[3] A factor that influences the efficiency of reverse t ranscription is the ability of RNA to form  secondary structures. Such secondary structures can fo rm, for example, when regions of RNA  molecules have sufficient complementarity to hybridize� �and form double stranded RNA.  Generally, the formation of RNA secondary structures  can be reduced by raising the  temperature of solutions which contain the RNA molecu les. Thus, in many instances, it is  desirable to reverse transcribe RNA at temperatures a bove 37°C. However, reverse  transcriptases generally lose activity when incubated  at temperatures much above 37°C (e.g.,  50°C). 

[4] The accuracy of methods utilizing reverse transcriptas es, including molecular diagnostics  methods using such enzymes, would be improved by the  discovery of reverse transcriptases  with improved thermostability and/or thermoreactivity.  If such enzymes were available, then  methods employed for other thermostable enzymes to im prove accuracy, could be used to  conceive new methods utilizing thermostable reverse tr anscriptases. For instance, ‘hot start’   

approaches have been employed with thermostable pol ymerases to improve the accuracy of  polymerase chain reaction (PCR) methods. In one examp le, U.S. Pat. No. 5,338,671 describes  the use of antibodies specific for a thermostable DN A polymerase to inhibit the DNA  polymerase activity at low temperatures (e.g. <70° C). Chemical treatment with citraconic  anhydride is another way hot start PCR has been ach ieved (see, e.g., U.S. Pat. No. 5,773,258  and U.S. Pat. No. 5,677,152). The application of suc h hot start approaches to reverse  transcription has proven to be challenging. This is  because, for example, many reverse  transcriptases are not heat‐stable.  

[5] Moreover, biological samples from which nucleic acids� �are extracted often contain additional  compounds that are inhibitory to reverse transcription . Humic acid in soil, plants and feces,  hematin in blood, immunoglobin G in serum, and vario us blood anticoagulants, like heparin  and citrate, are all examples of such inhibitors. Su ch inhibitors may not be completely  removed during the nucleic acid extraction and purifi cation process, thus negatively  impacting downstream nucleic acid synthesis, as reflec ted by a decrease in cDNA product  produced as a result of reverse transcription. 

[6] Thus, improved reverse transcriptases, and compositions , kits and methods that include such  reverse transcriptases which overcome some of the dra wbacks mentioned above are met by  the present invention.    BRIEF SUMMARY OF THE INVENTION  [7] The present invention provides mutant reverse transcri ptase enzymes with improved  properties, and compositions, kits, and methods that  include such novel enzymes.  

Accordingly, the present invention provides, in certai n embodiments, mutant reverse  transcriptase enzymes that exhibit increased thermostab ility, increased thermoreactivity,  and/or increased speed, as well as additional benefic ial properties such as improved inhibitor  resistance, for example resistance to polyphenol‐like  compounds, improved cDNA generation  with difficult RNA templates, and increased specificit y; and to methods of producing, such as  by reverse transcribing, amplifying or sequencing nucl eic acid molecules, for example mRNA  molecules, using such reverse transcriptase enzymes. � �In illustrative embodiments, mutant  reverse transcriptases of the present invention includ e two or more of the aforementioned   

properties. Mutant reverse transcriptases with other  beneficial properties are provided  herein, some of which include one or more of the a dditional aforementioned properties.  In  certain embodiments, the invention provides kits and  compositions, such as storage  compositions and reaction mixtures, which include the� �mutant reverse transcriptases  provided herein. 

[8] In certain illustrative embodiments, the mutant revers e transcriptases provide increased  efficiency in reverse transcription, especially with r egard to reverse transcription carried out  at elevated temperatures. Accordingly, in certain illu strative embodiments, the present  invention provides mutant reverse transcriptases wherei n one or more amino acid changes  have been made which renders the enzyme more thermos table and/or thermoreactive  during nucleic acid synthesis reactions.  

[9] In some embodiments, the present invention is directe d to mutant reverse transcriptases  derived from Maloney Murine Leukemia Virus (M‐MLV)  reverse transcriptase.  In particular,  the present invention provides reverse transcriptases  having improved thermostability by  substituting one or more amino acid residues of the� �wild type amino acid sequence of M‐ MLV reverse transcriptase represented by SEQ. ID. NO:  2 with other amino acid residues.  In  some embodiments, the amino acid positions targeted f or mutation or modification to  produce higher thermostability and/or thermoreactivity  (as well as other properties  disclosed herein) are listed in Table 1.  For examp le, the present invention includes M‐MLV  reverse transcriptases having specific mutations (or c ombinations thereof) at amino acid  positions corresponding to wild type M‐MLV selected� �from the group consisting of: P51, S67,  E69, T197, H204, E302, F309, W313, T330, L435, N454,  D524, D583, H594, D653, and/or  L671.  In a preferred embodiment of the present inv ention, M‐MLV reverse transcriptases  are provided having all of the following mutations P 51L, S67R, E69K, T197A, H204R, E302K,  F309N, W313F, T330P, L435G, N454K, D524G, D583N, H594 Q, D653N, and L671P. In some  embodiments, reverse transcriptases of the invention a lso preferably have reduced or  substantially reduced RNase H activity. 

[10] Similar or equivalent sites of corresponding amino ac id positions in reverse 

transcriptases from other species can be mutated to  produce thermostable and/or  thermoreactive reverse transcriptases as disclosed here in.   For example, in some 

embodiments the present invention provides reverse tra nscriptases having at least 50% (e.g.,   

50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91% , 92%, 93%, 94%, 95%, 96%, etc.) amino  acid sequence identity to SEQ ID NO:4.   

[11] In some embodiments, the mutant M‐MLV reverse trans criptases of the present  invention exhibit increased reverse transcriptases acti vity at a reaction temperature of at  least 50°C (e.g., 50°C, 55°C, 60°C, 65°C, 70°C,  and 75°C) when compared to wild type M‐MLV.  For example, in some embodiments, the increased rever se transcriptase activity at 50°C to  60°C is at least 10%, 25%, 50%, 75%, 100%, or 200 % more compared to wild type M‐MLV at  an even lower reaction temperature (e.g., 37°C).  L ikewise, in some embodiments, reverse  transcriptases of the present invention retain at lea st 50% (e.g., 50%, 70%, 80%, 90%, etc.)  reverse transcriptase activity at 50°C to 60°C for� �at least 5 minutes.  In other embodiments,  the reverse transcriptases retain at least 50% activi ty after heating to at least 50°C) for at  least 5 minutes.  Similarly, in other embodiments, t he reverse transcriptases as described  herein retain at least 50% (e.g., 50%, 70%, 80%, 90 %, etc.) activity after heating to at least  50°C for at least 10 minutes (e.g., 10 minutes, 15  minutes, 60 minutes, etc.) at a pH ranging  from about 7.3 to 8.3 when compared to wild type M ‐MLV at an even lower reaction  temperature (e.g., 37°C) under similar pH conditions.  

[12] In some embodiments, the reverse transcriptases of th e present invention are able to  produce a cDNA that is at least 7.5 kb within 5 m inutes at a reaction temperature of about  60°C.  In other embodiments, reverse transcriptases  of the present invention are able to  produce a cDNA that is at least 9.5 kb within 15  minutes at a reaction temperature of about  60°C.   

[13] The present invention is also directed to DNA molecu les (preferably vectors) 

containing a gene or nucleic acid molecule encoding  the mutant reverse transcriptases of the  present invention and to host cells containing such  DNA molecules.  Any number of hosts  may be used to express the gene or nucleic acid mo lecule of interest, including prokaryotic  and eukaryotic cells. Preferably, prokaryotic cells ar e used to express the polymerases of the  invention. The preferred prokaryotic host according to  the present invention is E. coli.   

[14] The invention also provides compositions and reaction� �mixtures for use in reverse  transcription of nucleic acid molecules, comprising on e or more mutant or modified reverse  transcriptase enzymes or polypeptides as disclosed her ein.  Such compositions may further  comprise one or more nucleotides, a suitable buffer,� �and/or one or more DNA polymerases.  The compositions of the invention may also comprise  one or more oligonucleotide primers or 

terminating agents (e.g., dideoxynucleotides).  Such  compositions may also comprise a  stabilizing agent, such as glycerol or a surfactant.� � Such compositions may further comprise  the use of hot start mechanisms to prevent or reduc e unwanted polymerization products  during nucleic acid synthesis.     

[15] The invention provides in certain embodiments, composi tions that include one or  more reverse transcriptases of the invention and one� �or more DNA polymerases for use in  amplification reactions. Such compositions may further� �comprise one or more nucleotides  and/or a buffer suitable for amplification. The compo sitions of the invention may also  comprise one or more oligonucleotide primers. Such co mpositions may also comprise a  stabilizing agent, such as glycerol or a surfactant.� � Such compositions may further comprise  the use of one or more hot start mechanisms to pre vent or reduce unwanted polymerization  products during nucleic acid synthesis.     

[16] The invention further provides methods for synthesis  of nucleic acid molecules using  one or more mutant reverse transcriptase enzymes or  polypeptides as disclosed herein.  In  particular, the invention is directed to methods for� �making one or more nucleic acid  molecules, comprising mixing one or more nucleic acid  templates (preferably one or more  RNA templates and most preferably one or more messen ger RNA templates) with one or  more reverse transcriptases of the invention and incu bating the mixture under conditions  sufficient to make a first nucleic acid molecule or� �molecules complementary to all or a  portion of the one or more nucleic acid templates.  In some embodiments, the first nucleic  acid molecule is a single‐stranded cDNA. Nucleic ac id templates suitable for reverse  transcription according to this aspect of the inventi on include any nucleic acid molecule or  population of nucleic acid molecules (preferably RNA  and most preferably mRNA),  particularly those derived from a cell or tissue. In  some embodiments, cellular sources of  nucleic acid templates include, but are not limited  to, bacterial cells, fungal cells, plant cells  and animal cells. 

[17] In certain embodiments, the invention provides methods  for making one or more  double‐stranded nucleic acid molecules. Such methods� �comprise (a) mixing one or more  nucleic acid templates (preferably RNA or mRNA, and  more preferably a population of mRNA  templates) with one or more reverse transcriptases of  the invention; (b) incubating the  mixture under conditions sufficient to make a first  nucleic acid molecule or molecules  complementary to all or a portion of the one or mo re templates; and (c) incubating the first 

nucleic acid molecule or molecules under conditions  sufficient to make a second nucleic acid  molecule or molecules complementary to all or a port ion of the first nucleic acid molecule or  molecules, thereby forming one or more double‐strand ed nucleic acid molecules comprising  the first and second nucleic acid molecules. Such me thods may include the use of one or  more DNA polymerases as part of the process of maki ng the one or more double‐stranded  nucleic acid molecules. The invention also concerns c ompositions useful for making such  double‐stranded nucleic acid molecules. Such composit ions comprise one or more reverse  transcriptases of the invention and optionally one or  more DNA polymerases, a suitable  buffer, one or more primers, and/or one or more nuc leotides. 

[18] The invention also provides methods for amplifying a� �nucleic acid molecule.  Such  amplification methods comprise mixing the double‐stra nded nucleic acid molecule or  molecules produced as described above with one or mo re DNA polymerases and incubating  the mixture under conditions sufficient to amplify th e double‐stranded nucleic acid molecule.  In a first preferred embodiment, the invention concer ns a method for amplifying a nucleic  acid molecule, the method comprising (a) mixing one  or more nucleic acid templates  (preferably one or more RNA or mRNA templates and m ore preferably a population of mRNA  templates) with one or more reverse transcriptases of  the invention and with one or more  DNA polymerases and (b) incubating the mixture under� �conditions sufficient to amplify  nucleic acid molecules complementary to all or a por tion of the one or more templates.   [19] The invention is also directed to methods for revers e transcription of one or more  nucleic acid molecules comprising mixing one or more� �nucleic acid templates, which are  preferably RNA or messenger RNA (mRNA) and more pref erably a population of mRNA  molecules, with one or more reverse transcriptase of� �the present invention and incubating  the mixture under conditions sufficient to make a nu cleic acid molecule or molecules  complementary to all or a portion of the one or mo re templates. To make the nucleic acid  molecule or molecules complementary to the one or mo re templates, a primer (e.g., an  oligo(dT) primer) and one or more nucleotides are pr eferably used for nucleic acid synthesis  in the 5  to 3  direction. Nucleic acid molecules suitable for rever se transcription according  to this aspect of the invention include any nucleic� �acid molecule, particularly those derived  from a prokaryotic or eukaryotic cell. Such cells ma y include normal cells, diseased cells,  transformed cells, established cells, progenitor cells,  precursor cells, fetal cells, embryonic  cells, bacterial cells, yeast cells, animal cells (in cluding human cells), avian cells, plant cells 

and the like, or tissue isolated from a plant or  an animal (e.g., human, cow, pig, mouse,  sheep, horse, monkey, canine, feline, rat, rabbit, bi rd, fish, insect, etc.). Nucleic acid  molecules suitable for reverse transcription may also� �be isolated and/or obtained from  viruses and/or virally infected cells. 

[20] The invention further provides methods for amplifying� �or sequencing a nucleic acid  molecule comprising contacting the nucleic acid molecu le with a reverse transcriptase of the  present invention. In some embodiments, such methods  comprise one or more polymerase  chain reactions (PCRs). In some embodiments, a revers e transcription reaction is coupled to a  PCR, such as in RT‐PCR. 

[21] The present invention also provides kits for reverse� �transcription comprising the  reverse transcriptase of the present invention in a  packaged format. The kit for reverse  transcription of the present invention can include, f or example, the reverse transcriptase,  any conventional constituent necessary for reverse tra nscription such as a nucleotide primer,  at least one dNTP, and a reaction buffer, and optio nally a DNA polymerase. 

[22] The invention is also directed to kits for use in  the methods of the invention. Such kits  can be used for making, sequencing or amplifying nuc leic acid molecules (single‐ or double‐ stranded). The kits of the invention comprise a carr ier, such as a box or carton, having in  close confinement therein one or more containers, suc h as vials, tubes, bottles and the like.  In certain embodiments of the kits of the invention,  a first container contains one or more of  the reverse transcriptase enzymes of the present inve ntion. The kits of the invention may  also comprise, in the same or different containers,  one or more DNA polymerase (preferably  thermostable DNA polymerases), one or more suitable b uffers for nucleic acid synthesis and  one or more nucleotides. Alternatively, the components  of the kit may be divided into  separate containers (e.g., one container for each enz yme and/or component). The kits of the  invention also may comprise instructions or protocols� �for carrying out the methods of the  invention. In preferred kits of the invention, the r everse transcriptases are mutated such that  the temperature at which cDNA synthesis occurs is in creased. In additional preferred kits of  the invention, the enzymes (reverse transcriptases and /or DNA polymerases) in the  containers are present at working concentrations. 

[23] Thus, as described in detail above, in one aspect,  mutant M‐MLV reverse 

transcriptases are provided.  Such reverse transcripta ses comprise at least one mutation at  an amino acid position corresponding to the sequence� �for wild type M‐MLV reverse 

transcriptase (SEQ ID NO:2), wherein at least one� �amino acid position is selected from: S67,  T197, and E302. In some embodiments, the at least o ne mutation is selected from the  following amino acid substitution mutations:  (S67R,  S67N, or S67K), (T197A, T197S, or  T197G), and (E302K, E302R, or E302G).  In some embo diments, the mutant reverse  transcriptases further comprises at least one addition al mutation at an amino acid position  selected from: P51, E69, P196, D200, H204, M289, T30 6, F309, W313, T330, L435, N454,  D524, E562, D583, H594, L603, D653, and L671.  In  some embodiments, the at least one  additional mutation is selected from the following am ino acid substitution mutations: P51L,  E69K, P196S, D200N, H204R, M289L, T306K, (F309N, F309 Y, or F309I), (W313F, W313L, or  W313C), T330P, (L435G, L435V, or L435R), N454K, D524G , E562Q, D583N, H594Q, L603W,  (D653N or D653H), and L671P.   

[24] In another aspect, mutant M‐MLV reverse transcriptas es are provided that comprise  at least six mutations at an amino acid position co rresponding to the sequence for wild type  M‐MLV reverse transcriptase (SEQ ID NO:2), wherein  at least six amino acid positions are  selected from: P51, E69, P196, D200, H204, M289, T30 6, F309, W313, T330, L435, N454,  D524, E562, D583, H594, L603, D653, and L671.  In  some embodiments, the at least six  mutations are selected from the following amino acid� �substitutions:  P51L, E69K, P196S,  D200N, H204R, M289L, T306K, (F309N, F309Y, or F309I),  (W313F, W313L, or W313C), T330P,  (L435G, L435V, or L435R), N454K, D524G, E562Q, D583N,  H594Q, L603W, (D653N or D653H),  and L671P.  In some embodiments, the mutant M‐MLV� �reverse transcriptases further  comprise at least one additional mutation at an amin o acid position selected from:  S67,  T197, and E302.  In some embodiments, the at least� �one additional mutation is selected from  the following amino acid substitutions:  (S67R, S67N,  or S67K), (T197A, T197S, or T197G), and  (E302K, E302R, or E302G). 

[25] In some embodiments, mutant M‐MLV reverse transcript ases are provided that have  a mutation at each of the amino acid positions: P51 , S67, E69, T197, H204, E302, F309,  W313, T330, L435, N454, D524, D583, H594, D653, and� �L671. In some embodiments, the  mutant M‐MLV reverse transcriptase comprises each of  the following amino acid substitution  mutations: P51L, S67R, E69K, T197A, H204R, E302K, F30 9N, W313F, T330P, L435G, N454K,  D524G, D583N, H594Q, D653N, and L671P.   

[26] In some embodiments, the mutant M‐MLV reverse trans criptases lack RNase H  activity.  In yet other embodiments, the mutant M‐ MLV reverse transcriptases demonstrate 

increased reverse transcriptase activity at a react ion temperature of at least 50°C compared  to reverse transcriptase activity of the corresponding  wild type M‐MLV reverse transcriptase.  In some embodiments, the mutant M‐MLV reverse trans criptases demonstrate increased  reverse transcriptase activity that is at least 10%  (e.g., 10%, 25%, 50%, 75%, 80%, 90%, 100%,  200%, etc.) more than wild type M‐MLV reverse tran scriptase activity. In some 

embodiments, the mutant M‐MLV reverse transcriptases� �possess reverse transcriptase  activity after 5 minutes at 60°C that is at least� �25% (e.g., 50%, 100%, 200%, etc.) of the  reverse transcriptase activity of wild type M‐MLV r everse transcriptase after 5 minutes at  37°C.  In some embodiments, the mutant M‐MLV reve rse transcriptases, demonstrate one or  more of the following properties: increased thermostab ility; increased thermoreactivity;  increased resistance to reverse transcriptase inhibitor s; increased ability to reverse  transcribe difficult templates, increased speed/processi vity; and increased specificity (e.g.,  decreased primer‐less reverse transcription). 

[27] In another aspect, mutant reverse transcriptases are  provided that comprise at least  50% (e.g., 50%, 60%, 705, 80%, 90%, 95%, etc.) amin o acid sequence identity to SEQ ID NO:4.   In some embodiments, the mutant reverse transcriptases  comprise SEQ ID NO:4.  In some  embodiments, the mutant reverse transcriptases consist� �of SEQ ID NO:4. 

[28] In some embodiments, the mutant reverse transcriptases  are thermostable at  temperatures between 50°C to 65°C (e.g. 50°C, 52° C, 55°C, 58°C, 60°C, and 62°C). In some  embodiments, they are thermostable for at least 1 mi nute (e.g., 1 minute, 5 minutes, 15  minutes, 60 minutes, 120 minutes, etc.) at a tempera ture between 50°C to 65°C (e.g., 55°C,  60°C, etc.).  In some embodiments, the mutant rever se transcriptases are thermoreactive at  temperatures between 50°C to 65°C (e.g. 50°C, 52° C, 55°C, 58°C, 60°C, and 62°C).  In some  embodiments, the mutant reverse transcriptase are ther moreactive for at least 1 minute  (e.g., 1 minute, 5 minutes, 15 minutes, 60 minutes,� �120 minutes, etc.) at temperatures  between 50°C to 65°C (e.g., 55°C, 60°C, etc.). � �In some embodiments, the mutant reverse  transcriptases retain at least 10% (e.g., 10%, 20%,  30%, 40%, 50%, 60%, 70%, 80%, 90%, and  100%) reverse transcriptase activity after heating to� �at least 50° C (e.g., 50°C, 55°C, 60°C,  62°C, 65°C, etc.) for at least 1 minute (e.g., 1� �minute, 2 minutes, 5 minutes, 10 minutes, 15  minutes, etc.).   In some embodiments, the reverse  transcriptases retain at least 10% (e.g.,  10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 1 00%) reverse transcriptase activity  after heating to at least 60°C (e.g., 60°C, 62°C,  65°C, etc.) for at least 1 minute  (e.g., 1 

minute, 2 minutes, 5 minutes, 10 minutes, 15 minu tes, etc.). In some embodiments, the  reverse transcriptases retain at least 50% (e.g., 50% , 60%, 70%, 80%, 90%, and 100%) reverse  transcriptase activity after heating to at least 50° C (e.g., 50°C, 55°C, 60°C, 62°C, 65°C, etc.) fo r  at least 1 minute (e.g., 1 minute, 2 minutes, 5 mi nutes, 10 minutes, 15 minutes, etc.).  In  some embodiments, the reverse transcriptases retain at  least 10% (e.g., 10%, 20%, 30%,  40%, 50%, 60%, 70%, 80%, 90%, and 100%) reverse tra nscriptase activity after heating to at  least 50°C (e.g., 50°C, 55°C, 60°C, 62°C, 65°C, ) for at least 5 minutes (e.g., 5 minutes, 10  minutes, 15 minutes, 30 minutes, etc.).   

[29] In some embodiments, the mutant reverse transcriptases  are mutant M‐MLV reverse  transcriptases. In other embodiments, the mutant rever se transcriptases are mutant reverse  transcriptases obtained from other species, including  for example, fowl pox, wild boar, koala  and baboon.  In some embodiments, the mutant reverse  transcriptases comprise regions of  amino acid homology and identity, such as that depic ted by the consensus sequence listed in  Figures 1A through 1D. 

[30] In another aspect, compositions for nucleic acid synt hesis are provided.  Such 

compositions can comprise a buffer and any of the m utant reverse transcriptases described  herein.  In some embodiments, the compositions furthe r comprise one or more components  useful for nucleic acid synthesis, such as one or m ore nucleotides, one or more DNA  polymerases, one or more detergents, one or more pri mers, one or more hot start  components, and/or one or more terminating agents.   In some embodiments, the 

termination agent is a dideoxynucleotide. 

[31] In another aspect, methods for nucleic acid synthesis  (such as reverse transcription  and amplification) are provided.  Such methods can c omprise the use of any of the mutant  reverse transcriptases described herein.  In some emb odiments, the methods comprise: (a)  preparing a mixture comprising one or more nucleic a cid templates with one or more reverse  transcriptases as described herein; and (b) incubating  the mixture under conditions sufficient  to make one or more first nucleic acid molecules co mplementary to all or a portion of the  one or more nucleic acid templates.  

[32] In other embodiments, the methods comprise:  (a) mix ing one or more nucleic acid  templates with one or more reverse transcriptases as� �described herein and one or more DNA  polymerases; and (b) incubating the mixture under con ditions sufficient to amplify one or  more nucleic acid molecules complementary to all or  a portion of the one or more templates.  

[33] In some embodiments, the nucleic acid template is a� �messenger RNA molecule or a  population of mRNA molecules. In some embodiments, th e methods comprise a step of  incubating one or more first nucleic acid molecules  under conditions sufficient to make one  or more second nucleic acid molecules complementary t o all or a portion of the one or more  first nucleic acid molecules. In other embodiments, t he methods further comprise a step of  determining the nucleotide sequence of all or a port ion of the amplified nucleic acid  molecules that are complementary to all or a portion  of the one or more templates.  In some  embodiments of the described methods, incubating is p erformed at a temperature of about  60°C. 

[34] In another aspect, kits comprising mutant M‐MLV rev erse transcriptases as described  herein in one or more packaged containers are provid ed.   

[35] In yet another aspect, isolated nucleic acids encodin g mutant reverse transcriptases  as described herein are provided.   

