63

WA09 210 T42 T42 lllumlna 1 113 21

WA09 211 T14 T14 lllumina 1 111 19 .

WA09 212 RA-D20-6 RA-D20-6 Affymetrix NA NA

WA09 213 Z8 28 lllumina 1 100 108

WA09 214 SK40 SK40 lllumina 1 91 183

WA09 215 EN11 EN11 lllumina 1 42 165

WA09 216 EN18 EN18 lllumlna 1 45 53

WA09 217 EN23 EN23 lllumina 1 NA NA

WA09 218 SK14 SK1 lllumlna 1 82 192

WA09 219 SK10 S 10 lllumlna 1 80 181

WA09 220 EN51 EN51 lllumlna 1 69 173

WA09 221 EN16 EN16 lllumlna 1 44 168

MA03 222 E53 E53 lllumlna 1 NA NA A03 223 E111 E111 lllumlna 1 24 48

WA09 224 SK49 SK49 lllumlna 1 NA NA

WA09 226 SMS SM8 lllumlna 1 110 106

WA09 226 RA-D20-6 RA-D20-5 lllumlna 1 74 67

WA09 227 RA-D20-24 RA-D20-24 Affymetrlx NA NA

WA09 228 W7 W7 Affymetrlx NA NA

WA09 229 4-O20-14 4-D20-14 lllumina 1 NA NA

WA09 230 RA-D20- 9 RA-D20-19 lllumlna 1 73 59

WA09 231 T20 T20 Affymetrlx NA NA

WA09 232 RA-SMO-19 RA-SMO-19 lllumina 1 NA NA

MA03 233 M11 M11 Affymetrlx NA NA

WA09 234 EN9 EN9 lllumina 1 NA NA

WA09 235 Q7 Q7 lllumina 1 71 194

WA09 236 U31 U31 lllumina 1 116 64

WA09 237 EN19 EN19 lllumina 1 46 175

WA09 238 C4 ELS 5 #8 C4 ELS5 #8 lllumina 1 39 8

WA09 239 Q8 Q8 lllumlna 1 NA NA

WA09 240 SK25 SK25 Affymetrlx NA NA

WA09 241 EN20 EN20 Affymetrlx NA NA

WA09 242 MW1 MW1 lllumina 2 66 4

WA09 243 C4 ELSR #13 C4 ELSR #13 lllumina 1 40 10

WA09 244 Z3 Z3 Affymetrix NA NA

WA09 245 W8 (Rep 1) W8 (Rep 1} lllumlna 1 120 51

WA09 245 W8 (Rep 2) W8 (Rep 2) Affymetrlx NA NA

WA09 246 S 28 SK28 lllumlna 1 87 196

MA03 247 E120 E120 lllumina 1 25 44

WA09 248 SM51 SM51 lllumina 1 NA NA

WA09 249 ENS EN8 lllumlna 1 NA NA

WA09 250 SK11 SK11 lllumina 1 81 200

WA09 251 EN43 EN43 Affymetrix

WA09 252 4-D20-3 4-D20-3 Affymetrix NA NA WA09 253 EN44 EN44 lllumlna 1 NA NA

WA09 264 EN50 EN50 lllumina 1 58 178

WA09 255 22 22 lllumlna 1 140 117

WA09 256 SM30 SM30 lllumlna 1 103 124

WA09 257 EN53 EN63 lllumlna 1 60 179