[36] In another aspect, vectors comprising nucleic acids e ncoding mutant reverse 

transcriptases as described herein are provided. In o ne embodiment, expression vectors  comprising a promoter operably linked to nucleic acid s encoding mutant reverse 

transcriptases as described herein are provided.   

[37] In another aspect, host cells comprising nucleic acid s encoding mutant reverse  transcriptases as described herein are provided.  In� �another aspect, host cells comprising  mutant reverse transcriptases or polypeptides having r everse transcriptase activity as  described herein are provided.  

[38] Other preferred embodiments of the present invention  will be apparent to one of  ordinary skill in light of the following drawings an d description of the invention, and of the  claims.   

BRIEF DESCRIPTION OF THE DRAWINGS  [39] These and other features, aspects, and advantages of� �the present invention will  become better understood with reference to the follow ing description and appended claims,  and accompanying drawings where: 

[40] FIGURES 1A through 1D show a table comprising the a mino acid sequence alignment  between wild type M‐MLV reverse transcriptase (MMLV)  and viral reverse transcriptases  specific to other species of animals (i.e., baboon,  fowl pox, koala, and wild boar).  Regions of  amino acid similarity and identity are seen throughou t the various RTs.  A consensus  sequence among the various RTs is also shown. 

[41] FIGURE 2 is a fluorescent image showing RT activity� �of an exemplary mutant M‐MLV  reverse transcriptase as disclosed herein (“Mut D9� �; SEQ ID NO:4) compared to wild type M‐ MLV reverse transcriptase (“WT MMLV”; SEQ ID NO:2 ) as well as other commercially  available (“conventional”) mutant M‐MLV reverse t ranscriptases (“SSII”, “SSIII”, and “Q‐RT” ).   Each lane shows the cDNA products obtained from RT  reactions carried out for varying  lengths of time (i.e., 5 minutes, 15 minutes or 60� �minutes) and under varying reaction  temperatures (i.e., 37°C, 42°C, 50°C or 60°C), as  indicated.  A 0.24 to 9.5 kb RNA ladder was  used as the template nucleic acid for each reaction.  

[42] FIGURE 3 is a fluorescent image showing RT activity� �of an exemplary mutant M‐MLV  reverse transcriptase as disclosed herein (“Mut D9� �; SEQ ID NO:4) compared to wild type M‐ MLV reverse transcriptase (“WT MMLV” ; SEQ ID NO :2).  Each lane shows the cDNA products  obtained from RT reactions carried out for varying l engths of time (i.e., 10 minutes, 30  minutes or 60 minutes) either at 37°C (for WT MMLV ) or 50°C (for Mut D) and under pH 8.3  or 7.3, as indicated.  A 0.5 to 10 kb RNA ladder� �was used as the template nucleic acid for each  reaction. 

[43] FIGURE 4 is a fluorescent image showing RT activity� �of an exemplary mutant M‐MLV  reverse transcriptase as disclosed herein (“Mut D9� �; SEQ ID NO:4) compared to wild type M‐ MLV reverse transcriptase (“WT MMLV” ; SEQ ID NO :2) as well as other commercially  available (“conventional”) mutant M‐MLV reverse t ranscriptases (“SSIII” and “C‐RT”).  Each  lane shows the cDNA products obtained from RT reacti ons carried out for varying lengths of  time (i.e., 5 minutes, 10 minutes, 30 minutes or 60  minutes) at 60°C and at pH 8.3.  A 0.5 to  10 kb RNA ladder was used as the template nucleic  acid for each reaction.   

[44] FIGURE 5 is a photograph of an ethidium bromide sta ined gel showing RT activity of  an exemplary mutant M‐MLV reverse transcriptase as  disclosed herein (“Mut D9”; SEQ ID  NO:4) compared to other commercially available mutant� �M‐MLV reverse transcriptases  (“SSIII” and “M‐RT”).  Each lane shows the� �products (amplified via PCR) obtained from RT  reactions carried out using different primers: (1) no  primer; (2) oligo(dT) ₂₀  primer; (3)  oligo(dT) ₂₀ LNA primer; or (4) PolE 2.5Rve gene‐specific  primer and under varying reaction  conditions (i.e., “NON‐HS‐RT‐rxn” or “HS‐R T‐rxn”; HS= hot start), as indicated and as  described in more detail in Example 4. A different  amount (i.e., 10 ng, 50 ng, or 100 ng) of a 1  kb target (“Hela RNA”) was used as the template� �nucleic acid for each reaction.    

[45] FIGURE 6 is a fluorescent image showing RT activity� �of an exemplary mutant reverse  transcriptase as disclosed herein (“Mut D9”; SEQ  ID NO:4) compared to wild type M‐MLV  reverse transcriptase (“WT MMLV”; SEQ ID NO:2) as  well as other commercially available  (“conventional”) mutant M‐MLV reverse transcriptas es (“SSIII” and “C‐RT”).  Each lane shows  the cDNA products obtained from RT reactions carried� �out for 60 minutes at 50°C and in the  presence of various inhibitors at various concentratio ns, as indicated.  A 0.5 to 10 kb RNA  ladder was used as the template nucleic acid for ea ch reaction. 

[46] FIGURE 7 illustrates the RT activity in graphical fo rmat of the different RTs in the  presence of inhibitors, as shown in Figure 6.  RT  activity was normalized to reactions  comprising no inhibitor (indicated as 100% activity).� � Dark shading represents the lowest RT  activity, while light shading represents the highest  RT activity (Black to White = Lowest to  Highest Activity). 

[47] FIGURES 8A and 8B list the nucleic acid sequence fo r wild type M‐MLV reverse  transcriptase (SEQ ID NO:1)  

[48] FIGURE 9 lists the amino acid sequence for wild typ e M‐MLV reverse transcriptase  (SEQ ID NO:2) 

[49] FIGURES 10A and 10B list the nucleic acid sequence  for an exemplary mutant (“Mut  D9”) M‐MLV reverse transcriptase (SEQ ID NO:3) of  the invention. 

[50] FIGURE 11 lists the amino acid sequence for an exem plary mutant (“Mut D9”) M‐MLV  reverse transcriptase (SEQ ID NO:4) of the invention.      

DETAILED DESCRIPTION  [51] Provided herein are  reverse transcriptases that have  been mutated to increase  thermostability and/or thermoreactivity, reverse transcr iptase inhibitor resistance, cDNA  generation with difficult RNA templates, and specifici ty. In certain embodiments, the  invention provides methods of making such reverse tra nscriptases by mutating or modifying  specific amino acids of the corresponding wild type  reverse transcriptases. In other  embodiments, the invention provides methods of produci ng, amplifying and/or sequencing  nucleic acid molecules, in illustrative embodiments, c DNA molecules, using compositions  and/or reactions mixtures containing such mutant rever se transcriptase enzymes.  For  example, the reverse transcriptases of the invention  are well‐suited for nucleic acid synthesis  methods including, but not limited to, RNA sequencing  and reverse transcription of crude  samples, difficult RNA templates and gene specific se quences.  Definitions 

[52] In the description that follows, a number of terms  are used that have the following  meaning: 

[53] Operably linked. As used herein “operably linked”� �means that a nucleic acid element  is positioned so as to influence the initiation of  expression of the polypeptide encoded by the  structural gene or other nucleic acid molecule. 

[54] Substantially Pure. As used herein “substantially pu re” means that the desired  material is essentially free from contaminating cellul ar components which are associated  with the desired material in nature. In a preferred� �aspect, a reverse transcriptase of the  invention has 25% or less, preferably 15% or less,  more preferably 10% or less, more  preferably 5% or less, and still more preferably 1%� �or less contaminating cellular 

components. In another aspect, the reverse transcripta ses of the invention have no  detectable protein contaminants when 200 units of rev erse transcriptase are run on a  protein gel (e.g., SDS‐PAGE) and stained with Cooma ssie blue. Contaminating cellular  components may include, but are not limited to, enzy matic activities such as phosphatases,  exonucleases, endonucleases or undesirable DNA polymera se enzymes. Preferably, reverse  transcriptases of the invention are substantially pure . 

[55] Substantially isolated. As used herein “substantially  isolated” means that the 

polypeptide of the invention is essentially free from  contaminating proteins, which may be 

associated with the polypeptide of the invention i n nature and/or in a recombinant host. In  one aspect, a substantially isolated reverse transcrip tase of the invention has 25% or less,  preferably 15% or less, more preferably 10% or less,  more preferably 5% or less, and still  more preferably 1% or less contaminating proteins. In  another aspect, in a sample of a  substantially isolated polypeptide of the invention, 7 5% or greater (preferably 80%, 85%,  90%, 95%, 98%, or 99% or greater) of the protein i n the sample is the desired reverse  transcriptase of the invention. The percentage of con taminating protein and/or protein of  interest in a sample may be determined using techniq ues known in the art, for example, by  using a protein gel (e.g., SDS‐PAGE) and staining  the gel with a protein dye (e.g., Coomassie  blue, silver stain, amido black, etc.). In another a spect, the reverse transcriptases of the  invention have no detectable protein contaminants when  200 units of reverse transcriptase  are run on a protein gel (e.g., SDS‐PAGE) and sta ined with Coomassie blue. 

[56] Terminating agent.  The term “terminating agent”  which is sometimes used 

interchangeably with “terminator base” refers to a  nucleotide which is incapable of being  extended by a DNA or RNA polymerase.  Such nucleoti des can include, for example,  dideoxynucleotides (ddNTPs) or various sugar‐modified� �nucleotides. 

[57] Reverse Transcriptase.  As used herein, the term “ reverse transcriptase” refers to a  protein, polypeptide, or polypeptide fragment that exh ibits reverse transcriptase activity.   [58] Reverse Transcriptase Activity.  As used herein, the� �term "reverse transcriptase  activity," “reverse transcription activity,” or "re verse transcription" indicates the capability of  an enzyme to synthesize DNA strand (that is, complem entary DNA or cDNA) using RNA as a  template.  

[59] Mutation.  As used herein, the term "mutation" or � ��mutant” indicates a change or  changes introduced in a wild type DNA sequence or a  wild type amino acid sequence.  Examples of mutations include, but are not limited t o, substitutions, insertions, deletions,  and point mutations. Mutations can be made either at  the nucleic acid level or at the amino  acid level. 

[60] Thermostable. For the purposes of this disclosure, � �thermostable” generally refers to  an enzyme, such as a reverse transcriptase (“thermo stable reverse transcriptase”), which  retains a greater percentage or amount of its activi ty after a heat treatment than is retained  by the same enzyme having wild type thermostability,� �after an identical treatment. Thus, a  reverse transcriptase having increased/enhanced thermost ability may be defined as a 

reverse transcriptase having any increase in thermo stability, preferably from about 1.2 to  about 10,000 fold, from about 1.5 to about 10,000 f old, from about 2 to about 5,000 fold, or  from about 2 to about 2000 fold (preferably greater� �than about 5 fold, more preferably  greater than about 10 fold, still more preferably gr eater than about 50 fold, still more  preferably greater than about 100 fold, still more p referably greater than about 500 fold, and  most preferably greater than about 1000 fold) retenti on of activity after a heat treatment  sufficient to cause a reduction in the activity of  a reverse transcriptase that is wild type for  thermostability. Preferably, the mutant reverse transcr iptase of the invention is compared to  the corresponding un‐mutated or wild type reverse t ranscriptase to determine the relative  enhancement or increase in thermostability. For exampl e, after a heat treatment at 60°C for  5 minutes, a thermostable reverse transcriptase may r etain approximately 90% of the activity  present before the heat treatment, whereas a reverse� �transcriptase that is wild type for  thermostability may retain 10% of its original activi ty. Likewise, after a heat treatment at  60°C for 15 minutes, a thermostable reverse transcri ptase may retain approximately 80% of  its original activity, whereas a reverse transcriptase  that is wild type for thermostability may  have no measurable activity. Similarly, after a heat� �treatment at 60°C for 15 minutes, a  thermostable reverse transcriptase may retain approxima tely 50%, approximately 55%,  approximately 60%, approximately 65%, approximately 70% , approximately 75%, 

approximately 80%, approximately 85%, approximately 90% , or approximately 95% of its  original activity, whereas a reverse transcriptase tha t is wild type for thermostability may  have no measurable activity or may retain 20%, 15%,� �10%, or none of its original activity. In  the first instance (i.e., after heat treatment at 60 °Cfor 5 minutes), the thermostable reverse  transcriptase would be said to be 9‐fold more ther mostable than the wild type reverse  transcriptase (90% compared to 10%). Examples of cond itions which may be used to  measure thermostability of an enzyme such as reverse� �transcriptases are set out in further  detail below and in the Examples. 

[61] The thermostability of a reverse transcriptase can be  determined, for example, by  comparing the residual activity of a reverse transcri ptase that has been subjected to a heat  treatment, e.g., incubated at 60°C for a given peri od of time, for example, five minutes, to a  control sample of the same reverse transcriptase that  has been incubated at room  temperature for the same length of time as the heat  treatment. Typically the residual activity  may be measured by following the incorporation of a� �radiolabled deoxyribonucleotide into 

an oligodeoxyribonucleotide primer using a complemen tary oligoribonucleotide template.  For example, the ability of the reverse transcriptase  to incorporate [α‐ ³² P]‐dGTP into an  oligo‐dG primer using a poly(riboC) template may be  assayed to determine the residual  activity of the reverse transcriptase. Other methods  for measuring residual activity are  known by those of skill in the art, such as by in corporation of unlabeled nucleotides into a  fluorescently‐labeled primer.  See, for example, Nik iforov, T. T., Anal Biochem., 2011, 412(2):  229‐36, which is hereby incorporated by reference.    

[62] In another aspect, thermostable reverse transcriptases� �of the invention may include  any reverse transcriptase which is inactivated at a  higher temperature compared to the  corresponding wild type, un‐mutated reverse transcrip tase. Preferably, the inactivation  temperature for the thermostable reverse transcriptases  of the invention is from about 2°C  to about 50°C (e.g., about 2°C, about 4°C, about� �6°C, about 8°C, about 10°C, about 12°C,  about 14°C, about 16°C, about 18°C, about 19°C,  about 20°C, about 21°C, about 22°C, about  23°C, about 24° C, about 26°C, about 28°C, about  30°C, about 32°C, about 34°C, about 36°C,  about 38°C, about 40°C, about 42°C, about 44°C,  about 46°C, about 48°C, or about 50°C)  higher than the inactivation temperature for the corr esponding wild type, un‐mutated  reverse transcriptase. More preferably, the inactivatio n temperature for the reverse  transcriptases of the invention is from about 5°C t o about 50°C, from about 5°C to about  40°C, from about 5°C to about 30°C, or from abou t 5°C to about 25°C greater than the  inactivation temperature for the corresponding wild ty pe, un‐mutated reverse transcriptase,  when compared under the same conditions. In some emb odiments, mutant reverse  transcriptases of the invention possess reverse transc riptase activity after at least one  minute (e.g., 1 minute, 2 minutes, 5 minutes, 10 mi nutes, 15 minutes, 30 minutes, etc.) at an  elevated temperature (e.g., 50°C, 55°C, 60°C, 65°C ) that is at least 10% (e.g., 10%, 25%, 50%,  75%, 100%, 150%, 200%, 300%, etc.) of the reverse t ranscriptase activity of wild type reverse  transcriptase after 5 minutes at a lower temperature� �(e.g., 50°C, 45°C, 42°C, 40°C, 37°C).  [63] The difference in inactivation temperature for the re verse transcriptase of the  invention compared to its corresponding wild type, un ‐mutated reverse transcriptase can be  determined by treating samples of such reverse transc riptases at different temperatures for  a defined time period and then measuring residual re verse transcriptase activity, if any, after  the samples have been heat treated. Determination of� �the difference or delta in the  inactivation temperature between the test reverse tran scriptase compared to the wild type, 

un‐mutated control is determined by comparing the  difference in temperature at which each  reverse transcriptase is inactivated (i.e., no residua l reverse transcriptase activity is  measurable in the particular assay used). As will be  recognized, any number of reverse  transcriptase assays may be used to determine the di fferent or delta of inactivation  temperatures for any reverse transcriptases tested. 

[64] In another aspect, thermostability of a reverse trans criptase of the invention is  determined by measuring the half‐life of the revers e transcriptase activity of a reverse  transcriptase of interest. Such half‐life may be co mpared to a control or wild type reverse  transcriptase to determine the difference (or delta)  in half‐life. Half‐life of the reverse  transcriptases of the invention are preferably determi ned at elevated temperatures (e.g.,  greater than 37° C) and preferably at temperatures  ranging from 40° C to 80° C, more  preferably at temperatures ranging from 45° C to 75 ° C, 50° C to 70° C, 55° C to 65° C, and 5 8°  C to 62° C. Preferred half‐lives of the reverse  transcriptases of the invention may range from  4 minutes to 10 hours, 4 minutes to 7.5 hours, 4  minutes to 5 hours, 4 minutes to 2.5 hours,  or 4 minutes to 2 hours, depending upon the tempera ture used. For example, the reverse  transcriptase activity of the reverse transcriptases o f the invention may have a half‐life of at  least 4 minutes, at least 5 minutes, at least 6 mi nutes, at least 7 minutes, at least 8 minutes,  at least 9 minutes, at least 10 minutes, at least  11 minutes, at least 12 minutes, at least 13  minutes, at least 14 minutes, at least 15 minutes,  at least 20 minute, at least 25 minutes, at  least 30 minutes, at least 40 minutes, at least 50� �minutes, at least 60 minutes, at least 70  minutes, at least 80 minutes, at least 90 minutes,  at least 100 minutes, at least 115 minutes,  at least 125 minutes, at least 150 minutes, at leas t 175 minutes, at least 200 minutes, at least  225 minutes, at least 250 minutes, at least 275 min utes, at least 300 minutes, at least 400  minutes, at least 500 minutes at temperatures of 48� � C, 50° C, 52° C, 54° C, 56° C, 58° C, 60� �  C, 62° C, 64° C, 66° C, 68° C, and/or 70° C.  

[65] Thermoreactivity.  As used herein, “thermoreactivity� �� or “thermoreactive” refers to  the ability of a reverse transcriptase to exhibit en zyme activity at elevated temperatures.   [66] Thermostability. As used herein, “thermostability”  or “thermostable” refers to the  ability to withstand exposure to elevated temperatures , but not necessarily show activity at  such elevated temperatures. 

[67] Processivity.  As used herein, “processivity” refe rs to the ability of a reverse 

transcriptase to continuously extend a primer without� �disassociating from the nucleic acid 

template.  The length of a template an enzyme is  capable of replicating (e.g., “X enzyme can  polymerase a 9 kb template” or “X enzyme can pr oduce a cDNA that is about 6000 bases in  length.”) can also be used to describe the process ivity of a given enzyme. 

[68] Inhibitor resistance.  As used herein, “inhibitor r esistance” refers to the ability of a  reverse transcriptase to perform reverse transcription� �in the presence of a compound,  chemical, protein, buffer, etc. that is typically inh ibitory to the reverse transcriptase 

(prevents or inhibits reverse transcriptase activity).� �

[69] Fidelity. Fidelity refers to the accuracy of polymeri zation, or the ability of the reverse  transcriptase to discriminate correct from incorrect s ubstrates, (e.g., nucleotides) when  synthesizing nucleic acid molecules which are compleme ntary to a template. The higher the  fidelity of a reverse transcriptase, the less the re verse transcriptase misincorporates  nucleotides in the growing strand during nucleic acid  synthesis; that is, an increase or  enhancement in fidelity results in a more faithful r everse transcriptase having decreased  error rate or decreased misincorporation rate. 

[70] About. The term “about” as used herein, means th e recited number plus or minus  10%. Thus, “about 100” includes the full range o f values within the range of 90 through 110.   

Sources of Reverse Transcriptases 

[71] In accordance with the invention, mutations or modifi cations may be made in any  reverse transcriptase or polypeptide having reverse tr anscriptase activity in order to increase  the thermostability and/or thermoreactivity of the enz yme, or confer other properties upon  the enzyme, such as increased specificity, increased  resistance to reverse transcriptase  inhibitors, and/or increased ability to generate cDNAs  from difficult RNA templates.  

[72] Reverse transcriptases for use in the compositions, m ethods and kits of the invention  include any enzyme or polypeptide having reverse tran scriptase activity. Such enzymes  include, but are not limited to, retroviral reverse  transcriptase, retrotransposon reverse  transcriptase, hepatitis B reverse transcriptase, cauli flower mosaic virus reverse 

transcriptase, bacterial reverse transcriptase, Tth DNA  polymerase, Taq DNA polymerase  (Saiki, R. K., et al., Science 239:487‐491 (1988);� �U.S. Pat. Nos. 4,889,818 and 4,965,188), Tne  DNA polymerase (WO 96/10640), Tma DNA polymerase (U.S . Pat. No. 5,374,553) and  mutants, fragments, variants or derivatives thereof (s ee, e.g., commonly owned U.S. Pat.   

Nos. 5,948,614 and 6,015,668, which are incorporate d by reference herein in their  entireties).  

[73] Preferred reverse transcriptases include retroviral rev erse transcriptases such as  Maloney Murine Leukemia Virus (M‐MLV) reverse transc riptase, Human Immunodeficiency  Virus (HIV) reverse transcriptase, Rous sarcoma virus� �(RSV) reverse transcriptase, Avian  Myeloblastosis Virus (AMV) reverse transcriptase, Rous� ��associated virus (RAV) reverse  transcriptase, and Myeloblastosis Associated Virus (MAV ) reverse transcriptase or other  Avian sarcoma leukosis virus (ASLV) reverse transcript ases. Additional reverse transcriptases  which may be mutated to make the reverse transcripta ses of the invention include bacterial  reverse transcriptases (e.g., Escherichia coli reverse� �transcriptase) (see, e.g., Mao et al.,  Biochem. Biophys. Res. Commun. 227:489‐93 (1996)) an d reverse transcriptases of 

Saccharomyces cerevisiae (e.g., reverse transcriptases  of the Ty1 or Ty3 retrotransposons)  (see, e.g., Cristofari et al., Jour. Biol. Chem. 274 :36643‐36648 (1999); Mules et al., Jour. Virol.  72:6490‐6503 (1998)).  Other reverse transcriptases  that can be used in accordance with the  described invention include, but are not limited to  reverse transcriptases isolated from  viruses isolated from, for example, baboon, fowl pox,  koala bear, and wild boar species.  [74] The present invention further provides polynucleotides� �which are identical or have  the same functions as the reverse transcriptases incl uded in the present invention. The  phrase "identical” or “have same functions as" he rein indicates that two polynucleotides  demonstrate at least 70%, preferably at least 80%, m ore preferably at least 90%, and most  preferably at least 95% amino acid identity when the y are properly arranged by a well‐ informed computerized algorithm. 

[75] The invention further includes reverse transcriptases  which are 50%, 55%, 60%, 65%,  70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99 % identical at the amino acid level to a  wild type reverse transcriptase (e.g., M‐MLV reverse  transcriptase enzyme; SEQ ID NO:2),  AMV reverse transcriptase, RSV reverse transcriptase,  HIV reverse transcriptase, etc.) and  exhibit increased thermostability and/or other desired� �properties of the invention. Also  included within the invention are reverse transcriptas es which are 70%, 75%, 80%, 85%, 90%,  95%, 96%, 97%, 98%, or 99% identical at the amino  acid level to a reverse transcriptase  comprising the amino acid sequence set out below in� �SEQ ID NO:4 and exhibit increased  thermostability and/or thermoreactivity.    

[76] The invention also includes fragments of reverse tran scriptases which comprise at  least 200, 250, 300, 350, 400, 450, 500, 550, 600,� �650, or 700 amino acid residues and retain  one or more activities associated with reverse transc riptases. Such fragments may be  obtained by deletion mutation, by recombinant techniqu es that are routine and well‐known  in the art, or by enzymatic digestion of the revers e transcriptase(s) of interest using any of a  number of well‐known proteolytic enzymes. Reverse tr anscriptase fragments of the  invention further comprise polypeptides which are 70%,  75%, 80%, 85%, 90%, 95%, 96%,  97%, 98%, or 99% identical to one or more of the  fragments set out above. The invention  also concerns various combinations of any number of  these fragments. 

[77] By a protein or protein fragment having an amino ac id sequence at least, for example,  70% “identical” to a reference amino acid sequenc e it is intended that the amino acid  sequence of the protein is identical to the referenc e sequence except that the protein  sequence may include up to 30 amino acid alterations  per each 100 amino acids of the amino  acid sequence of the reference protein. In other wor ds, to obtain a protein having an amino  acid sequence at least 70% identical to a reference� �amino acid sequence, up to 30% of the  amino acid residues in the reference sequence may be  deleted or substituted with another  amino acid, or a number of amino acids up to 30%  of the total amino acid residues in the  reference sequence may be inserted into the reference  sequence. These alterations of the  reference sequence may occur at the amino (N‐) and /or carboxy (C‐) terminal positions of  the reference amino acid sequence and/or anywhere bet ween those terminal positions,  interspersed either individually among residues in the  reference sequence and/or in one or  more contiguous groups within the reference sequence.� �As a practical matter, whether a  given amino acid sequence is, for example, at least� �70% identical to the amino acid sequence  of a reference protein can be determined conventional ly using known computer programs  such as those described above for nucleic acid seque nce identity determinations, or using the  CLUSTAL W program (Thompson, J. D., et al., Nucleic� �Acids Res. 22:4673‐4680 (1994)). 

[78] Sequence identity may be determined by comparing a r eference sequence or a  subsequence of the reference sequence to a test sequ ence. The reference sequence and the  test sequence are optimally aligned over an arbitrary  number of residues termed a  comparison window. In order to obtain optimal alignme nt, additions or deletions, such as  gaps, may be introduced into the test sequence. The� �percent sequence identity is 

determined by determining the number of positions at� �which the same residue is present in 

both sequences and dividing the number of matching  positions by the total length of the  sequences in the comparison window and multiplying by  100 to give the percentage. In  addition to the number of matching positions, the nu mber and size of gaps is also considered  in calculating the percentage sequence identity. 

[79] Sequence identity is typically determined using comput er programs. A representative  program is the BLAST (Basic Local Alignment Search T ool) program publicly accessible at the  National Center for Biotechnology Information (NCBI, h ttp://www.ncbi.nlm.nih.gov/). This  program compares segments in a test sequence to sequ ences in a database to determine the  statistical significance of the matches, then identifi es and reports only those matches that  that are more significant than a threshold level. A� �suitable version of the BLAST program is  one that allows gaps, for example, version 2.X (Alts chul, et al., Nucleic Acids Res. 

25(17):3389‐402, 1997). Standard BLAST programs for  searching nucleotide sequences  (blastn) or protein (blastp) may be used. Translated� �query searches in which the query  sequence is translated, i.e., from nucleotide sequence  to protein (blastx) or from protein to  nucleic acid sequence (tbblastn) may also be used as  well as queries in which a nucleotide  query sequence is translated into protein sequences i n all 6 reading frames and then  compared to an NCBI nucleotide database which has be en translated in all six reading frames  (tbblastx). 

[80] Additional suitable programs for identifying proteins  with sequence identity or  similarity to the proteins of the invention include,� �but are not limited to, PHI‐BLAST (Pattern  Hit Initiated BLAST, Zhang, et al., Nucleic Acids Re s. 26(17):3986‐90, 1998) and PSI‐BLAST  (Position‐Specific Iterated BLAST, Altschul, et al.,� �Nucleic Acids Res. 25(17):3389‐402, 1997).  [81] Programs may be used with default searching parameter s. Alternatively, one or more  search parameter may be adjusted. Selecting suitable  search parameter values is within the  abilities of one of ordinary skill in the art. 

[82] Some reverse transcriptase enzymes for use in the in vention include those that are  reduced, substantially reduced, or lacking in RNase H  activity. Such enzymes that are reduced  or substantially reduced in RNase H activity include� �RNase H− derivatives of any of the  reverse transcriptases described above and may be obt ained by mutating, for example, the  RNase H domain within the reverse transcriptase of i nterest, for example, by introducing one  or more (e.g., one, two, three, four, five, ten, tw elve, fifteen, twenty, thirty, etc.) point  mutations, one or more (e.g., one, two, three, four,  five, ten, twelve, fifteen, twenty, thirty, 

etc.) deletion mutations, and/or one or more (e.g. , one, two, three, four, five, ten, twelve,  fifteen, twenty, thirty, etc.) insertion mutations as� �described elsewhere herein.  For example,  such mutations are described in U.S. Patent Nos. 8,5 41,219 and 8,753,845, and are herein  incorporated by reference in their entirety. 

[83] By an enzyme “substantially reduced in RNase H act ivity” is meant that the enzyme  has less than about 30%, less than about 25%, less� �than about 20%, more preferably less  than about 15%, less than about 10%, less than abou t 7.5%, or less than about 5%, and most  preferably less than about 5% or less than about 2% , of the RNase H activity of the  corresponding wild type or RNase H+ enzyme, such as� �wild type Maloney Murine Leukemia  Virus (M‐MLV), Avian Myeloblastosis Virus (AMV) or  Rous Sarcoma Virus (RSV) reverse  transcriptases. A reduction in RNase H activity means  any reduction in the activity compared,  for example, to the corresponding wild type or un‐ mutated reverse transcriptase. Thus, in  one aspect, the reverse transcriptase of the inventio n can have 50%, 40%, 30%, 20%, 10%,  5%, 1% or no RNase H activity compared to the corr esponding wild type reverse 

transcriptase. 

[84] Reverse transcriptases having reduced, substantially re duced, undetectable or lacking  RNase H activity have been previously described (see� �U.S. Pat. No. 5,668,005, U.S. Pat. No.  6,063,608, and PCT Publication No. WO 98/47912). The� �RNase H activity of any enzyme may  be determined by a variety of assays, such as those  described, for example, in U.S. Pat. No.  5,244,797, in Kotewicz, M. L., et al., Nucl. Acids  Res. 16:265 (1988), in Gerard, G. F., et al.,  FOCUS 14(5):91 (1992), in PCT publication number WO  98/47912, and in U.S. Pat. No.  5,668,005, the disclosures of all of which are fully  incorporated herein by reference.  

[85] Reverse transcriptases having no detectable RNase H a ctivity or lacking RNase H  activity by one or more of the described assays are  also contemplated in accordance with the  invention. Thus, in some embodiments, mutated enzymes� �for use in the invention include,  but are not limited to, M‐MLV H− reverse transcr iptase, RSV H− reverse transcriptase, AMV  H− reverse transcriptase, RAV H− reverse transcrip tase, MAV H− reverse transcriptase and  HIV H− reverse transcriptase. It will be understood  by one of ordinary skill, however, that any  enzyme capable of producing a DNA molecule from a r ibonucleic acid molecule (i.e., having  reverse transcriptase activity) that is reduced or su bstantially reduced in RNase H activity  may be equivalently used in accordance with the inve ntion.   

[86] Alternatively, reverse transcriptase enzymes of the in vention may not contain any  modification or mutation in the RNase H domain which  reduces RNase H activity. Thus, in  other embodiments, the reverse transcriptases of the  invention can have 100% RNase H  activity which is equivalent to the corresponding wil d type reverse transcriptase. 

[87] Reverse transcriptase enzymes or polynucleotides for u se in the invention also  include those in which terminal deoxynucleotidyl trans ferase (TdT) activity has been reduced,  substantially reduced, or eliminated. Such enzymes tha t are reduced or substantially reduced  in terminal deoxynucleotidyl transferase activity, or  in which TdT activity has been  eliminated, may be obtained by mutating, for example,  amino acid residues within the  reverse transcriptase of interest which are in close� �proximity or in contact with the template‐ primer, for example, by introducing one or more (e.g ., one, two, three, four, five, ten, twelve,  fifteen, twenty, thirty, etc.) point mutations, one o r more deletion mutations, and/or one or  more insertion mutations. Reverse transcriptases which� �exhibit decreased TdT activity are  described in U.S. Patent No. 7,056,716, issued June  6, 2006 (the entire disclosure of which is  incorporated herein by reference).  

[88] Enzymes for use in the invention also include those� �that exhibit increased fidelity.  Reverse transcriptases which exhibit increased fidelity  are described in U.S. Appl. No.  60/189,454, filed Mar. 15, 2000, and U.S. Patent No.  7,056,716, issued June 6, 2006 (the  entire disclosures of which are incorporated herein b y reference). 

[89] Thus, in specific embodiments, the invention includes� �reverse transcriptases which  exhibit increased thermostability and/or increased ther moreactivity and, optionally, also  exhibit one or more of the following characteristics:  (1) reduced or substantially reduced  RNase H activity, (2) reduced or substantially reduce d TdT activity, and/or (3) increased  fidelity.  

[90] The present invention further provides nucleic acid m olecules which encode the  above described mutant reverse transcriptases and reve rse transcriptase fragments.  In some  embodiments, the nucleic acid molecules encoding the  mutant reverse transcriptases and  reverse transcriptase fragments are at least 80% (e.g ., 80%, 85%, 90%, 95%, 99%) identical to  SEQ ID NO:3.  In some embodiments, the nucleic acid  molecules encoding the mutant  reverse transcriptases and reverse transcriptase fragme nts comprise SEQ ID NO:3.   

[91] As will be understood by one of ordinary skill in  the art, mutated reverse 

transcriptases in accordance with the invention may b e obtained by recombinant or genetic 

engineering techniques that are routine and well‐ known in the art (see, e.g., Kotewicz, M. L.,  et al., Nucl. Acids Res. 16:265 (1988); Soltis, D.  A., and Skalka, A. M., Proc. Natl. Acad. Sci. USA  85:3372‐3376 (1988)); U.S. Pat. No. 5,668,005; and  PCT publication no. WO 98/47912.  Mutant reverse transcriptases can, for example, be ob tained by mutating the gene(s) or  nucleic acid sequences encoding the reverse transcript ase or polynucleotide having reverse  transcriptase activity, such as those described above,  by site‐directed or random 

mutagenesis. Such mutations may include point mutation s, deletion mutations and  insertional mutations. Preferably, one or more point  mutations (e.g., substitution of one or  more amino acids with one or more different amino a cids) are used to construct mutant  reverse transcriptases of the invention. Fragments of� �reverse transcriptases may be obtained  by deletion mutation by recombinant techniques that a re routine and well‐known in the art,  or by enzymatic digestion of the reverse transcriptas e(s) of interest using any of a number of  well‐known proteolytic enzymes. 

[92] To clone a gene or other nucleic acid molecule enco ding a reverse transcriptase which  will be mutated in accordance with the invention, is olated, DNA which contains the reverse  transcriptase gene or open reading frame may be used  to construct a recombinant DNA  library. Any vector, well known in the art, can be� �used to clone the reverse transcriptase of  interest. However, the vector used must be compatible  with the host in which the  recombinant vector will be transformed. 

[93] The present invention also provides transformants tran sformed by the expression  vector.  The transformant of the present invention c an be easily constructed by inserting the  said expression vector into random prokaryotic cells  or eukaryotic cells. The method to  introduce a specific vector into cells is well‐know n to those in the art.  In a preferred  embodiment of the present invention, a pBAD vector c omprising the mutant gene or  polynucleotide of the present invention (+/‐ an add itional unrelated sequence, such as a His  Tag) is introduced in E. coli Top10 cells, leading  to the construction of a transformant.  

[94] The present invention also provides an expression vec tor containing the genes or  polynucleotides of the present invention. The vector  used for the construction of the  expression vector of the present invention is not li mited, and any conventional vector for the  transformation of prokaryotes or eukaryotes can be us ed. In some embodiments of the  present invention, recombinant expression vectors are  constructed by inserting a mutant  gene represented by SEQ. ID. NO: 3.  

[95] Prokaryotic vectors for constructing the plasmid libra ry include plasmids such as  those capable of replication in E. coli such as, fo r example, pBR322, ColE1, pSC101, pUC‐ vectors (pUC18, pUC19, etc.: In: Molecular Cloning, A  Laboratory Manual, Cold Spring Harbor  Laboratory Press, Cold Spring Harbor, N.Y. (1982); an d Sambrook et al., In: Molecular Cloning  A Laboratory Manual (2d ed.) Cold Spring Harbor Labo ratory Press, Cold Spring Harbor, N.Y.  (1989)). Bacillus plasmids include pC194, pUB110, pE19 4, pC221, pC217, etc. Such plasmids  are disclosed by Glyczan, T. In: The Molecular Biolo gy Bacilli, Academic Press, York (1982),  307‐329. Suitable Streptomyces plasmids include pIJ10 1 (Kendall et al., J. Bacteriol. 

169:4177‐4183 (1987)). Pseudomonas plasmids are revie wed by John et al., (Rad. Insec. Dis.  8:693‐704 (1986)), and Igaki, (Jpn. J. Bacteriol. 3 3:729‐742 (1978)). Broad‐host range  plasmids or cosmids, such as pCP13 (Darzins and Chak rabarty, J. Bacteriol. 159:9‐18 (1984))  can also be used for the present invention. Preferre d vectors for cloning the genes and  nucleic acid molecules of the present invention are  prokaryotic vectors. Preferably, pBAD,  pCP13 and pUC vectors are used to clone the genes  of the present invention. Other suitable  vectors are known to those skilled in the art and  are commercially available.  

[96] Suitable hosts for cloning the reverse transcriptase  genes and nucleic acid molecules  of interest are prokaryotic hosts. One example of a� �prokaryotic host is E. coli. However, the  desired reverse transcriptase genes and nucleic acid  molecules of the present invention may  be cloned in other prokaryotic hosts including, but  not limited to, hosts in the genera  Escherichia, Bacillus, Streptomyces, Pseudomonas, Salmon ella, Serratia, and Proteus.  Bacterial hosts of particular interest include E. col i DH10B, which may be obtained from Life  Technologies, Corp. (Carlsbad, Calif.). 

[97] Eukaryotic hosts for cloning and expression of the r everse transcriptase of interest  include yeast, fungal, and mammalian cells. Expression  of the desired reverse transcriptase in  such eukaryotic cells may require the use of eukaryo tic regulatory regions which include  eukaryotic promoters. Cloning and expressing the rever se transcriptase gene or nucleic acid  molecule in eukaryotic cells may be accomplished by  well‐known techniques using well  known eukaryotic vector systems. 

[98] Once a DNA library has been constructed in a partic ular vector, an appropriate host is  transformed by well‐known techniques. In some embodi ments, transformed cells are plated  at a density to produce approximately 200‐300 trans formed colonies per petri dish. For  selection of reverse transcriptase, colonies can then� �be screened for the expression of a 

reverse transcriptase or a thermostable reverse tra nscriptase using methods well‐known to  those skilled in the art. For example, in some embo diments, overnight cultures of individual  transformant colonies are lysed, heated at 50°C for� �15 minutes and assayed for reverse  transcriptase or thermostable reverse transcriptase act ivity and/or other desirable activities  using a fluorescently‐labeled stem loop template (e. g. FRET assay).  See, for example,  Nikiforov, T. T., Anal Biochem., 2011, 412(2): 229‐ 36. In some embodiments, thermostable  reverse transcriptase activity and/or other desirable  activity are detected, the mutant is  sequenced to determine which amino acids maintain rev erse transcriptase activity. The gene  or nucleic acid molecule encoding a reverse transcrip tase of the present invention can be  cloned using techniques known to those in the art.   

Mutant Reverse Transcriptases 

[99] In accordance with the invention, a number of specif ied mutations can be made to  the reverse transcriptases and, in a preferred aspect , multiple mutations can be made to  result in an increased thermostability, thermoactivity,  increased resistance to inhibitors,  and/or to confer other desired properties on reverse� �transcriptases as described. Such  mutations include point mutations, frame shift mutatio ns, deletions and insertions. 

Preferably, one or more point mutations, resulting in  one or more amino acid substitutions,  are used to produce reverse transcriptases having enh anced or increased thermostability  and/or thermoreactivity or increased resistance to inh ibitors.  

[100] Mutations can be introduced into reverse transcriptase s of the present invention  using any methodology known to those of skill in th e art. Mutations can be introduced  randomly by, for example, conducting a PCR reaction  in the presence of manganese as a  divalent metal ion cofactor. Alternatively, oligonucleo tide directed mutagenesis may be used  to create the mutant polymerases which allows for al l possible classes of base pair changes  at any determined site along the encoding DNA molecu le. In general, this technique involves  annealing an oligonucleotide complementary (except for� �one or more mismatches) to a  single stranded nucleotide sequence coding for the re verse transcriptase of interest. The  mismatched oligonucleotide is then extended by DNA po lymerase, generating a double‐ stranded DNA molecule which contains the desired chan ge in sequence in one strand. The  changes in sequence can, for example, result in the� �deletion, substitution, or insertion of an   

amino acid. The double‐stranded polynucleotide can  then be inserted into an appropriate  expression vector, and a mutant polypeptide can thus� �be produced. The above‐described  oligonucleotide directed mutagenesis can, for example,� �be carried out via PCR. 

[101] In general, the invention provides, in part, reverse� �transcriptases with one or more  (e.g., one, two, three, four, five, ten, twelve, fif teen, eighteen, twenty, etc.) mutations or  modification at specified amino acid sites which rend er the reverse transcriptase more  thermostable and/or thermoreactive compared to its un� ��mutated counterpart. The invention  also provides reverse transcriptases with one or more  specified mutations or modification  which render the reverse transcriptase more efficient� �(e.g., having increased speed and/or  processivity), more specific, more resistant to revers e transcriptase inhibitors than a  corresponding un‐mutated reverse transcriptase, and/or  better able to generate cDNAs from  difficult RNA templates.  

[102] In some embodiments, the mutations or modifications o f the reverse transcriptases  provided by the invention are made in a recognized  region of the reverse transcriptase  enzyme (e.g., pol or RNase H region) in such a way  as to produce a mutated reverse  transcriptase having increased or enhanced thermostabil ity and/or thermoreactivity.  Modifications or mutations may also be made in other  regions in accordance with the  invention (e.g., such as those regions know to play� �a role in enzyme Kd, thermostability,  fidelity, substrate binding, etc.). Thus, the inventio n includes reverse transcriptases which  exhibit increased thermostability (as well as other p roperties), as described elsewhere  herein, and have one or more (e.g., one, two, three , four, five, ten, fifteen, twenty, etc.)  specified mutations or modification or combination of� �mutations or modifications.   

[103] In certain embodiments of the invention, amino acid  substitutions are made at one or  more of the amino acid positions corresponding to th e sequence for wild type M‐MLV  reverse transcriptase (SEQ ID NO:2) which are listed� �in Table 1 below (e.g., amino acid  position 51, 67, 69, 196, 197, 200, 204, 289, 302,� �306, 309, 313, 435, 454, 524, 562, 583, 594,  603, 653, and 671). In accordance with the invention , the wild type amino acids at these  positions may be substituted with any other amino ac id including Ala, Arg, Asn, Arg, Asp, Cys,  Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro,  Ser, Thr, Trp, Tyr, and Val. Certain illustrative  amino acids at these positions are those listed in  Table 1 (e.g., L/P51, S/R/N/K67, K/E69,  S/P196, T/A/S/G197, N/D200, H/R204, L/M289, K/R/E/G302,  T/K306, F/Y/I/N309, 

F/L/C/W313, P/T330, L/V/R/G435, N/K454 D/G524, Q/E562,� �N/D583, N/D594, H/Q603, 

H/N/D653, and L/P671.  Thus, specific examples of� �reverse transcriptases according to the  invention which exhibit increased thermostability and/o r thermoreactivity include M‐MLV  reverse transcriptase in which (1) the residue at po sition 51 is proline (P) or lysine (L); (2)  residue at position 67 is the serine (S), arginine  (R), lysine (K) or asparagine (N); (3) the  residue at position 69 is glutamic acid (E) or lysi ne (K); (4) the residue at position 196 is  proline (P) or serine (S); (5) the residue at posit ion 197 is threonine (T),  glycine (G), serine (S)� � or alanine (A); (6) the residue at position 200 is� �aspartic acid (D) or asparagine (N); (7) the  residue at position 204 is histidine or asparagine ( R); (8) the residue at position 289 is  methionine (M) or leucine (L); (9) the residue at p osition 302 is glutamic acid residue (E),  lysine (K), arginine (R), or glycine (G); (10) the  residue at position 306 is threonine (T) or  lysine (K); (11) the residue at position 309 is phe nylalanine (F), tyrosine (Y), isoleucine (I) or  asparagine (N); (12) the residue at position 313 is� �tryptophan (W),  phenylalanine (F), leucine  (L) or cysteine (C); (13) the residue at position 3 30 is tyrosine (Y) or proline (P); (14) the  residue at position 435 is leucine (L), valine (V),� �arginine (R), or glycine (G); (15) the residue at  position 454 is asparagine (N) or lysine (K); (16)  the residue at position 524 is aspartic acid (D)  or glycine (G); (17) the residue at position 562 is  glutamic acid (E) or glutamine (Q); (18) the  residue at position 583 is aspartic acid (D) or asp aragine (N); (19) the residue at position 594  is histidine (H) or glutamine (Q); (20) the residue� �at position 603 is leucine (L) or tryptophan  (W); (21) the residue at position 653 is aspartic a cid (D), histidine (H) or asparagine (N); and  (22) the residue at position 671 is leucine (L) or� �proline (P). 

  Table 1.       

  [104] In some embodiments, mutations or modifications in re verse transcriptases which  alter thermoreactivity and/or thermostability properties  may be present in conjunction with  alterations which either have little or no effect on  activities normally associated with reverse  transcriptases (e.g., RNase H activity, reverse transc riptase or polymerase activity, terminal  deoxynucleotidyl transferase (TdTase) activity, etc.) o r substantially alter one or more of  these activities normally associated with reverse tran scriptases. 

[105] In some embodiments, one or more mutations at a pos ition equivalent or 

corresponding to positions S67, T197, and E302 of wi ld type M‐MLV (SEQ ID NO:2) reverse  transcriptase can be made to produce the desired res ult (e.g., increased thermostability,  increased thermoreactivity, increased efficiency (speed� �and processivity), increased   

specificity, increased resistance to reverse transcr iptase inhibitors, and increased ability to  generate cDNA from difficult RNA templates.). Thus, i n some embodiments, using amino acid  positions of M‐MLV reverse transcriptase as a frame  of reference, reverse transcriptases of  the invention include any reverse transcriptase (e.g.,  M‐MLV reverse transcriptase, AMV  reverse transcriptase, HIV reverse transcriptase, RSV  reverse transcriptase, reverse  transcriptases from viruses isolated from, for example , baboon, fowl pox, koala bear, and  wild boar species) having alterations that correspond� �in position to one or more of the  following alterations: (S67R, S67N, or S67K), (T197A,� �T197S, T197G), and (302K, E302R, or  E302G), as well as compositions, kits, and reaction  mixtures containing these mutated  proteins, nucleic acid molecules which encode these p roteins, and host cells which contain  these nucleic acid molecules. 

[106] In other embodiments, six or more mutations at posit ions equivalent or 

corresponding to positions P51, E69, P196, D200, H204 , M289, T306, F309, W313, T330,  L435, N454, D524, E562, D583, H594, L603, D653, and� �L671 of wild type M‐MLV (SEQ ID  NO:2) reverse transcriptase may be made to produce t he desired result (e.g., increased  thermostability, increased thermoreactivity, increased e fficiency (speed and processivity),  increased specificity, increased resistance to reverse� �transcriptase inhibitors, and/or  increased ability to generate cDNA from difficult RNA  templates.). Thus, in specific  embodiments, using amino acid positions of M‐MLV re verse transcriptase as a frame of  reference, reverse transcriptases of the invention inc lude any reverse transcriptase (e.g., M‐ MLV reverse transcriptase, AMV reverse transcriptase,  HIV reverse transcriptase, RSV reverse  transcriptase, reverse transcriptases from viruses isol ated from, for example, baboon, fowl  pox, koala bear, and wild boar species) having six  or more of the following alterations: P51L,  E69K, P196S, D200N, H204R, M289L, T306K, (F309N, F309 Y, or F309I), (W313F, W313L, or  W313C), T330P, (L435G, L435V, or L435R), N454K, D524G , E562Q, D583N, H594Q, L603W,  (D653N or D653H), and L671P, as well as compositions  and reaction mixtures containing  these mutated proteins, nucleic acid molecules which  encode these proteins, and host cells  which contain these nucleic acid molecules. 