WA09 268 SK27 SK27 lllumlna 1 86 13

WA09 259 U18 U18 lllumlna 1 115 62

WA09 260 SM35 SM35 lllumina 1 NA NA

WA09 261 EN26 EN25 lllumlna 1 48 174

WA09 262 C4 ELSR 6 C4 ELSR 6 Affymetrlx NA NA

WA09 263 Z1 Z1 lllumlna 1 138 119

MA03 264 F15 F16 Affymetrlx NA NA

WA09 265 RA-SKEL-9 RA-SKEL-9 lllumlna 1 NA NA

MA03 266 E85 ESS Affymetrlx NA NA

WA09 267 W4 W4 lllumlna 1 88 177

WA09 268 MEL-2 MEL-2 Affymetrlx NA NA

WA09 269 LS2 LS2 lllumlna 1 NA NA

WA09 270 7-SKEL-4 7-SKEL-4 lllumlna 2 129 130

WA09 271 7-SKEL-7 7-SKEL-7 lllumina 2 129 132

WA09 272 7-PEND-9 7-PEND-9 lllumina 2 126 128

WA09 273 7-PEND-16 7-PEND-16 lllumlna 2 126 127

WA09 274 7-SKEL-6 7-SKEL-6 lllumlna 2 129 131

WA09 276 LS3 LS3 lllumlna 1

WA09 276 7-SMOO-19 7-SMOO-19 lllumlna 2 131 140

WA09 277 7-S OO-29 7-SMOO-29 lllumlna 2 134 141

WA09 278 7-S OO-32 7-SMOO-32 lllumlna 2 135 136

WA09 279 7-SMOO-33 7-SMOO-33 lllumlna 1 NA NA

WA09 280 7-SMOO-4 7-SMOO-4 lllumina 1 NA NA

WA09 281 7-SMOO-9 7-SMOO-9 lllumlna 2 134 142

WA09 282 7-SMOO-17 7-S OO-17 lllumina 1 NA NA

WA09 283 7-PEND-24 7-PEND-24 lllumina 2 124 156

WA09 284 7-SKEL-32 7-SKEL-32 lllumlna 1 NA NA

WA09 286 7-SMOO-13 7-S OO-13 lllumlna 1 NA NA

WA09 286 7-SMOO-25 7-SMOO-25 lllumlna 2 132 168

WA09 287 7-SMOO-12 7-SMOO-12 lllumina 2 130 138

WA09 288 7-PEND-30 7-PEND-30 lllumina 2 126 126

WA09 289 7-SKEL-25 7-SKEL-26 lllumlna 1

WA09 290 7-SMOO-6 7-SMOO-6 lllumlna 2 136 139

WA09 291 7-S OO-26 7-SMOO-26 lllumlna 2 133 137

WA09 292 7-SMOO-22 7-SMOO-22 lllumlna 1 NA NA

WA09 293 7-SMOO-8 7-SMOO-8 lllumina 1 NA NA

WA09 294 7-SKEL-14 7-SKEL-14 lllumina 1 NA NA

WA09 295 7-SKEL-11 7-SKEL-11 lllumlna 1 NA NA

WA09 296 7-SKEL-2 7-SKEL-2 lllumlna 2 127 129

WA09 297 7-SKEL-22 7-SKEL-22 lllumlna 2 128 133

WA09 298 7-SMOO-7 7-SMOO-7 lllumlna 2 137 1

WA09 299 7-PEND-12 7-PENO-12 lllumlna 2 124 165 WA09 300 7-SMOO-27 7-S OO-27 NA NA NA