[107] In other embodiments, one or more mutations at a po sition equivalent or 

corresponding to positions S67, T197, and E302 and,  additionally, one or more mutation at a  position equivalent or corresponding to position P51,� �E69, P196, D200, H204, M289, T306,  F309, W313, T330, L435, N454, D524, E562, D583, H594 , L603, D653, and L671 of wild type 

M‐MLV (SEQ ID NO:2) reverse transcriptase may be  made to produce the desired result (e.g.,  increased thermostability, increased thermoreactivity, i ncreased efficiency (speed and  processivity), increased specificity, increased resistan ce to reverse transcriptase inhibitors,  and/or increased ability to generate cDNA from diffic ult RNA templates.). Thus, in specific  embodiments, using amino acid positions of M‐MLV re verse transcriptase as a frame of  reference, proteins of the invention include reverse  transcriptases (e.g., M‐MLV reverse  transcriptase, AMV reverse transcriptase, HIV reverse  transcriptase, RSV reverse 

transcriptase, reverse transcriptases from viruses isol ated from, for example, baboon, fowl  pox, koala bear, and wild boar species) having one  or more of the following alterations:  (S67R, S67N, or S67K), (T197A, T197S, T197G), and (3 02K, E302R, or E302G) and, additionally,  one or more of the following alterations: P51L, E69K , P196S, D200N, H204R, M289L, T306K,  (F309N, F309Y, or F309I), (W313F, W313L, or W313C),  T330P, (L435G, L435V, or L435R),  N454K, D524G, E562Q, D583N, H594Q, L603W, (D653N or  D653H), and L671P, as well as  compositions and reaction mixtures containing these mu tated proteins, nucleic acid  molecules which encode these proteins, and host cells  which contain these nucleic acid  molecules. 

[108] In other embodiments, six or more mutations at a po sition equivalent or 

corresponding to positions P51, E69, P196, D200, H204 , M289, T306, F309, W313, T330,  L435, N454, D524, E562, D583, H594, L603, D653, and� �L671 and, additionally, one or more  mutation at a position equivalent or corresponding to  position S67, T197, and E302 of wild  type M‐MLV (SEQ ID NO:2) reverse transcriptase can� �be made to produce the desired result  (e.g., increased thermostability, increased thermoreacti vity, increased efficiency (speed and  processivity), increased specificity, increased resistan ce to reverse transcriptase inhibitors,  and/or increased ability to generate cDNA from diffic ult RNA templates.). Thus, in specific  embodiments, using amino acid positions of M‐MLV re verse transcriptase as a frame of  reference, proteins of the invention include reverse  transcriptases (e.g., M‐MLV reverse  transcriptase, AMV reverse transcriptase, HIV reverse  transcriptase, RSV reverse 

transcriptase, reverse transcriptases from viruses isol ated from, for example, baboon, fowl  pox, koala bear, and wild boar species) having six  or more of the following alterations: P51L,  E69K, P196S, D200N, H204R, M289L, T306K, (F309N, F309 Y, or F309I), (W313F, W313L, or  W313C), T330P, (L435G, L435V, or L435R), N454K, D524G , E562Q, D583N, H594Q, L603W,  (D653N or D653H), and L671P and, additionally, one o r more of the following alterations: 

(S67R, S67N, or S67K), (T197A, T197S, or T197G),  and (E302K, E302R, or E302G), as well as  compositions and reaction mixtures containing these mu tated proteins, nucleic acid  molecules which encode these proteins, and host cells  which contain these nucleic acid  molecules. 

[109] In other embodiments, mutations at each position equi valent or corresponding to  positions S67, T197, and E302 and, additionally, muta tions at each position equivalent or  corresponding to position P51, E69, H204, F309, W313,  T330, L435, N454, D524, D583, H594,  D653, and L671 of wild type M‐MLV (SEQ ID NO:2)  reverse transcriptase can be made to  produce the desired result (e.g., increased thermostab ility, increased thermoreactivity,  increased efficiency (speed and processivity), increase d specificity, increased resistance to  reverse transcriptase inhibitors, and/or increased abil ity to generate cDNA from difficult RNA  templates.). Thus, in specific embodiments, using amin o acid positions of M‐MLV reverse  transcriptase as a frame of reference, proteins of t he invention include reverse transcriptases  (e.g., M‐MLV reverse transcriptase, AMV reverse tran scriptase, HIV reverse transcriptase,  RSV reverse transcriptase, reverse transcriptases from� �viruses isolated from, for example,  baboon, fowl pox, koala bear, and wild boar species)  having the following alterations: (S67R,  S67N, or S67K), (T197A, T197S, or T197G), and (302K,  E302R, or E302G) and, additionally, at  P51L, E69K, H204R, (F309N, F309Y, or F309I), (W313F,� �W313L, or W313C), T330P, (L435G,  L435V, or L435R), N454K, D524G, D583N, H594Q, (D653N� �or D653H), and L671P, as well as  compositions and reaction mixtures containing these mu tated proteins, nucleic acid  molecules which encode these proteins, and host cells  which contain these nucleic acid  molecules.  In some embodiments, reverse transcriptase s of the invention have the following  mutations:  P51L, S67R, E69K, T197A, H204R, E302M, F 309N, W313F, T330P, L435G, N454K,  D524G, D583N, H594QD653N, and L671P, also referred to  herein as “Mut D9” (SEQ ID NO:4).   [110] In some embodiments, the invention provides mutant re verse transcriptases or  polypeptides having the properties described herein an d at least 70% amino acid sequence  identity to SEQ ID NO:4.  For example, in some emb odiments, reverse transcriptases of the  invention are at least 70%, 75%, 80%, 85%, 90%, 95% , 97%, 98%, 99% or 100% identical to  SEQ ID NO:4.  In some embodiments, the invention pr ovides mutant reverse transcriptases or  polypeptides that comprise SEQ ID NO:4. In some pref erred embodiments, the properties of  the mutant reverse transcriptases or polypeptides desc ribed herein comprise one or more of  the following:  (a) increased thermostability; (b) in creased thermoreactivity; (c) increased 

resistance to reverse transcriptase inhibitors; (d)� �increased speed; (e) decreased primer‐less  reverse transcription; and (f) increased processivity.� �

[111] The corresponding positions of M‐MLV reverse transcr iptase identified above can be  readily identified for other reverse transcriptases by  one with skill in the art. Thus, given the  defined region and the assays described in the prese nt application, one with skill in the art  can make the specified modifications which would resu lt in increased thermostability,  increased thermoactivity, and/or other desired features  of any reverse transcriptase of  interest. Identified regions of interest for other kn own reverse transcriptases and residues to  be mutated in accordance with the present invention  can include those listed in Figures 1A  through 1D. 

[112] The nucleotide sequence for wild type M‐MLV reverse  transcriptase (SEQ ID NO:1) is  well‐known to those skilled in the art. See, for  example, Shinnick et al., 1981, Nature 

293:543‐548; Georgiadis et al., 1995, Structure 3:87 9‐892), the disclosure of which is  incorporated herein by reference in its entirety. 

[113] In some preferred embodiments, oligonucleotide directed  mutagenesis is used to  create the mutant reverse transcriptases which allows� �for all possible classes of base pair  changes at any determined site along the encoding DN A molecule. Those skilled in the art are  well aware of that even when the amino acid substit uted once is replaced again with another  amino acid having similar characteristics (that is, c onservative amino acid substitution),  similar physiological and biochemical properties are s till observed. The effect of amino acid  substitution on the various amino acid properties and  protein structure and functions has  been well‐studied by those in the art.  

[114] In some embodiments of the present invention, the mu tant reverse transcriptases  described herein demonstrate higher thermostability and /or thermoreactivity than the  corresponding wild type reverse transcriptase. In some  embodiments, M‐MLV mutant  reverse transcriptases having the following mutations:� �P51L, S67R, E69K, T197A, H204R,  E302K, F309N, W313F, T330P, L435G, N454K, D524G, D583 N, H594Q, D653N, and L671P,  demonstrate increased thermostability at 60°C. In par ticular, in some embodiments, mutant  M‐MLV reverse transcriptases as disclosed herein dem onstrate increased reverse 

transcriptase activity at 60  compared to the wild type M‐MLV reverse transcrip tase as well  as compared to other commercially available M‐MLV d erivative reverse transcriptases (e.g.,   

Q‐SS, SSII, and SSIII) at temperatures much lowe r than 60°C (i.e., 37°C,  42°C, and 50°C,  respectively).  See, for example, Figure 2. 

[115] In some embodiments of the present invention, the mu tant reverse transcriptases  described herein demonstrate increased reverse transcri ptase activity compared to the  corresponding wild type reverse transcriptase.  In so me preferred embodiments, the mutant  reverse transcriptases exhibit increased reverse transc riptase activity at reaction 

temperatures above 37°C.  For example, the mutant r everse transcriptases as described  herein exhibit increased reverse transcriptase activity  at reaction temperatures of 38°C, 40°C,  42°C, 45°C, 48°C, 50°C, 52°C, 55°C, 58°C, 60° C, 62°C, 65°C, 68°C, 70°C, 72°C, 75°C, 78°C,  etc.  See, for example, Figure 4. 

[116] In some embodiments of the present invention, the mu tant reverse transcriptases  described herein demonstrate increased reverse transcri ptase activity that is at least 10%  more compared to the corresponding wild type reverse� �transcriptase.  For example, the  mutant reverse transcriptases as described herein exhi bit at least 10%, 15%, 20%, 25%, 30%,  35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% 80%, 8 5%, 90%, 95%, 100%, etc. more  reverse transcriptase activity compared to the corresp onding wild type reverse transcriptase.   In some embodiments, the mutant reverse transcriptases  as described herein exhibit 110%,  115%, 120%, 125%, 150%, 200%, 250%, 300%, 400%, 500% , etc. the amount of the reverse  transcriptase activity exhibited by the wild type rev erse transcriptase. In some embodiments,  the mutant reverse transcriptases as described herein� �are at least about 1.1X, 1.5X, 1.8X, 2X,  4X, 6X, 8X, 10X, 30X, 40X, 50X, etc. more thermorea ctive than the corresponding wild type  reverse transcriptase.  In some embodiments, the muta nt reverse transcriptases of the  present invention exhibit increased activity compared  to the corresponding wild type reverse  transcriptase, even when the reaction or incubation t emperature of the mutant reverse  transcriptase is at a higher temperature compared to� �the reaction or incubation temperature  of the wild type polymerase. 

[117] In some embodiments of the present invention, the mu tant reverse transcriptases  described herein demonstrate improved or increased pro perties compared to the 

corresponding wild type reverse transcriptase when bot h reverse transcriptases are at the  same reaction temperature (e.g., 37°C, 40°C, 42°C,� �50°C, 52°C, 55°C, 58°C, 60°C, 62°C, 65°C,  70°C, or 75°C).  In some other embodiments, the m utant reverse transcriptases described  herein demonstrate improved or increased properties at  an elevated reaction temperature 

(e.g., 52°C, 55°C, 58°C, 60°C, 62°C, 65°C, 7 0°C, 75°C) compared to the same properties  demonstrated by the corresponding wild type reverse t ranscriptase at a lower temperature  (e.g., 37°C, 40°C, 42°C, 50°C).   

[118] In another aspect, the mutant reverse transcriptases  described herein exhibit  improved or increased activity (e.g., thermostability  or thermoreactivity) at lower pH  compared to the activity demonstrated by the correspo nding wild type reverse transcriptase  under the same pH.  See, for example, Figure 3. 

[119]  In some embodiments, the reverse transcriptases of  the present invention exhibit  increased activity at a wider range of pH, producing  more cDNA and longer cDNA compared  to a non‐mutated or conventional RTs under similar� �or the same conditions.  For example,  the mutant reverse transcriptases described herein exh ibit increased activity compared to  wild type reverse transcriptase at a pH range  from  about from about pH 5.5 to about pH 9.0  (e.g., about pH 6.0, about pH 6.5, about pH 7.0, a bout pH 7.1, about pH 7.2, about pH 7.3,  about pH 7.4, about pH 7.5, about pH 7.6, about pH  7.7, about pH 7.8, about pH 7.9, about  pH 8.0, about pH 8.1, about pH 8.2, about pH 8.3,� �about pH 8.4, about pH 8.5, about pH 8.6,  about pH 8.7, about pH 8.8, about pH 8.9, about pH  9.0, from about pH 6.0 to about pH 8.5,  from about pH 6.5 to about pH 8.5, from about pH  7.0 to about pH 8.5, from about pH 7.5 to  about pH 8.5, from about pH 6.0 to about pH 8.0,  from about pH 6.0 to about pH 7.7, from  about pH 6.0 to about pH 7.5, from about pH 6.0 t o about pH 7.0, from about pH 7.2 to  about pH 7.7, from about pH 7.3 to about pH 7.7,  from about pH 7.4 to about pH 7.6, from  about pH 7.0 to about pH 7.4, from about pH 7.6 t o about pH 8.0, from about pH 7.6 to  about pH 8.5, from about pH 7.7 to about pH 8.5,  from about pH 7.9 to about pH 8.5, from  about pH 8.0 to about pH 8.5, from about pH 8.2 t o about pH 8.5, from about pH 8.3 to  about pH 8.5, from about pH 8.4 to about pH 8.5,  from about pH 8.4 to about pH 9.0, from  about pH 8.5 to about pH 9.0, etc.). In some embod iments, the mutant reverse transcriptases  of the present invention exhibit at least 10% (e.g.,  10%, 15%, 20%, 25%, 30%, 40%, 50%, 75%,  100%, 200%, 300%, 500%, etc.) more activity compared� �to the wild type RT at the same pH.   In other embodiments, the mutant reverse transcriptase s of the present invention produce  at least 10% (e.g., 10%, 15%, 20%, 25%, 30%, 40%,  50%, 75%, 100%, 200%, 300%, 500%, etc.)  more cDNA product compared to the wild type RT at  the same pH.  In still other 

embodiments, the mutant reverse transcriptases of the� �present invention produce cDNA  products that are at least 10% (e.g., 10%, 15%, 20% , 25%, 30%, 40%, 50%, 75%, 100%, 200%, 

300%, 500%, etc.) longer than the cDNA products p roduced by the corresponding wild type  RT at the same pH. In yet other embodiments, the m utant reverse transcriptases of the  present invention produce cDNA products at a rate th at is at least 10% (e.g., 10%, 15%, 20%,  25%, 30%, 40%, 50%, 75%, 100%, 200%, 300%, 500%, et c.) faster than that of the 

corresponding wild type RT at the same pH.  For ex ample, the mutant reverse transcriptases  of the present invention produces at least 2x more  (e.g., 2x, 3x, 4x, 5x, 10x, 20x, etc.) cDNA  product than the corresponding wild type RT at the  same pH. 

[120] In some embodiments of the present invention, the mu tant reverse transcriptases  described herein retain at least 20% reverse transcri ptase activity after heating to a  temperature between 55°C to 75°C.  For example, th e mutant reverse transcriptases retain at  least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,� �65%, 70%, 75%, 80%, 90%, 95%, 99%  or 100% reverse transcriptase activity after heating  to a temperature between 55°C to 75°C.   In some embodiments, the mutant reverse transcriptases  retain at least 20% reverse  transcriptase activity after heating to a temperature� �between 55°C to 75°C for at least 5  minutes. For example, the mutant reverse transcriptase s retain at least 20%, 25%, 30%, 35%,  40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%,  95%, 99% or 100% reverse 

transcriptase activity after heating to a temperature� �between 55°C to 75°C for at least 5  minutes.  

[121] In some embodiments of the present invention, the mu tant reverse transcriptases  described herein retain at least 20% reverse transcri ptase activity after heating to a  temperature between 50°C to 75°C.  For example, th e mutant reverse transcriptases retain at  least 20% reverse transcriptase activity after heating  to a temperature of 50°C, 55°C, 58°C,  60°C, 62°C, 64°C, 68°C, 70°C, 72°C, or 75°C.   In some embodiments, the mutant reverse  transcriptases retain at least 20% reverse transcripta se activity after heating to a 

temperature between 50°C to 75°C for at least 5 m inutes. For example, the mutant reverse  transcriptases retain at least 20% reverse transcripta se activity after heating to a 

temperature between a temperature of 50°C, 58°C, 60 °C, 62°C, 64°C, 68°C, 70°C, 72°C, or  75°C for at least 5 minutes.  

[122] In some embodiments of the present invention, the mu tant reverse transcriptases  described herein retain at least 20% reverse transcri ptase activity after heating to a  temperature between 50°C to 75°C for at least 1 m inute.  For example, the mutant reverse  transcriptases retain at least 20% reverse transcripta se activity after heating to a 

temperature between 50°C to 75°C for at least 1  minute, 2 minutes , 5 minutes, 10 minutes,  15 minutes, 20 minutes, 30 minutes, 40 minutes, 50  minutes, 60 minutes, etc.  In some  embodiments, the mutant reverse transcriptases retain  at least about 20%, about 25%,  about 30%, about 35%, about 40%, about 45%, about 5 0%, about 55%, about 60%, about  65%, about 70%, about 75%, about 80%, about 90%, ab out 95%, about 99% or about 100%  reverse transcriptase activity after heating to a tem perature of about 50°C, about 55°C,  about 58°C, about 60°C, about 62°C, about 64°C,  about 68°C, about 70°C, about 72°C, or  about 75°C for at least about 1 minute, about 2 m inutes, about 5 minutes, about 10 minutes,  about 15 minutes, about 20 minutes, about 30 minutes , about 40 minutes, about 50 minutes,  or about 60 minutes.  

[123] In some embodiments of the present invention, the mu tant reverse transcriptases  described herein are able to produce a cDNA that is  at least 0.2 kb in length.  For example,  the mutant reverse transcriptases are able to produce  a cDNA that is 0.2 kb, 0.5 kb, 1 kb, 1.5  kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 7.5 kb , 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 15 kb, or� �20 kb,  etc. in length. In some embodiments, the mutant reve rse transcriptases described herein are  able to produce a cDNA that is between about 0.2 k b to 10 kb in length.  In some 

embodiments, the mutant reverse transcriptases describe d herein are able to produce a  cDNA that is between about 0.2 kb to 10 kb in len gth within 1 to 60 minutes at a 

temperature between 25°C to 75°C.  In some embodim ents, the mutant reverse 

transcriptases are able to produce a cDNA that is b etween about 0.2 kb to 10 kb in length  within 1 minute, 5 minutes, 10 minutes, 15 minutes,� �20 minutes, 30 minutes, 40 minutes, 50  minutes or 60 minutes at a temperature of at least� �37°C (e.g., 37°C, 40°C, 45°C, 50°C, 55°C,  60°C, 70°C or 75°C).   

[124] In some preferred embodiments, the mutant or mutated� �reverse transcriptases of the  present invention demonstrate higher thermostability th an the corresponding wild type  reverse transcriptase.  In particular, mutant reverse� �transcriptases as described herein,  exhibit increased thermostability and/or increased ther moreactivity.  Among some of the  possible mutant reverse transcriptases provided herein,  an exemplary mutant “D9” (SEQ ID  NO:4) (see Figure 11) demonstrates increased thermosta bility at least 50°C.  In some  embodiments, at 60°C this exemplary mutant reverse t ranscriptase produces cDNA more  efficiently than wild type M‐MLV reverse transcripta se at a temperature of 37°C (see, for  example, Figure 2).   

[125] In another aspect, the mutant reverse transcriptases  as described herein are resistant  to enzyme inhibitors found in biological samples, inc luding, for example, blood, sweat, tears,  soil, feces, saliva, urine, and bile. Such inhibitors  can include, but are not limited to, humic  acid, heparin, ethanol, bile salts, fulvic acid, poly saccarides, metal ions, sodium dodecyl  sulfate (SDS), EDTA, guanidinium salts, formamide, sod ium pyrophosphate, and spermidine.  An inhibitor‐resistant reverse transcripatase, as use d herein, can generally refer to a reverse  transcriptase that exhibits at least 10% reverse tran scriptase activity in the presence of an  inhibitor(s) in the reaction mixture. For example, th e mutant reverse transcriptases described  herein exhibit up to about 90% (e.g., 90%, 85%, 80% , 75%, 70%, 65%, 60%, 55%, 50%, 45%,  40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, etc.) revers e transcriptase activity in the presence  of an inhibitor compared to reactions comprising no  inhibitor. The amount of inhibitor in any  given reaction mixture can depend upon the type of  inhibitory substance that exists within  the biological sample from which the nucleic acid be ing assayed is extracted. Generally,  mutant reverse transcriptases described herein (even w hen at elevated temperatures) can  tolerate at least 2x (e.g., 2x, 3x, 5x, 10x, 50x,  100x) greater concentration of these inhibitory  substances, as compared to the corresponding wild typ e reverse transcriptase. Assays to  determine the level of inhibitory substances in a sa mple are known in the art. Inhibitor‐ resistance can be readily determined by assays descri bed herein.  

Expression of Reverse Transcriptases 

[126] To optimize expression of reverse transcriptases of t he present invention, inducible or  constitutive promoters are well known and may be use d to express high levels of a reverse  transcriptase structural gene in a recombinant host.  Similarly, high copy number vectors, well  known in the art, may be used to achieve high leve ls of expression. Vectors having an  inducible high copy number may also be useful to en hance expression of the reverse  transcriptases of the invention in a recombinant host . 

[127] To express the desired structural gene in a prokaryo tic cell (such as E. coli, B. subtilis,  Pseudomonas, etc.), it is preferable to operably link  the desired structural gene to a  functional prokaryotic promoter. However, the natural  promoter of the reverse transcriptase  gene may function in prokaryotic hosts allowing expre ssion of the reverse transcriptase gene.  Thus, the natural promoter or other promoters may be  used to express the reverse  transcriptase gene. Such other promoters that may be� �used to enhance expression include 

constitutive or regulatable (i.e., inducible or der epressible) promoters. Examples of  constitutive promoters include the int promoter of ba cteriophage λ, and the bla promoter of  the β‐lactamase gene of pBR322. Examples of induci ble prokaryotic promoters include the  major right and left promoters of bacteriophage λ ( PR and PL), trp, recA, lacZ, lad, tet, gal,  trc, ara BAD (Guzman, et al., 1995, J. Bacteriol. 1 77(14):4121‐4130) and tac promoters of E.  coli. The B. subtilis promoters include α‐amylase  (Ulmanen et al., J. Bacteriol 162:176‐182  (1985)) and Bacillus bacteriophage promoters (Gryczan,� �T., In: The Molecular Biology Of  Bacilli, Academic Press, New York (1982)). Streptomyce s promoters are described by Ward et  al., Mol. Gen. Genet. 203:468478 (1986)). Prokaryotic� �promoters are also reviewed by Glick,  J. Ind. Microbiol. 1:277‐282 (1987); Cenatiempto, Y. , Biochimie 68:505‐516 (1986); and  Gottesman, Ann. Rev. Genet. 18:415‐442 (1984). Expre ssion in a prokaryotic cell also  requires the presence of a ribosomal binding site up stream of the gene‐encoding sequence.  Such ribosomal binding sites are disclosed, for examp le, by Gold et al., Ann. Rev. Microbiol.  35:365404 (1981). 

[128] To enhance the expression of reverse transcriptases o f the invention in a eukaryotic  cell, well known eukaryotic promoters and hosts may  be used. Enhanced expression of the  reverse transcriptases may be accomplished in a proka ryotic host. One example of a  prokaryotic host suitable for use with the present i nvention is Escherichia coli.    

Isolation and Purification of Reverse Transcriptases  

[129] The enzyme(s) of the present invention is preferably� �produced by growth in culture of  the recombinant host containing and expressing the de sired reverse transcriptase gene.  However, the reverse transcriptase of the present inv ention may be isolated from any strain,  organism, or tissue which produces the reverse transc riptase of the present invention.  Fragments of the reverse transcriptase are also inclu ded in the present invention. Such  fragments include proteolytic fragments and fragments  having reverse transcriptase activity.  Such fragments may also be produced by cloning and  expressing portions of the reverse  transcriptase gene of interest, creating frame shift  mutations and/or by adding one or more  stop codons in the gene of interest for expression  of a truncated protein or polypeptide.  Preferably, polypeptides of the invention may be puri fied and/or isolated from a cell or  organism expressing them, which may be a wild type  cell or organism or a recombinant cell   

or organism. In some embodiments, such polypeptides  may be substantially isolated from  the cell or organism in which they are expressed. 

[130] Any nutrient that can be assimilated by a host cont aining the cloned reverse 

transcriptase gene may be added to the culture mediu m. Optimal culture conditions should  be selected case by case according to the strain us ed and the composition of the culture  medium. Antibiotics may also be added to the growth� �media to insure maintenance of vector  DNA containing the desired gene to be expressed. Med ia formulations have been described  in DSM or ATCC Catalogs and Sambrook et al., In: M olecular Cloning, a Laboratory Manual  (2nd ed.), Cold Spring Harbor Laboratory Press, Cold� �Spring Harbor, N.Y. (1989). 

[131] Recombinant host cells producing the reverse transcrip tases of this invention can be  separated from liquid culture, for example, by centri fugation. In general, the collected  microbial cells are dispersed in a suitable buffer,  and then broken open by ultrasonic  treatment or by other well‐known procedures to allo w extraction of the enzymes by the  buffer solution. After removal of cell debris by ult racentrifugation or centrifugation, the  reverse transcriptases can be purified by standard pr otein purification techniques such as  extraction, precipitation, chromatography, affinity chro matography, electrophoresis or the  like. Assays to detect the presence of the reverse  transcriptase during purification are well  known in the art and can be used during conventiona l biochemical purification methods to  determine the presence of these enzymes. 

[132] In some embodiments, reverse transcriptases of the pr esent invention may be  mutated to contain an affinity tag in order to faci litate the purification of the reverse  transcriptase. Suitable affinity tags are well known  to those skilled in the art and include, but  are not limited to, repeated sequences of amino acid s such as six histidines, epitopes such as  the hemagglutinin epitope and the myc epitope, and o ther amino acid sequences that permit  the simplified purification of the reverse transcripta se. 

[133] The invention further provides fusion proteins compris ing (1) a protein, or fragment  thereof, having one or more activity associated with� �a reverse transcriptase and (2) a tag  (e.g., an affinity tag). In particular embodiments, t he invention includes a reverse 

transcriptase (e.g., a thermostable reverse transcripta se) described herein having one or  more (e.g., one, two, three, four, five, six, seven,  eight, etc.) tags. These tags may be located,  for example, (1) at the N‐terminus, (2) at the C� ��terminus, or (3) at both the N‐terminus and C‐ terminus of the protein, or a fragment thereof havin g one or more activities associated with 

a reverse transcriptase. A tag may also be locate d internally (e.g., between regions of amino  acid sequence derived from a reverse transcriptase an d/or attached to an amino acid side  chain). For example, Ferguson et al., Protein Sci. 7 :1636‐1638 (1998), describe a siderophore  receptor, FhuA, from Escherichia coli into which an  affinity tag (i.e., a hexahistidine  sequence) was inserted. This tag was shown to functi on in purification protocols employing  metal chelate affinity chromatography. Additional fusio n proteins with internal tags are  described in U.S. Pat. No. 6,143,524, the entire dis closure of which is incorporated herein by  reference. 

[134] Tags used to prepare compositions of the invention m ay vary in length but will  typically be from about 5 to about 500, from about� �5 to about 100, from about 10 to about  100, from about 15 to about 100, from about 20 to� �about 100, from about 25 to about 100,  from about 30 to about 100 from about 35 to about� �100, from about 40 to about 100, from  about 45 to about 100, from about 50 to about 100,  from about 55 to about 100, from about  60 to about 100, from about 65 to about 100, from� �about 70 to about 100, from about 75 to  about 100, from about 80 to about 100, from about  85 to about 100, from about 90 to about  100, from about 95 to about 100, from about 5 to  about 80, from about 10 to about 80, from  about 20 to about 80, from about 30 to about 80,  from about 40 to about 80, from about 50  to about 80, from about 60 to about 80, from about  70 to about 80, from about 5 to about  60, from about 10 to about 60, from about 20 to a bout 60, from about 30 to about 60, from  about 40 to about 60, from about 50 to about 60,  from about 5 to about 40, from about 10  to about 40, from about 20 to about 40, from about  30 to about 40, from about 5 to about  30, from about 10 to about 30, from about 20 to a bout 30, from about 5 to about 25, from  about 10 to about 25, or from about 15 to about 2 5 amino acid residues in length. 

[135] Tags used to prepare compositions of the invention i nclude those which contribute to  the thermostability of the fusion protein. Thus, thes e tags may be at least partly responsible,  for example, for a particular protein (e.g., a prote in having one or more activities of a reverse  transcriptase activity) having increased thermostability . Examples of tags that enhance the  thermostability of a reverse transcriptase (i.e., M‐ MLV reverse transcriptase) include, but are  not limited to, tags having the following amino acid  sequences: 

MGGSHHHHHHGMASMTGGQQMGRDLYDDDDKH and MASGTGGQQMGRDLYDDDDKH .  Fragments of these tags may also be used in accorda nce with the invention (preferably those  having 3 or more, 5 or more, 10 or more, or 15 o r more amino acids) Thus, the invention 

includes, in part, reverse transcriptases, or fragm ents thereof that comprise tags and  demonstrate enhanced thermostability. Using well known� �methods, one of skill in the art can  attach one or more of above‐mentioned tags to one� �or more RT enzymes, or fragments  thereof having reverse transcriptase activity, to prod uce a thermostable reverse 

transcriptase enzyme or fragment thereof.  

[136] Tags used in the practice of the invention may serv e any number of purposes and a  number of tags may be added to impart one or more� �different functions to the reverse  transcriptase of the invention. For example, tags may  (1) contribute to protein‐protein  interactions both internally within a protein and wit h other protein molecules, (2) make the  protein amenable to particular purification methods, ( 3) enable one to identify whether the  protein is present in a composition; or (4) give th e protein other functional characteristics.  [137] Examples of tags which may be used in the practice� �of the invention include metal  binding domains (e.g., a poly‐histidine segments suc h as a three, four, five, six, or seven  histidine region), immunoglobulin binding domains (e.g. , (1) Protein A; (2) Protein G; (3) T  cell, B cell, and/or Fc receptors; and/or (4) comple ment protein antibody‐binding domain);  sugar binding domains (e.g., a maltose binding domain , chitin‐binding domain); and  detectable domains (e.g., at least a portion of beta ‐galactosidase). Fusion proteins may  contain one or more tags such as those described ab ove. Typically, fusion proteins that  contain more than one tag will contain these tags a t one terminus or both termini (i.e., the  N‐terminus and the C‐terminus) of the reverse tra nscriptase, although one or more tags may  be located internally instead of or in addition to  those present at termini. Further, more than  one tag may be present at one terminus, internally  and/or at both termini of the reverse  transcriptase. For example, three consecutive tags cou ld be linked end‐to‐end at the N‐ terminus of the reverse transcriptase. The invention  further include compositions and  reaction mixture which contain the above fusion prote ins, as well as methods for preparing  these fusion proteins, nucleic acid molecules (e.g.,  vectors) which encode these fusion  proteins and recombinant host cells which contain the se nucleic acid molecules. The  invention also includes methods for using these fusio n proteins as described elsewhere  herein (e.g., methods for reverse transcribing nucleic  acid molecules). 

[138] Tags which enable one to identify whether the fusion  protein is present in a 

composition include, for example, tags which can be  used to identify the protein in an   

electrophoretic gel. A number of such tags are kn own in the art and include epitopes and  antibody binding domains which can be used for Weste rn blots. 

[139] The amino acid composition of the tags for use in  the present invention may vary. In  some embodiments, a tag may contain from about 1% t o about 5% amino acids that have a  positive charge at physiological pH, e.g., lysine, ar ginine, and histidine, or from about 5% to  about 10% amino acids that have a positive charge a t physiological pH, or from about 10% to  about 20% amino acids that have a positive charge a t physiological pH, or from about 10% to  about 30% amino acids that have a positive charge a t physiological pH, or from about 10% to  about 50% amino acids that have a positive charge a t physiological pH, or from about 10% to  about 75% amino acids that have a positive charge a t physiological pH. In some 

embodiments, a tag may contain from about 1% to abo ut 5% amino acids that have a  negative charge at physiological pH, e.g., aspartic a cid and glutamic acid, or from about 5% to  about 10% amino acids that have a negative charge a t physiological pH, or from about 10%  to about 20% amino acids that have a negative charg e at physiological pH, or from about  10% to about 30% amino acids that have a negative  charge at physiological pH, or from  about 10% to about 50% amino acids that have a neg ative charge at physiological pH, or  from about 10% to about 75% amino acids that have  a negative charge at physiological pH. In  some embodiments, a tag may comprise a sequence of  amino acids that contains two or  more contiguous charged amino acids that may be the� �same or different and may be of the  same or different charge. For example, a tag may co ntain a series (e.g., two, three, four, five,  six, ten etc.) of positively charged amino acids tha t may be the same or different. A tag may  contain a series (e.g., two, three, four, five, six,  ten etc.) of negatively charged amino acids  that may be the same or different. In some embodime nts, a tag may contain a series (e.g.,  two, three, four, five, six, ten etc.) of alternatin g positively charged and negatively charged  amino acids that may be the same or different (e.g. , positive, negative, positive, negative,  etc.). Any of the above‐described series of amino  acids (e.g., positively charged, negatively  charged or alternating charge) may comprise one or m ore neutral polar or non‐polar amino  acids (e.g., two, three, four, five, six, ten etc.)� �spaced between the charged amino acids. Such  neutral amino acids may be evenly distributed through out the series of charged amino acids  (e.g., charged, neutral, charged, neutral) or may be� �unevenly distributed throughout the  series (e.g., charged, a plurality of neutral, charge d, neutral, a plurality of charged, etc.). In  some embodiments, tags to be attached to the polypep tides of the invention may have an 

overall charge at physiological pH (e.g., positive� �charge or negative charge). The size of the  overall charge may vary, for example, the tag may c ontain a net plus one, two, three, four,  five, etc. or may possess a net negative one, two,� �three, four, five, etc. The present invention  also provides reverse transcriptases (e.g., thermostabl e reverse transcriptases) comprising  one or more of the above‐described tag sequences,  vectors encoding such reverse  transcriptases, host cells reaction mixture, compositio ns and reaction mixtures comprising  such reverse transcriptases, as well as kits comprisi ng containers containing such reverse  transcriptases. 

[140] In some embodiments, it may be desirable to remove  all or a portion of a tag 

sequence from a fusion protein comprising a tag sequ ence and a sequence having reverse  transcriptase (RT) activity. In embodiments of this t ype, one or more amino acids forming a  cleavage site, e.g., for a protease enzyme, may be  incorporated into the primary sequence of  the fusion protein. The cleavage site may be located  such that cleavage at the site may  remove all or a portion of the tag sequence from t he fusion protein. In some embodiments,  the cleavage site may be located between the tag se quence and the sequence having RT  activity such that all of the tag sequence is remov ed by cleavage with a protease enzyme that  recognizes the cleavage site. Examples of suitable cl eavage sites include, but are not limited  to, the Factor Xa cleavage site having the sequence� �Ile‐Glu‐Gly‐Arg, which is recognized and  cleaved by blood coagulation factor Xa, and the thro mbin cleavage site having the sequence  Leu‐Val‐Pro‐Arg, which is recognized and cleaved� �by thrombin. Other suitable cleavage sites  are known to those skilled in the art and may be  used in conjunction with the present  invention. 

[141] In some embodiments, the reverse transcriptases of th e invention have specific  activities (e.g., RNA‐directed DNA polymerase activit y and/or RNase H activity) greater than  about 5 units/mg, preferably greater than about 50 u nits/mg, more preferably greater than  about 100 units/mg, 250 units/mg, 500 units/mg, 1000� �units/mg, 5000 units/mg or 10,000  units/mg, and most preferably greater than about 15,0 00 units/mg, greater than about  16,000 units/mg, greater than about 17,000 units/mg,  greater than about 18,000 units/mg,  greater than about 19,000 units/mg and greater than  about 20,000 units/mg. In some  embodiments, the reverse transcriptases of the present  invention may have specific activities  greater than about 50,000 units/mg, greater than abou t 100,000 units/mg, greater than  about 150,000 units/mg, greater than about 200,000 un its/mg, greater than about 250,000 

units/mg and greater than about 300,000 units/mg.  Preferred ranges of specific activities for  the reverse transcriptases of the invention include a  specific activity from about 5 units/mg  to about 750,000 units/mg, a specific activity from  about 5 units/mg to about 500,000  units/mg, from about 5 units/mg to about 300,000 uni ts/mg, a specific activity of from about  50 units/mg to about 750,000 units/mg, a specific ac tivity from about 100 units/mg to about  750,000 units/mg, a specific activity from about 250� �units/mg to about 750,000 units/mg, a  specific activity from about 500 units/mg to about 7 50,000 units/mg, a specific activity from  about 1000 units/mg to about 750,000 units/mg, a spe cific activity from about 5000  units/mg to about 750,000 units/mg, a specific activi ty from about 10,000 units/mg to about  750,000 units/mg, a specific activity from about 25,0 00 units/mg to about 750,000 units/mg,  a specific activity from about 100 units/mg to about  500 units/mg, a specific activity from  about 100 units/mg to about 400 units/mg, and a spe cific activity from about 200 units/mg  to about 500 units/mg. Other preferred ranges of spe cific activities include a specific activity  of from about 200,000 units/mg to about 350,000 unit s/mg, a specific activity from about  225,000 units/mg to about 300,000 units/mg, a specifi c activity from about 250,000 units/mg  to about 300,000 units/mg, a specific activity of fr om about 200,000 units/mg to about  750,000 units/mg, a specific activity of from about  200,000 units/mg to about 500,000  units/mg, a specific activity of from about 200,000  units/mg to about 400,000 units/mg, a  specific activity of from about 250,000 units/mg to  about 750,000 units/mg, a specific activity  of from about 250,000 units/mg to about 500,000 unit s/mg, and a specific activity of from  about 250,000 units/mg to about 400,000 units/mg. Pre ferably, the lower end of the specific  activity range may vary from 50, 100, 200, 300, 400 , 500, 700, 900, 1,000, 5,000, 10,000,  20,000, 30,000, 35,000, 40,000, 45,000, 50,000, 55,000 , 60,000, 65,000, 70,000, 75,000, and  80,000 units/mg, while the upper end of the range m ay vary from 750,000, 650,000, 600,000,  550,000, 500,000, 450,000, 400,000, 350,000, 300,000,  250,000, 200,000, 150,000, 140,000,  130,000, 120,000, 110,000, 100,000, and 90,000 units/m g. Specific activity may be  determined using enzyme assays and protein assays wel l known in the art. DNA polymerase  assays and RNase H assays are described, for example , in U.S. Pat. No. 5,244,797 and WO  98/47912, the disclosures of which are fully incorpor ated herein by reference. In some  embodiments of the present invention, the specific ac tivity of the thermostable reverse  transcriptase prepared in accordance with the present� �invention may be higher than the  specific activity of a non‐thermostable (e.g., wild� �type) reverse transcriptase. In some 

embodiments, the specific activity of the thermosta ble reverse transcriptase may be 5%,  10,%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%,� �90%, 100% or more higher than the  specific activity of a corresponding non‐thermostable  reverse transcriptase. In some  preferred embodiments, the specific activity of the t hermostable reverse transcriptase  according to the present invention may be 30% or mo re than the specific activity of a  corresponding non‐thermostable reverse transcriptase.  In accordance with the invention,  specific activity is a measurement of the enzymatic  activity (in units) of the protein or  enzyme relative to the total amount of protein or e nzyme used in a reaction. The 

measurement of a specific activity may be determined� �by standard techniques well‐known to  one of ordinary skill in the art.   

Compositions and Reaction Mixtures Comprising Revers e Transcriptases 

[142] The present teachings provide compositions comprising  a variety of components in  various combinations.  In some embodiments of the pr esent invention, the compositions are  formulated by admixing one or more reverse transcript ases a in a buffered salt solution. One  or more DNA polymerases and/or one or more nucleotid es, and/or one or more primers may  optionally be added to make the compositions of the� �invention. These compositions can be  used in the present methods to produce, analyze, qua ntitate and otherwise manipulate  nucleic acid molecules (e.g., using reverse transcript ion or one‐step (coupled) RT‐PCR  procedures).  

[143] In some embodiments, the enzymes are provided at wor king concentrations (e.g., 1x)  in stable buffered salt solutions. The terms “stabl e” and “stability” as used herein generally  mean the retention by a composition, such as an enz yme composition, of at least 70%,  preferably at least 80%, and most preferably at leas t 90%, of the original enzymatic activity  (in units) after the enzyme or composition containing  the enzyme has been stored for about  one week at a temperature of about 4°C, about two� �to six months at a temperature of about  −20° C., and about six months or longer at a te mperature of about −80°C. As used herein, the  term “working concentration” means the concentratio n of an enzyme that is at or near the  optimal concentration used in a solution to perform  a particular function (such as reverse  transcription of nucleic acids).   

[144] Such compositions can also be formulated as concentra ted stock solutions (e.g., 2x,  3x, 4x, 5x, 6x, 10x, etc.). In some embodiments, ha ving the composition as a concentrated  (e.g., 5x) stock solution allows a greater amount of  nucleic acid sample to be added (such as,  for example, when the compositions are used for nucl eic acid synthesis).  

[145] The water used in forming the compositions of the p resent invention is preferably  distilled, deionized and sterile filtered (through a  0.1‐0.2 micrometer filter), and is free of  contamination by DNase and RNase enzymes. Such water� �is available commercially, for  example from Life Technologies (Carlsbad, CA), or may  be made as needed according to  methods well known to those skilled in the art.  � �

[146] In addition to the enzyme components, the present co mpositions can comprise one  or more buffers and cofactors necessary for synthesis  of a nucleic acid molecule such as a  cDNA molecule. In some embodiments, buffers for use  in forming the present compositions  are the acetate, sulfate, hydrochloride, phosphate or� �free acid forms of Tris‐

(hydroxymethyl)aminomethane (TRIS®) or 4‐(2‐hydroxye thyl)‐1‐piperazineethanesulfonic  acid (HEPES), although alternative buffers of the sam e approximate ionic strength and pKa as  TRIS® or HEPES may be used with equivalent results.  For example, possible buffers for use  with the described enzymes can include, but are not� �limited to 3‐

{[tris(hydroxymethyl)methyl]amino} propanesulfonic acid ( TAPS), N,N‐bis(2‐

hydroxyethyl)glycine (Bicine), (hydroxymethyl)methylamine� �(Tris), N‐

tris(hydroxymethyl)methylglycine (Tricine), 3‐[N‐Tris( hydroxymethyl)methylamino]‐2‐ hydroxypropanesulfonic Acid (TAPSO), 4‐2‐hydroxyethyl ‐1‐piperazineethanesulfonic acid  (HEPES), 2‐ {[tris(hydroxymethyl)methyl]amino} ethanesu lfonic acid (TES),  3‐(N‐

morpholino)propanesulfonic acid (MOPS), piperazine‐N,N� ��bis(2‐ethanesulfonic acid)  (PIPES), and dimethylarsinic acid (cacodylate).   

[147] In addition to buffer salts, cofactor salts such as� �those of potassium (preferably  potassium chloride or potassium acetate) and magnesium  (preferably magnesium chloride or  magnesium acetate) are contemplated for use in the c ompositions of the invention.  

[148] Addition of one or more carbohydrates and/or sugars  to the compositions and/or  synthesis reaction mixtures may also be advantageous,� �to support enhanced stability of the  compositions upon storage and/or reaction mixtures dur ing synthesis. In some 

embodiments, carbohydrates or sugars for inclusion in� �the compositions and/or synthesis  reaction mixtures of the invention include, but are  not limited to, sucrose, trehalose, 

glycerol, and the like. In some embodiments, treha lose is provided at concentrations ranging  from 0.01M to 5M (e.g., 0.01 M, 0.05 M, 0.1 M, 0. 5 M, 0.75 M, 1.0 M, 2.0 M, 3.0 M, 4.0 M or  5.0 M). In some embodiments, glycerol is provided at  concentrations ranging from 5% to  60%. (e.g., 5%, 10%, 15%, 25%, 30%, 40%, 50%, 60%).  Furthermore, such carbohydrates  and/or sugars may be added to the storage buffers f or the enzymes used in the production of  the enzyme compositions and kits of the invention an d may be provided in compositions that  are either in liquid or dry form (e.g., lyophilized) .  Such carbohydrates and/or sugars are  commercially available from a number of sources, incl uding Sigma (St. Louis, Mo.).  

[149] Likewise, addition of one or more surfactants and/or� �detergents to the compositions  and/or synthesis reaction mixtures may also be advant ageous, to support enhanced stability  of the compositions and/or reaction mixtures upon sto rage. Preferred such detergents for  inclusion in the compositions and/or synthesis reactio n mixtures of the invention include, but  are not limited to Tween 20, Nonidet P 40 (NP‐40) , Brij58, CHAPS, Big CHAPS, CHAPS, and the  like.  Other surfactants or detergents, such as thos e described in pending U.S. Application  Nos. 13/492,576 and 61/895,876 (the disclosures of wh ich are incorporated herein by  reference in their entirety) may also be included in  the compositions and/or synthesis  reaction mixtures of the invention. Furthermore, such� �detergents may be added to the  storage buffers for the enzymes used in the producti on of the enzyme compositions and kits  of the invention. Examples of such detergents are co mmercially available from a number of  sources, including Sigma (St. Louis, Mo.). 

[150] It is often preferable to first dissolve the buffer� �salts, cofactor salts, carbohydrates or  sugars, or detergents at working concentrations in wa ter and to adjust the pH of the solution  prior to addition of the enzymes. In this way, the� �pH‐sensitive enzymes will be less subject to  acid‐ or alkaline‐mediated inactivation during form ulation of the present compositions. Thus,  in some embodiments, buffered salt solutions are form ulated by combining a buffer salt such  as a salt of Tris(hydroxymethyl)aminomethane (TRIS®)  or the hydrochloride salt thereof, with  a sufficient quantity of water.  In some embodiments , this combination yields a solution  having a TRIS® concentration of 5‐150 millimolar,  preferably 10‐60 millimolar, and most  preferably about 20‐60 millimolar. To this solution,  a salt of magnesium (preferably either  the chloride or acetate salt thereof) or other dival ent cation, may be added to provide a  working concentration thereof of 1‐10 millimolar, pr eferably 1.5‐8.0 millimolar, and most  preferably about 3‐7.5 millimolar. A salt of potass ium (preferably a chloride or acetate salt of 

potassium), or other monovalent cation (e.g., Na),� �may also be added to the solution, at a  working concentration of 10‐100 millimolar and most� �preferably about 75 millimolar. A  reducing agent, such as dithiothreitol, may be added� �to the solution, preferably at a final  concentration of about 1‐100 mM, more preferably a� �concentration of about 5‐50 mM or  about 7.5‐20 mM, and most preferably at a concentr ation of about 10 mM. Preferred  concentrations of carbohydrates and/or sugars for incl usion in the compositions of the  invention range from about 5% (w/v) to about 30% (w /v), from about 7.5% (w/v) to about  25% (w/v), from about 10% (w/v) to about 25% (w/v),  from about 10% (w/v) to about 20%  (w/v), and preferably from about 10% (w/v) to about� �15% (w/v). Preferred concentrations of  surfactants and/or detergents for inclusion in the co mpositions of the invention range from  about 0.001% (w/v) to about 5% (w/v), from about 0. 002% (w/v) to about 2% (w/v), from  about 0.004% (w/v) to about 1% (w/v), from about 0. 01% (w/v) to about 0.5% (w/v), and  preferably from about 0.05% (w/v) to about 0.1% (w/v ). A small amount of a salt of  ethylenediaminetetraacetate (EDTA), such as disodium ED TA, may also be added (preferably  about 0.1 millimolar). In some embodiments, after add ition of all buffers and salts, this  buffered salt solution is mixed well until all salts  are dissolved, and the pH is adjusted using  methods known in the art.  In some embodiments, the  final buffer pH ranges from about 6.0  to about 9.5, from about 6.9 to about 8.7, or from  about 7.3 to about 8.3. 