WA09 301 7-PENO-13 7-PEND-13 NA NA NA

WA09 302 7-PEND-11 7-PEND-11 NA NA NA

WA09 303 7-PEND-15 7-PEND-15 NA NA NA

WA09 304 7-PEND-32 7-PEND-32 NA NA NA

WA09 305 7-PEND-26 7-PEND-26 NA NA NA

WA09 306 7-SKEL-24 7-SKEL-24 NA NA NA

WA09 307 7-PEND-10 7-PEND-10 NA NA NA

WA09 308 7-PEND-23 7-PEND-23 NA NA NA

309 10-RPE-9 10-RPE-9 NA NA NA

310 10-RPE-8 10-RPE-8 NA NA NA

WA09 311 RA-PEND-19 RA-PEND-19 NA NA NA

MA03 NA X4.1 X4.1 lllumlna 1 3 29

MA03 NA X4.3 X4.3 lllumlna 1 3 31

MA03 NA B-10 B-10 lllumlna 1 3 30

MA03 NA B-1 B-1 lllumlna 1 2 39

MA03 NA X4 X4 lllumlna 1 121 40

MA03 NA X6 X6 lllumlna 1 123 81

MA03 NA B-20 B-20 lllumlna 1 6 23 A03 NA B-22 B-22 lllumlna 1 10 41

MA03 NA X6 X6 lllumlna 1 10 43 A03 NA CM10.1 CM10.1 lllumlna 1 11 33

MA03 NA X2 X2 lllumlna 1 11 34

MA03 NA B-27 B-27 t!ftimina 1 11 35

MA03 NA B-9 B-9 lllumina 1 11 36

MA03 NA X4.4 X4.4 lllumlna 1 11 38

MA03 NA E31 E31 lllumina 1 21 51

MA03 NA CM10-4 CM10-4 lllumlna 1 23 91

MA03 NA CM30-5 C 30-S lllumlna 1 23 92

MA03 NA EN28 EN28 lllumlna 1 51 170

WA09 NA Q4 Q4 lllumlna 1 69 143

WA09 NA Q6 Q6 lllumlna 1 70 180

WA09 NA RA-PEND-17 RA-PEND-17 lllumlna 1 75 146

(Bio l) (Blo 1)

WA09 NA RA-PEND-17 RA-PEND-17 Aff metrlx

(Bio 2) (Bio 2)

WA09 NA RA-SKEL-18 RA-SKEL-18 lllumlna 1 76 144

(Rep 1) (Rep )

WA09 NA RA-SKEL-18 RA-SKEL-18 Affymetrlx NA NA

(Rep 2) (Rep 2)

WA09 NA RA-SKEL-6 RA-SKEL-6 lllumlna 1 77 145

WA09 NA S 19 SM- 9 lllumlna 1 97 121

WA09 NA SM29 SM-29 lllumlna 1 ^• 102 111

WA09 NA SM40 S -40 lllumlna 1 106 123

WA09 NA T23 T-23 lllumlna 1 112 60

WA09 NA T4 T-4 lllumlna 1 112 61

WA09 NA U30 U-30 Affymetrlx 116 63

WA09 NA W2 W-2 lllumlna 1 118 169 WA09 NA W3 W-3 lllumlna 1 119 2

MA03 NA E11 E-11 lllumlna 1 21 SO

WA09 NA S 15 SK15 Affymetrix NA NA

MA03 NA ESS ESS Affymetrix NA NA

MA03 NA E132 E132 Affymetrix NA NA A09 NA RA-SMO-10 AS O10 Affymetrix NA NA

WA09 NA RA-SMO-14 RASM014 Affymetrix NA NA

WA09 NA W9 W9 Affymetrix NA NA

WA09 NA MW4 MW4 Affymetrix NA NA

WA09 NA SK16 S 16 Affymetrix NA NA

Table IV

A comparison of gene expression markers in human adipocyte stem cells (ACSs), human bone marrow mesenchymal stem cells (MSCs), human adult dental pulp stem cells (DPSCs), cultured human foreskin fibroblasts (Fibro), a clonal hEP line not capable of COL2A1 induction 7SM007, and the human embryonic progenitors SM30, E15, 4D20.8, 7S 0032, MEL2 and SKI I each capable of induced COL2A1 Expression. Numbers in parenthesis are RFU values. Negative expression indicated by shaded boxes. (ND means No Data)

Table V

Exemplary Differentiation Protocols

2. After two days of post confluency (which is counted as day 0), stimulate the cells with MD1 induction media.

3. After two days of MDI an induction medium (which is called as day

2) replace the MDI induction media with Insulin Media and feed every two days.

Staining procedure 1. Aspirate media, add formaldehyde slowly and let sit for 30 min.

2. Aspirate formaldehyde and add oil red O solution to cover the well, leave 1 hr at RT.

3. Remove the stain and wash with distilled water twice,

Photograph.

Adipogenesis Protocol 2

Cells are grown to confluence in their standard growth medium (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308), medium is removed and replaced by serum-free differentiation medium (DMEM/ F12 containing 1 μΜ bovine insulin, 100 ii hydrocortisone, 10 pg of transferrin/mL, 1 n thyronine, 1 μΜ rosiglitazone, 33 μΜ biotin, and 17 μ pantothenic acid) to induce adipocyte differentiation for 3 d. After 3 d of culture, the medium is changed to differentiation medium without rosiglitazone for another 5 d. The mRNA from cultured cells was extracted at 0, 2, 5, 7 and 14 d of incubation for transcript analysis as described herein.