[151] To these buffered salt solutions, the enzymes (revers e transcriptases) are added to  produce the compositions of the present invention. In  some embodiments, reverse  transcriptases are added at a working concentration i n the solution of from about 1,000 to  about 50,000 units per milliliter, from about 2,000  to about 30,000 units per milliliter, from  about 2,500 to about 25,000 units per milliliter, fr om about 3,000 to about 22,500 units per  milliliter, from about 4,000 to about 20,000 units p er milliliter, or from about 5,000 to about  20,000 units per milliliter. In some embodiments, a  reverse transcriptases of the invention  (e.g., an M‐MLV reverse transcriptase) may be added  at a working concentration described  above in a first strand reaction mixture (e.g., a r eaction to reverse transcribe an mRNA  molecule) and/or in a reverse transcription coupled w ith a polymerase chain reaction. A  suitable concentration of a reverse transcriptase of  the invention for these reactions may be  from about 5,000 units/ml to about 50,000 units/ml,  from about 5,000 units/ml to about  40,000 units/ml, from about 5,000 units/ml to about  30,000 units/ml, or from about 5,000  units/ml to about 20,000 units/ml of reverse transcri ptase. A reaction may be conducted in a 

volume of 20 μl to 50 μl and such a reaction� �may contain 50 units, 100, units, 200 units, 300  units, 400 units or more of a reverse transcriptase� �of the invention. Those skilled in the art  will appreciate that adding additional reverse transcr iptase may allow increased synthesis of  the first strand (e.g., the DNA strand complementary� �to the mRNA strand) at the expense of  increased enzyme usage. The skilled artisan can deter mine without undue experimentation  the amount of a reverse transcriptase of the inventi on to add to a reaction in order to  produce a desired amount of product at an acceptable  expense. 

[152] In some embodiments, mutant reverse transcriptases des cribed herein are provided  at a working concentration in solution from about 10 0 to about 5000 units per milliliter, from  about 125 to about 4000 units per milliliter, from  about 150 to about 3000 units per milliliter,  from about 200 to about 2500 units per milliliter,  from about 225 to about 2000 units per  milliliter, and most preferably at a working concentr ation of from about 250 to about 1000  units per milliliter. The enzymes may be added to t he solution in any order, or may be added  simultaneously. 

[153] The compositions of the invention may further compris e one or more nucleotides,  which are preferably deoxynucleoside triphosphates (dNT Ps) or dideoxynucleoside  triphosphates (ddNTPs). The dNTP components of the pr esent compositions serve as the  “building blocks” for newly synthesized nucleic ac ids, being incorporated therein by the  action of the polymerases, and the ddNTPs may be us ed in sequencing methods according to  the invention. Examples of nucleotides suitable for u se in the present compositions include,  but are not limited to, dUTP, dATP, dTTP, dCTP, dGT P, dITP, 7‐deaza‐dGTP, α‐thio‐dATP, α‐ thio‐dTTP, α‐thio‐dGTP, α‐thio‐dCTP, ddUTP,  ddATP, ddTTP, ddCTP, ddGTP, ddITP, 7‐deaza‐ ddGTP, α‐thio‐ddATP, α‐thio‐ddTTP, α‐thio‐ ddGTP, α‐thio‐ddCTP or derivatives thereof, all o f  which are available commercially from sources includin g Invitrogen Corporation (Carlsbad,  Calif.), New England BioLabs (Beverly, Mass.) and Sig ma Chemical Company (Saint Louis,  Mo.). The nucleotides may be unlabeled, or they may� �be detectably labeled by coupling them  by methods known in the art with radioisotopes (e.g. ,  ³ H,  ¹⁴ C,  ³² P or  ³⁵ S), vitamins (e.g.,  biotin), fluorescent moieties (e.g., fluorescein, rhoda mine, Texas Red, or phycoerythrin),  chemiluminescent labels (e.g., using the PHOTO‐GENE� � or ACES™ chemiluminescence  systems, available commercially from Life Technologies� �(Carlsbad, Calif.)), dioxigenin and the  like. Labeled nucleotides may also be obtained commer cially, for example from Life 

Technologies (Carlsbad, Calif.) or Sigma Chemical Comp any (Saint Louis, Mo.). In some 

embodiments of the present compositions, the nucleo tides are added to give a working  concentration of each nucleotide of about 10‐4000 m icromolar, about 50‐2000 micromolar,  about 100‐1500 micromolar, or about 200‐1200 micro molar, or about 1000 micromolar.  [154] In accordance with the present teachings, one or mor e agents can also be added to  the present compositions to assist in overcoming the� �inhibition of RT reactions by a variety of  compounds often found in samples used for nucleic ac id preparation, isolation or 

purification. Such inhibitors can include, for example , heparin (blood); hematin (blood); EDTA  (blood); citrate (blood); immunoglobin G (blood, serum ); humic acid (soil, feces); lactoferrin  (milk, saliva, other secretory fluids); urea (urine);� �plant polysaccharides (plants); melanin  (skin, hair); myoglobin (tissue); and indigo dye (tex tiles). Such agents for use in overcoming  RT inhibition can include proteins such as, but not� �limited to, albumin (e.g. bovine serum  albumin (BSA), recombinant BSA and albumins derived f rom other species), α‐lacalbumin, β‐ lactoblogulin, casein, apotransferrin, spermine, gelatin  (e.g., human recombinant gelatin, fish  gelatin and gelatins derived from other species), and  DNA‐binding proteins (e.g., phage T4  gene 32 (T4gP32)), or peptide or polypeptide variants , fragments or derivatives thereof.  Other non‐protein based PCR inhibitor blocking agent s for use in the present teachings can  include, for example, deferoxamine mesylate. Some pref erred proteins for use as PCR  inhibitor blocking agents include bovine serum albumin  (BSA), fish gelatin, and T4gP32  proteins. In some embodiments, anti‐RT inhibitor age nts are added to the present  compositions to give a final concentration in a work ing solution of about 1 ng/μL to about  10,000 ng/μL, about 50 ng/μL to about 8000 ng/μL,  about 100 ng/μL to about 6000 ng/μL,  about 200 ng/μL to about 5000 ng/μL or preferably� �about 500 ng/μL to about 3000 ng/μL.  Anti‐RT inhibitor agents can also be added as a p ercentage of the final concentration in a  working solution, for example, from about 0.001% to  about 15%, about 0.05% to about 10%,  about 0.01% to about 5%, or preferably about 0.1% t o about 1%. The addition of these anti‐ RT inhibitor agents, both individually or in combinat ion, can increase tolerance to such RT  inhibitor contaminants. Thus, the present compositions� �can further comprise agents that  work alone or in combination to increase tolerance t o various inhibitors including, for  example, ethanol, bile salts, humic acid, hematin, an d heparin. 

[155] In some embodiments, component deterioration can be r educed by storage of the  reagent compositions at a temperature of about ‐80� �C (for up to two years) or at a  temperature of about −20° C (for up to one year) .   

[156] In some embodiments, the present compositions can be� �packaged in a suitable  container or vessel capable of holding the compositio n and which will not significantly  interact with components of the composition. The cont ainer or vessel can be designed to  permit easy dispensing of the dosage form by individ uals or by a liquid handling instrument.  The containers or vessels of such composition can be  further packaged into multi‐pack units.  [157] In another aspect, the compositions and reverse trans criptases of the invention may  be prepared and stored in dry form (e.g., lyophilize d) in the presence of one or more  carbohydrates, sugars, or synthetic polymers. Preferred  carbohydrates, sugars or polymers  for the preparation of dried compositions or reverse� �transcriptases include, but are not  limited to, sucrose, trehalose, and polyvinylpyrrolidon e (PVP) or combinations thereof. See,  e.g., U.S. Pat. Nos. 5,098,893, 4,891,319, and 5,556, 771, the disclosures of which are entirely  incorporated herein by reference. Such dried compositi ons and enzymes may be stored at  various temperatures for extended times without signif icant deterioration of enzymes or  components of the compositions of the invention. In  some preferred embodiments, the  dried reverse transcriptases or compositions are store d at about −20°C to about 25°C. 

[158] The invention further includes compositions for revers e transcribing nucleic acid  molecules, as well as reverse transcription methods e mploying such compositions and  product nucleic acid molecules produced using such me thods. In many instances, 

compositions of the invention may contain one or mor e of the following components: (1) one  or more buffering agent (e.g., sodium phosphate, sodi um acetate, 2‐(N‐morpholino)‐ ethanesulfonic acid (MES), tris‐(hydroxymethyl)aminomet hane (Tris), 3‐(cyclohexylamino)‐2‐ hydroxy‐1‐propanesulfonic acid (CAPS), citrate, N‐ 2‐hydroxyethylpiperazine‐N‐2‐

ethanesulfonic acid (HEPES), acetate, 3‐(N‐morpholin o)propanesulfonic acid (MOPS), N‐ tris(hydroxymethyl)methyl‐3‐aminopropanesulfonio acid  (TAPS), etc.), (2) one or more  monovalent cationic salt (e.g., NaCl, KCl, etc.), (3)  one or more divalent cationic salt (e.g.,  MnCl2, MgCl2, MgSO4, CaCl2, etc.), (4) one or more  reducing agent (e.g., dithiothreitol, β‐ mercaptoethanol, etc.), (5) one or more ionic or non ‐ionic detergent (e.g., TRITON X‐100™,  NONIDET P40™, sodium dodecyl sulphate, etc.), (6) o ne or more DNA polymerase inhibitor  (e.g., Actinomycin D, etc.), (7) nucleotides (e.g., d NTPs, such as dGTP, dATP, dCTP, dTTP, etc.),  (8) RNA to be reverse transcribed and/or amplified,  (9) one or more RNase inhibitor (e.g.,  RNASEOUT™, Invitrogen Corporation, Carlsbad, Calif.,  catalog number 10777‐019 etc.), (10) a  reverse transcriptase (e.g., a reverse transcriptase o f the invention, and/or (11) one or more 

diluent (e.g., water). Other components and/or cons tituents (e.g., primers, DNA  polymerases, etc.) may also be present in composition s.  In certain embodiments,  compositions used for sequencing may contain one or  more of the following components: (1)  a single‐ stranded RNA template, (2) a primer, (3)  nucleotides, (4) a label such as a  radioactive label conjugated with the nucleotide base� �or a fluorescent label conjugated to  the primer, and/or (5) a terminating agent, such as� �a chain terminator base comprising a  dideoxynucleotide (ddATP, ddGTP, ddCTP, or ddTTP. 

[159] The concentration of the buffering agent in the comp ositions of the invention will  vary with the particular buffering agent used. Typica lly, the working concentration (i.e., the  concentration in the reaction mixture) of the bufferi ng agent will be from about 5 mM to  about 500 mM (e.g., about 10 mM, about 15 mM, abou t 20 mM, about 25 mM, about 30  mM, about 35 mM, about 40 mM, about 45 mM, about  50 mM, about 55 mM, about 60 mM,  about 65 mM, about 70 mM, about 75 mM, about 80 m M, about 85 mM, about 90 mM,  about 95 mM, about 100 mM, from about 5 mM to abo ut 500 mM, from about 10 mM to  about 500 mM, from about 20 mM to about 500 mM, f rom about 25 mM to about 500 mM,  from about 30 mM to about 500 mM, from about 40 m M to about 500 mM, from about 50  mM to about 500 mM, from about 75 mM to about 500  mM, from about 100 mM to about  500 mM, from about 25 mM to about 50 mM, from abo ut 25 mM to about 75 mM, from  about 25 mM to about 100 mM, from about 25 mM to� �about 200 mM, from about 25 mM to  about 300 mM, etc.). When Tris (e.g., Tris‐HCl) is  used, the Tris working concentration will  typically be from about 5 mM to about 100 mM, from  about 5 mM to about 75 mM, from  about 10 mM to about 75 mM, from about 10 mM to  about 60 mM, from about 10 mM to  about 50 mM, from about 25 mM to about 50 mM, etc . 

[160] The final pH of solutions of the invention will gen erally be set and maintained by  buffering agents present in compositions of the inven tion. The pH of compositions of the  invention, and hence reaction mixtures of the inventi on, will vary with the particular use and  the buffering agent present but will often be from  about pH 5.5 to about pH 9.0 (e.g., about  pH 6.0, about pH 6.5, about pH 7.0, about pH 7.1,� �about pH 7.2, about pH 7.3, about pH 7.4,  about pH 7.5, about pH 7.6, about pH 7.7, about pH  7.8, about pH 7.9, about pH 8.0, about  pH 8.1, about pH 8.2, about pH 8.3, about pH 8.4,� �about pH 8.5, about pH 8.6, about pH 8.7,  about pH 8.8, about pH 8.9, about pH 9.0, from abo ut pH 6.0 to about pH 8.5, from about pH  6.5 to about pH 8.5, from about pH 7.0 to about p H 8.5, from about pH 7.5 to about pH 8.5, 

from about pH 6.0 to about pH 8.0, from about p H 6.0 to about pH 7.7, from about pH 6.0 to  about pH 7.5, from about pH 6.0 to about pH 7.0,  from about pH 7.2 to about pH 7.7, from  about pH 7.3 to about pH 7.7, from about pH 7.4 t o about pH 7.6, from about pH 7.0 to  about pH 7.4, from about pH 7.6 to about pH 8.0,  from about pH 7.6 to about pH 8.5, from  about pH 7.7 to about pH 8.5, from about pH 7.9 t o about pH 8.5, from about pH 8.0 to  about pH 8.5, from about pH 8.2 to about pH 8.5,  from about pH 8.3 to about pH 8.5, from  about pH 8.4 to about pH 8.5, from about pH 8.4 t o about pH 9.0, from about pH 8.5 to  about pH 9.0, etc.) 

[161] As indicated, one or more monovalent cationic salts  (e.g., NaCl, KCl, etc.) may be  included in compositions of the invention. In many i nstances, salts used in compositions of  the invention will dissociate in solution to generate  at least one species which is monovalent  (e.g., Na+, K+, etc.) When included in compositions  of the invention, salts will often be  present either individually or in a combined concentr ation of from about 0.5 mM to about  500 mM (e.g., about 1 mM, about 2 mM, about 3 mM,  about 5 mM, about 10 mM, about 12  mM, about 15 mM, about 17 mM, about 20 mM, about  22 mM, about 23 mM, about 24 mM,  about 25 mM, about 27 mM, about 30 mM, about 35 m M, about 40 mM, about 45 mM,  about 50 mM, about 55 mM, about 60 mM, about 64 m M, about 65 mM, about 70 mM,  about 75 mM, about 80 mM, about 85 mM, about 90 m M, about 95 mM, about 100 mM,  about 120 mM, about 140 mM, about 150 mM, about 17 5 mM, about 200 mM, about 225  mM, about 250 mM, about 275 mM, about 300 mM, abou t 325 mM, about 350 mM, about  375 mM, about 400 mM, from about 1 mM to about 50 0 mM, from about 5 mM to about  500 mM, from about 10 mM to about 500 mM, from ab out 20 mM to about 500 mM, from  about 30 mM to about 500 mM, from about 40 mM to� �about 500 mM, from about 50 mM to  about 500 mM, from about 60 mM to about 500 mM, f rom about 65 mM to about 500 mM,  from about 75 mM to about 500 mM, from about 85 m M to about 500 mM, from about 90  mM to about 500 mM, from about 100 mM to about 50 0 mM, from about 125 mM to about  500 mM, from about 150 mM to about 500 mM, from a bout 200 mM to about 500 mM, from  about 10 mM to about 100 mM, from about 10 mM to� �about 75 mM, from about 10 mM to  about 50 mM, from about 20 mM to about 200 mM, fr om about 20 mM to about 150 mM,  from about 20 mM to about 125 mM, from about 20 m M to about 100 mM, from about 20  mM to about 80 mM, from about 20 mM to about 75  mM, from about 20 mM to about 60  mM, from about 20 mM to about 50 mM, from about 3 0 mM to about 500 mM, from about 

30 mM to about 100 mM, from about 30 mM to abo ut 70 mM, from about 30 mM to about  50 mM, etc.). 

[162] As indicated, one or more divalent cationic salts (e .g., MnCl ₂ , MgCl ₂ , MgSO ₄ , CaCl ₂ ,  etc.) may be included in compositions of the inventi on. In many instances, salts used in  compositions of the invention will dissociate in solu tion to generate at least one species  which is monovalent (e.g., Mg ⁺⁺ , Mn ⁺⁺ , Ca ⁺⁺ , etc.). When included in compositions of the  invention, salts will often be present either individ ually or in a combined concentration of  from about 0.5 mM to about 500 mM (e.g., about 1  mM, about 2 mM, about 3 mM, about 4  mM, about 5 mM, about 6 mM, about 7 mM, about 8  mM, about 9 mM, about 10 mM, about  12 mM, about 15 mM, about 17 mM, about 20 mM, abo ut 22 mM, about 23 mM, about 24  mM, about 25 mM, about 27 mM, about 30 mM, about  35 mM, about 40 mM, about 45 mM,  about 50 mM, about 55 mM, about 60 mM, about 64 m M, about 65 mM, about 70 mM,  about 75 mM, about 80 mM, about 85 mM, about 90 m M, about 95 mM, about 100 mM,  about 120 mM, about 140 mM, about 150 mM, about 17 5 mM, about 200 mM, about 225  mM, about 250 mM, about 275 mM, about 300 mM, abou t 325 mM, about 350 mM, about  375 mM, about 400 mM, from about 1 mM to about 50 0 mM, from about 5 mM to about  500 mM, from about 10 mM to about 500 mM, from ab out 20 mM to about 500 mM, from  about 30 mM to about 500 mM, from about 40 mM to� �about 500 mM, from about 50 mM to  about 500 mM, from about 60 mM to about 500 mM, f rom about 65 mM to about 500 mM,  from about 75 mM to about 500 mM, from about 85 m M to about 500 mM, from about 90  mM to about 500 mM, from about 100 mM to about 50 0 mM, from about 125 mM to about  500 mM, from about 150 mM to about 500 mM, from a bout 200 mM to about 500 mM, from  about 10 mM to about 100 mM, from about 10 mM to� �about 75 mM, from about 10 mM to  about 50 mM, from about 20 mM to about 200 mM, fr om about 20 mM to about 150 mM,  from about 20 mM to about 125 mM, from about 20 m M to about 100 mM, from about 20  mM to about 80 mM, from about 20 mM to about 75  mM, from about 20 mM to about 60  mM, from about 20 mM to about 50 mM, from about 3 0 mM to about 500 mM, from about  30 mM to about 100 mM, from about 30 mM to about� �70 mM, from about 30 mM to about  50 mM, etc.). 

[163] When included in compositions of the invention, reduc ing agents (e.g., dithiothreitol,  β‐mercaptoethanol, etc.) will often be present eith er individually or in a combined  concentration of from about 0.1 mM to about 50 mM  (e.g., about 0.2 mM, about 0.3 mM, 

about 0.5 mM, about 0.7 mM, about 0.9 mM, about� �1 mM, about 2 mM, about 3 mM, about  4 mM, about 5 mM, about 6 mM, about 10 mM, about� �12 mM, about 15 mM, about 17 mM,  about 20 mM, about 22 mM, about 23 mM, about 24 m M, about 25 mM, about 27 mM,  about 30 mM, about 35 mM, about 40 mM, about 45 m M, about 50 mM, from about 0.1 mM  to about 50 mM, from about 0.5 mM to about 50 mM,  from about 1 mM to about 50 mM,  from about 2 mM to about 50 mM, from about 3 mM  to about 50 mM, from about 0.5 mM  to about 20 mM, from about 0.5 mM to about 10 mM,  from about 0.5 mM to about 5 mM,  from about 0.5 mM to about 2.5 mM, from about 1 m M to about 20 mM, from about 1 mM  to about 10 mM, from about 1 mM to about 5 mM, f rom about 1 mM to about 3.4 mM, from  about 0.5 mM to about 3.0 mM, from about 1 mM to� �about 3.0 mM, from about 1.5 mM to  about 3.0 mM, from about 2 mM to about 3.0 mM, fr om about 0.5 mM to about 2.5 mM,  from about 1 mM to about 2.5 mM, from about 1.5 m M to about 2.5 mM, from about 2 mM  to about 3.0 mM, from about 2.5 mM to about 3.0 m M, from about 0.5 mM to about 2 mM,  from about 0.5 mM to about 1.5 mM, from about 0.5� �mM to about 1.1 mM, from about 5.0  mM to about 10 mM, from about 5.0 mM to about 15� �mM, from about 5.0 mM to about 20  mM, from about 10 mM to about 15 mM, from about 1 0 mM to about 20 mM, etc.). 

[164] Compositions of the invention may also contain one o r more ionic or non‐ionic  detergents (e.g., TRITON X‐100™, NONIDET P40™, T ween 20, sodium dodecyl sulphate, etc.).  When included in compositions of the invention, deter gents will often be present either  individually or in a combined concentration of from  about 0.001% to about 5.0% (e.g., about  0.001%, about 0.002%, about 0.003%, about 0.004%, abo ut 0.005%, about 0.006%, about  0.007%, about 0.008%, about 0.009%, about 0.01%, abou t 0.02%,about 0.05%, about 0.1,  about 0.5%, about 1%, about 2%, about 5%, from abou t 0.001% to about 5.0%, from about  0.001% to about 4.0%, from about 0.001% to about 3. 0%, from about 0.001% to about 2.0%,  from about 0.001% to about 1.0%, from about 0.005%  to about 5.0%, from about 0.01% to  about 3.0%, from about 0.01% to about 2.0%, from ab out 0.01% to about 1.0%, from about  0.1% to about 5.0%, from about 0.1% to about 4.0%,� �from about 0.1% to about 3.0%, from  about 0.1% to about 2.0%, from about 0.1% to about� �1.0%, from about 0.1% to about 0.5%,  etc.). For example, compositions of the invention may  contain Tween 20, NP‐40 and/or  TRITON X100™ at a concentration of from about 0.01 % to about 2.0%, from about 0.03% to  about 1.0%, from about 0.04% to about 1.0%, from ab out 0.05% to about 0.5%, from about  0.04% to about 0.6%, from about 0.04% to about 0.3% , etc. 

[165] Other additives capable of facilitating or enhancing  reverse transcription,  amplification, or a combination of both reactions (e. g., agents for facilitating or enhancing  RT‐PCR), other than those disclosed herein, are kno wn in the art. In accordance with the  present compositions and methods, one or more of the se additives can be incorporated in  the present compositions to optimize the generation a nd replication of nucleic acids from a  ribonucleic acid or deoxyribonucleic acid templates. A dditives can be organic or inorganic  compounds. Some additives useful in the present compo sitions, methods and kits include  polypeptides as well as nonpolypeptide additives. Such  additives can include, for example,  RNase inhibitor protein (RIP), uracil DNA glycosylase� �(UDG), lectins, E. coli single‐stranded  binding (SSB) protein, tRNA, rRNA, 7‐deaza‐2‐deox yguanosine (dC7GTP), sulfur‐containing  compounds, acetate‐containing compounds, dimethylsulfox ide (DMSO), ribonuclease  inhibitor (e.g., Rnase OUT™) formamide, betaine, tet ramethylammonium chloride ( TMAC),  polyethylene glycol (PEG), ectoine, sodium azide, kath on, and polyols, to name just a few.  Those of ordinary skill in the art will be able to  identify additional additives for use in  accordance with the present compositions, methods and� �kits. 

[166] Compositions of the invention may also contain one o r more primers.  In some  embodiments, compositions of the invention comprise ol igo(dT) primers. These primers are  typically ~20 bases in length, and anneal to the po lyA tails of mRNA. By targeting the mRNA  fraction, the complexity of the resultant cDNA popula tion is dramatically reduced, since rRNA  and tRNA species will not serve as templates in the  reaction. The drawback of using oligo(dT)  primers is that the resultant cDNA population will h ave a 3' bias, thus compromising the  effectiveness of PCR primers targeting the 5' ends o f transcripts. In addition, due to the 3'  bias, fragmented samples lacking a polyA tail will n ot be reverse transcribed.  