Differentiation Factor Protocol 1

Cells are seeded in a 12 well plate precoated with fibronectin (Gibco) at a high density (1.5 x 10 ^s cells/well). Cells are fed three times per week for 14 days with a basal media of knock out DMEM with penicillin/streptomycin and 16% knock out serum replacement, individual differentiation factors added to this basal medium chosen from Table III.

Control five day quiescent cells are plated at 3,0 x 10 ^s cells/well and at confluence fed media with serum or other growth supplements reduced to 10% of normal values. The cells are refed two days prior to harvest.

Angiogenesis Protocols

Endothelial Formation Tiie tube formation assay is carried out on 24-well plates previously Protocol (Tube Formation) coated with 250μ1 of matrigel per well (BD Biosciences, cat. #

356237). The plates are pre-incubated for 30 minutes at 37 ^D C before seeding the cells. Subsequently, the cells to be differentiated are seeded at a density of 5x10 ⁴ cells/well in 1 ml of EGM2 media (LONZA cat. # CC-3162). The tube formation assays were analyzed at 24 and 96 hours. Cells are photographed for scoring of the quantity and quality of tube formation as is well-known in the ait. RNA is harvested for Q-PCR and microarray analysis of gene expression and markers of endothelial cell differentiation such as the up-regulation of VWF, CDH5 (VB-Cadherin), CD31, KDR, is assayed.

Mural Cell Integration into Endothelial tubes are generated as described in Endothelial Formation Endothelial Tube Protocol Protocol (Tube Formation)Above. To measure tube stability and cell integration, 5xl0 ⁴ HUVEC or cells of the present invention including but not limited to the cell line W10 or cells with markers thereof, are mixed with l lO ⁴ cells that are to be assayed. HUVEC or similar cells capable of tube formation are labeled with the red dye PKH26 (Sigma, cat. ft M1N126); all other cell lines to be tested for mural cell capacity in this assay are labeled with the green dye PKH2 (Sigma, cat. ft PKH2GL- 1 T). The cell labeling was performed according to the manufacture's protocol, ). The tube formation and m rai integration assays are analyzed at 24 and 96 hours. Fluorescence and transmitted light images were taken at a magnification of 4x using a Nikon Eclipse TE 2000-U microscope equipped with an EXFO X-Cite 120 illumination system.

Osteogenic Protocol 1

Tissue culture plates are exposed to 12ug mL of Type I collagen (gelatin) and 12 ug rnL of vitronectin for 24 hours. This gelatin vitronectin solution is then aspirated and the cell lines of the present invention are added at confluent density. Osteogenic media comprising: DMEM (low glucose) with L-Glutamine, 10% fetal bovine serum, 0.1 uM dexamethasone, 0.2 mM ascorbic acid 2-phosphate, 10 irtM glycerol 2- phosphate, and 100 nM B P7 is added for 15-21 days. The degree of steogenesis is scored by relative staining with Alizarin red S performed as follows: Alizarin red S (Sigma) (40mM) is prepared in d¾0 and the pH is adjusted to 4.1 using 10% (v/v) ammonium hydroxide. Monolayers in 6-weIl plates (10 cm2/well) ate washed with PBS and fixed in 10% (v/v) formaldehyde (Sigma Aldrich) at room temperature for 15min. The monolayers are then washed twice with excess dH ₂ 0 prior to addition of 1 mL of 40 mM Alizarin red S (pH 4.1 ) per well. The plates are incubated at room temperature for 20 min with gentle shaking. After aspiration of the unincorporated dye, the wells are washed four times with 4 niL dH ₂ 0 while shaking for 5 min. The plates are then left at an angle for 2min to facilitate removal of excess water, reaspi rated, and then stored at -20°C prior to dye extraction. Stained monolayers are visual-ized by phase microscopy using an inverted microscope (Nikon).