[167] In other embodiments, compositions of the invention c omprise random primers. In  some embodiments, the random primers are a random mi xture of 4 bases of a specified oligo  length. Random hexamer mixes, for example, can be us ed. Each of the random primers can  anneal anywhere the complementary sequence exists with in a given RNA molecule (including  rRNA, tRNA, mRNA, and any fragments of these species ). Reverse transcription using random  primers overcomes concerns about RNA secondary structu re, and RNA fragments, which are  common headaches when using oligo(dT) primers.  

[168] In some other embodiments, compositions of the invent ion comprise locked nucleic  acid (LNA) primers.  The incorporation of LNA into  oligonucleotide primers has been shown 

to increase template binding strength and specifici ty for DNA amplification.  See, e.g.,  Ballantyne, K. N. , et al., Genomics. 2008 Mar;91(3) :301‐5.doi: 10.1016/j.ygeno.2007.10.016.   LNA primers bind to polyA sequences with a higher m elting temperature (Tm) than those  that do not comprise LNA. 

[169] In other embodiments, compositions of the invention c omprise sequence‐specific (or  gene‐specific) primers. Sequence specific primers typ ically offer the greatest specificity and  have been shown to be the most consistent of the p rimer options for reverse transcription.  However, they do not offer the flexibility of oligo( dT) and random primers, meaning that a  new cDNA synthesis reaction must be performed for ea ch gene to be studied. This can  sometimes makes sequence‐specific primers less than  optimal for processing limiting tissue  or cell samples.  In some embodiments, a mixture of  different types of primers (e.g.,  oligo(dT), random, LNA and/or sequence‐specific prime rs are used.   

[170] Compositions of the invention may also comprise one  or more hot start components.    Hot‐start is a common technique used to reduce non specific amplification due to assembly of  nucleic acid synthesis reactions at room temperature.� �At lower temperatures, 

oligonucleotide primers can anneal to template sequenc es that are not perfectly 

complementary. Oftentimes, at these low temperatures e nzymes such as reverse 

transcriptases can extend misannealed primers. This ne wly synthesized region then acts as a  template for primer extension and synthesis of undesi red nucleic acid synthesis products.  However, if the reaction temperature is elevated (e.g ., to temperatures >60°C) before  polymerization begins, the stringency of primer anneal ing is increased, and production of  undesired nucleic acid synthesis products can be avoi ded or reduced.  

[171] The inclusion of hot start components in nucleic aci d synthesis reactions can also  reduce the amount of primer‐dimer synthesized by in creasing the stringency of primer  annealing. At lower temperatures, oligonucleotide prime rs can anneal to each other via  regions of complementarity to form hairpins, for exam ple, and the reverse transcriptase can  extend the annealed primers to produce primer dimers.  The formation of nonspecific  products and primer‐dimers can compete for reagent  availability for synthesis of the desired  product. Thus, hot start techniques can improve the  yield of specific nucleic acid synthesis  products.  

[172] In some embodiments, hot start reactions are assemble d on ice or at room 

temperature, with omission of a critical component un til the reaction is heated to about 

  60°C, at which point the missing reagent is added.� �This omission prevents the reverse  transcriptase from extending primers until the critica l component is added at the higher  temperature where primer annealing is more stringent.� � 

[173] In some other embodiments, the reverse transcriptase  is reversibly inactivated or  physically separated from one or more critical compon ents in the reaction. For example,  magnesium can be sequestered in a wax bead, which m elts as the reaction is heated,  releasing the component only at higher temperatures ( see, e.g., Carothers et al. 1989;  Krishnan et al. 1991; Clark, 1988). The reverse tran scriptase can also be kept in an inactive  state by binding to an oligonucleotide, also known a s an aptamer (see, e.g., Lin and Jayasena,  1997; Dang and Jayasena, 1996) or an antibody (see,� �e.g., Scalice et al. 1994; Sharkey et al.  1994). This bond can then be disrupted at a higher� �temperature, releasing the functional  reverse transcriptase.  

[174] In yet other embodiments, the reverse transcriptase c an be maintained in an inactive  state through chemical modification (see, e.g., Morett i, T. et al 1998).  In some 

embodiments, the chemical modification is reversible.   Thus, in some embodiments, the  reverse transcriptase is chemically modified such that  it is in an inactive state at a lower  temperature (e.g., less than about 55°C) and is ful ly functional/active at an elevated  temperature (e.g., greater than about 55°C). 

[175] Compositions of the invention may also contain one o r more DNA polymerase  inhibitors (e.g., Actinomycin D, etc.). When included� �in compositions of the invention, such  inhibitors will often be present either individually  or in a combined concentration of from  about 0.1 μg/ml to about 100 μg/ml (e.g., about 0 .1 μg/ml, about 0.2 μg/ml, about 0.3  μg/ml, about 0.4 μg/ml, about 0.5 μg/ml, about 0. 6 μg/ml, about 0.7 μg/ml, about 0.8 μg/ml,  about 0.9 μg/ml, about 1.0 μg/ml, about 1.1 μg/ml , about 1.3 μg/ml, about 1.5 μg/ml, about  1.7 μg/ml, about 2.0 μg/ml, about 2.5 μg/ml, abou t 3.5 μg/ml, about 5.0 μg/ml, about 7.5  μg/ml, about 10 μg/ml, about 15 μg/ml, about 20  μg/ml, about 25 μg/ml, about 30 μg/ml,  about 35 μg/ml, about 40 μg/ml, about 50 μg/ml,  about 60 μg/ml, about 70 μg/ml, about 80  μg/ml, about 90 μg/ml, about 100 μg/ml, from abou t 0.5 μg/ml to about 30 μg/ml, from  about 0.75 μg/ml to about 30 μg/ml, from about 1. 0 μg/ml to about 30 μg/ml, from about  2.0 μg/ml to about 30 μg/ml, from about 3.0 μg/m l to about 30 μg/ml, from about 4.0 μg/ml  to about 30 μg/ml, from about 5.0 μg/ml to about� �30 μg/ml, from about 7.5 μg/ml to about  30 μg/ml, from about 10 μg/ml to about 30 μg/ml,  from about 15 μg/ml to about 30 μg/ml, 

from about 0.5 μg/ml to about 20 μg/ml, from a bout 0.5 μg/ml to about 10 μg/ml, from  about 0.5 μg/ml to about 5 μg/ml, from about 0.5� �μg/ml to about 2 μg/ml, from about 0.5  μg/ml to about 1 μg/ml, from about 1 μg/ml to a bout 10 μg/ml, from about 1 μg/ml to about  5 μg/ml, from about 1 μg/ml to about 2 μg/ml, f rom about 1 μg/ml to about 100 μg/ml, from  about 10 μg/ml to about 100 μg/ml, from about 20� �μg/ml to about 100 μg/ml, from about 40  μg/ml to about 100 μg/ml, from about 30 μg/ml to  about 80 μg/ml, from about 30 μg/ml to  about 70 μg/ml, from about 40 μg/ml to about 60  μg/ml, from about 40 μg/ml to about 70  μg/ml, from about 40 μg/ml to about 80 μg/ml, et c.). 

[176] In many instances, nucleotides (e.g., dNTPs, such as� �dGTP, dATP, dCTP, dTTP, etc.) will  be present in reaction mixtures of the invention. Ty pically, individually nucleotides will be  present in concentrations of from about 0.05 mM to  about 50 mM (e.g., about 0.07 mM,  about 0.1 mM, about 0.15 mM, about 0.18 mM, about  0.2 mM, about 0.3 mM, about 0.5  mM, about 0.7 mM, about 0.9 mM, about 1 mM, about� �2 mM, about 3 mM, about 4 mM,  about 5 mM, about 6 mM, about 10 mM, about 12 mM,  about 15 mM, about 17 mM, about  20 mM, about 22 mM, about 23 mM, about 24 mM, abo ut 25 mM, about 27 mM, about 30  mM, about 35 mM, about 40 mM, about 45 mM, about  50 mM, from about 0.1 mM to about  50 mM, from about 0.5 mM to about 50 mM, from abo ut 1 mM to about 50 mM, from about  2 mM to about 50 mM, from about 3 mM to about 50  mM, from about 0.5 mM to about 20  mM, from about 0.5 mM to about 10 mM, from about  0.5 mM to about 5 mM, from about  0.5 mM to about 2.5 mM, from about 1 mM to about� �20 mM, from about 1 mM to about 10  mM, from about 1 mM to about 5 mM, from about 1  mM to about 3.4 mM, from about 0.5  mM to about 3.0 mM, from about 1 mM to about 3.0� �mM, from about 1.5 mM to about 3.0  mM, from about 2 mM to about 3.0 mM, from about 0 .5 mM to about 2.5 mM, from about 1  mM to about 2.5 mM, from about 1.5 mM to about 2. 5 mM, from about 2 mM to about 3.0  mM, from about 2.5 mM to about 3.0 mM, from about� �0.5 mM to about 2 mM, from about  0.5 mM to about 1.5 mM, from about 0.5 mM to abou t 1.1 mM, from about 5.0 mM to about  10 mM, from about 5.0 mM to about 15 mM, from abo ut 5.0 mM to about 20 mM, from  about 10 mM to about 15 mM, from about 10 mM to  about 20 mM, etc.). The combined  nucleotide concentration, when more than one nucleotid es is present, can be determined by  adding the concentrations of the individual nucleotide s together. When more than one  nucleotide is present in compositions of the inventio n, the individual nucleotides may not be   

present in equimolar amounts. Thus, a composition  may contain, for example, 1 mM dGTP, 1  mM dATP, 0.5 mM dCTP, and 1 mM dTTP. 

[177] RNA will typically be present in compositions of the  invention. In most instances, RNA  will be added to the composition shortly prior to r everse transcription. Thus, compositions  may be provided without RNA. This will typically be� �the case when compositions are  provided in kits. RNA, when present in compositions  will often be present in a concentration  of 1 picogram to 100 μg/20 μl reaction mixture (e .g., about 1 picogram/20 μl, about 10  picograms/20 μl, about 50 picograms/20 μl, about 10 0 picograms/20 μl, about 200  picograms/20 μl, about 10 picograms/20 μl, about 50 0 picograms/20 μl, about 800  picograms/20 μl, about 1.0 nanogram/20 μl, about 5. 0 nanograms/20 μl, about 10  nanograms/20 μl, about 25 nanograms/20 μl, about 50  nanograms/20 μl, about 75  nanograms/20 μl, about 100 nanograms/20 μl, about 1 50 nanograms/20 μl, about 250  nanograms/20 μl, about 400 nanograms/20 μl, about 5 00 nanograms/20 μl, about 750  nanograms/20 μl, about 1.0 μg/20 about 5.0 μg/20  μl, about 10 μg/20 μl, about 20 μg/20 μl,  about 30 μg/20 μl, about 40 μg/20 μl, about 50� �μg/20 μl, about 70 μg/20 μl, about 85 μg/20  μl, about 100 μg/20 μl, from about 10 picograms/2 0 μl to about 100 μg/20 μl, from about 10  picograms/20 μl to about 100 μg/20 μl, from about  100 picograms/20 μl to about 100 μg/20  μl, from about 1.0 nanograms/20 μl to about 100 � �g/20 μl, from about 100 nanograms/20 μl  to about 100 μg/20 μl, from about 10 picograms/20� �μl to about 10 μg/20 μl, from about 10  picograms/20 μl to about 5 μg/20 μl, from about  100 nanograms/20 μl to about 5 μg/20 μl,  from about 1 μg/20 μl to about 10 μg/20 μl, fr om about 1 μg/20 μl to about 5 μg/20 μl, from� � about 100 nanograms/20 μl to about 1 μg/20 μl, f rom about 500 nanograms/20 μl to about 5  μg/20 μl, etc.). As one skilled in the art would� �recognize, different reverse transcription  reactions may be performed in volumes other than 20� �μl. In such instances, the total amount  of RNA present will vary with the volume used. Thus , the above amounts are provided as  examples of the amount of RNA/20 μl of composition.  

[178] Mutant reverse transcriptases of the invention when p resent in compositions as  described herein (storage compositions and/or reaction� �mixtures), can be present in a  concentration which results in about 0.01 to about 1 ,000 units of reverse transcriptase  activity/μl (e.g., about 0.01 unit/μl, about 0.05 u nit/μl, about 0.1 unit/μl, about 0.2 unit/μl,  about 0.3 unit/μl, about 0.4 unit/μl, about 0.5 un it/μl, about 0.7 unit/μl, about 1.0 unit/μl,  about 1.5 unit/μl, about 2.0 unit/μl, about 2.5 un it/μl, about 5.0 unit/μl, about 7.5 unit/μl, 

about 10 unit/μl, about 20 unit/μl, about 25 un it/μl, about 50 unit/μl, about 100 unit/μl,  about 150 unit/μl, about 200 unit/μl, about 250 un it/μl, about 350 unit/μl, about 500 unit/μl,  about 750 unit/μl, about 1,000 unit/μl, from about� �0.1 unit/μl to about 1,000 unit/μl, from  about 0.2 unit/μl to about 1,000 unit/μl, from abo ut 1.0 unit/μl to about 1,000 unit/μl, from  about 5.0 unit/μl to about 1,000 unit/μl, from abo ut 10 unit/μl to about 1,000 unit/μl, from  about 20 unit/μl to about 1,000 unit/μl, from abou t 50 unit/μl to about 1,000 unit/μl, from  about 100 unit/μl to about 1,000 unit/μl, from abo ut 200 unit/μl to about 1,000 unit/μl, from  about 400 unit/μl to about 1,000 unit/μl, from abo ut 500 unit/μl to about 1,000 unit/μl, from  about 0.1 unit/μl to about 300 unit/μl, from about  0.1 unit/μl to about 200 unit/μl, from  about 0.1 unit/μl to about 100 unit/μl, from about  0.1 unit/μl to about 50 unit/μl, from about  0.1 unit/μl to about 10 unit/μl, from about 0.1 u nit/μl to about 5.0 unit/μl, from about 0.1  unit/μl to about 1.0 unit/μl, from about 0.2 unit/ μl to about 0.5 unit/μl, etc. 

[179] Compositions of the invention may be prepared as con centrated solutions (e.g., 5×  solutions) which are diluted to a working concentrati on for final use. With respect to a 5×  composition, a 5:1 dilution is required to bring suc h a 5× solution to a working concentration.  Compositions of the invention may be prepared, for e xamples, as a 2×, a 3×, a 4×, a 5×, a 6×,  a 7×, a 8×, a 9×, a 10×, etc. solutions. One  limitation on the fold concentration of such  solutions is that, when compounds reach particular co ncentrations in solution, precipitation  can occur. Thus, concentrated compositions will genera lly be prepared such that the  concentrations of the various components are low enou gh so that precipitation of buffer  components will not occur. As one skilled in the ar t would recognize, the upper limit of  concentration which is feasible for each solution wil l vary with the particular solution and the  components present. 

[180] In many instances, compositions of the invention will  be provided in sterile form.  Sterilization may be performed on the individual comp onents of compositions prior to mixing  or on compositions after they are prepared. Steriliza tion of such solutions may be performed  by any suitable means including autoclaving or ultraf iltration.   

Methods of Using Reverse Transcriptases 

[181] The reverse transcriptases of the invention may be u sed to make nucleic acid 

molecules from one or more templates. Such methods c an comprise mixing one or more   

nucleic acid templates (e.g., DNA or RNA, such as  non‐coding RNA (ncRNA), messenger RNA  (mRNA), micro RNA (miRNA), and small interfering RNA� �(siRNA) molecules) with one or more  of the reverse transcriptases of the invention and i ncubating the mixture under conditions  sufficient to make one or more nucleic acid molecule s complementary to all or a portion of  the one or more nucleic acid templates. 

[182] The invention also concerns nucleic acid molecules pr oduced by such methods (which  may be full‐length cDNA molecules), vectors (particu larly expression vectors) comprising  these nucleic acid molecules and host cells comprisin g these vectors and nucleic acid  molecules. 

[183] Other methods of cDNA synthesis which may advantageou sly use the present  invention will be readily apparent to one of ordinar y skill in the art. 

[184] The invention also provides methods for the amplifica tion of one or more nucleic acid  molecules comprising mixing one or more nucleic acid� �templates with one of the reverse  transcriptases of the invention, and incubating the m ixture under conditions sufficient to  amplify one or more nucleic acid molecules complement ary to all or a portion of the one or  more nucleic acid templates. Such amplification method s may further comprise the use of  one or more DNA polymerases and may be employed as� �in standard reverse transcription‐ polymerase chain reaction (RT‐PCR) reactions. 

[185] Nucleic acid amplification methods according to this  aspect of the invention may be  one‐step (e.g., one‐step RT‐PCR) or two‐step ( e.g., two‐step RT‐PCR) reactions. According to  the invention, one‐step RT‐PCR type reactions may� �be accomplished in one tube thereby  lowering the possibility of contamination. Such one‐ step reactions comprise (a) mixing a  nucleic acid template (e.g., mRNA) with one or more� �reverse transcriptases of the present  invention and with one or more DNA polymerases and  (b) incubating the mixture under  conditions sufficient to amplify a nucleic acid molec ule complementary to all or a portion of  the template. Such amplification may be accomplished  by the reverse transcriptase activity  alone or in combination with the DNA polymerase acti vity. Two‐step RT‐PCR reactions may  be accomplished in two separate steps. Such a method  comprises (a) mixing a nucleic acid  template (e.g., mRNA) with a reverse transcriptase of  the present invention, (b) incubating  the mixture under conditions sufficient to make a nu cleic acid molecule (e.g., a DNA  molecule) complementary to all or a portion of the  template, (c) mixing the nucleic acid  molecule with one or more DNA polymerases and (d) i ncubating the mixture of step (c) 

under conditions sufficient to amplify the nucleic� �acid molecule. For amplification of long  nucleic acid molecules (i.e., greater than about 3‐ 5 kb in length), a combination of DNA  polymerases may be used, such as one DNA polymerase� �having 3  exonuclease activity and  another DNA polymerase being substantially reduced in� �3  exonuclease activity. 

[186] Amplification methods which may be used in accordance  with the present invention  include PCR (see, e.g., U.S. Pat. Nos. 4,683,195 and  4,683,202), Isothermal Amplification  (using one or more RNA polymerases (see, e.g., PCT  Publication No. WO 2006/081222),  Strand Displacement Amplification (SDA; see, e.g., U.S . Pat. No. 5,455,166; EP 0 684 315), and  Nucleic Acid Sequence‐Based Amplification (NASBA; see , e.g., U.S. Pat. No. 5,409,818; EP 0  329 822), as well as more complex PCR‐based nuclei c acid fingerprinting techniques such as  Random Amplified Polymorphic DNA (RAPD) analysis (see,  e.g., Williams, J. G. K., et al., Nucl.  Acids Res. 18(22):6531‐6535, 1990), Arbitrarily Prime d PCR (AP‐PCR; see, e.g., Welsh, J., and  McClelland, M., Nucl. Acids Res. 18(24):7213‐7218, 1 990), DNA Amplification Fingerprinting  (DAF; see, e.g., Caetano‐Anollés et al., Bio/Techno logy 9:553‐557, 1991), microsatellite PCR  or Directed Amplification of Minisatellite‐region DNA  (DAVID; see, e.g., Heath, D. D., et al.  Nucl. Acids Res. 21(24): 5782‐5785 (1993), and Ampl ification Fragment Length Polymorphism  (AFLP) analysis (see, e.g., EP 0 534 858; Vos, P.,� �et al. Nucl. Acids Res. 23(21):4407‐4414  (1995); Lin, J. J., and Kuo, J. FOCUS 17(2):66‐70� �(1995). Nucleic acid sequencing techniques  which may employ the present compositions include did eoxy sequencing methods such as  those disclosed in U.S. Pat. Nos. 4,962,022 and 5,49 8,523. In some embodiments, the  invention may be used in methods of amplifying or s equencing a nucleic acid molecule  comprising one or more polymerase chain reactions (PC Rs), such as any of the PCR‐based  methods described above. 

[187] The invention also concerns methods for the sequencin g of one or more nucleic acid  molecules comprising (a) mixing one or more nucleic  acid molecules to be sequenced with  one or more primer nucleic acid molecules, one or m ore reverse transcriptases of the  invention, one or more nucleotides and one or more  terminating agents; (b) incubating the  mixture under conditions sufficient to synthesize a p opulation of nucleic acid molecules  complementary to all or a portion of the one or mo re nucleic acid molecules to be  sequenced; and (c) separating the population of nucle ic acid molecules to determine the  nucleotide sequence of all or a portion of the one� �or more nucleic acid molecules to be  sequenced. 

[188] Nucleic acid sequencing methods according to this asp ect of the invention can  comprise both cycle sequencing (sequencing in combinat ion with amplification) and standard  sequencing reactions. The sequencing method of the in vention thus comprises (a) mixing a  nucleic acid molecule to be sequenced with one or m ore primers, one or more reverse  transcriptase of the invention, one or more nucleotid es and one or more terminating agents,  (b) incubating the mixture under conditions sufficient  to synthesize a population of nucleic  acid molecules complementary to all or a portion of� �the molecule to be sequenced, and (c)  separating the population to determine the nucleotide� �sequence of all or a portion of the  molecule to be sequenced. According to the invention,  one or more DNA polymerases  (preferably thermostable DNA polymerases) can be used� �in combination with or separate  from the reverse transcriptases of the invention. 

[189] In accordance with the invention, cDNA molecules (sin gle‐stranded or double‐ stranded) can be prepared from a variety of nucleic� �acid template molecules using the novel  mutant reverse transcriptases provided herein. Preferre d nucleic acid molecules for use in  the present invention include single‐stranded or dou ble‐stranded DNA and RNA molecules,  as well as double‐stranded DNA:RNA hybrids. More pr eferred nucleic acid molecules include  messenger RNA (mRNA), transfer RNA (tRNA) and ribosom al RNA (rRNA) molecules, although  mRNA molecules are the preferred template according t o the invention. In certain  embodiments gene‐specific primers can be used. In c ertain other embodiments in which at  least some of the mutant reverse transcriptases provi ded herein are well‐suited, oligo dT  primers are used. These dT primers can be LNA prime rs in some embodiments. Furthermore,  in illustrative examples, the templates for such reac tions can be mRNA. 

[190] The nucleic acid molecules that are used to prepare� �cDNA molecules according to the  methods of the present invention may be prepared syn thetically according to standard  organic chemical synthesis methods that will be famil iar to one of ordinary skill. More  preferably, the nucleic acid molecules may be obtaine d from natural sources, such as a  variety of cells, tissues, organs or organisms. Cells  that may be used as sources of nucleic acid  molecules may be prokaryotic (bacterial cells, includi ng but not limited to those of species of  the genera Escherichia, Bacillus, Serratia, Salmonella,  Staphylococcus, Streptococcus,  Clostridium, Chlamydia, Neisseria, Treponema, Mycoplasma , Borrelia, Legionella, 

Pseudomonas, Mycobacterium, Helicobacter, Erwinia, Agrob acterium, Rhizobium, 

Xanthomonas and Streptomyces) or eukaryotic (including� �fungi (especially yeasts), plants, 

protozoans and other parasites, and animals includi ng insects (particularly Drosophila spp.  cells), nematodes (particularly Caenorhabditis elegans  cells), and mammals (particularly  human cells)). 

[191] Mammalian somatic cells that may be used as sources� �of nucleic acids include blood  cells (reticulocytes and leukocytes), endothelial cells , epithelial cells, neuronal cells (from the  central or peripheral nervous systems), muscle cells  (including myocytes and myoblasts from  skeletal, smooth or cardiac muscle), connective tissue  cells (including fibroblasts, adipocytes,  chondrocytes, chondroblasts, osteocytes and osteoblasts)  and other stromal cells (e.g.,  macrophages, dendritic cells, Schwann cells). Mammalian  germ cells (spermatocytes and  oocytes) may also be used as sources of nucleic aci ds for use in the invention, as may the  progenitors, precursors and stem cells that give rise  to the above somatic and germ cells.  Also suitable for use as nucleic acid sources are m ammalian tissues or organs such as those  derived from brain, kidney, liver, pancreas, blood, b one marrow, muscle, nervous, skin,  genitourinary, circulatory, lymphoid, gastrointestinal a nd connective tissue sources, as well  as those derived from a mammalian (including human)  embryo or fetus. 

[192] Any of the above prokaryotic or eukaryotic cells, ti ssues and organs may be normal,  diseased, transformed, established, progenitors, precurs ors, fetal or embryonic. Diseased  cells may, for example, include those involved in in fectious diseases (caused by bacteria,  fungi or yeast, viruses (including AIDS, HIV, HTLV,  herpes, hepatitis and the like) or parasites),  in genetic or biochemical pathologies (e.g., cystic f ibrosis, hemophilia, Alzheimer's disease,  muscular dystrophy or multiple sclerosis) or in cance rous processes. Transformed or  established animal cell lines may include, for exampl e, COS cells, CHO cells, VERO cells, BHK  cells, HeLa cells, HepG2 cells, K562 cells, 293 cell s, L929 cells, F9 cells, and the like. Other  cells, cell lines, tissues, organs and organisms suit able as sources of nucleic acids for use in  the present invention will be apparent to one of or dinary skill in the art. 

[193] In some embodiments, a composition can comprise genom ic nucleic acid. In some  embodiments, a composition can comprise maternal nucle ic acid, fetal nucleic acid or a  mixture of maternal and fetal nucleic acids. In some  embodiments, a composition can  comprise fragments of genomic nucleic acids. In some� �embodiments a composition can  comprise nucleic acids derived from a virus, bacteria , yeast, fungus, mammal or mixture  thereof. A nucleic acid sample may be derived from  one or more sources. A sample may be  collected from an organism, mineral or geological sit e (e.g., soil, rock, mineral deposit, fossil), 

or forensic site (e.g., crime scene, contraband or  suspected contraband), for example. Thus, a  source may be environmental, such as geological, agri cultural, combat theater or soil  sources, for example. A source also may be from any  type of organism such as any plant,  fungus, protistan, moneran, virus or animal, including  but not limited, human, non‐human,  mammal, reptile, cattle, cat, dog, goat, swine, pig,� �monkey, ape, gorilla, bull, cow, bear,  horse, sheep, poultry, mouse, rat, fish, dolphin, wha le, and shark, or any animal or organism  that may have a detectable nucleic acids. Sources al so can refer to different parts of an  organism such as internal parts, external parts, livi ng or nonliving cells, tissue, fluid and the  like. A sample therefore may be a "biological sample ," which refers to any material obtained  from a living source or formerly‐living source, for  example, an animal such as a human or  other mammal, a plant, a bacterium, a fungus, a pro tist or a virus. A source can be in any  form, including, without limitation, a solid material� �such as a tissue, cells, a cell pellet, a cell  extract, or a biopsy, or a biological fluid such as  urine, blood, saliva, amniotic fluid, exudate  from a region of infection or inflammation, or a mo uth wash containing buccal cells, hair,  cerebral spinal fluid and synovial fluid and organs.� �A sample also may be isolated at a  different time point as compared to another sample,  where each of the samples are from the  same or a different source. A nucleic acid may be  from a nucleic acid library, such as a cDNA  or RNA library, for example. A nucleic acid may be� �a result of nucleic acid purification or  isolation and/or amplification of nucleic acid molecul es from the sample. Nucleic acid  provided for sequence analysis processes described her ein may contain nucleic acid from  one sample or from two or more samples (e.g., from� �1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13 ,  14, 15, 16, 17, 18, 19, 20, 25, 50, 75, 100, 200,  300, 400, 500, 600, 700, 800, 900 or 1000 or  more samples). Nucleic acids may be treated in a va riety of manners. For example, a nucleic  acid may be reduced in size (e.g., sheared, digested  by nuclease or restriction enzyme, de‐ phosphorylated, de‐ methylated), increased in size ( e.g., phosphorylated, reacted with a  methylation‐specific reagent, attached to a detectabl e label), treated with inhibitors of  nucleic acid cleavage and the like.  

[194] Nucleic acids may be provided for conducting methods� �described herein without  processing, in certain embodiments. In some embodiment s, nucleic acid is provided for  conducting methods described herein after processing.  For example, a nucleic acid may be  extracted, isolated, purified or amplified from a sam ple. The term "isolated" as used herein  refers to nucleic acid removed from its original env ironment (e.g., the natural environment if 

it is naturally occurring, or a host cell if exp ressed exogenously), and thus is altered "by the  hand of man" from its original environment. An isola ted nucleic acid generally is provided  with fewer non‐nucleic acid components (e.g., protei n, lipid) than the amount of 

components present in a source sample. A composition� �comprising isolated nucleic acid can  be substantially isolated (e.g., about 90%, 91 %, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99% or  greater than 99% free of non‐nucleic acid component s). The term "purified" as used herein  refers to nucleic acid provided that contains fewer  nucleic acid species than in the sample  source from which the nucleic acid is derived. A co mposition comprising nucleic acid may be  substantially purified (e.g., about 90%, 91 %, 92%,  93%, 94%, 95%, 96%, 97%, 98%, 99% or  greater than 99% free of other nucleic acid species) .  

[195] Nucleic acids may be processed by a method that gen erates nucleic acid fragments, in  certain embodiments, before providing nucleic acid for  a process described herein. In some  embodiments, nucleic acid subjected to fragmentation o r cleavage may have a nominal,  average or mean length of about 5 to about 10,000  base pairs, about 100 to about 1 ,00 base  pairs, about 100 to about 500 base pairs, or about� �10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,  65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 5 00, 600, 700, 800, 900, 1000, 2000, 3000,  4000, 5000, 6000, 7000, 8000, 9000 or 10000 base pa irs. Fragments can be generated by any  suitable method known in the art, and the average,  mean or nominal length of nucleic acid  fragments can be controlled by selecting an appropria te fragment‐generating procedure. In  certain embodiments, nucleic acid of a relatively sho rter length can be utilized to analyze  sequences that contain little sequence variation and/o r contain relatively large amounts of  known nucleotide sequence information. In some embodim ents, nucleic acid of a relatively  longer length can be utilized to analyze sequences t hat contain greater sequence variation  and/or contain relatively small amounts of unknown nu cleotide sequence information. As  used herein, the term "target nucleic acid" or "targ et nucleic acid species" refers to any  nucleic acid species of interest in a sample. A tar get nucleic acid includes, without limitation,  (i) a particular allele amongst two or more possible  alleles, and (ii) a nucleic acid having, or  not having, a particular mutation, nucleotide substitu tion, sequence variation, repeat  sequence, marker or distinguishing sequence.  

[196] Once the starting cells, tissues, organs or other sa mples are obtained, nucleic acid  molecules (such as mRNA) may be isolated therefrom b y methods that are well‐known in the  art (See, e.g., Maniatis, T., et al., Cell 15:687‐ 701 (1978); Okayama, H., and Berg, P., Mol. Cell. 

Biol. 2:161‐170 (1982); Gubler, U., and Hoffman,� �B. J., Gene 25:263‐269 (1983)). The nucleic  acid molecules thus isolated may then be used to pr epare cDNA molecules and cDNA  libraries in accordance with the present invention.   

Kits 

[197] In another embodiment, the present invention may be  assembled into kits, which  may be used in reverse transcription or amplification  of a nucleic acid molecule, or into kits  for use in sequencing of a nucleic acid molecule. K its according to this aspect of the invention  comprise a carrier means, such as a box, carton, tu be or the like, having in close confinement  therein one or more container means, such as vials,� �tubes, ampoules, bottles and the like,  wherein a first container means contains one or more  polypeptides of the present invention  having reverse transcriptase activity. When more than� �one polypeptide having reverse  transcriptase activity is used, they may be in a si ngle container as mixtures of two or more  polypeptides, or in separate containers. The kits of� �the invention can also comprise (in the  same or separate containers) one or more DNA polymer ases, a suitable buffer, one or more  nucleotides and/or one or more primers. The kits of� �the invention can also comprise one or  more hosts or cells including those that are compete nt to take up nucleic acids (e.g., DNA  molecules including vectors). Preferred hosts may incl ude chemically competent or  electrocompetent bacteria such as E. coli (including  DH5, DH5α, DH10B, HB101, Top 10, and  other K‐12 strains as well as E. coli B and E.  coli W strains). 

[198] In a specific aspect of the invention, the kits of� �the invention (e.g., reverse 

transcription and amplification kits) can include one� �or more components (in mixtures or  separately) including one or more polypeptides having� �reverse transcriptase activity of the  invention, one or more nucleotides (one or more of  which may be labeled, e.g., fluorescently  labeled) used for synthesis of a nucleic acid molecu le, and/or one or more primers (e.g.,  oligo(dT) for reverse transcription). Such kits (inclu ding the reverse transcription and  amplification kits) can further comprise one or more� �DNA polymerases. Sequencing kits of  the invention may comprise one or more polypeptides  having reverse transcriptase activity  of the invention, and optionally one or more DNA po lymerases, one or more terminating  agents (e.g., dideoxynucleoside triphosphate molecules)� �used for sequencing of a nucleic  acid molecule, one or more nucleotides and/or one or  more primers. Preferred polypeptides   

having reverse transcriptase activity, DNA polymeras es, nucleotides, primers and other  components suitable for use in the reverse transcript ion, amplification and sequencing kits of  the invention include those described above. The kits  encompassed by this aspect of the  present invention may further comprise additional reag ents and compounds necessary for  carrying out standard nucleic acid reverse transcripti on, amplification or sequencing  protocols. Such polypeptides having reverse transcripta se activity of the invention, DNA  polymerases, nucleotides, primers, and additional reage nts, components or compounds can  be contained in one or more containers, and can be� �contained in such containers in a mixture  of two or more of the above‐noted components or m ay be contained in the kits of the  invention in separate containers. Such kits can also� �comprise instructions (e.g., for  performing the methods of the invention such as for� �labeling nucleic acid molecules in  accordance with the invention). 

[199] In certain illustrative embodiments, the kits of the� �invention are prepared for 

molecular diagnostics assays.  The kits can be appro ved by a government regulatory agency  that regulates the sale of diagnostics products for  human diagnostics, animal diagnostics,  environmental diagnostics and/or food safety. The reve rse transcriptases of the present  invention can be provided in place of current revers e transcriptases in such kits. 

Furthermore, the advantageous and surprising properties  of the novel reverse transcriptases  of the present invention make them particularly well� ��suited for these applications.  

[200] In some embodiments, the kits of the invention inclu de one or more components,  including, but not limited to: an internal and/or ex ternal positive control, a set of 

oligonucleotides for detection of the target gene (e. g., primer and/or probe), lysis buffer,  uracil DNA glycosylase (UDG), a master mix, and a d etection dye.  

[201] It will be readily apparent to one of ordinary skil l in the relevant arts that other  suitable modifications and adaptations to the methods� �and applications described herein are  obvious and may be made without departing from the  scope of the invention or any  embodiment thereof. Section headings provided herein a re for convenience only. Having  now described the present invention in detail, the s ame will be more clearly understood by  reference to the following examples, which are includ ed herewith for purposes of illustration  only and are not intended to be limiting of the in vention.     

  EXAMPLES  Example 1 

Comparison of Thermostability and Processivity of Vari ous Reverse Transcriptases   

[202] 2 µg of 0.24‐9.5 kb RNA Ladder (Invitrogen, Cat.� �No. 15620016) and 5 µM of 5’  labeled oligo(dT) ₂₀  primer (Alexa‐647) was added to a final rea ction volume of 19 µL of 1X 1st  strand cDNA synthesis buffer, pH 8.4 (Life Technologi es, Cat. No. Y02321) supplemented with  10 mM DTT, 500 µM of each dNTP (dATP, dTTP, dGTP� �and dCTP), and 2U RNaseOut 

(Invitrogen, Cat. No. 10777‐019) and incubated on i ce.  Reactions were then initiated by  adding 1 µL of a reverse transcriptase (200U/µl) ( to a final volume 20 µL) followed by  incubation at 60°C, 37°C, 42°C, or 50°C (as indi cated in Figure 2) for various lengths of time  (i.e., 5 minutes, 15 minutes and 60 minutes). At th e end of each time point, the reactions  were terminated by addition of 10 µl of alkaline l oading dye (300mM NaOH, 2mM EDTA, 20%  glycerol, 10% saturated Thymol Blue) and visualized b y electrophoresis on a 1% alkaline  agarose gel (30 mM NaOH, 2 mM EDTA pH 7.5) in buf fer (30 mM NaOH, 2 mM EDTA pH 7.5)  for 2‐4 hours at 30 volts. The gel was then anal yzed by Molecular Dynamics Typhoon 8600  Variable Mode Imager (Harlow Scientific) using ImageQu ant software. 

[203] As Figure 2 shows, reactions that include mutant M� �MLV RT “Mut D9” (SEQ ID NO:4),  an exemplary mutant M‐MLV constructed using the tea chings herein, produced cDNAs up to  7.5 kb as early as 5 minutes after incubation and  cDNAs up to 9.5 kb after only 15 minutes of  incubation at 60°C.   This is in contrast to reac tions comprising wild type M‐MLV RT incubated  at 37°C which required up to 60 minutes to produce  a comparable amount of 7.5 kb cDNAs.   Similarly, 7.5 kb cDNAs were not detected in reactio ns comprising either SuperScript™ II  (“SSII”) or SuperScript™ III (“SSIII”)RTs unt il more than 5 minutes of incubation at 42°C or  50°C, respectively.  Another commercially available R T (“Q‐RT”) that was examined did not  produce any similar cDNAs even after 60 minutes of  incubation at 37°C.  This demonstrates  that mutant M‐MLV (“Mut D9”) RT was highly pro cessive and exhibited increased 

thermostability, as well as thermoreactivity, in rever se transcription reactions performed at  temperatures as high as 60°C.     

Example 2  

Mutant Reverse Transcriptase Stability at Low pH 

[204] Comparison of wild type M‐MLV RT (Invitrogen™, Ca talog # 28025‐013) (“WT MMLV”)  and  an  exemplary mutant  M‐MLV  RT  (“Mut  D9”) was  performed  to  evaluate  speed  and  length  of  cDNA  synthesized  at  varying  pH.  These  assays  contained  0.5‐10  kb  RNA  ladder  (Ambion®, Catalog # 15623‐200) and Alexa Fluor® 6 47 oligo(dT)20 and was performed with a  standard pH 8.3 buffer (50 mM Tris‐HCl pH 8.3, 72 .5 mM KCl, and 3 mM MgCl2) or a pH 7.3  buffer (50 mM Tris‐HCl pH 7.3, 72.5 mM KCl, and  3 mM MgCl2). Reaction temperatures were  37  °C  for wild  type M‐MLV  and  50  °C  for Mut D9  and  RT  reactions were  carried  out  for  varying lengths of time (i.e., 10 minutes, 30 minute s or 60 minutes, as indicated in Figure 3).  The  first strand cDNAs produced were resolved by alkaline  agarose gel electrophoresis and  visualized using Molecular Dynamics Typhoon 8600 Varia ble Mode Imager (Harlow Scientific)  set at Cy5 flourescent mode.  

[205] As Figure 3 shows, at pH 8.3, Mut D9 reaches 4 kb  by 10 minutes while wild type M‐ MLV reaches only 3 kb in the same amount of time.� �At pH 7.3, Mutant D9 can reach 4 kb in  30 minutes whereas wild type M‐MLV cannot produce  cDNA over 3 kb even after 60 minute  RT reaction time. Mut D9 is therefore more active t han wild type M‐MLV at a wider range of  pH, producing more cDNA and longer cDNA at both pH� �8.3 and pH 7.3, even while at a higher  temperature than wild type M‐MLV. 

Example 3  

Mutant Reverse Transcriptase Thermostability 

[206] The experiment described in Example 2 was also perfo rmed at 60 °C for varying  lengths of time (i.e., 5 minutes, 10 minutes, 30 mi nutes or 60 minutes, as indicated in Figure  4) to evaluate thermostability of an exemplary mutant  RT as described herein (“Mut D9”)  compared to wild type M‐MLV (“WT MMLV”) and ot her commercially available RTs (“SSIII”  and “C‐RT”). At this temperature, a standard ol igo(dT) ₂₀  cannot anneal to the polyadenylated  tail of the RNA targets because the melting temperat ure is around 50 °C. Instead an LNA™  oligo‐T20 (Exiqon Life Sciences) containing 50% LNA� �was utilized. Another difference in the 

experiment is that reaction mix containing buffer,� �RNA targets, and primer were first heated  to 60 °C prior to the addition of RT enzyme (“m anual hot start”). Manual hot start was  performed to eliminate cDNA synthesis during reaction� �set up and temperature ramp up  time. At pH 8.3 and 60 °C, all enzymes except Mut  D9 are non‐functional. Mut D9 speed,  cDNA yield, and cDNA length performance remains uncha nged at 60 °C (see Figure 4)  compared to 50 °C (compare to Figure 3). Thus, Mut  D9 is both thermostable and  thermoreactive ‐ it can refold into an active enzy me after being heated to a higher  temperature (thermostable) as well as synthesize cDNA� �at higher temperatures 

(thermoreactive) (see, e.g., Figure 4). 

Example 4 

Evaluation of Reverse Transcription Sensitivity and Th ermostability 

[207] For all reactions, 100, 50 or 10 ng per 20 µL re action of Hela RNA (Life Technologies,  Cat. No. AM7852, Cervical Adenocarcinoma (Hela‐S3) T otal RNA) was incubated at the  temperatures and times indicated below in: (1) the a bsence of primer, (2) in the presence of  oligo(dT) ₂₀  primer; (3) in the presence of LNA T20 prime r (Exiqon); and (4) in the presence of  a gene specific primer (PolE 2.5 kb‐rev primer seq uence: GACCAGGTCCTGCAGGGTGAAGGC).   Each reaction mixture contained the indicated amount  of Hela RNA (as indicated in Figure 5),  1mM of each dNTP (dATP, dTTP, dGTP and dCTP) (Life� �Technologies, Cat. No. 10297018), 5  mM DTT (Life Technologies, Cat. No. Y00147), 1X Firs t strand buffer (Life Technologies, Cat.  No. Y02321), 1 µM primer (1, 2, 3, or 4, as desc ribed above and indicated in Figure 5), 40 U  RNaseOut (Life Technologies, Cat. No. 10777019) and 1 00 U of other commercially available  mutant M‐MLV reverse transcriptase (“SSIII” and  “M‐RT”), or an exemplary mutant M‐MLV  reverse transcriptase as disclosed herein (“Mut D9� �). 

[208] For non‐hot start (“NON‐HS‐RT”) reaction cond itions, reaction mixtures minus  proteins (reverse transcriptase and RNaseOut) were inc ubated at 65°C for 5 minutes,  followed by a 10 minute incubation on ice.  RNaseOu t and reverse transcriptase enzyme  were added to each reaction, and the reactions were� �then incubated at room temperature  for 10 minutes.  This was followed by an additional  incubation at 50°C for 50 minutes, and  then all reactions were heat killed at 95°C for 10  minutes.     

[209] For manual hot start (“HS‐RT”) reaction conditio ns, reaction mixtures minus proteins  (reverse transcriptase and RNaseOut) were incubated at  65°C for 5 minutes, followed by 10  minute incubation on ice.  RNaseOut was added to ea ch reaction, and the reactions were  incubated at 60°C for 10 minutes in the absence of  reverse transcriptase.  Reverse  transcriptase enzymes were then added directly to the  reactions while incubating at 60°C  and the reactions were allowed to proceed at 60°C  for 50 minutes. All reactions were then  heat killed at 95°C for 10 minutes. 

[210] Using the cDNA products from the above‐mentioned re verse transcription reactions,  PCR mixtures were prepared. Briefly, 1 µL of the a bove RT reactions was added to 24 µL of a  PCR mixture.  PCR reactions were set up as recommen ded by the manufacturer using  Platinum Taq DNA Polymerase High Fidelity (Life Techn ologies, Cat. No. 11304102) and  amplified for 30 cycles.  Gene‐specific primers for  the pol E gene were used for PCR and  resulted in a 1 kb fragment.   Primer sequences we re as follows:  Forward 

(AGCGCCAGACATCGAGGGCGTATATGAGAC) and Reverse (TGGTGAGACTG GAGAATGGTGTTG).   Gel products were visualized using 10 µL of each P CR reaction on a 2% E‐gel (Life 

Technologies, Cat. No. G501802)  As Figure 5 demonstrates, all three reverse transcrip tases produced transcripts using 10‐100  ng template DNA when incubated at room temperature a nd 50°C (see “NON‐HS‐RT”  reactions), even in the absence of any primer (1),  and produced similar amounts of 1 kb  cDNA using either (2) oligo(dT) ₂₀  primer; (3) locked nucleic acid (LNA) T20 pri mer, and (4)  gene specific primer with 50‐100 ng template DNA.   For the “HS‐RT” reactions, the 1 kb cDNA  was not produced by SSIII for 10, 50, or 100 ng t emplate DNA in the absence of primer or  with the addition of any of the primers (2, 3, or� �4).  The other commercially available RT (“M‐ RT”) also did not produce any cDNA in the absence  of primer and only produced trace  amounts of cDNA for 10, 50, or 100 ng template DNA  when either the LNA T20 primer or the  gene specific primers were used.  Mutant M‐MLV Mut  D9 (SEQ ID NO:4) on the other hand  produced significant amounts of cDNA for 10 ng templ ate DNA when either the LNA T20  primer or the gene specific primers were used and a lso produced significant amounts of  cDNA for 50 and 100 ng of template DNA for all th ree of the primers (2, 3, and 4) that were  tested.  This shows that Mut D9 not only functions� �at 60°C, but is also able to reverse  transcribe template DNA using non‐specific (e.g., dT  or LNA) primers as well as specific   

primers types. Mut D9’s ability to produce more� �products with only 10 ng input RNA than  either wild type M‐MLV reverse transcriptase or any  of the other commercially available  (“conventional”) mutant M‐MLV RTs further indicat es an increase in sensitivity.  [211] Moreover, the ability to carry out reverse transcript ion reactions at higher 

temperatures, such as at 60°C, helps to prevent pri merless cDNA synthesis which was visible  for all RTs tested in the “NON‐HS‐RT” reactio ns.  Thus, having an RT that is able to perform  efficiently at 60°C, such as those disclosed herein,  provides the benefit of reducing the  amount of non‐specific priming due to self‐priming  events that can often occur during RT  reactions.  This reduction in primerless cDNA is gre atly enhanced at elevated temperatures  (e.g., at 50°C, 55°C, 60°C, etc.).    

Example 5  

Mutant Reverse Transcriptase Performance in the Presen ce of Inhibitors 

[212] A similar assay as that described in Example 2 was� �performed in the presence of  various inhibitors. RT reaction temperature was 37 ° C for wild type M‐MLV, while the  reaction temperature for other commercially available  mutant M‐MLV RTs (“SSIII” and “C‐ RT”), and Mut D9 was 50°C.  Each RT reaction wa s carried out for 60 minutes.  The RT  inhibitors tested include SDS (0.006‐0.01%), ethanol� �(26‐30%), humic acid (21‐25 ng/µL), bile  salts (0.16‐0.2%), heparin (0.0031‐0.0042 U/µL), a nd hematin (46‐50 µM). As Figure 6  demonstrates, wild type M‐MLV is not functional at� �all concentration of SDS, humic acid, bile  salts, and hematin. It is slightly function in ethan ol but cannot synthesize a full length 0.5 kb  cDNA. However, in the presence of heparin, wild type  M‐MLV is able to synthesize the 0.5 kb  cDNA. SSIII is not functional at all concentration o f SDS, humic acid, and hematin. It is slightly  functional in ethanol and bile salts but cannot synt hesize a full length 0.5 kb cDNA. It can  reverse transcribe up to 1.5 kb when heparin is pre sent. Mut D9 shows greater activity than  both wild type M‐MLV and SSIII at all concentratio ns of inhibitors tested. Mut D9 compared  to other commercially available RTs (i.e., C‐RT) di splays greater activity at all concentrations  of inhibitors tested with the exception of ethanol a nd heparin where activity is 

approximately equal. 

[213] The % activity of the RTs tested in the presence o f the various inhibitors as described  above was quantitated by densitometry using TotalLab  TL100 software. Volume intensity of 

each band was summed in each lane. The volume in tensity of no inhibitor lanes was set to  100% and lanes with inhibitors were normalized as %� �of no inhibitors to give % activity.  Figure 7 shows the comparison of RT activities of t he different RTs shown in Figure 6.