For quantification of staining, 800 uL 10% (v/v) acetic acid is added to each well, and the plate is incubated at room teinpei'ature for 30 min with shaking. The monolayer (loosely attached to the plate) is scraped from the plate with a cell scraper (Fisher Lifesciences) and transferred with 10% (v/v) acetic acid to a 1.5-mL microcentrifuge tube with a wide-mouth pipette. After vortexing for 30 s, the slurry is overlaid with 500iiL mineral oil (Sigma-Aldrich), heated to exactly 85°C for 10 mill, and transferred to ice for 5 min, Care should be taken at this point to avoid opening of the tubes until frilly cooled. The s in y is then centrifuged at 20,000g for 15 min and 500 uL of the supernatant is removed to a new 1.5- niL microcentrifuge tube, 200 uL of 10% (v/v) ammonium hydroxide is added to neutralize the acid. The pH can be measured at this point to ensure that it is between 4.1 and 4,5. Aliquots (150 uL) of the supernatant are read in triplicate at 405nm in 96-well format using opaque-walled, transparent-bottomed plates (Fisher Lifesciences) as described (Gregory, CA et al, An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridiniuni chloride extraction, Analytical Biochemistry 329 (2004) 77 84).

In vitro conditions to induce chondrogenenesis - Pellet Culture.

Functional differentiation assays utilizing the ceils of the present invention can employ micromass and pellet protocols that are well known in the ait as capable of causing bone marrow, adipose, and tooth- derived mesenchymal stem cells to differentiate into chondrogenic lineages. To demonstrate that individual cell lines are capable of differentiating into chondrogenic lineages we assayed by qPCR transcript levels for COL2A 1, ACAN, CRTL1 , CILP, BGN, and CRTAC1 (CEP-68).

hi the case of the Chondrogenic Pellet Protocol:

1. Cells are cultured in gelatin (0, 1 %) coated Corning tissue culture treated cuttureware and detached with 0.25% trypsin/EDTA (Invitrogen, Carlsbad, CA, Gibco) diluted 1 :3 with PBS (Ca,Mg free). After detachment and addition of growth medium cells are counted using a Coulter counter and appropriate number of cells needed for experiment (e.g. 10x 106 or more) are transferred into a sterile poiyproylene tube and spun at 150g for 5 min at room temperature.

2. The supernatant is aspirated and discarded. The cells are washed with the addition of Incomplete Chondrogenic Medium consisting of hMSC Chondro BulletKit (PT-3925) to which is added supplements (Lonza, Basel, Switzerland, Poietics Single-Quots, Cat. # PT-4121 ). Supplements added to prepare Incomplete Chondrogenic Medium are: Dexamethasone (PT-4130G), Ascorbate (PT-4131G), ITS + supplements (41 13G), Pyruvate (41 14G), Proline (41 15G), Gentamicin (4505G), Glutamine (PT- 4140G).

3. Ceils are spun at !50g at room temperature, the supernatant is aspirated and cell the pellet is resuspended (once more) with 1.0 ml Incomplete Chondrogenic Medium per 7,5 x 10e5 cells, and spun at 150 x g for 5 minutes. The supernatant is aspirated and discarded. The Chondrogenesis culture protocol as described by Lonza is followed with some modifications (as written below).

4. Cell pellets are resuspended hi Complete Chondrogenic medium to a concentration of 5.0 x 10e5 cells per ml. Complete Chondrogenic Medium consists of Lonza incomplete Medium plus TGF03 (Lonza, PT-4124). Sterile lyophilized TGFp3 is reconstituted with the addition of sterile 4mM HC1 containing l mg/ml BSA .to a concentration of 20ug ml and is stored after aliquoting at -80°C. Complete Chondrogenic medium is prepared just before use by the addition of l ul of TGFp3 for each 2 ml of Incomplete Chondrogenic medium (final TGFp3 concentration is l Ong ml).

5. An aliquot of 0.5 ml (2.5 x 10 ⁵ cells) of the cell suspension is placed into sterile 15 ml polypropylene culture tubes. Ceils are spun at 150 x g for 5 minutes at room temperature.

6. Following centrifugation the caps of the tubes are loosened one half turn to allow gas exchange. The tubes are placed in an incubator at 37°C, in a humidified atmosphere of 10% C0 ₂ and 5%0 ₂ . Pellets are not disturbed for 24 hours.

7. Cell pellets are fed every 2-3 days by completely replacing the medium in each tube by aspirating the old medium with sterile 1 -200 l pipette tip and adding 0.5 ml of freshly prepared Complete Chondrogenic Medium to each tube.

8. After replacing the medium and ensuring that the pellet is free-floating, caps are loosened and tubes returned to the incubator.

9. Pellets are harvested after varying time points in chondrogenic medium and prepared for histology by fixation with Neutral Buffered Formalin and/or the pellets are combined and prepared for RNA extraction using Rneasy mini Kits (Qiagen, Germantown, MD, Cat. No. 74104).

The protocol for RNA extraction is followed as described by the Qiagen Handbook. RNA yield is maximized by using Qiagen's QiaShredder (Cat. # 79654) to homogenize samples following lysis of cell pellets with RLT buffer (provided in Rneasy mini kits) prior to RNA extraction.

In vitro conditions to induce chondi ogenenesis - Micromass Culture.

1. Cells are cultured in gelatin (0.1%) coated Coining tissue culture treated cultureware and detached with 0.25% trypsin/EDTA (Gibco) diluted 1 :3 with PBS (Gibco Ca,Mg free). After detachment and addition of growth medium cells are counted using a Coulter counter and appropriate number of cells needed for experiment (e.g. 10 xlO ⁶ cells or more) are resuspended at a cell density of 20 10 ⁶ cells/ml in growth medium.

2. lOul aliquots are seeded onto Corning Tissue Culture Treated Polystyrene plates or dishes. Twenty Five or more micromass aliqouts (200,000 cells/iOul aliquot) are seeded.

3. The seeded micromasses are placed in a humidified incubator at 37°C with 5% 0 ₂ and 10% C0 ₂ for 90 minutes to 2 hours for attaclmient.

4. Growth medium is added and the following morning is replaced, after aspiration and washing with PBS (Ca, g free), with Complete Chondrogemc Medium (prepared as described above for the pellet micromasses). For example 6 mi Complete Chondrogenic medium/ 10cm dish is added. Cells are maintainied in a humidified incubator at 37°C with 5% 0 ₂ , 10% C0 ₂ and chondrogenic medium replaced with freshly prepared medium every 2-3 days.

5. After varying periods of time in chondrogenic medium RNA is extracted using Qiagen Rneasy kits (Qiagen Cat. No. 74104) as described in the Qiagen Handbook. RNA yield is maximized by using Qiagen's QiaShredder (Cat. # 79654 to homogenize samples following lysis of micromasses with RLT buffer, (which is provided with the Rneasy mini kits) prior to RNA extraction. An alternative to Lonza Chondrogenic medium is CellGro (Cat. No. 15-013-CV) from Media Tech. To each 500ml, the following supplements are added: 5,0 ml Pen Strep (Gibco Cat. No. 15140), 5.0ml Glutamax (Gibco Cat. No. 35050), Dexamethasone (Sigma, St. Louis, MO, Cat. No.D1756-100) - 500ul of O. lmM for a final concentration of 0.1 uM; L-Proline (Sigma Cat. No. D49752) -500ul 0.35M for a final concentration of 0,35mM; Ascorbic Acid-2-phosphate (Sigma, Cat. No. 49792, Fluka) -500ul

0.17. for a final concentration 0.17mM; ITS Premix (BD, Franklin Lakes, NJ, sterile Cat. No. 47743- 628) -500ul of lOOOx concentrate for a final concentration of 6.25ug/ml insulin, 6.25ug ml transferrin, 6.25ng ml se!eniotis acid, serum albumin 1.25mg/mi, 5.35 ug ml linoleic acid.

Following addition of constituents above the media is filtered through a 500 ml Corning 0.2 micron filter unit.

As an alternative to Lonza TGFp3 descibed above we use TGFp3 (R&D Systems, Minneapolis MN, Cat. No. 243-B3-010). It is prepared, aliquoted and stored and used similarly to that purchased from Lonza,

Differentiation in gels containing crosslinked hyaluronic acid and gelatin The cell lines of the present invention may also be differentiated within hydrogels, including crosslinked gels containing hyaluronic acid and gelatin with or without added factors listed in Table ΙΠ. Cells are trypsinized and suspended at i -30 x 10e6 cells/ml HyStem-CSS (Glycosan Hydrogel Kit GS31 ) according to manufacturers directions.

1. Preparation of HyStem-CSS:

HyStem (thiol-modified hyaluranan) is dissolved in 1 ml degassed deionized water (taking about 20 minutes). Gelin-S (tiiiol modified gelatin) is dissolved in i ml degassed deionized water and PEGSSDA (disulfide-containing PEG diaciylate) is dissolved in 0.5 ml degassed deionized water (designated herein as "PEGSSDA solution"). Then HyStem ( 1ml) is mixed with Gelin-S (I ml) without creating air bubbles, immediately before use (designated herein as "HyStem:Gelin-S mix").

2. Retinoic acid and EGF-Containing HyStem-CSS:

In the case of differentiation in HyStem hydrogel containing RA and EGF, 17 million cells are pelleted and resuspended in 1.4 ml Hystem: Gelin-S mix. Then 0.35ml of PEGSSDA solution is added, pipetted up and down, without creating air bubbles, and l OOul aliquots are quickly placed onto multiple 24 well inserts (Corning Cat #3413). After gelation, in 20 minutes, encapsulated cells are fed 2ml growth media with trans-RA ( UiM) (Sigma, Cat # 2625) or 2ml growth media with EGF l OOng/ml (R&D systems Cat# 236-EG). Cells are fed three times weekly, After 28 days, cells are lysed and RNA harvested using RNeasy micro kits (Qiagen Cat # 74004) for qPCR or microarray analysis as described herein.

3. Differentiation in Hydrogels Containing Crosslinked Hyaluronic Acid and Gelatin to Induce Chondrogenesis:

Cells are suspended at a density of 20 x 10e6 cells/ml in 1,4 ml Hystem:Gelin-S mix. Then 0.35m! of PEGSSDA solution is added, pipetted up and down, without creating air bubbles, and lOOul aliquots are quickly placed onto multiple 24 well inserts (Coming Cat #3413). After gelation, in 20 minutes, encapsulated cells are fed 2ml Complete Chondrogenic Medium which consists of Lonza Incomplete Medium plus TGFp3 (Lonza, PT-4124). Incomplete Chondrogenic Medium consisting of liMSC Chondro BuiletKit (PT-3925) to which is added supplements (Lonza, Basel, Switzerland, Poietics Single-Quots, Cat. # PT-4121). Supplements added to prepare Incomplete Chondrogenic Medium are: Dexamethasone (PT-4130G), Ascorbate (PT-4131 G), ITS + supplements (41 13G), Pyruvate (41 14G), Proline (41 15G), Gentamicin (4505G), Glutamine (PT-4140G). Sterile lyophilized TGFp3 is reconstituted with the addition of sterile 4mM HC! containing 1 ing/ml BSA to a concentration of 20ug/ml and is stored after aliquoting at -80°C. Complete Chondrogenic medium is prepared just before use by the addition of l ul of ΤΟΡβ3 for each 2 ml of Incomplete Chondrogenic medium (Final TGFp3 concentration is lOng ml). Cells are refed three times a week and cultured for a total of !4 days. Cells are then lysed and RNA harvested using RNeasy micro kits (Qiagen Cat # 74004).

Differentiation of confluent cultures in the presence of EGF Cell of the present invention are grown to confluence in a 10 cm cell culture dish which may take 0.5-2 weeks depending upon the initial seeding density and the rate of growth of the cell line. Cells are fed growth media plus lOOng ml EGF when they reach confluence and are fed three times a week. After 28 days, cells are lysed and RNA prepared using RNeasy mini kits (Qiagen Cat #71404).

Table 6 is a summary of genes expressed on an mRNA level as determined by IlEumina microarrays (P=positive) or not expressed (N-negative) or indeterminate (p/n) or (n/p) in human ES-derived clonal embryonic progenitor cell lines observed to be chondrogenic in the presence of TGF beta family members, Data shown is for the cells when cultured in the undifferentiated state and held for five days of quiescence as described herein. Also shown for comparison is parallel data obtained from bone marrow mesenchymal stem cells (MSCs).

Although the foregoing invention has been described in some detail by way of illustration and exainple for purposes of clarity of understanding, it is readily apparent to those of ordinaty skill in the art hi light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. Accordingly, the preceding merely i I htstrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims.