NOVEL SPECIFICALLY SUBSTITUTED THIOPHENOLIC COMPOUNDS Field of the invention The present invention relates to novel, preferably specifically substituted, thiophenolic compounds which preferably are useful in the treatment of diseases, preferably proliferative and/or hyper- proliferative diseases. Preferably, the compounds of the present invention comprise activity in inhibiting one or more helicases, preferably including Werner helicase (WRN). Furthermore, the instant invention preferably relates to the use of the compounds according to the invention to inhibit the activity of one or more helicases, preferably including Werner Helicase (WRN). These compounds are useful for inhibiting the activity of the WRN helicase and for the treatment and/or prevention of medical conditions affected by WRN activity such as proliferative diseases and cancer. Background of invention Werner syndrome protein (WRN, also known as RECQL2) is one of the five members of the human RecQ helicase family. WRN was initially identified as the defective protein responsible for a rare autosomal recessive genetic disorder called Werner Syndrome, characterized by the onset of premature aging and multiple age-related diseases. WRN is an ATP dependent DNA helicase which also possesses exonuclease activity and plays important roles in DNA metabolism, including DNA replication, recombination, repair, and transcription and in maintaining genomic stability via telomere regulation. WRN is crucial for the recovery of stalled replication forks and promotes repair of double-strand breaks. Moreover, loss of WRN function deregulates DNA metabolism, resulting in detrimental consequences for various cellular processes, ultimately causing chromosomal aberrations, replication fork stalling and prolonged S phase triggering/activation of DNA damage checkpoints, leading to G2 arrest. Finally, WRN depleted cells were found to be more sensitive to DNA damaging agents as compared with WRN wild type cells. The role of WRN in DNA repair regulation, together with the fact that this enzyme has been found to be upregulated in a subset of tumors, suggest a possible role of this helicase in promoting cancer and therefore the hypothesis that direct inhibition of this target could lead to anti-tumoral effects in determined genetic contexts. Recent studies published by different groups report WRN as being exquisitely required for the proper growth of cancer cell lines which are characterized by microsatellite instability (MSI) caused by mismatch repair pathway deficiencies. The high incidence of MSI status in cancer patient populations, which today includes predominantly colon, gastric, ovarian and endometrial cancer, but with additional tumor types in continual emergence, is associated with a high unmet medical need, suggesting that a novel WRN targeting drug might be beneficial as a single agent in a synthetic lethal setting, as well as in combination with DNA damaging agents or immuno-modulators in wider cancer populations. Introduction Helicases are classically defined as molecular motors that are able to couple nucleoside triphosphate hydrolysis (typically that of ATP) to the unwinding of polynucleic acids. In doing so, the helicase translocates in a directionally specific manner (3’ to 5’ or 5’ to 3’) along the strand it predominantly interacts with. DNA helicases are classified according to their amino acid sequence homology in the ATPase/helicase core domain into two larger (SF1 and SF2) and four smaller superfamilies (1). There are an estimated 95 helicases or putative helicases (31 DNA helicases and 64 RNA helicases) encoded by the human genome (2-3). WRN (also known as RECQL2), belongs to a conserved RecQ DNA helicase sub-family consisting of RECQL1, RECQL4, RECQL5 and BLM (4-6). These five helicases take part in all stages of DNA replication, comprising unwinding, Okazaki fragment maturation, initiation and extension of lagging and leading-strands. In addition, these “genome guardians” participate in DNA G-quadruplex and Holliday junction resolution (7) as well as in other replication-related processes, such as replication re-initiation, telomere lengthening, translesion synthesis and DNA damage signaling, many of which might represent interesting targets for cancer therapy (4-6). RecQ helicases can therefore be considered as “caretaker” genes that maintain genomic stability (8) and, due to their important roles in DNA metabolism, some of these helicases are implicated in rare heritable human autosomal recessive disorders characterized by genomic instability, developmental abnormalities and premature aging. WRN inactivation is the cause of Werner syndrome (WS), characterized by increased incidence of premature aging related diseases beginning in the second decade of life (3). WRN is the largest protein in the RecQ family, it localizes predominantly to the nucleolus but, after DNA damage, it rapidly mobilizes to other nuclear regions (9) where it regulates DNA strand displacement, normal progression of replication forks, recovery of stalled replication forks induced by DNA damage, proofreading activity and base excision repair regulation via its ATP dependent 3′ to 5′ DNA helicase and DNA exonucleolytic activities, the latter being unique among the RecQ family members (4-5; 10-11). WS cells deficient in functional WRN exhibit replication stress due to irreparable mutations, translesions and damaged DNA forks, that normally occur during cell life (12- 15). These DNA lesions stall DNA replication, making WRN dependent reactivation of stalled replication forks a major challenge for DNA replication machinery, ultimately leading to highly toxic DNA double strand breaks (DSBs) which are mainly repaired by NHEJ and HR pathways. Improperly repaired DSBs are the cause of genome instability (16-17). WRN-knockout mice have no overt pathology and fail to recapitulate features of clinical WS (18-20) whereas, in contrast to WS cells which lack functional WRN, many types of cancers and cell lines display increased levels of the helicase. High level of helicase is also induced by c-Myc and by the presence of several translocations including BCR/ABL (6; 21- ,23). Accordingly, high levels of WRN are beneficial to cell cycle progression and proliferation of cancer cells (4-5). By contrast, low levels of the helicase-nuclease due to targeted inhibition led to replication stress, owing to the formation of translesions, stalled DNA forks and genome fragility, all of which can trigger cell death (24-25). WRN was recently reported to be required for the proper proliferation of cancer cell lines characterized by microsatellite instability (MSI) caused by mismatch repair pathway deficiencies and this synthetic lethality requires the helicase/ATPase activity of the enzyme (26-29). In 2020 an elegant paper published by Nussenzweig and coworkers reported that the synthetic lethality is due to the presence in the genome of MSI cells of long TA repeats that form secondary DNA structure that require the unwinding activity of WRN (30). The high incidence of MSI status in cancer patient population is associated with a high unmet medical need, suggesting that a novel WRN targeting drug might be beneficial as a single agent in a synthetic lethal setting, as well as in combination with DNA damaging agents or immuno-modulators in wider cancer populations. References 1. Singleton, M.R., et al. Structure and mechanism of helicases and nucleic acid translocases. Annu. Rev. Biochem.76, 23–50 (2007). 2. Umate, P., et al. Genome-wide comprehensive analysis of human helicases. Commun. Integr. Biol.4, 118–137 (2011). 3. Bosh RM. DNA helicases involved in DNA repair and their roles in cancer. Nature Rev Cancer 13(8): 542–558. (2013). 4. Brosh RM.et al. DNA helicases involved in DNA repair and their roles in cancer. Nat. Rev. Cancer 13 (2013) 542–558. 5. Brosh RM., V.A. Bohr, Human premature aging, DNA repair and RecQ helicases. Nucleic Acids Res.35 (2007) 7527–7544. 6. Croteau DL et al. Human RecQ helicases in DNA repair, recombination, and replication. Annu. Rev. Biochem.83 (2014) 519–552. 7. Mendoza o et al. G-quadruplexes and helicases. Nucleic Acids Res.44 (2016) 1989– 2006. 8. Cotreau DL et al. Human RecQ Helicases in DNA Repair, Recombination and Replication. Annu. Rev. Biochem. (2014).83:519–52. 9. Shamanna RA et al. WRN regulates pathway choice between classical and alternative non-homologous end joining. Nature Communications 7, 13785 (2016). 10. Gocha AR et al. WRN loss induces switching of telomerase-independent mechanisms of telomere elongation. PLoS ONE 9 (2014), e93991. 11. Banerjee T et al. Catalytic strand separation by RECQ1 is required for RPA-mediated response to replication stress. Curr. Biol.25 (2015) 2830–2838. 12. Hand R et al. A retarded rate of DNA chain growth in Bloom’s syndrome. Proc. Natl. Acad. Sci. U. S. A.72 (1975) 758–762. 13. Poot M et al. Impaired S-phase transit of Werner syndrome cells expressed in lymphoblastoid cell lines. Exp. Cell Res.202 (1992) 267–273. 14. Sidorova J et al. The RecQ helicase WRN is required for normal replication fork progression after DNA damage or replication fork arrest. Cell Cycle 7 (2008) 796–807. 15. Sidorova J et al. Distinct functions of human RECQ helicases WRN and BLM in replication fork recovery and progression after hydroxyurea-induced stalling. DNA Repair 12 (2013) 128–139. 16. Chang HHY et al. Non-homologous DNA end joining and alternative pathways to double-strand break repair. Nat. Rev. Mol. Cell Biol. (2017) Aug;18(8):495-506. 17. Tubbs A et al. Endogenous DNA Damage as a Source of Genomic Instability in Cancer. Cell 168, February 9, (2017). 18. Lebel M, Leder P. A deletion within the murine Werner syndrome helicase induces sensitivity to inhibitors of topoisomerase and loss of cellular proliferative capacity. Proc. Natl. Acad. Sci. USA 95:13097–102 (1998). 19. Lombard DB et al. Mutations in the WRN gene in mice accelerate mortality in a p53- null background. Mol. Cell. Biol.20:3286–91 (2000). 20. Luo J WRN protein and Werner syndrome. NAM J Med sci (2010);3(4):205-207. 21. Arai A et al. RECQL1 and WRN proteins are potential therapeutic targets in head and neck squamous cell carcinoma. Cancer Res.71 (2011) 4598–4607. 22. Futam K et al. RECQL1 and WRN DNA repair helicases: potential therapeutic targets and proliferative markers against cancers. Front. Genet.5 (2015) 441. 23. Slupianek A. BCR/ABL stimulates WRN to promote survival and genomic instability. Cancer research (2011) Feb 1;71(3):842-51. 24. Basile G et al. Checkpoint-dependent and independent roles of the Werner syndrome protein in preserving genome integrity in response to mild replication stress. Nucleic Acids Res.42 (2014) 12628–12639. 25. Iannascoli C et al. The WRN exonuclease domain protects nascent strand from pathological MRE11/EXO1-dependent degradation. NAR, 9788 (2015). 26. Chan EM et al. WRN Helicase is a Synthetic Lethal Target in Microsatellite Unstable Cancers. Nature; 568 (7753): 551-55 (2019). 27. Behan FM et al. Prioritization of oncology therapeutic targets using CRISPR- Cas9 screening. Nature, 568 (7753): 511-516 (2019). 28. Lieb S et al. Werner syndrome helicase is a selective vulnerability of microsatellite instability-high tumor cells. eLife; 8: e43333 (2019). 29. Kategaya L et al. Werner syndrome helicase is required for the survival of cancer cells with microsatellite instability. iScience 29; 13:488-497 (2019). 30. Van Wietmarschen N et al. Repeat expansions confer WRN dependence in microsatellite-unstable cancers. Nature 586 (7828): 292-298 (2020). The present invention provides new compounds which are endowed with inhibitory activity against Werner helicase protein (WRN, RECQL2) and are thus useful in the therapy or treatment of disorders, preferably disorders as described herein, and especially in the therapy or treatment of cancer. Accordingly, the object of the present invention is to provide a compound of formula (I): wherein: Cy ¹ is selected from the group consisting of P ¹ and/or or P ^2; P ¹ is selected from optionally substituted monocyclic residues, selected from the group consisting of C ₃ -C ₈ cycloalkyl residues, optionally substituted phenyl residues, optionally substituted saturated or ethylenically unsaturated 4-to-8 membered heterocyclic residues, and/or optionally substituted aromatic 5-to-6-membered heterocyclic residues, wherein each of said substituted monocyclic residues is mono- , di-, tri-, tetra- or penta-substituted and wherein each substituent is preferably selected independently from each other from Hal, CN, NO ₂ , oxo, linear or branched C ₁ -C ₆ alkyl, linear or branched C ₁ -C ₆ haloalkyl, linear or branched C ₁ -C ₆ perhaloalkyl, and wherein said heterocyclic residues comprise 1-4 heteroatoms in each case independently selected from from N, O and/or S atoms; P ² is selected from optionally substituted bicyclic residues, selected from the group consisting of 8-, 9- or 10- membered carbocycles or 8-, 9- or 10- membered heterocycles, wherein said substituted carbocycles or heterocycles are mono-, di-, tri-, tetra- or penta-substituted by substituents in each case independently selected from Hal, CN, NO ₂ , oxo, linear or branched C ₁ -C ₆ alkyl, linear or branched C ₁ -C ₆ haloalkyl, linear or branched C ₁ -C ₆ perhaloalkyl, C ₁ -C ₆ haloalkyl, and linear or branched C ₁ -C ₆ perhaloalkyl, wherein at least one ring of the bicyclic hydrocarbon or heterocycle is ethylenically unsaturated or aromatic, and wherein the heterocyclic system contains 1-5 heteroatoms, in each case independently selected from N, O and/or S atoms; R is in each case independently selected from each other from hydrogen atoms, optionally substituted linear, branched and/or cyclic C ₁ -C ₈ alkyl, optionally substituted linear or branched C ₂ -C ₆ alkenyl, optionally substituted linear or branched C ₂ -C ₆ alkynyl, optionally substituted C ₃ -C ₇ cycloalkyl, optionally substituted R ⁵ R ⁶ N-C ₁ -C ₆ alkyl, optionally substituted R ⁵ , optionally substituted R ⁵ C ₁ -C ₆ alkyl, optionally substituted R ⁵ O, optionally substituted R ⁵ O-C ₁ -C ₆ alkyl, optionally substituted linear or branched C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, linear or branched R ⁵ O-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, linear or branched R ⁵ R ⁶ N-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, optionally substituted heterocyclyl, optionally substituted heteroaryl or optionally substituted aryl group, wherein in each group 1 to 2 carbon atoms optionally may be replaced by O, SO, SO ₂ , and/or wherein in each group 1 to 5 hydrogen atoms may be independently replaced by oxo, halogen, cyano, isocyano, nitril and/or isonitril; and wherein A is oxygen (atom) or NR ^a ; m is in each case independently selected from each other from 0, 1, 2, 3 and/or 4, preferably 1, 2, 3 and/or 4; R ⁵ is independently selected from hydrogen, a linear or branched C ₁ -C ₆ alkyl, C ₁ -C ₆ -A- C ₁ -C ₆ alkyl, C ₁ -C ₆ -alkyl-O-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, heterocyclyl-NR ⁶ -C ₁ -C ₆ -alkyl, heterocyclyl-NR ⁶ -C ₁ -C ₆ -A- C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, C ₅ -C ₁₂ bicycloalkyl, heterocyclyl, bicyclic heterocyclyl, aryl, and heteroaryl group, wherein 1 to 12 H atoms may be replaced by Hal, preferably F, and wherein each of said cycloalkyl, bicycloalkyl, heterocyclyl, and bicyclic heterocyclyl groups may be substituted by oxo, cyano, isocyano, nitril and/or isonitril; and/or R ⁵ is Het ¹ , wherein Het ¹ is an aliphatic, ethylenically unsaturated or aromatic 3- to 7-membered heterocyclic ring that contains 1-4 nitrogen atoms and optionally 1 or 2 heteratoms, independently selected from O and S, which heterocyclic ring can be substituted by 1-4 substituents, independently selected from oxo, halogen, C ₁ -C ₄ -alkyl, C ₁ -C ₄ -haloalkyl and C ₁ -C ₄ - perhaloalkyl, R ⁶ is independently selected from hydrogen, COR ⁷ , a linear or branched C ₁ -C ₆ alkyl, C ₁ - C ₆ -A-C ₁ -C ₆ alkyl, R ⁵ O-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, R ⁵ R ⁶ N-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, C ₅ -C ₁₂ bicycloalkyl, heterocyclyl, bicyclic heterocyclyl, aryl, heteroaryl group, wherein 1 to 12 H atoms may be replaced by hal, preferably F, and/or R ⁵ and R ⁶ , taken together with the nitrogen atom to which they are bonded, may form a heterocyclyl group which may contain 1 or 2 further heteroatoms, independently selected from N, O and S, and which may be substituted by oxo, halogen, cyano, isocyano, nitril and/or isonitril; R ⁷ is independently selected from hydrogen atom, NR ⁸ R ¹⁰ , OR ¹⁰ , R ⁸ R ¹⁰ N-C ₁ -C ₆ alkyl, R ¹⁰ O-C ₁ -C ₆ alkyl, an optionally substituted linear or branched C ₁ -C ₆ alkyl, C ₁ -C ₆ -A-C ₁ - C ₆ alkyl, R ¹⁰ O-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, R ⁸ R ¹⁰ N-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl or heteroaryl group wherein 1 to 12 H atoms may be replaced by Halogen, preferably F; and R ^a is in each case independently selected from the group consisting of hydrogen, COR ⁷ , a linear or branched C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl, heteroaryl group, wherein one or more of the hydrogen atoms may be replaced by halogen, preferably halogen selected from the group consisting of F, Cl, Br and I, or R ^a , together with another Residue R ¹ to R ¹¹ other than hydrogen, may form, taken together with the nitrogen or oxygen atom to which they are bonded to, may form a heterocyclyl group; preferably provided that when Cy ¹ is an optionally fused, optionally substituted nitrogen- containing 5-membered ring, then preferably one or more, and preferably all, nitrogen atom possessing exocyclic bonds are substituted with R, wherein R is as defined above except hydrogen; X is S, SO or SO ₂ ; Y denotes a group selected from wherein each residue R ^a is preferably in each case independently selected from the group consisting of hydrogen, COR ⁷ , a linear or branched C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ - C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl, heteroaryl group, wherein one or more of the hydrogen atoms may be replaced by halogen, preferably halogen selected from the group consisting of F, Cl, Br and I, or R ^a , together with another Residue R ¹ to R ¹¹ other than hydrogen, may form, taken together with the nitrogen or oxygen atom to which they are bonded to, may form a heterocyclyl group; Cy ² is in each case independently selected from optionally substituted monocyclic aryl, optionally substituted monocyclic heteroaryl, optionally substituted and/or fused monoaryl, optionally substituted and/or fused hetero-monoaryl, optionally substituted bicyclic and/or tricylic aryl, optionally substituted bicyclic and/or tricylic heteroaryl, optionally fused heteroaryl ring optionally substituted C ₃ -C ₇ cycloalkyl and/or optionally substituted or C ₆ -C ₁₀ bicycloalkyl, wherein one or more hydrogen atoms can be optionally and independently substituted by R ¹ other than hydrogen; R ¹ is in each case independently from each other selected from hydrogen atom, halogen atom, cyano, C(=O)R ⁷ , NR ⁸ R ⁹ , NR ⁸ C(=O)R ⁷ , OR ¹⁰ , SR ¹⁰ , SF ₅ , SO ₂ R ¹¹ , NR ⁸ SO ₂ R ¹¹ , R ⁵ R ⁶ N-C ₁ -C ₆ alkyl (linear and/or branched), R ⁶ O-C ₁ -C ₆ alkyl (linear, branched and/or cyclic), R ⁶ C(=O)-C ₁ -C ₆ alkyl (linear, branched and/or cyclic), R ⁸ R ⁹ NC(=O)-C ₁ -C ₆ alkyl (linear, branched and/or cyclic), optionally substituted linear, branched and/or cyclic C ₁ -C ₈ alkyl, linear or branched C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, linear or branched R ⁶ O-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, linear or branched R ⁵ R ⁶ N-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, optionally substituted C ₃ -C ₇ cycloalkyl, optionally substituted C ₆ -C ₁₂ bicycloalkyl, optionally substituted C ₅ -C ₇ cycloalkenyl, optionally substituted linear, branched and/or cyclic C ₂ -C ₆ alkenyl, optionally substituted linear or branched C ₂ -C ₆ alkynyl, optionally substituted aryl, optionally substituted aryl-C ₁ -C ₆ alkyl (linear, branched and/or cyclic), optionally substituted aryl-C ₃ -C ₇ cycloalkyl, optionally substituted aryl-C ₂ -C ₆ alkenyl, optionally substituted aryl-C ₂ -C ₆ alkynyl, optionally substituted heterocyclyl , optionally substituted heterocyclyl-C ₁ -C ₆ alkyl, optionally substituted heterocyclyl-C ₃ -C ₇ cycloalkyl, optionally substituted heterocyclyl-C ₂ -C ₆ alkenyl, optionally substituted heterocyclyl-C ₂ - C6 alkynyl, optionally substituted heteroaryl, optionally substituted heteroaryl-C ₁ -C ₆ alkyl, optionally substituted heteroaryl-C ₃ -C ₇ cycloalkyl, heteroaryl-C ₂ -C ₆ alkenyl, heteroaryl-C ₂ -C ₆ alkynyl, wherein one or more hydrogen atoms, preferably 1 to 12 hydrogen atoms may be independently substituted or replaced by substituents selected from linear or branched C ₁ -C ₆ alkyl, linear or branched C ₁ -C ₆ haloalkyl, linear or branched C ₁ -C ₆ perhaloalkyl, Hal, CN, NC or oxo, wherein preferably at least one ring of the bicyclic hydrocarbon or heterocycle is ethylenically unsaturated or aromatic, and wherein the heterocyclic or heteroaromatic residues contain 1-5 heteroatoms, in each case independently selected from N, O and/or S atoms, and preferably wherein in each group 1 to 2 carbon atoms optionally may be replaced by O, SO, SO ₂ , and/or wherein in each group 1 to 5 hydrogen atoms may be independently replaced by halogen, preferably F, Cl and/or I, cyano, isocyano, nitril and/or isonitril; and/or R ¹ is in each case independently from each other selected from Het ² , Het ² -C ₁ -C ₆ alkyl, Het ² - O, Het ² -O-C ₁ -C ₆ alkyl, Het ² NR ^a , Het ² NR ^a -C ₁ -C ₆ alkyl, wherein in each group 1 to 5 hydrogen atoms may be independently replaced by halogen, preferably F, Cl and/or I, cyano, isocyano, nitril and/or isonitril; and wherein Het ² is an aliphatic, ethylenically unsaturated or aromatic 3- to 7-membered heterocyclic ring that contains 1-4 nitrogen atoms and optionally 1 or 2 heteroatoms, independently selected from O and S, which heterocycling ring can be substituted by 1-4 substituents, independently selected from oxo, halogen, C ₁ -C ₄ -alkyl, C ₁ -C ₄ -haloalkyl and C ₁ -C ₄ - perhaloalkyl; and/or R ¹ is in each case independently from each other selected from R ^c , R ^c’ and/or R ^c’’ , wherein R ^c , R ^c’ and R ^c’’ is in each case independently from each other selected from linear or branched C ₁ -C ₆ alkyl, linear or branched C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, linear or branched R ⁶ O- C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, linear or branched R ⁵ R ⁶ N-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, linear, branched or cyclic C ₁ -C ₆ haloalkyl, linear, branched or cyclic C ₁ -C ₆ perhaloalkyl, C ₅ -C ₁₂ bicycloalkyl C ₅ -C ₁₂ bicyclohaloalkyl, Hal, CN, NC, C(=O)OR ¹² , C(=O)NR ⁸ R ⁹ , -NR ¹⁵ R ¹⁶ , 5-, 6- or 7- membered heterocyclyl and/or O-heterocyclyl residues which contain 1, 2 or 3 heteroatoms independently selected from N, O and S, 5 to 12-membered bicyclic heterocyclyl and/or bicyclic O-heterocyclyl residues which contain 1, 2 or 3 heteroatoms independently selected from N, O and S, and wherein preferably in each residue R ¹ , R ^c , R ^c’ and/or R ^c’’ other than Hal, CN, NC or perhaloalkyl, 1 to 5 hydrogen atoms may be independently replaced by halogen, preferably F, Cl and/or I, and/or cyano, isocyano, nitril and/or isonitril; wherein R ¹² is in each case independently selected from the meanings given for R ⁷ , and wherein R ¹⁵ and R ¹⁶ are in each case independently selected from the meanings given for R ⁵ and R ⁶ , respectively; U is hydrogen, halogen atom, -NH ₂ , -NR ⁵ R ⁶ , NHAc, nitro, cyano, trifluoromethyl, C(OH) ₂ R ¹¹ , COR ¹¹ or SO ₂ R ¹¹ ; Ac is in each case independently selected from acetyl and/or acetyl residues in which one or more or all hydrogen atoms are replaced by Hal, preferably F; R ² , R ³ and R ⁴ are independently from each other hydrogen, halogen atom, cyano, SR ⁵ , OR ⁵ , COR ⁷ , NHAc, R ⁵ R ⁶ N-C ₁ -C ₆ alkyl, R ⁵ O-C ₁ -C ₆ alkyl, C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, R ⁵ O-C ₁ -C ₆ -A-C ₁ - C ₆ alkyl, R ⁵ R ⁶ N-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, a linear or branched C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ - C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl, heteroaryl group wherein 1 to 12 H atoms may be independently replaced by F or, taken together with the atoms to which they are bonded, R ³ and R ⁴ may form a fused aryl, heteroaryl, cycloalkyl or heterocyclyl ring; R ⁸ and R ⁹ are independently hydrogen atom, a linear or branched C ₁ -C ₆ alkyl, C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, R ⁵ O-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, R ⁵ R ⁶ N-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, C ₅ -C ₁₂ bicycloalkyl R ⁵ R ⁶ N-C ₂ -C ₆ alkyl, R ⁵ O-C ₂ - C ₆ alkyl, heterocyclyl, aryl or heteroaryl group, wherein 1 to 12 H atoms may be replaced by F, or R ⁸ and R ⁹ , taken together with the nitrogen atom to which they are bonded, may form a heterocyclyl group which additionally may contain 1, 2 or 3 heteroatoms independently selected from N, O and S; R ¹⁰ is hydrogen, COR ⁸ , SO ₂ R ¹¹ , R ⁵ R ⁶ N-C ₂ -C ₆ alkyl, R ⁵ O-C ₂ -C ₆ alkyl group, a linear or branched C ₁ -C ₆ alkyl, C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, R ⁵ O-C ₁ -C ₆ -A-C ₁ -C ₆ alkyl, R ⁵ R ⁶ N-C ₁ -C ₆ -A- C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, C ₅ -C ₁₂ bicycloalkyl, heterocyclyl , aryl or heteroaryl group, wherein 1 to 12 H atoms may be replaced by Hal, preferably F; R ¹¹ is NR ⁸ R ⁹ , OR ¹⁰ , R ⁵ R ⁶ N-C ₁ -C ₆ alkyl, R ⁵ O-C ₁ -C ₆ alkyl, linear, branched or cyclic C ₁ -C ₆ alkyl, linear, branched or cyclic C ₁ -C ₆ haloalkyl, linear, branched or cyclic C ₁ -C ₆ perhaloalkyl, linear, branched or cyclic C ₁ -C ₆ perfluoroalkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl or heteroaryl group, wherein 1 to 12 H atoms may be replaced by Hal, preferably F; Hal is halogen (atom), in each case independently selected from the group consisting of I, Br, Cl and F; n is in each case independently selected from each other from 0, 1, 2, 3 and/or 4, preferably 1, 2, 3 and/or 4; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer thereof and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Preferably, the present invention provides a compound of formula (I) and/or compound of one or more of subformulae (Ia) to (Ik) and/or (Ir) to Iu), preferably as defined in more detail above and/or below, wherein: X is preferably independently selected from the group consisting of S, SO and SO ₂ ; Y is preferably independently selected from the group consisting of wherein each residue R ^a is preferably in each case independently selected from the group consisting of hydrogen, COR ⁷ _, a linear or branched C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ - C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl, heteroaryl group, in all of which one or more of the hydrogen atoms may be replaced by halogen, preferably halogen selected from the group consisting of F, Cl, Br and I, or R ^a , together with another Residue R ¹ to R ¹¹ other than hydrogen, may form, taken together with the nitrogen or oxygen atom to which they are bonded to, may form a heterocyclyl group; U is preferably in any case independently selected from the group consisting of hydrogen, halogen, NH ₂ , NR ^a R ^b , NHAc, nitro, cyano, trifluoromethyl, C(OH) ₂ R ¹¹ , COR ¹¹ or SO ₂ R ¹¹ ; wherein each residue R ^a and/or R ^b is preferably in each case independently selected from the group consisting of hydrogen, COR ⁷ , a linear or branched C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl, heteroaryl group, in all of which one or more of the hydrogen atoms may be replaced by halogen, preferably halogen selected from the group consisting of F, Cl, Br and I, or R ^a and R ^b , taken together with the nitrogen or oxygen atom to which they are bonded to, may form a heterocyclyl group; and wherein Ac and/or each residue R ¹¹ is preferably independently selected from meanings given above and/ or below; and more preferably wherein each residue R ¹¹ is independently selected from the group consisting of C ₁ -C ₄ -alkyl, C ₁ -C ₄ -haloalkyl, and C ₁ -C ₄ -perhaloalkyl, and/or selected from the group consisting of C ₁ -C ₄ -alkyl, C ₁ - C ₄ -fluoroalkyl, and C ₁ -C ₄ -perfuoroalkyl, R ² , R ³ and R ⁴ are preferably independently selected from each other from the group consisting of hydrogen, halogen atom, cyano, SR ⁵ , OR ⁵ , COR ⁷ , R ⁵ R ⁶ N-C ₁ -C ₆ alkyl, R ⁵ O-C ₁ -C ₆ alkyl, a linear or branched C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl, heteroaryl group wherein 1 to 12 H atoms may be independently replaced by F, or taken together with the atoms to which they are bonded, R ³ and R ⁴ may form a fused aryl, heteroaryl, cycloalkyl or heterocyclyl ring; and/or R ² , R ³ and R ⁴ are independently from each other selected from hydrogen, cyano, halogen and C ₁ -C ₆ alkyl and/or C ₁ -C ₆ alkylsulfanyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by 1-3 substituents, selected from C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer thereof and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. More preferred are compounds of formula (I), preferably as described above and/or below, wherein is preferably selected from one or more of structures a) to q), wherein a) is preferably selected from one more of , , and , b) is preferably selected from one more of , , and , c) is preferably selected from one more of , , and d) is preferably selected from one more of , , and e) is preferably selected from one more of , , and f) is preferably selected from one more of , , and g) is preferably selected from one more of , , and h) is preferably selected from one more of , , and i) is preferably selected from one more of , , and j) is preferably selected from one more of , , and k) is preferably selected from one more of , , and l) is preferably selected from one more of , , and m) is preferably selected from one more of , , n) is preferably selected from one more of , , o) is preferably selected from one more of , , and p) is preferably selected from one more of , , and and/or q) is preferably selected from one more of , , and/or and/or structures a) to q) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. More preferred are compounds of formula (I), preferably as described above and/or below, wherein is selected from one or more of structures a) to h), wherein a) is preferably selected from and structures according to a) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; b) is preferably selected from , and structures according to b) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; c) is preferably selected from one more of , and structures according to c) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; d) is preferably selected from , and structures according to d) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; e) is preferably selected from , and structures according to e) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; f) is preferably selected from , and structures according to f) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; g) is preferably selected from , and structures according to g) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; h) is preferably selected from one more of , and structures according to h) in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl. Also preferred are compounds of formula (I), preferably as described above and/or below, wherein is preferably selected from one or more of structures given below: , , , , , , and/or , and/or structures as given above in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Alternatively preferred are compounds of formula (I), preferably as described above and/or below, wherein is preferably selected from , and/or structures as given above in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Especially preferred are compounds of formula (I), preferably as described above and/or below, wherein is preferably selected from one or more of structures given below: , , , , , , , and/or , and/or structures as given above in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Preferred are compounds of formula (I) and/or compounds of one or more of subformulae (Ia) to (Ik) and/or (Ir) to Iu), preferably as defined in more detail above and/or below, wherein is preferably as described above and/or below and more preferably selected from one or more of , , , , , , , , and/or , and/or structures as given above in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Also preferred are compounds of formula (I) and/or compounds of one or more of subformulae (Ia) to (If), preferably as defined in more detail above and/or below, wherein is preferably as described above and/or below and more preferably selected from one or more of , , , , , , , , , N N N O ^H _{, , ,} and/or structures as given above in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Also preferred are compounds of formula (I) and/or compounds of one or more of subformulae (Ia) to (If), preferably as defined in more detail above and/or below, wherein is preferably selected from one or more of structures i) to viii), wherein i) is preferably selected from one more of , , ii) is preferably selected from one more of , , iii) is preferably selected from one more of , , iv) is preferably selected from one more of , , v) is preferably selected from one more of , , , vi) is preferably selected from , vii) is preferably selected from , viii) is preferably selected from , and/or structures as given above in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Also preferred are compounds of formula (I) and/or compounds of one or more of subformulae (Ia) to (If), preferably as defined in more detail above and/or below, wherein i) is preferably selected from one more of , ii) is preferably selected from one more of , , iii) is preferably selected from one more of , iv) is preferably selected from one more of , , , v) is preferably selected from one more of vi) is preferably selected from one more of and/or structures as given above in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Also preferred are compounds of formula (I) and/or compounds of one or more of subformulae (Ia) to (If), preferably as defined in more detail above and/or below, wherein is preferably selected from one or more of structures 1) to 3), wherein 1) is preferably selected from one more of , , , , , and , 2) is preferably selected from one more of , and ; and/or 3) is preferably selected from one more of and/or structures as given above in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Preferably, the compounds according to formula (I), the compounds according to one or more of sub-formulae (Ia) to (If), the compounds according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according one or more of sub-formulae (Ir) to (Iu) comprise at least one residue R ¹ . More preferably, at least one of said residues R ¹ is other than hydrogen (or hydrogen atom or H). Even more preferably, the compounds according to formula (I), the compounds according to one or more of sub-formulae (Ia) to (If), the compounds according to one or more of sub- formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according one or more of sub-formulae (Ir) to (Iu) comprise at least one residue R ¹ other than hydrogen (or hydrogen atom or H), which is preferably selected from the meanings given for R ¹ other than hydrogen hereinabove and/or hereinbelow. Even more preferably, of said at least one residue R ¹ other than hydrogen (or hydrogen atom or H), one residue R ¹ is located in the para-position relative to group Y (or the group that Y stands for) on Cy ² (or the group that Cy ² stands for). Thus, especially preferred are compounds according to formula (I), the compounds according to one or more of sub-formulae (Ia) to (If), the compounds according to one or more of sub- formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according one or more of sub-formulae (Ir) to (Iu) which comprise at least one residue R ¹ other than hydrogen on the cyclic residue that Cy ² stands, wherein one residue R ¹ other than hydrogen is located in the para position relative to Y. This is especially preferred if Cy ² comprises or consists of a 6-membered cyclic group or residue, preferably a 6-membered cyclic residue as defined herein above and/or hereinbelow for Cy ² . In this case preferably both said R ¹ (other than hydrogen) and said group Y are preferably located in para-position to each other. Especially preferred are compounds of formula (I) as described above and/or below in more detail, but that are selected from one or more subformulae (Ia) to (If):

, and/or wherein R ¹ , R ² , R ³ , R ⁴ , and/or R ^a preferably are as defined above and /or below, Cy ¹ -R and/or Cy ¹ -(R)m are as defined above and/or below and especially Cy ¹ -R is as defined above and/or below, and wherein R ^c , R ^c‘ and/or R ^c’’ are independently from each other selected from hydrogen, halogen atom, cyano, SR ⁵ , OR ⁵ , COR ⁷ , R ⁵ R ⁶ N-C ₁ -C ₆ alkyl, R ⁵ O-C ₁ -C ₆ alkyl, a linear or branched C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₃ -C ₇ cycloalkyl, heterocyclyl, aryl, heteroaryl group wherein 1 to 12 H atoms may be independently replaced by F, or, taken together with the atoms to which they are bonded, two out of R ^c , R ^c‘ and R ^c‘’ may form a fused aryl, heteroaryl, cycloalkyl or heterocyclyl ring, and/or selected from dimethylamino and/or dimethylamino in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, (dimethylamino)ethoxy and/or (dimethylamino)ethoxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, methoxy and/or methoxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-trifluoromethoxy, 1-hydroxyethyl and/or 1-hydroxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or one or more of subformulae (Ia) to (If) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Especially preferred are compounds of formula (Ia) as described above and/or below in more detail that are selected from subformula (Ia’): . If not explicitly indicated otherwise, a reference to a compound of formula (Ia) and/or subformula (Ia) shall preferably always include a reference to a compound of formula (Ia’). Especially preferred are compounds of formula (Ib) as described above and/or below in more detail that are selected from subformula (Ib’): . If not explicitly indicated otherwise, a reference to a compound of formula (Ib) and/or subformula (Ib) shall preferably always include a reference to a compound of formula (Ib’). Especially preferred are compounds of formula (I) as described above and/or below in more detail, but that are selected from one or more subformulae (Ia) to (If), preferably including subformulae (Ia’) and/or (ib’) : and/or , and/or , , , , and/or preferably as described above and/or below, wherein R ¹ is preferably selected from the meanings given for R ¹ above and/or below other than hydrogen, and is especially preferably selected, preferably in each case independently, from the group consisting of: methyl and/or methyl in which 1, 2 or 3 of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, ethyl and/or ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-1-yl and/or propan-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-2-yl and/or propan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, butan-2-yl and/or butan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-methylpropyl and/or 2-methylpropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-cyclopropylethyl and/or 2-cyclopropylethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, tert-butyl and/or tert-butyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopropyl and/or cyclopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclobutyl and/or cyclobutyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopentyl and/or cyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methylcyclopentyl and/or 3-methylcyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-methylcyclohexyl and/or 1-methylcyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-1-en-1-yl and/or cyclopent-1-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-2-en-1-yl and/or cyclopent-2-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent‐3‐en‐1‐yl and/or cyclopent-3-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclohexyl and/or cyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, bicyclo[3.1.0]hexan-1-yl and/or bicyclo[3.1.0]hexan-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, phenyl and/or phenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, benzyl and/or benzyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-methylphenyl and/or 2-methylphenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methylphenyl and/or 3-methylphenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 4-methylphenyl and/or 4-methylphenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-tert-butylphenyl and/or 2-tert-butylphenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-tert-butylphenyl and/or 3-tert-butylphenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 4-tert-butylphenyl and/or 4-tert-butylphenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, ethyl-isopropyl-amino and/or ethyl-isopropyl-amino in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, azetidin-1-yl and/or azetidin-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-azaspiro[3.3]heptan-2-yl and/or 2-azaspiro[3.3]heptan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, pyrrolidin-1-yl and/or pyrrolidin-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, piperidin-1-yl and/or piperidin-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 4-methyl-piperidin-1-yl and/or 4-methyl-piperidin-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, piperazin-1-yl and/or piperazin-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, azepan-1-yl and/or azepan-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-azabicyclo[3.1.0]hexan-3-yl and/or 3-azabicyclo[3.1.0]hexan-3-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-aza-bicyclo[3,2,2]non-3-yl and/or 3-aza-bicyclo[3,2,2]non-3-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-cyanocyclopentyl and/or 1-cyanocyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1,1,1-trifluoropropan-2-yl, 1,1,1,2,3,3,3-heptafluoropropan-2-yl, 1,1,2,2,3,3,3-heptafluoropropyl 2,2-difluoro-1-methylcyclopropyl, 2,2-difluorocyclopentyl, 3,3-difluoroazetidin-1-yl, 3-methylpyrrolidin-1-yl, 4,4-dimethylpiperidin-1-yl, 3,3-difluoropiperidin-1-yl, 4,4-difluoro-piperidin-1-yl, 4-methyl-piperazin-1-yl, 2-hydroxypropan-2-yl and/or 2-hydroxypropan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, methoxy and/or methoxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, ethoxy and/or ethoxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, isopropoxy and/or isopropoxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, tert-butoxy and/or tert-butoxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 4-prop-2-yn-yloxy and/or 4-prop-2-yn-yloxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopentyloxy and/or cyclopentyloxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, phenoxy and/or phenoxy in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, difluoromethoxy, trifluoromethoxy, bicyclo[2,2,1]hept-2-ylamino and/or bicyclo[2,2,1]hept-2-ylamino in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or trifluoromethylsulfanyl; perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or one or more of subformulae (Ia) to (If) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Further preferred are compounds of formula (I) as described above and/or below in more detail and especially compounds selected from one or more subformulae (Ia) to (If), preferably including subformulae (Ia’) and/or (ib’) as described above and/or below, wherein R ^c and/or R ^c’ , more preferably R ^c , is in each case independently selected from the group consisting of: Hydrogen, hydrogen atom or H; Hal or halogen, preferably F or Cl; methyl and/or methyl in which 1, 2 or 3 of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl; and/or nitril or CN. Further preferred are compounds of formula (I) as described above and/or below in more detail and especially compounds selected from one or more subformulae (Ia) to (If), preferably including subformulae (Ia’) and/or (ib’) as described above and/or below, wherein R ^c and/or R ^c’ , more preferably R ^c , is in each case independently selected from the group consisting of: R ^c and/or R ^c’ , more preferably R ^c’ , is in each case independently selected from the group consisting of: Hydrogen, hydrogen atom or H (atom); Hal or halogen, preferably F or Cl; methyl and/or methyl in which 1, 2 or 3 of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl; nitril or CN; C(=O)NH ₂ ; C(=O)NHR ⁵ ; C(=O)NR ⁵ R ⁶ ; NH ₂ ; NHR ⁵ ; NR ⁵ R ⁶ ; OR ⁵ ; O(CR ⁵ R ⁶ )1-4R ⁵ O(CR ⁵ R ⁶ )1-4NR ⁵ R ⁶ as defined above and/or below, and especially are independently selected from hydrogen, C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or one or more of subformulae (Ia) to (If) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Preferably, at least one of R ^c and/or R ^c’ is other than hydrogen. Even more preferably, R ^c is preferably other than hydrogen. Preferred are compounds of formula (I), preferably as described in more detail above and/or below, wherein is preferably selected from one or more of: , , , , ,

and/or and/or structures in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Especially preferred are compounds of formula (I), preferably as described above and/or below in more detail, but especially compounds that are selected from one or more subformulae (Ig) to (Ij): wherein R ¹ and/or R is preferably as defined above and/or below, Z ¹ , Z ² , Z ³ and/or Z ⁴ is independently selected from N and/or CR ^Z , wherein each R ^Z is independently selected from the meanings given for R ⁸ and/or R ⁹ , or is independently selected from the group consisting of H, C ₁ -C ₄ -alkyl, C ₁ -C ₆ -cycloalkyl, C ₁ -C ₄ -hydroxyalkyl, C ₁ -C ₄ -Halo-alkyl and C ₁ -C ₄ - perhaloalkyl, or selected from one or more of the following residues: methyl and/or methyl in which 1, 2 or 3 of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, ethyl and/or ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-1-yl and/or propan-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-2-yl and/or propan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, butan-2-yl and/or butan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-methylpropyl and/or 2-methylpropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-cyclopropylethyl and/or 2-cyclopropylethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, tert-butyl and/or tert-butyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopropyl and/or cyclopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclobutyl and/or cyclobutyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopentyl and/or cyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methylcyclopentyl and/or 3-methylcyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-methylcyclohexyl and/or 1-methylcyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-1-en-1-yl and/or cyclopent-1-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-2-en-1-yl and/or cyclopent-2-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent‐3‐en‐1‐yl and/or cyclopent-3-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclohexyl and/or cyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, oxetan-3-yl and/or oxetan-3-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, hydroxymethyl and/or hydroxymethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-hydroxyethyl and/or 2-hydroxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, (dimethylamino)methyl and/or (dimethylamino)methyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl; R is as defined above and/or below, and especially is selected from one or more of the following residues: methyl and/or methyl in which 1, 2 or 3 of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, ethyl and/or ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-1-yl and/or propan-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-2-yl and/or propan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, butan-2-yl and/or butan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-methylpropyl and/or 2-methylpropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-cyclopropylethyl and/or 2-cyclopropylethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, tert-butyl and/or tert-butyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-ethenyl and/or 1-ethenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, phenyl and/or phenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopropyl and/or cyclopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclobutyl and/or cyclobutyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopentyl and/or cyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methylcyclopentyl and/or 3-methylcyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-methylcyclohexyl and/or 1-methylcyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-1-en-1-yl and/or cyclopent-1-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-2-en-1-yl and/or cyclopent-2-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent‐3‐en‐1‐yl and/or cyclopent-3-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclohexyl and/or cyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, oxetan-3-yl and/or oxetan-3-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, hydroxymethyl and/or hydroxymethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-hydroxyethyl and/or 2-hydroxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-hydroxypropyl and/or 3-hydroxypropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-hydroxy-2-methylpropan-2-yl and/or 1-hydroxy-2-methylpropan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-methoxyethyl and/or 2-methoxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methoxypropyl and/or 3-methoxypropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-aminoethyl and/or 2-aminoethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-aminopropyl and/or 3-aminopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, (dimethylamino)methyl and/or (dimethylamino)methyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-(dimethylamino)ethyl and/or 2-(dimethylamino)ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-(methylamino)propyl and/or 3-(methylamino)propyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-(N-methylformamido)ethyl and/or 2-(N-methylformamido)ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ - C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-(N-methylformamido)propyl and/or 3-(N-methylformamido)propyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-isocyanoethyl and/or 2-isocyanoethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, , and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-fluoroethyl,and/or 2,2,2-trifluoroethyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or one or more of subformulae (Ig) to (Ij) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Especially preferred are compounds of formula (I), preferably as described above and/or below, but which are preferably selected from compounds of subformula (Ik): wherein R ¹ and/or R ^c is preferably as defined above and/or below, Z ² selected from N and/or C-F, R is as defined as defined above and/or below, and especially is selected from from one or more of the following residues: methyl and/or methyl in which 1, 2 or 3 of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, ethyl and/or ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-1-yl and/or propan-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-2-yl and/or propan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, butan-2-yl and/or butan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-methylpropyl and/or 2-methylpropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-cyclopropylethyl and/or 2-cyclopropylethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, tert-butyl and/or tert-butyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-ethenyl and/or 1-ethenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, phenyl and/or phenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopropyl and/or cyclopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclobutyl and/or cyclobutyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopentyl and/or cyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methylcyclopentyl and/or 3-methylcyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-methylcyclohexyl and/or 1-methylcyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-1-en-1-yl and/or cyclopent-1-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-2-en-1-yl and/or cyclopent-2-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent‐3‐en‐1‐yl and/or cyclopent-3-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclohexyl and/or cyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, oxetan-3-yl and/or oxetan-3-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, hydroxymethyl and/or hydroxymethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-hydroxyethyl and/or 2-hydroxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-hydroxypropyl and/or 3-hydroxypropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-hydroxy-2-methylpropan-2-yl and/or 1-hydroxy-2-methylpropan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-methoxyethyl and/or 2-methoxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methoxypropyl and/or 3-methoxypropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-aminoethyl and/or 2-aminoethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-aminopropyl and/or 3-aminopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, (dimethylamino)methyl and/or (dimethylamino)methyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, 2-(dimethylamino)ethyl and/or 2-(dimethylamino)ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, 3-(methylamino)propyl and/or 3-(methylamino)propyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, 2-(N-methylformamido)ethyl and/or 2-(N-methylformamido)ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-(N-methylformamido)propyl and/or 3-(N-methylformamido)propyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-isocyanoethyl and/or 2-isocyanoethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, , and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-fluoroethyl, and/or 2,2,2-trifluoroethyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or subformula (Ik) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Especially preferred are compounds of formula (I), preferably as described above and/or below, but which are preferably selected from the group consisting of subformulae (Ir) to (Iu) and/or wherein R ¹ and/or R is as defined as defined above and/or below, Z ¹ , Z ² , Z ³ and/or Z ⁴ is independently selected from N and/or CR ^Z , wherein each R ^Z is independently selected from the meanings given for R ⁸ and/or R ⁹ , or is independently selected from the group consisting of H, C ₁ -C ₄ -alkyl, C ₁ -C ₆ -cycloalkyl, C ₁ -C ₄ - hydroxyalkyl, C ₁ -C ₄ -halo-alkyl and C ₁ -C ₄ -perhaloalkyl, or selected from one or more of the following residues: methyl and/or methyl in which 1, 2 or 3 of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, ethyl and/or ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-1-yl and/or propan-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-2-yl and/or propan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, butan-2-yl and/or butan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-methylpropyl and/or 2-methylpropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-cyclopropylethyl and/or 2-cyclopropylethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, tert-butyl and/or tert-butyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopropyl and/or cyclopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclobutyl and/or cyclobutyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopentyl and/or cyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methylcyclopentyl and/or 3-methylcyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-methylcyclohexyl and/or 1-methylcyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-1-en-1-yl and/or cyclopent-1-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-2-en-1-yl and/or cyclopent-2-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent‐3‐en‐1‐yl and/or cyclopent-3-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclohexyl and/or cyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, oxetan-3-yl and/or oxetan-3-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, hydroxymethyl and/or hydroxymethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-hydroxyethyl and/or 2-hydroxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, (dimethylamino)methyl and/or (dimethylamino)methyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, R is as defined above and/or below, and especially is selected from or selected from one or more of the following residues: methyl and/or methyl in which 1, 2 or 3 of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, ethyl and/or ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-1-yl and/or propan-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, propan-2-yl and/or propan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, butan-2-yl and/or butan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-methylpropyl and/or 2-methylpropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, 2-cyclopropylethyl and/or 2-cyclopropylethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, tert-butyl and/or tert-butyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-ethenyl and/or 1-ethenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, phenyl and/or phenyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopropyl and/or cyclopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclobutyl and/or cyclobutyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopentyl and/or cyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methylcyclopentyl and/or 3-methylcyclopentyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-methylcyclohexyl and/or 1-methylcyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-1-en-1-yl and/or cyclopent-1-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent-2-en-1-yl and/or cyclopent-2-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclopent‐3‐en‐1‐yl and/or cyclopent-3-en-1-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, cyclohexyl and/or cyclohexyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, oxetan-3-yl and/or oxetan-3-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, hydroxymethyl and/or hydroxymethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-hydroxyethyl and/or 2-hydroxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-hydroxypropyl and/or 3-hydroxypropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 1-hydroxy-2-methylpropan-2-yl and/or 1-hydroxy-2-methylpropan-2-yl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-methoxyethyl and/or 2-methoxyethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-methoxypropyl and/or 3-methoxypropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-aminoethyl and/or 2-aminoethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-aminopropyl and/or 3-aminopropyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, (dimethylamino)methyl and/or (dimethylamino)methyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, 2-(dimethylamino)ethyl and/or 2-(dimethylamino)ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, 3-(methylamino)propyl and/or 3-(methylamino)propyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ - C ₃ perhaloalkyl, 2-(N-methylformamido)ethyl and/or 2-(N-methylformamido)ethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 3-(N-methylformamido)propyl and/or 3-(N-methylformamido)propyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-isocyanoethyl and/or 2-isocyanoethyl in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, , and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, and/or in which one or more or all of the hydrogen atoms may be replaced by Hal, preferably F and/or Cl, and/or by C ₁ -C ₃ alkyl or C ₁ -C ₃ perhaloalkyl, 2-fluoroethyl, and/or 2,2,2-trifluoroethyl; and/or any derivative, any N-oxide, prodrug, solvate, tautomer or stereoisomer of the compound of formula (I) and/or one or more of subformulae (Ir) to (Iu) and/or any pharmaceutically acceptable salt of each of the foregoing, including mixtures thereof in all ratios. Especially preferred are compounds of formula (I), preferably as described herein above and/or herein below, selected from one or more of compounds numbered 1 to 26, numbered 28 to 59, numbered 61 to 175, numbered 177 to 294, numbered 298 to 386, numbered 388 to 435, numbered 437 to 450, numbered 452 and/or 454 as given in Table 1. Especially preferred are compounds, preferably compounds of formula (I), preferably as described herein above and/or herein below, for the treatment of disorders. Especially preferred are compounds, preferably compounds of formula (I), preferably as described herein above and/or herein below, as a medicament. Compound according to one or more of the preceding claims as a WRN inhibitor. A preferred aspect is a pharmaceutical composition, characterized in that it contains one or more compounds, preferably compounds of formula (I), preferably as described herein above and/or herein below. A preferred aspect is a pharmaceutical composition, preferably as described herein above and/or below, characterized in that it contains one or more compounds according to the instant invention, preferably compounds of formula (I), preferably as described herein above and/or below. A preferred aspect is a pharmaceutical composition, preferably as described herein above and/or below, characterized in that it contains a) one or more compounds according to the instant invention, preferably compounds of formula (I), preferably as described herein above and/or below, b) one or more additional compounds, selected from the group consisting of physiologically acceptable excipients, auxiliaries, adjuvants, carriers and pharmaceutical active ingredients other than the compounds according to the instant invention, preferably compounds of formula (I), preferably as described herein above and/or below. A preferred aspect is a process for the manufacture of a pharmaceutical composition, preferably a pharmaceutical composition, preferably as described herein above and/or below, characterized in that one or more compounds according to the instant invention, preferably compounds of formula (I), preferably as described herein above and/or below, and one or more compounds selected from the group consisting of carriers, excipients, auxiliaries and pharmaceutical active ingredients (other than the compounds according to the instant invention, preferably compounds of formula (I), preferably as described herein above and/or below), is processed by mechanical means into a pharmaceutical composition that is suitable as dosage form for application and/or administration to a patient. A preferred aspect is the use of a compound according to the instant invention, preferably a compound of formula (I), preferably as described herein above and/or below, as a pharmaceutical. A preferred aspect is the use of a compound according to the instant invention, preferably a compound of formula (I), preferably as described herein above and/or below, in the treatment and/or prophylaxis of disorders. A preferred aspect is the use of a compound according to the instant invention, preferably a compound of formula (I), preferably as described herein above and/or below, for producing a pharmaceutical composition for the treatment and/or prophylaxis of disorders. A preferred aspect is the use of a compound according to the instant invention, preferably a compound of formula (I), preferably as described herein above and/or below, for producing a pharmaceutical composition for the treatment and/or prophylaxis of disorders, wherein the disorders are selected from the group consisting of hyperproliferative and non- hyperproliferative disorders. A preferred aspect is a compound for use, preferably as described herein above and/or below, and/or a method of treatment using a compound of formula (I), preferably as described herein above and/or below, characterized in that the disorders are selected from the group consisting of hyperproliferative and non-hyperproliferative disorders. A preferred aspect is a compound for use, preferably as described herein above and/or below, and/or a method of treatment using a compound of formula (I), preferably as described herein above and/or below, characterized in that the disorder is cancer. A preferred aspect is a compound for use, preferably as described herein above and/or below, and/or a method of treatment using a compound of formula (I), preferably as described herein above and/or below, wherein the disorder is additionally having assay detectable Microsatellite Instability (MSI). Preferably, the disorder is selected from the group consisting of hyperproliferative and non- hyperproliferative disorders, preferably hyperproliferative disorders. More preferably, the disorder is cancer. Even more preferably, the disorder is additionally having assay detectable Microsatellite Instability (MSI). Even more preferably, the disorder is a cancerous disorder, selected from the group consisting of melanoma, brain cancer, lung cancer, squamous cell cancer, bladder cancer, gastric cancer, pancreatic cancer, hepatic cancer, renal cancer, colorectal cancer, breast cancer, head cancer, neck cancer, esophageal cancer, gynecological cancer, ovarian cancer, uterine cancer, prostate cancer, thyroid cancer, lymphoma, chronic leukemia and/or acute leukemia. Even more preferably, the disorder is a cancerous disorder, selected from the group consisting of melanoma, brain cancer, lung cancer, squamous cell cancer, bladder cancer, gastric cancer, pancreatic cancer, hepatic cancer, renal cancer, colorectal cancer, breast cancer, head cancer, neck cancer, esophageal cancer, gynaecological cancer, ovarian cancer, uterine cancer, prostate cancer, thyroid cancer, lymphoma, chronic leukemia and/or acute leukemia, wherein the disorder is additionally having assay detectable Microsatellite Instability (MSI). Thus, a preferred aspect is a compound for use, preferably as described herein above and/or below, and/or a method of treatment using a compound of formula (I), preferably as described herein above and/or below, wherein the disorder is additionally having assay detectable Microsatellite Instability (MSI). Thus, a preferred aspect is a compound for use, preferably as described herein above and/or below, and/or a method of treatment using a compound of formula (I), preferably as described herein above and/or below, wherein the cancerous disorders are selected from the group consisting of melanoma, brain cancer, lung cancer, squamous cell cancer, bladder cancer, gastric cancer, pancreatic cancer, hepatic cancer, renal cancer, colorectal cancer, breast cancer, head cancer, neck cancer, esophageal cancer, gynecological cancer, ovarian cancer, uterine cancer, prostate cancer, thyroid cancer, lymphoma, chronic leukemia and/or acute leukemia, preferably wherein the disorder is additionally having assay detectable Microsatellite Instability (MSI). Especially preferably, the disorder is selected from the group consisting of endometrial cancer, colon cancer, colorectal cancer (CRC), gastric cancer, glioblastoma, and/or glioblastoma multiforme (GBM). Especially preferably, the disorder is selected from the group consisting of Uterine Corpus Endometrial Carcinoma (UCEC), Stomach adenocarcinoma (STAD), Rectum adenocarcinoma (READ), Adrenocortical carcinoma (ACC), Uterine Carcinosarcoma (UCS), Cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), Wilms Tumor Syndromes (WT), Mesothelioma (MESO), Esophageal carcinoma (ESCA), Breast Cancer (BC), Kidney renal clear cell carcinoma (KIRC), Ovarian serous cystadenocarcinoma (OV), Cholangiocarcinoma (CHOL), Thymoma (THYM), Liver hepatocellular carcinoma (LIHC), Head and Neck squamous cell carcinoma (HNSC), Sarcoma (SARC), Lung squamous cell carcinoma (LUSC), Prostate adenocarcinoma (PRAD), Lung adenocarcinoma (LUAD), Bladder Urothelial Carcinoma (BLCA), Neuroblastoma (NBL), Brain Lower Grade Glioma (LGG), and/or Chronic lymphocytic leukemia (CLL). Alternatively preferably, the disorders are selected from the group consisting of arthritis, restenosis; fibrotic disorders; mesangial cell proliferative disorders, diabetic nephropathy, malignant nephrosclerosis, thrombotic microangiopathy syndromes, organ transplant rejection, glomerulopathies, metabolic disorders, inflammation, solid tumors, rheumatic arthritis, diabetic retinopathy, and neurodegenerative diseases. Especially preferred are disorders as described herein above and/or below, wherein disorder is additionally having assay detectable Microsatellite Instability (MSI). Thus, especially preferred is a method for the treatment and/or prophylaxis of disorders, characterized in that one or more of the compounds according to the instant invention, preferably one or more compounds of formula (I), preferably as described herein above and/or below, is/are administered to a patient in need of such a treatment. As used herein, the following definitions shall apply unless otherwise indicated or defined specifically elsewhere in the description and/or the claims for specific substituents, radicals, residues, groups or moieties. The term “aliphatic” or “aliphatic group”, as used herein, means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon or tricyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, such as one or more C=C double bond(s) and/or C≡C triple bond(s), but which is not aromatic (also referred to herein as “carbocycle”, “cycloaliphatic” or “cycloalkyl”), that has – in general and if not defined otherwise in this specification or the accompanied claims – a single point of attachment to the rest of the molecule. Unless otherwise specified, aliphatic groups contain 1-8 or 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” (“cycloalkyl”) refers to a monocyclic C ₃ -C ₇ hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. In another embodiment the term “carbocycle” refers to a monocyclic or bicyclic cycloaliphatic ring system which is fused to an aromatic, heteroaromatic or heterocyclic ring or ring system via two adjacent ring atoms of that aromatic, heteroaromatic or heterocyclic ring or ring system; in other words, such carbocycle shares two ring atoms with the ring or ring system to which it is fused thereby having two points of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl. The term "alkyl" usually refers to a saturated aliphatic and acyclic moiety, while the term "alkenyl" usually refers to an unsaturated aliphatic and acyclic moiety with one or more C=C double bonds and the term "alkynyl" usually refers to an aliphatic and acyclic moiety with one or more C≡C triple bonds. Exemplary aliphatic groups are linear or branched, substituted or unsubstituted C _1-8 -alkyl,C _1-6 -alkyl, C _1-4 -alkyl, C _2-8 -alkenyl, C _2-6 -alkenyl, C _2-8 -alkynyl, C _2-6 - alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl. In particular, the term “C _1-3 -alkyl” refers to alkyl groups, i.e., saturated acyclic aliphatic groups, having 1, 2 or 3 carbon atoms. Exemplary C ₁ -3-alkyl groups are methyl, ethyl, propyl and isopropyl. The term “C _1-4 -alkyl” refers to alkyl groups having 1, 2, 3 or 4 carbon atoms. ExemplaryC _1-4 -alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl. The term “C _1-6 -alkyl” refers to alkyl groups having 1, 2, 3, 4, 5 or 6 carbon atoms. Exemplary C _1-6 -alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, n-pentyl, 2- pentyl, n-hexyl, and 2-hexyl. The term "C _1-8 -alkyl" refers to alkyl groups having 1, 2, 3, 4, 5, 6, 7 or 8 carbon atoms. Exemplary C _1-8 -alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, n-pentyl, 2-pentyl, n-hexyl, 2-hexyl n-heptyl, 2-heptyl, n-octyl, 2-octyl, and 2,2,4-trimethylpentyl. Each of these alkyl groups may be straight-chain or – except for C ₁ -alkyl and C ₂ -alkyl – branched and may be unsubstituted or substituted with 1, 2 or 3 substituents that may be the same or different and are, if not specified differently elsewhere in this specification, selected from the group comprising halogen, hydroxy, alkoxy, unsubstituted or mono- or di-substituted amino. In some instances the C ₁ -3-alkyl, C _1-4 -alkyl, C _1-6 -alkyl, C _1-8 -alkyl groups may also comprise those residues in which 1 or 2 of non-terminal and non-adjacent –CH ₂ - (methylene) groups are replaced by –O-, -S- and/or 1 or 2 non-terminal and non-adjacent –CH ₂ - or –CH- groups are replaced by –NH- or –N-. These replacements yield, for instance, (modified) alkyl groups like –CH ₂ -CH ₂ -O-CH ₃ , –CH ₂ -CH ₂ -CH ₂ -S-CH ₃ , -CH ₂ -CH ₂ -NH-CH ₂ -CH ₃ , -CH ₂ -CH ₂ -O-CH ₂ -CH ₂ -O- CH ₃ , -CH ₂ -CH ₂ -N(CH ₃ )-CH ₂ -CH ₃ , and the like. Further and/or different replacements of –CH– and –CH ₂ – groups may be defined for specific alkyl substituents or radicals elsewhere in the description and/or the claims. The term “C _3-7 -cycloalkyl” refers to a cycloaliphatic hydrocarbon, as defined above, with 3, 4, 5, 6 or 7 ring carbon atoms. C _3-7 -cycloalkyl groups may be unsubstituted or substituted with – unless specified differently elsewhere in this specification – 1, 2 or 3 substituents that may be the same of different and are – unless specified differently elsewhere in this specification – selected from the group comprising C _1-6 -alkyl, O-C _1-6 -alkyl (alkoxy), halogen, hydroxy, unsubstituted or mono- or di-substituted amino. Exemplary C _3-7 -cycloalkyl groups are cyclopropyl, 2-methyl-cyclopropyl, cyclopropenyl, cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl. The term “aliphatoxy” refers to saturated or unsaturated aliphatic groups or substituents as defined above that are connected to another structural moiety via an oxygen atom (-O-). The term “alkoxy” refers to a particular subgroup of saturated aliphatoxy, i.e., to alkyl substituents and residues that are connected to another structural moiety via an oxygen atom (-O-). Sometimes, it is also referred to as “O-alkyl” and more specifically as “O-C _1-4 -alkyl”, “O-C _1-6 - alkyl”, “O-C _1-8 -alkyl”. Like the similar alkyl groups, it may be straight-chain or – except for –O- C ₁ -alkyl and –O-C ₂ -alkyl – branched and may be unsubstituted or substituted with 1, 2 or 3 substituents that may be the same or different and are, if not specified differently elsewhere in this specification, selected from the group comprising halogen, unsubstituted or mono- or di- substituted amino. Exemplary alkoxy groups are methoxy, trifluoromethoxy, ethoxy, 2,2,2- trifluoroethoxy, n-propoxy, iso-propoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy. The term “alkylene” refers to a divalent aliphatic group and in particular a divalent alkyl group. An “alkylene chain” is a polymethylene group, i.e., –(CH ₂ )x–, wherein x is a positive integer, preferably 1, 2, 3, 4, 5 or 6. In the context of the present invention "C ₁ -3-alkylene" refers to an alkylene moiety with 1, 2 and 3, respectively, -CH ₂ - groups; the term "alkylene", however, not only comprises linear alkylene groups, i.e. "alkylene chains", but branched alkylene groups as well. The term "C _1-6 -alkylene" refers to an alkylene moiety that is either linear, i.e., an alkylene chain, or branched and has 1, 2, 3, 4, 5 or 6 carbon atoms. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced by (or with) a substituent. Suitable substituents include those described herein for a substituted alkyl group. In some instances, 1 or 2 methylene groups of the alkylene chain may be replaced by, for instance, O, S and/or NH or N-C _1-4 -alkyl. Exemplary alkylene groups are –CH ₂ -, –CH ₂ – CH ₂ -, –CH ₂ –CH ₂ –CH ₂ –CH ₂ -, -O–CH ₂ -O-, -O–CH ₂ –CH ₂ -O-, -O–CH ₂ –CH ₂ –CH ₂ -O-, –CH ₂ -NH– CH ₂ –CH ₂ -, –CH ₂ -N(CH ₃ )–CH ₂ –CH ₂ -. The term “alkenylene” refers to a bivalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described herein for a substituted aliphatic group. The term “alkynylene” refers to a bivalent alkynyl group. A substituted alkynylene chain is a polymethylene group containing at least one triple bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described herein for a substituted aliphatic group. The term “halogen” means F, Cl, Br, or I. The term “heteroatom” means one or more of oxygen (O), sulfur (S), or nitrogen (N), including, any oxidized form of nitrogen or sulfur, e.g. N-oxides, sulfoxides and sulfones; the quaternarized form of any basic nitrogen or a substitutable nitrogen of a heterocyclic or heteroaromatic ring, for example N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or N- SUB with SUB being a suitable substituent (as in N-substituted pyrrolidinyl). The term “aryl” used alone or as part of a larger moiety as in “arylalkyl”, “arylalkoxy”, or “aryloxyalkyl”, refers to monocyclic, bicyclic and tricyclic ring systems having a total of five to fourteen ring members, that ring members being carbon atoms, wherein at least one ring in the system is aromatic, i.e., it has (4n+2) π (pi) electrons (with n being an integer selected from 0, 1, 2, 3), which electrons are delocalized over the system, and wherein each ring in the system contains three to seven ring members. Preferably, all rings in the aryl system or the entire ring system are aromatic. The term “aryl” is used interchangeably with the term “aryl ring”. In certain embodiments of the present invention, “aryl” refers to an “aromatic ring system”. More specifically, those aromatic ring systems may be mono-, bi- or tricyclic with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 ring carbon atoms. Even more specifically, those aromatic ring systems may be mono- or bicyclic with 6, 7, 8, 9, 10 ring carbon atoms. The term “monoaryl” refers to a monocyclic aryl. The term “biaryl” refers to a bicyclic aryl. Exemplary aryl groups are phenyl, biphenyl, naphthyl, anthracenyl and the like, which may be unsubstituted or substituted with one or more identical or different substituents. Also included within the scope of the terms “aryl” or “aromatic ring system”, as they are used herein, is a group in which an aromatic ring is fused to one or more non–aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like. In the latter case the "aryl" group or substituent is attached to its pendant group via the aromatic part of the ring system. The term “benzo” refers to a six-membered aromatic ring (with carbon ring atoms) that is fused via two adjacent carbon atoms to another ring, being it a cycloaliphatic, aromatic, heteroaromatic or heterocyclic (heteroaliphatic) ring; as a result a ring system with at least two rings is formed in which the benzo ring shares two common carbon atoms with the other ring to which it is fused. For example, if a benzo ring is fused to a phenyl ring, a naphthalin ring system is formed, while fusing a benzo ring to a pyridine provides for either a quinoline or an isoquinoline. The terms “heteroaryl” and “heteroar–”, used alone or as part of a larger moiety, e.g., “heteroaralkyl”, or “heteroaralkoxy”, refer to groups having 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 ring atoms (which atoms are carbon and hetero atoms), preferably 5, 6, 9 or 10 ring atoms; having 6, 10, or 14 π (pi) electrons shared in a cyclic array and having, in addition to carbon atoms, 1, 2, 3, 4 or 5 heteroatoms. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternarized form of a basic nitrogen. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, furazanyl, pyridyl (pyridinyl), pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, pteridinyl, and pyrrolopyridinyl, in particular pyrrolo[2,3-b]pyridinyl. The terms “heteroaryl” and “heteroar–”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is preferably on the heteroaromatic or, if present, the aryl ring. Nonlimiting examples include indolyl, isoindolyl, benzothienyl (benzothiophenyl), benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H–quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, 9H-carbazolyl, dibenzofuranyl and pyrido[2,3–b]–1,4–oxazin–3(4H)–one. For example, an indolyl ring may be attached via one of the ring atoms of the six-membered aryl ring or via one of the ring atoms of the five-membered heteroaryl ring. A heteroaryl group is optionally mono-, bi- or tricyclic. The term “heteroaryl” is used interchangeably with the terms “heteroaryl ring”, “heteroaryl group”, or “heteroaromatic”, any of which terms include rings that are unsubstituted or substituted with one or more identical or different substituents. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted. A heteroaryl ring can be attached to its pendant group at any of its hetero or carbon ring atoms which attachment results in a stable structure or molecule: any of the ring atoms may be unsubstituted or substituted. The structures of typical examples of "heteroaryl" substituents as used in the present invention are depicted below:

Those heteroaryl substituents can be attached to any pendant group via any of its ring atoms suitable for such an attachment. When used in reference to a ring atom of a heterocycle, the term “nitrogen” includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 1–3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen is N (as in 3,4–dihydro–2H– pyrrolyl), NH (as in pyrrolidinyl), or N-SUB with SUB being a suitable substituent (as in N– substituted pyrrolidinyl). The term “unsaturated”, as used herein, means that a moiety or group or substituent has one or more units of unsaturation. As used herein, the term “bicyclic”, “bicyclic ring” or “bicyclic ring system” refers to any bicyclic ring system, i.e., carbocyclic or heterocyclic, saturated or having one or more units of unsaturation, i.e., being partially unsaturated or aromatic, having one or more atoms in common between the two rings of the ring system. Thus, the term includes any permissible ring fusion, such as ortho-fused or spirocyclic. As used herein, the term “heterobicyclic” is a subset of “bicyclic” that requires that one or more heteroatoms are present in one or both rings of the bicycle. Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfoxides, sulfones and sulfonates), phosphorus (including oxidized forms such as phosphates), boron, etc. In some embodiments, a bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Likewise, the term “tricyclic”, “tricyclic ring” or “tricyclic ring system” refers to any tricyclic ring system, i.e., carbocyclic or heterocyclic, saturated or having one or more units of unsaturation, i.e., being partially unsaturated or aromatic, in which a bicyclic ring system (as defined above) is fused with another, third ring. Thus, the term includes any permissible ring fusion. As used herein, the term “heterotricyclic” is a subset of “tricyclic” that requires that one or more heteroatoms are present in one, two or all rings of the tricycle. Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfoxides, sulfones and sulfonates), phosphorus (including oxidized forms such as phosphates), boron, etc. In some embodiments, a tricyclic group has 10-14 ring members and 0-5 heteroatoms independently selected from nitrogen, oxygen or sulfur. As described herein, certain compounds of the invention contain “substituted” or “optionally substituted” moieties. In general, the term “substituted”, whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. “Substituted” applies to one or more hydrogens that are either explicit or implicit from the structure. Unless otherwise indicated, a “substituted” or “optionally substituted” group has a suitable substituent at each substitutable position of the group, and when more than one position in any given structure is substituted with more than one substituent selected from a specified group, the substituent is either the same or different at every position. If a certain group, substituent, moiety or radical is "mono-substituted", it bears one (1) substituent. If it is "di-substituted", it bears two (2) substituents, being either the same or different; if it is "tri-substituted", it bears three (3) substituents, wherein all three are the same or two are the same and the third is different or all three are different from each other. Combinations of substituents envisioned by this invention are preferably those that result in the formation of stable or chemically feasible compounds. The term “stable”, as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein. If not specified otherwise elsewhere in the specification or the accompanying claims it is understood that each optional substituent on a substitutable carbon is a monovalent substituent independently selected from halogen; –(CH ₂ ) _0–4 R°; –(CH ₂ ) _0–4 OR°; -O–(CH ₂ ) _0-4 R ^o , – O–(CH ₂ ) _0–4 C(O)OR°; –(CH ₂ ) _0–4 CH(OR°) ₂ ; –(CH ₂ ) _0–4 SR°; –(CH ₂ ) _0–4 Ph, which may be substituted with one or more R°; –(CH ₂ ) _0–4 O(CH ₂ ) _0–1 Ph which may be substituted with one or more R°; –CH=CHPh, which may be substituted with one or more R°; –(CH ₂ ) _0–4 O– (CH ₂ ) _0–1 - pyridyl which may be substituted with one or more R°; –NO ₂ ; –CN; –N ₃ ; -(CH ₂ ) _0–4 N(R°) ₂ ; – (CH ₂ ) _0–4 N(R°)C(O)R°; –N(R°)C(S)R°; –(CH ₂ ) _0–4 N(R°)C(O)NR° ₂ ; -N(R°)C(S)NR° ₂ ; –(CH ₂ ) _{0– 4} N(R°)C(O)OR°; –N(R°)N(R°)C(O)R°; -N(R°)N(R°)C(O)NR° ₂ ; -N(R°)N(R°)C(O)OR°; –(CH ₂ ) _{0– 4} C(O)R°; –C(S)R°; –(CH ₂ ) _0–4 C(O)OR°; –(CH ₂ ) _0–4 C(O)SR°; -(CH ₂ ) _0–4 C(O)OSiR° ₃ ; –(CH ₂ ) _{0– 4} OC(O)R°; –OC(O)(CH ₂ ) _0–4 SR°–, SC(S)SR°; –(CH ₂ ) _0–4 SC(O)R°; –(CH ₂ ) _0–4 C(O)NR° ₂ ; – C(S)NR° ₂ ; –C(S)SR°; –SC(S)SR°, -(CH ₂ ) _0–4 OC(O)NR° ₂ ; -C(O)N(OR°)R°; –C(O)C(O)R°; – C(O)CH ₂ C(O)R°; –C(NOR°)R°; -(CH ₂ ) _0–4 SSR°; –(CH ₂ ) _0–4 S(O) ₂ R°; –(CH ₂ ) _0–4 S(O) ₂ OR°; – (CH ₂ ) _0–4 OS(O) ₂ R°; –S(O) ₂ NR° ₂ ; –S(O)(NR°)R°; –S(O) ₂ N=C(NR° ₂ ) ₂ ; -(CH ₂ ) _{0– 4} S(O)R°; -N(R°)S(O) ₂ NR° ₂ ; –N(R°)S(O) ₂ R°; –N(OR°)R°; –C(NH)NR° ₂ ; – P(O) ₂ R°; -P(O)R° ₂ ; -OP(O)R° ₂ ; –OP(O)(OR°) ₂ ; -SiR° ₃ ; –(C _1–4 straight or branched alkylene)O– N(R°) ₂ ; or –(C _1–4 straight or branched alkylene)C(O)O–N(R°) ₂ . It is understood that “Ph” means phenyl; and that “–(CH ₂ ) _0-4 ” means that there is either no alkylene group if the subscript is “0” (zero) or an alkylene group with 1, 2, 3 or 4 CH ₂ units. Each R° is independently hydrogen, halogen, C ₁ –6 aliphatic, –CH ₂ Ph, –O– (CH ₂ ) _0–1 Ph, -CH ₂ - (5-6 membered heteroaryl ring), or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3–12–membered saturated, partially unsaturated, or aryl mono– or bicyclic ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted by a divalent substituent on a saturated carbon atom of R° selected from =O and =S; or each R° is optionally substituted with a monovalent substituent independently selected from halogen, –(CH ₂ ) _0–2 R ^● , –(haloR ^● ), –(CH ₂ ) _0–2 OH, –(CH ₂ ) _0–2 OR ^● , – (CH ₂ ) _0–2 CH(OR ^● ) ₂ ; -O(haloR ^● ), –CN, –N ₃ , –(CH ₂ ) _0–2 C(O)R ^● , –(CH ₂ ) _0–2 C(O)OH, –(CH ₂ )0– ₂ C(O)OR ^● , –(CH ₂ ) _0–2 SR ^● , –(CH ₂ ) _0–2 SH, –(CH ₂ ) _0–2 NH ₂ , –(CH ₂ ) _0–2 NHR ^● , –(CH ₂ ) _0–2 NR ^● ₂ , –NO ₂ , – SiR ^● ₃ , –OSiR ^● ₃ , -C(O)SR ^● _, –(C _1–4 straight or branched alkylene)C(O)OR ^● , or –SSR ^● . It is understood that “Ph” means phenyl; “halo” means halogen; and “–(CH ₂ ) _0-2 ” means that there is either no alkylene group if the subscript is “0” (zero) or an alkylene group with 1 or 2 CH ₂ units. Each R ^● is independently selected from C _1–4 aliphatic, –CH ₂ Ph, –O(CH ₂ ) _0–1 Ph, or a 5–6– membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, and wherein each R ^● is unsubstituted or where preceded by halo is substituted only with one or more halogens; or wherein an optional substituent on a saturated carbon is a divalent substituent independently selected from =O, =S, =NNR ^* ₂ , =NNHC(O)R ^* , =NNHC(O)OR ^* , =NNHS(O) ₂ R ^* , =NR ^* , =NOR ^* , –O(C(R ^* ₂ )) ₂ –3O–, or –S(C(R ^* ₂ )) ₂ –3S–, or a divalent substituent bound to vicinal substitutable carbons of an “optionally substituted” group is –O(CR ^* ₂ ) _2–3 O–, wherein each independent occurrence of R ^* is selected from hydrogen, C _1–6 aliphatic or an unsubstituted 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. When R ^* is C ₁ –6 aliphatic, R ^* is optionally substituted with halogen, –R ^● , -(haloR ^● ), -OH, –OR ^● , –O(haloR ^● ), –CN, –C(O)OH, –C(O)OR ^● , –NH ₂ , –NHR ^● , –NR ^● ₂ , or –NO ₂ , wherein each R ^● is independently selected from C _1–4 aliphatic, –CH ₂ Ph, –O(CH ₂ ) _0–1 Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, and wherein each R ^● is unsubstituted or where preceded by halo is substituted only with one or more halogens. An optional substituent on a substitutable nitrogen is independently –R ^† , –NR ^† ₂ , –C(O)R ^† , – C(O)OR ^† , –C(O)C(O)R ^† , –C(O)CH ₂ C(O)R ^† , -S(O) ₂ R ^† , -S(O) ₂ NR ^† ₂ , –C(S)NR ^† ₂ , –C(NH)NR ^† ₂ , or –N(R ^† )S(O) ₂ R ^† ; wherein each R ^† is independently hydrogen, C ₁ –6 aliphatic, unsubstituted – OPh, or an unsubstituted 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur or, two independent occurrences of R ^† , taken together with their intervening atom(s) form an unsubstituted 3–12– membered saturated, partially unsaturated, or aryl mono– or bicyclic ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; wherein when R ^† is C _1–6 aliphatic, R ^† is optionally substituted with halogen, –R ^● , -(haloR ^● ), -OH, –OR ^● , –O(haloR ^● ), – CN, –C(O)OH, –C(O)OR ^● , –NH ₂ , –NHR ^● , –NR ^● 2, or –NO ₂ , wherein each R ^● is independently selected from C ₁ –4 aliphatic, –CH ₂ Ph, –O–(CH ₂ ) _0–1 Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, and wherein each R ^● is unsubstituted or where preceded by halo is substituted only with one or more halogens. It is understood that “Ph” means phenyl; and “halo” means halogen. In the context of the present invention the term “derivative” means any non-toxic salt, ester, salt of an ester or other derivative of a compound of this invention that, upon administration to a recipient, is capable of providing, either directly or indirectly, a compound of this invention or an inhibitory active metabolite or residue thereof. The compounds of the present invention can be in the form of a prodrug compound. “Prodrugs” and "prodrug compound" mean a derivative that is converted into a biologically active compound according to the present invention under physiological conditions in the living body, e.g., by oxidation, reduction, hydrolysis or the like, each of which is carried out enzymatically, or without enzyme involvement. Examples of prodrugs are compounds, in which the amino group in a compound of the present invention is acylated, alkylated or phosphorylated, e.g., eicosanoylamino, alanylamino, pivaloyloxymethylamino or in which the hydroxyl group is acylated, alkylated, phosphorylated or converted into the borate, e.g. acetyloxy, palmitoyloxy, pivaloyloxy, succinyloxy, fumaryloxy, alanyloxy or in which the carboxyl group is esterified or amidated, or in which a sulfhydryl group forms a disulfide bridge with a carrier molecule, e.g. a peptide, that delivers the drug selectively to a target and/or to the cytosol of a cell. These compounds can be produced from compounds of the present invention according to well- known methods. Other examples of prodrugs are compounds, wherein the carboxylate in a compound of the present invention is for example converted into an alkyl-, aryl-, choline-, amino-, acyloxymethylester, linolenoyl-ester. The term “solvates” means addition forms of the compounds of the present invention with solvents, preferably pharmaceutically acceptable solvents that contain either stoichiometric or non-stoichiometric amounts of solvent. Some compounds have a tendency to trap a fixed molar ratio of solvent molecules in the crystalline solid state, thus forming a solvate. If the solvent is water, the solvate formed is a hydrate, e.g., a mono- or dihydrate. If the solvent is alcohol, the solvate formed is an alcoholate, e.g., a methanolate or ethanolate. If the solvent is an ether, the solvate formed is an etherate, e.g., diethyl etherate. The term "N-oxides" means such compounds of the present invention that contain an amine oxide moiety, i.e., the oxide of a tertiary amine group. The compounds of formula (I) may have one or more asymmetric centers. They may accordingly occur in various enantiomeric and diastereomeric forms, as the case may be, and be in racemic or optically active form. The invention, therefore, also relates to the optically active forms, enantiomers, racemates, diastereomers, mixtures thereof in all ratios, collectively: “stereoisomers” for the purpose of the present invention, of these compounds. Since the pharmaceutical activity of the racemates or stereoisomers of the compounds according to the invention may differ, it may be desirable to use a specific stereoisomer, e.g., one specific enantiomer or diastereomer. In these cases, a compound according to the present invention obtained as a racemate or even intermediates thereof – may be separated into the stereoisomeric (enantiomeric, diastereomeric) compounds by chemical or physical methods known to the person skilled in the art. Another approach that may be applied to obtain one or more specific stereoisomers of a compound of the present invention in an enriched or pure form makes use of stereoselective synthetic procedures, e.g. applying starting material in a stereoisomerically enriched or pure form (for instance using the pure or enriched (R)- or (S)- enantiomer of a particular starting material bearing a chiral center) or utilizing chiral reagents or catalysts, in particular enzymes. In the context of the present invention the term "pure enantiomer" usually refers to a relative purity of one enantiomer over the other (its antipode) of equal to or greater than 95%, preferably ≥ 98%, more preferably ≥ 98.5%, still more preferably ≥ 99%. Thus, for example, the compounds of the invention which have one or more centers of chirality and which occur as racemates or as mixtures of enantiomers or diastereomers can be fractionated or resolved by known methods into their optically pure or enriched isomers, i.e., enantiomers or diastereomers. The separation of the compounds of the invention can take place by chromatographic methods, e.g., column separation on chiral or nonchiral phases, or by recrystallization from an optionally optically active solvent or by use of an optically active acid or base or by derivatization with an optically active reagent such as, for example, an optically active alcohol, and subsequent elimination of the radical. In the context of the present invention the term “tautomer” refers to compounds of the present invention that may exist in tautomeric forms and show tautomerism; for instance, carbonyl compounds may be present in their keto and/or their enol form and show keto-enol tautomerism. Those tautomers may occur in their individual forms, e.g., the keto or the enol form, or as mixtures thereof and are claimed separately and together as mixtures in any ratio. The same applies for cis/trans isomers, E/Z isomers, conformers and the like. In one embodiment the compounds of the present invention are in the form of free base or acid – as the case may be -, i.e., in their non-salt (or salt-free) form. In another embodiment the compounds of the present invention are in the form of a pharmaceutically acceptable salt, a pharmaceutically acceptable solvate, or a pharmaceutically acceptable solvate of a pharmaceutically acceptable salt. The term "pharmaceutically acceptable salts" refers to salts prepared from pharmaceutically acceptable bases or acids, including inorganic bases or acids and organic bases or acids. In cases where the compounds of the present invention contain one or more acidic or basic groups, the invention also comprises their corresponding pharmaceutically acceptable salts. Thus, the compounds of the present invention which contain acidic groups, such as carboxyl groups, can be present in salt form, and can be used according to the invention, for example, as alkali metal salts, alkaline earth metal salts, aluminum salts or as ammonium salts. More precise examples of such salts include lithium salts, sodium salts, potassium salts, calcium salts, magnesium salts, barium salts or salts with ammonia or organic amines such as, for example, ethylamine, ethanolamine, diethanolamine, triethanolamine, piperidine, N- methylglutamine or amino acids. These salts are readily available, for instance, by reacting the compound having an acidic group with a suitable base, e.g., lithium hydroxide, sodium hydroxide, sodium propoxide, potassium hydroxide, potassium ethoxide, magnesium hydroxide, calcium hydroxide or barium hydroxide. Other base salts of compounds of the present invention include but are not limited to copper(I), copper(II), iron(II), iron(III), manganese(II) and zinc salts. Compounds of the present invention which contain one or more basic groups, e.g., groups which can be protonated, can be present in salt form, and can be used according to the invention in the form of their addition salts with inorganic or organic acids. Examples of suitable acids include hydrogen chloride, hydrogen bromide, hydrogen iodide, phosphoric acid, sulfuric acid, nitric acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene-2-sulfonic acid, sulfoacetic acid, trifluoroacetic acid, oxalic acid, acetic acid, tartaric acid, lactic acid, salicylic acid, benzoic acid, carbonic acid, formic acid, propionic acid, pivalic acid, diethylacetic acid, malonic acid, succinic acid, pimelic acid, fumaric acid, malonic acid, maleic acid, malic acid, embonic acid, mandelic acid, sulfamic acid, phenylpropionic acid, gluconic acid, ascorbic acid, isonicotinic acid, citric acid, adipic acid, taurocholic acid, glutaric acid, stearic acid, glutamic acid or aspartic acid, and other acids known to the person skilled in the art. The salts which are formed are, inter alia, hydrochlorides, chlorides, hydrobromides, bromides, iodides, sulfates, phosphates, methanesulfonates (mesylates), tosylates, carbonates, bicarbonates, formates, acetates, sulfoacetates, triflates, oxalates, malonates, maleates, succinates, tartrates, malates, embonates, mandelates, fumarates, lactates, citrates, glutarates, stearates, aspartates and glutamates. The stoichiometry of the salts formed from the compounds of the invention may moreover be an integral or non-integral multiple of one. Compounds of the present invention which contain basic nitrogen-containing groups can be quaternarized using agents such as (C ₁ C ₄ )alkyl halides, for example methyl, ethyl, isopropyl and tert-butyl chloride, bromide and iodide; di(C ₁ -C ₄ )alkyl sulfates, for example dimethyl, diethyl and diamyl sulfate; (C ₁₀ -C ₁₈ )alkyl halides, for example decyl, dodecyl, lauryl, myristyl and stearyl chloride, bromide and iodide; and aryl(C ₁ -C ₄ )alkyl halides, for example benzyl chloride and phenethyl bromide. Both water- and oil-soluble compounds according to the invention can be prepared using such salts. If the compounds of the present invention simultaneously contain acidic and basic groups in the molecule, the invention also includes, in addition to the salt forms mentioned, inner salts or betaines (zwitterions). The respective salts can be obtained by customary methods which are known to a person skilled in the art, for example by contacting these with an organic or inorganic acid or base in a solvent or dispersant, or by anion exchange or cation exchange with other salts. The present invention also includes all salts of the compounds of the present invention which, owing to low physiological compatibility, are not directly suitable for use in pharmaceuticals but which can be used, for example, as intermediates for chemical reactions or for the preparation of pharmaceutically acceptable salts. Therefore, the following items are also in accordance with the invention: (a) all stereoisomers or tautomers of the compounds, including mixtures thereof in all ratios; (b) prodrugs of the compounds, or stereoisomers or tautomers of these prodrugs; (c) pharmaceutically acceptable salts of the compounds and of the items mentioned under (a) and (b); (d) pharmaceutically acceptable solvates of the compounds and of the items mentioned under (a), (b) and (c); (e) N-oxides of the compounds and of the items mentioned under (a), (b), (c), and (d). It should be understood that all references to compounds above and below are meant to include these items, in particular pharmaceutically acceptable solvates of the compounds, or pharmaceutically acceptable solvates of their pharmaceutically acceptable salts. There is furthermore intended that a compound of the present invention includes isotope- labelled forms thereof. An isotope-labelled form of a compound of the formula (I) is identical to this compound apart from the fact that one or more atoms of the compound have been replaced by an atom or atoms having an atomic mass or mass number which differs from the atomic mass or mass number of the atom which usually occurs naturally. Examples of isotopes which are readily commercially available and which can be incorporated into a compound of the present invention by well-known methods include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine and chlorine, for example ² H (D), ³ H, ¹³ C, ¹⁴ C, ¹⁵ N, ¹⁸ O, ¹⁷ O, ³¹ P, ³² P, ³³ S, ³⁴ S, ³⁵ S, ³⁶ S, ¹⁸ F and ³⁶ CI, respectively. A compound of formula (I) or a pharmaceutically acceptable salt thereof which contains one or more of the above-mentioned isotopes and/or other isotopes of other atoms is intended to be part of the present invention. An isotope-labelled compound of formula (I) can be used in a number of beneficial ways. For example, an isotope-labelled compound of the present invention into which, for example, a radioisotope, such as ³ H or ¹⁴ C, has been incorporated is suitable for medicament and/or substrate tissue distribution assays. These radioisotopes, i.e., tritium ( ³ H) and carbon-14 ( ¹⁴ C), are particularly preferred owing to simple preparation and excellent detectability. Incorporation of heavier isotopes, for example deuterium ( ² H), into a compound of formula (I) has therapeutic advantages owing to the higher metabolic stability of this isotope-labelled compound. Higher metabolic stability translates directly into an increased in vivo half-life or lower dosages, which under most circumstances would represent a preferred embodiment of the present invention. An isotope-labelled compound of formula (I) can usually be prepared by carrying out the procedures disclosed in the synthesis schemes and the related description, in the example part and in the preparation part in the present text, replacing a non-isotope-labelled reactant by a readily available isotope-labelled reactant. Deuterium ( ² H; D) can also be incorporated into a compound of formula (I) for the purpose of manipulating the oxidative metabolism of the compound by way of the primary kinetic isotope effect. The primary kinetic isotope effect is a change of the rate for a chemical reaction that results from exchange of isotopic nuclei, which in turn is caused by the change in ground state energies necessary for covalent bond formation after this isotopic exchange. Exchange of a heavier isotope usually results in a lowering of the ground state energy for a chemical bond and thus cause a reduction in the rate in rate-limiting bond breakage. If the bond breakage occurs in or in the vicinity of a saddle-point region along the coordinate of a multi-product reaction, the product distribution ratios can be altered substantially. For explanation: if deuterium is bonded to a carbon atom at a non-exchangeable position, rate differences of kM/kD = 2-7 are typical. If this rate difference is successfully applied to a compound of the formula Ia and Ib that is susceptible to oxidation, the profile of this compound in vivo can be drastically modified and result in improved pharmacokinetic properties. When discovering and developing therapeutic agents, the person skilled in the art attempts to optimize pharmacokinetic parameters while retaining desirable in vitro properties. It is reasonable to assume that many compounds with poor pharmacokinetic profiles are susceptible to oxidative metabolism. In vitro liver microsomal assays currently available provide valuable information on the course of oxidative metabolism of this type, which in turn permits the rational design of deuterated compounds of the formula (I) with improved stability through resistance to such oxidative metabolism. Significant improvements in the pharmacokinetic profiles of compounds of the formula (I) are thereby obtained and can be expressed quantitatively in terms of increases in the in vivo half-life (t1/2), concentration at maximum therapeutic effect (Cmax), area under the dose response curve (AUC), and oral bioavailability (F); and in terms of reduced clearance, dose and materials costs. The following is intended to illustrate the above: a compound of formula (I) which has multiple potential sites of attack for oxidative metabolism, for example benzylic hydrogen atoms and hydrogen atoms bonded to a nitrogen atom, is prepared as a series of analogues in which various combinations of hydrogen atoms are replaced by deuterium atoms, so that some, most or all of these hydrogen atoms have been replaced by deuterium atoms. Half-life determinations enable favorable and accurate determination of the extent to which the improvement in resistance to oxidative metabolism has improved. In this way, it is determined that the half-life of the parent compound can be extended by up to 100% as the result of deuterium-hydrogen exchange of this type. Deuterium-hydrogen exchange in a compound of the present invention can also be used to achieve a favorable modification of the metabolite spectrum of the starting compound in order to diminish or eliminate undesired toxic metabolites. For example, if a toxic metabolite arises through oxidative carbon-hydrogen (C-H) bond cleavage, it can reasonably be assumed that the deuterated analogue will greatly diminish or eliminate production of the unwanted metabolite, even if that particular oxidation is not a rate-determining step. Further information on the state of the art with respect to deuterium-hydrogen exchange may be found, for example in Hanzlik et al., J. Org. Chem.55, 3992-3997, 1990, Reider et al., J. Org. Chem.52, 3326- 3334, 1987, Foster, Adv. Drug Res.14, 1-40, 1985, Gillette et al., Biochemistry 33(10) 2927- 2937, 1994, and Jarman et al., Carcinogenesis 16(4), 683-688, 1995. Furthermore, the present invention relates to pharmaceutical compositions comprising at least one compound of formula (I), or its derivatives, prodrugs, solvates, tautomers or stereoisomers thereof as well as the pharmaceutically acceptable salts of each of the foregoing, including mixtures thereof in all ratios, as active ingredient, together with a pharmaceutically acceptable carrier. For the purpose of the present invention the term “pharmaceutical composition” (or “pharmaceutical formulation”) refers to a composition or product comprising one or more active ingredients, and one or more inert ingredients that make up the carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients. Accordingly, the pharmaceutical compositions of the present invention encompass any composition made by admixing at least one compound of the present invention and a pharmaceutically acceptable carrier. It may further comprise physiologically acceptable excipients, auxiliaries, adjuvants, diluents and/or additional pharmaceutically active substances other than the compounds of the invention. The pharmaceutical compositions include compositions and pharmaceutical formulations suitable for oral, rectal, topical, parenteral (including subcutaneous, intramuscular, and intravenous), ocular (ophthalmic), pulmonary (nasal or buccal inhalation), or nasal administration, although the most suitable route in any given case will depend on the nature and severity of the conditions being treated and on the nature of the active ingredient. They may be conveniently presented in unit dosage form and prepared by any of the methods well- known in the art of pharmacy. A pharmaceutical composition of the present invention may additionally comprise one or more other compounds as active ingredients (drugs), such as one or more additional compounds of the present invention. In a particular embodiment the pharmaceutical composition further comprises a second active ingredient or its derivatives, prodrugs, solvates, tautomers or stereoisomers thereof as well as the pharmaceutically acceptable salts of each of the foregoing, including mixtures thereof in all ratios, wherein that second active ingredient is other than a compound of formula (I); preferably, that second active ingredient is a compound that is useful in the treatment, prevention, suppression and/or amelioration of medicinal conditions or pathologies for which the compounds of the present invention are useful as well and which are listed elsewhere hereinbefore or hereinafter. Such combination of two or more active ingredients or drugs may be safer or more effective than either drug or active ingredient alone, or the combination is safer or more effective than it would be expected based on the additive properties of the individual drugs. Such other drug(s) may be administered, by a route and in an amount commonly used contemporaneously or sequentially with a compound of the invention. When a compound of the invention is used contemporaneously with one or more other drugs or active ingredients, a combination product containing such other drug(s) and the compound of the invention – also referred to as “fixed dose combination” – is preferred. However, combination therapy also includes therapies in which the compound of the present invention and one or more other drugs are administered on different overlapping schedules. It is contemplated that when used in combination with other active ingredients, the compound of the present invention or the other active ingredient or both may be used effectively in lower doses than when each is used alone. Accordingly, the pharmaceutical compositions of the present invention include those that contain one or more other active ingredients, in addition to a compound of the invention. The compounds of the present invention – or derivatives, N-oxides, prodrugs, solvates, tautomers or stereoisomers thereof and/or the pharmaceutically acceptable salts of each of the foregoing, including mixtures thereof in all ratios – can be used as medicaments. They have been found to exhibit pharmacological activity by inhibiting Werner Helicase (WRN). Thus, the compounds of the present invention being WRN inhibitors are useful in particular in the treatment, prevention, suppression and/or amelioration of hyperproliferative disorders and cancer, in particular tumors including solid tumors, of bladder, breast, colorectal, colon, kidney, liver, lung, head and neck, esophagus, gallbladder, ovary, pancreas, stomach, cervix, thyroid, prostate, and skin, including squamous cell carcinoma; leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T- cell lymphoma, Hodgkin’s lymphoma, non- Hodgkin’s lymphoma, hairy cell lymphoma, mantle cell lymphoma, Burkitt lymphoma; chronic lymphocytic leukemia ("CLL"), acute and chronic myelogenous leukemia, myelodysplastic syndrome and promyelocyte leukemia; fibrosarcoma, rhabdomyosarcoma; myeloma; astrocytoma, neuroblastoma, glioma, glioblastoma, malignant glial tumors, hepatocellular carcinoma, gastrointestinal stromal tumors ("GIST") and schwannomas; melanoma, multiple myeloma, seminoma, teratocarcinoma, osteosarcoma, xeroderma pigmentosum, keratoacatanthoma, thyroid follicular cancer, endometrial cancer, gastrointestinal tract cancer and Kaposi's sarcoma; acanthoma, acinic cell carcinoma, acoustic neuroma, acral lentiginous melanoma, acrospiroma, acute eosinophilic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute myeloblastic leukemia with maturation, acute myeloid dendritic cell leukemia, acute myeloid leukemia, acute promyelocytic leukemia, adamantinoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, adenomatoid odontogenic tumor, adrenocortical carcinoma, adult T-cell leukemia, aggressive NK-cell leukemia, AIDS-related cancers, AIDS-related lymphoma, alveolar soft part sarcoma, ameloblastic fibroma, anal cancer, anaplastic large cell lymphoma, anaplastic thyroid cancer, angioimmunoblastic T-cell lymphoma, angiomyolipoma, angiosarcoma, appendix cancer, atypical teratoid rhabdoid tumor, basal cell carcinoma, basal-like carcinoma, B-cell leukemia, Bellini duct carcinoma, biliary tract cancer, bladder cancer, blastoma, bone cancer, brain stem glioma, brain tumor, breast cancer, Brenner tumor, bronchial tumor, bronchioloalveolar carcinoma, brown tumor, carcinoid tumor, carcinoma, carcinosarcoma, Castleman's disease, central nervous system embryonal tumor, cerebellar astrocytoma, cerebral astrocytoma, cervical cancer, cholangiocarcinoma, chondroma, chondrosarcoma, chordoma, choriocarcinoma, choroid plexus papilloma, chronic monocytic leukemia, chronic myeloproliferative disorder, chronic neutrophilic leukemia, clear cell renal cell carcinoma, clear- cell tumor, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, dermatofibrosarcoma protuberans, dermoid cyst, desmoplastic small round cell tumor, diffuse large B cell lymphoma, dysembryoplastic neuroepithelial tumor, embryonal carcinoma, endodermal sinus tumor, endometrial uterine cancer, endometrioid tumor, enteropathy- associated T-cell lymphoma, ependymoblastoma, ependymoma, epithelioid sarcoma, erythroleukemia, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, extramammary Paget's disease, fallopian tube cancer, fibroma, follicular lymphoma, follicular thyroid cancer, gallbladder cancer, ganglioglioma, ganglioneuroma, gastric cancer, gastric lymphoma, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, germ cell tumor, germinoma, gestational choriocarcinoma, gestational trophoblastic tumor, giant cell tumor of bone, glioblastoma multiforme, gliomatosis cerebri, glomus tumor, glucagonoma, gonadoblastoma, granulosa cell tumor, hairy cell leukemia, head and neck cancer, heart cancer, hemangioblastoma, hemangiopericytoma, hemangiosarcoma, hematological malignancy, hepatosplenic T-cell lymphoma, hypopharyngeal cancer, hypothalamic glioma, inflammatory breast cancer, intraocular melanoma, islet cell carcinoma, juvenile myelomonocytic leukemia, kidney cancer, Klatskin tumor, Krukenberg tumor, laryngeal cancer, lentigo maligna melanoma, leukemia, lip and oral cavity cancer, liposarcoma, lung cancer, luteoma, lymphangioma, lymphangiosarcoma, lymphoepithelioma, lymphoid leukemia, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, malignant glioma, malignant mesothelioma, malignant peripheral nerve sheath tumor, malignant rhabdoid tumor, malignant triton tumor, malt lymphoma, mantle cell lymphoma, mast cell leukemia, mediastinal germ cell tumor, mediastinal tumor, medullary thyroid cancer, medulloblastoma, medulloepithelioma, meningioma, Merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer with occult primary, metastatic urothelial carcinoma, mixed mullerian tumor, monocytic leukemia, mouth cancer, mucinous tumor, multiple endocrine neoplasia syndrome, mycosis fungoides, myeloid leukemia, myeloid sarcoma, myeloproliferative disease, myxoma, nasal cavity cancer, nasopharyngeal cancer, neoplasm, neurinoma, neurofibroma, neuroma, nodular melanoma, nonmelanoma skin cancer, non-small cell lung cancer, ocular oncology, oligoastrocytoma, oligodendroglioma, oncocytoma, optic nerve sheath meningioma, oral cancer, oropharyngeal cancer, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancoast tumor, pancreatic cancer, papillary thyroid cancer, papillomatosis, paraganglioma, paranasal sinus cancer, parathyroid cancer, penile cancer, perivascular epithelioid cell tumor, pharyngeal cancer, pheochromocytoma, pineal parenchymal tumor of intermediate differentiation, pineoblastoma, pituicytoma, pituitary adenoma, pituitary tumor, plasma cell neoplasm, pleuropulmonary blastoma, polyembryoma, precursor T-lymphoblastic lymphoma, primitive neuroectodermal tumor, prostate cancer, pseudomyxoma peritonei, rectal cancer, renal cell carcinoma, retinoblastoma, rhabdomyoma, Richter's transformation, sacrococcygeal teratoma, salivary gland cancer, sarcoma, schwannomatosis, sebaceous gland carcinoma, secondary neoplasm, serous tumor, Sertoli- Leydig cell tumor, sex cord-stromal tumor, Sezary syndrome, Signet ring cell carcinoma, skin cancer, small blue round cell tumor, small cell carcinoma, small cell lung cancer, small cell lymphoma, small intestine cancer, soft tissue sarcoma, somatostatinoma, soot wart, spinal tumor, splenic marginal zone lymphoma, stomach cancer, superficial spreading melanoma, supratentorial primitive neuroectodermal tumor, surface epithelial-stromal tumor, synovial sarcoma, T-cell acute lymphoblastic leukemia, T-cell large granular lymphocyte leukemia, T- cell leukemia, T-cell lymphoma, T-cell prolymphocytic leukemia, teratoma, terminal lymphatic cancer, testicular cancer, thecoma, throat cancer, thymic carcinoma, thymoma, thyroid cancer, transitional cell cancer of renal pelvis and ureter, transitional cell carcinoma, urachal cancer, urethral cancer, urogenital neoplasm, uterine sarcoma, uveal melanoma, vaginal cancer, Verner Morrison syndrome, verrucous carcinoma, visual pathway glioma, vulvar cancer, Waldenstrom's macroglobulinemia, Warthin's tumor, Wilms' tumor or any combination thereof. However, since activity of WRN plays a role in non-cancer cells too, the compounds of the present invention are useful also in the treatment, prevention, suppression and/or amelioration of an inflammatory disorder or disease, in particular Crohn's disease, ulcerative colitis, idiopathic pulmonary fibrosis, muscular dystrophy, rheumatoid arthritis, and systemic sclerosis (scleroderma); a neurogenerative disorder or disease, in particular Huntington’s disease; Lipid metabolism disorders, e.g. NASH (non-alcoholic steatohepatitis), NAFLD (non-alcoholic fatty liver disease), fatty liver disease; viral infections, e.g. with cytomegalovirus; post-traumatic stress disorder (PTSD); bipolar disorder, depression, Tourette’s syndrome, schizophrenia, obsessive-compulsive disorder, anxiety disorder, panic disorders, phobias, addiction to e.g. alcohol, tobacco, opioids, sedatives, hypnotics, anxiolytics, cocaine, cannabis, amphetamines, hallucinogens, inhalants, phencyclidine, impulse control disorders, behavioral addictions. In a particular embodiment the compounds of the present invention are for use in the prevention and/or treatment, especially in the treatment of any of the disorders or diseases listed above, preferably of cancer, in particular tumors including solid tumors, of the specific types of cancer disclosed in the previous paragraph; of an inflammatory disorder or disease, in particular Crohn's disease, ulcerative colitis, idiopathic pulmonary fibrosis, muscular dystrophy, rheumatoid arthritis, and systemic sclerosis (scleroderma); a neurogenerative disorder or disease, in particular Huntington’s disease; Lipid metabolism disorders, e.g. NASH (non-alcoholic steatohepatitis), NAFLD (non-alcoholic fatty liver disease), fatty liver disease; viral infections, e.g. with cytomegalovirus; post-traumatic stress disorder (PTSD); bipolar disorder, depression, Tourette’s syndrome, schizophrenia, obsessive-compulsive disorder, anxiety disorder, panic disorders, phobias, addiction to e.g. alcohol, tobacco, opioids, sedatives, hypnotics, anxiolytics, cocaine, cannabis, amphetamines, hallucinogens, inhalants, phencyclidine, impulse control disorders, behavioral addictions. Another particular embodiment of the present invention is a method for preventing and/or treating, preferably treating a disorder or disease selected from the group consisting of hyperproliferative disorders and cancer, in particular tumors including solid tumors, of the specific types of cancer disclosed in the previous paragraphs; of an inflammatory disorder or disease, in particular Crohn's disease, ulcerative colitis, idiopathic pulmonary fibrosis, muscular dystrophy, rheumatoid arthritis, and systemic sclerosis (scleroderma); a neurogenerative disorder or disease, in particular Huntington’s disease; lipid metabolism disorders, e.g. NASH (non-alcoholic steatohepatitis), NAFLD (non-alcoholic fatty liver disease), fatty liver disease; viral infections, e.g. with cytomegalovirus; post-traumatic stress disorder (PTSD); bipolar disorder, depression, Tourette’s syndrome, schizophrenia, obsessive- compulsive disorder, anxiety disorder, panic disorders, phobias, addiction to e.g. alcohol, tobacco, opioids, sedatives, hypnotics, anxiolytics, cocaine, cannabis, amphetamines, hallucinogens, inhalants, phencyclidine, impulse control disorders, behavioral addictions. Still another particular embodiment of the invention is the use of a compound of the present invention – or derivatives, N-oxides, prodrugs, solvates, tautomers or stereoisomers thereof and/or the pharmaceutically acceptable salts of each of the foregoing, including mixtures thereof in all ratios – for the manufacturing of a medicament, in particular for preventing and/or treating, preferably treating a disorder or disease selected from the group consisting of hyperproliferative disorders and cancer, in particular tumors including solid tumors, of the specific types of cancer disclosed in the previous paragraphs; of an inflammatory disorder or disease, in particular Crohn's disease, ulcerative colitis, idiopathic pulmonary fibrosis, muscular dystrophy, rheumatoid arthritis, and systemic sclerosis (scleroderma); a neurogenerative disorder or disease, in particular Huntington’s disease; Lipid metabolism disorders, e.g. NASH (non-alcoholic steatohepatitis), NAFLD (non-alcoholic fatty liver disease), fatty liver disease; viral infections, e.g. with cytomegalovirus; post-traumatic stress disorder (PTSD); bipolar disorder, depression, Tourette’s syndrome, schizophrenia, obsessive-compulsive disorder, anxiety disorder, panic disorders, phobias, addiction to e.g. alcohol, tobacco, opioids, sedatives, hypnotics, anxiolytics, cocaine, cannabis, amphetamines, hallucinogens, inhalants, phencyclidine, impulse control disorders, behavioral addictions. Thus, the compounds according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compounds according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub-formulae (Ir) to (Iu), as described hereinabove and/or hereinbelow are preferably suitable for use and/or used for the treatment of disorders. Thus, the compounds according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compounds according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub-formulae (Ir) to (Iu), as described hereinabove and/or hereinbelow, are preferably suitable for use and/or used as a medicament. Preferably, the compounds according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub-formulae (Ir) to (Iu), as described hereinabove and/or hereinbelow, are preferably suitable for use and/or used as a WRN inhibitor. Thus, preferred is also a pharmaceutical composition, preferably for use in the treatment as described hereinabove and/or hereinbelow, comprising one or more compounds described hereinabove and/or hereinbelow, preferably compounds according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub- formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow. Thus, preferred is also a pharmaceutical composition as described hereinabove and/or hereinbelow, that contains one or more additional compounds, selected from the group consisting of physiologically acceptable excipients, auxiliaries, adjuvants, carriers and pharmaceutical active ingredients other than the compounds according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub- formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow. Thus, preferred is also a process for the manufacture of a pharmaceutical composition, characterized in that one or more compounds according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub- formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow, and one or more compounds, selected from the group consisting of carriers, excipients, auxiliaries and pharmaceutical active ingredients other than the compounds according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub- formula (Ik) and/or the compounds according to one or more of sub-formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow, is processed by mechanical means into a pharmaceutical composition that is suitable as dosage form for application and/or administration to a patient. Thus, especially preferred is the use of a compound according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub- formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow, as a pharmaceutical. Thus, especially preferred is the use of a compound according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub- formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow, in the treatment and/or prophylaxis of disorders, preferably disorders as described hereinabove and/or hereinbelow. Thus, also especially preferred is the use of a compound according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub- formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow, for producing a pharmaceutical composition for the treatment and/or prophylaxis of disorders, preferably disorders as described hereinabove and/or hereinbelow. Preferably, the disorders in this regard are selected from the group consisting of hyperproliferative and non-hyperproliferative disorders. More preferably, the disorders in this regard comprise cancerous disorders. Even more preferably, the preferred disorder in this regard is cancer, preferably cancer as described hereinabove and/or hereinbelow. Alternatively preferably, the disorder in this regard is selected from the group consisting of noncancerous disorders, preferably noncancerous disorders as described hereinabove and/or hereinbelow. Preferred disorders in this regard are disorders having or additionally having Microsatellite Instability (MSI), preferably assay detectable Microsatellite Instability (MSI). Thus, the preferred cancerous disorders in this regard are selected from the group consisting of melanoma, brain cancer, lung cancer, squamous cell cancer, bladder cancer, gastric cancer, pancreatic cancer, hepatic cancer, renal cancer, colorectal cancer, breast cancer, head cancer, neck cancer, esophageal cancer, gynecological cancer, ovarian cancer, uterine cancer, prostate cancer, thyroid cancer, lymphoma, chronic leukemia and/or acute leukemia. Thus, especially preferred cancerous disorders in this regard are one or more disorders, selected from the group consisting of endometrial cancer, colon cancer, colorectal cancer (CRC), gastric cancer, glioblastoma, and/or glioblastoma multiforme (GBM). Thus, especially preferred cancerous disorders in this regard are disorders selected from the group consisting of Uterine Corpus Endometrial Carcinoma (UCEC), Stomach adenocarcinoma (STAD), Rectum adenocarcinoma (READ), Adrenocortical carcinoma (ACC), Uterine Carcinosarcoma (UCS), Cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), Wilms Tumor Syndromes (WT), Mesothelioma (MESO), Esophageal carcinoma (ESCA), Breast Cancer (BC), Kidney renal clear cell carcinoma (KIRC), Ovarian serous cystadenocarcinoma (OV), Cholangiocarcinoma (CHOL), Thymoma (THYM), Liver hepatocellular carcinoma (LIHC), Head and Neck squamous cell carcinoma (HNSC), Sarcoma (SARC), Lung squamous cell carcinoma (LUSC), Prostate adenocarcinoma (PRAD), Lung adenocarcinoma (LUAD), Bladder Urothelial Carcinoma (BLCA), Neuroblastoma (NBL), Brain Lower Grade Glioma (LGG), and/or Chronic lymphocytic leukemia (CLL). Alternatively preferably, the disorders in this regard are one or more disorders, selected from the group consisting of arthritis, restenosis; fibrotic disorders; mesangial cell proliferative disorders, diabetic nephropathy, malignant nephrosclerosis, thrombotic microangiopathy syndromes, organ transplant rejection, glomerulopathies, metabolic disorders, inflammation, solid tumors, rheumatic arthritis, diabetic retinopathy, and neurodegenerative diseases. Preferred for the prophylaxis and/or treatment in the context of the instant invention are disorders having or additionally having Microsatellite Instability (MSI), preferably Microsatellite Instability (MSI) that can be shown by diagnostic procedures, and especially assay detectable Microsatellite Instability (MSI). Thus, especially preferred are methods for the treatment and/or prophylaxis of disorders, characterized in that one or more compounds compound according to formula (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub- formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow, is administered to a patient in need of such a treatment, even more preferably such methods for the treatment and/or prophylaxis of disorders, wherein the disorders are as described hereinabove and/or hereinbelow. The disclosed compounds of formulas (I), preferably including the compounds according to one or more of sub-formulae (Ia) to (If), the compound according to one or more of sub-formulae (Ig) to (Ij), the compounds according to sub-formula (Ik) and/or the compounds according to one or more of sub-formulae (Ir) to (Iu), preferably including one or more the compounds explicitly described in the Experimental Section provided hereinbelow, can be administered in combination with other known therapeutic agents, including anticancer agents. As used here, the term "anticancer agent" relates to any agent which is administered to a patient with cancer for the purposes of treating the cancer. The anti-cancer treatment defined above may be applied as monotherapy or may involve, in addition to the herein disclosed compounds of formula (I), conventional surgery or radiotherapy or medicinal therapy. Such medicinal therapy, e.g., a chemotherapy or a targeted therapy, may include one or more, but preferably one, of the following anti-tumor agents: Alkylating agents such as altretamine, bendamustine, busulfan, carmustine, chlorambucil, chlormethine, cyclophosphamide, dacarbazine, ifosfamide, improsulfan, tosilate, lomustine, melphalan, mitobronitol, mitolactol, nimustine, ranimustine, temozolomide, thiotepa, treosulfan, mechloretamine, carboquone, apaziquone, fotemustine, glufosfamide, palifosfamide, pipobroman, trofosfamide, uramustine, TH-302 ⁴ , VAL-083 ⁴ ; Platinum Compounds such as carboplatin, cisplatin, eptaplatin, miriplatin hydrate, oxaliplatin, lobaplatin, nedaplatin, picoplatin, satraplatin; DNA altering agents such as amrubicin, bisantrene, decitabine, mitoxantrone, procarbazine, trabectedin, clofarabine, amsacrine, brostallicin, pixantrone, laromustine ^1,3 ; Topoisomerase Inhibitors such as etoposide, irinotecan, razoxane, sobuzoxane, teniposide, topotecan; amonafide, belotecan, elliptinium acetate, voreloxin; Microtubule modifiers such as cabazitaxel, docetaxel, eribulin, ixabepilone, paclitaxel, vinblastine, vincristine, vinorelbine, vindesine, vinflunine, fosbretabulin, tesetaxel; Antimetabolites such as asparaginase ³ , azacitidine, calcium levofolinate, capecitabine, cladribine, cytarabine, enocitabine, floxuridine, fludarabine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, nelarabine, pemetrexed, pralatrexate, azathioprine, thioguanine, carmofur, doxifluridine, elacytarabine, raltitrexed, sapacitabine, tegafur ^2,3 , trimetrexate; Anticancer antibiotics such as bleomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, levamisole, miltefosine, mitomycin C, romidepsin, streptozocin, valrubicin, zinostatin, zorubicin, daunurobicin, plicamycin, aclarubicin, peplomycin, pirarubicin; Hormones/Antagonists such as abarelix, abiraterone, bicalutamide, buserelin, calusterone, chlorotrianisene, degarelix, dexamethasone, estradiol, fluocortolone, fluoxymesterone, flutamide, fulvestrant, goserelin, histrelin, leuprorelin, megestrol, mitotane, nafarelin, nandrolone, nilutamide, octreotide, prednisolone, raloxifene, tamoxifen, thyrotropin alfa, toremifene, trilostane, triptorelin, diethylstilbestrol; acolbifene, danazol, deslorelin, epitiostanol, orteronel, enzalutamide ^1,3 ; Aromatase inhibitors such as aminoglutethimide, anastrozole, exemestane, fadrozole, letrozole, testolactone, formestane; Small molecule kinase inhibitors such as crizotinib, dasatinib, erlotinib, imatinib, lapatinib, nilotinib, pazopanib, regorafenib, ruxolitinib, sorafenib, sunitinib, vandetanib, vemurafenib, bosutinib, gefitinib, axitinib, afatinib, alisertib, dabrafenib, dacomitinib, dinaciclib, dovitinib, enzastaurin, nintedanib, lenvatinib, linifanib, linsitinib, masitinib, midostaurin, motesanib, neratinib, orantinib, perifosine, ponatinib, radotinib, tepotinib, tipifarnib, tivantinib, tivozanib, trametinib, pimasertib, brivanib alaninate, cediranib, apatinib ⁴ , cabozantinib S-malate ^1,3 , ibrutinib ^1,3 , icotinib ⁴ , buparlisib ² , cipatinib ⁴ , cobimetinib ^1,3 , idelalisib ^1,3 , fedratinib ¹ , XL-647 ⁴ ; Photosensitizers such as methoxsalen ^3, porfimer sodium, talaporfin, temoporfin; Antibodies such as alemtuzumab, besilesomab, brentuximab vedotin, cetuximab, denosumab, ipilimumab, ofatumumab, panitumumab, rituximab, tositumomab, trastuzumab, bevacizumab, pertuzumab ^2,3, catumaxomab, elotuzumab, epratuzumab, farletuzumab, mogamulizumab, necitumumab, nimotuzumab, obinutuzumab, ocaratuzumab, oregovomab, ramucirumab, rilotumumab, siltuximab, tocilizumab, zalutumumab, zanolimumab, matuzumab, dalotuzumab ^1,2,3 , onartuzumab ^1,3 , racotumomab ¹ , tabalumab ^1,3 , EMD-525797 ⁴ , atezolizumab, durvalumab, pembrolizumab, nivolumab ^1,3 ; Cytokines such as aldesleukin, interferon alfa ² , interferon alfa2a ³ , interferon alfa2b ^2,3, celmoleukin, tasonermin, teceleukin, oprelvekin ^1,3 , recombinant interferon beta-1a ⁴ ; Drug Conjugates such as denileukin diftitox, ibritumomab tiuxetan, iobenguane I123, prednimustine, trastuzumab emtansine, estramustine, gemtuzumab, ozogamicin, aflibercept, cintredekin besudotox, edotreotide, inotuzumab, naptumomab estafenatox, oportuzumab monatox, technetium (99mTc), arcitumomab ^1,3 , vintafolide ^1,3 ; Vaccines such as sipuleucel ^3, vitespen ³ , emepepimut-S ³ , oncoVAX ⁴ , rindopepimut ³ , troVax ⁴ , MGN-1601 ⁴ , MGN-1703 ⁴ ; Miscellaneous alitretinoin, bexarotene, bortezomib, everolimus, ibandronic acid, imiquimod, lenalidomide, lentinan, metirosine, mifamurtide, pamidronic acid, pegaspargase, pentostatin, sipuleucel ³ , sizofiran, tamibarotene, temsirolimus, thalidomide, tretinoin, vismodegib, zoledronic acid, vorinostat; celecoxib, cilengitide, entinostat, etanidazole, ganetespib, idronoxil, ixazomib, lonidamine, nimorazole, panobinostat, peretinoin, plitidepsin, pomalidomide, procodazol, ridaforolimus, tasquinimod, telotristat, thymalfasin, tirapazamine, tosedostat, trabedersen, ubenimex, valspodar, gendicine ⁴ , picibanil ⁴ , reolysin ⁴ , retaspimycin hydrochloride ^1,3 , trebananib ^2,3 , virulizin ⁴ , carfilzomib ^1,3 , endostatin ⁴ , immucothel ⁴ , belinostat ³ , MGN-1703 ⁴ ; PARP inhibitors Olaparib, Rucaparib, Niraparib, Talazoparib, Veliparib. MCT1 inhibitors AZD3965 ⁴ , BAY-8002 ⁴ . ¹ Prop. INN (Proposed International Nonproprietary Name) ² Rec. INN (Recommended International Nonproprietary Name) ³ USAN (United States Adopted Name) ⁴ no INN. A further embodiment of the present invention is a process for the manufacture of the pharmaceutical compositions of the present invention, characterized in that one or more compounds according to the invention and one or more compounds selected from the group consisting of solid, liquid or semiliquid excipients, auxiliaries, adjuvants, diluents, carriers and pharmaceutically active agents other than the compounds according to the invention, are converted in a suitable dosage form. In another aspect of the invention, a set or kit is provided comprising a therapeutically effective amount of at least one compound of the invention and/or at least one pharmaceutical composition as described herein and a therapeutically effective amount of at least one further pharmacologically active substance other than the compounds of the invention. It is preferred that this set or kit comprises separate packs of a) an effective amount of a compound of formula (I), or its derivatives, prodrugs, solvates, tautomers or stereoisomers thereof as well as the physiologically acceptable salts of each of the foregoing, including mixtures thereof in all ratios, and b) an effective amount of a further active ingredient that further active ingredient not being a compound of formula (I). The pharmaceutical compositions (formulations) of the present invention may be administered by any means that achieve their intended purpose. For example, administration may be via oral, parenteral, topical, enteral, intravenous, intramuscular, inhalant, nasal, intraarticular, intraspinal, transtracheal, transocular, subcutaneous, intraperitoneal, transdermal, or buccal routes. Alternatively, or concurrently, administration may be via the oral route. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. Parenteral administration is preferred. Oral administration is especially preferred. Suitable dosage forms include, but are not limited to capsules, tablets, pellets, dragees, semi- solids, powders, granules, suppositories, ointments, creams, lotions, inhalants, injections, cataplasms, gels, tapes, eye drops, solution, syrups, aerosols, suspension, emulsion, which can be produced according to methods known in the art, for example as described below: Tablets: mixing of active ingredient/s and auxiliaries, compression of said mixture into tablets (direct compression), optionally granulation of part of mixture before compression. Capsules: mixing of active ingredient/s and auxiliaries to obtain a flowable powder, optionally granulating powder, filling powders/granulate into opened capsules, capping of capsules. Semi-solids (ointments, gels, creams): dissolving/dispersing active ingredient/s in an aqueous or fatty carrier; subsequent mixing of aqueous/fatty phase with complementary fatty/aqueous phase, homogenization (creams only). Suppositories (rectal and vaginal): dissolving/dispersing active ingredient/s in carrier material liquified by heat (rectal: carrier material normally a wax; vaginal: carrier normally a heated solution of a gelling agent), casting said mixture into suppository forms, annealing and withdrawal suppositories from the forms. Aerosols: dispersing/dissolving active agent/s in a propellant, bottling said mixture into an atomizer. In general, non-chemical routes for the production of pharmaceutical compositions and/or pharmaceutical preparations comprise processing steps on suitable mechanical means known in the art that transfer one or more compounds of the invention into a dosage form suitable for administration to a patient in need of such a treatment. Usually, the transfer of one or more compounds of the invention into such a dosage form comprises the addition of one or more compounds, selected from the group consisting of carriers, excipients, auxiliaries and pharmaceutical active ingredients other than the compounds of the invention. Suitable processing steps include, but are not limited to combining, milling, mixing, granulating, dissolving, dispersing, homogenizing, casting and/or compressing the respective active and nonactive ingredients. Mechanical means for performing said processing steps are known in the art, for example from Ullmann's Encyclopedia of Industrial Chemistry, 5th Edition. In this respect, active ingredients are preferably at least one compound of the invention and optionally one or more additional compounds other than the compounds of the invention, which show valuable pharmaceutical properties, preferably those pharmaceutical active agents other than the compounds of the invention, which are disclosed herein. Particularly suitable for oral use are tablets, pills, coated tablets, capsules, powders, granules, syrups, juices or drops, suitable for rectal use are suppositories, suitable for parenteral use are solutions, preferably oil-based or aqueous solutions, furthermore suspensions, emulsions or implants, and suitable for topical use are ointments, creams or powders. The compounds of the invention may also be lyophilized and the resultant lyophilizates used, for example, for the preparation of injection preparations. The preparations indicated may be sterilized and/or comprise assistants, such as lubricants, preservatives, stabilizers and/or wetting agents, emulsifiers, salts for modifying the osmotic pressure, buffer substances, dyes, flavors and/or a plurality of further active ingredients, for example one or more vitamins. Suitable excipients are organic or inorganic substances, which are suitable for enteral (for example oral), parenteral or topical administration and do not react with the compounds of the invention, for example water, vegetable oils, benzyl alcohols, alkylene glycols, polyethylene glycols, glycerol triacetate, gelatine, carbohydrates, such as lactose, sucrose, mannitol, sorbitol or starch (maize starch, wheat starch, rice starch, potato starch), cellulose preparations and/or calcium phosphates, for example tricalcium phosphate or calcium hydrogen phosphate, magnesium stearate, talc, gelatine, tragacanth, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, polyvinyl pyrrolidone and/or vaseline. If desired, disintegrating agents may be added such as the above-mentioned starches and also carboxymethyl-starch, cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate. Auxiliaries include, without limitation, flow-regulating agents and lubricants, for example, silica, talc, stearic acid or salts thereof, such as magnesium stearate or calcium stearate, and/or polyethylene glycol. Dragee cores are provided with suitable coatings, which, if desired, are resistant to gastric juices. For this purpose, concentrated saccharide solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, polyethylene glycol and/or titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. In order to produce coatings resistant to gastric juices or to provide a dosage form affording the advantage of prolonged action, the tablet, dragee or pill can comprise an inner dosage and an outer dosage component the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer, which serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, acetyl alcohol, solutions of suitable cellulose preparations such as acetyl-cellulose phthalate, cellulose acetate or hydroxypropylmethyl- cellulose phthalate, are used. Dyestuffs or pigments may be added to the tablets or dragee coatings, for example, for identification or in order to characterize combinations of active compound doses. Suitable carrier substances are organic or inorganic substances which are suitable for enteral (e.g., oral) or parenteral administration or topical application and do not react with the novel compounds, for example water, vegetable oils, benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose or starch, magnesium stearate, talc and petroleum jelly. In particular tablets, coated tablets, capsules, syrups, suspensions, drops or suppositories are used for enteral administration, solutions, preferably oily or aqueous solutions, furthermore suspensions, emulsions or implants, are used for parenteral administration, and ointments, creams or powders are used for topical application. The compounds of the invention can also be lyophilized and the lyophilizates obtained can be used, for example, for the production of injection preparations. Other pharmaceutical preparations, which can be used orally include push-fit capsules made of gelatine, as well as soft, sealed capsules made of gelatine and a plasticizer such as glycerol or sorbitol. The push-fit capsules can contain the active compounds in the form of granules, which may be mixed with fillers such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds are preferably dissolved or suspended in suitable liquids, such as fatty oils, or liquid paraffin. In addition, stabilizers may be added. The liquid forms in which the novel compositions of the present invention may be incorporated for administration orally include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil or peanut oil, as well as elixirs and similar pharmaceutical vehicles. Suitable dispersing or suspending agents for aqueous suspensions include synthetic and natural gums such as tragacanth, acacia, alginate, dextran, sodium carboxymethylcellulose, methylcellulose, polyvinyl-pyrrolidone or gelatine. Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts and alkaline solutions. In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides or polyethylene glycol-400 (the compounds are soluble in PEG-400). Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, including, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran,optionally, the suspension may also contain stabilizers. For administration as an inhalation spray, it is possible to use sprays in which the active ingredient is either dissolved or suspended in a propellant gas or propellant gas mixture (for example CO ₂ or chlorofluorocarbons). The active ingredient is advantageously used here in micronized form, in which case one or more additional physiologically acceptable solvents may be present, for example ethanol. Inhalation solutions can be administered with the aid of conventional inhalers. Possible pharmaceutical preparations, which can be used rectally include, for example, suppositories, which consist of a combination of one or more of the active compounds with a suppository base. Suitable suppository bases are, for example, natural or synthetic triglycerides, or paraffin hydrocarbons. In addition, it is also possible to use gelatine rectal capsules, which consist of a combination of the active compounds with a base. Possible base materials include, for example, liquid triglycerides, polyethylene glycols, or paraffin hydrocarbons. For use in medicine, the compounds of the present invention may be in the form of pharmaceutically acceptable salts. Other salts may, however, be useful in the preparation of the compounds of the invention or of their pharmaceutically acceptable salts. Suitable pharmaceutically acceptable salts of the compounds of this invention are those described hereinbefore and include acid addition salts which may, for example be formed by mixing a solution of the compound according to the invention with a solution of a pharmaceutically acceptable acid such as hydrochloric acid, sulfuric acid, methanesulfonic acid, fumaric acid, maleic acid, succinic acid, acetic acid, benzoic acid, oxalic acid, citric acid, tartaric acid, carbonic acid or phosphoric acid. Furthermore, where the compounds of the invention carry an acidic moiety, suitable pharmaceutically acceptable salts thereof may include alkali metal salts, e.g., sodium or potassium salts; alkaline earth metal salts, e.g. calcium or magnesium salts; and salts formed with suitable organic bases, e.g., quaternary ammonium salts. Pharmaceutical preparations can be employed as medicaments in human and veterinary medicine. As used herein, the term "effective amount" means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal or human that is being sought, for instance, by a researcher or clinician. Furthermore, the term "therapeutically effective amount" means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder. The term also includes within its scope amounts effective to enhance normal physiological function. Said therapeutic effective amount of one or more of the compounds of the invention is known to the skilled artisan or can be easily determined by standard methods known in the art. The compounds of the present invention and the optional additional active substances are generally administered analogously to commercial preparations. Usually, suitable doses that are therapeutically effective lie in the range between 0.0005 mg and 1000 mg, preferably between 0.005 mg and 500 mg and especially between 0.5 mg and 100 mg per dose unit. The daily dose is preferably between about 0.001 mg/kg and 10 mg/kg of body weight. Those of skill will readily appreciate that dose levels can vary as a function of the specific compound, the severity of the symptoms and the susceptibility of the subject to side effects. Some of the specific compounds are more potent than others. Preferred dosages for a given compound are readily determinable by those of skill in the art by a variety of means. A preferred means is to measure the physiological potency of a given compound. The specific dose for the individual patient, in particular for the individual human patient, depends, however, on the multitude of factors, for example on the efficacy of the specific compounds employed, on the age, body weight, general state of health, the sex, the kind of diet, on the time and route of administration, on the excretion rate, the kind of administration and the dosage form to be administered, the pharmaceutical combination and severity of the particular disorder to which the therapy relates. The specific therapeutic effective dose for the individual patient can readily be determined by routine experimentation, for example by the doctor or physician, which advises or attends the therapeutic treatment. The compounds of the present invention can be prepared according to the procedures of the following Schemes and Examples, using appropriate materials, and as further exemplified by the following specific examples. They may also be prepared by known methods, as described in the literature (for example in standard works, such as Houben-Weyl, Methoden der Organischen Chemie [Methods of Organic Chemistry], Georg Thieme Verlag, Stuttgart; Organic Reactions, John Wiley & Sons, Inc., New York). Use can also be made of synthetic variants which are known per se but are not mentioned here in greater detail. Likewise, the starting materials for the preparation of compounds of the present invention can be prepared by methods as described in the examples or by methods known per se, as described in the literature of synthetic organic chemistry and known to the skilled person or can be obtained commercially. The starting materials for the processes claimed and/or utilized may, if desired, also be formed in situ by not isolating them from the reaction mixture, but instead immediately converting them further into the compounds of the invention or intermediate compounds. On the other hand, in general it is possible to carry out the reaction stepwise. Preferably, the reaction of the compounds is carried out in the presence of a suitable solvent, which is preferably inert under the respective reaction conditions. Examples of suitable solvents comprise but are not limited to hydrocarbons, such as hexane, petroleum ether, benzene, toluene or xylene; chlorinated hydrocarbons, such as trichlorethylene, 1,2- dichloroethane, tetrachloromethane, chloroform or dichloromethane; alcohols, such as methanol, ethanol, isopropanol, n-propanol, n-butanol or tert-butanol; ethers, such as diethyl ether, diisopropyl ether, tetrahydrofuran (THF) or dioxane; glycol ethers, such as ethylene glycol monomethyl or monoethyl ether or ethylene glycol dimethyl ether (diglyme); ketones, such as acetone or butanone; amides, such as acetamide, dimethylacetamide, dimethylformamide (DMF) or N-methyl pyrrolidinone (NMP); nitriles, such as acetonitrile; sulfoxides, such as dimethyl sulfoxide (DMSO); nitro compounds, such as nitromethane or nitrobenzene; esters, such as ethyl acetate, or mixtures of the said solvents or mixtures with water. The reaction temperature is between about -100 °C and 300 °C, depending on the reaction step and the conditions used. Reaction times are generally in the range between a fraction of a minute and several days, depending on the reactivity of the respective compounds and the respective reaction conditions. Suitable reaction times are readily determinable by methods known in the art, for example reaction monitoring. Based on the reaction temperatures given above, suitable reaction times generally lie in the range between 10 minutes and 48 hours. Moreover, by utilizing the procedures described herein, in conjunction with ordinary skills in the art, additional compounds of the present invention claimed herein can be readily prepared. The compounds illustrated in the examples are not, however, to be construed as forming the only genus that is considered as the invention. The examples further illustrate details for the preparation of the compounds of the present invention. Those skilled in the art will readily understand that known variations of the conditions and processes of the following preparative procedures can be used to prepare these compounds. As will be understood by the person skilled in the art of organic synthesis, compounds of the present invention, in particular compounds of formula (I), are readily accessible by various synthetic routes, some of which are exemplified in the accompanying Experimental Part. The skilled artisan will easily recognize which kind of reagents and reactions conditions are to be used and how they are to be applied and adapted in any particular instance – wherever necessary or useful – in order to obtain the compounds of the present invention. Furthermore, some of the compounds of the present invention can readily be synthesized by reacting other compounds of the present invention under suitable conditions, for instance, by converting one particular functional group being present in a compound of the present invention, or a suitable precursor molecule thereof, into another one by applying standard synthetic methods, like reduction, oxidation, addition or substitution reactions; those methods are well known to the skilled person. Likewise, the skilled artisan will apply – whenever necessary or useful – synthetic protecting (or protective) groups; suitable protecting groups as well as methods for introducing and removing them are well-known to the person skilled in the art of chemical synthesis and are described, in more detail, in, e.g., P.G.M. Wuts, T.W. Greene, “Greene’s Protective Groups in Organic Synthesis”, 4th edition (2006) (John Wiley & Sons). "Treating" or “treatment” as used herein, means an alleviation, in whole or in part, of symptoms associated with a disorder or disease, or slowing, or halting of further progression or worsening of those symptoms, or prevention or prophylaxis of the disease or disorder in a subject at risk for developing the disease or disorder. Thus, the terms "disorder(s)" and "disease(s)" as used herein are well-known and understood in the art. In the context of the present invention, they are preferably used as synonyms and thus are preferably interchangeable, if the context they are used herein does not strongly implicate otherwise. Accordingly, the terms "fibrotic disorder(s)" and "fibrotic disease(s)" as used herein are also well-known and understood in the art. In the context of the present invention, they are preferably used as synonyms and thus are preferably interchangeable, if the context they are used herein does not strongly implicate otherwise. The term "effective amount" in connection with a compound of formula (I) refers to an amount (of a compound, drug, pharmaceutical compositions, etc.) capable of alleviating, in whole or in part, symptoms associated with a disorder or disease, or slowing or halting further progression or worsening of those symptoms, or preventing or providing prophylaxis for the disease or disorder in a subject having or at risk for developing a disease disclosed herein, such as inflammatory conditions, immunological conditions, cancer or metabolic conditions. It is to be noted that – except for instances where it is specifically stated or the context provides for a different meaning – in general the number of a term, i.e., its singular and plural form, is used and can be read interchangeably. For example, the term “compound” in its singular form may also comprise or refer to a plurality of compounds, while the term “compounds” in its plural form may also comprise or refer to a singular compound. Especially preferred according to the invention are subjects as described herein, wherein the characteristics of two or more preferred, more preferred and/or especially preferred embodiments, aspects and/or subjects are combined into one embodiment, aspect and/or subject. Preferably, according to this invention, preferred subjects or embodiments can be combined with other preferred subjects or embodiments; more preferred subjects or embodiments can be combined with other less preferred or even more preferred subjects or embodiments; especially preferred subjects or embodiments can be combined with other just preferred or just even more preferred subjects or embodiments, and the like. The term "about" as used herein with respect to numbers, figures, ranges and/or amounts is preferably meant to mean "circa" and/or "approximately". The meaning of those terms is well known in the art and preferably includes a variance, deviation and/or variability of the respective number, figure, range and/or amount of plus/minus 15% and especially of plus/minus 10%. More preferably, the term "about" with respect to numbers, amounts, dosings, hours, times, timings, durations, and the like, is preferably understood to mean "approximately" with respect to said numbers, amounts, dosings, hours, times, timings, durations, and the like. More preferably, “about” means +/- 10%, more preferably +/- 5% of the given specific value with respect to numbers, amounts, dosing, hours, times, timings, durations, and the like. Even more preferably, the term "about" includes a variance, deviation and/or variability of the respective number, figure, range and/or amount of at least plus/minus 5%, and especially a variance, deviation and/or variability of the respective number, figure, range and/or amount of plus/minus 5%. If not specified otherwise, amounts administered to a subject, human subject or patient given in "mg", such as in 500 mg, 1000 mg, or the like, are preferably intended to mean the respective amounts to be administered "flat", i.e. as a fixed dose that is not adjusted to the body weight and/or body surface of the respective subject, human subject or patient. If not explicitly indicated otherwise, the term "one or more" as used herein, e.g. with respect to the number of compounds, agents, cancer co-therapeutic agents, cancer chemotherapeutic agents and the like, preferably means "one or more than one" and thus preferably includes "two or more" (or "two or more than two"), "three or more" (or "three or more than three") and/or "four more" (or "more or more than four"). Accordingly, the term "one or more" as used herein preferably includes the numbers one, two, three, four, five, six and/or higher numbers. With respect to the number of agents, cancer co-therapeutic agents, cancer chemotherapeutic agents, it especially preferably includes the numbers one, two, three, four and/or five, even more preferably the numbers one, two, three and/or four and especially the numbers one, two and/or three. In the context of the present invention, subjects and especially human subjects are preferably also referred to as patients. The terms "disorder(s)" and "disease(s)" as used herein are well-known and understood in the art. In the context of the present invention, they are preferably used as synonyms and thus are preferably interchangeable, if the context they are used herein does not strongly implicate otherweise. In the medical context, including, but not limited to treatment regimens, dosing schedules and clinical trial designs, for convenience and/or ease of use by patients, medical staff and/or physicians, as well as reliability and/or reproducibility of results etc., the terms “week”/“a week”, “month”/“a month” and/or “year”/“a year” can used with slight deviations from the definitions of the Gregorian calendar. For example, in said medical context, a month is often referred to as 28 days, and a year is often referred to 48 weeks. Thus, in the context of the instant invention, the term “week” or “a week” preferably refers to a period of time of about 5, about 6 or about 7 days, more preferably about 7 days. In the medical context, the term “month” or “a month” preferably refers to a period of time of about 28, about 29, about 30 or about 31 days, more preferably about 28, about 30 or about 31 days. In the medical context, the term “year” or “a year” preferably refers to a period of time of about 12 months or to a period of time of about 48, about 50, or about 52 weeks, more preferably12 months, or about 48 or about 52 weeks. The invention is explained in greater detail below by means of examples. The invention preferably can be carried out throughout the range claimed and is not restricted to the examples given here. Moreover, the following examples are given in order to assist the skilled artisan to better understand the present invention by way of exemplification. The examples are not intended to limit the scope of protection conferred by the claims. The features, properties and advantages exemplified for the processes, compounds, compositions and/or uses defined in the examples may be assigned to other processes, compounds, compositions and/or uses not specifically described and/or defined in the examples, but falling under the scope of what is defined in the claims. Thus, the following examples describe the invention in more detail but do not limit the invention and its scope as claimed. Experimental Part The compounds of the present invention can be prepared according to the procedures of the following Schemes and Examples, using appropriate materials and are further exemplified by the following specific examples. The compounds are shown in Table 1. Analytical data of compounds made according to the following examples are preferably also shown in Table 1. Cellular data of selected compounds are shown in Table 2. The invention will be illustrated, but not limited, by reference to the specific embodiments described in the following examples. Unless otherwise indicated in the schemes, the variables have the same meaning as described above and in the claims. Unless otherwise specified, all starting materials are obtained from commercial suppliers and used without further purifications. Unless otherwise specified, all temperatures are expressed in °C and all reactions are conducted at RT (room temperature). Compounds are purified by either silica chromatography or preparative HPLC. ¹ H NMR: ¹ H-NMR data is provided in Table 1 below. ¹ H NMR spectra were usually acquired on a 700 MHz Bruker Avance III HD, 600 MHz Bruker Avance III HD Bruker Avance DRX 500, Bruker Avance 400 or a Bruker DPX 300 NMR spectrometer at a constant temperature of 25 °C, under standard conditions using TMS (tetramethylsilan) as internal reference and DMSO-d ₆ as standard solvents, if not reported otherwise. Alternatively ¹ H-NMR spectra were recorded at a constant temperature of 25 °C on a Varian INOVA 500 spectrometer operating at 499.7 MHz and equipped with a 5 mm ¹ H{ ¹³ C- ¹⁵ N} triple resonance Indirect Detection probe or alternatively at a constant temperature of 28 °C on a Varian INOVA 400 spectrometer operating at 400.5 MHz and equipped with a 5 mm ¹ H{ ¹⁵ N- ³¹ P} z-axis PFG Indirect Detection probe. Chemical shifts (δ) are reported in ppm relative to the residual solvent signal (δ= 2.5 ppm for ¹ H NMR in DMSO-d ₆ , δ= 7.27 ppm for ¹ H NMR in CDCl3, δ= 3.31 ppm for Methanol-d4). ¹ H NMR data are reported as follows: chemical shift (multiplicity, coupling constants and number of hydrogens). Multiplicity is abbreviated as follows: s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), dd (doublet of doublets), tt (triplet of triplets), td (triplet of doublets) br (broad) and coupling constants (J) are reported in Hz. HPLC-MS: HPLC-MS data provided in Table 1 are given with mass in m/z. The results can be obtained by one of the methods described below. HPLC-MS analyses were usually performed on a Shimadzu LCMS-2020, Shimadzu SP-M20A 2010EV or Shimadzu UFLC-MS 2010EV system utilizing one of the following columns: Shim-pack VP-ODS, Shim-pack XR-ODS, Kinetex XB- C18100A, Xbridge BEH C18, Gemini-NX 3u C18110A or ACE UltraCore 2.5 SuperC18. Standard conditions applied: Standard solvent gradients using A: Water + 0.1 vol.% formic acid, B: acetonitrile + 0.1 vol.% formic acid; or A: Water + 0.05 vol.% trifluoroacetic acid, B: acetonitrile + 0.05 vol.% trifluoroacetic acid Detection wavelength: 220 nm, MS-Typ: API-ES Methods: LC-MS: Method A: Agilent 1200 series LC-MS; Kinetex EVO C185.0 µm 50-4.6 mm; flow: 3.3 mL/min; 220 nm; T: 40 °C; buffer A: water + 0.05% formic acid; buffer B: acetonitrile + 0.04% formic acid; 1% - 99% B: 0 - 0.8 min | 99% B: 0.8 - 1.1 min Method B: Agilent 1200 series LC-MS; Chromolith HR- RP 18e 50-4.6 mm; flow: 3.3 mL/min, 220 nm, buffer A: water + 0.05% formic acid; buffer B: acetonitrile + 0.04% formic acid; 0%- 100% buffer B: 0 -2.0min; 100% buffer B: 2.0 - 2.5 min. Method C: Agilent 1200 series LC-MS; Kinetex EVO C185.0 µm 50-4.6 mm; flow: 3.3 mL/min; 220 nm; T: 40 °C; buffer A: water + 0.05% formic acid; buffer B: acetonitrile + 0.04% formic acid; 1% - 100% B: 0 - 1.8 min | 100% B: 1.8 - 2.1 min. Method D: Titank C18, 1.7 µm 30-2.1 mm; flow: 0.8 mL/min; 254 nm; T: 40 °C; buffer A: water + 0.04% NH ₄ OH; T: 40 °C; buffer B: ACN; Gradient: 10% B - 95% B in 2.1 min, hold 0.6 min. Method E: Kinetex 1.7 µm C18100A 30-2.1 mm; flow: 1.0 mL/min; 254 nm; T: 40 °C; buffer A: water + 0.05% TFA; buffer B: ACN + 0.05% TFA; gradient: 5% - 100% B in 1.2min, hold 0.6 min. Method F: HALO 2 µm 2.1-30 mm; flow: 1.5 mL/min; 254 nm; T: 45 °C; buffer A: water + 0.05% TFA; buffer B: ACN + 0.05% TFA; Gradient 5% B - 100% B in 1.2min, hold 0.4 min. Method G: HALO C182 µm 3.0-30 mm; flow: 1.5 mL/min; 254 nm; T: 40 °C; buffer A: water + 0.1% TFA; buffer B: Acetonitrile + 0.1% TFA; Gradient: 5% B - 100% B in 2.0 min. Method H: HALO 2 µm 3.0-30 mm; T: 40 °C; buffer A: water + 0.05% TFA; buffer B: ACN + 0.05% TFA; Gradient: 5% B - 100% B in 1.2 min, hold 0.5 min; 254 nm Method I: HALO C182.0 µm 3.0-30 mm; flow: 1.5 mL/min; 254 nm; T: 40 °C; buffer A: water + 0.1% FA; buffer B: ACN + 0.1% FA; flow: 1.5 mL/min; Gradient:5% B - 100% B in 1.2 min, hold 0.6 min. Method J: Exsil Mono 100 C181.7 µm 2.0-30 mm; flow: 0.8 mL/min; 254 nm; T: 45 °C; buffer A: water + 0.1% FA; buffer B: ACN + 0.1% FA; Gradient: 5% B - 100% B in 1.2 min, hold 0.6 min. Method K: Kinetex EVO C182.6 µm 3.0-50 mm; flow: 1.2 mL/min; 254 nm; T: 40 °C; buffer A: water (5mM NH ₄ HCO ₃ ); buffer B: ACN; Gradient: 10% B - 95% B in 2.1 min, hold 0.6 min. Method L: Agilent 70294979 - Chromolith Speed ROD RP-18e 50-4.6 mm; flow: 3.3 mL/min; 220 nm; T: 40 °C; buffer A: H ₂ O + 0.05% HCOOH; buffer B: MeCN + 0.04% HCOOH + 1% H ₂ O; 0% - 100% B: 0 – 2.0 min, 100% buffer B: 2.0 – 2.5 min Method M: Column: XBridge C8, 3.5 µm, 4.6 x 50 mm; Flow: 2 mL/min; Solvent A: water + 0.1% TFA; Solvent B: ACN + 0.1% TFA; Gradient: 0 min: 5% B, 8 min: 100% B, 8.1 min: 100% B, 8.5 min: 5% B, 10 min 5% B. Method N: Poroshell HPH C18; Solvent A: water + 10 mM NH ₄ HCO ₃ ; Solvent B: ACN; Flow: 1 mL/min; Gradient: 0 min: 5% B, 8 min: 100% B, 8.1 min: 100% B, 8.5 min: 5% B, 10 min 5% B. Method O: Shim-pack velox; Mobile phase A: Water/0.1% FA; Mobile phase B: Acetonitrile/0.1% FA UPLC-MS: Method A: Waters Acquity UPLC-MS; Kinetex EVO-C181.7 µm 50-2.1 mm; flow 0.9 mL/min; 220 nm; buffer A: water + 0.05% formic acid; buffer B: acetonitrile + 0.04% formic acid; T: 40 °C; 1-100% B: 0 - 1.0 min; 100% B: 1.0 -1.3 min HPLC-MS: Method A: Waters Alliance HT 2795 equipped with Waters 996 photodiode array detector and Waters micromass ZQ. Solid phase: YMC-TriaRt:C184.6 x 50 mm 3 µm. Mobile phase: solvent B water CH ₃ COONH ₄ 5 mM pH 5.2: ACN 95:5; solvent C ACN: water 95:5; 10 to 90% of C in 5 min; flow 1.2 mL/min Method B: Waters Alliance HT 2795 equipped with Waters 996 photodiode array detector and Waters micromass ZQ. Solid phase: YMC-TriaRt:C184.6 x 50 mm 3 µm. Mobile phase: solvent D 0.05%NH ₃ /ACN 95:5; solvent C ACN: water 95:5; 10 to 90% of C in 5 min; flow 1.2 mL/min Method C: Waters Acquity Arc equipped with QDa detector and 2998 PDA detector. Solid phase: Phenomenex Gemini C18 4.6 x 50 mm 3 µm. Mobile phase: solvent B water CH ₃ COONH ₄ 5 mM pH 5.2: ACN 95:5; solvent C ACN: water 95:5; 10 to 90% of C in 5 min; flow 1.2 mL/min Method D: Waters Acquity Arc equipped with QDa detector 2424 ELS detector and 2998 PDA detector. Solid phase: Phenomenex Gemini C184.6 x 50 mm 3 µm. Mobile phase: solvent B water CH3COONH ₄ 5 mM pH 5.2: ACN 95:5; solvent C ACN: water 95:5; 50 to 100% of C in 5 min; flow 1.2 mL/min Method E: Waters Acquity Arc equipped with QDa detector 2424 ELS detector and 2998 PDA detector. Solid phase: Phenomenex Gemini NX C184.6 x 50 mm 3 µm. Mobile phase: solvent B water CH ₃ COONH ₄ 5 mM pH 5.2: ACN 95:5; solvent C ACN: water 95:5; 10 to 90% of C in 5 min; flow 1.2 mL/min Method F: Waters Alliance LC 2795 equipped with a Waters PDA UV detector 2996 and a TOF Waters LCT Premier XE mass detector (ESI interface). Solid phase: Waters x Select 3.0 x 30 mm 3.5 µm. Mobile phase: solvent A 0.05% v/v formic acid and solvent B 70/25/5 (v/v/v) mixture of MeOH/iPrOH/H ₂ O 0.035% v/v of formic acid; column 50 °C; 0% to 12% B in 4 min, 32% B in 4 min, 60% B in 4 min then 100% B in 4 min hold 100% B 1.4 min; flow 0.8 mL/min Method G: Waters Alliance HT 2795 equipped with Waters 996 photodiode array detector and Waters micromass ZQ. Solid phase: Gemini Phenyl C64.6 x 50 mm 3 µm. Mobile phase: solvent B water CH ₃ COONH ₄ 5 mM pH 5.2: ACN 95:5; solvent C ACN: water 95:5; 10 to 90% of C in 5 min; flow 1.2 mL/min Method H: Waters Alliance HT 2795 equipped with Waters 996 photodiode array detector and Waters micromass ZQ. Solid phase: YMC-TriaRt:C184.6 x 50 mm 3 µm. Mobile phase: solvent B water CH ₃ COONH ₄ 5 mM pH 5.2: ACN 95:5; solvent C ACN: water 95:5; 50 to 100% of C in 5 min; flow 1.2 mL/min Method I: Waters Alliance HT 2795 equipped with Waters 996 photodiode array detector and Waters micromass ZQ. Solid phase: GeminiPhenyl C64.6 x 50 mm 3 µm. Mobile phase: solvent A water 0.1% HCOOH: ACN 95:5; solvent C ACN: water 95:5; 50 to 100% of C in 5 min; flow 1.2 mL/min Method L: Waters Acquity Arc equipped with QDa detector 2424 ELS detector and 2998 PDA detector. Solid phase: Waters Cortecs C184.6 x 50 mm 2.7 µm. Mobile phase: solvent A water 0.1% HCOOH: ACN 95:5; solvent C ACN: water 95:5; 10 to 90% of C in 5 min; flow 1.2 mL/min Method M: Waters Acquity Arc equipped with QDa detector 2424 ELS detector and 2998 PDA detector. Solid phase: Sepachrom Robusta Phenyl 4.6 x 50 mm 3 µm. Mobile phase: solvent B water CH ₃ COONH ₄ 5mM pH 5.2: ACN 95:5; solvent C ACN: water 95:5; 10 to 90% of C in 5 min; flow 1.2 mL/min HRMS HPLC-MS/UV analyses and High-Resolution Mass Spectra (HRMS) were performed on a Waters Alliance LC 2795 equipped with a Waters PDA UV detector 2996 and a TOF Waters LCT Premier XE mass detector (ESI interface) supported by a Waters Reagent Manager liquid pump. Abbreviations: AcOH (acetic acid), ACN (acetonitrile), BINAP (2,2’-bis(disphenylphosphino)-1,1’-binaphthalene), dba (dibenzylidene acetone), tBu (tert-Butyl), tBuOK (potassium tert-butoxide), CEM (CEM microwave reactor), CDI (1,1’-carbonyldiimidazole), DBU (1,8-diazabicyclo[5.4.0]undec-7-ene), DCC (dicyclohexylcarbodiimide), DCE (1,2-dichloroethane), DCM (dichloromethane), DIAD (diisobutylazodicarboxylate), DIC (diisopropylcarbodiimide), DIPEA, DIEA (N,N-di-isopropyl ethylamine), DMA (dimethyl acetamide), DMAP (4-dimethylaminopyridine), DMSO (dimethyl sulfoxide), DMF (N,N-dimethylformamide), EDC.HCl (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride), EtOAc or EA or AcOEt (ethyl acetate), EtOH (ethanol), FA (formic acid), g (gram), cHex (cyclohexane), HATU (dimethylamino-([1,2,3]triazolo[4,5-b]pyridin-3-yloxy)-methy lene]-dimethyl-ammonium hexafluorophosphate), HOBt (N-hydroxybenzotriazole), HPLC (high performance liquid chromatography), h (hour(s)), m-CPBA (meta-Chloroperoxybenzoic acid) MHz (Megahertz), MeOH (methanol), min (minute), mL (milliliter), mmol (millimole), mM (millimolar), mp (melting point), MS (mass spectrometry), MW (microwave), NMM (N-methyl morpholine), NMP (N-Methyl-2-pyrrolidone), NMR (Nuclear Magnetic Resonance), NBS (N-bromo succinimide), PBS (phosphate buffered saline), PE (petroleum ether), PMB (para-methoxybenzyl), PyBOP (benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluoro phosphate), RT or rt (room temperature), Rt (retention time), SEM-Cl (2-Chloromethoxyethyl)trimethylsilane), TBAF (tetra-butylammonium fluoride), TBTU (N,N,N′,N′-tetramethyl-O-(benzotriazol-1-yl)uronium tetrafluoroborate), T3P (propane phosphonic acid anhydride), TCFH (tetramethylchloroformamidinium hexafluorophosphate), TEA (triethyl amine), TFA (trifluoroacetic acid), THF (tetrahydrofuran), PE or PetEther (petroleum ether), TBME or MTBE (tert-butyl methyl ether), TLC (thin layer chromatography), TMS (trimethylsilyl), TMSI (trimethylsilyl iodide), UV (ultraviolet), Xantphos (4,5-bis(diphenylphosphino)-9,9-dimethylxanthene), X-Phos ([2-Dicyclohexylphosphino-2′,4′,6′-triisopropylbipheny l]) Intermediates and examples: The invention will be illustrated, but not limited, by reference to the specific embodiments described in the following examples. Unless otherwise indicated in the schemes, the variables have the same meaning as described above. Unless otherwise specified, all starting materials are obtained from commercial suppliers and used without further purification. Unless otherwise specified, all temperatures are expressed in °C and all reactions are conducted at rt. Compounds can be purified by common means such as in particular silica gel chromatography or preparative HPLC. Ester intermediate 1: methyl 2-[(1-{2-[(4-methylbenzenesulfonyl)oxy]ethyl}-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzoate Step 1: methyl 2-{[1-(2-hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5- nitrobenzoate In a microwave vial under argon atmosphere, methyl 2-iodo-5-nitrobenzoate (0.2 g, 0.65 mmol, 1 eq.), 2-(5-sulfanyl-1H-1,2,3,4-tetrazol-1-yl)ethan-1-ol (0.107 g, 0.72 mmol, 1.1 eq.), Pd ₂ (dba) ₃ (0.03 g, 0.03 mmol, 0.05 eq.), xantphos (0.039 g, 0.07 mmol, 0.1 eq.), DIPEA (0.258 g, 1.95 mmol, 3 eq.) and dry 1,4-dioxane (7 mL) degassed were added. The mixture was heated (microwave irradiation) at 110 °C for 1 h. HPLC-MS analysis showed the presence of the expected product. After cooling the mixture to room temperature, it was diluted with AcOEt, washed with H ₂ O three times and once with brine. The organic layer was dried on Na ₂ SO ₄ and evaporated. The product (beige solid) was precipitated with DCM (0.139 mg, 0.43 mmol, 66% yield, 100% purity). HPLC-MS Method C: (M+H) 326.1; Rt: 3.49 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.77 (q, J=5.44 Hz, 2 H) 3.99 (s, 3 H) 4.51 (t, J=5.19 Hz, 2 H) 5.07 (t, J=5.57 Hz, 1 H) 6.97 (d, J=9.00 Hz, 1 H) 8.27 (dd, J=8.92, 2.67 Hz, 1 H) 8.71 (d, J=2.74 Hz, 1 H) Step 2: methyl 2-[(1-{2-[(4-methylbenzenesulfonyl)oxy]ethyl}-1H-1,2,3,4-tet razol-5- yl)sulfanyl]-5-nitrobenzoate To a solution of methyl 2-{[1-(2-hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5- nitrobenzoate (0.139 g, 0.43 mmol, 1 eq.) in DCM (5.2 mL), 4-(dimethylamino)pyridine (0.026 g, 0.21 mmol, 0.5 eq.), TEA (0.048 g, 0.47 mmol, 1.1 eq.) and p-toluenesulfonyl chloride (0.082 g, 0.42 mmol, 1 eq.) were added at 0 °C. The mixture was stirred at room temperature for 30 min. HPLC-MS analysis shown the presence of the target compound. The mixture was diluted with DCM, washed with NH ₄ Cl aqueous saturated solution three times and once with brine. The organic layer was dried on Na ₂ SO ₄ and evaporated. The crude was purified by chromatographic column hexane/AcOEt (8/2 to 1/1) to afford the title compound as white solid foam (0.145 g, 0.30 mmol, 71% yield, 100% purity). HPLC-MS Method C: (M+H) 480.0; Rt: 5.20 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.40 (s, 3 H) 4.00 (s, 3 H) 4.44 (t, J=4.88 Hz, 2 H) 4.75 (t, J=4.88 Hz, 2 H) 6.86 (d, J=9.00 Hz, 1 H) 7.41 (d, J=8.08 Hz, 2 H) 7.61 (d, J=8.39 Hz, 2 H) 8.23 (dd, J=9.00, 2.75 Hz, 1 H) 8.70 (d, J=2.75 Hz, 1 H) Acid intermediate 1: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid Methyl 2-fluoro-5-nitrobenzoate (4.0 g; 19.1 mmol; 1.0 eq.) and 5-mercapto-1-methyltetrazole (3.4 g; 28.6 mmol; 1.5 eq.) were suspended in triethylamine (8 mL; 57.4 mmol; 3.0 eq.). The reaction mixture was stirred overnight at 110 °C and evaporated. The remaining dark residue was diluted with aqueous 5% NaHCO ₃ solution and extracted three times with EtOAc. The combined aqueous phases were acidified with 25% HCl to pH ~2 and extracted three times with EtOAc. The combined organic phases were dried over Na ₂ SO ₄ , filtered and evaporated. The solid residue was triturated with diethyl ether, filtered off and dried in air to give 2-[(1- methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (3.1 g; 10.8 mmol; 56% yield; 99% purity) as a beige solid. LC-MS method C: (M+H) 282.1; Rt: 1.26 min Acid intermediate 2: 2-[(1-cyclopropyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro benzoic acid To a stirred solution of 2-fluoro-5-nitrobenzoic acid (1.94 mg; 10.0 mmol; 1.5 eq.) and 1- cyclopropyl-1,2,3,4-tetrazole-5-thiol (1.00 g; 6.68 mmol; 1.0 eq.) in 20 mL THF was added Et ₃ N (2.1 mL; 14.5 mmol; 2.2 eq.) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 48 h at 70 °C under nitrogen atmosphere. The resulting mixture was diluted with water and extracted with DCM (4 x 100 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to obtain 2-[(1-cyclopropyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitroben zoic acid (150 mg; 0.40 mmol; 6% yield; 82% purity) as a light-yellow solid. LC-MS method I: (M+H) 308.0; Rt: 0.54 min Acid intermediate 3: 3-methyl-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzoic acid To a mixture of 2-fluoro-3-methyl-5-nitrobenzoic acid (500 mg; 2.39 mmol; 1.0 eq.) and 5- mercapto-1-methyterazole (1167 mg; 9.54 mmol; 4.0 eq.) in 10 mL THF was added Et ₃ N (1.0 mL; 7.16 mmol; 3.0 eq.). The resulting mixture was stirred overnight at 70 °C under nitrogen atmosphere, concentrated under reduced pressure and directly purified by silica gel column chromatography, eluted with DCM/MeOH (10/1). The crude product was additionally purified by reverse column chromatography (C18; water + 0.05% TFA/28 - 58% ACN) to get 3-methyl- 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (40 mg; 0.13 mmol; 5.6% yield; 99% purity) as a light-yellow solid. LC-MS method J: (M+H) 296.0; Rt: 0.72 min Acid intermediate 4: 5-nitro-2-(thiophen-2-ylsulfanyl)benzoic acid Using the same procedure as in acid intermediate 2, 5-nitro-2-(thiophen-2-ylsulfanyl)benzoic acid was obtained as a yellow solid (700 mg; 2.25 mmol; 88% yield; 88% purity). LC-MS method G: (M+H) 281.9; Rt: 0.65 min Acid intermediate 5: 5-nitro-2-(1,3,4-thiadiazol-2-ylsulfanyl)benzoic acid Using the same procedure as in acid intermediate 2, 5-nitro-2-(1,3,4-thiadiazol-2- ylsulfanyl)benzoic acid was obtained as a yellow solid (280 mg; 0.90 mmol; 35% yield; 91% purity). LC-MS method G: (M+H) 284.0; Rt: 0.86 min Acid intermediate 6: 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzoic acid 2-Iodo-5-nitro-benzoic acid (1.14 g, 3.69 mmol, 1.0 eq.) and 3-mercapto-4-methyl-1,2,4-triazol (0.88 g, 7.39 mmol, 2.0 eq.) were dissolved in dried 1,4-dioxane (28.5 mL). Then Pd ₂ (dba) ₃ (69.8 mg, 0.074 mmol, 0.02 eq.), xantphos (110 mg, 0.19 mmol, 0.05 eq.) and Cs ₂ CO ₃ (2.41 g, 7.39 mmol, 2.0 eq.) were added while the solution was bubbled with nitrogen. The resulting mixture was stirred for 20 h at 100 °C. The reaction mixture was diluted with water and acidified with 2 M HCl to pH ~2. A precipitate was formed, which was collected by vacuum filtration. The filter cake was dried at 50 °C under vacuo. The residue was suspended in DMSO and purified by prep HPLC (Sunfire RP18; water + 0.1% HCOOH/acetonitrile + 0.1% HCOOH; gradient: 10-40 or 100% acetonitrile + 0.1% HCOOH) to afford 2-[(4-methyl-4H-1,2,4-triazol-3- yl)sulfanyl]-5-nitrobenzoic acid as an orange-red solid (795 mg, 2.74 mmol, 74% yield, 96.5% purity).. LC-MS method L: (M+H) 280.8; Rt: 1.02 min Acid intermediate 7: 2-({1-[2-(dimethylamino)ethyl]-1H-1,2,3,4-tetrazol-5-yl}sulf anyl)-5- nitrobenzoic acid In a microwave vial under argon atmosphere, 2-iodo-5-nitrobenzoic acid (0.150 g.0.49 mmol, 1eq.), 1-[2-(dimethylamino)ethyl]-1H-1,2,3,4-tetrazole-5-thiol (0.095 g, 0.53 mmol, 1.1 eq.), Pd ₂ (dba) ₃ (0.023 g, 0.02 mmol, 0.05 eq.), xantphos (0.029 g, 0.05 mmol, 0.1 eq.), DIPEA (0.192 g, 1.46 mmol, 3 eq.) and dry 1,4-dioxane degassed (5 mL) were added. The mixture was heated (microwave) at 110 °C for 1 h. HPLC-MS analysis showed the presence of target product. After cooling to room temperature, the mixture was diluted with AcOEt, washed with H ₂ O three times and once with brine. The product was in water meanwhile impurities were in the organic layer. Water was extracted with DCM/MeOH 95/5 five times, dried on Na ₂ SO ₄ and evaporated. The product was used in the next step without further purification (pale yellow- orange solid, 0.075 g, 0.22 mmol, 46% yield, 100% purity). HPLC-MS Method C: (M+H) 339.10; Rt: 1.27 min Acid intermediate 8: 2-{[1-(2-formamidoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}- 5- nitrobenzoic acid

Step 1: methyl 2-{[1-(2-formamidoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}- 5- nitrobenzoate To a stirred solution of methyl 2-[(1-{2-[(4-methylbenzenesulfonyl)oxy]ethyl}-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzoate (0.063 g, 0.13 mmol, 1 eq.) in ACN (1.3 mL), was added sodium diformylamide (0.015 g, 0.16 mmol, 1.2 eq.). The resulting mixture was stirred for 30 min at 50 °C, the HPLC-MS analysis showed the presence of some starting material left. Hence the reaction was heated for 1 h at 82 °C. After cooling the mixture to room temperature, solvent was removed under reduced pressure. The compound was purified by chromatographic column hexane/AcOEt (8/2 to AcOEt 100%) (white solid, 0.021 g, 0.06 mmol, 45% yield, 100% purity). HPLC-MS Method C: (M+H) 353.1; Rt: 3.28 min Step 2: 2-{[1-(2-formamidoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}- 5-nitrobenzoic acid In a reactor methyl 2-{[1-(2-formamidoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}- 5-nitrobenzoate (0.02 g, 0.06 mmol, 1 eq.), LiOH ^. H ₂ O (0.003 g, 0.07 mmol, 1.2 eq.), THF (1 mL) and water (0.08 mL) were added. The reaction mixture was stirred at room temperature for 1 h and 40 min. HPLC-MS analysis showed the presence of the desired product. The reaction mixture was evaporated without heating the bath, the residue was suspended in water and 0.1N aqueous HCl was added until pH = 2 resulting in the formation of a white precipitate. The solid was filtrated and the water was extracted five times with DCM, organic layer was washed with brine, dried on Na ₂ SO ₄ and evaporated. The two lots were put together, and the product was used in the next step without further purification (white solid, 0.02 g, 0.05 mmol, 93% yield, 89% purity). HPLC-MS Method C: (M+H) 339.1; Rt: 1.49 min Acid intermediate 9: 2-[(1-ethenyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenz oic acid

Step 1: methyl 2-[(1-ethenyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenz oate To a stirred solution of methyl 2-[(1-{2-[(4-methylbenzenesulfonyl)oxy]ethyl}-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzoate (0.063 g, 0.13 mmol, 1 eq.) in ACN (1.3 mL), was added sodium diformylamide (0.015 g, 0.16 mmol, 1.2 eq.). The resulting mixture was stirred for 30 min at 50 °C, then for 1 h at 82 °C. After cooling the mixture to room temperature, the solvent was removed under reduced pressure. The compound was purified by chromatographic column hexane/AcOEt (8/2 to AcOEt 100%) (white solid, 0.015 g, 0.05 mmol, 36% yield, 98% purity). HPLC-MS Method C: (M+H) 308.1; Rt: 4.56 min Step 2: 2-[(1-ethenyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenz oic acid In a reactor methyl 2-[(1-ethenyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenz oate (0.027 g, 0.09 mmol, 1 eq.), LiOH ^. H ₂ O (0.004 g, 0.1 mmol, 1.2 eq.), THF (1.3 mL) and water (0.1 mL) were added. The reaction mixture was stirred at room temperature for 1 h and 40 min. HPLC- MS analysis showed the formation of the desired product. The reaction mixture was evaporated without heating the bath, the residue was suspended in water and 0.1N aqueous HCl was added until pH = 2, resulting in the formation of a white precipitate. The solid was filtrated and the product was used in the next step without further purification (white solid, 0.02 g, 0.06 mmol, 74% yield, 94% purity). HPLC-MS Method C: (M+H) 294.0; Rt: 2.51 min Acid intermediate 10: 2-(1-ethyltetrazol-5-yl)sulfanyl-5-nitro-benzoic acid Step 1: (1-ethyltetrazol-5-yl)sulfanylpotassium To a stirred solution of KOH (0.045 g, 0.79 mmol, 1.01 eq.) in MeOH (2 mL), was added 1- ethyltetrazole-5-thiol (0.100 g, 0.77 mmol, 1 eq.). The resulting mixture was stirred for 1 h at room temperature. Solvent was removed under reduced pressure and the compound was used in the next step without further purification (white solid, 0.129 g, 0.77 mmol, quantitative yield, 100% purity). HRMS (ESI) calcd for C ₃ H ₆ N ₄ S [M + H] ⁺ 131.0386, found 131.0379 Step 2: 2-(1-ethyltetrazol-5-yl)sulfanyl-5-nitro-benzoic acid To a solution of (1-ethyltetrazol-5-yl)sulfanylpotassium (0.129 g, 0.77 mmol, 1.1 eq.) in NMP (2 mL), 18-crown-6 (0.203 g, 0.77 mmol, 1.1 eq.) and 2-fluoro-5-nitro-benzoic acid (0.129 g, 0.7 mmol, 1 eq.) were added. The reaction mixture was stirred at 100 °C for 8 h. HPLC-MS analysis showed the presence of the planned product. Water was added to the reaction mixture and 25% aqueous HCl was added until pH = 2 resulting in the formation of a precipitate. The solid was filtrated and the product was purified by recrystallization with MeOH (0.090 g, 0.305 mmol, 48% yield, 95% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.40 (t, J=7.32 Hz, 3 H) 4.43 (q, J=7.27 Hz, 2 H) 6.77 (d, J=9.00 Hz, 1 H) 8.24 (dd, J=8.92, 2.67 Hz, 1 H) 8.70 (d, J=2.59 Hz, 1 H) 8.94 (s, 1 H) Acid intermediate 11: 1-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-4-nitronapht halene- 2-carboxylic acid Step 1: methyl 1-hydroxy-4-nitro-naphthalene-2-carboxylate Nitric acid (0.35 mL) in glacial acetic acid (3.5 mL) was added to a stirred solution of methyl 1- hydroxynaphthalene-2-carboxylate (1 g, 4.95 mmol, 1.00 eq.) in the smallest amount of glacial acetic acid at room temperature. The reaction mixture was stirred at 40 °C until it became brown. After cooling at room temperature an excess of water was added in order to precipitate the nitro compound. The solid was filtrated and the crude was recrystallized from toluene to obtain the purified product (yellow solid, 0.7 g, 2.83 mmol, 57% yield, 65% purity). HPLC-MS Method G: (M+H) 248.2; Rt: 4.98 min Step 2: methyl 4-nitro-1-(trifluoromethanesulfonyloxy)naphthalene-2-carboxy late To a solution of methyl 1-hydroxy-4-nitro-naphthalene-2-carboxylate (0.1 g, 0.4 mmol, 1 eq.) in DCM (4 mL) at 0 °C, DIPEA (0.083 mL, 0.48 mmol, 1.19 eq.) and trifluoromethanesulfonic anhydride (0.135 g, 0.48 mmol, 1.19 eq.) were added. The reaction mixture was stirred at 0 °C for 30 min. After warming at room temperature, water was added and the product was extracted with DCM 3 times, organic layers were combined and washed with brine, dried on Na ₂ SO ₄ and evaporated. The crude was used in the next step without further purification (yellow-brown solid, 0.15 g, 0.4 mmol, 98% yield, 73% purity). HPLC-MS Method H: (M+NH ₄ ) 397.1; Rt: 3.78 min Step 3: methyl 1-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-4-nitronapht halene-2- carboxylate To a solution of methyl 4-nitro-1-(trifluoromethanesulfonyloxy)naphthalene-2-carboxy late (0.15 g, 0.4 mmol, 1 eq.) in ACN (10 mL), (1-methyltetrazol-5-yl)sulfanylpotassium (0.062 g, 0.4 mmol, 1 eq.) was added. The reaction mixture was stirred at 80 °C for 3 h. HPLC-MS analysis showed the presence of planned compound. After cooling at room temperature, water was added and the product was extracted with DCM 3 times, organic layers were combined and washed with brine, dried on Na ₂ SO ₄ and evaporated. The crude was purified by chromatographic column hexane/AcOEt (7/3) to afford the target product (0.11 g, 0.32 mmol, 81% yield, 95% purity). HPLC-MS Method A: (M+H) 346.2; Rt: 4.45 min Step 4: 1-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-4-nitronapht halene-2-carboxylic acid In a reactor methyl 1-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-4-nitronapht halene-2- carboxylate (0.11 g, 0.32 mmol, 1 eq.), KOH (0.022 g, 0.39 mmol, 1.23 eq.), MeOH (2 mL) and water (1 mL) were added. The reaction mixture was stirred at 60 °C for 4 h. HPLC-MS analysis showed the presence of the planned product. After cooling to room temperature, the reaction mixture was evaporated without heating the bath, the residue was suspended in water and 1N aqueous HCl was added until pH = 2 resulting in the formation of a precipitate. The solid was filtrated and the product was used in the next step without further purification (0.1 g, 0.3 mmol, 95% yield, 78% purity). HPLC-MS Method A: (M+H) 332.1; Rt: 2.82 min Acid intermediate 12: 5-(dimethylsulfamoyl)-2-(1-methyltetrazol-5-yl)sulfanyl-benz oic acid Step 1: methyl 5-(dimethylsulfamoyl)-2-hydroxybenzoate To a solution of methyl 5-(chlorosulfonyl)-2-hydroxybenzoate (1.5 g, 5.98 mmol, 1 eq.) in ACN (30 mL), a solution at 25% of Na ₂ CO ₃ (1.50 mL) and dimethylamine solution (40 wt.% in H ₂ O, 1.05 mL, 8.29 mmol, 1.39 eq.) were added. The reaction mixture was stirred at room temperature for 2 h. HPLC-MS analysis showed the presence of planned product. The reaction mixture was evaporated, water was added, and the product was extracted with AcOEt 3 times, organic layers were combined and washed with brine, dried on Na ₂ SO ₄ and evaporated. The crude was purified by chromatographic column using hexane/AcOEt (2/1) to afford the title compound as white solid (1.45 g, 5.59 mmol, 84% yield, 90% purity). HPLC-MS Method G: (M+H) 260.0; Rt: 3.68 min Step 2: methyl 5-(dimethylsulfamoyl)-2-(trifluoromethanesulfonyloxy)benzoat e To a solution of methyl 5-(dimethylsulfamoyl)-2-hydroxybenzoate (1.150 g, 4.44 mmol, 1 eq.) in DCM (30 mL) at 0 °C, DIPEA (1.7 mL, 9.13 mmol, 2.06 eq.) and trifluoromethanesulfonic anhydride (1.6 mL, 9.47 mmol, 2.14 eq.) were added. The reaction mixture was stirred at 0 °C for 30 min. After warming at room temperature, water was added and the product was extracted with DCM 3 times, organic layers were combined and washed with brine, dried on Na ₂ SO ₄ and evaporated. The crude was purified by chromatographic column using hexane/AcOEt (8/2) to afford the target product as solid (1.4 g, 3.58 mmol, 81% yield, 87% purity). HPLC-MS Method G: (M+H) 392.0; Rt: 4.53 min Step 3: methyl 5-(dimethylsulfamoyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl) sulfanyl] benzoate To a solution of methyl 5-(dimethylsulfamoyl)-2-(trifluoromethanesulfonyloxy)benzoat e (1.4 g, 3.58 mmol, 1 eq.) in ACN (25 mL), (1-methyltetrazol-5-yl)sulfanylpotassium (0.551 g, 3.58 mmol, 1 eq.) was added. The reaction mixture was stirred at 80 °C for 3 h. HPLC-MS analysis showed the presence of the desired product. After cooling to room temperature, water was added and the product was extracted with AcOEt 3 times, organic layers were combined and washed with brine, dried on Na ₂ SO ₄ and evaporated. The crude was used in the next step without further purification (1.2 g, 3.36 mmol, 94% yield, 66% purity). HPLC-MS Method G: (M+H) 358.0; Rt: 3.77 min Step 4: 5-(dimethylsulfamoyl)-2-(1-methyltetrazol-5-yl)sulfanyl-benz oic acid In a reactor methyl 5-(dimethylsulfamoyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]benzoate (1.2 g, 3.36 mmol, 1 eq.), KOH (0.226 g, 4.02 mmol, 1.2 eq.), MeOH (30 mL) and water (15 mL) were added. The reaction mixture was stirred at 60 °C for 4 h. HPLC- MS analysis showed the presence of the planned product. The reaction mixture was evaporated without heating bath, the residue was suspended in water and HCl 1N was added until pH = 2 resulting in the formation of a precipitate. The solid was filtrated and the product was used in the next step without further purification (0.974 g, 2.84 mmol, 85% yield, 87% purity). HPLC-MS Method G: (M+H) 344.1; Rt: 2.27 min Acid intermediate 13: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-sulfamoylb enzoic acid Step 1: methyl 5-{[(dimethylamino)methylidene]amino-sulfonyl}-2-hydroxybenz oate To a solution of methyl 2-hydroxy-5-sulfamoylbenzoate (0.500 g, 1.58 mmol, 1 eq.) in ACN (30 mL), (dimethoxymethyl)dimethylamine (0.35 mL, 2.51 mmol, 1.6 eq.) was added. The reaction mixture was stirred at room temperature for 1.5 h. HPLC-MS analysis showed the presence of target product. The reaction mixture was evaporated to dryness, water was added and the product was extracted with AcOEt 3 times, organic layers were combined and washed with brine, dried on Na ₂ SO ₄ and evaporated. The crude was used in the next step without further purification (white foam, 0.45 g, 1.57 mmol, 99% yield, 96% purity). HPLC-MS Method G: (M+H) 287.1; Rt: 3.04 min Step 2: methyl 5-{[(dimethylamino)methylidene]amino-sulfonyl}-2- (trifluoromethanesulfonyloxy)benzoate To a solution of methyl 5-{[(dimethylamino)methylidene]amino-sulfonyl}-2-hydroxybenz oate (0.45 g, 1.57 mmol, 1 eq.) in DCM (15 mL) at 0 °C, DIPEA (0.58 mL, 3.12 mmol, 2 eq.) and trifluoromethanesulfonic anhydride (0.53 mL, 3.12 mmol, 2 eq.) were added. The reaction mixture was stirred at 0 °C for 30 min. After warming at room temperature, water was added and the product was extracted with DCM 3 times, organic layer was washed with brine, dried on Na ₂ SO ₄ and evaporated. The crude was purified by chromatographic column using hexane/AcOEt (9/1 to 1/1) to afford the target product as solid (0.56 g, 1.34 mmol, 85% yield, 100% purity). HPLC-MS Method G: (M+H) 419.0; Rt: 4.11 min Step 3: methyl 5-{[(dimethylamino)methylidene]amino-sulfonyl}-2-[(1-methyl- 1H-1,2,3,4- tetrazol-5-yl)sulfanyl]benzoate To a solution of methyl 5-{[(dimethylamino)methylidene]amino-sulfonyl}-2- (trifluoromethanesulfonyloxy)benzoate (0.56 g, 1.34 mmol, 1 eq.) in ACN (30 mL), (1- methyltetrazol-5-yl)sulfanylpotassium (0.277 g, 1.78 mmol, 1.33 eq.) was added. The reaction mixture was stirred in microwave at 80 °C for 10 h. HPLC-MS analysis showed the presence of planned product. Solvent was removed under reduced pressure and the compound was purified by chromatographic column hexane/AcOEt (8/2), the solid was washed with Et ₂ O to afford the title compound as a white solid (0.27 g, 0.63 mmol, 47% yield, 90% purity). HPLC-MS Method G: (M+H) 385.0; Rt: 3.40 min Step 4: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-sulfamoylb enzoic acid In a reactor methyl 5-{[(dimethylamino)methylidene]amino-sulfonyl}-2-[(1-methyl- 1H-1,2,3,4- tetrazol-5-yl)sulfanyl]benzoate (0.27 g, 0.63 mmol, 1 eq.), KOH (0.12 g, 1.82 mmol, 2.88 eq.), MeOH (3 mL) and water (1.5 mL) were added. The reaction mixture was stirred at 60 °C for 4 h. HPLC-MS analysis showed the presence of the expected product. The reaction mixture was evaporated without heating the bath, the residue was suspended in water and 1N aqueous HCl was added until pH = 2 resulting in the formation of a precipitate. The solid was filtrated and the product was used in the next step without further purification (0.12 g, 0.38 mmol, 60% yield, 90% purity). HPLC-MS Method I: (M+H) 316.1; Rt: 3.58 min Acid intermediate 14: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- trifluoromethanesulfonylbenzoic acid To a solution of 2-fluoro-5-trifluoromethanesulfonylbenzoic acid (0.100 g, 0.368 mmol, 1 eq.) in ACN (4 mL), (1-methyltetrazol-5-yl)sulfanylpotassium (0.057 g, 0.368 mmol, 1 eq.) was added. The reaction mixture was stirred in microwave at 100 °C for 1.5 h. HPLC-MS analysis had shown the presence of planned product. Solvent was removed under reduced pressure and the compound was used in the next step without further purification (0.08 g, 0.217 mmol, 59% yield, 70% purity). HPLC-MS Method C: (M+H) 369.1; Rt: 3.13 min Acid intermediate 15: 5-nitro-2-(1-phenyltetrazol-5-yl)sulfanyl-benzoic acid To a solution of (1-phenyltetrazol-5-yl)sulfanylsodium (0.300 g, 1.5 mmol, 1 eq.) in NMP (3 mL), 18-crown-6 (0.436 g, 1.65 mmol, 1.1 eq.) and 2-fluoro-5-nitro-benzoic acid (0.278 g, 1.5 mmol, 1 eq.) were added. The reaction mixture was stirred at 100 °C for 4 h. HPLC-MS analysis showed the presence of the expected product. Water was added to the reaction mixture and 25% aqueous HCl was added until pH = 2. The product was then extracted three times with DCM, organic layers were combined and washed with brine, dried on Na ₂ SO ₄ and evaporated. The crude was purified by chromatographic column using DCM/MeOH (95/5 to 9/1) to afford the title compound (0.122 g, 0.356 mmol, 24% yield, 86% purity). HPLC-MS Method A: (M+H) 344.1; Rt: 2.86 min Acid intermediate 16: 5-methanesulfonyl-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-benz oic acid Step 1: methyl 2-hydroxy-5-methylsulfonyl-benzoate 2-Hydroxy-5-methanesulfonylbenzoic acid (0.170 g, 0.78 mmol, 1 eq.) was treated with oxalyl chloride (0.036 mL, 1.1 mmol, 1.4 eq.) in dry DCM (2 mL) in the presence of few drops of DMF. After 2 h MeOH (1 mL) was added and the solvent was evaporated under reduced pressure. The residue was rinsed with DCM, washed with a saturated aqueous solution of NaHCO ₃ , brine and finally water. The organic phase was dried over Na ₂ SO ₄ and concentrated to dryness to give the title product as a white solid (0.160 g, 0.65 mmol, 83% yield, 70% purity). HPLC-MS Method A: (M+H) 248.2; Rt: 2.89 min Step 2: methyl 5-methylsulfonyl-2-(trifluoromethylsulfonyloxy)benzoate Methyl 2-hydroxy-5-methylsulfonyl-benzoate (0.135 g, 0.41 mmol, 1 eq.) was dissolved in dry DCM (3 mL) under argon atmosphere in the presence of DIPEA (0.15 mL, 0.82 mmol, 2 eq.). Triflic anhydride (0.10 mL, 0.62 mmol, 1.5 eq.) was added and the reaction mixture was stirred 3 h at room temperature. The solvent was evaporated in vacuo and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to obtain the target compound as a beige solid (0.167 g, 0.46 mmol, 79% yield, 79% purity). HRMS (ESI) calcd for C ₁₀ H ₉ F ₃ O ₇ S ₂ [M + H] ⁺ 362.9815, found 362.9811 Step 3: methyl 5-methylsulfonyl-2-(1- methyl-1H-tetrazol-5-ylsulfanyl)-benzoate Methyl 5-methylsulfonyl-2-(trifluoromethylsulfonyloxy)benzoate (0.160 g, 0.35 mmol, 1 eq.) and the (1-methyltetrazol-5-yl)sulfanylpotassium (0.049 g, 0.35 mmol, 1 eq.) in ACN dry (3 mL) were heated to reflux under argon atmosphere until the disappearance of the starting material (1 h). The reaction mixture was cooled down and the precipitate was filtered and washed with ACN to afford the title compound as a white solid (0.090 g, 0.27 mmol, 79% yield, 97% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.27 (s, 3 H) 3.98 (s, 3 H) 4.06 (s, 3 H) 6.91 (d, J=8.69 Hz, 1 H) 7.98 (dd, J=8.54, 2.14 Hz, 1 H) 8.47 (d, J=1.98 Hz, 1 H) HRMS (ESI) calcd for C ₁₁ H ₁₂ N ₄ O ₄ S ₂ [M + H] ⁺ 329.0373, found 329.0371 Step 4: 5-methanesulfonyl-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-benz oic acid Methyl 5-methylsulfonyl-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-benzo ate (0.085 g, 0.26 mmol, 1 eq.) in MeOH (1.5 mL) and H ₂ O (0.7 mL) was treated with KOH (0.020 g, 0.31 mmol, 1.2 eq.) and the reaction mixture was heated at 70 °C until the disappearance of the starting material (2 h). After cooling to room temperature, the solvent was concentrated under reduced pressure and the crude was processed without any further purification (0.080 g, 0.25 mmol, 98% yield, 96% purity). HPLC-MS Method A: (M+H) 315.0; Rt: 0.74 min Acid intermediate 17: 2-thiazol-2-ylsulfanyl-5-(trifluoromethylsulfonyl)benzoic acid Step 1: thiazol-2-ylsulfanylpotassium To a stirred solution of KOH (0.048 g, 0.86 mmol, 1.01 eq.) in MeOH (1 mL), was added thiazole-2-thiol (0.100 g, 0.85 mmol, 1 eq.). The resulting mixture was stirred for 3 h at room temperature. Solvent was removed under reduced pressure and the compound was used in the next step without further purification (white solid, 0.133 g, 0.86 mmol, quantitative yield, 100% purity). HRMS (ESI) calcd for C ₃ H ₃ NS ₂ [M + H] ⁺ 117.9780, found 117.9784 Step 2: 2-thiazol-2-ylsulfanyl-5-(trifluoromethylsulfonyl)benzoic acid To a solution of 2-fluoro-5-trifluoromethanesulfonylbenzoic acid (0.080 g, 0.29 mmol, 1 eq.) in ACN (2 mL), thiazol-2-ylsulfanylpotassium (0.046 g, 0.29 mmol, 1 eq.) was added. The reaction mixture was heated at 90 °C for 1.5 h under microwave condition. The solvent was removed under reduced pressure and the compound was used in the next step without further purification (beige solid, 0.095 g, 0.26 mmol, 89% yield, 85% purity). HPLC-MS Method E: (M+H) 370.1; Rt: 3.13 min Acid intermediate 18: 5-nitro-2-{[1-(2,2,2-trifluoroethyl)-1H-1,2,3,4-tetrazol-5-y l]sulfanyl} benzoic acid Step 1: methyl 5-nitro-2-{[1-(2,2,2-trifluoroethyl)-1H-1,2,3,4-tetrazol-5-y l]sulfanyl} benzoate Methyl 2-iodo-5-nitrobenzoate (0.050 mg, 0.163 mmol, 1 eq.) and 1-(2,2,2-trifluoroethyl)-1H- 1,2,3,4-tetrazole-5-thiol (0.039 g, 0.21 mmol, 1.3 eq.) in ACN dry (2 mL) were heated to reflux in the presence of DIPEA (0.06 mL, 0.34 mmol, 2 eq.) as the base until the disappearance of the starting material (7 h). after cooling to room temperature, the solvent was evaporated under reduced pressure and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the target product as a white solid (0.030 g, 0.083 mmol, 51% yield, 97% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.99 (s, 3 H) 5.62 - 5.81 (m, 2 H) 7.00 (d, J=9.00 Hz, 1 H) 8.32 (dd, J=9.00, 2.59 Hz, 1 H) 8.72 (d, J=2.59 Hz, 1 H) HRMS (ESI) calcd for C ₁₁ H ₈ F ₃ N ₅ O ₄ S [M + H] ⁺ 364.0322, found 364.0313 Step 2: 5-nitro-2-{[1-(2,2,2-trifluoroethyl)-1H-1,2,3,4-tetrazol-5-y l]sulfanyl}benzoic acid Methyl 5-nitro-2-{[1-(2,2,2-trifluoroethyl)-1H-tetrazol-5-yl]sulfan yl}benzoate (0.020 g, 0.055 mmol, 1 eq.) was treated with LiOH ^. H ₂ O (0.004 g, 0.08 mmol, 1.5 eq.) in THF/H ₂ O: 1/1 (0.6 mL) at room temperature for 1 h. The solvent was evaporated under reduced pressure and the compound was used in the next step without further purification (0.018 g, 0.052 mmol, 95% yield, 90% purity). HPLC-MS Method C: (M - H) 348.1; Rt: 3.29 min Acid intermediate 19: 4-methyl-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzoic acid To a solution of 2-fluoro-4-methyl-5-nitrobenzoic acid (0.500 g, 2.46 mmol, 1 eq.) in NMP (3 mL), 18-crown-6 ether (0.850 g, 3.18 mmol, 1.3 eq.) and (1-methyltetrazol-5- yl)sulfanylpotassium (0.500 g, 3.18 mmol, 1.3 eq.) were added and the reaction mixture was heated at 100 °C under microwave irradiation for 14 h. The reaction mixture was then cooled to room temperature, diluted with H ₂ O and the aqueous phase was extracted with DCM three times. The organic layers were combined, dried over Na ₂ SO ₄ and concentrated. The crude was purified by flash chromatography on silica gel eluting with DCM/MeOH (98/2 to 8/2) to give the title compound as a beige solid (0.390 g, 1.32 mmol, 54% yield, 88% purity). HPLC-MS Method L: (M + H) 296.0; Rt: 2.99 min Acid intermediate 20: lithium 2-{[1-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1H-1,2,3,4- tetrazol-5-yl]sulfanyl}-5-nitrobenzoate Step 1: methyl 2-{[1-(2-aminoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-ni trobenzoate hydrochloride To a solution of methyl 2-{[1-(2-formamidoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}- 5- nitrobenzoate (0.03 g, 0.07 mmol, 1 eq.) in EtOH (0.85 mL), HCl 37% (0.5 mL) was added. The reaction mixture was stirred for 1 h at T = 78 °C. HPLC-MS show the presence of planned compound. Solvent was removed to dryness and the residue was rinsed with EtOH, the white solid was filtrated to give th title compound (0.028 g, 0.07 mmol, 100% yield, 92% purity). HPLC-MS Method M: (M + H) 325.2; Rt: 3.22 min Step 2: methyl 2-{[1-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1H-1,2,3,4-tet razol-5- yl]sulfanyl}-5-nitrobenzoate To a solution of methyl 2-{[1-(2-aminoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-ni trobenzoate hydrochloride (0.028 g, 0.07 mmol, 1 eq.) in 1,4-dioxane dry (0.5 mL), TEA (0.022 g, 0.21 mmol, 3 eq.) and Boc anhydride (0.017 g, 0.08 mmol, 1.1 eq.) were added. The reaction mixture was stirred at room temperature overnight. HPLC-MS shows the presence of planned compound. The mixture was diluted with AcOEt, washed with H ₂ O three times and once with brine, dried on Na ₂ SO ₄ and evaporated. The product was rinsed with Et ₂ O to give a white solid (0.032 g, 0.07 mmol, 100% yield, 94% purity). HPLC-MS Method G: (M + H) 425.5; Rt: 4.53 min Step 3: lithium 2-{[1-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1H-1,2,3,4-tet razol-5- yl]sulfanyl}-5-nitrobenzoate In a reactor methyl 2-{[1-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1H-1,2,3,4-tet razol-5- yl]sulfanyl}-5-nitrobenzoate (0.032 g, 0.07 mmol, 1 eq.), LiOH ^. H ₂ O (0.0096 g, 0.23 mmol, 3.2 eq.), THF (1.2 mL) and water (0.92 mL) were added. The reaction mixture was stirred at room temperature for 3 h and 30 min. HPLC-MS analysis had shown the presence of planned product. The reaction mixture was evaporated without heating bath, the residue was suspended in acetone. The solid was filtrated and the solvent was evaporated to dryness to achieve the product (0.029 g, 0.06 mmol, 91% yield, 94% purity). HPLC-MS Method G: (M + H) 411.5; Rt: 2.90 min Acid intermediate 21: lithium(1+) 5-nitro-2-({1-[2-(oxan-2-yloxy)ethyl]-1H-1,2,3,4- tetrazol-5-yl}sulfanyl)benzoate Step 1: methyl 5-nitro-2-({1-[2-(oxan-2-yloxy)ethyl]-1H-1,2,3,4-tetrazol-5- yl}sulfanyl)benzoate To a solution of methyl 2-{[1-(2-hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5- nitrobenzoate (0.087 g, 0.27 mmol, 1 eq.) (for synthesis see Ester intermediate 1) in THF dry (5 mL), 3,4-dihydro-2H-pyran (0.046 g, 0.53 mmol, 2 eq.) and pyridinium p-toluenesulfonate (0.014 g, 0.05 mmol, 0.2 eq.) were added. The reaction mixture was stirred at room temperature overnight. The HPLC-MS shows the presence of the planned compound. Water was added to the mixture and the product was extracted with AcOEt 3 times, organic layer was washed with brine, dried on Na ₂ SO ₄ and evaporated. The product was purified by chromatographic column hexane/acetone (9/1 to 6/4) (0.103 g, 0.25 mmol, 94% yield, 100% purity). HPLC-MS Method B: (M + H) 410.1; Rt: 5.07 min Step 2: lithium 5-nitro-2-({1-[2-(oxan-2-yloxy)ethyl]-1H-1,2,3,4-tetrazol-5- yl}sulfanyl)benzoate In a reactor methyl 5-nitro-2-({1-[2-(oxan-2-yloxy)ethyl]-1H-1,2,3,4-tetrazol-5- yl}sulfanyl)benzoate (0.100 g, 0.24 mmol, 1 eq.), LiOH.. H ₂ O (0.012 g, 0.29 mmol, 1.2 eq.), THF (3.6 mL) and water (0.27 mL) were added. The reaction mixture was stirred at room temperature for 4 h. HPLC-MS analysis had shown the presence of planned product. The reaction mixture was evaporated without heating bath, the residue was suspended in acetone. The solid was filtrated and the solvent was evaporated to dryness to achieve the product (0.096 g, 0.24 mmol, 98% yield, 100% purity). HPLC-MS Method C: (M + H) 396.1; Rt: 2.87 min Acid intermediate 22: lithium 4-(methylaminomethyl)-2-(1-methyltetrazol-5-yl)sulfanyl-5- nitro-benzoate Step 1: methyl 4-(bromomethyl)-2-fluoro-5-nitro-benzoate To a solution of methyl 2-fluoro-4-methyl-5-nitrobenzoate (124 mg, 0.5817 mmol, 0.124 g) in degassed acetonitrile (1.2 mL, 1.2 mL) under Ar atmosphere N-bromosuccinimide (1 equiv., 0.5817 mmol, 0.1035 g) and (E)-azobis(isobutyronitrile) (0.1 equiv., 0.05817 mmol, 9.5 mg) were added. The resulting mixture was stirred at 80°C, after a few min all the solids dissolved giving a clear colorless solution that was stirred overnight at the same temperature. HPLC/MS analysis showed at 254 nm 66% of product, 25% of SM and 7% of an unknown by-product. The solution was allowed to cool at room temperature, the light-yellow solution was concentrated via rotavapor affording a pale-yellow oil. Loaded on a silica (5 cm in a plastic syringe 20 mL) and eluted with (hexane/AcOEt 9/1), mainly inpure fractions, evaporated to dryness under reduce pressure affording a second crude of 144 mg as colourless oil that was dissolved in the minimum amount of DCM and loaded on a silica (5 cm in a plastic syringe 20 mL) and eluted with (Hexane/AcOEt 95/5), Sm eluted in fractions 5-8, fractions 9-15 containing the desired compound were collected affording methyl 4-(bromomethyl)-2-fluoro-5-nitro- benzoate (80 mg, 0.2739 mmol, 47.09% yield) as colorless oil. HPLC-MS Method D: Rt: 2.20 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ ppm 3.87 (s, 3 H) 4.79 (s, 2 H) 7.84 (d, J=9.28 Hz, 1 H) 8.44 (d, J=6.35 Hz, 1 H) Step 2: methyl 4-[(dimethylamino)methyl]-2-fluoro-5-nitro-benzoate To a stirred suspension of dimethylamine hydrochloride (1.2 equiv., 0.32870 mmol, 26.80 mg) in DCM (0.75 mL) at 0 °C N-ethyldiisopropylamine (3 equiv., 0.82175 mmol, 0.1062 g, 0.143 mL) was added and stirred for 10 min under nitrogen atmosphere. A methyl 4-(bromomethyl)- 2-fluoro-5-nitro-benzoate (80 mg, 0.27392 mmolsolution in DCM (0.5 mL) was added and stirred for 30 min (final solution turned to yellow). The mixture was allowed to warm to room temperature and stirred for an additional 2 h.. The reaction mixture was washed with saturated NaHCO ₃ solution (4 mL), dried over anhydrous Na ₂ SO ₄ , and then evaporated to dryness under reduced pressure. 69 mg Of crude product as yellow oil was isolated. Purified via flash chromatography (silica): dissolve crude mixture in minimum volume of DCM, add to column and elute with DCM/MeOH 98:2. A second column was required. Thus, 55 mg of the crude arising from the first purification was purified again via flash chromatography (silica): dissolve crude mixture in minimum volume of DCM, add to column and elute with hexane/AcOEt 6:4. The fractions containing product were collected and dried affording methyl 4- [(dimethylamino)methyl]-2-fluoro-5-nitro-benzoate (44 mg, 0.17172 mmol, 62.7% yield) as yellow oil. HPLC-MS Method C: (M + H) 257.0; Rt: 1.63 min Step 3: methyl 4-[(dimethylamino)methyl]-2-(1-methyltetrazol-5-yl)sulfanyl- 5-nitro- benzoate In CEM vial methyl 4-[(dimethylamino)methyl]-2-fluoro-5-nitro-benzoate (44 mg, 0.171 mmol) was dissolved in acetonitrile (1.71 mL), and potassium;1-methyltetrazole-5-thiolate (1.25 equiv., 0.21465 mmol, 33.1 mg) was added. The final suspension was stirred at 80 °C for 90 min in CEM explorer. HPLC/MS analysis showed partial conversion in the desired product (254 nm). The mixture was stirred for further 90 min at 80°C in microwave with slight conversion improvement. The reaction was stirred for a total time of 8h in CEM microwave reactor at 80°. HPLC/MS analysis showed, besides an improvement of the conversion, also the formation of the product of the ester hydrolysis of the final product. The reaction mixture was dried (78 mg), dissolved in DCM and washed with NaHCO ₃ saturated aqueous solution, the aqueous phase was ri-extracted twice with DCM. The organic phases were collected, dried over anhydrous Na ₂ SO ₄ , filtered and evaporated to dryness under reduce pressure affording 50 mg of crude material that was purified by flash chromatography (Silica): crude dissolved in minimum amount of eluant (hexane/AcOEt 50/50) and purified. methyl 4-[(dimethylamino)methyl]-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzoate (26 mg, 0.07378 mmol, 42.96% yield) as light- yellow solid was recovered. HPLC-MS Method C: (M + H) 353.1; Rt: 3.35 min Step 4: lithium 4-(methylaminomethyl)-2-(1-methyltetrazol-5-yl)sulfanyl-5-ni tro- benzoate A solution of methyl 4-[(dimethylamino)methyl]-2-(1-methyltetrazol-5-yl)sulfanyl- 5-nitro- benzoate (22 mg, 0.06243 mmol) in THF (1.25 mL) was added a solution of lithium hydroxide monohydrate (1.2 equiv., 0.07491 mmol, 3.14 mg) in water (0.09 mL). The reaction mixture (clear yellow solution) was stirred at room temperature overnight at RT. The reaction was carefully dried in rotavapor without bath heating. The crude material was used without further purification. HPLC-MS Method M: (M + H) 337.1; Rt: 0.71 min Acid intermediate 23: 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-2-(1-methyltetrazol -5- yl)sulfanyl-5-nitro-benzoic acid Step 1: methyl 2-bromo-4-[(E)-2-(dimethylamino)vinyl]-5-nitro-benzoate In a CEM microwave reactor methyl 2-bromo-4-methyl-5-nitro-benzoate (1 g, 3.6487 mmol) was dissolved in DMF (5 mL) and to this N,N-dimethylformamide dimethyl acetal (1.3 equiv., 4.74 mmol, 0.65 mL) was added. The mixture turned immediately to deep purple, was heated at 140 °C for 1 h in Discover CEM. The reaction mixture turned to deep dark red. HPLC/MS analysis showed at 254 nm 69% of product, 27% of SM. A second cycle in microwave, in the same conditions, was performed with no significant improvement. 200 µL of N,N- dimethylformamide dimethyl acetal were added and a further 1h heating at 140 °C was performed. HPLC/MS analysis showed at 254 nm 80% of product, 13% of SM. The resulting deep red solution was concentrated under vacuum. The residue was triturated with methanol (10 mL) and filtered. The filtrate was washed with methanol and dried on the sintered glass filter to yield methyl 2-bromo-4-[(E)-2-(dimethylamino)vinyl]-5-nitro-benzoate (702 mg, 2.07 mmol, 0.702 g, 56.7% yield) as a brown powder. HPLC-MS Method C: (M + H) 331.1; Rt: 2.98 min Step 2: methyl 2-bromo-4-formyl-5-nitro-benzoate To a solution of the methyl 2-bromo-4-[(E)-2-(dimethylamino)vinyl]-5-nitro-benzoate (A, 700 mg, 2.1267 mmol) in THF (7 mL) and water (7 mL), sodium metaperiodate (2 equiv., 4.25 mmol, 0.919 g) was added and the mixture allowed to stir for 90 min (the mixture changed to a lighter color). HPLC/MS analysis showed at 254 nm complete consumption of the starting material, several peaks formed. The mixture was filtered, and the resulting solids were washed with EtOAc (50 mL). All the filtrates were collected, washed with NaHCO ₃ (2 x 10 mL) and dried ( Na ₂ SO ₄ ). Concentration under vacuum afforded 600 mg of crude (dark brown solid) that was purified by flash chromatography (Silica): crude dissolved in minimum amount of DCM: eluant (hexane/AcOEt: 9/1). fractions 14-25 were collected affording methyl 2-bromo-4-formyl-5-nitro- benzoate (178 mg, 0.618 mmol, 0.178 g, 29% yield) as a white-yellow powder. HPLC-MS Method C: Rt: 3.52 min 1H NMR (600 MHz, DMSO-d ₆ ) δ ppm 3.93 (s, 3 H) 8.16 (s, 1 H) 8.50 (s, 1 H) 10.25 (s, 1 H) Step 3: methyl 2-bromo-4-(hydroxymethyl)-5-nitro-benzoate A solution of methyl 2-bromo-4-formyl-5-nitro-benzoate (178 mg, 0.61795 mmol) in tetrahydrofuran (6.18 mL) was cooled to 0°C, sodium borohydride (1 equiv., 0.61795 mmol, 23.4 mg) was added and the reaction was stirred at 0 °C for 45 min. HPLC/MS analysis showed showed complete conversion. The mixture was diluted with EtOAc and washed with 1N HCl and brine; the organic phase was dried over Na ₂ SO ₄ and the solvent was removed. methyl 2- bromo-4-(hydroxymethyl)-5-nitro-benzoate (176 mg, 0.60675 mmol, 176 mg, 98.2% yield) was isolated as a yellow solid and used without further purification. HPLC-MS Method C: (M -) 289.9; Rt: 2.73 min Step 4: methyl 2-bromo-4-[[tert-butyl(diphenyl)silyl]oxymethyl]-5-nitro-ben zoate To a solution of methyl 2-bromo-4-(hydroxymethyl)-5-nitro-benzoate (169 mg, 0.58 mmol, 0.169 g) and imidazole (1.5 equiv., 0.87 mmol, 59.5 mg) in DCM (4.225 mL), diphenyl- terbutylchlorosilane (1.1 equiv., 0.64 mmol, 0.164 mL) was added dropwise at room temperature. The mixture was stirred at room temperature for 1 h. HPLC/MS analysis showed complete conversion, the reaction mixture was diluted with DCM, washed with water and brine then dried affording 314 mg of a brown oil that was dissolved in DCM and filtered through a silica pad with DCM. methyl 2-bromo-4-[[tert-butyl(diphenyl)silyl]oxymethyl]-5-nitro-ben zoate (235 mg, 0.445 mmol, 235 mg, 76.3% yield) was isolate as yellow oil HPLC-MS Method D: Rt: 5.51 min 1H NMR (600 MHz, DMSO-d ₆ ) δ ppm 1.07 (s, 9 H) 3.91 (s, 3 H) 5.15 (s, 2 H) 7.40 - 7.47 (m, 4 H) 7.47 - 7.52 (m, 2 H) 7.59 - 7.65 (m, 4 H) 8.26 (s, 1 H) 8.47 (s, 1 H) Step 5: methyl 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-2-(1-methyltetrazol -5-yl)sulfanyl- 5-nitro-benzoate To a CEM microwave reactor (20 ml) methyl 2-bromo-4-[[tert-butyl(diphenyl)silyl]oxymethyl]-5- nitro-benzoate (235 mg, 0.44 mmol), 1-methyltetrazole-5-thiol (2 equiv., 0.889 mmol, 103.3 mg), 1,4-dioxane (7.05 mL) and DIPEA (3 equiv., 1.334 mmol, 0.232 mL) were added. The yellow solution was degassed by bubbling Ar for 15 min. Then tris(dibenzylideneacetone)dipalladium (0.1 equiv., 0.0447 mmol, 41 mg) and 4,5- bis(diphenylphosphino)-9,9-dimethylxanthene (0.2 equiv., 0.0889 mmol, 52 mg) were added and the final solution was heated in a CEM at 80 °C for 1h. HPLC/MS analysis showed complete conversion. The reaction mixture was diluted with EtOAc washed with water and twice with brine, then dried on Na ₂ SO ₄ and filtered. Organic layer was concentrated via rotovap affording 375 mg of orange-brown oil. Purified by flash chromatography (silica): crude dissolved in DCM, eluant (hexane/AcOEt: 7/3). Methyl 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-2-(1-methyltetrazol -5-yl)sulfanyl-5-nitro- benzoate (166 mg, 0.294 mmol, 66.2% yield) was collected as light-yellow solid. HPLC-MS Method D: (M+H) 564.4 Rt: 5.01 min Step 6: 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-2-(1-methyltetrazol -5-yl)sulfanyl-5-nitro- benzoic acid In a round-bottom flask to a solution of methyl 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzoate (160 mg, 0.284 mmol, 0.16 g) in THF (10 mL) was added a solution of lithium hydroxide monohydrate (1.2 equiv., 0.3406 mmol, 14.3 mg) in water (1 mL). The reaction mixture (clear yellow solution) was stirred at room temperature overnight. HPLC-MS analysis shows complete conversion into the desired acid and partial desilylation. The crude reaction was carefully dried in rotavapor providing a crude of 166 mg. Purified by flash chromatography (silica): crude dissolved in minimum amount of dcm (with few drops of MeOH), eluant (DCM/MeOH 8:2). 4-[[Tert-butyl(diphenyl)silyl]oxymethyl]-2-(1-methyltetrazol -5-yl)sulfanyl-5-nitro-benzoic acid was obtained (85 mg, 0.155 mmol, 85 mg, 54.5% yield) HPLC-MS Method D: (M -) 548.8; Rt: 2.62 min Acid intermediate 24: 4-[(tert-butoxycarbonylamino)methyl]-2-(1-methyltetrazol-5- yl)sulfanyl-5-nitro-benzoic acid Step 1: methyl 2-bromo-4-(bromomethyl)-5-nitro-benzoate To a solution of methyl 2-bromo-4-methyl-5-nitro-benzoate (1.54 g, 5.62 mmol) in previously degassed acetonitrile (15.4 mL) under Ar atmosphere N-bromosuccinimide (1 equiv., 5.62 mmol, 1.00 g) and (E)-azobis(isobutyronitrile) (0.1 equiv., 0.562 mmol, 92.3 mg) were added. The resulting mixture was stirred at 80 °C, after a few min all the solids dissolved giving a clear colorless solution that was stirred overnight at the same temperature. HPLC/MS analysis showed at 254 nm 32% of product, 68% of SM. The solution was allowed to cool at room temperature, N-bromosuccinimide (1 equiv., 5.62 mmol, 1.00 g) and (E)- azobis(isobutyronitrile) (0.1 equiv., 0.562 mmol, 92.3 mg) were newly added and stirred under Ar atmosphere at 80 °C for further 16h. HPLC/MS analysis showed at 254 nm 56% of product, 38% of SM. The solution was allowed to cool at room temperature, N-bromosuccinimide (1 equiv., 5.62 mmol, 1.00 g) and (E)-azobis(isobutyronitrile) (0.1 equiv., 0.562 mmol, 92.3 mg) were newly added and stirred under Ar atmosphere at 80 °C for further 16h. HPLC/MS analysis showed at 254 nm 63% of product, 14% of SM and 18% of likely bis-bromo derivative. The solution was allowed to cool at room temperature, the light-yellow solution was loaded on a silica and eluted with (hexane/AcOEt 95:5), fractions containing the desired compound were collected affording methyl 2-bromo-4-(bromomethyl)-5-nitro-benzoate (1.16 g, 3.29 mmol, 58.5% yield) as a white solid. HPLC-MS Method C: (M -H) 351.9; Rt: 2.53 min Step 2: methyl 4-(aminomethyl)-2-bromo-5-nitro-benzoate In a round-bottom flask to a stirred solution of methyl 2-bromo-4-(bromomethyl)-5-nitro- benzoate (300 mg, 0.850 mmol) in THF (8.5 mL) at room temperature, ammonia, 7N in methanol (20 equiv., 17 mmol, 2.43 mL) was added, the final solution was stirred at room temperature. HPLC-MS analysis after 3h showed almost conversion in the desired product. The reaction mixture was dried at rotavap, the residue was taken up with DCM, washed with NaOH 1N. The acqueous phase was extracted three times, the organic phases were collected dried over anhydrous Na ₂ SO ₄ , filtered and evaporated to dryness under reduce pressure To afford 240 mg of crude product as yellow oil. Purified via flash chromatography (silica): crude mixture was diluted with DCM, loaded on column and eluted with DCM/MeOH (95/5 to 9/1). The fractions containing product were collected and dried affording methyl 4-(aminomethyl)-2- bromo-5-nitro-benzoate (130 mg, 0.450 mmol, 52.9% yield) as yellow oil. HPLC-MS Method B: (M+H) 291.1; Rt: 3.63 min Step 3: methyl 2-bromo-4-[(tert-butoxycarbonylamino)methyl]-5-nitro-benzoat e In round-bottom flask (equipped with a CaCl ₂ valve) di-tert-butyl dicarbonate (1.2 equiv., 0.54 mmol, 0.1178 g) was added to a stirred solution of methyl 4-(aminomethyl)-2-bromo-5-nitro- benzoate (130 mg, 0.45 mmol, 0.13 g) in triethylamine (2 equiv., 0.9 mmol, 0.125 mL) and DCM (4.5 mL). The solution was stirred at rt for 16h. The reaction was diluted with DCM and washed with a citric acid solution (1M), the organic phase was separated and the the acqueous phase was extracted twice with DCM. The combined organic phases were collected dried over anhydrous Na ₂ SO ₄ , filtered and evaporated to dryness under reduced pressure affording 220 mg of yellow oil. The crude was purified by flash chromatography (Silica): crude dissolved in minimum amount of DCM, eluant (hexane/AcOEt 8/2). Fraction containing product were collected and dried affording methyl 2-bromo-4-[(tert-butoxycarbonylamino)methyl]-5-nitro- benzoate (75 mg, 0.1927 mmol, 42.85% yield) as yellow oil. HPLC-MS Method D : (M-H) 387.1; Rt: 2.60 min Step 4: methyl 4-[(tert-butoxycarbonylamino)methyl]-2-(1-methyltetrazol-5-y l)sulfanyl- 5-nitro-benzoate To a CEM microwave reactor (5 ml) methyl 2-bromo-4-[(tert-butoxycarbonylamino)methyl]-5- nitro-benzoate (70 mg, 0.18 mmol), 1-methyltetrazole-5-thiol (2 equiv., 0.36 mmol, 0.042 g), 1,4-dioxane (2.1 mL) and DIPEA (3 equiv., 0.54 mmol, 94 uL) were added. The yellow solution was degassed by bubbling Ar for 15 min. Then tris(dibenzylideneacetone)dipalladium (0.1 equiv., 0.018 mmol, 16.5 mg) and 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene (0.2 equiv., 0.036 mmol, 21 mg) were added and the final solution was heated in a CEM at 80 °C for 1h. HPLC/MS analysis showed complete conversion. The reaction mixture was diluted with EtOAc washed with water and twice with brine, then dried on Na ₂ SO ₄ and filtered. The organic layer was concentrated via rotovapor affording 129 mg of orange-brown foam. Purified by flash chromatography (silica): the silica was netralized during the conditioning performed with Hexane/AcOEt/TEA: 7/2.5/0.5. Crude dissolved in DCM, eluant (Hexane/AcOEt: 7/3). methyl 4-[(tert-butoxycarbonylamino)methyl]-2-(1-methyltetrazol-5-y l)sulfanyl-5-nitro-benzoate (50 mg, 0.118 mmol, 65.5% Yield) was collected as light yellow solid. HPLC-MS Method D: (M+H) 425.1; Rt: 2.10 min Step 5: 4-[(tert-butoxycarbonylamino)methyl]-2-(1-methyltetrazol-5-y l)sulfanyl-5-nitro- benzoic acid In a round-bottom flask to a solution of methyl 4-[(tert-butoxycarbonylamino)methyl]-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzoate (50 mg, 0.118 mmol) in tetrahydrofuran (2.5 mL) was added a solution of lithium hydroxide monohydrate (1.2 equiv., 0.141 mmol, 0.006 g) in Water (0.25 mL). The reaction mixture (clear yellow solution) was stirred at room temperature for 4h. HPLC-MS analysis shows complete conversion into the desired acid. The crude reaction was carefully dried in rotavap and the residue was directly used. HPLC-MS Method C: (M-H) 409.1; Rt: 0.45 min Acyl chloride intermediate 1: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzoyl chloride A suspension of the 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (0.100 g, 0.36 mmol, 1eq.) in neat thionyl chloride (1.00 mL, 13.65 mmol, 38 eq.) was heated at reflux for 30 min. The reaction mixture was then cooled to room temperature and evaporated. The residue was suspended in toluene and evaporated. The crude product was used in the next step without further purification (white solid, 0.105 g, 0.53 mmol, 100% yield, 100% purity). HPLC-MS Method A: (M+H) 296.3 (Methyl ester); Rt: 3.86 min Acyl chloride intermediate 2: 5-cyano-2-fluoro-benzoyl chloride To a suspension of 5-cyano-2-fluoro-benzoic acid (0.33 g, 2 mmol, 1 eq.) in DCM dry (5 mL) oxalyl chloride (0.22 mL, 2.5 mmol, 1.25 eq.) and dry DMF (0.01 mL) were added. The reaction mixture was stirred at room temperature for 1 h. The crude was evaporated to dryness and used without further purification in the next step (0.366 g, 2 mmol, 100% yield, 100% purity). HPLC-MS Method C: (M+H) 180.1 (Methyl ester); Rt: 2.69 min Acyl chloride intermediate 3: 2-(1-methyltetrazol-5-yl)sulfanyl-5- (trifluoromethylsulfonyl)benzoyl chloride To a suspension of 2–(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-trifluoromethanesu lfonyl-benzoic acid (0.080 g, 0.217 mmol, 1 eq.) in dry DCM (1.5 mL) oxalyl chloride (0.22 mL, 0.25 mmol, 1.19 eq.) and dry DMF (0.01 mL) were added. The reaction mixture was stirred at room temperature for 1 h. The crude was evaporated to dryness and used in the next step without further purification (0.084 g, 0.217 mmol, 100% yield, 100% purity). HPLC-MS Method C: (M+H) 383.0 (Methyl ester); Rt: 4.03 min Acyl chloride intermediate 4: 5-methylsulfonyl-2-(1-methyltetrazol-5-yl)sulfanyl-benzoyl chloride A solution of 5-methanesulfonyl-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-benz oic acid (0.080 g, 0.26 mmol, 1 eq.) in dry DCM (1.5 mL) was treated with (COCl) ₂ (0.34 mL, 0.39 mmol, 1.5 eq.) and few drops of dry DMF under nitrogen. The reaction mixture was stirred at room temperature for 2 h. The crude was then evaporated to dryness and used without further purification in the next step (0.086 g, 0.26 mmol, 100% yield, 100% purity). HPLC-MS Method A: (M+H) 329.3 (Methyl ester); Rt: 3.66 min Acyl chloride intermediate 5: 2-thiazol-2-ylsulfanyl-5-(trifluoromethylsulfonyl)benzoyl chloride A solution of 2-(thiazol-2-sulfanyl)-5-trifluoromethanesulfonyl-benzoic acid (0.095 g, 0.25 mmol, 1 eq.) in SOCl ₂ (3 mL) was heated at reflux until the disappearance of the starting material (2 h). The solvent was evaporated under reduced pressure and the compound was used without further purification in the next step (0.097 g, 0.25 mmol, 100% yield, 100% purity). HPLC-MS Method A: (M+H) 384.2 (Methyl ester); Rt: 4.15 min Aniline intermediate 1: 5-Amino-2-cyclopentyl-N,N-dimethylbenzamide Step 1: methyl 2-(cyclopent-1-en-1-yl)-5-nitrobenzoate 1-Cyclopenteneboronic acid pinacol ester (1.87 g; 9.14 mmol; 1.2 eq.) was dissolved in 20 mL dried 1,4-dioxane, 10 mL methanol and 5 mL demineralized water. Potassium carbonate (3.16 g; 22.85 mmol; 3.0 eq.), [1,1’’-bis(diphenylphosphino)ferrocene] dichloropalladium(II) complex with DCM (315 mg; 0.38 mmol; 0.05 eq.) and methyl 2-bromo-5-nitrobenzoate (2.0 g; 7.61 mmol; 1.0 eq) were added. The mixture was flushed with argon, closed with a septum and stirred in the microwave for 30 min at 110 °C. The mixture was reduced to dryness, absorbed onto silica gel and purified by chromatography (silica gel; n-heptane/0 - 40% EA) to give methyl 2-(cyclopent-1-en-1-yl)-5-nitrobenzoate (1.61 g; 6.46 mmol; 85% yield; 99% purity) as a yellow oil. LC-MS method A: (M+H) 248.1; Rt: 1.04 min Step 2: 2-(cyclopent-1-en-1-yl)-5-nitrobenzoic acid Methyl 2-(cyclopent-1-en-1-yl)-5-nitrobenzoate (1.61 g; 6.46 mmol; 1.0 eq.) was dissolved in 32 mL THF and 0.6 mL water. Lithium hydroxide (0.155 g; 6.46 mmol; 1.0 eq.) was then added and the orange solution was stirred overnight at room temperature. The reaction mixture was concentrated under reduced pressure and the aqueous phase was extracted three times with DCM. The aqueous phase was acidified to pH 2-3 with 1M HCl and extracted again five times with DCM. The combined organic phases were dried over Na ₂ SO ₄ , filtered off and reduced to dryness to obtain 2-(cyclopent-1-en-1-yl)-5-nitrobenzoic acid (1.35 g; 5.46 mmol; 84% yield; 94% purity) as a beige solid. LC-MS method A: (M+H) 234.0; Rt: 0.96 min Step 3: 2-(cyclopent-1-en-1-yl)-N,N-dimethyl-5-nitrobenzamide 2-(Cyclopent-1-en-1-yl)-5-nitrobenzoic acid (350 mg; 1.41 mmol; 1.0 eq.), dimethylamine solution 2.0M in THF (0.846 mL; 1.69 mmol; 1.2 eq.), HATU (697 g; 1.83 mmol; 1.3 eq.) and Et ₃ N (587 µl; 4.23 mmol; 3.0 eq.) were dissolved in 10 mL dried DMF. The yellow solution was stirred for 2 h at rt. The mixture was diluted with EtOAc, extracted once with saturated NaHCO ₃ aqueous solution and once with water. The organic phase was dried over Na ₂ SO ₄ , filtered off, reduced to dryness and purified by chromatography (silica gel; n-heptane/0 - 70% EtOAc) to get 2-(cyclopent-1-en-1-yl)-N,N-dimethyl-5-nitrobenzamide (304 mg; 1.16 mmol; 82% yield; 99% purity) as a yellow solid. LC-MS method A: (M+H) 261.1; Rt: 0.94 min Step 4: 5-amino-2-cyclopentyl-N,N-dimethylbenzamide 2-(Cyclopent-1-en-1-yl)-N,N-dimethyl-5-nitrobenzamide (304 mg; 1.16 mmol; 1.0 eq.) was dissolved in 10 mL THF. Then dry 5% Pd/C (150 mg; 1.41 mmol; 1.2 eq.) was added and the suspension was treated with H ₂ at room temperature and at atmospheric pressure. After 17 h 356 mL of H ₂ were consumed. The filtered reaction mixture was reduced to dryness to get 5- amino-2-cyclopentyl-N,N-dimethylbenzamide (290 mg; 1.17 mmol, 101% yield; 95% purity) as a colorless oil. UPLC-MS method: (M+H) 233.1; Rt: 0.76 min Aniline intermediate 2: 4-cyclopentyl-3-(morpholine-4-carbonyl)aniline Step 1: 4-[2-(cyclopent-1-en-1-yl)-5-nitrobenzoyl] morpholine 2-(Cyclopent-1-en-1-yl)-5-nitrobenzoic acid (350 mg; 1.41 mmol; 1.0 eq.), morpholine (147 mg; 1.69 mmol; 1.2 eq.), HATU (697 mg; 1.83 mmol; 1.3 eq.) and Et ₃ N (587 µl; 4.23 mmol; 3.0 eq.) were dissolved in 10 mL dried DMF. The yellow-brown solution was stirred 2.5 h at room temperature. The mixture was diluted with EtOAc, extracted once with saturated NaHCO ₃ solution (aq.) and once with water. The organic phase was dried over Na ₂ SO ₄ , filtered off, reduced to dryness and purified by chromatography (silica gel; n-heptane/0 - 70% EtOAc) to obtain 4-[2-(cyclopent-1-en-1-yl)-5-nitrobenzoyl]morpholine (369 mg; 1.20 mmol; 85% yield; 98% purity) as a yellow solid. LC-MS method A: (M+H) 303.1; Rt: 0.93 min Step 2: 4-cyclopentyl-3-(morpholine-4-carbonyl) aniline 4-[2-(Cyclopent-1-en-1-yl)-5-nitrobenzoyl] morpholine (368 mg; 1.19 mmol; 1.0 eq.) was dissolved in 10 mL THF and dry 5% Pd/C (150 mg; 1.41 mmol; 1.2 eq.) was added. The suspension was treated with H ₂ at room temperature and at atmospheric pressure. After 17 h 389.5 mL H ₂ were consumed. The filtered reaction mixture was reduced to dryness to get 4- cyclopentyl-3-(morpholine-4-carbonyl) aniline (380 mg; 1.27 mmol, 107% yield; 93% purity) as a rose-colored oil. UPLC-MS method A: (M+H) 275.0; Rt: 0.77 min Aniline intermediate 3: methyl 5-amino-2-cyclopentylbenzoate Step 1: methyl 2-(cyclopent-1-en-1-yl)-5-nitrobenzoate Methyl 2-bromo-5-nitrobenzoate (500 mg; 1.90 mmol; 1.0 eq.), 1-cyclopenteneboronic acid pinacol ester (583 mg; 2.86 mmol; 1.5 eq.) were dissolved in 5 mL dry 1,4-dioxane, 2.5 mL ethanol and 1.3 mL demineralized water. Potassium carbonate (789 mg; 5.71 mmol; 3.0 eq.) and [1,1’’-bis(diphenylphosphino) ferrocene] dichloro palladium(II) complex with DCM (79 mg; 0.095 mmol; 0.05 eq.) were added, flushed with argon and the reaction was stirred in a microwave for 30 min at 110 °C. The mixture was reduced to dryness and purified by chromatography (silica gel; n-heptane/0 - 50% EtOAc) to obtain methyl 2-(cyclopent-1-en-1- yl)-5-nitrobenzoate (340 mg; 1.37 mmol; 72% yield; 100% purity) as yellow needles. UPLC-MS method A: (M+H) 248.0; Rt: 1.14 min Step 2: methyl 5-amino-2-cyclopentylbenzoate Methyl 2-(cyclopent-1-en-1-yl)-5-nitrobenzoate (339 mg; 1.37 mmol; 1.0 eq.) was dissolved in 10 mL THF. Then dry 5% Pd/C (300 mg; 2.82 mmol, 2.0 eq.) was added. The suspension was treated with H ₂ at room temperature and at atmospheric pressure. After 2 h 20 min 122 mL H ₂ were consumed. The reaction mixture was filtered over celite and reduced to dryness to obtain methyl 5-amino-2-cyclopentylbenzoate (0.29 g; 1.23 mmol, 89% yield; 94% purity) as a colorless oil. UPLC-MS method A: (M+H) 220.4; Rt: 0.96 min Aniline intermediate 4: 4-cyclopentyl-2-[(1-methylpiperidin-4 yl)oxy] aniline Step 1: 4-(5-bromo-2-nitrophenoxy)-1-methylpiperidine To a stirred mixture of 4-bromo-2-fluoro-1-nitrobenzene (1.0 g; 4.32 mmol; 1.0 eq.) and Cs ₂ CO ₃ (4.4 g; 13.0 mmol; 3.0 eq.) in 10 mL DMF 1-methylpiperidin-4-ol (785 mg; 6.48 mmol; 1.5 eq.) was added. The resulting mixture was stirred for 16 h at 80 °C under nitrogen atmosphere. The resulting mixture was diluted with water and extracted with DCM four times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to obtain 4-(5-bromo-2-nitrophenoxy)-1-methylpiperidine (1.0 g; 2.42 mmol; 56% yield; 76% purity). LC-MS method F: (M+H) 315.0; Rt: 0.52 min Step 2: 4-[5-(cyclopent-1-en-1-yl)-2-nitrophenoxy]-1-methylpiperidin e To a mixture of 4-(5-bromo-2-nitrophenoxy)-1-methylpiperidine (300 mg; 0.72 mmol; 1.0 eq.), K ₂ CO ₃ (315 mg; 2.17 mmol; 3.0 eq.) and Pd(dppf)Cl ₂ ^. CH ₂ Cl ₂ (31 mg; 0.04 mmol; 0.05 eq.) in 1.8 mL 1,4-dioxane, 1.2 mL EtOH and 0.6 mL H ₂ O, 2-(cyclopent-1-en-1-yl)-4,4,5,5-tetramethyl- 1,3,2-dioxaborolane (221 mg; 1.08 mmol; 1.5 eq.) was added. The resulting mixture was stirred for 0.5 h at 110 °C under nitrogen atmosphere. The resulting mixture was diluted with water and extracted with DCM four times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with DCM/MeOH (12/1)) to afford 4-[5-(cyclopent- 1-en-1-yl)-2-nitrophenoxy]-1-methylpiperidine (150 mg; 0.44 mmol; 61% yield; 89% purity) as a light-yellow solid. LC-MS method G: (M+H) 303.1; Rt: 0.51 min Step 3: 4-cyclopentyl-2-[(1-methylpiperidin-4-yl)oxy]aniline To a solution of 4-[5-(cyclopent-1-en-1-yl)-2-nitrophenoxy]-1-methylpiperidin e (130 mg; 0.38 mmol; 1.0 eq.) in 10 mL MeOH, 10% Pd/C (817 mg; 0.77 mmol; 2.0 eq.) was added under nitrogen atmosphere. The mixture was hydrogenated at room temperature for 2 h using a hydrogen balloon, filtered through a pad of celite and concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with hexane/EtOAc (1/1)) to afford 4-cyclopentyl-2-[(1-methylpiperidin-4-yl) oxy] aniline (80 mg; 0.24 mmol; 62% yield; 81% purity) as a brown oil. LC-MS method F: (M+H) 275.3; Rt: 0.49 min Aniline intermediate 5: 4-cyclopentyl-2-[2-(dimethylamino) ethoxy] aniline

Step 1: [2-(5-bromo-2-nitrophenoxy)ethyl]dimethylamine To a mixture of 5-bromo-2-nitrophenol (500 mg; 2.18 mmol; 1.0 eq.) and K ₂ CO ₃ (792 mg; 5.45 mmol; 2.5 eq.) in 10 mL DMF (2-bromoethyl) dimethylamine hydrobromide (855 mg, 3.49 mmol; 1.6 eq.) was added. The reaction mixture was stirred in the microwave for 4 h at 140 °C. The resulting mixture was diluted with water and extracted with DCM four times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with PE/EtOAc (1/1)) to afford [2-(5-bromo-2-nitrophenoxy) ethyl] dimethylamine (150 mg; 0.52 mmol; 24% yield; 100% purity) as a light brown solid. LC-MS method F: (M+H) 289.1; Rt: 0.48 min Step 2: {2-[5-(cyclopent-1-en-1-yl)-2-nitrophenoxy] ethyl} dimethylamine To a solution of [2-(5-bromo-2-nitrophenoxy)ethyl]dimethylamine (150 mg; 0.52 mmol; 1.0 eq.), K ₂ CO ₃ (226 mg; 1.56 mmol; 3.0 eq.) and Pd(dppf)Cl ₂ ^. CH ₂ Cl ₂ (22 mg, 0.03 mmol; 0.05 eq.) in 3 mL 1,4-dioxane, 2 mL EtOH and 1 mL H ₂ O were added 2-(cyclopent-1-en-1-yl)-4,4,5,5- tetramethyl-1,3,2-dioxaborolane (159 mg, 0.78 mmol; 1.5 eq.). After stirring for 30 min at 110 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure and was diluted with water. The resulting mixture was extracted with DCM four times, the combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with CH ₂ Cl ₂ /MeOH (12:1)) to afford [2-[5-(cyclopent-1-en-1-yl)-2-nitrophenoxy]ethyl]dimethylami ne (80 mg; 0.27 mmol; 53% yield; 94% purity) as a brown solid. LC-MS method G: (M+H) 277.1; Rt: 0.50 min Step 3: 4-cyclopentyl-2-[2-(dimethylamino) ethoxy] aniline To a solution of [2-[5-(cyclopent-1-en-1-yl)-2-nitrophenoxy]ethyl]dimethylami ne (70 mg; 0.24 mmol; 1.0 eq.) in 10 mL MeOH, 10% Pd/C (763 mg; 0.72 mmol; 3.0 eq.) was added under nitrogen atmosphere. The mixture was hydrogenated at room temperature for 2 h, filtered through a pad of celite pad and concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with DCM/MeOH (10/1)) to afford 4-cyclopentyl-2-[2- (dimethylamino) ethoxy] aniline (40 mg; 0.13 mmol; 53% yield; 78% purity) as a light brown solid. LC-MS method F: (M+H) 249.2; Rt: 0.50 min Aniline intermediate 6: 4-cyclopentyl-3-methoxyaniline Step 1: 1-(cyclopent-1-en-1-yl)-2-methoxy-4-nitrobenzene To a solution of 1-bromo-2-methoxy-4-nitrobenzene (500 mg; 2.05 mmol; 1.0 eq.) and cyclopent-1-en-1-ylboronic acid (362 mg; 3.07 mmol; 1.5 eq.) in 6 mL 1,4-dioxane, 4 mL EtOH and 2 mL H ₂ O, K ₂ CO ₃ (893 mg; 6.14 mmol; 3.0 eq.) and Pd(dppf)Cl ₂ ^. CH ₂ Cl ₂ (88 mg; 0.10 mmol; 0.05 eq.) was added. After stirring for 30 min at 110 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure, diluted with water and extracted with DCM three times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with PE/EtOAc (1/1)) to afford 1-(cyclopent-1-en-1-yl)-2- methoxy-4-nitrobenzene (430 mg; 1.74 mmol; 85% yield; 89% purity) as a light-yellow solid. LC-MS method H: (M+H) 220.0; Rt: 0.82 min Step 2: 4-cyclopentyl-3-methoxyaniline To a solution of 1-(cyclopent-1-en-1-yl)-2-methoxy-4-nitrobenzene (430 mg; 1.74 mmol; 1.0 eq.) in 10 mL MeOH, 10% Pd/C (3.7 g; 3.48 mmol; 2.0 eq.) was added under nitrogen atmosphere. The mixture was hydrogenated at room temperature for 2 h, filtered through a pad of celite and concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with PE/EtOAc (1/1)) to afford 4-cyclopentyl-3- methoxyaniline (180 mg; 0.72 mmol; 41% yield; 77% purity) as a yellow oil. LC-MS method I: (M+H) 192.1; Rt: 0.53 min Aniline intermediate 7: 5-amino-2-cyclopentylbenzonitrile

Step 1: 2-(cyclopent-1-en-1-yl)-5-nitrobenzonitrile To a solution of 2-bromo-5-nitrobenzonitrile (500 mg; 2.09 mmol; 1.0 eq.) and cyclopent-1-en- 1-ylboronic acid (370 mg; 3.14 mmol; 1.5 eq.) in 6 mL 1,4-dioxane, 4 mL EtOH and 2 mL H ₂ O, K ₂ CO ₃ (913 mg; 6.28 mmo; 3.0 eq.) and Pd(dppf)Cl ₂ ^. CH ₂ Cl ₂ (90 mg, 0.11 mmol; 0.05 eq.) were added. After stirring for 30 min at 110 °C under a nitrogen atmosphere, the resulting mixture was diluted with water and extracted with DCM three times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with PE/EtOAc (5/1)) to afford 2-(cyclopent-1-en-1-yl)-5-nitrobenzonitrile (380 mg; 1.72 mmol; 82% yield; 97% purity) as a light-yellow solid. LC-MS method I: (M+H) 215.1; Rt: 1.22 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 8.68 (d, J = 2.5 Hz, 1H), 8.44 (dd, J = 8.8, 2.5 Hz, 1H), 7.78 (d, J = 8.8 Hz, 1H), 6.79 - 6.72 (m, 1H), 2.83 (ddt, J = 10.1, 4.4, 2.2 Hz, 2H), 2.61 (tq, J = 7.6, 2.5 Hz, 2H), 2.01 (p, J = 7.6 Hz, 2H) Step 2: 5-amino-2-cyclopentylbenzonitrile To a solution of 2-(cyclopent-1-en-1-yl)-5-nitrobenzonitrile (380 mg; 1.72 mmol; 1.0 eq.) in 10 mL MeOH, 10% Pd/C (3.7 g; 3.45 mmol; 2.0 eq.) was added under nitrogen atmosphere. The mixture was hydrogenated at room temperature for 2 h, filtered through a celite pad and concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with PE/EtOAc (1/1)) to afford 5-amino-2-cyclopentylbenzonitrile (200 mg; 1.07 mmol; 62% yield; 99% purity) as a yellow oil. LC-MS method I: (M+H) 187.0; Rt: 0.64 min Aniline intermediate 8: 2-amino-5-cyclopentylbenzamide

Step 1: methyl 2-nitro-5-cyclopentylbenzoate To a solution of methyl 5-bromo-2-nitrobenzoate (500 mg; 1.83 mmol; 1.0 eq.) and cyclopent- 1-en-1-ylboronic acid (323 mg; 2.74 mmol; 1.50 eq.) in 6.0 mL 1,4-dioxane, 4.0 mL EtOH and 2.0 mL H ₂ O, K ₂ CO ₃ (797 mg; 5.48 mmol; 3.0 eq.) and Pd(dppf)Cl ₂ ^. CH ₂ Cl ₂ (79 mg; 0.091 mmol; 0.05 eq.). After stirring for 30 min at 110 ⁰C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure, diluted with water and extracted with DCM four times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (5/1) to afford methyl 5-(cyclopent-1-en-1-yl)-2- nitrobenzoate (360 mg; 1.19 mmol; 56% yield; 73% purity) as a yellow oil. LC-MS method E: (M+H) 248.2; Rt: 1.24 min Step 2: methyl 2-amino-5-cyclopentylbenzoate To a solution of methyl 5-(cyclopent-1-en-1-yl)-2-nitrobenzoate (360 mg; 1.19 mmol; 1.0 eq.) in 10 mL MeOH, 10% Pd/C (2.52 g; 2.37 mmol; 2.0 eq.) was added under nitrogen atmosphere. The mixture was hydrogenated at room temperature for 2 h using a hydrogen balloon, filtered through a celite pad and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (1/1) to afford methyl 2-amino-5- cyclopentylbenzoate (200 mg; 0.67 mmol; 57% yield; 73% purity) as a light yellow semi-solid. LC-MS method H: (M+H) 220.2; Rt: 0.91 min Step 3: 2-amino-5-cyclopentylbenzamide To methyl 2-amino-5-cyclopentylbenzoate (160 mg; 0.54 mmol; 1.0 eq.) NH ₃ (g) in 10 mL MeOH in a pressure tank was added. The mixture was stirred at 140 °C for 3 days. The resulting mixture was concentrated under reduced pressure. The residue was purified by chromatography (silica gel; eluted with PE/EtOAc (1/1)) to afford 2-amino-5- cyclopentylbenzamide (50 mg; 0.21 mmol; 40% yield; 88% purity) as a light-yellow solid. LC-MS method I: (M+H) 205.1; Rt: 1.06 min Aniline intermediate 9: Sodium 1-(4-aminophenyl)cyclopentane-1-carboxamide hydrochloride chloride Sodium hydroxide pellets (81.6 mg; 2.04 mmol; 2.0 eq.) were dissolved in 5.0 mL tert-butanol and 1-(4-aminophenyl)cyclopentane-1-carbonitrile (200 mg; 1.02 mmol; 1.0 eq.) was added. The reaction mixture was stirred for 15 h at 100 °C. The mixture was reduced to dryness under vacuo. The residue was suspended in water and acidified with 1 M HCl to pH ~2. The water phase was diluted with brine and extracted with AcOEt three times. Since both phases contained the product, they were combined and concentrated. The obtained residue was washed with MeOH and filtered obtaining the desired product as brown solid (808 mg; 182% yield; 69% purity) which was used in the next step without further purification. LC-MS method L: (M+H) 295.1; Rt: 0.89 min Aniline intermediate 10: Step 1: 4-(cyclopent-1-en-1-yl)-2-methoxy-1-nitrobenzene To a solution of 4-bromo-2-methoxy-1-nitrobenzene (500 mg; 2.05 mmol; 1.0 eq.) and cyclopent-1-en-1-ylboronic acid (362 mg; 3.07 mmol; 1.50 eq.) in 6.0 mL 1,4-dioxane, 4.0 mL EtOH and 2.0 mL H ₂ O, K ₂ CO ₃ (893 mg; 6.14 mmol; 3.0 eq.) and Pd(dppf)Cl ₂ ^. CH ₂ Cl ₂ (88 mg; 0.10 mmol; 0.05 eq.) were added. After stirring for 30 min at 110 ⁰C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (5/1) to afford 4- (cyclopent-1-en-1-yl)-2-methoxy-1-nitrobenzene (400 mg; 1.77 mmol; 87% yield; 97% purity) as a yellow solid. LC-MS method I: (M+H) 220.1; Rt: 1.28 min Step 2: 4-cyclopentyl-2-methoxyaniline To a solution of 4-(cyclopent-1-en-1-yl)-2-methoxy-1-nitrobenzene (400 mg; 1.77 mmol; 1.0 eq.) in 10.0 mL MeOH, 10% Pd/C (3.77 g, 3.54 mmol, 2.0 eq.) was added under nitrogen atmosphere. The mixture was hydrogenated at room temperature for 2 h using a hydrogen balloon. The reaction mixture was filtered through a celite pad and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (1/1) to afford 4-cyclopentyl-2-methoxyaniline (180 mg; 0.94 mmol; 53% yield; 100% purity) as a light orange oil. LC-MS method I: (M+H) 192.0; Rt: 0.52 min Aniline intermediate 11: Step 1: 4-(cyclopent-1-en-1-yl)-2-fluoro-1-nitrobenzene 4-Bromo-2-fluoronitrobenzene, (200 mg; 0.88 mmol; 1.0 eq) was dissolved in 10.0 mL 1,4- dioxane.1-cyclopenteneboronic acid pinacol ester (270 mg; 1.32 mmol; 1.50 eq.), K ₂ CO ₃ (366 mg; 2,65 mmol; 3.0 eq), 1.9 mL EtOH and 0.7 mL H ₂ O were added. Nitrogen was bubbled through the reaction mixture and 1,1′-bis(diphenylphosphino)ferrocene]dichloropalladium(II) , complex with dichloromethane (35 mg; 0.044 mmol; 0.05 eq.) was added. The reaction mixture was stirred for 0.5 h at 110 °C under nitrogen atmosphere. The reaction mixture was diluted with AcOEt and washed twice with brine. Then the aqueous layer was washed once with AcOEt. The combined organic layers were dried over Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by flash chromatography (silica gel 12 g; heptane/EtOAc; gradient: 0-50% AcOEt) to afford 4-(cyclopent-1-en-1-yl)-2-fluoro-1- nitrobenzene (181 mg; 0.86 mmol; 97% yield; 98% purity) as yellow solid. LC-MS method A: (M+H) 208.1; Rt: 1.06 min Step 2: 4-cyclopentyl-2-fluoroaniline 4-(Cyclopent-1-en-1-yl)-2-fluoro-1-nitrobenzene (181 mg; 0.87 mmol; 1.0 eq.) was dissolved in 10 mL THF. Then 5% Pd/C (180 mg; 1.69 mmol, 2.0 eq.) was added. The suspension was treated with H ₂ at room temperature and at atmospheric pressure. After 19 h 79 mL H ₂ were consumed. The filtered reaction mixture was reduced to dryness to obtain 4-cyclopentyl-2- fluoroaniline (148 mg; 0.83 mmol; 97% yield; 91% purity) as a dark red oil. LC-MS method A: (M+H) 180.2; Rt: 1.00 min Aniline intermediate 12: Step 1: 5-(cyclopent-1-en-1-yl)-2-nitrobenzonitrile To a mixture of 5-bromo-2-nitrobenzonitrile (500 mg; 2.09 mmol; 1.0 eq.), cyclopent-1-en-1- ylboronic acid (370 mg; 3.14 mmol; 1.50 eq.) and K ₂ CO ₃ (913 mg; 6.28 mmol; 3.0 eq.) in 6.0 mL 1,4-dioxane, 4.0 mL EtOH and 2.0 mL H ₂ O, Pd(dppf)Cl ₂ ^. CH ₂ Cl ₂ (90 mg; 0.11 mmol; 0.05 eq.) was added at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 0.5 h at 110 ⁰C under nitrogen atmosphere. The resulting mixture was diluted with water and extracted with DCM four times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with hexane/EtOAc (10/1) to afford 5-(cyclopent-1-en-1-yl)-2-nitrobenzonitrile (390 mg; 1.59 mmol; 76% yield; 87% purity) as a yellow solid. LC-MS method I: (M+H) 215.1; Rt: 0.92 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 8.34 (d, J = 8.8 Hz, 1H), 8.25 (d, J = 2.0 Hz, 1H), 7.95 (dd, J = 8.7, 2.0 Hz, 1H), 6.84 (td, J = 2.8, 1.4 Hz, 1H), 2.73 (ddq, J = 8.2, 6.7, 2.3 Hz, 2H), 2.57 (tq, J = 7.7, 2.6 Hz, 2H), 2.10 - 1.90 (m, 2H) Step 2: 2-amino-5-cyclopentylbenzonitrile To a solution of 5-(cyclopent-1-en-1-yl)-2-nitrobenzonitrile (390 mg; 1.59 mmol; 1.0 eq.) in 10.0 mL MeOH, 10% Pd/C (3.38 g; 3.18 mmol; 2.0 eq.) was added under nitrogen atmosphere. The mixture was hydrogenated at room temperature for 2 h under a hydrogen atmosphere using a hydrogen balloon, filtered through a celite pad and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (5/1) to afford 2-amino-5-cyclopentylbenzonitrile (160 mg; 0.81 mmol; 51% yield; 94% purity) as a light-yellow oil. LC-MS method I: (M+H)187.0; Rt: 0.70 min Aniline intermediate 13: Step 1: 5-(cyclopent-1-en-1-yl)-2-nitropyridine 5-Bromo-2-nitropyridine (200 mg; 0.97 mmol; 1.0 eq.) was dissolved in 10 mL 1,4-dioxane.1- Cyclopenteneboronic acid pinacol ester (296 mg; 1.45 mmol; 1.5 eq.), potassium carbonate (401 mg; 2.90 mmol; 3.0 eq.); 2.0 mL ethanol and 0.8 mL H ₂ O were added. Nitrogen was bubbled through the reaction mixture and then [1,1′- bis(diphenylphosphino)ferrocene]dichloropalladium(II), complex with DCM (38.6 mg; 0.05 mmol; 0.1 eq.) was added. The reaction mixture was stirred for 0.5 h at 110 °C under nitrogen atmosphere. The resulting mixture was diluted with 2M Na ₂ CO ₃ aqueous solution and the organic phase was washed with brine. The aqueous layer was then extracted with EtOAc three times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by flash chromatography (silica gel 12 g; heptane/AcOEt; gradient: 0-50% AcOEt) to afford 5-(cyclopent-1-en-1-yl)-2- nitropyridine (147 mg; 0.77 mmol; 80% yield; 100% purity) as a yellow solid. LC-MS method A: (M+H) 191.1; Rt: 0.96 min Step 2: 4-cyclopentyl-2-fluoroaniline 5-(Cyclopent-1-en-1-yl)-2-nitropyridine (110 mg; 0.58 mmol; 1.0 eq.) was dissolved in 10 mL THF. Then 5% Pd/C (150 mg; 1.41 mmol, 2.4 eq.) was added. The suspension was treated with H ₂ at room temperature and at atmospheric pressure. After 19 h 149 mL H ₂ were consumed. The filtered reaction mixture was reduced to dryness to get 5-cyclopentylpyridin-2- amine (126 mg; 0.78 mmol; 134% yield; 87% purity) as white crystals. LC-MS method A: (M+H) 163.2; Rt: 0.60 – 0.62 min (double peak) Aniline intermediate 14: 4-(1,3-dimethyl-1H-pyrazol-5-yl)aniline 4-Bromoaniline (200 mg; 1.14 mmol; 1.0 eq.) and (1,3-dimethyl-1H-pyrazol-5-yl)boronic acid (201 mg; 1.37 mmol; 1.2 eq.) were dissolved in 12.0 mL THF, 4.0 mL ethanol and 2.0 mL demineralized water. Then potassium carbonate (787 mg; 5.70 mmol; 5.0 eq.) and Pd(PPh3)4 (66 mg; 0.06 mmol; 0.05 eq.) were added. The mixture was purged with nitrogen and heated to 100 °C for 1 h. The purple reaction mixture was diluted with water and extracted twice with AcOEt. The combined organic layers were dried over Na ₂ SO ₄ , filtered and evaporated to dryness. The residue was purified by flash chromatography using n-heptane/EtOAc (4/6 to 2/8) as eluent to afford 4-(1,3-dimethyl-1H-pyrazol-5-yl)aniline in pure form (84 mg; 0.45 mmol; 39% yield; 100% purity). LC-MS method A: (M+H) 188.1; Rt: 0.91 min Aniline intermediate 15: 4-[1-methyl-3-(trifluoromethyl)-1H-pyrazol-5-yl]aniline 4-Bromoaniline (200 mg; 1.14 mmol; 1.0 eq.) and 1-methyl-3-trifluoromethyl-1H-pyrazole-5- boronic acid (221 mg; 1.14 mmol; 1.0 eq.) were dissolved in 6.0 mL THF 2.0 mL EtOH and 1.0 mL demineralized water. Then potassium carbonate (787 mg; 5.70 mmol; 5.0 eq.) and Pd(PPh ₃ ) ₄ (65.8 mg; 0.06 mmol; 0.05 eq.) were added. The mixture was purged with nitrogen and heated to 100 °C for 1 h. The brown reaction mixture was diluted with water and extracted twice with AcOEt. The combined organic layers were dried over Na ₂ SO ₄ , filtered and evaporated to dryness. The residue was purified by flash chromatography using heptane/EtOAc (6/4) as eluent to afford 4-[1-methyl-3-(trifluoromethyl)-1H-pyrazol-5-yl]aniline (90 mg; 0.37 mmol; 32% yield; 98% purity) as a beige solid. LC-MS method A: (M+H) 242.1; Rt: 0.91 min Aniline intermediate 16: 5-amino-2-(2,2-difluorocyclopentyl)benzamide 5-Amino-2-bromobenzamide (100 mg; 0.45 mmol; 1.0 eq.), 2-bromo-1,1-difluorocyclopentane (261 mg; 1.33 mmol; 3.0 eq.) and Na ₂ CO ₃ (95 mg; 0.89 mmol; 2.0 eq.) were suspended in 3 mL dried ACN and 300 µL dried DMF. Then 4,4’’-di-tert-butyl-2,2’’-bipyridine (2.40 mg; 8.93 mmol; 0.02 eq.), 1,1,1,3,3,3-hexamethyl-2-(trimethylsilyl)trisilane (111 mg; 0.45 mmol; 1.0 eq.), 2,2-dichloro-1,3-dimethyl-1,3-dioxa-2-nickelacyclopentane-1, 3-diium-2,2-diuide (1.96 mg; 8.93 µmol; 0.02 eq.) and Ir[dF(CF ₃ )ppy]2(dtbbpy)PF ₆ (10.0 mg; 8.93 µmol; 0.02 eq.) under argon atmosphere. The light-yellow suspension was irritated with blue light for 21.5 h at room temperature. The reaction was stopped and filtered through kieselguhr. The filter cake was washed with EtOH and the filtrate was reduced to dryness under vacuo. The residue was dissolved in DMSO, filtered through a syringe filter and purified by preparative HPLC (Sunfire RP18, water + 0.1% FA/10-80% ACN + 0.1% FA) giving 5-amino-2-(2,2- difluorocyclopentyl)benzamide (20.0 mg; 0.07 mmol; 17% yield; 89% purity) as a light brown solid. LC-MS method B: (M+H) 241.9; Rt: 1.01 min Aniline intermediate 17: 6-amino-3-cyclopentylpyridine-2-carbonitrile Step 1: 6-amino-3-(cyclopent-1-en-1-yl)pyridine-2-carbonitrile 6-Amino-3-bromo-2-cyanopyridine (400 mg; 1.96 mmol; 1.0 eq.) and 1-cyclopenteneboronic acid pinacol ester (480 mg; 2.35 mmol; 1.2 eq.) were dissolved in 12 mL dried DMF, 2 mL MeOH and 1 mL water. Then K ₂ CO ₃ (813 mg; 5.88 mmol; 3.0 eq.) and [1,1’’- bis(diphenylphosphino)ferrocene]dichloropalladium(II) (81.0 mg; 0.098 mmol; 0.05 eq.) were added under argon atmosphere. The reaction mixture was stirred for 21 h at 100 °C. After reaction completion the mixture was filtered through Kieselguhr, washed with EtOAc and concentrated under reduced pressure. The residue was purified by preparative HPLC (HPLC (Sunfire RP18, water + 0.1% FA/10-70% ACN + 0.1% FA) to afford 6-amino-3-(cyclopent-1- en-1-yl)pyridine-2-carbonitrile (325 mg; 1.67 mmol; 85% yield; 95% purity) as a brown solid. LC-MS method B: (M+H) 186.0; Rt: 1.47 min Step 2: 6-amino-3-cyclopentylpyridine-2-carbonitrile 6-Amino-3-(cyclopent-1-en-1-yl)pyridine-2-carbonitrile (325 mg; 1.75 mmol; 1.0 eq.) was dissolved in 10 mL THF then 5% Pd/C (3.00 g; 28.2 mmol; 16.0 eq.) were added under nitrogen atmosphere. The reaction mixture was hydrogenated overnight at room temperature. The reaction mixture was filtered through Kieselguhr and the filter cake was washed with EtOAc. The filtrate was reduced to dryness under vacuo giving 6-amino-3-cyclopentylpyridine-2- carbonitrile (288 mg; 1.44 mmol; 82% yield; 94% purity) as a brown solid. LC-MS method B: (M+H) 188.0; Rt: 1.49 min Aniline intermediate 18: 2-amino-5-cyclopentylpyridine-3-carbonitrile Step 1: 2-amino-5-(cyclopent-1-en-1-yl)pyridine-3-carbonitrile 2-Amino-5-bromopyridine-3-carbonitrile (1.00 g; 5.05 mmol; 1.0 eq.) and (cyclopent-1-en-1- yl)boronic acid (840 mg; 7.12 mmol; 1.4 eq.) were dissolved in 40 mL 1,4-dioxane and 8 mL water. K ₃ PO ₄ (2.14 g, 9.58 mmol; 1.9 eq.), Pd(OAc) ₂ (224 mg; 0.95 mmol; 0.2 eq.) and X-Phos (480 mg, 0.96 mmol; 0.2 eq.) were added under nitrogen atmosphere. The resulting mixture was stirred for 16 h at 100 °C under nitrogen atmosphere. The reaction mixture was filtered through celite and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE/EtOAc: 10/1) giving 2-amino-5-(cyclopent-1- en-1-yl)pyridine-3-carbonitrile (850 mg; 4.57 mmol; 91% yield; 100% purity). LC-MS method I: (M+H) 186.0; Rt: 0.83 min Step 2: 2-amino-5-cyclopentylpyridine-3-carbonitrile 2-Amino-5-(cyclopent-1-en-1-yl)pyridine-3-carbonitrile (777 mg; 4.18 mmol; 1.0 eq.) was dissolved in 78 mL MeOH.10% Pd/C (311 mg; 0.29 mmol; 0.07 eq.) was added under nitrogen atmosphere. The resulting solution was hydrogenated using a hydrogen balloon for 2 h at rt. The reaction mixture was filtered through celite and the filtrate was concentrated under reduced pressure giving 2-amino-5-cyclopentylpyridine-3-carbonitrile (373 mg; 1.97 mmol; 47% yield; 99% purity) as a white solid. LC-MS method I: (M+H) 188.0; Rt: 0.74 min Aniline intermediate 19: 3-amino-6-cyclopentyl-2-fluorobenzamide Step 1: 6-bromo-2-fluoro-3-nitrobenzoic acid Into a 10 mL sealed tube 2-bromo-6-fluorobenzoic acid (3.00 g; 13.0 mmol; 1.0 eq.) in 9 mL H ₂ SO ₄ was added HNO ₃ (1.20 mL; 26.9 mmol; 2.1 eq.) at -20 °C. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere. To the reaction mixture ice was added at 0 °C and the precipitated solid was collected by vacuum filtration and washed with water. The filter cake was purified by reversed phase column chromatography (water/10-50% ACN) giving 6-bromo-2-fluoro-3-nitrobenzoic acid (700 mg; 2.62 mmol; 20% yield; 99% purity) as a white solid. LC-MS method M: (M+H) 264.2; Rt: 0.16 min Step 2: 6-(cyclopent-1-en-1-yl)-2-fluoro-3-nitrobenzoic acid 6-Bromo-2-fluoro-3-nitrobenzoic acid (700 mg; 2.62 mmol; 1.0 eq.) and 2-(cyclopent-1-en-1- yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (805 mg; 3.94 mmol; 1.5 eq.) were dissolved in 9 mL 1,4-dioxane, 6 mL EtOH and 3 mL water. To this mixture K ₂ CO ₃ (1.15 g; 7.91 mmol; 3.0 eq.) and 1,1’’-bis(diphenylphosphino)ferrocene-palladium(II)dichl oride DCM complex (375 mg; 0.44 mmol; 0.2 eq.) were added under nitrogen atmosphere. The resulting mixture was stirred for 0.5 h at 110 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduces pressure and the residue was purified by silica gel column chromatography (PE/EtOAc: 1/1) giving 6-(cyclopent-1-en-1-yl)-2-fluoro-3-nitrobenzoic acid (650 mg; 2.59 mmol; 99% yield; 100% purity) as a white solid. LC-MS method M: (M+H) 252.1; Rt: 0.78 min Step 3: 6-(cyclopent-1-en-1-yl)-2-fluoro-3-nitrobenzamide 6-(Cyclopent-1-en-1-yl)-2-fluoro-3-nitrobenzoic acid (800 mg; 3.18 mmol; 1.0 eq.) was dissolved in 10 mL DMF. Then NH ₄ Cl (120 mg; 2.13 mmol; 0.7 eq.), HATU (1.2 g, 3.00 mmol; 0.9 eq.) and DIEA (256 mL; 1.40 mmol; 0.4 eq.) were added. The resulting mixture was stirred for 6 h at room temperature under nitrogen atmosphere. The mixture was quenched with water and extracted three times with EtOAc. The combined organic phases were dried over Na ₂ SO ₄ , filtered and evaporated under reduced pressure. The residue was purified by silica gel column chromatography (PE/EtOAc, 1/1) giving 6-(cyclopent-1-en-1-yl)-2-fluoro-3-nitrobenzamide (400 mg; 1.60 mmol; 50% yield; 100% purity). LC-MS method M: (M+H) 251.1; Rt: 0.69 min Step 4: 3-amino-6-cyclopentyl-2-fluorobenzamide 6-(Cyclopent-1-en-1-yl)-2-fluoro-3-nitrobenzamide (300 mg; 1.20 mmol; 1.0 eq.) was dissolved in 10 mL MeOH, then 10% Pd/C (150 mg; 0.14 mmol; 0.1 eq.) was added under nitrogen atmosphere. The resulting solution was hydrogenated using a hydrogen balloon for 1 h at room temperature. The reaction mixture was filtered through celite and the filter cake was washed three times with MeOH. The filtrate was concentrated under reduced pressure and the residue was purified by reversed phase column chromatography (Column: XBridge Prep OBD C18, water (10 mmol/L NH ₄ HCO ₃ + 0.1% NH ₄ OH)/20-50%) giving 2-amino-5-cyclopentylpyridine-3- carbonitrile (222 mg, 0.93 mmol, 77% yield; 93.0% purity) as a white solid. LC-MS method I: (M+H) 223.1; Rt: 0.74 min Aniline intermediate 20: 1-(5-amino-2-cyclopentylphenyl)ethan-1-ol Step 1: 1-[2-(cyclopent-1-en-1-yl)-5-nitrophenyl]ethan-1-one 1-(2-Bromo-5-nitro-phenyl)-ethanone (300 mg; 1.19 mmol; 1.0 eq.), 1-cyclopenteneboronic acid pinacol ester (365 mg; 1.79 mmol; 1.5 eq.) and K ₂ CO ₃ (494 mg; 3.58 mmol; 3.0 eq.) were suspended in 3 mL 1,4-dioxane, 1.5 mL EtOH and 200 µL water. The vial was purged with nitrogen and [1,1’’-bis(diphenylphosphino)ferrocene]dichloropalladium (II), complex with DCM (49 mg; 0.060 mmol; 0.05 eq.) were added. The vial was refilled with nitrogen and stirred in the microwave for 30 min at 110 °C. The reaction mixture was diluted with water and extracted three times with EtOAc. The combined organic layers were dried over Na ₂ SO ₄ , filtered and evaporated. The obtained residue was purified by silica gel column chromatography (n- heptane/0-20% EtOAc) giving 1-[2-(cyclopent-1-en-1-yl)-5-nitrophenyl]ethan-1-one (244 mg; 1.06 mmol; 89% yield; 100% purity) as a light-yellow oil. LC-MS method C: (M+H) 232.0; Rt: 1.71 min Step 2: 1-(5-amino-2-cyclopentylphenyl)ethan-1-ol 1-[2-(Cyclopent-1-en-1-yl)-5-nitrophenyl]ethan-1-one (244 mg; 1.06 mmol; 1.0 eq.) were dissolved in 10 mL THF and 5% Pd/C (~55% H ₂ O) (100 mg; 0.94 mmol; 0.9 eq.) was added. The reaction mixture was hydrogenated overnight at room temperature and atmospheric pressure for 17 h under hydrogen atmosphere absorbing 98 mL hydrogen. The solvent was removed under vacuo and the residue purified by silica gel column chromatography (n- heptane/0-70% EtOAc) giving 1-(5-amino-2-cyclopentylphenyl)ethan-1-ol (68 mg; 0.33 mmol; 31% yield; 100% purity) as a white solid. LC-MS method C: (M+H) 206.2: Rt: 1.15 min Aniline intermediate 21: 3-chloro-5-cyclopentylpyridin-2-amine Step 1: 3-chloro-5-(cyclopent-1-en-1-yl)pyridin-2-amine 5-Bromo-3-chloropyridin-2-amine (1.50 g; 6.87 mmol; 0.7 eq.), (cyclopent-1-en-1-yl)boronic acid (1.20 g; 10.18 mmol; 1.0 eq.) and K ₃ PO ₄ (3.00 g; 13.4 mmol; 1.3 eq.) were dissolved in 60 mL 1,4- dioxane and 12 mL water. Then, Pd(OAc) ₂ (162 mg; 0.69 mmol; 0.07 eq.) and X- Phos (688 mg; 1.37 mmol; 0.1 eq.) were added at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 h at 100 °C under nitrogen atmosphere. The reaction mixture was filtered through celite and the filtrate concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE/EtOAc: 4/1) to afford 3-chloro-5-(cyclopent-1-en-1-yl)pyridin-2-amine (1.10 g; 5.65 mmol; 56% yield; 100% purity) as a light-yellow solid. LC-MS method I: (M+H) 195.1; Rt: 0.74 min Step 2: 3-chloro-5-cyclopentylpyridin-2-amine 3-Chloro-5-(cyclopent-1-en-1-yl)pyridin-2-amine (940 mg; 4.83 mmol; 1.0 eq.) was dissolved in 95 mL MeOH, then 10% Pd/C (376 mg; 0.35 mmol; 0.07 eq.) was added under nitrogen atmosphere. The resulting solution was hydrogenated using a hydrogen balloon for 2 h at room temperature. The mixture was filtered through celite and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE/EtOAc: 1/4) giving 3-chloro-5-cyclopentylpyridin-2-amine (314 mg; 1.54 mmol; 32% yield; 97% purity) as a white solid. LC-MS method I: (M+H) 197.0; Rt: 0.61 min Aniline intermediate 22: 6-cyclopentyl-4-fluoropyridin-3-amine Step 1: 6-(cyclopent-1-en-1-yl)-4-fluoropyridin-3-amine 6-Chloro-4-fluoropyridin-3-amine (1.00 g; 6.48 mmol; 1.0 eq.), (cyclopent-1-en-1-yl)boronic acid (1.15 g; 9.72 mmol; 1.5 eq.) and K ₃ PO ₄ (2.90 g; 12.97 mmol; 2.0 eq.) were dissolved in 40 mL 1,4-dioxane and 8 mL water. Then Pd(OAc) ₂ (153 mg; 0.65 mmol; 0.1 eq.) and X-Phos (651 mg; 1.30 mmol; 0.2 eq.) were added under nitrogen atmosphere at room temperature and the resulting mixture was stirred for 3 h at 100 °C. The solvent was then removed under reduced pressure and purified by silica gel column chromatography (PE/EtOAc, 10/6) giving 6-(cyclopent-1-en-1-yl)-4-fluoropyridin-3-amine (810 mg; 4.43 mmol; 68% yield; 97% purity) as a pink solid. LC-MS method N: (M+H) 179.2; Rt: 1.10 min Step 2: 6-cyclopentyl-4-fluoropyridin-3-amine 6-(Cyclopent-1-en-1-yl)-4-fluoropyridin-3-amine (500 mg; 2.73 mmol; 1.0 eq.) was dissolved in 40 mL MeOH, then 10% Pd/C (300 mg; 0.28 mmol; 0.1 eq.) was added under nitrogen atmosphere. The resulting solution was hydrogenated using a hydrogen balloon for 0.5 h at room temperature. The mixture was filtered through celite and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE/EtOAc, 10/5) giving 6-cyclopentyl-4-fluoropyridin-3-amine (231 mg; 1.23 mmol; 45% yield; 96% purity) as a pink solid. LC-MS method N: (M+H) 181.2; Rt: 1.38 min Aniline intermediate 23: 4-cyclopentyl-2,6-difluoroaniline Step1: 5-(cyclopent-1-en-1-yl)-1,3-difluoro-2-nitrobenzene 5-Bromo-1,3-difluoro-2-nitrobenzene (0.85 g; 3.57 mmol), (cyclopent-1-en-1-yl)boronic acid (0.495 g; 4.27 mmol) and potassium carbonate (1.48 g; 10.71 mmol) were suspended in ethanol absolute (10 mL), 1,4-dioxane (4 mL; 42.86 mmol) and water (12 mL). The suspension was degassed with argon, then [1,1’’-bis(diphenylphosphino)ferrocene]-dichloropalladiu m(II), complex with DCM (0.146 g; 0.18 mmol) was added. The vial was closed with a septum and irradiated at microwave 30 min at 110 °C. The mixture was filtered over Celite, reduced to dryness and purified by chromatography (silica gel; n-heptane/AcOEt; gradient 0-30% AcOEt) to get 5-(cyclopent-1-en-1-yl)-1,3-difluoro-2-nitrobenzene (668 mg; 2.50 mmol; 70.1% yield, 84.4% purity) as a yellow solid. LC-MS method B: (M+H) 225.9; Rt: 1.97 min Step2: 4-cyclopentyl-2,6-difluoroaniline (5-(cyclopent-1-en-1-yl)-1,3-difluoro-2-nitrobenzene (660 mg; 2.35 mmol) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using Pd/C-5% (~54,8% H ₂ O) (1.4 g; 13.15 mmol) as catalyst. After consumption of hydrogen 5.0 (210 mL; 9.37 mmol) the reaction was stopped and filtered off. The filtered reaction mixture was reduced to dryness to afford 4-cyclopentyl-2,6-difluoroaniline (436 mg; 2.21 mmol; 94% yiels; 90% purity) as a red oil. LC-MS method B: (M+H) 198.1; Rt: 1.05 min Aniline intermediate 24: 3-fluoro-5-(pyrrolidin-1-yl)pyridin-2-amine 3-Fluoro-5-iodopyridin-2-amine (500 mg; 2.04 mmol) and pyrrolidine (159.4 mg; 2,24 mmol) were dissolved in 7.5 mL DMSO, then copper(I) iodide (39.6 mg; 0.204 mmol), L-proline (46.9 mg; 0.41 mmol) and potassium carbonate (704 mg; 5.09 mmol) were added and the brown suspension was stirred 4 h at 100 °C.The mixture was filtered over Celite, the filtrate was reduced to dryness and purified by chromatography (reversed phase; water/ACN /0.1% HCOOH; gradient 5-70% ACN/0.1% HCOOH). The fraction was dissolved in AcOEt and treated twice with saturated NaHCO ₃ aqueous solution. The organic phase was dried over Na ₂ SO ₄ , filtered off and reduced to dryness to get 3-fluoro-5-(pyrrolidin-1-yl)pyridin-2-amine (132 mg; 0.701 mmol; 34% yield; 96% purity) as a black solid. UPLC-MS method A: (M+H) 182.4; Rt: 0.63 min Aniline intermediate 25: 3-fluoro-5-[(3S)-3-methylpyrrolidin-1-yl]pyridin-2-amine 3-Fluoro-5-iodopyridin-2-amine (500 mg; 2.04 mmol) and (3S)-3-methylpyrrolidine HCl (281,0 mg; 2.24 mmol) were dissolved in 7,5 mL DMSO, then copper(I) iodide (39.6 mg; 0.20 mmol), L-proline (46.9 mg; 0.41 mmol) and potassium carbonate (985 mg; 7.13 mmol) were added and the dark brown mixture was stirred overnight at 100 °C. The mixture was filtered over Celite, the filtrate was reduced to dryness and purified by RP chromatography (reversed phase; water /ACN/0.1% HCOOH; gradient 5-50% ACN/0.1% HCOOH). The fractions were combined and reduced to dryness. The residue was dissolved in AcOEt and treated twice with saturated NaHCO ₃ aqueous solution to neutralize. The organic phase was dried over Na ₂ SO ₄ , filtered off and reduced to dryness to get 3-fluoro-5-[(3S)-3-methylpyrrolidin-1-yl]pyridin-2-amine (143 mg; 0.72 mmol; 36% yield; 99% purity) as a brown oil. UPLC-MS method A: (M+H) 196.4; Rt: 0.71 min Aniline intermediate 26: 3-fluoro-5-[(3R)-3-fluoropyrrolidin-1-yl]pyridin-2-amine 3-Fluoro-5-iodopyridin-2-amine (500 mg; 2.04 mmol) and (R)-3-fluoropyrrolidine hydrochloride 97% (290.1 mg; 2.22 mmol) were dissolved in 7.5 mL DMSO, then copper(I) iodide (39.6 mg; 0.20 mmol), L-proline (46.9 mg; 0.41 mmol) and potassium carbonate (985.7 mg; 7.13 mmol) were added and the dark brown mixture was stirred 4,5h at 100 °C. The mixture was filtered over Celite, the filtrate was reduced to dryness and purified by chromatography (reversed phase; water/ACN /0.1% HCOOH; gradient 5-50% ACN/0.1% HCOOH). The product fractions were combined, reduced to dryness and then dissolved in AcOEt and treated twice with saturated NaHCO ₃ aqueous solution. The organic phase was dried over Na ₂ SO ₄ , filtered off and reduced to dryness to get 3-fluoro-5-[(3R)-3-fluoropyrrolidin-1-yl]pyridin-2-amine (104 mg; 0.46 mmol; 23% yield; 88% purity) as a dark brown oil. UPLC-MS method A: (M+H) 200.3; Rt: 0.55 min Aniline intermediate 27: 3-fluoro-5-[(3S)-3-fluoropyrrolidin-1-yl]pyridin-2-amine 3-Fluoro-5-iodopyridin-2-amine (500 mg; 2.04 mmol) and (S)-(+)-3-fluoropyrrolidine hydrochloride (290.2 mg; 2,24 mmol) were dissolved in 7.5 mL, then copper(I) iodide (39.6 mg; 0.20 mmol), L-proline (46.9 mg; 0.41 mmol) and potassium carbonate (986 mg mL; 7.13 mmol) were added and the reaction mixture was stirred 2h at 100 °C. The mixture was filtered over Celite, the filtrate was reduced to dryness and purified by chromatography (reversed phase; water/ACN/0.1% HCOOH; gradient 5-40% ACN/0.1% HCOOH). The product fractions were combined, reduced to dryness and then dissolved in AcOEt and treated twice with saturated NaHCO ₃ aqueous solution. The organic phase was dried over Na ₂ SO ₄ , filtered off and reduced to dryness to get 3-fluoro-5-[(3S)-3-fluoropyrrolidin-1-yl]pyridin-2-amine (73 mg; 0.35 mmol; 17% yield; 94% purity) as a dark brown solid. UPLC-MS method A: (M+H) 200.4; Rt: 0.57 min Aniline intermediate 28: 2-amino-5-[(3R)-3-methylpyrrolidin-1-yl]benzonitrile Step 1: 5-[(3R)-3-methylpyrrolidin-1-yl]-2-nitrobenzonitrile 5-Bromo-2-nitrobenzonitrile (415 mg; 1.77 mmol; 1.0 äq.) and (3R)-3-methylpyrrolidine hydrochloride (250 mg; 1.95 mmol; 1.1 eq.) were suspended in 10 mL 1,4-dioxane, anhydrous and cesium carbonate extra pure (2.3 g; 7,09 mmol; 4.0 eq.) was added. The vial was purged with argon, then xantphos (102.6 mg; 0.177 mmol; 0.10 eq.) and tris(dibenzylideneacetone)dipalladium(0) (81.2 mg; 0.089 mmol; 0.05 eq.) were added. The vial was closed with a septum and stirred in a microwave 30 min at 110 °C. The mixture was absorbed on silica gel and purified by chromatography (silica gel; n-heptane/AcOEt; gradient 0-60% AcOEt) to get 5-[(3R)-3-methylpyrrolidin-1-yl]-2-nitrobenzonitrile (379.1 mg; 1.16 mmol; 66% yield; 71% purity) as a yellow oil. UPLC-MS method A: (M+H) 176.0; Rt: 1.049 min Step 2: 2-amino-5-[(3R)-3-methylpyrrolidin-1-yl]benzonitrile 5-[(3R)-3-methylpyrrolidin-1-yl]-2-nitrobenzonitrile (1,47 mmol; 480 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 300 mg Pd/C-5% as catalyst. After consumption of 85 mL of hydrogen, the reaction was stopped. The reaction mixture was filtered over celite and the resulting filtrate was evaporated to dryness to yield 2-amino-5-[(3R)-3-methylpyrrolidin-1-yl]benzonitrile (315 mg; 1.2 mmol; 82% yield; 77% purity) as a dark brown oil, which was used without further purification. UPLC-MS method A (M+H) 202.1; Rt: 0.835 min Aniline intermediate 29: 4-(1,1,1,2,3,3,3-heptafluoropropan-2-yl)aniline To a vigorously stirred 2-phase mixture comprising tert-butyl methyl ether (5.1 mL; 10 V) and water (7.65 mL; 15 V) was added aniline (0.50 mL; 5.48 mmol; 1.0 eq.), sodium dithionite (1.14 g; 6.57 mmol; 1.2 eq.), sodium hydrogen carbonate (0.55 g; 6.57 mmol; 1.2 eq.) and tetra-n- butylammonium hydrogen sulfate (0.19 g; 0.55 mmol; 0.1 eq.). To this mixed solution heptafluoro-2-iodopropane (0.92 mL; 6.30 mmol; 1.15 eq.) was added dropwise and stirred vigorously for 3 h at rt. The organic layer was washed with 6 mL 1N HCl and saturated NaHCO ₃ aqueous solution, dried Na ₂ SO ₄ , filtrated and evaporated. The residue was purified by flash chromatography (silica gel, heptane/0 - 40% AcOEt) to afford 4-(1,1,1,2,3,3,3- heptafluoropropan-2-yl)aniline (697 mg; 2.60 mmol; 48% yield; 98% purity) as a light yellow oil. UPLC-MS method A: (M+H) 262.1; Rt: 0.80 min Aniline intermediate 30: 2-amino-5-[(3S)-3-methylpyrrolidin-1-yl]benzonitrile Step 1: 5-[(3S)-3-methylpyrrolidin-1-yl]-2-nitrobenzonitrile 5-bromo-2-nitrobenzonitrile (415 mg; 1.77 mmol; 1.0 eq.) and (3S)-3-methylpyrrolidine HCl (250 mg; 1.95 mmol; 1.1 eq.) were suspended in 10 mL 1,4-dioxane, anhydrous and cesium carbonate (2.3 g; 7,09 mmol; 4.0 eq.) was added. The vial was purged with argon, then xantphos (102.6 mg; 0.177 mmol; 0.10 eq.) and tris(dibenzylideneacetone)dipalladium(0) (81.2 mg; 0.089 mmol; 0.05 eq.) were added. The vial was closed with a septum and stirred in a microwave 30 min at 110 °C. The mixture was absorbed on silica gel and purified by chromatography (silica gel; n-heptane/AcOEt; gradient 0-60% AcOEt) to get 5-[(3S)-3- methylpyrrolidin-1-yl]-2-nitrobenzonitrile (280 mg; 1.16 mmol; yield 66%; 96% purity) as a yellow orange solid. UPLC-MS method A: (M+H) 232.1; Rt: 1.051 min Step 2: 2-amino-5-[(3S)-3-methylpyrrolidin-1-yl]benzonitrile 5-[(3R)-3-methylpyrrolidin-1-yl]-2-nitrobenzonitrile (1,17 mmol; 280 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 300 mg Pd/C-5% as catalyst. After consumption of 123 mL of hydrogen, the reaction was stopped. The reaction mixture was filtered over celite and the resulting filtrate was evaporated to dryness to yield 2-amino-5-[(3S)-3-methylpyrrolidin-1-yl]benzonitrile (223.5 mg; 0.93 mmol; yield 84%; 80% purity) as a khaki colored greasy solid which was used without further purification. UPLC-MS method A: (M+H) 202.1; Rt: 0.843 min Aniline intermediate 31: 3-fluoro-5-(propan-2-yl)pyridin-2-amine Step 1: 3-fluoro-2-nitro-5-(prop-1-en-2-yl)pyridine Under argon atmosphere 5-bromo-3-fluoro-2-nitropyridine (1.83 mmol; 425 mg), Isopropenylboronic acid pinacol ester (2.74 mmol; 150 mol%; 485 mg) and potassium carbonate (5.48 mmol; 300 mol%; 758 mg) were suspended in 0.5 mL methanol, 1 mL demineralized water and 4.25 mL 1,4-dioxane. Then [1,1’’- bis(diphenylphosphino)ferrocene]dichloropalladium(II), complex with DCM (0.09 mmol; 5 mol%; 76 mg) was added and the experiment was heated by microwave (100 °C; 20 min). The reaction mixture was filtered over celite. The filtrate was reduced by vacuum and then absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n- heptane/0 - 50% EA to get 3-fluoro-2-nitro-5-(prop-1-en-2-yl)pyridine (273 mg; 1.48 mmol; 81% yield; 99% purity) as light orange needles. LC-MS method B: (M+H) 183.1; Rt: 1.524 min Step 2: 3-fluoro-5-(propan-2-yl)pyridin-2-amine 3-Fluoro-2-nitro-5-(prop-1-en-2-yl)pyridine (1.19 mmol; 220 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 200 mg Pd/C-5% as catalyst. After consumption of 113 mL of hydrogen the reaction was stopped. The reaction mixture was filtered over celite and was evaporated to residue to get 3-fluoro-5- (propan-2-yl)pyridin-2-amine (178 mg; 1.02 mmol; 86% yield; 88% purity) as a red oil. LC-MS method B: (M+H) 155.1; Rt: 0.928 min Aniline intermediate 32: 5-cyclopentyl-3-fluoropyridin-2-amine Step 1: 5-(cyclopent-1-en-1-yl)-3-fluoro-2-nitropyridine 5-Bromo-3-fluoro-2-nitropyridine (1 g; 4.39 mmol; 1 eq.) and 1-cyclopenteneboronic acid pinacol ester were dissolved in 1 mL dried methanol, 10 mL dried 1,4-dioxane and 2.5 mL demineralized water. Then potassium carbonate (1.8 g; 13,17 mmol; 3 eq.) and [1,1’’- bis(diphenylphosphino)ferrocene]dichloropalladium(II), complex with DCM (181.4 mg; 0.22 mmol; 0.050 eq.) were added, flushed with argon, closed with the septum and stirred in a microwave for 30 min at 100 °C. The mixture was filtered over Celite, and the filtrate was reduced to dryness. The residue was purified by flash chromatography (40 g silica gel, heptane/0 - 40% AcOEt) to get 5-(cyclopent-1-en-1-yl)-3-fluoro-2-nitropyridine (770 mg; 3.69 mmol; 84% yield; 99% purity) as a yellow solid. UPLC-MS method A: (M+H) 209.1; Rt: 0.769 min Step 2: 5-cyclopentyl-3-fluoropyridin-2-amine 5-(cyclopent-1-en-1-yl)-3-fluoro-2-nitropyridine (770 mg, 3.69 mmol) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 0.400 g Pd/C-5% (3.76 mmol, 54.8% water) as catalyst. After consumption of 325 mL hydrogen gas the reaction was stopped. The reaction mixture was filtered over celite, the celite was washed with THF and MeOH and the resulting filtrate was evaporated to dryness to yield 5-cyclopentyl- 3-fluoropyridin-2-amine (648 mg, 3.38 mmol, 91.6% yield, 94% purity) as brown solid which was used without further purification. UPLC-MS method A:(M+H) 181.1; Rt: 0.425 min Aniline intermediate 33: 5-cyclohexyl-3-fluoropyridin-2-amine Step 1: 5-(cyclohex-1-en-1-yl)-3-fluoro-2-nitropyridine Under argon atmosphere 5-bromo-3-fluoro-2-nitropyridine (2.15 mmol; 500 mg), 1- cyclohexenylboronic acid (3.22 mmol; 150 mol%; 406 mg) and potassium carbonate (6.45 mmol; 300 mol%; 891 mg) were suspended in 0.5 mL methanol, 1 mL demineralized water and 4 mL 1,4-dioxane in a microwave vessel (2-5 mL). Then [1,1’’- bis(diphenylphosphino)ferrocene]dichloropalladium(II), complex with DCM (0.11 mmol; 5 mol%; 89 mg) was added and heated by microwave (100 °C; 4 h). The reaction mixture was filtered over celite. The filtrate was reduced by vacuum and then absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n-heptane/0% - 50% EA to get 5-(cyclohex-1-en-1-yl)-3-fluoro-2-nitropyridine (236 mg; 1.04 mmol; 48% yield; 98% purity) as yellow crystals. LC-MS method B: (M+H) 223.1; Rt: 1.799 min Step 2: 5-cyclohexyl-3-fluoropyridin-2-amine 5-(Cyclohex-1-en-1-yl)-3-fluoro-2-nitropyridine (1.04 mmol; 236 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 200 mg Pd/C-5% as catalyst. After consumption of 105 mL of hydrogen the reaction was stopped. The reaction mixture was filtered over celite. The celite was washed with THF and MeOH and the resulting filtrate was evaporated to dryness. The residue was dissolved in THF, absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n- heptane/0 - 20% EA to get 5-cyclohexyl-3-fluoropyridin-2-amine (178mg; 0.88 mmol; 84.4% yield; 96% purity) as a yellow solid. LC-MS method B: (M+H) 195.1; Rt: 1.186 min Aniline intermediate 34: 5-(butan-2-yl)-3-fluoropyridin-2-amine Step 1: 5-[(2E)-but-2-en-2-yl]-3-fluoro-2-nitropyridine Under argon atmosphere 5-bromo-3-fluoro-2-nitropyridine (2.15 mmol; 500 mg), (Z)-2-buten- 2-ylboronic acid pinacol ester (3.22 mmol; 150 mol%; 605 mg) and potassium carbonate (6.45 mmol; 300 mol%; 891 mg) were suspended in 0.5 mL methanol, 1 mL demineralized water and 4 mL 1,4-dioxane. Then [1,1’’-bis(diphenylphosphino)ferrocene]dichloropalladium (II), complex with DCM (0.11 mmol; 5 mol%; 89 mg) was added and heated by microwave (110 °C; 9 h). The residue was dissolved in THF, absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n-heptane/0 - 45% EA) to get 5-[(2E)-but-2- en-2-yl]-3-fluoro-2-nitropyridine (214 mg; 1.03 mmol; 47.9% yield; 94% purity) as a yellow solid. LC-MS method B:(M+H) 197.1; Rt: 1.637 min Step 2: 5-(butan-2-yl)-3-fluoropyridin-2-amine 5-[(2E)-but-2-en-2-yl]-3-fluoro-2-nitropyridine (1.03 mmol; 214 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 200 mg Pd/C-5% as catalyst. After consumption of 125 mL of hydrogen gas the reaction was stopped. The reaction mixture was filtered over celite, the celite was washed with THF and MeOH and the resulting filtrate was evaporated to dryness to yield 5-(butan-2-yl)-3- fluoropyridin-2-amine (172 mg; 0.95 mmol; 92,4% yield; 93% purity) as a; yellow oil which was used without further purification. LC-MS method B: (M+H) 169.1; Rt: 1.045 min Aniline intermediate 35: 3-fluoro-5-(1,1,1-trifluoropropan-2-yl)pyridin-2-amine Step 1: 3-fluoro-2-nitro-5-(3,3,3-trifluoroprop-1-en-2-yl)pyridine Under argon atmosphere 5-bromo-3-fluoro-2-nitropyridine (2.15 mmol; 500 mg), 4,4,6- trimethyl-2-[1-(trifluoromethyl)vinyl]-1,3,2-dioxaborinane (2.58 mmol; 120 mol%; 573 mg) and potassium carbonate (6.45 mmol; 300 mol%; 891 mg) were suspended in 0.5 mL methanol, 1 mL demineralized water and 4 mL 1,4-dioxane. Then [1,1’’- bis(diphenylphosphino)ferrocene]dichloropalladium(II), complex with DCM (0.11 mmol; 5 mol%; 89 mg) was added and stirred at 60 °C for 30 min. The reaction mixture was absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n- heptane/0 - 30% EA to get 3-fluoro-2-nitro-5-(3,3,3-trifluoroprop-1-en-2-yl)pyridine (120 mg; 0.49 mmol; 22.7% yield; 96% purity) as a yellow oil. LC-MS method B:(M+H) 236.9; Rt: 1.612 min Step 2: 3-fluoro-5-(1,1,1-trifluoropropan-2-yl)pyridin-2-amine 3-fluoro-2-nitro-5-(3,3,3-trifluoroprop-1-en-2-yl)pyridine (0.49 mmol; 120 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 100 mg Pd/C-5% as catalyst. After consumption of 74 mL hydrogen gas the reaction was stopped. The reaction mixture was filtered over celite, the celite was washed with THF and MeOH and the resulting filtrate was evaporated to dryness to yield 3-fluoro-5-(1,1,1- trifluoropropan-2-yl)pyridin-2-amine (92 mg; 0.38 mmol; 78.5% yield; 87% purity) as a brown oil which was used without further purification. LC-MS method B:(M+H) 209.1; Rt: 1.161 min Aniline intermediate 36: 3-fluoro-5-(2-methylpropyl)pyridin-2-amine Step 1: 3-fluoro-5-(2-methylprop-1-en-1-yl)-2-nitropyridine Under argon atmosphere 5-bromo-3-fluoro-2-nitropyridine (2.15 mmol; 500 mg), 2,2- Dimethylethenylboronic acid (3.22 mmol; 150 mol%; 339 mg) and sodium hydrogen carbonate (6.45 mmol; 300 mol%; 542 mg) were suspended in 1 mL demineralized water and 4 mL 1,4- dioxane. Then [1,1’’ bis(diphenylphosphino) ferrocene]dichloropalladium(II), complex with dichloromethane (0.11 mmol; 5 mol%; 89 mg) was added and stirred at 60 °C for 2 h. The reaction mixture was filtered over celite. The filtrate was reduced by vacuum and then absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n- heptane/0 - 30% EA) to get 3-fluoro-5-(2-methylprop-1-en-1-yl)-2-nitropyridine (437 mg; 2.21 mmol; 103% yield; 99% purity) as a yellow solid. LC-MS method B:(M+H) 197.1; Rt: 1.633 min Step 2: 3-fluoro-5-(2-methylpropyl)pyridin-2-amine 3-fluoro-5-(2-methylprop-1-en-1-yl)-2-nitropyridine (2.21 mmol; 437 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 0.2 g Pd/C-5% as catalyst. After consumption of 193 mL hydrogen gas the reaction was stopped. The reaction mixture was filtered over celite, the celite was washed with THF and MeOH and the resulting filtrate was evaporated to dryness to yield 370 mg of 3-fluoro-5-(2- methylpropyl)pyridin-2-amine (63 mg; 0.34 mmol; 16% yield; 91% purity) as a light-yellow oil which was used without further purification. LC-MS method B:(M+H) 169.1; Rt: 1.043 min Aniline intermediate 37: 4-cyclopentyl-2,5-difluoroaniline Step 1: 4-(cyclopent-1-en-1-yl)-2,5-difluoroaniline 4-Bromo-2,5-difluoroaniline (2.40 mmol; 500 mg), 1-cyclopenteneboronic acid pinacol ester (2.64 mmol; 110 mol%; 540 mg), potassium phosphate (7.21 mmol; 300 mol%; 1.53 g) and 2- dicyclohexylphosphino-2‘‘,4‘‘,6‘‘-tri-isopropyl- 1,1‘‘-biphenyl (0.48 mmol; 20 mol%; 229 mg) were suspended in 5 mL demineralized water and 5 mL THF. The suspension was flushed with nitrogen (approx. 1 min). Then tris(dibenzylideneacetone)dipalladium(0) (0.12 mmol; 5 mol%; 110 mg) was added and heated by microwave (80 °C; 2 h). The reaction mixture was absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n-heptane/0 - 20% EA) to get 4-(cyclopent-1-en-1-yl)-2,5-difluoroaniline (510 mg; 2.33 mmol; 97% yield; 89% purity) as a light brown oil. LC-MS method B: (M+H) 196.0; Rt: 1.844 min Step 2: 4-cyclopentyl-2,5-difluoroaniline 4-(Cyclopent-1-en-1-yl)-2,5-difluoroaniline (1.37 mmol; 300 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using 300 mg Pd/C-5% as catalyst. After consumption of 52 mL hydrogen gas the reaction was stopped. The reaction mixture was filtered over celite, the celite was washed with THF and MeOH and the resulting filtrate was evaporated to dryness: 288 mg. The residue was dissolved in THF, absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n-heptane/0 - 15% EA) to get 4-cyclopentyl-2,5-difluoroaniline (139 mg; 0.64 mmol; 47% yield; 91% purity) as a yellow oil. LC-MS method B: (M+H) 198.1; Rt: 1.855 min Aniline intermediate 38: 3-fluoro-5-[(3R)-3-methylpyrrolidin-1-yl]pyridin-2-amine 3-Fluoro-5-iodopyridin-2-amine (500 mg; 2.03 mmol) and (3R)-3-methylpyrrolidine HCl (286 mg; 2.24 mmol) were dissolved in 7.5 mL DMSO, then copper(I) iodide (39 mg; 0.20 mmol), L- proline (46 mg; 0.41 mmol) and potassium carbonate (406 µL; 7.13 mmol) were added and the reaction mixture was stirred overnight at 100 °C. The mixture was filtered over Celite, the filtrate was reduced to dryness and purified by RP chromatography (reversed phase; water/ACN/0.1% HCOOH; gradient 5-40% ACN /0.1% HCOOH). The product fractions were combined, reduced and the residue dissolved in AcOEt and treated twice with saturated NaHCO ₃ aqueous solution. The organic phase was dried over Na ₂ SO ₄ , filtered off and reduced to dryness to get 3-fluoro-5-[(3R)-3-methylpyrrolidin-1-yl]pyridin-2-amine as a dark brown oil (144 mg; 0.69 mmol; 34% yield; 93% purity). UPLC-MS method A: (M+H) 196.1; Rt: 0.70 min Aniline intermediate 39: 4-(3,3-difluoroazetidin-1-yl)aniline Step 1: 3,3-difluoro-1-(4-nitrophenyl)azetidine In a reactor under argon atmosphere, 1-iodo-4-nitrobenzene (0.048 g, 0.19 mmol, 1 eq.), 3,3- difluoroazetidine hydrochloride (0.03 g, 0.23 mmol, 1.2 eq.), sodium tert-butoxide (0.049 g, 0.49 mmol, 2.6 eq.), Pd ₂ (dba) ₃ (0.009 g, 0.01 mmol, 0.05 eq.), xantphos (0.011 g, 0.02 mmol, 0.1 eq.) and dry 1,4-dioxane degassed (1 mL) were placed. Three vacuum/argon cycles were performed, and the mixture was heated at 90 °C for 1 h. HPLC-MS analysis showed the presence of the planned product. After cooling to room temperature, the mixture was diluted with AcOEt, washed with H ₂ O three times, once with brine, dried over Na ₂ SO ₄ and evaporated. The crude was purified by chromatographic column hexane/AcOEt (9/1) to afford the title compound (0.029 g, 0.14 mmol, 72% yield, 100% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.51 (t, J=12.28 Hz, 4 H) 6.51 - 6.69 (m, 2 H) 7.95 - 8.25 (m, 2 H) Step 2: 4-(3,3-difluoroazetidin-1-yl)aniline 3,3-Difluoro-1-(4-nitrophenyl)azetidine (0.025 g, 0.12 mmol, 1 eq.) was dissolved in EtOH (5 mL). H-cube hydrogenation was performed on Pd/C 10%, 3 bar, 1mL/min at room temperature. HPLC-MS analysis revealed the formation of the target product along with 5% of remaining starting material. The reaction mixture was evaporated to dryness and the product was used in the next step without further purification (yellow brown oil, 0.020 g, 0.10 mmol, 83% yield, 89% purity). HPLC-MS Method C: (M+H) 185.10; Rt: 1.72 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.06 (t, J=12.20 Hz, 4 H) 4.54 (s, 2 H) 6.30 - 6.37 (m, 2 H) 6.47 - 6.54 (m, 2 H) Aniline intermediate 40: 2-amino-5-cyclopentylpyridine-4-carbonitrile Step 1: 2-amino-5-(cyclopent-1-en-1-yl)pyridine-4-carbonitrile 2-Amino-5-bromopyridine-4-carbonitrile (0.4 g, 1.92 mmol, 1 eq.), (cyclopent-1-en-1-yl)boronic acid (0.289 g, 2.49 mmol, 1.3 eq.) and potassium carbonate (0.804 g, 5.76 mmol, 3 eq.) were suspended in 1,4-dioxane (3 mL), EtOH (2 mL), and H ₂ O (1 mL) and three vacuum/argon cycles were performed.1,1’’-Bis(diphenylphosphino)ferrocenepalladium (II) dichloride (0.072 g, 0.1 mmol, 0.05 eq.) was added and additional three vacuum/argon cycles were performed. The mixture was heated at 95 °C for 30 min. HPLC-MS analysis showed the formation of the target compound. After cooling to room temperature, the mixture was extracted with AcOEt 3 times, organic layers were combined and washed with brine, dried on Na ₂ SO ₄ and evaporated. The product was purified by chromatographic column hexane/AcOEt (9/1 to 6/4) to afford the title compound (pale yellow solid, 0.342 g, 1.85 mmol, 96% yield, 100% purity). HPLC-MS Method C: (M+H) 186.20; Rt: 4.05 min Step 2: 2-amino-5-cyclopentylpyridine-4-carbonitrile 2-Amino-5-(cyclopent-1-en-1-yl)pyridine-4-carbonitrile (0.339 g, 1.83 mmol, 1 eq.) was dissolved in EtOH (82 mL). H-cube hydrogenation was performed on Pd/C 10%, 30 bar, 1 mL/min at room temperature. HPLC-MS analysis had revealed the formation of desired product with no starting material left. The reaction mixture was evaporated to dryness and the product was used in the next step without further purification (pale yellow solid, 0.322 g, 1.72 mmol, 94% yield, 100% purity). HPLC-MS Method C: (M+H) 188.20; Rt: 3.99 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.52 - 1.83 (m, 6 H) 1.93 - 2.06 (m, 2 H) 2.97 - 3.07 (m, 1 H) 6.29 (s, 2 H) 6.70 (d, J=0.61 Hz, 1 H) 8.07 (s, 1 H) Aniline intermediate 41: 2-(cyclopent-1-en-1-yl)pyrimidin-5-amine 5-Amino-2-bromopyrimidine (0.348 g, 1.90 mmol, 1eq.), cyclopenten-1-yl boronic acid (0.263 g, 2.28 mmol, 1.2 eq.) and potassium carbonate (0.795 g, 5.70 mmol, 3 eq.) were suspended in dry 1,4-dioxane (4.5 mL), EtOH (2.5 mL) and H ₂ O (1.2 mL). Three vacuum/argon cycles were performed and [1,1’’-bis(diphenylphosphino) ferrocene] dichloropalladium(II) complex with DCM (0.079 g, 0.10 mmol, 0.05 eq.) was added. An additional three vacuum/argon cycles were performed. The mixture was heated at 95 °C for 4 h. After cooling the mixture to room temperature, solvents were evaporated and the residue was diluted with DCM, washed with H ₂ O, dried over Na ₂ SO ₄ and evaporated. The residue was purified by chromatographic column hexane/AcOEt (6/4 to AcOEt 100%) to give the title compound as light orange solid (0.305 g, 1.89 mmol, 99% yield, 100% purity). HPLC-MS Method A: (M+H) 162.2; Rt: 2.26 min Aniline intermediate 42: 2-cyclopentylpyrimidin-5-amine To a solution of 2-(cyclopent-1-en-1-yl)pyrimidin-5-amine (0.300 g, 1.86 mmol, 1 eq.) in MeOH (15 mL) Pd/C-10% (0.250 g) was added and the suspension was hydrogenated in a Parr apparatus at 50 psi for 3.5 h. The mixture was then filtered on a celite cake and washed with MeOH then solvent was evaporated. The residue was purified by chromatographic column DCM to DCM/MeOH (95/5) to give the target compound as white solid (0.183 g, 1.12 mmol, 60% yield, 100% purity). HPLC-MS Method A: (M+H) 164.3; Rt: 2.10 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.38 - 1.80 (m, 6 H) 1.86 - 1.98 (m, 2 H) 3.10 (quin, J=8.05 Hz, 1 H) 5.26 (s, 2 H) 8.02 (s, 2 H) Aniline intermediate 43: 5-(cyclopent-1-en-yl)pyrazin-2-amine 2-Amino-5-bromopyrazine (0.174 g, 0.97 mmol, 1 eq.), cyclopenten-1-yl boronic acid (0.134 g, 1.16 mmol, 1.2 eq.) and potassium carbonate (0.406 g, 2.91 mmol, 3 eq.) were suspended in 1,4-dioxane (1.5 mL), EtOH (1.0 mL) and H ₂ O (0.5 mL) and three vacuum/argon cycles were performed. [1,1’’-bis(diphenylphosphino) ferrocene] dichloropalladium(II) complex with dichloromethane (0.040 g, 0.05 mmol, 0.05 eq.) was added and additional three vacuum/argon cycles were performed. The mixture was heated at 90 °C for 30 min. After cooling the mixture to room temperature, solvents were evaporated and the residue was diluted with DCM, washed with H ₂ O, dried over Na ₂ SO ₄ and evaporated. The residue was purified by chromatographic column hexane/AcOEt (6/4 to 4/6) to give the title compound as white solid (0.120 g, 0.74 mmol, 77% yield, 100% purity). HPLC-MS Method A: (M+H) 162.20; Rt: 2.80 min Aniline intermediate 44: 2-cyclopentylpyrazin-2-amine To a solution of 5-(cyclopent-1-en-yl)pyrazin-2-amine (0.090 g, 0.56 mmol, 1eq.) in MeOH (20 mL) Pd/C-10% (0.100 g) was added and the suspension was hydrogenated in a Parr apparatus at 50 psi for 2.5 h.. The mixture was then filtered on a celite cake and washed with MeOH then the solvent was evaporated. The residue was purified by chromatographic column hexane/AcOEt (7/3 to 1/1) to give the target compound as a white solid (0.072 g, 0.44 mmol, 79% yield, 100% purity). HPLC-MS Method A: (M+H) 164.30; Rt: 2.76 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.54 - 1.65 (m, 4 H) 1.67 - 1.76 (m, 2 H) 1.84 - 1.93 (m, 2 H) 2.91 - 3.02 (m, 1 H) 6.10 (s, 2 H) 7.76 (d, J=1.37 Hz, 1H) 7.81 (d, J=1.37 Hz, 1 H) Aniline intermediate 45: 4-(1-methyl-cyclohexyl)-phenylamine Step 1: 1-(methyl-cyclohexyl)-benzene To a solution of methylcyclohexanol (0.500 g, 4.38 mmol, 1 eq.) in benzene (3 mL), H ₂ SO ₄ conc (2 mL) was added dropwise at 0 °C. The reaction mixture was stirred for 2 h at room temperature, then diluted with AcOEt. The organic phase was washed with H ₂ O and dried over Na ₂ SO ₄ . The solvent was evaporated under reduced pressure and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (98/2) to afford the title compound as a colorless oil (0.390 g, 2.24 mmol, 51% yield, 80% purity). HPLC-MS Method H: Rt: 5.01 min Step 2: 1-(1-methyl-cyclohexyl)-4-nitro-benzene To a suspension of 1-(methyl-cyclohexyl)-benzene (0.100 g, 0.57 mmol, 1 eq.) in Ac ₂ O (0.5 mL), a solution of conc. HNO ₃ (0.030 mL, 0.57 mmol, 1 eq.) and Ac ₂ O (0.1 mL) were added at 0 °C. The reaction mixture was stirred at room temperature until the disappearance of the starting material (2 h), then poured in icy water and the aqueous phase was extracted with Et ₂ O. The organic extracts were dried over Na ₂ SO ₄ and the solvent was evaporated under reduced pressure. The crude was purified by flash chromatography on silica gel eluting with hexane/DCM (95/5) to give the target product as a solid (0.075 g, 0.342 mmol, 60% yield, 75% purity). HPLC-MS Method H: Rt: 4.57 min Step 3: 4-(1-methyl-cyclohexyl)-phenylamine 1-(1-methyl-cyclohexyl)-4-nitrobenzene (0.020 g, 0.09 mmol, 1 eq.) was dissolved in EtOH (2 mL) under ineRt:atmosphere. Ammonium formate (0.057 g, 0.9 mmol, 10 eq.) and 10% Pd/C (0.003 g, 15%) were added and the reaction mixture was heated at reflux until the disappearance of the starting material (3 h). The reaction mixture was cooled to room temperature and filtered throught a celite pad to remove the catalyst. The solvent was removed under vacuum to afford the title compound as a solid (0.017 g, 0.09 mmol, 98% yield, 100% purity). HPLC-MS Method A: (M+H) 190.0; Rt: 1.41 min Aniline intermediate 46: 2-[(4-cyclohexylphenyl)amino]ethan-1-ol To a solution of 4-cyclohexylaniline (0.050 g, 0.28 mmol, 1 eq.) in DMF (1 mL), Cs ₂ CO ₃ (0.137 g, 0.42 mmol, 1.5 eq.) and 2-iodoethan-1-ol (0.02 mL, 0.28 mmol, 1 eq.) were added. The reaction mixture was stirred at 70 °C under microwave irradiation for 1.5 h. After cooling the mixture to room temperature, the solvent was evaporated under reduced pressure and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to give the target product as a brown oil (0.050 g, 0.22 mmol, 79% yield, 96% purity). HPLC-MS Method C: (M+H) 220.3; Rt: 2.18 min Aniline intermediate 47: 4-{2-azaspiro[3.3]heptan-2-yl}aniline Step 1: 2-(4-nitrophenyl)-2-azaspiro[3.3]heptane In a microwave vial, under argon atmosphere, 1-iodo-4-nitrobenzene (0.199 g, 0.80 mmol, 1 eq.), 2-azaspiro[3.3]heptane hydrochloride (0.135 g, 0.96 mmol, 1.2 eq.), Pd ₂ (dba) ₃ (0.037 g, 0.04 mmol, 0.05 eq.), xantphos (0.048 g, 0.08 mmol, 0.1 eq.), NaOtBu (0.238 g, 2.4 mmol, 3 eq.) and dry 1,4 dioxane degassed (4.2 mL) were added. The mixture was heated (microwave) at 110 °C for 2 h. HPLC-MS analysis revealed the disappearance of the starting material and the presence of the desired product. The mixture was diluted with AcOEt, washed with H ₂ O and brine, dried on Na ₂ SO ₄ , filtered and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt 9/1 to afford the title compound as an orange solid (0.123 g, 0.56 mmol, 70% yield, 97% purity). HPLC-MS Method C: (M+H) 219.1; Rt: 3.49 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.81 (t, J=7.63 Hz, 2 H) 2.20 (t, J=7.63 Hz, 4 H) 4.01 (s, 4 H) 6.37 - 6.44 (m, 2 H) 7.97 - 8.07 (m, 2 H) Step 2: 4-{2-azaspiro[3.3]heptan-2-yl}aniline 2-(4-Nitrophenyl)-2-azaspiro[3.3]heptane (0.122 g, 0.56 mmol, 1 eq.) was dissolved in EtOH (9 mL) and DCM (3.5 mL). H-cube hydrogenation was performed on Pd/C 10%, 3 bar, 1 mL/min at room temperature. HPLC-MS analysis revealed the formation of the target product. The reaction mixture was evaporated to dryness and the product was used in the next step without further purification (brown oil, 0.095 g, 0.50 mmol, 90% yield, 100% purity). HPLC-MS Method C: (M+H) 189.1; Rt: 0.93 min Aniline intermediate 48: 4-{6,6-difluoro-2-azaspiro[3.3]heptan-2-yl}aniline

Step 1: 6,6-difluoro-2-(4-nitrophenyl)-2-azaspiro[3.3]heptane In a microwave vial, under argon atmosphere, 1-iodo-4-nitrobenzene (0.199 g, 0.80 mmol, 1 eq.), 6,6-difluoro-2-azaspiro[3.3]heptane hydrochloride (0.171 g, 0.96 mmol, 1.2 eq.), Pd ₂ (dba) ₃ (0.037 g, 0.04 mmol, 0.05 eq.), xantphos (0.048 g, 0.08 mmol, 0.1 eq.), NaOtBu (0.238 g, 2.4 mmol, 3 eq.) and 1,4-dioxane dry degassed (4.2 mL) were added. The mixture was heated (microwave) at 110 °C for 1 h. HPLC-MS analysis revealed the disappearance of the starting material and the presence of the desired product. The mixture was diluted with AcOEt, washed with H ₂ O and brine, dried on Na ₂ SO ₄ , filtered and evaporated to dryness. The crude was purified by chromatographic column DCM/acetone 97/3 to afford the title compound as an orange solid (0.201 g, 0.79 mmol, 99% yield, 97% purity). HPLC-MS Method C: (M+H) 255.1; Rt: 2.72 min Step 2: 4-{6,6-difluoro-2-azaspiro[3.3]heptan-2-yl}aniline 6,6-Difluoro-2-(4-nitrophenyl)-2-azaspiro[3.3]heptane (0.200 g, 0.79 mmol, 1 eq.) was dissolved in EtOH (17 mL). H-cube hydrogenation was performed on Pd/C 10%, 3 bar, 1mL/min at room temperature. HPLC-MS analysis revealed the formation of the target product. The reaction mixture was evaporated to dryness and the product was used in the next step without further purification (brown solid, 0.112 g, 0.50 mmol, 63% yield, 100% purity). HPLC-MS Method C: (M+H) 224.1; Rt: 0.98 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.79 (t, J=12.58 Hz, 4 H) 3.70 (s, 4 H) 4.43 (br. s., 2 H) 6.22 (d, J=8.39 Hz, 2 H) 6.46 (d, J=8.39 Hz, 2 H) Aniline intermediate 49: 5-amino-2-cyclopentyl-4-fluorobenzonitrile Step 1: 5-amino-2-(cyclopent-1-en-1-yl)-4-fluorobenzonitrile 5-Amino-2-bromo-4-fluorobenzonitrile (0.387 g, 1.80 mmol, 1 eq.), (cyclopent-1-en-1- yl)boronic acid (0.415 g, 3.60 mmol, 2 eq.) and cesium carbonate (1.777 g, 5.40 mmol, 3 eq.) were suspended in toluene (12.5 mL) and H ₂ O (4 mL) and three vacuum/argon cycles were performed. Palladium acetate (0.082 g.0.36 mmol.0.2 eq.) and tricyclohexylphosphine (0.100 g, 0.36 mmol, 0.2 eq.) were added and an additional three vacuum/argon cycles were performed. The mixture was heated at 110 °C for 3 h. HPLC-MS analysis revealed the disappearance of the starting material and the formation of the desired product. The mixture was diluted with water and extracted with AcOEt. The organic layer was washed with brine, dried over Na ₂ SO ₄ filtered and evaporated. The product was purified by chromatographic column hexane/AcOEt (9/1) to give the planned compound as an orange solid (0.190 g, 0.94 mmol, 52% yield, 95% purity). HRMS (ESI) calcd for C ₁₂ H ₁₁ FN ₂ [M + H] ⁺ 203.0979, found 203.0978 Step 2: 5-amino-2-cyclopentyl-4-fluorobenzonitrile 5-Amino-2-(cyclopent-1-en-1-yl)-4-fluorobenzonitrile (0.190 g, 0.94 mmol, 1 eq.) was dissolved in DCM (18 mL). H-cube hydrogenation was performed on Pd/C 10%, 60 bar, 1 mL/min at room temperature. HPLC-MS analysis revealed the formation of the target product. The reaction mixture was evaporated to dryness and product was used in next step without further purification (white solid, 0.121 g, 0.59 mmol, 63% yield, 87% purity). HRMS (ESI) calcd for C ₁₂ H ₁₃ FN ₂ [M + H] ⁺ 205.1136, found 205.1132 Aniline intermediate 50: 4-cyclopentyl-2-methylaniline Step 1: 4-(cyclopent-1-en-1-yl)-2-methylaniline 4-Bromo-2-methylaniline (0.201 g, 1.07 mmol, 1 eq.), (cyclopent-1-en-1-yl)boronic acid (0.247 g, 2.14 mmol, 2 eq.) and cesium carbonate (1.056 g, 3.21 mmol, 3 eq.) were suspended in toluene (7 mL) and H ₂ O (2.3 mL) and three vacuum/argon cycles were performed. Palladium acetate (0.049 g.0.21 mmol.0.2 eq.) and tricyclohexylphosphine (0.060 g, 0.21 mmol, 0.2 eq.) were added and an additional three vacuum/argon cycles were performed. The mixture was heated at 110 °C for 3 h. HPLC-MS analysis revealed the disappearance of the starting material and the formation of the desired product. The mixture was diluted with water and extracted with AcOEt. The organic layer was washed with brine, dried over Na ₂ SO ₄ filtered and evaporated. The product was purified by chromatographic column hexane/AcOEt (85/15) to give the planned compound as an orange oil (0.116 g, 0.67 mmol, 62% yield, 90% purity). HPLC-MS Method C: (M+H) 174.0; Rt: 2.66 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.83 - 1.96 (m, 2 H) 2.04 (s, 3 H) 2.37 - 2.46 (m, 2 H) 2.54 - 2.59 (m, 2 H) 4.87 (s, 2 H) 5.90 (t, J=1.98 Hz, 1 H) 6.53 (d, J=8.24 Hz, 1 H) 7.00 (dd, J=8.24, 1.98 Hz, 1 H) 7.03 (s, 1 H) Step 2: 4-cyclopentyl-2-methylaniline 4-(Cyclopent-1-en-1-yl)-2-methylaniline (0.116 g, 0.67 mmol, 1 eq.) was dissolved in MeOH (13.5 mL). H-cube hydrogenation was performed on Pd/C 10%, 60 bar, 1 mL/min at room temperature. HPLC-MS analysis revealed the formation of the target product. The reaction mixture was evaporated to dryness and the product was used in the next step without further purification (orange oil, 0.106 g, 0.60 mmol, 90% yield, 90% purity). HPLC-MS Method C: (M+H) 176.0; Rt: 2.85 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.33 - 1.48 (m, 2 H) 1.50 - 1.64 (m, 2 H) 1.64 - 1.78 (m, 2 H) 1.84 - 1.94 (m, 2 H) 1.99 - 2.04 (m, 3 H) 2.70 - 2.82 (m, 1 H) 4.65 (br. s., 2 H) 6.51 (d, J=8.08 Hz, 1 H) 6.75 (dd, J=7.93, 2.14 Hz, 1 H) 6.78 (s, 1 H) Aniline intermediate 51: 4-cyclopentyl-2-fluoro-6-methylaniline Step 1: 4-(cyclopent-1-en-1-yl)-2-fluoro-6-methylaniline 4-Bromo-2-fluoro-6-methylaniline (0.200 g, 0.98 mmol, 1 eq.), (cyclopent-1-en-1-yl)boronic acid (0.226 g, 1.96 mmol, 2 eq.) and cesium carbonate (0.968 g, 2.94 mmol, 3 eq.) were suspended in toluene (6 mL) and H ₂ O (2 mL) and three vacuum/argon cycles were performed. Palladium acetate (0.045 g. 0.20 mmol. 0.2 eq.) and tricyclohexylphosphine (0.055 g, 0.20 mmol, 0.2 eq.) were added and an additional three vacuum/argon cycles were performed. The mixture was heated at 110 °C for 3 h. HPLC-MS analysis revealed the disappearance of the starting material and the formation of the desired product. The mixture was diluted with water and extracted with AcOEt. The organic layer was washed with brine, dried over Na ₂ SO ₄ filtered and evaporated. The product was purified by chromatographic column hexane/AcOEt (85/15) to give the planned compound as a red oil (0.186 g, 0.97 mmol, 99% yield, 99% purity). HPLC-MS Method C: (M+H) 192.0; Rt: 3.17 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.90 (quin, J=7.47 Hz, 2 H) 2.11 (s, 3 H) 2.40 - 2.45 (m, 2 H) 2.55 (td, J=7.59, 2.06 Hz, 2 H) 4.88 (s, 2 H) 6.00 (t, J=1.98 Hz, 1 H) 6.90 (s, 1 H) 6.97 (dd, J=12.66, 1.53 Hz, 1 H) Step 2: 4-cyclopentyl-2-fluoro-6-methylaniline 4-(Cyclopent-1-en-1-yl)-2-fluoro-6-methylaniline (0.186 g, 0.97 mmol, 1 eq.) was dissolved in MeOH (24 mL). H-cube hydrogenation was performed on Pd/C 10%, 60 bar, 1 mL/min at room temperature. HPLC-MS analysis revealed the formation of the target product. The reaction mixture was evaporated to dryness and the product was used in the next step without further purification (orange oil, 0.166 g, 0.86 mmol, 89% yield, 95% purity). HPLC-MS Method C: (M+H) 194.0; Rt: 3.38 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.32 - 1.49 (m, 2 H) 1.50 - 1.64 (m, 2 H) 1.64 - 1.79 (m, 2 H) 1.85 - 1.97 (m, 2 H) 2.06 - 2.10 (m, 3 H) 2.71 - 2.84 (m, 1 H) 4.58 (br. s., 2 H) 6.67 (s, 1 H) 6.71 (dd, J=12.35, 1.83 Hz, 1 H) Aniline intermediate 53: 5-cyclopentyl-3-methylpyridin-2-amine Step 1: 5-(cyclopent-1-en-1-yl)-3-methylpyridin-2-amine 5-Bromo-3-methylpyridin-2-amine (0.202 g, 1.06 mmol, 1 eq.), (cyclopent-1-en-1-yl)boronic acid (0.245 g, 2.12 mmol, 2 eq.) and cesium carbonate (1.047 g, 3.18 mmol, 3 eq.) were suspended in toluene (6.5 mL) and H ₂ O (2.1 mL) and three vacuum/argon cycles were performed. Palladium acetate (0.049 g.0.21 mmol.0.2 eq.) and tricyclohexylphosphine (0.059 g, 0.21 mmol, 0.2 eq.) were added and an additional three vacuum/argon cycles were performed. The mixture was heated at 110 °C for 3 h. HPLC-MS analysis revealed the disappearance of the starting material and the formation of the desired product. The mixture was diluted with water and extracted with AcOEt. The organic layer was washed with brine, dried over Na ₂ SO ₄ filtered and evaporated. The product was purified by chromatographic column hexane/AcOEt (85/15) to give the planned compound as a beige solid (0.146 g, 0.84 mmol, 79% yield, 100% purity). HPLC-MS Method C: (M+H) 175.0; Rt: 1.01 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.91 (quin, J=7.47 Hz, 2 H) 2.04 (s, 3 H) 2.39 - 2.46 (m, 2 H) 2.57 (td, J=7.51, 2.06 Hz, 2 H) 5.74 (s, 2 H) 6.00 (t, J=1.98 Hz, 1 H) 7.40 (d, J=1.22 Hz, 1 H) 7.81 - 7.86 (m, 1 H) Step 2: 5-cyclopentyl-3-methylpyridin-2-amine 5-(Cyclopent-1-en-1-yl)-3-methylpyridin-2-amine (0.146 g, 0.84 mmol, 1 eq.) was dissolved in MeOH (18 mL). H-cube hydrogenation was performed on Pd/C 10%, 60 bar, 1mL/min at room temperature. HPLC-MS analysis revealed the formation of the target product. The reaction mixture was evaporated to dryness and the product was used in the next step without further purification (orange oil, 0.081 g, 0.46 mmol, 55% yield, 89% purity). HPLC-MS Method C: (M+H) 177.0; Rt: 0.78 min Amine intermediate 54: 6-[4-(propan-2-yl)phenyl]-[1,2,4]triazolo[1,5-a]pyridin-2-am ine 6-Bromo-[1,2,4]triazolo[1,5-a]pyridin-2-ylamine (552 mg; 1.79 mmol), 4- isopropylbenzeneboronic acid (586 mg; 3.58 mmol) and potassium carbonate (494 mg; 3.58 mmol) were suspended in 8.3 mL ethanol absolute and 8.3 mL water. The suspension was degassed with argon, then tetrakis(triphenylphosphine) palladium(0) (124 mg; 0.11 mmol) was added. The vial was closed with a septum and irradiated at microwave 1.5 h at 130 °C. The mixture was filtered over Celite, reduced to dryness and purified by chromatography (silica gel; n-heptane/AcOEt; gradient 0-100% AcOEt) to get 6-[4-(propan-2-yl)phenyl]-[1,2,4]triazolo[1,5- a]pyridin-2-amine (286 mg; 1.13 mmol; 63% yield; 99% purity) as a pale brown solid. UPLC-MS method A: (M+H) 253.5; Rt: 0.98 min Amine intermediate 55: 5-amino-2-(1,1,2,2,3,3,3-heptafluoropropyl)benzamide 5-Amino-2-bromobenzamide (1.00 g; 4.46 mmol; 1.0 eq.) was dissolved in 15 mL dry DMSO, copper fine powder (710 mg; 11.16 mmol; 2.5 eq.) and perfluoropropyl iodide (3.2 mL; 22.32 mmol; 5.0 eq.) were added under argon atmosphere. The dark orange reaction suspension was stirred at 90 °C for 1 h in the microwave. The reaction suspension was diluted AcOEt, stirred for 5 min and filtrated over celite. The filtrate was diluted with water and the aqueous phase was extracted 2 x with AcOEt. The combined organic phase was washed with water and brine, dried over Na ₂ SO ₄ , filtrated and evaporated to get 5-amino-2-(1,1,2,2,3,3,3- heptafluoropropyl)benzamide (267 mg; 0.84 mmol; 19% yield; 95.8% purity) as a brown solid. HPLC-MS Method B: (M+H) 305.1; Rt: 1.37 min Aniline intermediate 56: 5-(1,1,2,2,3,3,3-heptafluoropropyl)-3-methyl-pyridin-2-amine In a Biotage microwave vial (30 mL) under argon atmosphere, 5-iodo-3-methyl-pyridin-2-amine (1 g, 4.2728 mmol) was added and dissolved in DMSO over molecular sieves (20 mL, 280 mmol).. Argon was bubbled for 15'.1,1,1,2,2,3,3-heptafluoro-3-iodo-propane (2 equiv., 8.5455 mmol, 1.30 mL) and copper (1.5 equiv., 6.4092 mmol, 0.4073 g) were added. The vial was capped, the final brown-orange suspension was stirred in a oil bath at 120°C for 4 h. HPLC/MS analysis showed mainly starting material (83%), 10% of desired product. 1,1,1,2,2,3,3- heptafluoro-3-iodo-propane (2 equiv., 8.5455 mmol, 1.30 mL) and copper (1.5 equiv., 6.4092 mmol, 0.4073 g) were newly added and the mixture was stirred in a oil bath at 120°C for 16h. HPLC/MS analysis showed complete conversion, 64% of desired product at 254 nm. The mixture was diluted with water, extracted three times with DCM. The organic phase was filtered over celite pad, then washed with brine, dried on Na ₂ SO ₄ and filtered.Purified by flash chromatography (silica): crude (brown oil) diluted in minimum amount of DCM, eluant (hexane/AcOEt 8/2). Fractions were collected affording 5-(1,1,2,2,3,3,3-heptafluoropropyl)-3- methyl-pyridin-2-amine (620 mg, 2.2452 mmol, 52.5% yield) as orange-brown solid. HPLC-MS Method C: (M+H) 277.2; Rt: 4.66 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.08 (s, 3 H) 6.59 (br. s., 1 H) 7.43 (s, 1 H) 8.01 (br. s., 1 H) Aniline intermediate 57: 3-fluoro-5-[1,1,2,2-tetrafluoro-2(trifluoromethoxy)ethyl] pyridin- 2-amine Prepared using appropriate intermediates according to procedure described for aniline intermediate 56. HRMS (ESI) calcd for C ₁₆ H ₈ BrF ₈ N ₃ O ₃ [M + H] ⁺ 296.01960, found 296.01656 Aniline intermediate 58: 2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-[(4- methoxyphenyl)methoxy]aniline Step 11-fluoro-5-iodo-3-[(4-methoxyphenyl)methoxy]-2-nitro-benzen e Prepared using appropriate intermediates according to procedure described in ACS Medicinal Chemistry Letters (2019), 10(3), 358-362; HRMS (ESI) calcd for C ₁₄ H ₁₂ FINO ₄ [M + H] ⁺ 403.9790, found 403.9795 Step 21- 2-fluoro-4-iodo-6-[(4-methoxyphenyl)methoxy]aniline A mixture of 1-fluoro-5-iodo-3-[(4-methoxyphenyl)methoxy]-2-nitro-benzene (1.0 g, 2.48 mmol), iron powder (1.5 g, 26.8 mmol) and NH ₄ Cl (0.46 g, 2.95 mmol) was taken up in ethanol (10 mL) and water (10 mL) and heated at 90 °C for 3 h. After cooling to ambient temperature, the reaction mixture was filtered through a celite bed and the filtrate concentrated in vacuo.The aqueous residue was extracted with DCM and the organic layer washed with brine, dried Na ₂ SO ₄ and concentrated in vacuo to give 2-fluoro-4-iodo-6-[(4- methoxyphenyl)methoxy]aniline which was used without further purification. (0.920 g, 2.46 mmol, 99% yield) HRMS (ESI) calcd for C ₁₄ H ₁₄ FINO ₂ [M + H] ⁺ 374.005, found 374.007 Step 32-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-[(4- methoxyphenyl)methoxy]aniline Prepared using appropriate intermediates according to procedure described for aniline 56 HRMS (ESI) calcd for C ₁₇ H ₁₄ F ₈ NO ₂ [M + H] ⁺ 416.0891, found 416.0899 Amide intermediate 1: N-(5-cyclopentylpyrimidin-2-yl)-2-iodo-5-nitrobenzamide

Step 1: 5-(cyclopent-1-en-1-yl) pyrimidin-2-amine To a solution of 5-bromopyrimidin-2-amine (5.0 g; 27.30 mmol; 1.0 eq.) and (cyclopent-1-en- 1-yl) boronic acid (3.86 g; 32.76 mmol; 1.2 eq.) in 30.0 mL 1,4-dioxane, 10.0 mL ethanol and 10.0 mL water were added followed by K ₂ CO ₃ (11.9 g; 81.90 mmol; 3.0 eq.) and Pd(dppf)Cl ₂ ^. CH ₂ Cl ₂ (1.17 g; 1.37 mmol; 0.05 eq.) under nitrogen atmosphere. The reaction mixture was stirred for 30 min at 110 °C. The reaction mixture was quenched with water at room temperature and the aqueous layer was extracted with DCM three times. The combined organic layers were dried over Na ₂ SO ₄ , filtered and concentrated under vacuo. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH (1/1) to afford 5- (cyclopent-1-en-1-yl) pyrimidin-2-amine in pure form (4.0 g; 24.34 mmol; 89% yield; 98% purity) as a yellow solid. LC-MS method K: (M+H) 162.2; Rt: 0.91 min Step 2: 5-cyclopentylpyrimidin-2-amine To a stirred mixture of 5-(cyclopent-1-en-1-yl)pyrimidin-2-amine (4.0 g; 24.81 mmol; 1.0 eq.) in 80.0 mL methanol was added 10% Pt/C (19.4 g; 9.92 mmol; 0.04 eq.) at room temperature. The resulting mixture was stirred for 1 h at room temperature under hydrogen atmosphere. The precipitate was collected by vacuum filtration and washed with dichloromethane three times. The filtrate was concentrated under reduced pressure and the residue was purified by silica gel column chromatography, eluted with PE/AcOEt (1/1) to afford 5-cyclopentylpyrimidin- 2-amine in pure form (6.0 g; 33.12 mmol; 67% yield; 90% purity) as a white solid. LC-MS method G: (M+H) 164.0; Rt: 0.47 min Step 3: N-(5-cyclopentylpyrimidin-2-yl)-2-iodo-5-nitrobenzamide 2-Iodo-5-nitrobenzoic acid (1.0 g; 3.24 mmol; 1.0 eq.) was dissolved in thionyl chloride (3.0 mL; 39.3 mmol; 12.3 eq.) at room temperature. The resulting mixture was stirred for 1 h at 80 °C. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in 5.0 mL DCM and 5-cyclopentylpyrimidin-2-amine (560 mg; 3.19 mmol; 1.0 eq.) and pyridine (2.0 mL; 24.85 mmol; 7.8 eq.) were added. The resulting mixture was stirred for 1 h at room temperature under argon atmosphere, concentrated under reduced pressure and the residue was purified by silica gel column chromatography, eluted with PE/AcOEt (1/1) to afford N-(5-cyclopentylpyrimidin-2-yl)-2-iodo-5-nitrobenzamide in pure form (900 mg; 1.99 mmol; 62% yield; 97% purity) as a yellow solid. LC-MS method G: (M+H) 438.9; Rt: 0.67 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ = 11.27 (s, 1H), 8.53 (s, 2H), 8.27 - 8.12 (m, 2H), 7.96 (dd, J = 8.6, 2.7 Hz, 1H), 3.01-2.90 (m, 1H), 2.11 - 1.94 (m, 2H), 1.84 - 1.71 (m, 2H), 1.71 - 1.44 (m, 4H) Amide intermediate 2: 2-chloro-N-(5-cyclopentylpyrimidin-2-yl)-5-nitrobenzamide 2-chloro-5-nitrobenzoic acid (100 mg; 0.49 mmol; 1.0 eq,) was dissolved in 10.0 mL THF under a nitrogen atmosphere and triethylamine (84.2 µl; 0.61 mmol; 1.25 eq.) was added. The reaction solution was cooled to 5 °C, a solution of isobutyl chloroformate (72.7 µL; 0.56 mmol; 1.2 eq.) in 1.0 mL THF was added dropwise and the mixture was stirred for 30 min at 5 °C. Then a solution of 5-cyclopentylpyrimidin-2-amine (79.4 mg; 0.49 mmol; 1.0 eq.) in 5.0 mL THF was added dropwise. The reaction mixture was stirred for 1 h at 5 °C and overnight at room temperature. The reaction mixture was diluted with a 5% aqueous NaHCO ₃ solution and extracted with AcOEt twice. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure. The residue was purified by flash chromatography eluted with 100% n-heptane to n-heptane/AcOEt 6/4 to afford 2-chloro-N-(5- cyclopentylpyrimidin-2-yl)-5-nitrobenzamide in pure form (34 mg; 0.09 mmol; 19% yield; 93% purity) as a yellow oil. LC-MS method B: (M+H) 347.1; Rt: 1.63 min Amide-intermediate 3: 2-cyclopentyl-5-(2-iodo-5-nitrobenzamido)-benzamide

Step 1: 2-(cyclopent-1-en-1-yl)-5-nitrobenzonitrile 2-Bromo-5-nitrobenzonitrile (4.0 g; 17.1 mmol; 1.0 eq.), 1-cyclopenteneboronic acid pinacol ester (5.24 g; 25.6 mmol; 1.5 eq.), potassium carbonate (7.0 g; 51.3 mmol; 3.0 eq.) and [1,1‘‘- bis(diphenylphosphino)ferrocene] dichloropalladium(II) complex with DCM (760 mg; 0.92 mmol; 0.05 eq.) were suspended in 40 mL dried 1,4-dioxane, 20 mL EtOH and 10 mL demineralized water. The vial was purged with nitrogen and stirred in a microwave for 30 min at 110 °C. The reaction mixture was diluted with water and extracted three times with EtOAc. The combined organic layers were dried over Na ₂ SO ₄ , filtered and evaporated. The residue purified by flash chromatography (silica gel, eluent A: n-heptane; eluent B: n-heptane/EA 8/2; gradient 1-20%) to obtain 2-(cyclopent-1-en-1-yl)-5-nitrobenzonitrile (3.3 g; 15.4 mmol; 90% yield; 100% purity) as yellow oil which crystallized. LC-MS method B: (M+H) 215.1 mmol; Rt: 1.80 min Step 2: 5-amino-2-cyclopentylbenzonitrile 2-(Cyclopent-1-en-1-yl)-5-nitrobenzonitrile (500 mg; 2.33 mmol; 1.0 eq.) was dissolved in 10 mL THF.5% Pd/C (500 mg; 4.70 mmol; 2.0 eq.) was added and the suspension was treated with H ₂ at room temperature and atmospheric pressure. After 2 h 209 mL H ₂ were consumed. The filtered reaction mixture was reduced to dryness to obtain 5-amino-2- cyclopentylbenzonitrile (411 mg; 2.13 mmol; 91% yield; 97% purity) as a yellow oil. LC-MS method A: (M+H) 187.1; Rt: 0.96 min Step 3: 5-amino-2-cyclopentylbenzamide 5-Amino-2-cyclopentylbenzonitrile (554 mg; 2.80 mmol; 1.0 eq.) was stirred in 5.5 mL sulfuric acid (95-98%) for 1 h at 80 °C under argon atmosphere. The red reaction solution was poured into ice-water and basified with 2 M NaOH. The precipitate was filtered off, washed with water and dried under vacuum to obtain 5-amino-2-cyclopentylbenzamide (441 mg; 2.06 mmol; 74% yield; 96% purity) as a beige solid. LC-MS method A: (M+H) 187.1; Rt: 0.96 min Step 4: 2-cyclopentyl-5-(2-iodo-5-nitrobenzamido)benzamide Under argon atmosphere 2--iodo-5-nitro-benzoic acid (144 mg; 0.47 mmol; 1.0 eq.) was dissolved in 2.0 mL DMF and NMM (129 µL; 1.17 mmol; 2.5 eq.), 5--amino-2- cyclopentylbenzamide (100 mg; 0.47 mmol; 1.0 eq.) and then HATU (267 mg; 0.70 mmol; 1.5 eq.) were added. The brown reaction solution was stirred for 2 h at room temperature. The brown reaction solution was poured into water and stirred for 5 min. The formed precipitate was collected by vacuum filtration, washed with water and dried under vacuum. The obtained solid was purified by using flash chromatography (heptane/EtOAc gradient 0 - 100%) to obtain 2-cyclopentyl-5-(2-iodo-5-nitrobenzamido)benzamide (176 mg; 0.36 mmol; 77% yield; 98% purity) as a light-yellow solid. LC-MS method A: (M+H) 480.0; Rt: 0.95 min Amide-intermediate 4: N-(5-cyclohexyl-3-fluoropyridin-2-yl)-2-iodo-5 nitrobenzamide Step 1: 5-(cyclohex-1-en-1-yl)-3-fluoro-2-nitropyridine Under argon atmosphere 5-bromo-3-fluoro-2-nitropyridine (2.15 mmol; 500 mg), 1- cyclohexenylboronic acid (3.22 mmol; 406 mg) and potassium carbonate (6.45 mmol; 891 mg) were suspended in 500 µl methanol, 1 mL demineralized water and 4 mL 1,4-dioxane. Then [1,1’’-bis(diphenylphosphino)ferrocene]dichloropalladium (II), complex with DCM (0.11 mmol; 89 mg) was added and the experiment was heated by microwave (100 °C; 3.5 h). The reaction mixture was filtered over celite. The filtrate was reduced by vacuum and then absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n- heptane/0% - 50% EA). The pure product vials were combined and evaporated to dryness to get 5-(cyclohex-1-en-1-yl)-3-fluoro-2-nitropyridine (236,00 mg; 1.04 mmol; 48% yield; 98% purity) as yellow crystals. LC-MS method A: (M+H) 223.1; Rt: 1.80 min Step 2: 5-cyclohexyl-3-fluoropyridin-2-amine 5-(Cyclohex-1-en-1-yl)-3-fluoro-2-nitropyridine (1.04 mmol; 236 mg) was dissolved in 10 mL THF and hydrogenated at room temperature and atmospheric pressure overnight using Pd/C 5%, (200 mg) as catalyst. After consumption of hydrogen gas (105 mL) the reaction was stopped. The reaction mixture was filtered over celite, the celite was washed with THF and MeOH and the resulting filtrate was evaporated to dryness. The residue was dissolved in THF, absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n-heptane/0 - 20% EA). The pure product vials were combined and were evaporated to dryness to get 5-cyclohexyl-3-fluoropyridin-2-amine (178 mg; 0.88 mmol; 84,4% yield; 96% purity; yellow solid). LC-MS method A: (M+H) 195.1; Rt: 1.186 min Step 3: N-(5-cyclohexyl-3-fluoropyridin-2-yl)-2-iodo-5-nitrobenzamid e Using the general procedure of amide coupling method D to get N-(5-cyclohexyl-3- fluoropyridin-2-yl)-2-iodo-5-nitrobenzamide (97.2 mg; 0.21 mmol; 70% yield; 99% purity) as a beige solid. UPLC/MS method A: (M+H) 470.0; Rt: 1.19 min Amide-intermediate 5: N-(5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-yl)-2-iodo -5- nitrobenzamide Step 1: 5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-amine 5-Bromo-3-fluoropyridin-2-amine (389 mg; 2.00 mmol), potassium {bicyclo[3.1.0] hexan-1- yl}trifluoroboranuide (360 mg; 1.82 mmol) and cesium carbonate (2.37 g) were suspended in 6 mL 1,4-dioxane and 0.6 mL demineralized water. Nitrogen was then bubbled through the reaction mixture and cataCXium A Pd G395% (79 mg; 0.11 mmol) was added. The reaction mixture was stirred for 16 h at 100 °C. The reaction mixture was filtered off and rinsed with 1,4- dioxane. The layer was evaporated. The residue was purified by prep HPLC. The pure product fractions were combined and evaporated. The light wet residue was basified with 5% NaHCO ₃ aqueous solution and extracted twice with AcOEt. The combined org. layers were dried over Na ₂ SO ₄ , filtered and evaporated to afford 5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-amine (230 mg; 1.2 mmol; 66% yield; 100% purity) as a yellow oil. LC-MS method A: (M+H) 193.1; Rt: 1.78 min Step 2: N-(5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-yl)-2-iodo -5-nitrobenzamide Using the general procedure D of amide coupling to afford N-(5-{bicyclo[3.1.0]hexan-1-yl}-3- fluoropyridin-2-yl)-2-iodo-5-nitrobenzamide (72 mg; 0.15 mmol; 74% yield; 100% purity) as a yellow solid. UPLC-MS method A: (M+H) 468.2; Rt: 1.15 min Amide-intermediate 6: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2- iodo-5-nitrobenzamide Step 1: 3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-amine 3-Fluoro-5-iodopyridin-2-amine (500 mg; 2.04 mmol) was dissolved in 10 mL dried dimethylsulfoxid, copper powder (324 mg; 5.1 mmol; 2.5 eq.) and perfluoropropyl iodide (1.5 mL; 10.2 mmol; 5 eq.) were added under argon atmosphere. The dark orange reaction suspension was stirred at 120 °C for 4 h. The reaction suspension was diluted with water and extracted 3x with DCM. The organic phase was filtrated over celite, washed with brine, dried over Na ₂ SO ₄ , filtrated over celite and evaporated. The residue was purified by flash chromatographie (40 g silica gel; heptane/0 - 50% AcOEt) to get 3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-amine (324 mg; 1.14 mmol; 56% yield; 99% purity) a a light beige solid. LC-MS method B: (M+H) 280.9; Rt: 1.7 min Step 2: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-iodo-5- nitrobenzamide 2-Iodo-5-nitrobenzoic acid (250 mg; 0.84 mmol) and 3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-amine (270 mg; 0.95 mmol; 1,14 eq.) were dissolved in 5 mL dried pyridine. Then phosphoryl chloride (84 µl; 0.92 mmol; 1.1 eq.) was added and the yellow solution was stirred for 1 h at rt and overnight at 40 °C. The orange-brown reaction suspension was diluted with AcOEt, washed 4 times with water and twice with brine. The organic phase was dried over Na ₂ SO ₄ , filtrated and evaporated. The residue was purified by flash chromatography (40 g silica gel, heptane/0 - 50% AcOEt) to get N-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-yl]-2-iodo-5-nitrobenzamide (166 mg; 0.3 mmol; 36% yield; 100% purity) as a white solid. LC-MS method B: (M+H) 555.6; Rt: 1.9 min Amide-intermediate 7: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-iodo-5-nitrobenzami de 2-Iodo-5-nitrobenzoic acid (3.5 mmol; 100 mol%; 1 g) was dissolved in 5 mL dried pyridine. Then phosphoryl chloride (3.8 mmol; 110 mol%; 351 µL) was added and the yellow solution was stirred for 10 min at RT. Then a solution of 5-cyclopentyl-3-fluoropyridin-2-amine (3.5 mmol; 100 mol%; 646 mg) in 2 mL dried DCM was added. The experiment was stirred at rt for 1.5 h. The reaction mixture was quenched with DCM/water. Then sat. NaHCO ₃ solution was added until pH 8 was reached. The org. layer was separated and washed with water and brine. The organic layer was dried over Na ₂ SO ₄ , filtered and evaporated. The residue was dissolved in THF and was absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n-heptane/0 - 100% EA) to get N-(5-cyclopentyl-3-fluoropyridin-2- yl)-2-iodo-5-nitrobenzamide (861 mg; 1.2 mmol; 34% yield; 63% purity) as a brown solid. LC-MS method B: (M+H) 455.8; Rt: 1.832 min Amide-intermediate 8: N-[5-(2,2-difluorocyclopentyl)-3-fluoropyridin-2-yl]-2-iodo- 5- nitrobenzamide Step 1: 2-(6-amino-5-fluoropyridin-3-yl)cyclopent-2-en-1-one Into a 250-mL round-bottom flask, were added 2-iodocyclopent-2-en-1-one (5.00 g; 22.84 mmol), 3-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyri din-2-amine hydrochloride (7.60 g; 27.41 mmol), Pd(dppf)Cl ₂ (1.76 g; 2.29 mmol), Cs ₂ CO ₃ (30.10 g; 91.46 mmol), 120 mL 1,4-dioxane, and 40 mL H ₂ O at room temperature. The flask was purged and maintained with an atmosphere of N ₂ . The resulting mixture was stirred for 1 h at 90 °C. The resulting mixture was cooled to room temperature, and then quenched with 200 mL of water. The resulting mixture was extracted with EtOAc. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EtOAc/PE (0 to 50% over 35 min). This resulted in 2-(6-amino-5-fluoropyridin-3-yl)cyclopent-2-en-1-one (3.50 g; 18.01 mmol; 79% yield; 99% purity) as a yellow solid. LC-MS method O: (M+H) 193.2; Rt: 0.14 min Step 2: N-acetyl-N-[3-fluoro-5-(5-oxocyclopent-1-en-1-yl)pyridin-2-y l]acetamide Into a 250-mL round-bottom flask, were added 2-(6-amino-5-fluoropyridin-3-yl)cyclopent-2-en- 1-one (2.50 g; 12.86 mmol), DCM (120 mL), acetyl chloride (9.66 mL; 128.65 mmol), and Et ₃ N (26.35 mL; 192.93 mmol) at 0 °C in an ice/water bath. The cooling bath was removed, and the resulting mixture was stirred for 2 h at room temperature. The reaction mixture was diluted with 200 mL of DCM, and then quenched with 250 mL of water. The organic phase was collected, and then washed with 2x200 mL brine, and dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EtOAc /PE (0 to 45% over 40 min). This resulted in N-acetyl-N- [3-fluoro-5-(5-oxocyclopent-1-en-1-yl)pyridin-2-yl]acetamide (2.70 g; 8.64 mmol; 67% yield; 88% purity) as a yellow solid. LC-MS method O: (M+H) 277.1; Rt: 0.67 min Step 3: N-acetyl-N-[3-fluoro-5-(2-oxocyclopentyl)pyridin-2-yl]acetam ide Into a 100-mL round-bottom flask, were added N-acetyl-N-[3-fluoro-5-(5-oxocyclopent-1-en-1- yl)pyridin-2-yl]acetamide (2.70 g; 8.64 mmol), THF (30 mL), and Pd(OH) ₂ /C (500.00 mg; 0.71 mmol) at room temperature. The flask was purged and maintained with an atmosphere of H ₂ , which was connected with a tire full of H ₂ (10 L, about 2 atm). The resulting mixture was stirred for 2 h at room temperature. The reaction mixture was filtered through Celite. The filter cake was washed with 2x100 mL of THF, and the combined filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EtOAc/PE (0 to 40% over 30 min). This resulted in N-acetyl-N-[3-fluoro-5-(2-oxocyclopentyl)pyridin-2- yl]acetamide (2.30 g; 7.23 mmol; 84% yield; 87% purity) as a light yellow oil. LC-MS method O: (M+H) 279.2; Rt: 0.80 min Step 4: N-acetyl-N-[5-(2,2-difluorocyclopentyl)-3-fluoropyridin-2-yl ]acetamide To a stirred solution of N-acetyl-N-[3-fluoro-5-(2-oxocyclopentyl)pyridin-2-yl]acetam ide (1.50 g; 4.71 mmol) in DCM (10.00 mL) were added DAST (8.00 g; 47.15 mmol) at 0 degrees C. The resulting solution was stirred for 2 h at 40 °C. The resulting solution was quenched with 1 x 50 mL of water. The resulting aqueous phase was extracted with DCM (3 x 50 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (10/2). This resulted in N-acetyl-N-[5-(2,2-difluorocyclopentyl)-3-fluoropyridin- 2-yl]acetamide (660 mg; 1.21 mmol; 26% yield; 55% purity) as a yellow oil. LC-MS method G: (M+H) 301.2; Rt: 0.90 min Step 5: 5-(2,2-difluorocyclopentyl)-3-fluoropyridin-2-amine hydrochloride Into a 30-mL sealed tube, were added N-acetyl-N-[5-(2,2-difluorocyclopentyl)-3-fluoropyridin- 2-yl]acetamide (465 mg; 1.45 mmol), and HCl 4 M in methanol (10.00 mL; 40.00 mmol) at room temperature. The tube was purged and maintained with an atmosphere of N ₂ . The resulting mixture was stirred for 1 h at 60 °C in an oil bath. The reaction mixture was cooled to room temperature, and then concentrated under reduced pressure. The residue and CH ₃ CN (3 mL) were added into a 25-mL round-bottom flask. The resulting suspension was stirred for 2 h at 0 °C in an ice/water bath. The solids were collected by filtration, and then dried overnight under vacuum. This resulted in 5-(2,2-difluorocyclopentyl)-3-fluoropyridin-2-amine hydrochloride (278 mg; 1.04 mmol; 72% yield; 95% purity) as a white solid. LC-MS method G: (M+H) 216.9; Rt: 0.46 min Step 6: N-[5-(2,2-difluorocyclopentyl)-3-fluoropyridin-2-yl]-2-iodo- 5-nitrobenzamide Using the general procedure D of amide coupling to afford N-[5-(2,2-difluorocyclopentyl)-3- fluoropyridin-2-yl]-2-iodo-5-nitrobenzamide (160 mg; 0.33 mmol; 69% yield; 100% purity) as a beige solid. UPLC-MS method A: (M+H) 491.6; Rt: 1.07 min Amide intermediate 9: N-(4-cyclopentyl-2,6-difluorophenyl)-2-iodo-5-nitrobenzamide Using general procedure D of amide coupling to afford N-(4-cyclopentyl-2,6-difluorophenyl)-2- iodo-5-nitrobenzamide (995 mg; 1.82 mmol; 535 yield; 86% purity) as a beige solid. UPLC-MS method A: (M+H) 472.9; Rt: 1.24 min Amide intermediate 10: 5-cyano-2-fluoro-N-[4-(trifluoromethyl)phenyl]benzamide To a solution of 5-cyano-2-fluoro-benzoyl chloride (0.366 g, 2 mmol, 1 eq.) in dry DCM (5.0 mL) and DIPEA (0.44 mL, 2.5 mmol, 1.25 eq.), 4-(trifluoromethyl)aniline (0.28 mL, 2.2 mmol, 1.1 eq.) was added and the mixture was stirred at room temperature overnight. The reaction mixture was diluted with DCM, washed with water, 1N aqueous HCl and brine, dried on Na ₂ SO ₄ , filtered then solvent was evaporated. The crude was purified by chromatographic column hexane/AcOEt (85/15 to 8/2) to give the planned compound (white solid, 0.64 g, 0.166 mmol, 51% yield, 100% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 7.65 (t, J=9.23 Hz, 1 H) 7.76 (d, J=8.69 Hz, 2 H) 7.91 (d, J=8.54 Hz, 2 H) 8.14 (ddd, J=8.69, 4.73, 2.13 Hz, 1 H) 8.29 (dd, J=6.41, 2.14 Hz, 1 H) 10.96 (s, 1 H) Amide intermediate 11: N-(4-chlorophenyl)-2-fluoro-5-nitro-benzamide To a suspension of 2-fluoro-5-nitro-benzoyl chloride (0.219 g, 1.08 mmol, 1 eq.) in dry DCM (7.0 mL), 4-chloroaniline (0.151 g, 1.18 mmol, 1.1 eq.) and DIPEA (0.24 mL, 1.35 mmol, 1.25 eq.) were added and the reaction was stirred at room temperature overnight. The mixture was diluted with DCM, washed with saturated aqueous solution of NaHCO ₃ , 1N aqueous HCl and brine then dried on Na ₂ SO ₄ , filtered and the solvent was evaporated. The crude was used in the next step without further purification (0.25 g, 0.080 mmol, 78% yield, 77% purity). HPLC-MS Method B: (M+H) 295.4; Rt: 4.81 min Amide intermediate 12: 2-fluoro-5-nitro-N-[4-(trifluoromethyl)phenyl]benzamide To a solution of 2-fluoro-5-nitro-benzoyl chloride (0.405 g, 2 mmol, 1 eq.) in dry DCM (3.0 mL) and DIPEA (0.44 mL, 2.5 mmol, 1.25 eq.), 4-(trifluoromethyl)aniline (0.28 mL, 2.2 mmol, 1.1 eq.) was added and the mixture was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM, washed with water, 1N aqueous HCl and brine, dried on Na ₂ SO ₄ , filtered and then solvent was evaporated. The crude was purified by chromatographic column hexane/AcOEt (9/1 to 8/2) to give the title compound (0.532 g, 1.62 mmol, 81% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 7.70 (t, J=9.15 Hz, 1 H) 7.76 (d, J=8.69 Hz, 2 H) 7.93 (d, J=8.39 Hz, 2 H) 8.46 - 8.50 (m, 1 H) 8.58 (dd, J=5.80, 2.90 Hz, 1 H) 11.04 (s, 1 H) Amide intermediate 13: 2-[(4-cyclohexylphenyl)carbamoyl]-4-fluorophenyl trifluoromethanesulfonate Step 1: N-(4-cyclohexylphenyl)-5-fluoro-2-hydroxybenzamide To a solution of 5-fluoro-2-hydroxybenzoic acid (0.150 g, 0.96 mmol, 1 eq.) in DMA (7 mL), DIPEA (0.21 mL, 1.13 mmol, 1.17 eq.), TBTU (0.363 g, 1.13 mmol, 1.18 eq.) and 4- cyclohexylaniline (0.204 g, 1.16 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The mixture was diluted with AcOEt and H ₂ O. The aqueous phase was extracted 2 times with AcOEt. The organic extracts were combined, washed with a saturated aqueous solution of NaHCO ₃ , 1N aqueous HCl and brine and dried over Na ₂ SO ₄ . The solvent was evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a pale beige solid (0.200 g, 0.64 mmol, 67% yield, 92% purity). HPLC-MS Method G: (M+H) 314.3; Rt: 5.66 min Step 2: 2-[(4-cyclohexylphenyl)carbamoyl]-4-fluorophenyl trifluoromethanesulfonate To a solution of N-(4-cyclohexylphenyl)-5-fluoro-2-hydroxybenzamide (0.200 g, 0.64 mmol, 1 eq.) in dry DCM (10 mL) at 0 °C, DIPEA (0.14 mL, 0.76 mmol, 1.2 eq.) and trifluoromethanesulfonic anhydride (0.13 mL, 0.76 mmol, 1.2 eq.) were added and the reaction mixture was stirred 30 min at 0 °C. The mixture was then diluted with DCM and H ₂ O. The aqueous phase was extracted with DCM. The organic extracts were combined and washed with brine and dried over Na ₂ SO ₄ . The solvent was evaporated under vacuum and the crude was used in the next step without further purification (pale beige solid, 0.250 g, 0.52 mmol, 82% yield, 93% purity). HPLC-MS Method I: (M+H) 446.0; Rt: 4.06 min Amide intermediate 14: 2-[(4-cyclohexylphenyl)carbamoyl]-3,4-difluorophenyl trifluoromethanesulfonate Step 1: N-(4-cyclohexylphenyl)-2,3-difluoro-6-hydroxybenzamide To a solution of 2,3-difluoro-6-hydroxybenzoic acid (0.150 g, 0.86 mmol, 1 eq.) in DMA (5 mL), DIPEA (0.2 mL, 1.07 mmol, 1.25 eq.), TBTU (0.337 g, 1.05 mmol, 1.22 eq.) and 4- cyclohexylaniline (0.184 g, 1.05 mmol, 1.22 eq.) were added and the reaction mixture was stirred overnight at room temperature. The mixture was diluted with AcOEt and H ₂ O. The aqueous phase was extracted with AcOEt. The organic extracts were washed with a saturated aqueous solution of NaHCO ₃ , 1N aqueous HCl and brine and dried over Na ₂ SO ₄ . The solvent was evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a beige solid (0.085 g, 0.26 mmol, 30% yield, 93% purity). HPLC-MS Method G: (M+H) 332.0; Rt: 5.77 min Step 2: 2-[(4-cyclohexylphenyl)carbamoyl]-3,4-difluorophenyl trifluoromethanesulfonate To a solution of N-(4-cyclohexylphenyl)-2,3-difluoro-6-hydroxybenzamide (0.085 g, 0.26 mmol, 1 eq.) in dry DCM (5 mL) at 0 °C, DIPEA (0.06 mL, 0.31 mmol, 1.2 eq.) and trifluoromethanesulfonic anhydride (0.087 g, 0.31 mmol, 1.2 eq.) were added and the reaction mixture was stirred 30 min at 0 °C. The mixture was diluted with DCM and H ₂ O. The aqueous phase was extracted with DCM. The organic extracts were combined, washed with brine and dried over Na ₂ SO ₄ . The solvent was evaporated under vacuum and the crude was used in the next step without further purification (0.120 g, 0.26 mmol, quantitative yield, 87% purity). HPLC-MS Method I: (M+H) 464.0; Rt: 4.14 min Amide intermediate 15: N-(4-cyclohexylphenyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]benzamide Step 1: methyl 2-(trifluoromethanesulfonyloxy)benzoate To a solution of methyl 2-hydroxybenzoate (1.52 g, 10 mmol, 1 eq.) in dry DCM (10 mL) at 0 °C, DIPEA (2.21 mL, 11.87 mmol, 1.19 eq.) and trifluoromethanesulfonic anhydride (2.02 mL, 11.96 mmol, 1.2 eq.) were added and the reaction mixture was stirred 30 min at 0 °C. The mixture was diluted with DCM and H ₂ O. The aqueous phase was extracted with DCM. The organic extracts were combined, washed with brine and dried over Na ₂ SO ₄ . The solvent was evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a beige solid (2.9 g, 9.29 mmol, 93% yield, 91% purity). HPLC-MS Method G: (M+H) 285.0; Rt: 4.51 min Step 2: methyl 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]benzoate A solution of methyl 2-(trifluoromethanesulfonyloxy)benzoate (2.9 g, 9.29 mmol, 1 eq.) and 1- methyl-1H-tetrazole-5-thiol (1.4 g, 12.05 mmol, 1.18 eq.) in dry 1,4-dioxane (30 mL) was treated with DIPEA (3.75 mL, 20.15 mmol, 1.97 eq.), xantphos (0.58 g, 1 mmol, 0.1 eq.) and Pd ₂ (dba) ₃ (0.613 g, 0.67 mmol, 0.07 eq.) under nitrogen and stirred at 110 °C until the disappearance of the starting material (8 h). The reaction mixture was cooled to room temperature, the solvent was evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3 to 6/4) to afford the target compound as an orange crystalline solid (0.855 g, 3.39 mmol, 30% yield, 89% purity). HPLC-MS Method G: (M+H) 251.0; Rt: 3.49 min Step 3: 2-(1-methyltetrazol-5-yl)sulfanylbenzoic acid In a reactor methyl 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]benzoate (0.855 g, 3.39 mmol, 1 eq.), KOH (0.23 g, 4.10 mmol, 1.21 eq.), MeOH (10 mL) and water (5 mL) were added. The reaction mixture was stirred at 60 °C for 4 h. HPLC-MS analysis showed the presence of planned product. The reaction mixture was evaporated without heating the bath, the residue was suspended in water and 1N aqueous HCl was added until pH = 2, resulting in the formation of a precipitate. The solid was filtrated and the product was used in next step without further purification (0.833 g, 3.02 mmol, 89% yield, 88% purity). HPLC-MS Method G: (M+H) 237.0; Rt: 2.06 min Step 4: N-(4-cyclohexylphenyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl )sulfanyl]benzamide To a solution of 2-(1-methyltetrazol-5-yl)sulfanylbenzoic acid (0.500 g, 1.82 mmol, 1 eq.) in DMA (10 mL), DIPEA (0.46 mL, 2.47 mmol, 1.36 eq.), TBTU (0.802 g, 2.5 mmol, 1.37 eq.) and 4-cyclohexylaniline (0.445 g, 2.54 mmol, 1.39 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3 to 1/1) to afford the target product as a solid (0.699 g, 1.78 mmol, 98% yield, 100% purity). HPLC-MS Method I: (M+H) 394.0; Rt: 3.19 min Amide intermediate 16: N-(4-cyclohexylphenyl)-2-fluoro-5-nitrobenzamide To a solution of 2-fluoro-5-nitrobenzoic acid (0.500 g, 2.7 mmol, 1 eq.) in DMA (10 mL), DIPEA (0.59 mL, 3.17 mmol, 1.17 eq.), TBTU (1 g, 3.12 mmol, 1.15 eq.) and 4-cyclohexylaniline (0.567 g, 3.24 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was rinsed with DCM/MeOH (8/2) to afford the target product as a precipitate that was filtrated to obtain a pale orange solid (0.41 g, 1.2 mmol, 44% yield, 100% purity). HPLC-MS Method I: (M+H) 343.0; Rt: 3.64 min Amide intermediate 17: N-(4-cyclohexylphenyl)-2-fluoro-5- trifluoromethanesulfonylbenzamide To a solution of 2-fluoro-5-trifluoromethanesulfonylbenzoic acid (0.150 g, 0.52 mmol, 1 eq.) in DMA (5 mL), DIPEA (0.12 mL, 0.65 mmol, 1.24 eq.), TBTU (0.212 g, 0.65 mmol, 1.24 eq.) and 4-cyclohexylaniline (0.114 g, 0.65 mmol, 1.24 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target product as a solid (0.044 g, 0.103 mmol, 20% yield, 100% purity). HPLC-MS Method I: (M+H) 430.0; Rt: 4.16 min Amide intermediate 18: 2-(1H-1,2,3-benzotriazol-1-yloxy)-N-(4-cyclopentylphenyl)-5- trifluoromethanesulfonylbenzamide To a solution of 2-fluoro-5-trifluoromethanesulfonylbenzoic acid (0.150 g, 0.52 mmol, 1 eq.) in DMA (5 mL), DIPEA (0.12 mL, 0.65 mmol, 1.24 eq.), TBTU (0.212 g, 0.65 mmol, 1.24 eq.) and 4-cyclopentylaniline (0.106 g, 0.64 mmol, 1.22 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a pale beige solid (0.150 g, 0.283 mmol, 54% yield, 80% purity). HPLC-MS Method F: (M+H) 531.0; Rt: 14.12 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.43 - 1.82 (m, 7 H) 1.91 - 2.07 (m, 2 H) 2.89 - 3.02 (m, 1 H) 7.05 (d, J=9.00 Hz, 1 H) 7.26 (d, J=8.54 Hz, 2 H) 7.57 - 7.62 (m, 1 H) 7.65 (d, J=8.54 Hz, 2 H) 7.76 (dd, J=8.16, 7.24 Hz, 1 H) 7.94 (d, J=8.39 Hz, 1 H) 8.19 (dd, J=9.00, 2.29 Hz, 1 H) 8.25 (d, J=8.39 Hz, 1 H) 8.52 (d, J=2.29 Hz, 1 H) Amide intermediate 19: N-(4-cyclopentylphenyl)-2-fluoro-5-nitrobenzamide To a solution of 2-fluoro-5-nitrobenzoic acid (0.185 g, 1 mmol, 1 eq.) in DMA (5 mL), DIPEA (0.22 mL, 1.19 mmol, 1.19 eq.), TBTU (0.385 g, 1.18 mmol, 1.18 eq.) and 4-cyclopentylaniline (0.193 g, 1.14 mmol, 1.14 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was used in the next step without further purification (beige solid, 0.2 g, 0.61 mmol, 61% yield, 78% purity). HPLC-MS Method G: (M+H) 329.0; Rt: 5.03 min Amide intermediate 20: [2-[(5-cyclopentylpyrimidin-2-yl)carbamoyl]-4-nitro-phenyl] trifluoromethanesulfonate Step 1: (2-chlorocarbonyl-4-nitro-phenyl) acetate To a stirred solution of 2-hydroxy-5-nitrobenzoic acid (5 g, 27.03 mmol, 1 eq.) in DCE (20 mL) acetyl chloride (9.65 mL, 135 mmol, 5 eq.) was added. The reaction mixture was stirred at 100 °C for 8 h then thionyl chloride (10 mL, 136.47 mmol, 5.05 eq.) was added and the reaction mixture was stirred at 100 °C for 1 h. After cooling to room temperature solvent was removed under reduced pressure and the compound was used in the next step without further purification (6 g, 24.69 mmol, 91% yield, 60% purity). HPLC-MS Method G: (M+H) 240.0 (methyl ester); Rt: 3.76 min Step 2: N-(5-cyclopentylpyrimidin-2-yl)-2-hydroxy-5-nitro-benzamide To a solution of (2-chlorocarbonyl-4-nitro-phenyl) acetate (0.450 g, 1.85 mmol, 1 eq.) in dry DCM (10 mL) and DIPEA (0.46 mL, 2.47 mmol, 1.34 eq.), 5-cyclopentylpyrimidin-2-amine (0.302 g, 1.85 mmol, 1 eq.) was added and the mixture was stirred overnight at room temperature. A 2% aqueous solution of K ₂ CO ₃ was added to the reaction and the mixture was further stirred at room temperature for 1 h. The reaction mixture was diluted with DCM, washed with water and brine, dried on Na ₂ SO ₄ , filtered then solvent was evaporated. The crude was purified by column chromatography DCM/MeOH (95/5 to 8/2) to give the planned compound (0.200 g, 0.61 mmol, 33% yield, 99% purity). HPLC-MS Method C: (M+H) 329.1; Rt: 3.80 min Step 3: [2-[(5-cyclopentylpyrimidin-2-yl)carbamoyl]-4-nitro-phenyl] trifluoromethanesulfonate To a solution of N-(5-cyclopentylpyrimidin-2-yl)-2-hydroxy-5-nitro-benzamide (0.200 g, 0.61 mmol, 1 eq.) in DCM (8 mL) at 0 °C, DIPEA (0.12 mL, 0.64 mmol, 1.05 eq.) and trifluoromethanesulfonic anhydride (0.11 mL, 0.66 mmol, 1.08 eq.) were added and the reaction mixture was stirred 30 min at 0 °C. The mixture was diluted with DCM and H ₂ O. The aqueous phase was extracted with DCM. The organic extracts were washed with brine and dried over Na ₂ SO ₄ . The solvent was evaporated under vacuum and the crude was used in the next step without further purification (0.250 g, 0.54 mmol, 89% yield, 92% purity). HPLC-MS Method L: (M+H) 461.0; Rt: 4.72 min Amide intermediate 21: 2-fluoro-5-(trifluoromethyl)-N-[4- (trifluoromethyl)phenyl]benzamide To a solution of 2-fluoro-5-(trifluoromethyl)benzoic acid (0.100 g, 0.48 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.127 mL, 0.72 mmol, 1.5 eq.), TBTU (0.170 g, 0.53 mmol, 1.1 eq.) and 4- (trifluoromethyl)aniline (0.073 mL, 0.57 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. The combined organic phases were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a white solid (0.090 g, 0.26 mmol, 54% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 7.65 (t, J=9.15 Hz, 1 H) 7.76 (d, J=8.54 Hz, 2 H) 7.92 (d, J=8.54 Hz, 2 H) 8.02 (dd, J=8.31, 4.50 Hz, 1 H) 8.11 (dd, J=6.18, 2.06 Hz, 1 H) 10.97 (s, 1 H) Amide intermediate 22: N-(4-cyclohexylphenyl)-2-fluoro-5-(2,2,2- trifluoroacetyl)benzamide To a solution of 2-fluoro-5-(2,2,2-trifluoroacetyl)benzoic acid (0.050 g, 0.20 mmol, 1 eq.) in DMF (2 mL), DIPEA (0.05 mL, 0.30 mmol, 1.5 eq.), TBTU (0.079 g, 0.24 mmol, 1.2 eq.) and 4- cyclohexylaniline (0.036 g, 0.20 mmol, 1 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. Solvent was removed under reduced pressure and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the target product as a white solid (0.043 g, 0.109 mmol, 55% yield, 78% purity). HRMS (ESI) calcd for C ₂₁ H ₁₉ F ₄ NO ₂ [M + H] ⁺ 394.1425, found 394.1424 Amide intermediate 23: N-[3-carbamoyl-4-(1,1,2,2,3,3,3-heptafluoropropyl)phenyl]-2- iodo-5-nitrobenzamide Under argon atmosphere 2-Iodo-5-nitrobenzoic acid (200 mg; 0.67 mmol; 1,000 eq.) and 5- amino-2-(1,1,2,2,3,3,3-heptafluoropropyl)benzamide (245 mg; 0.72 mmol; 1.1 eq.) were dissolved in 4 mL dry pyridine. Phosphoryl chloride (55 µl; 0.60 mmol; 0.9 eq.) was added (exotherm) and the yellow solution was stirred overnight at 55 °C. The orange reaction solution was poured into water and extracted 3 x with AcOEt. The organic phase was washed 4 x with water and brine, dried over Na ₂ SO ₄ , filtrated and evaporated to dryness. This oily residue was dissolved in 1 mL DCM and sonicated. The formed thick slurry was diluted with heptane and the precipitate was filtered and dried under vacuum to get N-[3-carbamoyl-4-(1,1,2,2,3,3,3- heptafluoropropyl)phenyl]-2-iodo-5-nitrobenzamide (200 mg; 0.33 mmol; 49% yield; 95% purity) as a off-white solid. HPLC-MS Method P: (M+H) 579.9; Rt: 1.52 min Amide intermediate 24: 2-bromo-N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2- pyridyl]-4-methyl-5-nitro-benzamide

Prepared using appropriate intermediates according to procedure described for amide intermediate 6. HPLC-MS Method D: (M+H) 524.0; Rt: 3.43 min Amide intermediate 25: 2-cyclopentyl-5-(2-iodo-5-nitrobenzamido) benzamide Step 1: 2-iodo-5-nitrobenzoyl chloride 2-Iodo-5-nitro-benzoic acid (800 mg; 2.59 mmol; 1.0 eq.) was dissolved in 8.0 mL thionyl chloride. The yellow solution was stirred at 70 °C for 4 h. The yellow reaction solution was reduced to dryness, diluted twice with DCM and reduced again to dryness to get 2-iodo-5- nitrobenzoyl chloride (824 mg; 2.52 mmol; 97% yield; 95% purity) as a beige solid. LC-MS method B: (M+H) 307.9 mmol; Rt: 1.69 min Step 2: 5-cyclopentyl-2-(2-iodo-5-nitrobenzamido)pyridine-4-carboxam ide 2-Iodo-5-nitrobenzoyl chloride (117 mg; 0.38 mmol; 1.1 eq.) was dissolved in 1.0 mL DCM. The mixture was cooled to 0 °C and a solution of 2-amino-5-cyclopentylpyridine-4-carboxamide (70 mg; 0.34 mmol; 1.0 eq.) in 0.3 mL DCM and dry pyridine (55 µL; 0.68 mmol; 2.0 eq.) was added dropwise. After 2h, 2-iodo-5-nitrobenzoyl chloride (50 mg; 0.16 mmol; 0.5 eq.) was added and the mixture was stirred overnight at room temperature. After purification by flash chromatography (silica gel: heptane/EtOAc: 0-100%) 5-cyclopentyl-2-(2-iodo-5- nitrobenzamido)pyridine-4-carboxamide (88 mg; 0.09 mmol; 28% yield; 52% purity) was obtained as a pale-yellow solid. UPLC-MS method A: (M+H) 463.0 mmol; Rt: 1.16 min Amide intermediate 26: N-[2,6-difluoro-4-(1,1,2,2,3, 3,3-heptafluoropropyl)pheny l]-2- iodo-5-nitrobenzamide Prepared using appropriate intermediates according to procedure described for amide intermediate 24. HRMS (ESI) calcd for C ₁₆ H ₇ F ₉ IN ₂ O ₃ [M + H] ⁺ 572.9352, found 572.9359 Amide intermediate 27: N-{3-fluoro-5-[(1,1,2,2,2-pentafluoroethyl)sulfanyl]pyridin -2-yl}- 2-iodo-5-nitrobenzamide Prepared using appropriate intermediates according to procedure described for amide intermediate 24 HRMS (ESI) calcd for C ₁₄ H ₇ F ₆ IN ₃ O ₃ S [M + H] ⁺ 537.9152, found 537.9153 Amide intermediate 28: N-[3-fluoro-5-(1,1,2,2,3,3,4,4-octafluorobutyl)pyridin-2-yl] -2- iodo-5-nitrobenzamide Prepared using appropriate intermediates according to procedure described for amide intermediate 6. HRMS (ESI) calcd for C ₁₆ H ₈ F ₉ IN ₃ O ₃ [M + H] ⁺ 587.9461, found 587.9471 Amide intermediate 29: N-[3-fluoro-5-(1,1,2,2,3,3,4,4,4-nonafluorobutyl)pyridin-2-y l]-2- iodo-5-nitrobenzamide Prepared using appropriate intermediates according to procedure described for amide intermediate 6. HRMS (ESI) calcd for C ₁₆ H ₇ F ₁₀ IN ₂ O ₃ [M + H] ⁺ 591.9336, found 591.9330 Amide intermediate 30: N-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-[(4- methoxyphenyl)methoxy]phenyl]-2-iodo-5-nitro-benzamide Prepared using appropriate intermediates according to procedure described for amide intermediate 6. HRMS (ESI) calcd for C ₂₄ H ₁₆ F ₈ IN ₂ O ₅ [M + H] ⁺ 690.9971, found 690.9959 Amide intermediate 31: 2-bromo-N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyrid in- 2-yl]-3-methyl-5-nitrobenzamide

Prepared using appropriate intermediates according to procedure described for amide intermediate 6. HRMS (ESI) calcd for C ₁₆ H ₈ BrF ₈ N ₃ O ₃ [M + H] ⁺ 522.96010, found 522.96023 Triazol intermediate 1: tert-butyl N-methyl-N-[2-(5-sulfanylidene-4,5-dihydro-1H-1,2,4- triazol-4-yl)ethyl]carbamate Step 1: tert-butyl N-(2-isothiocyanatoethyl)-N-methylcarbamate Under argon atmosphere 2-(N-Boc-N-methylamino)ethylamine (2.00 g; 10.90 mmol) and DIPEA (5.56 mL, 32.71 mL) were dissolved in 13 mL anhydrous DCM. The pale-yellow solution was cooled to 0-5 °C, then a solution of thiophosgene (0.878 mL; 11.45 mmol) in 13 mL anhydrous DCM was added dropwise (temperature kept below 15 °C). Exothermic reaction. After complete addition of thiophosgene, the mixture was warmed up to rt and stirred for 1.5 h. The reaction mixture was quenched with ice-water and extracted with DCM. The combined layers were dried over Na ₂ SO ₄ , filtered off and purified by chromatography to afford tert-butyl N-(2-isothiocyanatoethyl)-N-methylcarbamate (1.37g; 6.33 mmol; 58% yield; 100% purity) as a yellow brown oil. UPLC-MS method A: (M+H) 117.0; Rt: 1.08 min Step 2: tert-butyl N-{2-[(formohydrazidomethanethioyl)amino]ethyl}-N- methylcarbamate To a stirred solution of tert-butyl N-(2-isothiocyanatoethyl)-N-methylcarbamate (1,37 g; 6.33 mmol) in 12 mL anhydrous THF was added formohydrazide (0.38 g; 6.33 mmol) at room temperature. The orange solution was stirred for 2 h at 40 °C. The compound was used in the next step without further purification (1.70 g theoretical yield 5.84 mmol; 92% yield; in 12mL THF). Step 3: tert-butyl N-methyl-N-[2-(5-sulfanylidene-4,5-dihydro-1H-1,2,4-triazol- 4- yl)ethyl]carbamate To the solution of tert-butyl N-{2-[(formohydrazidomethanethioyl)amino]ethyl}-N- methylcarbamate in 12 mL dry THF (1.70 g; 5.84 mmol), further diluted with 10 mL THF and 6 mL deionized water, was added potassium carbonate (1.70 g; 11.69 mmol). The orange solution was stirred 2.5 h at 50 °C. The mixture was reduced to dryness and purified by chromatography (reversed phase; water/ACN/0.1% HCOOH; gradient 5-90% ACN /0.1% HCOOH) to afford tert-butyl N-methyl-N-[2-(5-sulfanylidene-4,5-dihydro-1H-1,2,4-triazol- 4- yl)ethyl]carbamate (4.43 g; 5.39 mmol; 92% yield; 97% purity) as a pale brown solid. UPLC-MS method A: (M+H) 257.0; Rt: 0.81 min Triazol intermediate 2: 4-(difluoromethyl)-5-[(dimethylamino)methyl]-1,2,4-triazole- 3- thiol 4-(difluoromethyl)-5-[(dimethylamino)methyl]-1,2,4-triazole- 3-thiol was prepared according to the method reported in WO2004074270, using the appropriate isothiocyanate. HRMS (ESI) calcd for C ₄ H ₁₀ N ₄ F ₂ S [M + H] ⁺ 209.0667, found 209.0657 Triazol intermediate 3: 3-methyl-3-(3-sulfanyl-1,2,4-triazol-4-yl)butan-1-ol

4-[3-[tert-butyl(dimethyl)silyl]oxy-1,1-dimethyl-propyl]- 1,2,4-triazole-3-thiol was prepared according to method reported in Youji Huaxue (2017), 37(9), 2303-2314, using the appropriate isothiocyanate. HRMS (ESI) calcd for C ₇ H ₁₃ N ₃ OS [M + H] ⁺ 188.0852, found 188.0889 Tetrazole intermediate 1: tert-butyl N-[3-(5-sulfanylidene-4,5-dihydro-1H-1,2,3,4-tetrazol- 1-yl)propyl]carbamate Step 1: tert-butyl N-(3-isothiocyanatopropyl)carbamate Under argon atmosphere N-(3-aminopropyl)carbamic acid tert-butyl ester (1.30 g; 7.31 mmol) and DIPEA (3.73 mL; 21.93 mmol) were dissolved in 13 mL anhydrous DCM. The pale-yellow solution was cooled to 0-5 °C, then a solution of thiophosgene (0.59 mL; 7.68 mmol) in 13 mL anhydrous DCM was added dropwise (temperature kept below 18°C). CAUTION: The reaction is exothermic. The resulting solution was warm up to rt and stirred 2 h. The reaction mixture was quenched with ice- water and extracted with DCM. The combined organic layers were dried over Na ₂ SO ₄ , filtered off, reduced and purified by chromatography to afford tert-butyl N- (3-isothiocyanatopropyl)carbamate (1.05 g; 4.85 mmol; 66% yield; 100% purity) as a pale brown oil. UPLC-MS method A: (M+H) 117.0; Rt: 1.02 min Step 2: tert-butyl N-[3-(5-sulfanylidene-4,5-dihydro-1H-1,2,3,4-tetrazol-1- yl)propyl]carbamate To a stirred solution of tert-butyl N-(3-isothiocyanatopropyl)carbamate (1.05 g; 4.84 mmol) in 20 mL 2-propanol were added a solution of sodium azide (0.36 g; 5.54 mmol) in 4 mL deionized water at room temperature and argon atmosphere. The red orange solution was stirred 2 h at 80 °C. The resulting mixture was cooled to room temperature and quenched with I2/sodium thiosulfate solution and extracted with DCM. Product stayed in the aqueous phase. The volume of theaqeuous phase was concentrated under reduced pressure and purified by chromatography (reversed phase; water/ACN/0.1% HCOOH; gradient 5-70% ACN/0.1% HCOOH) to get tert-butyl N-[3-(5-sulfanylidene-4,5-dihydro-1H-1,2,3,4-tetrazol-1- yl)propyl]carbamate (567 mg; 2.13 mmol; 44% yield; 97% purity) as a yellow oil. UPLC-MS method A: (M+H) 258.0; Rt: 0.87 min Tetrazole intermediate 2: [1-(2-hydroxyethyl)tetrazol-5-yl]sulfanylpotassium OH To a stirred solution of KOH (0.046 g, 0.82 mmol, 1.2 eq.) in MeOH (3 mL), was added 2-(5- sulfanyltetrazol-1-yl)ethanol (0.1 g, 0.68 mmol, 1 eq.). The resulting mixture was stirred for 3 h at room temperature. Solvent was removed under reduced pressure and the compound was used in the next step without further purification (white solid, 0.12 g, 0.65 mmol, 80% yield, 100% purity). HRMS (ESI) calcd for C ₃ H ₆ N ₄ OS [M + H] ⁺ 147.0335, found 147.0336 Tetrazole intermediate 3: 1-[2-(2-methoxyethoxy)ethyl]tetrazole-5-thiol Step 1: 1-isothiocyanato-2-(2-methoxyethoxy)ethane To a solution of 2-(2-methoxyethoxy)ethanamine (0.50 g, 4.2 mmol, 1.0 eq) in DMF (40 ml), at 0 °C (ice bath) a solution of 1,1'-thiocarbonyldiimidazole (0.823 g, 4.62 mmol, 1.1 eq) in DMF (16 ml) was added dropwise. The obtained orange solution was allowed to come to rt and stirred 2h. The reaction was diluted with water and extracted with Et ₂ O. The organic layer was washed with water, dried over anhydrous Na ₂ SO ₄ and evaporated to dryness. The crude was purified by flash chromatography (hexane/AcOEt 55/45) to give the planned compound 1- isothiocyanato-2-(2-methoxyethoxy)ethane (0.512 g, 3.17 mmol, 75.7% yield, 100% purity) as a pale-yellow oil. HPLC-MS Method C: (M+H) 162; Rt: 3.16 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 3.26 (s, 3 H) 3.43 - 3.48 (m, 2 H) 3.52 - 3.59 (m, 2 H) 3.61 (t, J=5.09 Hz, 2 H) 3.80 (t, J=5.09 Hz, 2 H) Step 2: 1-[2-(2-methoxyethoxy)ethyl]tetrazole-5-thiol To a stirred solution of 1-isothiocyanato-2-(2-methoxyethoxy)ethane (0.512 g, 3.18 mmol, 1.00 eq) in isopropyl alcohol (21.2 mL) a solution of sodium azide (0.310 g, 4.76 mmol, 1.50 eq) in water (5.2 mL) was added, under argon atmosphere. The obtained solution was stirred at 80 °C for 2 h. Isopropyl alchool was removed under reduce pressure and the water layer was extracted with AcOEt. The aqueous phase was acidified with concentrated HCl (pH ≤ 1) and extracted with DCM. The organic layer was washed with brine, dried over anhydrous Na ₂ SO ₄ and evaporated to dryness to give the desired product 1-[2-(2-methoxyethoxy)ethyl]tetrazole- 5-thiol (0.367 g, 1.79 mmol, 56.6% Yield, 100% purity) as a colorless oil. HPLC-MS Method C: (M+H) 205; Rt: 0.55 min 1H NMR (600 MHz, DMSO-d ₆ ) δ ppm 3.17 - 3.20 (m, 3 H) 3.36 - 3.41 (m, 2 H) 3.49 - 3.57 (m, 2 H) 3.79 - 3.89 (m, 2 H) 4.38 (t, J=5.45 Hz, 2 H). Tetrazole intermediate 4: 1-(3-methoxypentyl)tetrazole-5-thiol The same method depicted for the preparation of tetrazole intermediate 3 was used to get 1- (3-methoxypentyl)tetrazole-5-thiol. HRMS (ESI) calcd for C ₇ H ₁₄ N ₄ OS [M + H] ⁺ 202.08883, found 202.08894 Tetrazole intermediate 5: 1-[1-[2-[tert-butyl(dimethyl)silyl]oxyethyl]pyrrolidin-3- yl]tetrazole-5-thiol The same method as in tetrazole intermediate 3 was used to get 1-[1-[2-[tert- butyl(dimethyl)silyl]oxyethyl]pyrrolidin-3-yl]tetrazole-5-th iol. HRMS (ESI) calcd for C ₁₃ H ₂₇ N ₅ OSSi [M + H] ⁺ 329.17056, found 329.17048 Tetrazole intermediate 6: 2-methyl-2-(5-sulfanyltetrazol-1-yl)propan-1-ol The same methods as in tetrazole intermediate 3 and in example 363 (step 2) were used to get 2-methyl-2-(5-sulfanyltetrazol-1-yl)propan-1-ol. HRMS (ESI) calcd for C ₅ H ₁₀ N ₄ OS [M + H] ⁺ 175.0648, found 175.0651 According to this procedure, using the appropriate starting amine, the following tetrazoles were prepared: - (2S,3R)-3-(5-sulfanyltetrazol-1-yl)butan-2-ol - (2R,3S)-3-(5-sulfanyltetrazol-1-yl)butan-2-ol - (1S,3R)-3-(5-sulfanyltetrazol-1-yl)cyclopentanol - [1-(5-sulfanyltetrazol-1-yl)cyclopropyl]methanol - 4-(5-sulfanyltetrazol-1-yl)butan-2-ol - 2-[2-[2-(5-sulfanyltetrazol-1-yl)ethoxy]ethoxy]ethanol - 1-(5-sulfanyltetrazol-1-yl)pentan-3-ol - 2-methyl-1-[2-(5-sulfanyltetrazol-1-yl)ethoxy]propan-2-ol - 1-[3-(5-sulfanyltetrazol-1-yl)propyl]pyrrolidin-3-ol - 2-methyl-4-(5-sulfanyltetrazol-1-yl)butan-2-ol - 2-methyl-1-(5-sulfanyltetrazol-1-yl)propan-2-ol - 2-methyl-1-[3-(5-sulfanyltetrazol-1-yl)propoxy]propan-2-ol - 3-methyl-3-(5-sulfanyltetrazol-1-yl)butan-1-ol - 2-[3-(5-sulfanyltetrazol-1-yl)propoxy]ethanol - 2-methyl-1-[2-methyl-2-(5-sulfanyltetrazol-1-yl)propoxy]prop an-2-ol Tetrazole intermediate 7: 1-[3-[tert-butyl(diphenyl)silyl]oxy-2,2-difluoro-propyl] tetrazole-5-thiol The same methods as in tetrazole intermediate 3 was used to get 1-[3-[tert- butyl(diphenyl)silyl]oxy-2,2-difluoro-propyl]tetrazole-5-thi ol. HRMS (ESI) calcd for C ₂₀ H ₂₄ F ₂ N ₄ OSSi [M + H] ⁺ 435.1481, found 435.1476 Tetrazole intermediate 7: (2R)-1-(5-sulfanyltetrazol-1-yl)propan-2-ol The same methods as in tetrazole intermediate 6 was used to get (2R)-1-(5-sulfanyltetrazol-1- yl)propan-2-ol.. HRMS (ESI) calcd for C ₄ H ₈ N ₄ OS [M + H] ⁺ 161.0492, found 161.0490 Tetrazole intermediate 8: (2S)-1-(5-sulfanyltetrazol-1-yl)propan-2-ol The same methods as in tetrazole intermediate 6 was used to get (2S)-1-(5-sulfanyltetrazol-1- yl)propan-2-ol.. HRMS (ESI) calcd for C ₄ H ₈ N ₄ OS [M + H] ⁺ 161.0492, found 161.0469 Tetrazole intermediate 9: (2R)-2-(5-sulfanyltetrazol-1-yl)propan-1-ol The same methods as in tetrazole intermediate 6 was used to get (2R)-2-(5-sulfanyltetrazol-1- yl)propan-1-ol. HRMS (ESI) calcd for C ₄ H ₈ N ₄ OS [M + H] ⁺ 161.0492, found 161.0406 Tetrazole intermediate 10: 1-[(2-methyl-1,3-dioxolan-2-yl)methyl]tetrazole-5-thiol The same methods as in tetrazole intermediate 3 was used to get 1-[(2-methyl-1,3-dioxolan-2- yl)methyl]tetrazole-5-thiol. HRMS (ESI) calcd for C ₆ H ₁₀ N ₄ O ₂ S [M + H] ⁺ 202.05189, found 202.05102 According to this procedure, using the appropriate starting amine, the following tetrazole were prepared: - 1-[3-(5-sulfanyltetrazol-1-yl)propyl]pyrrolidin-2-one - 3-[3-(5-sulfanyltetrazol-1-yl)propyl]oxazolidin-2-one - methyl 3-(5-sulfanyltetrazol-1-yl)pyrrolidine-1-carboxylate - 3-[2-methyl-2-(5-sulfanyltetrazol-1-yl)propyl]oxazolidin-2-o ne - 1-quinuclidin-4-yltetrazole-5-thiol - 5-methyl-3-[2-(5-sulfanyltetrazol-1-yl)ethyl]oxazolidin-2-on e - 4-methyl-3-[2-(5-sulfanyltetrazol-1-yl)ethyl]oxazolidin-2-on e - 4,4-dimethyl-3-[2-(5-sulfanyltetrazol-1-yl)ethyl]oxazolidin- 2-one - 5,5-dimethyl-3-[2-(5-sulfanyltetrazol-1-yl)ethyl]oxazolidin- 2-one Tetrazole intermediate 11: (2S)-2-(5-sulfanyltetrazol-1-yl)propan-1-ol The same methods as in tetrazole intermediate 6 was used to get (2S)-2-(5-sulfanyltetrazol-1- yl)propan-1-ol. HRMS (ESI) calcd for C ₄ H ₈ N ₄ OS [M + H]+ 161.0492, found 161.0485 Tetrazol intermediate 12: 1-[(5-sulfanyltetrazol-1-yl)methyl]cyclobutanol The same methods as in tetrazole intermediate 3 was used to get 1-[(5-sulfanyltetrazol-1- yl)methyl]cyclobutanol. HRMS (ESI) calcd for C ₆ H ₁₀ N ₄ OS [M + H] ⁺ 186.05698, found 186.05720 General procedure A for amide coupling The desired nitrobenzoic acid (1.0 eq.) was dissolved in dried DMF (0.1 - 0.2 M). The corresponding amine (1.0 - 4.0 eq.), HATU (1.3 - 3.0 eq.) and 4-methylmorpholine (2.5 – 6.0 eq.) were then added. The reaction solution was stirred between 1 and 72 h at room temperature. The reaction mixture was poured into ice-cooled water and stirred for 20 min. A precipitate was formed which was filtered off under vacuo and washed with water. The crude product was purified by reversed phase chromatography to obtain the desired amides in pure form. For some examples, the reaction mixture was diluted with AcOEt and extracted with water two or three times. The combined aqueous layers were washed with AcOEt. The combined organic layers were dried over Na ₂ SO ₄ , filtered and evaporated. The crude product was purified by flash column or reversed phase chromatography to obtain the desired amides in pure form. For some examples, the crude product was purified by reversed phase chromatography to obtain the desired amides in pure form. General procedure B for amide coupling The desired nitrobenzoic acid (1.0 eq.) was dissolved in dried DMF (0.1-0.15 M). The corresponding amine (1.1 eq.), HATU (1.5 eq.) and DBU (2.0 eq.) were then added. The reaction solution was stirred between 23 and 25 h at room temperature.The reaction mixture was diluted with an aqueous 5% NaHCO ₃ solution and extracted twice with AcOEt. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and evaporated. The crude product was purified by flash chromatography or preparative HPLC. The evaporated fractions were lyophilized or diluted with acetonitrile or heptane, the solid was filtered off and dried at 65 °C under vacuo to afford the desired amides in pure form. General procedure C for amide coupling The starting acyl chloride (1.0 eq.) was dissolved in dry DCM (0.03 – 0.12 M). The corresponding amine (1.0 – 2.4 eq.) and DIPEA (1.15 - 17 eq.) were then added. The reaction solution was stirred between 2 and 20 h at room temperature.The reaction mixture was then diluted with DCM, washed with 1N aqueous NaOH or a saturated aqueous solution of NaHCO ₃ , with1N aqueous HCl and brine. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and evaporated. The crude product was purified by flash chromatography (hexane/AcOEt or DCM/MeOH) or preparative HPLC. The evaporated fractions were lyophilized or diluted with Et ₂ O, the solid was filtered off and dried at 65 °C under vacuo to afford the desired amides in pure form. General procedure D for amide coupling The starting acid (1.0 eq.) was dissolved in dry DMF or dry DMA (0.06 – 0.2 M). The corresponding amine (1.0 – 5.0 eq.), TBTU (1.1 eq. – 1.6 eq.) and DIPEA (1.2 - 20 eq.) were then added. The reaction solution was stirred between 2 and 20 h at a temperature between 25 °C to 50 °C.The reaction mixture was diluted with AcOEt, washed with a saturated aqueous solution of NaHCO ₃ , with 1N aqueous HCl and brine. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and evaporated. The crude product was purified by flash chromatography (hexane/AcOEt or DCM/MeOH) or preparative HPLC. The evaporated fractions were lyophilized or diluted with Et ₂ O, the solid was filtered off and dried at 65 °C under vacuo to afford the desired amides in pure form. For some examples, the product was precipitated with AcOEt/MeOH, the solid was filtered off and washed with Et ₂ O, dried at 65 °C under vacuo to afford the desired amides in pure form. General procedure E for amide coupling To an ice cooled mixture of the desired acid (1.0 eq.) and the corresponding amine (1.0 eq.) in dry pyridine (10 volumes), was added dropwise a solution of phosphoryl chloride (1.1 – 1.5 eq.) in anhydrous DCM (20 volumes). The reaction mixture was stirred for 10 min to 24 h at temperature between 0 °C to 25 °C. The mixture was diluted with water, extracted with DCM, the organic phase was washed with a 10% aqueous solution of citric acid and brine, dried over anhydrous Na ₂ SO ₄ , filtered and evaporated. The crude product was purified by flash chromatography (hexane/AcOEt or hexane/acetone) or by reversed phase chromatography to obtain the desired amides in pure form. General procedure F for amide coupling The desired nitrobenzoic acid (1.0 eq.) was dissolved in dry pyridine (20 volumes), then phosphoryl chloride (1.1 eq.) was added and the mixture was stirred for 15 min at rt. After acid chloride formation, the correspondending amine (1.0 eq.), dissolved in anhydrous DCM (15 volumes), was added and the reaction mixture was stirred at rt for 2-24 h. The mixture was diluted with DCM and extracted with water. The organic phase was dried over Na ₂ SO ₄ and filtered off. The crude product was purified by reversed phase chromatography to obtain the desired amides in pure form. General procedure A for nucleophilic substitution The starting halide or triflate (1.0 eq.) was dissolved in dry DCM or dry ACN (0.02 – 0.18 M). The corresponding thiol (1.0 – 3.7 eq.) and DIPEA (1.2 – 2.0 eq.) or TEA (2.0 eq. – 9.0 eq.) were then added. The reaction solution was stirred between 1 and 20 h at temperature between 25 °C to 80 °C or was stirred under microwave irradiations between 1 and 8 h at temperature between 70 °C to 130 °C.The reaction mixture was diluted with AcOEt or DCM, washed with water and brine. The combined organic layers were dried over Na ₂ SO ₄ , filtered and evaporated. The crude product was purified by flash chromatography (hexane/AcOEt or DCM/MeOH) or preparative HPLC. The evaporated fractions were lyophilized or diluted with Et ₂ O, the solid was filtered off and dried at 65 °C under vacuo to afford the desired amides in pure form. General procedure B for nucleophilic substitution The starting halide or triflate (1.0 eq.) was dissolved in dry DCM or dry ACN (0.02 – 0.18 M). The corresponding potassium or sodium thiolate (1.0 – 2.5 eq.) was then added. The reaction solution was stirred between 1 and 20 h at temperature between 25 °C to 80 °C or was stirred under microwave irradiation between 1 and 8 h at temperature between 70 °C to 130 °C.The reaction mixture was diluted with AcOEt or DCM, washed with water and brine. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and evaporated. The crude product was purified by flash chromatography (hexane/AcOEt or DCM/MeOH) or preparative HPLC. The evaporated fractions were lyophilized or diluted with Et ₂ O, the solid was filtered off and dried at 65 °C under vacuo to afford the desired amides in pure form. General procedure of Buchwald coupling with 3-mercapto-4-methyl-1,2,4-triazol In a microwave vial, under argon atmosphere, the desired nitrobenzamide (1.0 eq.), 3- mercapto-4-methyl-1,2,4-triazol (2.2 eq.), tris(dibenzylideneacetone)dipalladium(0) (0.05 eq.) and 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (0.10 eq.) were dissolved in anhydrous 1,4-dioxane (3.2 volumes). Then DIPEA (3.0 eq.) was added, and the reaction mixture was heated under microwave irradiation at 80-100 °C for 10-40 min. The mixture was filtered over Celite, reduced and purified by reversed phase chromatography to obtain the desired amides in pure form. General procedure of Buchwald coupling with other thiols The starting halide (1.0 eq.) was dissolved in dry and degassed 1,4-dioxane (0.07 – 0.09 M). The corresponding thiol (1.2 – 2.2 eq.), Pd ₂ (dba) ₃ (5% - 10%), xanthpos (10% - 13%) and DIPEA (1.9 – 5.0 eq.) were then added. The reaction solution was stirred for 8 h at 110 °C or was stirred under microwave irradiation between 10 min and 1 h at temperature between 80 °C to 110 °C. The reaction mixture was diluted with AcOEt, washed with water and brine. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and evaporated. The crude product was purified by flash chromatography (hexane/AcOEt). The evaporated fractions were lyophilized or diluted with Et ₂ O, the solid was filtered off and dried at 65 °C under vacuo to afford the desired amides in pure form. Example 1: N-(4,4-dimethyl-2-oxo-1,2,3,4-tetrahydroquinolin-7-yl)-2-[(1 -methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (24 mg; 0.09 mmol; 1.0 eq.) was dissolved in 2 mL DMF. Then 4-methylmorpholine (28 µL; 0.26 mmol; 3.0 eq.), HATU (49 mg; 0.13 mmol; 1.5 eq.) and 7-amino-4,4-dimethyl-1,2,3,4-tetrahydroquinolin-2-one (25 mg; 0.09 mmol; 1.0 eq.) were added. The yellow solution was stirred at room temperature overnight, concentrated and purified by chromatography (C18; water + 0.1% TFA/5 - 80% ACN + 0.1% TFA) to obtain N-(4,4-dimethyl-2-oxo-1,2,3,4-tetrahydroquinolin-7-yl)-2-[(1 -methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (16 mg; 0.03 mmol; 38% yield; 93% purity) as a yellow solid. LC-MS method B: (M+H) 454.0; Rt: 1.54 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.89 (s, 1H), 10.27 (s, 1H), 8.68 (d, J = 2.6 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.42 (d, J = 1.9 Hz, 1H), 7.33 - 7.29 (m, 2H), 7.18 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 2.36 (s, 2H), 1.24 (s, 6H) Example 2: methyl 2-cyclopentyl-5-[2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfa nyl]-5- nitrobenzamido] benzoate Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (330 mg; 1.17 mmol; 1.0 eq.) was dissolved in 6.6 mL DMF.4-Methylmorpholine (323 µL; 2.93 mmol; 2.5 eq.), methyl 5-amino-2-cyclopentylbenzoate (275 mg; 1.17 mmol; 1.0 eq.) and HATU (669 mg; 1.76 mmol; 1.5 eq.) were added and the yellow solution was stirred for 2 h at room temperature. The reaction mixture was poured into ice-cooled water and stirred for 20 min. A precipitate was formed, which was filtered off under vacuo and washed with water and heptane. The residue was purified by chromatography (C18; water + 0.1% HCOOH/5 -100% ACN + 0.1% HCOOH) to obtain methyl 2-cyclopentyl-5-[2-[(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamido] benzoate (12.8 mg; 0.03 mmol; 2% yield; 98% purity) as an off- white solid. UPLC-MS method A: (M+H) 481.1; Rt: 1.17 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.98 (s, 1H), 8.75 (d, J = 2.6 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 8.09 (d, J = 2.4 Hz, 1H), 7.87 (dd, J = 8.6, 2.4 Hz, 1H), 7.51 (d, J = 8.6 Hz, 1H), 7.19 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.86 (s, 3H), 3.63 - 3.55 (m, 1H), 2.04 - 1.96 (m, 2H), 1.84 - 1.75 (m, 2H), 1.69 - 1.60 (m, 2H), 1.60 - 1.51 (m, 2H) Example 3: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[6 -(propan-2-yl) pyridin-3-yl] benzamide Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (50 mg; 0.18 mmol; 1.0 eq.) was dissolved in 1 mL DMF. 4-Methylmorpholine (49 µL; 0.44 mmol; 2.5 eq.), 6-isopropylpyridin-3-amine (25 mg; 0.18 mmol; 1.0 eq.) and HATU (101 mg; 0.27 mmol; 1.5 eq.) were added and the yellow solution was stirred 2 h at room temperature. The reaction mixture was poured into ice-cooled water and stirred for 20 min. A precipitate was formed, which was filtered off under vacuo and was washed with water and heptane to obtain 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[6 -(propan-2-yl) pyridin-3-yl] benzamide (62.5 mg; 0.16 mmol; 87% yield; 99% purity) as a pale yellow solid. UPLC-MS method A: (M+H) 400.9; Rt: 0.86 min ¹ H NMR (400 MHz, DMSO-d ₆ ). δ 11.02 (s, 1H), 8.79 (d, J = 2.6 Hz, 1H), 8.76 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 8.08 (dd, J = 8.5, 2.6 Hz, 1H), 7.33 (d, J = 8.4 Hz, 1H), 7.20 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.09 - 2.97 (m, 1H), 1.25 (d, J = 6.9 Hz, 6H) Example 4: N-[4-cyclopentyl-3-(morpholine-4-carbonyl) phenyl]-2-[(1-methyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide

Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (40 mg; 0.14 mmol; 1.0 eq.) was dissolved in 0.8 mL DMF.4-Methylmorpholine (39 µL; 0.36 mmol; 2.5 eq.), 4-cyclopentyl-3-(morpholine-4-carbonyl) aniline (39 mg; 0.14 mmol; 1.0 eq.) and HATU (81 mg; 0.21 mmol; 1.5 eq.) were added and the yellow solution was stirred 1 h at room temperature. The reaction mixture was poured into ice-cooled water and stirred for 20 min. The mixture was extracted with EtOAc, the organic phase was dried over Na ₂ SO ₄ , filtered off, reduced to dryness and purified by chromatography (silica gel; n-heptane/0 - 100% EtOAc) to obtain N-[4-cyclopentyl-3-(morpholine-4-carbonyl) phenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide (42 mg; 0.07 mmol; 51% yield; 93% purity) as a white solid. UPLC-MS method A: (M+H) 538.1; Rt: 1.05 min 1H NMR (500 MHz, DMSO-d ₆ ) δ 10.93 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.71 (dd, J = 8.6, 2.3 Hz, 1H), 7.56 (d, J = 2.3 Hz, 1H), 7.44 (d, J = 8.6 Hz, 1H), 7.19 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.71 - 3.63 (m, 4H), 3.58 - 3.46 (m, 2H), 3.25 - 3.13 (m, 2H), 2.98 - 2.90 (m, 1H), 1.99 - 1.90 (m, 2H), 1.85 - 1.73 (m, 2H), 1.70 - 1.47 (m, 4H) Example 5: 2-cyclopentyl-N,N-dimethyl-5-[2-[(1-methyl-1H-1,2,3,4-tetraz ol-5-yl)sulfanyl]- 5-nitrobenzamido] benzamide Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (40 mg; 0.14 mmol; 1.0 eq.) was dissolved in 0.8 mL DMF.4-Methylmorpholine (39 µL; 0.36 mmol; 2.5 eq.), 5-amino-2-cyclopentyl-N,N-dimethylbenzamide (33 mg; 0.14 mmol; 1.0 eq.) and HATU (81 mg; 0.21 mmol; 1.5 eq.) were added and the yellow solution was stirred overnight at room temperature. The reaction mixture was poured into ice-cooled water and stirred for 20 min. A precipitate was formed, which was filtered off under vacuo and washed with water and heptane to obtain 2-cyclopentyl-N,N-dimethyl-5-[2-[(1-methyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamido]benzamide (54 mg; 0.11 mmol; 75% yield; 97% purity) as a beige solid. UPLC-MS method A: (M+H) 496.1; Rt: 1.07 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.91 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.67 (dd, J = 8.6, 2.3 Hz, 1H), 7.56 (d, J = 2.3 Hz, 1H), 7.42 (d, J = 8.6 Hz, 1H), 7.19 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.03 (s, 3H), 2.92 - 2.84 (m, 1H), 2.81 (s, 3H), 1.98 - 1.90 (m, 2H), 1.83 - 1.73 (m, 2H), 1.67 - 1.48 (m, 4H) Example 6: N-(4-bromo-2-cyanophenyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5 -yl)sulfanyl]-5- nitrobenzamide Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (50 mg; 0.18 mmol; 0.7 eq.) was dissolved in 1 mL DMF. 4-Methylmorpholine (49 µL; 0.44 mmol; 1.8 eq.), 2-amino-5-bromobenzonitrile (36 mg; 0.18 mmol; 0.7 eq.) and HATU (102 mg; 0.27 mmol; 1.1 eq.) were added and the yellow reaction solution was stirred overnight at room temperature. Then 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (20 mg; 0.07 mmol; 0.3 eq.), HATU (100 mg; 0.26 mmol; 1.1 eq.) and 1,8-diazabicyclo[5.4.0]undec-7- ene (60 µl; 0.39 mmol; 1.6 eq.) were added. The reaction was stirred at room temperature for 72 h. The solution was poured into water, stirred for 5 min and the formed precipitate was filtered off. This beige solid was slurred with acetonitrile/water, filtered off and dried under vacuum to get N-(4-bromo-2-cyanophenyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5 -yl)sulfanyl]-5- nitrobenzamide (42 mg; 0.09 mmol; 35% yield; 96% purity) as a beige solid. UPLC-MS method A: (M+H) 462.0; Rt: 0.74 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.32 (s, 1H), 8.82 (d, J = 2.5 Hz, 1H), 8.30 (dd, J = 8.9, 2.5 Hz, 1H), 8.24 (d, J = 2.4 Hz, 1H), 8.01 (dd, J = 8.7, 2.4 Hz, 1H), 7.64 (d, J = 8.7 Hz, 1H), 7.18 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H) Example 7: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[3 -(propan-2-yl) phenyl] benzamide Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (40 mg; 0.14 mmol; 1.0 eq.) was dissolved in 0.8 mL DMF.4-Methylmorpholine (39 µL; 0.36 mmol; 2.5 eq.), 3-isopropylaniline (19 mg; 0.14 mmol; 1.0 eq.) and then HATU (81 mg; 0.21 mmol; 1.5 eq.) were added and the yellow reaction solution was stirred for 3 h at room temperature. The beige suspension was poured into water and stirred for 5 min. The formed precipitate was collected by vacuum filtration, washed with water and dried under vacuum to get 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[3 -(propan-2-yl) phenyl] benzamide (45 mg; 0.11 mmol; 76% yield; 96% purity) as a beige solid. UPLC-MS method A: (M+H) 399.2; Rt: 0.82 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.86 (s, 1H), 8.72 (d, J = 2.6 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.64 - 7.62 (m, 1H), 7.61 - 7.58 (m, 1H), 7.32 (t, J = 7.8 Hz, 1H), 7.17 (d, J = 8.8 Hz, 1H), 7.09 - 7.06 (m, 1H), 4.05 (s, 3H), 2.94 - 2.88 (m, 1H), 1.23 (d, J = 6.9 Hz, 6H) Example 8: N-(5-bromo-2-cyanophenyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5 -yl)sulfanyl]-5- nitrobenzamide Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (40 mg; 0.14 mmol; 1.0 eq.) was dissolved in 0.8 mL DMF.4-Methylmorpholine (39 µL; 0.36 mmol; 2.5 eq.), 2-amino-4-bromobenzonitrile (29 mg; 0.14 mmol; 1.0 eq.) and then HATU (81 mg; 0.21 mmol; 1.5 eq.) were added and the yellow solution was stirred for 4 days at room temperature. After adding 1,8-diazabicyclo [5.4.0] undec-7-ene (54 µL; 0.36 mmol; 2.5 eq.) and HATU (81 mg; 0.21 mmol; 1.5 eq.) the dark brown solution was stirred for 3 h at room temperature. The reaction solution was poured into water, stirred for 5 min and the precipitate was filtered off, washed with water and dried under vacuum. The residue was purified by chromatography (silica gel; n-heptane/0 - 100% EtOAc) to obtain N-(5-bromo-2-cyanophenyl)- 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenza mide (5 mg; 0.01 mmol; 8% yield; 96% purity) as a white solid. UPLC-MS method A: (M+H) 460.0; Rt: 0.74 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.39 (s, 1H), 8.84 (d, J = 2.5 Hz, 1H), 8.30 (dd, J = 8.9, 2.6 Hz, 1H), 7.99 (d, J = 1.9 Hz, 1H), 7.91 (d, J = 8.4 Hz, 1H), 7.74 (dd, J = 8.4, 2.0 Hz, 1H), 7.19 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H) Example 9: 2-cyclopentyl-5-[2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfa nyl]-5- nitrobenzamido] benzamide Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (86 mg; 0.31 mmol; 1.0 eq.) was dissolved in 1.3 mL DMF.4-Methylmorpholine (84 µL; 0.76 mmol; 2.5 eq.), 5-amino-2-cyclopentylbenzamide (27 mg; 0.13 mmol; 0.42 eq.) and HATU (174 mg; 0.46 mmol; 1.5 eq.) were added and the brown solution was stirred for 2 h at room temperature. The solution was poured into water and stirred for 5 min. The formed precipitate was filtered and washed with water. The solution was extracted with DCM, the organic phase was dried over Na ₂ SO ₄ , filtrated and evaporated. The oily residue was diluted with DCM and the formed precipitate was sucked off and dried under vacuum to obtain 2-cyclopentyl-5-[2-[(1- methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamido] benzamide (66 mg; 0.14 mmol; 45% yield; 98% purity) as a white solid. UPLC-MS method A: (M+H) 468.2; Rt: 0.70 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.92 (s, 1H), 8.70 (d, J = 2.6 Hz, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 7.79 - 7.76 (m, 1H), 7.73 (dd, J = 8.5, 2.4 Hz, 1H), 7.67 (d, J = 2.4 Hz, 1H), 7.41 - 7.38 (m, 1H), 7.39 - 7.37 (m, 1H), 7.18 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.30 - 3.26 (m, 1H), 2.02 - 1.95 (m, 2H), 1.82 - 1.75 (m, 2H), 1.67 - 1.58 (m, 2H), 1.58 - 1.50 (m, 2H) Example 10: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-N-[3-(methyl carbamoyl)-4- (propan-2-yl) phenyl]-5-nitrobenzamide

O O Step 1: methyl 5-(2-iodo-5-nitrobenzamido)-2-(propan-2-yl) benzoate 2-Iodo-5-nitro-benzoic acid (252 mg; 0.82 mmol; 1.1 eq.) was dissolved in 3.1 mL DMF. HATU (424 mg; 1.12 mmol; 1.5 eq.), 4-methylmorpholine (0.21 mL; 1.86 mmol; 2.5 eq.) and methyl 5-amino-2-(propan-2-yl) benzoate (155 mg; 0.74 mmol; 1.0 eq.) were added and the reaction mixture was stirred 2 h at room temperature. The reaction mixture was poured into ice-cooled water and stirred for 20 min. A precipitate was formed, which was filtered off and was washed with water and heptane to obtain methyl 5-(2-iodo-5-nitrobenzamido)-2-(propan-2-yl) benzoate (0.41 g; 0.77 mmol; 103% yield; 89% purity) as a beige solid. UPLC-MS method A: (M-H) 466.9; Rt: 1.14 min Step 2: 5-(2-iodo-5-nitrobenzamido)-2-(propan-2-yl) benzoic acid Methyl 5-(2-iodo-5-nitrobenzamido)-2-(propan-2-yl) benzoate (406 mg; 0.87 mmol; 1.0 eq.) was dissolved in 8.1 mL THF and 78 µL water. Lithium hydroxide (25 mg; 1.04 mmol; 1.2 eq.) was added and the yellow solution was stirred at room temperature and at 60 °C for 2 h. Further lithium hydroxide (25 mg; 1.04 mmol; 1.2 eq.) was added and the mixture was stirred 48 h at room temperature. Potassium hydroxide (powder) (97 mg; 1.73 mmol; 2.0 eq.) was then added and the mixture was stirred for 6 h at 60 °C. The THF was concentrated under reduced pressure and the aqueous phase was extracted three times with DCM. The aqueous phase was acidified to pH 2-3 with 1M HCl and extracted again with DCM five times. The combined organic phases was dried over Na ₂ SO ₄ , filtered and reduced to dryness to obtain 5-(2-iodo-5- nitrobenzamido)-2-(propan-2-yl) benzoic acid (84 mg; 0.18 mmol; 21% yield; 61% purity) as a yellow oil. UPLC-MS: (M-H) 452.9; Rt: 1.04 min Step 3: 5-[2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobe nzamido]-2-(propan-2- yl) benzoic acid 5-(2-iodo-5-nitrobenzamido)-2-(propan-2-yl) benzoic acid (84 mg; 0.11 mmol; 1.0 eq.) and 5- mercapto-1-methyltetrazole (17 mg; 0.15 mmol; 1.3 eq.) were suspended in 2.1 mL dry 1,4- dioxane and DIPEA (58 µL; 0.34 mmol; 3.0 eq.) was added. The vial was purged with argon and tris(dibenzylideneacetone)dipalladium(0) (5.4 mg; 0.01 mmol; 0.05 eq.) and xantphos (6.8 mg; 0.01 mmol; 0.1 eq.) were added. The vial was stirred in a microwave for 30 min at 110 °C. The mixture was filtered over Celite, the filtrate was reduced to dryness and purified by chromatography (C18; water + 0.1% HCOOH/10 - 80% ACN + 0.1% HCOOH) to obtain 5-[2- [(1-methyl-1H-1,2,3,4-tetrazol-5-yl) sulfanyl]-5-nitrobenzamido]-2-(propan-2-yl) benzoic acid (37 mg; 0.07 mmol; 66% yield; 89% purity) as a yellow solid. UPLC-MS method A: (M-H) 441.0; Rt: 1.01 min Step 4: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-N-[3-(methyl carbamoyl)-4- (propan-2-yl) phenyl]-5-nitrobenzamide 5-[2-[(1-Methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobe nzamido]-2-(propan-2-yl) benzoic acid (24 mg; 0.05 mmol; 1.0 eq.), 2.0 M methylamine in THF (29 µL; 0.06 mmol; 1.2 eq.), HATU (24 mg; 0.06 mmol; 1.3 eq.) and TEA (20 µL; 0.14 mmol; 3.0 eq.) were dissolved in 1 mL dry DMF. The red solution was stirred 2 h at room temperature, concentrated and was purified by chromatography (C18; water + 0.1% HCOOH/5 - 70% ACN + 0.1% HCOOH) to obtain 2-[(1- methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-N-[3-(methylcarbam oyl)-4-(propan-2-yl)phenyl]-5- nitrobenzamide (20 mg; 0.04 mmol; 85% yield; 92% purity) as a yellow solid. UPLC-MS method A: (M+H) 456.1; Rt: 0.98 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.92 (s, 1H), 8.70 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 8.24 - 8.18 (m, 1H), 7.72 (dd, J = 8.5, 2.5 Hz, 1H), 7.68 (t, J = 2.7 Hz, 1H), 7.40 (d, J = 8.5 Hz, 1H), 7.18 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.19 - 3.10 (m, 1H), 2.76 (d, J = 4.6 Hz, 3H), 1.19 (d, J = 6.9 Hz, 6H) Example 11: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[5 -(propan-2-yl) pyridine-2-yl] benzamide

Step 1: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo yl chloride 2-[(1-Methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (220 mg; 0.78 mmol; 1.0 eq.) were suspended in 5 mL thionyl chloride and stirred at 70 °C for 2.5 h. The beige suspension was evaporated to dryness, diluted with toluene and evaporated again to dryness to obtain 2- [(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoyl chloride (223 mg; 0.7 mmol; 89% yield; 94% purity) as a beige solid. UPLC-MS method A: (M+H) 296.0; Rt: 1.01 min (as methyl ester due to quenching with methanol). Step 2: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[5 -(propan-2-yl) pyridin- 2-yl] benzamide 2-[(1-Methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo yl chloride (121 mg; 0.38 mmol; 1.1 eq.) was dissolved in 3.5 mL dry DCM. The reaction mixture was cooled to 0 °C and a solution of 2-amino-5-isopropylpyridine (50 mg; 0.35 mmol; 1.0 eq.) in 1.5 mL dry DCM and dry pyridine (56 µL; 0.70 mmol; 2.0 eq.) was added dropwise. The yellow suspension was stirred overnight at room temperature. The precipitate was filtered off and was washed with DCM. The filtrate was purified by column chromatography (silica gel; n-heptane/0 - 70% EtOAc) to obtain 2-[(1- methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[5-(prop an-2-yl)pyridin-2-yl]benzamide (30 mg; 0.07 mmol; 21% yield; 100% purity) as an off-white solid. UPLC-MS: (M+H) 400.1; Rt: 1.08 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.50 (s, 1H), 8.70 (d, J = 2.6 Hz, 1H), 8.33 (d, J = 2.4 Hz, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 8.10 (d, J = 8.5 Hz, 1H), 7.80 (dd, J = 8.5, 2.5 Hz, 1H), 7.18 (d, J = 8.9 Hz, 1H), 4.04 (s, 3H), 3.02 - 2.92 (m, 1H), 1.25 (d, J = 6.9 Hz, 6H) Example 12: N-(4-cyclopentyl-2-fluorophenyl)-2-[(1-methyl-1H-1,2,3,4-tet razol-5-yl) sulfinyl]-5-nitrobenzamide To an ice cooled mixture of N-(4-cyclopentyl-2-fluorophenyl)-2-[(1-methyl-1H-1,2,3,4-tet razol- 5-yl)sulfanyl]-5-nitrobenzamide (30 mg; 68 µmol; 1.0 eq.) in 1 mL dry DCM was added 3- chloroperbenzoic acid (15 mg; 68 µmol; 1.0 eq.) in portions. The colorless solution was stirred for 2 h at 5 °C and at room temperature for 3 days. The mixture was diluted with DCM and was extracted twice with an aqueous sodium thiosulfate solution. The organic phases were dried over Na ₂ SO ₄ , filtered and reduced to dryness. The residue was purified by chromatography (C18; water + 0.1% HCOOH/gradient 5 - 80% ACN + 0.1% HCOOH) to obtain N-(4- cyclopentyl-2-fluorophenyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol -5-yl)sulfinyl]-5-nitrobenzamide (12 mg; 0.02 mmol; 36% yield; 98% purity) as a white solid. LC-MS method A: (M+H) 459.1; Rt: 1.04 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 9.19 (d, J = 2.3 Hz, 1H), 8.86 (dd, J = 8.7, 2.2 Hz, 1H), 8.69 (d, J = 8.7 Hz, 1H), 7.29 (t, J = 8.1 Hz, 1H), 7.17 (dd, J = 11.9, 1.9 Hz, 1H), 7.10 (dd, J = 8.2, 1.9 Hz, 1H), 4.37 (s, 3H), 3.03 - 2.95 (m, 1H), 2.06 - 1.98 (m, 2H), 1.82 - 1.72 (m, 2H), 1.69 - 1.59 (m, 2H), 1.56 - 1.47 (m, 2H) Example 13: N-(4-cyclopentyl-2-fluorophenyl)-2-[(1-methyl-1H-1,2,3,4-tet razol-5-yl) sulfonyl]-5-nitrobenzamide During the synthesis of example 12, N-(4-cyclopentyl-2-fluorophenyl)-2-[(1-methyl-1H-1,2,3,4- tetrazol-5-yl)sulfonyl]-5-nitrobenzamide (3.3 mg; 0.01 mmol; 10% yield; 98% purity) was also isolated as a white solid. LC-MS method A: (M+H) 475.0; Rt: 1.06 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.85 (s, 1H), 8.72 - 8.67 (m, 2H), 8.61 (dd, J = 1.9, 0.9 Hz, 1H), 7.71 (t, J = 8.3 Hz, 1H), 7.21 (dd, J = 12.1, 1.9 Hz, 1H), 7.14 (dd, J = 8.3, 2.0 Hz, 1H), 4.29 (s, 3H), 3.05 - 2.96 (m, 1H), 2.07 - 1.99 (m, 2H), 1.83 - 1.73 (m, 2H), 1.69 - 1.60 (m, 2H), 1.59 - 1.49 (m, 2H) Example 14: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4 -(oxetan-3- yl)phenyl]benzamide To a stirred solution of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (100 mg; 0.36 mmol), TEA (86 mg; 0.81 mmol; 2.3 eq.) and HATU (324 mg, 0.81 mmol; 2.3 eq.) in 2 mL THF, 4-(oxetan-3-yl)aniline (128 mg; 0.81 mmol; 2.3 eq.) was added at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at room temperature under nitrogen atmosphere. The THF was concentrated under vacuum and the aqueous layer was extracted with DCM three times. The combined organic phases were dried over Na ₂ SO ₄ , filtered and concentrated. The obtained residue was purified by chromatography (C18; water (10 mmol/L NH ₄ HCO ₃ + 0.1% NH ₃ ^. H ₂ O)/30 – 60% ACN to obtain 2-[(1-methyl-1,2,3,4-tetrazol- 5-yl)sulfanyl]-5-nitro-N-[4-(oxetan-3-yl)phenyl]benzamide (2.4 mg; 0.01 mmol; 2% yield; 99% purity) as a white solid. LC-MS method D: (M+H) 413.1; Rt: 1.77 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.93 (s,1H), 8.72-8.71 (m,1H), 8.28-8.24 (m,1H), 7.77-7.74 (m, 2H), 7.46-7.43 (m,2H), 7.20-7.17 (m,1H), 4.97-4.93 (m,2H), 4.65-4.61 (m,2H), 4.25-4.21 (m,1H), 4.05 (s, 3H) Example 15: N-(4-cyclopentylphenyl)-2-[(1-cyclopropyl-1H-1,2,3,4-tetrazo l-5- yl)sulfanyl]-5-nitrobenzamide To a stirred mixture of 2-[(1-cyclopropyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitroben zoic acid (50 mg; 0.13 mmol; 1.0 eq.) and HATU (133 mg; 0.33 mmol; 2.5 eq.) in 5 mL DMF, DIEA (54 mg; 0.40 mmol; 3.0 eq.) and 4-cyclopentylaniline (45 mg, 0.27 mmol; 2.0 eq.) were added. The reaction mixture was stirred overnight at room temperature under nitrogen atmosphere. The reaction mixture was diluted with water and extracted with DCM four times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude product was purified by chromatography (C18; water (10 mmol/L NH ₄ HCO ₃ + 0.1% NH ₄ OH)/55 -85% ACN) to obtain N-(4-cyclopentylphenyl)-2-[(1-cyclopropyl- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (8.2 mg; 0.02 mmol; 13% yield; 98% purity) as an off-white solid. LC-MS method E: (M+H) 451.2; Rt: 2.13 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.85 (s, 1H), 8.68 (s, 1H), 8.27-8.24 (m, 1H), 7.66-7.64 (m, 2H), 7.30-7.26 (m, 3H), 3.75-3.71 (m, 1H), 3.01-2.93 (m, 1H), 2.02-2.00 (m, 2H), 1.81-1.48 (m, 6H), 1.23-1.11 (m, 4H) Example 16: N-{4-cyclopentyl-2-[(1-methylpiperidin-4-yl)oxy]phenyl}-2-[( 1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide To a stirred mixture of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (50 mg; 0.18 mmol; 1.0 eq.), 4-cyclopentyl-2-[(1-methylpiperidin-4-yl)oxy]aniline (70 mg; 0.21 mmol; 1.2 eq.) and HATU (171 mg; 0.43 mmol; 2.4 eq.) in 3 mL DMF, DIEA (58 mg, 0.43 mmol; 2.4 eq.) was added. The resulting mixture was stirred overnight at room temperature under nitrogen atmosphere. The crude product was purified by column chromatography (C18; water (10 mmol/L NH ₄ HCO ₃ + 0.1% NH ₄ OH/42% - 72% ACN) to obtain N-[4-cyclopentyl-2-[(1- methylpiperidin-4-yl)oxy]phenyl]-2-[(1-methyl-1,2,3,4-tetraz ol-5-yl)sulfanyl]-5-nitrobenzamide (26.5 mg; 0.05 mmol; 27% yield; 99% purity) as an orange solid. LC-MS method D: (M+H) 538.3; Rt: 2.17 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.16 (s, 1H), 8.68 (s, 1H), 8.26-8.23 (m, 1H), 7.54-7.52 (m, 1H), 7.15-7.13 (m, 1H), 7.02-7.01 (m, 1H), 6.89-6.87 (m, 1H), 4.47 (s, 1H), 4.06 (s, 3H), 3.00- 2.96 (m, 1H), 2.57-2.51 (m, 2H), 2.22-2.14 (m, 5H), 2.02-1.98 (m, 2H), 1.92-1.88 (m, 2H), 1.80- 1.75 (m, 4H), 1.72-1.53 (m, 4H) Example 17: N-{4-cyclopentyl-2-[2-(dimethylamino) ethoxy] phenyl}-2-[(1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide To a stirred mixture of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (30 mg; 0.11 mmol; 1.0 eq.), HATU (103 mg; 0.26 mmol; 2.4 eq.) and 4-cyclopentyl-2-[2- (dimethylamino)ethoxy]aniline (34 mg; 0.11 mmol; 1.0 eq.) in 2 mL DMF, DIEA (35 mg; 0.26 mmol; 2.4 eq) was added. The resulting mixture was stirred overnight at room temperature under nitrogen atmosphere, concentrated under reduced pressure and purified by chromatography (C18; water (10 mmol/L NH ₄ HCO ₃ + 0.1% NH ₄ OH/ 55 – 85% ACN). This resulted in N-[4-cyclopentyl-2-[2-(dimethylamino) ethoxy] phenyl]-2-[(1-methyl-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (26 mg; 0.05 mmol; 47% yield; 99% purity) as a yellow solid. LC-MS method H: (M+H) 512.3; Rt: 1.38 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.57 (s, 1H), 8.58 (s, 1H), 8.27-8.24 (m, 1H), 7.76-7.74 (m, 1H), 7.18-7.15 (m, 1H), 7.07 (s, 1H), 6.95-6.93 (m, 1H), 4.17-4.14 (m, 2H), 4.05 (s, 3H), 3.00- 2.96 (m, 1H), 2.55-2.52 (m, 2H), 2.09-1.99 (m, 8H), 1.80-1.75 (m, 2H), 1.67-1.54 (m, 4H) Example 18: N-[(1S,2R)-2-(4-fluorophenyl)cyclopropyl]-2-[(1-methyl-1H-1, 2,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide To a mixture of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (50 mg; 0.16 mmol; 1.0 eq.), (trans)-2-(4-fluorophenyl)cyclopropan-1-amine (50 mg; 0.32 mmol; 2.0 eq.) and NMM (68 mg; 0.63 mmol; 4.0 eq.) in 3 mL DMF was added TCFH (70 mg; 0.24 mmol; 1.5 eq.). The reaction mixture was stirred for 3 h at room temperature under nitrogen atmosphere, concentrated under reduced pressure and the crude product was purified by preparative chromatography (C18; water 10 mmol/L NH ₄ HCO ₃ + 0.1% NH ₄ OH/38 - 68% ACN). This resulted in N-[(trans)-2-(4-fluorophenyl) cyclopropyl]-2-[(1-methyl-1,2,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide (30 mg; 0.07 mmol; 45% yield; 100% purity) as a white solid. LC-MS method H: (M+H) 415.1; Rt: 1.56 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 9.36 (s, 1H), 8.62 (s, 1H), 8.21-8.18 (m, 1H), 7.27-7.23 (m, 2H), 7.15-7.10 (m, 2H), 7.03-7.01 (m, 1H), 4.04 (s, 3H), 3.05-3.01 (m, 1H), 2.23-2.07 (m, 1H), 1.42-1.37 (m, 1H), 1.31-1.25 (m, 1H) Example 19: N-(4-cyclopentyl-3-methoxyphenyl)-2-[(1-methyl-1H-1,2,3,4-te trazol-5- yl)sulfanyl]-5-nitrobenzamide To a stirred mixture of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (80 mg; 0.25 mmol; 1.0 eq.), NMM (108 mg; 1.02 mmol; 4.0 eq.) and 4-cyclopentyl-3-methoxyaniline (95 mg, 0.38 mmol; 1.5 eq.) in 5 mL DMF was added TCFH (112 mg; 0.38 mmol; 1.5 eq.) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at room temperature and diluted with water. It was extracted with DCM four times, the combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude product was purified by chromatography (C18; water (10 mmol/L NH ₄ HCO ₃ )/50 - 75% ACN) to afford N-(4-cyclopentyl-3-methoxyphenyl)-2-[(1-methyl-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (34 mg; 0.07 mmol; 29% yield; 99% purity) as a yellow solid. LC-MS method H: (M+H) 455.1; Rt: 1.90 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.95 (s, 1H), 8.70 (d, J = 2.4 Hz, 1H), 8.26-8.23 (m, 1H), 7.41 (d, J = 2.0 Hz, 1H), 7.32-7.30 (m, 1H), 7.22-7.15 (m, 2H), 4.05 (s, 3H), 3.80 (s, 3H), 3.25-3.21 (m, 1H), 1.94-1.89 (m, 2H), 1.77-1.72 (m, 2H), 1.65-1.61 (m, 2H), 1.56-1.49 (m, 2H) Example 20: N-(3-cyano-4-cyclopentylphenyl)-2-[(1-methyl-1H-1,2,3,4-tetr azol-5- yl)sulfanyl]-5-nitrobenzamide To a stirred mixture of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (80 mg; 0.25 mmol; 1.0 eq.), 5-amino-2-cyclopentylbenzonitrile (72 mg; 0.38 mmol; 1.5 eq.) and HATU (254 mg; 0.63 mmol; 2.5 eq.) in 5 mL DMF, DIEA (86 mg; 0.63 mmol) was added at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at room temperature. The reaction mixture was then diluted with water and extracted with DCM four times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude product was purified by chromatography (C18; water (10 mmol/L NH ₄ HCO ₃ )/50 - 73% ACN) to obtain N-(3-cyano-4 cyclopentylphenyl)- 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamid e (41 mg; 0.09 mmol; 35% yield; 97% purity) as a light yellow solid. LC-MS method D: (M+H) 450.2; Rt: 1.90 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.14 (s, 1H), 8.76 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 8.14 (d, J = 2.3 Hz, 1H), 7.94 (dd, J = 8.6, 2.4 Hz, 1H), 7.60 (d, J = 8.7 Hz, 1H), 7.20 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.30 - 3.20 (m, 1H), 2.07 (dd, J = 11.5, 7.2 Hz, 2H), 1.92 - 1.76 (m, 2H), 1.79 - 1.52 (m, 4H) Example 21: 5-cyclopentyl-2-{2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfa nyl]-5- nitrobenzamido}benzamide hydrochloride To a stirred mixture of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (40 mg; 0.13 mmol; 1.0 eq.), 2-amino-5-cyclopentylbenzamide (36 mg; 0.15 mmol; 1.2 eq.) and NMM (54 mg; 0.51 mmol; 4.0 eq.) in 2 mL DMF was added TCFH (56 mg; 0.19 mmol; 1.5 eq.) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at room temperature and concentrated under vacuum. The residue was purified by chromatography (C18; water (0.05% HCl)/60 - 90% ACN) to get 5-cyclopentyl-2-[2-[(1-methyl- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamido]benzamide hydrochloride (3.7 mg; 0.01 mmol; 6% yield; 99% purity) as a white solid. LC-MS-method H: (M+H) 468.2; Rt: 1.85 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 13.11 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.49 - 8.43 (m, 2H), 8.28 (dd, J = 8.9, 2.5 Hz, 1H), 7.96 (s, 1H), 7.82 (d, J = 2.1 Hz, 1H), 7.53 (d, J = 9.6 Hz, 1H), 7.08 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.01 (t, J = 8.4 Hz, 1H), 2.06 (s, 2H), 1.81 (s, 2H), 1.67 - 1.64 (m, 4H) Example 22: 3-methyl-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-n itro-N-[4- (propan-2-yl)phenyl]benzamide To a stirred mixture of 3-methyl-2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitr obenzoic acid (30 mg; 0.10 mmol; 1.0 eq.), HATU (101 mg; 0.25 mmol; 2.5 eq.) and para-isopropylaniline (22 mg; 0.15 mmol; 1.5 eq.) in 2 mL DMF, DIEA (34 mg; 0.25 mmol; 2.5 eq.) was added at room temperature under nitrogen atmosphere. The reaction mixture was stirred overnight at room temperature under nitrogen atmosphere, concentrated under reduced pressure and purified by chromatography (C18; water(10 mmol/L NH ₄ HCO ₃ + 0.1% NH ₄ OH)/35 - 65% ACN) to obtain N-(4-isopropylphenyl)-3-methyl-2-[(1-methyl-1,2,3,4-tetrazol -5-yl)sulfanyl]-5-nitrobenzamide (2.8 mg; 0.01 mmol; 7% yield; 100% purity) as an off-white solid. LC-MS method K: (M+H) 413.1; Rt: 1.81 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.63 (s, 1H), 8.41 (dd, J = 2.6, 0.7 Hz, 1H), 8.25 (d, J = 2.6 Hz, 1H), 7.59 - 7.51 (m, 2H), 7.23 - 7.21 (m, 2H), 3.95 (s, 3H), 2.88 (p, J = 6.8 Hz, 1H), 2.52 (s, 3H), 1.20 (d, J = 6.9 Hz, 6H) Example 23: N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H-1,2,3,4-tetr azol-5- yl)sulfanyl]-5-nitrobenzamide To a stirred solution of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (50 mg; 0.16 mmol; 1.0 eq.) in 3.0 mL DCM, 1-chloro-2-methylprop-1-en-1-yl)dimethylamine (45 mg; 0.32 mmol; 2.0 eq.) was added dropwise at room temperature under nitrogen atmosphere. After stirring the resulting mixture for 30 min, 5-cyclopentylpyrimidin-2-amine (22 mg; 0.13 mmol; 0.82 eq.) and Et ₃ N (51 mg; 0.48 mmol; 3.0 eq.) in 1.0 mL DCM were added dropwise at -5 ^o C. The resulting mixture was stirred for an additional 3 h at room temperature, diluted with water and extracted with DCM three times. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (1/1) and the crude product was then re-purified by Prep-HPLC: Phase A: Water (10 mM NH ₄ HCO ₃ +0.1% NH ₄ OH) and ACN (35% Phase B up to 55% in 8 min). This resulted in N-(5-cyclopentylpyrimidin-2-yl)-2-[(1- methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (4.2 mg, 0.01 mmol, 6% yield, 96% purity) as a light-yellow solid. LC-MS method G: MS: m/z = 427.0 (M+H); Rt: 1.20 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.64 (s, 1H), 8.65-8.64 (m, 3H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 7.17 (d, J = 8.9 Hz, 1H), 4.04 (s, 3H), 3.01 (p, J = 8.1 Hz, 1H), 2.10-2.05 (m, 2H), 1.82 - 1.78 (m, 2H), 1.69 - 1.60 (m, 4H) Example 24: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(thiophen-2-ylsulf anyl)benzamide 5-Nitro-2-(thiophen-2-ylsulfanyl)benzoic acid (400 mg; 1.29 mmol; 1.5 eq.) was suspended in thionyl chloride (1.0 mL; 13.1 mmol; 15.0 eq.) at room temperature. The resulting mixture was stirred for 1 h at 80 °C under nitrogen atmosphere and it was then concentrated under reduced pressure. The residue was dissolved in 3.0 mL DCM, 5-cyclopentylpyrimidin-2-amine (150 mg; 0.86 mmol; 1.0 eq.) and pyridine (101 mg; 1.28 mmol; 1.5 eq.) were added. The reaction mixture was stirred for 2 h at room temperature under nitrogen atmosphere, the solvent was removed under vacuum and the residue was purified by automated silica gel column chromatography, eluted with PE/AcOEt (1/1) to afford N-(5-cyclopentylpyrimidin-2-yl)-5-nitro- 2-(thiophen-2-ylsulfanyl)benzamide was obtained as a white solid (41 mg; 0.10 mmol; 11% yield; 100% purity). LC-MS method D: MS: m/z = 427.1 (M+H); Rt: 1.91 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.48 (s, 1H), 8.65 (s, 2H), 8.49 (d, J = 2.5 Hz, 1H), 8.25 (dd, J = 8.9, 2.6 Hz, 1H), 7.99 (dd, J = 5.4, 1.2 Hz, 1H), 7.55 (dd, J = 3.6, 1.3 Hz, 1H), 7.29 (dd, J = 5.4, 3.6 Hz, 1H), 7.04 (d, J = 8.9 Hz, 1H), 3.00 (p, J = 8.8, 8.3 Hz, 1H), 2.12 – 2.03 (m, 2H), 1.85 – 1.64 (m, 2H), 1.70 – 1.53 (m, 4H) Example 25: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(1,3,4-thiadiazol- 2- ylsulfanyl)benzamide Using the same procedure as in example 23, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(1,3,4- thiadiazol-2-ylsulfanyl)benzamide (42 mg; 0.10 mmol; 12% yield; 99% purity) was obtained as a yellow solid. LC-MS method D: MS: m/z = 429.1 (M+H); Rt: 1.54 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.60 (s, 1H), 9.81 (s, 1H), 8.63 (s, 2H), 8.57 (d, J = 2.5 Hz, 1H), 8.29 (dd, J = 8.8, 2.6 Hz, 1H), 7.51 (d, J = 8.8 Hz, 1H), 2.99 (p, J = 9.2 Hz, 1H), 2.11 – 2.00 (m, 2H), 1.85 – 1.74 (m, 2H), 1.72 - 1.49 (m, 4H) Example 26: N-(4-cyclopentylphenyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-y l)sulfanyl]-5- nitrobenzamide 2-[(1-Methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (400 mg; 0.99 mmol; 1.0 eq.) was dissolved in 10.0 mL of dried DMF. 4-Cyclopentylaniline (186 mg; 1.09 mmol; 1.1 eq.), EDC.HCl (289 mg; 1.49 mmol; 1.5 eq.), HOBT (314 mg; 1.99 mmol; 2.0 eq.) and DIPEA (0.27 mL; 1.49 mmol; 1.5 eq.) were added. The resulting reaction mixture was stirred at room temperature for 64 h and the solvent was removed under reduced pressure. The residue was dissolved in AcOEt and extracted twice with water. The aqueous layer was washed with AcOEt two times. The combined organic layers were dried over Na ₂ SO ₄ , filtered and evaporated to residue. The residue was purified first by automated flash chromatography (heptane/AcOEt; gradient: 0-50% AcOEt) followed by reversed phase chromatography (preparative HPLC (sunfire RP18; water + 0.1% TFA/ACN + 0.1% TFA; gradient: 5-100% ACN). Acetonitrile was removed and to the residual water phase a NaHCO ₃ aqueous solution was added to adjust the pH to basic. The aqueous layer was extracted with DCM three times. The combined organic layers were dried over Na ₂ SO ₄ , filtered and evaporated to obtain N-(4-cyclopentylphenyl)-2- [(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzami de as a yellow solid (206 mg; 0.49 mmol; 49% yield; 100% purity). LC-MS method A: MS: m/z = 425.0 (M+H); Rt: 1.05 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.82 (s, 1H), 8.69 (d, J = 2.5 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.68 – 7.63 (m, 2H), 7.30 – 7.26 (m, 2H), 7.18 (d, J = 8.8 Hz, 1H), 4.05 (s, 3H), 3.03 – 2.93 (m, 1H), 2.07 – 1.98 (m, 2H), 1.83 – 1.72 (m, 2H), 1.72 – 1.60 (m, 2H), 1.59 – 1.48 (m, 2H) Example 28: 2-{2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobe nzamido}-4,5,6,7- tetrahydro-1-benzothiophene-3-carboxamide Using the general procedure A for amide coupling 2-{2-[(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamido}-4,5,6,7-tetrahydro-1-benzothi ophene-3-carboxamide was obtained as yellow solid (34 mg; 0.07 mmol; 58% yield; 97% purity). LC-MS method A: MS: m/z = 459.8 (M+H); Rt: 0.98 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 13.00 (s, 1H), 8.63 (s, 1H), 8.30 - 8.23 (m, 1H), 7.90 - 6.90 (m, 2H), 7.09 (d, J = 8.9 Hz, 1H), 4.04 (s, 3H), 2.80 - 2.72 (m, 2H), 2.72 - 2.66 (m, 2H), 1.82 - 1.71 (m, 4H) Example 29: N-[4-(2,2-difluoro-1-methylcyclopropyl)phenyl]-2-[(1-methyl- 1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-[4-(2,2-difluoro-1- methylcyclopropyl)phenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5 -yl)sulfanyl]-5-nitrobenzamide was obtained as yellow solid (85 mg; 0.19 mmol; 66% yield; 98% purity). LC-MS method L: MS: m/z = 447.0 (M+H); Rt: 1.01 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.93 (s, 1H), 8.70 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 7.76 – 7.72 (m, 2H), 7.41 – 7.38 (m, 2H), 7.19 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 1.96 – 1.90 (m, 1H), 1.66 – 1.59 (m, 1H), 1.51 – 1.48 (m, 3H) Example 30: N-[3-(dimethylamino)-4-(trifluoromethyl)phenyl]-2-[(1-methyl -1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-[3-(dimethylamino)-4- (trifluoromethyl)phenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide was obtained as yellow solid (40 mg; 0.08 mmol; 29% yield; 95% purity). LC-MS method L: MS: m/z = 468.1 (M+H); Rt: 1.82 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.13 (s, 1H), 8.75 (d, J = 2.5 Hz, 1H), 8.28 (dd, J = 8.9, 2.6 Hz, 1H), 7.86 – 7.84 (m, 1H), 7.69 – 7.65 (m, 2H), 7.22 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 2.70 (s, 6H) Example 31: N-[4-(3,3-dimethyl-2-oxoazetidin-1-yl)phenyl]-2-[(1-methyl-1 H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-[4-(3,3-dimethyl-2-oxoazetidin-1- yl)phenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5 -nitrobenzamide was obtained as yellow solid (74 mg; 0.16 mmol; 54% yield; 100% purity). LC-MS method L: MS: m/z = 454.1 (M+H); Rt: 1.58 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.89 (s, 1H), 8.72 (d, J = 2.6 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.77 – 7.73 (m, 2H), 7.40 – 7.37 (m, 2H), 7.17 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.51 (s, 2H), 1.32 (s, 6H) Example 32: N-[4-(2-hydroxypropan-2-yl)phenyl]-2-[(1-methyl-1H-1,2,3,4-t etrazol-5- yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-[4-(2-hydroxypropan-2-yl)phenyl]-2-[(1- methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide was obtained as a pale yellow solid (42 mg; 0.10 mmol; 33% yield; 98% purity). UPLC-MS method A: MS: m/z = 413.1 (M-H); Rt: 0.94 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.85 (s, 1H), 8.70 (d, J = 2.6 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.68 – 7.65 (m, 2H), 7.50 – 7.47 (m, 2H), 7.18 (d, J = 8.9 Hz, 1H), 4.99 (s, 1H), 4.05 (s, 3H), 1.44 (s, 6H) Example 33: N-[4-(dimethylcarbamoyl)phenyl]-2-[(1-methyl-1H-1,2,3,4-tetr azol-5- yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-[4-(dimethylcarbamoyl)phenyl]-2-[(1- methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide was obtained as a yellow solid (48 mg; 0.11 mmol; 36% yield; 96% purity). LC-MS Method L: MS: m/z = 427.8 (M+H); Rt: 1.38 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 8.73 (d, J = 2.6 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 7.83 – 7.79 (m, 2H), 7.49 – 7.46 (m, 2H), 7.21 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.01 – 2.94 (m, 6H) Example 34: N-(4-cyclopentyl-2-methoxyphenyl)-2-[(1-methyl-1H-1,2,3,4-te trazol-5- yl)sulfanyl]-5-nitrobenzamide Using the same procedure as in example 19, N-(4-cyclopentyl-2-methoxyphenyl)-2-[(1-methyl- 1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (35 mg, 0.08 mmol, 30% yield, 98% purity) was obtained as a yellow solid. LC-MS method H: (M+H) 455.2; Rt: 2.00 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.27 (s, 1H), 8.68 (d, J = 1.6 Hz, 1H), 8.24-8.22 (m, 1H), 7.59-7.57 (m, 1H), 7.13-7.10 (m, 1H), 6.99 (s, 1H), 6.90-6.87 (m, 1H), 4.05(s, 3H), 3.86-3.84 (m, 3H), 3.04-2.97 (m, 1H), 2.06-2.00 (m, 2H), 1.83-1.50 (m, 6H) Example 35: N-(4-cyclopentyl-2-fluorophenyl)-2-[(1-methyl-1H-1,2,3,4-tet razol-5- yl)sulfanyl]-5-nitrobenzamide Using the general procedure B for amide coupling, N-(4-cyclopentyl-2-fluorophenyl)-2-[(1- methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (64 mg; 0.14 mmol; 56% yield; 100% purity) was obtained as a white solid. LC-MS method A: (M+H) 443.1; Rt: 1.08 mi ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.73 (s, 1H), 8.73 (d, J = 2.6 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.60 (t, J = 8.2 Hz, 1H), 7.21 (dd, J = 12.0, 1.9 Hz, 1H), 7.17 - 7.13 (m, 2H), 4.05 (s, 3H), 3.07 - 2.99 (m, 1H), 2.08 - 2.00 (m, 2H), 1.83 - 1.74 (m, 2H), 1.70 - 1.61 (m, 2H), 1.60 - 1.51 (m, 2H) Example 36: N-(2-cyano-4-cyclopentylphenyl)-2-[(1-methyl-1H-1,2,3,4-tetr azol-5- yl)sulfanyl]-5-nitrobenzamide To a stirred mixture of 2-[(1-methyl-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (80.0 mg; 0.25 mmol; 1.0 eq.), 2-amino-5-cyclopentylbenzonitrile (75.7 mg; 0.38 mmol; 1.5 eq.) and HATU (254.9 mg; 0.63 mmol; 2.5 eq.) in 5.0 mL DMF was added DIEA (86.3 mg; 0.63 mmol; 2.5 eq.) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at room temperature under nitrogen atmosphere. The reaction mixture was then diluted with water and extracted with DCM four time. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (1:1), and again repurified by preparative HPLC to afford N-(2-cyano-4-cyclopentylphenyl)-2-[(1-methyl-1,2,3,4-tetrazo l- 5-yl)sulfanyl]-5-nitrobenzamide (31 mg; 0.07 mmol; 27% yield; 100% purity) as a light yellow solid. LC-MS method D: (M-H) 448.0; Rt: 1.83 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.23 (s, 1H), 8.82 (d, J = 2.5 Hz, 1H), 8.29 (dd, J = 8.9, 2.5 Hz, 1H), 7.81 (d, J = 2.1 Hz, 1H), 7.69 (dd, J = 8.4, 2.1 Hz, 1H), 7.57 (d, J = 8.4 Hz, 1H), 7.15 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 3.15 - 3.00 (m, 1H), 2.12 - 2.00 (m, 2H), 1.80 (qd, J = 6.5, 4.6 Hz, 2H), 1.73 - 1.48 (m, 4H) Example 37: N-(5-cyclopentylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3,4-tetraz ol-5-yl)sulfanyl]- 5-nitrobenzamide Using the general procedure B for amide coupling, N-(5-cyclopentylpyridin-2-yl)-2-[(1-methyl- 1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (40 mg; 0.09 mmol; 37% yield; 100% purity) was obtained as a white solid. LC-MS method A: (M+H) 426.1; Rt: 1.04 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.46 (s, 1H), 8.70 (d, J = 2.5 Hz, 1H), 8.31 (d, J = 2.4 Hz, 1H), 8.24 (dd, J = 8.8, 2.5 Hz, 1H), 8.08 (d, J = 8.5 Hz, 1H), 7.79 (dd, J = 8.6, 2.5 Hz, 1H), 7.19 (d, J = 8.9 Hz, 1H), 4.04 (s, 3H), 3.07 - 2.99 (m, 1H), 2.10 - 2.02 (m, 2H), 1.85 - 1.75 (m, 2H), 1.72 - 1.63 (m, 2H), 1.61 - 1.52 (m, 2H) Example 38: N-[4-(1,3-dimethyl-1H-pyrazol-5-yl)phenyl]-2-[(1-methyl-1H-1 ,2,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure B for amide coupling, N-[4-(1,3-dimethyl-1H-pyrazol-5-yl)phenyl]- 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenza mide (157 mg; 0.35 mmol; 78% yield; 99% purity) was obtained as a light yellow solid. LC-MS method A: (M+H) 451.2; Rt: 1.40 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.03 (s, 1H), 8.73 (d, J = 2.6 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 7.88 - 7.85 (m, 2H), 7.56 - 7.52 (m, 2H), 7.23 (d, J = 8.9 Hz, 1H), 6.19 - 6.17 (m, 1H), 4.05 (s, 3H), 3.78 (s, 3H), 2.17 (s, 3H) Example 39: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-N-{4-[1-meth yl-3- (trifluoromethyl)-1H-pyrazol-5-yl]phenyl}-5-nitrobenzamide Using the general procedure B for amide coupling, 2-[(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-N-{4-[1-methyl-3-(trifluoromethyl)-1H-pyrazol-5 -yl]phenyl}-5-nitrobenzamide (101 mg; 0.20 mmol; 60% yield; 100% purity) was obtained as a light beige solid. LC-MS method A: (M+H) 505.1; Rt: 1.57 min 1H NMR (500 MHz, DMSO-d ₆ ) δ 11.09 (s, 1H), 8.74 (d, J = 2.5 Hz, 1H), 8.28 (dd, J = 8.9, 2.6 Hz, 1H), 7.93 - 7.90 (m, 2H), 7.67 - 7.64 (m, 2H), 7.24 (d, J = 8.9 Hz, 1H), 6.91 - 6.90 (m, 1H), 4.06 (s, 3H), 3.96 (s, 3H) Example 40: 2-(2,2-difluorocyclopentyl)-5-{2-[(1-methyl-1H-1,2,3,4-tetra zol-5- yl)sulfanyl]-5-nitrobenzamido}benzamide Using the general procedure A for amide coupling 2-(2,2-difluorocyclopentyl)-5-{2-[(1-methyl- 1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamido}benzamid e (22 mg; 0.040 mmol; 59% yield; 100% purity) was obtained as a light-yellow solid. LC-MS method B: (M+H) 504.8; Rt: 1.50 min 1H NMR (500 MHz, DMSO-d ₆ ) δ 10.99 (s, 1H), 8.71 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.86 - 7.82 (m, 1H), 7.81 (dd, J = 8.5, 2.4 Hz, 1H), 7.78 (d, J = 2.3 Hz, 1H), 7.47 (dd, J = 8.6, 2.1 Hz, 1H), 7.43 - 7.39 (m, 1H), 7.20 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 4.05 - 3.93 (m, 1H), 2.29 - 2.11 (m, 3H), 2.08 - 1.98 (m, 1H), 1.94 - 1.86 (m, 1H), 1.87 - 1.76 (m, 1H) Example 41: N-(6-cyano-5-cyclopentylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3, 4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide To an ice-cooled mixture of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (141 mg; 0.50 mmol; 1.0 eq.) and 6-amino-3-cyclopentylpyridine-2-carbonitrile (100 mg; 0.50 mmol; 1.0 eq.) in 1 mL dry pyridine was added dropwise a mixture of phosphoryl chloride (51 µL; 0.55 mmol; 1.1 eq.) in 2.5 mL dried DCM under ice-cooling. The reaction mixture was stirred for 30 min at room temperature and the reaction mixture was reduced to dryness under vacuo. The residue was purified by silica gel column chromatography (n-heptane/0-50% EtOAc) giving N-(6-cyano-5-cyclopentylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3, 4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide (149 mg; 0.32 mmol; 65% yield; 98.0% purity) as a white solid. LC-MS method B: (M+H) 451.8; Rt: 1.81 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.94 (s, 1H), 8.77 (d, J = 2.5 Hz, 1H), 8.41 (d, J = 8.8 Hz, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 8.15 (d, J = 8.9 Hz, 1H), 7.18 (d, J = 8.9 Hz, 1H), 4.04 (s, 3H), 3.36 - 3.28 (m, 1H), 2.15 - 2.07 (m, 2H), 1.89 - 1.80 (m, 2H), 1.78 - 1.68 (m, 2H), 1.68 - 1.59 (m, 2H) Example 42: N-(1-ethyl-2,3-dihydro-1H-indol-6-yl)-2-[(4-methyl-4H-1,2,4- triazol-3- yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-(1-ethyl-2,3-dihydro-1H-indol-6-yl)-2-[(4- methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide was obtained as a brown-orange solid (68 mg; 0.16 mmol; 54% yield; 100% purity). LC-MS method L: MS: m/z = 424.8 (M+H); Rt: 1.44 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.59 (s, 1H), 8.86 (s, 1H), 8.60 (d, J = 2.6 Hz, 1H), 8.21 (dd, J = 8.9, 2.5 Hz, 1H), 7.04 – 7.01 (m, 1H), 6.97 – 6.94 (m, 2H), 6.87 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H), 3.36 – 3.31 (m, 2H), 3.11 (q, J = 7.2 Hz, 2H), 2.87 (t, J = 8.2 Hz, 2H), 1.14 (t, J = 7.2 Hz, 3H) Example 43: N-(3-hydroxy-1,1-dimethyl-2,3-dihydro-1H-inden-5-yl)-2-[(4-m ethyl-4H- 1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-(3-hydroxy-1,1-dimethyl-2,3-dihydro-1H- inden-5-yl)-2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-n itrobenzamide was obtained as a yellow solid (22 mg; 0.05 mmol; 16% yield; 93% purity). UPLC-MS Method A: MS: m/z = 438.0 (M-H); Rt: 0.94 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.79 (s, 1H), 8.86 (s, 1H), 8.63 (d, J = 2.6 Hz, 1H), 8.22 (dd, J = 8.9, 2.5 Hz, 1H), 7.78 (d, J = 1.9 Hz, 1H), 7.55 (dd, J = 8.2, 2.0 Hz, 1H), 7.21 (d, J = 8.2 Hz, 1H), 6.90 (d, J = 8.9 Hz, 1H), 5.11 (t, J = 7.0 Hz, 1H), 3.59 (s, 3H), 2.25 (dd, J = 12.4, 7.0 Hz, 1H), 1.73 (dd, J = 12.4, 7.0 Hz, 1H), 1.34 (s, 3H), 1.16 (s, 3H) Example 44: N-{4-[1-(hydroxymethyl)cyclopropyl]phenyl}-2-[(4-methyl-4H-1 ,2,4-triazol- 3-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-{4-[1-(hydroxymethyl)cyclopropyl]phenyl}- 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamid e was obtained as a yellow solid (15 mg; 0.04 mmol; 12% yield; 100% purity). LC-MS method L: MS: m/z = 435.7 (M+H); Rt: 1.36 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.76 (s, 1H), 8.85 (s, 1H), 8.62 (d, J = 2.6 Hz, 1H), 8.22 (dd, J = 8.9, 2.5 Hz, 1H), 7.67 – 7.62 (m, 2H), 7.35 – 7.30 (m, 2H), 6.90 (d, J = 8.9 Hz, 1H), 4.63 (t, J = 5.7 Hz, 1H), 3.58 (s, 3H), 3.54 (d, J = 5.6 Hz, 2H), 0.86 – 0.82 (m, 2H), 0.75 – 0.71 (m, 2H) Example 45: N-[4-(1-carbamoylcyclopentyl)phenyl]-2-[(4-methyl-4H-1,2,4-t riazol-3- yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-[4-(1-carbamoylcyclopentyl)phenyl]-2-[(4- methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide was obtained as a beige solid (39 mg; 0.08 mmol; 24% yield; 100% purity). LC-MS method L: MS: m/z = 466.8 (M+H); Rt: 1.38 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.81 (s, 1H), 8.86 (s, 1H), 8.63 (d, J = 2.6 Hz, 1H), 8.22 (dd, J = 8.9, 2.6 Hz, 1H), 7.70 - 7.66 (m, 2H), 7.40 - 7.36 (m, 2H), 6.98 - 6.95 (m, 1H), 6.89 (d, J = 8.9 Hz, 1H), 6.80 - 6.77 (m, 1H), 3.58 (s, 3H), 2.55 - 2.50 (m, 2H), 1.82 - 1.74 (m, 2H), 1.66 - 1.58 (m, 4H) Example 46: methyl 1-(4-{2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5- nitrobenzamido}phenyl)cyclopentane-1-carboxylate Using the general procedure A for amide coupling methyl 1-(4-{2-[(4-methyl-4H-1,2,4-triazol- 3-yl)sulfanyl]-5-nitrobenzamido}phenyl)cyclopentane-1-carbox ylate was obtained as a beige solid (17 mg; 0.03 mmol; 3% yield; 100% purity). LC-MS method L: MS: m/z = 481.7 (M+H); Rt: 1.66 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.84 (s, 1H), 8.86 (s, 1H), 8.63 (d, J = 2.5 Hz, 1H), 8.23 (dd, J = 8.9, 2.6 Hz, 1H), 7.73 - 7.68 (m, 2H), 7.38 - 7.34 (m, 2H), 6.90 (d, J = 8.9 Hz, 1H), 3.58 (s, 3H), 3.56 (s, 3H), 2.56 - 2.51 (m, 2H), 1.93 - 1.85 (m, 2H), 1.73 - 1.59 (m, 4H) Example 47: 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitro-N-[4-(o xolan-3- yl)phenyl]benzamide Using the general procedure A for amide coupling 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]- 5-nitro-N-[4-(oxolan-3-yl)phenyl]benzamide was obtained as a light-yellow solid (51 mg; 0.12 mmol; 44% yield; 100% purity). LC-MS method B: MS: m/z = 425.7 (M+H); Rt: 1.41 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.81 (s, 1H), 8.86 (s, 1H), 8.64 (d, J = 2.6 Hz, 1H), 8.22 (dd, J = 8.9, 2.5 Hz, 1H), 7.72 - 7.67 (m, 2H), 7.33 - 7.30 (m, 2H), 6.89 (d, J = 8.9 Hz, 1H), 4.04 (t, J = 7.8 Hz, 1H), 3.98 - 3.93 (m, 1H), 3.81 (q, J = 7.8 Hz, 1H), 3.58 (s, 3H), 3.55 (t, J = 7.9 Hz, 1H), 3.43 - 3.35 (m, 1H), 2.35 - 2.28 (m, 1H), 1.97 - 1.89 (m, 1H) Example 48: 6-cyclopentyl-2-fluoro-3-{2-[(1-methyl-1H-1,2,3,4-tetrazol-5 -yl)sulfanyl]-5- nitrobenzamido}benzamide Using the general procedure A for amide coupling 6-cyclopentyl-2-fluoro-3-{2-[(1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamido}benzamide (38 mg, 0.080 mmol, 55% yield; 100% purity) was obtained as a white solid. LC-MS method B: (M+H): 486.8, Rt: 1.53 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.81 (s, 1H), 8.74 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 8.06 - 8.02 (m, 1H), 7.70 - 7.64 (m, 2H), 7.24 (d, J = 8.4 Hz, 1H), 7.15 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.14 - 3.03 (m, 1H), 2.06 - 1.95 (m, 2H), 1.86 - 1.73 (m, 2H), 1.70 - 1.53 (m, 4H) Example 49: N-(3-chloro-5-cyclopentylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3 ,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (50 mg; 0.18 mmol; 1.0 eq.) was suspended in 116 µL dry pyridine and phosphoryl chloride (36 µL; 0.39 mmol; 2.2 eq.) was added. The mixture was stirred for 30 min at room temperature. After complete conversion to acid chloride a solution of 3-chloro-5-cyclopentylpyridin-2-amine (36 mg; 0.18 mmol; 1.0 eq.) in 0.75 mL dried DCM was added. The reaction mixture was stirred for 1.5 h at room temperature and reduced to dryness under vacuo. The residue was purified by reversed phase column chromatography (water + 0.1% HCOOH /10-100% ACN + 0.1% HCOOH) giving N-(3- chloro-5-cyclopentylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3,4-te trazol-5-yl)sulfanyl]-5- nitrobenzamide (22 mg; 0.050 mmol; 27% yield; 100% purity) as a beige solid. LC-MS method B: (M+H) 459.7-462.7; Rt: 1.73 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.35 (s, 1H), 8.75 (d, J = 2.5 Hz, 1H), 8.40 (d, J = 2.1 Hz, 1H), 8.27 (dd, J = 8.9, 2.6 Hz, 1H), 7.99 (d, J = 2.1 Hz, 1H), 7.10 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 3.14 - 3.04 (m, 1H), 2.14 - 2.04 (m, 2H), 1.87 - 1.75 (m, 2H), 1.73 - 1.55 (m, 4H) Example 50: N-(6-cyclopentyl-4-fluoropyridin-3-yl)-2-[(1-methyl-1H-1,2,3 ,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-(6-cyclopentyl-4-fluoropyridin-3-yl)-2-[(1- methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (49 mg; 0.10 mmol; 73% yield; 95% purity) was obtained as a white solid. LC-MS method B: (M+H) 444.8; Rt: 1.61 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 8.81 (d, J = 2.5 Hz, 1H), 8.73 (d, J = 10.3 Hz, 1H), 8.28 (dd, J = 8.9, 2.5 Hz, 1H), 7.39 (d, J = 11.4 Hz, 1H), 7.14 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 3.24 - 3.18 (m, 1H), 2.05 - 1.99 (m, 2H), 1.81 - 1.72 (m, 4H), 1.69 - 1.62 (m, 2H) Example 51: N-(3-cyano-5-cyclopentylpyridin-2-yl)-2-[(4-methyl-4H-1,2,4- triazol-3- yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-(3-cyano-5-cyclopentylpyridin-2-yl)-2-[(4- methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide (4.0 mg; 0.01 mmol, 5% yield; 92% purity) was obtained as a white solid. LC-MS method B: (M+H) 450.8; Rt: 1.56 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.77 - 11.75 (m, 1H), 8.88 (s, 1H), 8.75 - 8.73 (m, 1H), 8.71 - 8.69 (m, 1H), 8.37 - 8.35 (m, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 6.88 (d, J = 8.9 Hz, 1H), 3.60 (s, 3H), 3.17 - 3.09 (m, 1H), 2.13 - 2.05 (m, 2H), 1.86 - 1.76 (m, 2H), 1.73 - 1.57 (m, 4H) Example 52: 6-cyclopentyl-2-fluoro-3-{2-[(4-methyl-4H-1,2,4-triazol-3-yl )sulfanyl]-5- nitrobenzamido}benzamide Using the general procedure A for amide coupling 6-cyclopentyl-2-fluoro-3-{2-[(4-methyl-4H- 1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamido}benzamide (30 mg; 0.06 mmol; 36% yield; 100% purity) was obtained as a white solid. LC-MS method B: (M+H) 485.8; Rt: 1.41 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.73 (s, 1H), 8.87 (s, 1H), 8.68 (d, J = 2.6 Hz, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 8.07 - 8.02 (m, 1H), 7.71 - 7.66 (m, 1H), 7.68 - 7.64 (m, 1H), 7.24 (d, J = 8.5 Hz, 1H), 6.88 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H), 3.14 - 3.04 (m, 1H), 2.06 - 1.94 (m, 2H), 1.85 - 1.73 (m, 2H), 1.70 - 1.53 (m, 4H) Example 53: N-[4-cyclopentyl-3-(1-hydroxyethyl)phenyl]-2-[(4-methyl-4H-1 ,2,4-triazol-3- yl)sulfanyl]-5-nitrobenzamide Using the general procedure A for amide coupling N-[4-cyclopentyl-3-(1-hydroxyethyl)phenyl]- 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamid e (30 mg; 0.06 mmol; 47% yield; 100% purity) was obtained as an ochre solid. LC-MS method C: (M+H) 468.8; Rt: 1.59 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.78 (s, 1H), 8.87 (s, 1H), 8.65 (d, J = 2.5 Hz, 1H), 8.22 (dd, J = 8.9, 2.5 Hz, 1H), 7.82 (d, J = 2.4 Hz, 1H), 7.67 (dd, J = 8.5, 2.5 Hz, 1H), 7.27 (d, J = 8.5 Hz, 1H), 6.86 (d, J = 8.9 Hz, 1H), 5.14 (d, J = 3.6 Hz, 1H), 5.11 - 5.07 (m, 1H), 3.59 (s, 3H), 3.24 - 3.19 (m, 1H), 2.02 - 1.97 (m, 1H), 1.97 - 1.91 (m, 1H), 1.85 - 1.77 (m, 2H), 1.70 - 1.63 (m, 2H), 1.58 - 1.51 (m, 2H), 1.32 (d, J = 6.4 Hz, 3H) Example 54: N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H-1,2,4-triazo l-5-yl)sulfanyl]- 5-nitrobenzamide N-(5-cyclopentylpyrimidin-2-yl)-2-iodo-5-nitrobenzamide (40 mg; 0.09 mmol; 1.0 eq.) and 1- methyl-4,5-dihydro-1H-1,2,4-triazole-5-thione (14 mg; 0.12 mmol; 1.3 eq.) were suspended in 1.0 mL dried 1,4-dioxane and DIEA (45 µL; 0.27 mmol; 3.0 eq.) was added. The vial was purged with argon, then xantphos (5.2 mg; 0.01 mmol; 0.1 eq.) and tris(dibezylideneacetone)dipalladium(0) (4.1 mg; 0.004 mmol; 0.05 eq.) were added. The vial was closed with the septum and stirred in a microwave reactor for 30 min at 110 °C. The mixture was concentrated in vacuo and purified by chromatography (reversed phase; buffer A: 0.1% HCOOH/water; buffer B: 0.1% HCOOH/ACN; gradient 10-100%) to get N-(5- cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H-1,2,4-triazol-5-y l)sulfanyl]-5-nitrobenzamide (26 mg; 0.06 mmol; 67% yield; 97% purity) as a yellow-orange solid. UPLC-MS method A: (M+H) 311.1; Rt: 1.00 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.57 (s, 1H), 8.66 - 8.64 (m, 2H), 8.58 (d, J = 2.5 Hz, 1H), 8.24 (s, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 7.02 (d, J = 8.9 Hz, 1H), 3.86 (s, 3H), 3.05 - 2.97 (m, 1H), 2.11 - 2.03 (m, 2H), 1.85 - 1.76 (m, 2H), 1.72 - 1.63 (m, 2H), 1.63 - 1.55 (m, 2H) Example 55: N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H-1,2,3-triazo l-5-yl)sulfanyl]- 5-nitrobenzamide Using the same procedure as in example 54, N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H- 1,2,3-triazol-5-yl)sulfanyl]-5-nitrobenzamide was obtained as yellow solid (14 mg; 0.03 mmol; 36% yield; 95% purity). UPLC-MS method A: (M+H) 311.1; Rt: 1.00 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.62 - 11.47 (m, 1H), 8.65 (s, 2H), 8.59 (d, J = 2.5 Hz, 1H), 8.21 (dd, J = 8.9, 2.5 Hz, 1H), 8.21 (s, 1H), 6.84 (d, J = 8.9 Hz, 1H), 3.95 (s, 3H), 3.05 - 2.97 (m, 1H), 2.11 - 2.04 (m, 2H), 1.85 - 1.76 (m, 2H), 1.72 - 1.62 (m, 2H), 1.63 - 1.54 (m, 2H) Example 56: N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H-1,2,3-triazo l-4-yl)sulfanyl]- 5-nitrobenzamide Using the same procedure as in example 54, N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H- 1,2,3-triazol-4-yl)sulfanyl]-5-nitrobenzamide was obtained as pale-yellow solid (10 mg; 0.02 mmol; 26% yield; 99% purity). UPLC-MS method A: (M+H) 426.1; Rt: 0.99 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.52 - 11.41 (m, 1H), 8.65 (s, 2H), 8.58 (s, 1H), 8.48 (d, J = 2.5 Hz, 1H), 8.17 (dd, J = 8.9, 2.6 Hz, 1H), 7.03 (d, J = 8.9 Hz, 1H), 4.14 (s, 3H), 3.06 - 2.97 (m, 1H), 2.11 - 2.04 (m, 2H), 1.85 - 1.76 (m, 2H), 1.72 - 1.64 (m, 2H), 1.64 - 1.55 (m, 2H) Example 57: N-(5-cyclopentylpyrimidin-2-yl)-2-[(4-cyclopropyl-4H-1,2,4-t riazol-3- yl)sulfanyl]-5-nitrobenzamide Using the same procedure as in example 54, N-(5-cyclopentylpyrimidin-2-yl)-2-[(4-cyclopropyl- 4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide was obtained as pale-yellow solid (4 mg; 0.01 mmol; 9% yield; 90% purity). UPLC-MS method A: (M+H) 450.0; Rt: 0.97 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.58 - 11.55 (m, 1H), 8.85 (s, 1H), 8.66 (s, 2H), 8.58 (d, J = 2.5 Hz, 1H), 8.22 (dd, J = 8.9, 2.6 Hz, 1H), 6.99 (d, J = 8.8 Hz, 1H), 3.22 - 3.16 (m, 1H), 3.05 - 2.97 (m, 1H), 2.11 - 2.04 (m, 2H), 1.85 - 1.76 (m, 2H), 1.72 - 1.64 (m, 2H), 1.64 - 1.55 (m, 2H), 0.94 - 0.88 (m, 4H) Example 58: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-[(2-oxoimidazolidi n-4- yl)sulfanyl]benzamide Using the same procedure as in example 54, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-[(2- oxoimidazolidin-4-yl)sulfanyl]benzamide was obtained as pale-grey solid (8.8 mg; 0.02 mmol; 21% yield; 89% purity). UPLC-MS method A: (M+H) 343.0; Rt: 1.01 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.42 (s, 1H), 10.47 - 10.45 (m, 1H), 10.37 - 10.35 (m, 1H), 8.65 (s, 2H), 8.52 (d, J = 2.5 Hz, 1H), 8.32 (dd, J = 8.9, 2.5 Hz, 1H), 7.31 (d, J = 8.9 Hz, 1H), 6.99 - 6.97 (m, 1H), 3.05 - 2.97 (m, 1H), 2.11 - 2.04 (m, 2H), 1.85 - 1.76 (m, 2H), 1.73 - 1.63 (m, 2H), 1.64 - 1.55 (m, 2H) Example 59: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-{[1,2,4]triazolo[4 ,3-a]pyridin-3- ylsulfanyl}benzamide To a stirred mixture of N-(5-cyclopentylpyrimidin-2-yl)-2-iodo-5-nitrobenzamide (120 mg; 0.27 mmol; 1.0 eq.) and [1,2,4]triazolo[4,3-a]pyridine-3-thiol (55 mg; 0.35 mmol; 1.30 eq.) in 1.0 mL 1,4-dioxane, Pd ₂ (dba) ₃ (12 mg; 0.013 mmol; 0.05 eq.), xantphos (16 mg; 0.0 mmol; 0.1 eq.) and DIEA (34 mg; 0.26 mmol; 1.0 eq.) were added at room temperature. The resulting mixture was stirred for 1 h at 70 ^o C under nitrogen atmosphere, concentrated under reduced pressure and purified by preparative chromatography (reversed phase; buffer A: water (10 mM NH ₄ HCO ₃ + 0.1% NH ₄ OH); buffer B: ACN (25% buffer B up to 55% in 8 min) to obtain N-(5- cyclopentylpyrimidin-2-yl)-5-nitro-2-{[1,2,4]triazolo[4,3-a] pyridin-3-ylsulfanyl}benzamide (48 mg, 0.10 mmol, 39% yield, 100% purity) as a yellow solid. LC-MS method D: MS: m/z = 463.1 (M+H); Rt: 1.49 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 8.66 (s, 2H), 8.62 (d, J = 2.5 Hz, 1H), 8.32 (dt, J = 6.9, 1.2 Hz, 1H), 8.08 (dd, J = 8.9, 2.6 Hz, 1H), 7.99 (dt, J = 9.3, 1.1 Hz, 1H), 7.56 (ddd, J = 9.3, 6.7, 1.1 Hz, 1H), 7.12 (td, J = 6.8, 1.1 Hz, 1H), 6.67 (d, J = 8.8 Hz, 1H), 3.00 (p, J = 8.3, 7.7 Hz, 1H), 2.14 - 1.97 (m, 2H), 1.85 - 1.50 (m, 6H) Example 61: N-(5-cyclopentylpyrimidin-2-yl)-2-[(6-methylpyridin-2-yl)sul fanyl]-5- nitrobenzamide

Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(6- methylpyridin-2-yl)sulfanyl]-5-nitrobenzamide was obtained as a yellow solid (48 mg; 0.11 mmol; 41% yield; 99% purity). LC-MS method D: MS: m/z = 436 (M+H); Rt: 1.79 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 8.58 (s, 2H), 8.41 (d, J = 2.6 Hz, 1H), 8.24 (dd, J = 8.8, 2.6 Hz, 1H), 7.68 (t, J = 7.8 Hz, 1H), 7.56 (d, J = 8.8 Hz, 1H), 7.21 (dd, J = 7.7, 3.2 Hz, 2H), 3.01 – 2.91 (m, 1H), 2.43 (s, 3H), 2.10 – 1.98 (m, 2H), 1.82 – 1.48 (m, 6H) Example 62: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-{[5-(trifluorometh yl)pyridin-2- yl]sulfanyl}benzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-{[5- (trifluoromethyl)pyridin-2-yl]sulfanyl}benzamide was obtained as an off-white solid (53 mg; 0.11 mmol; 39% yield; 99% purity). LC-MS method G: MS: m/z = 490.1 (M+H); Rt: 1.59 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.37 (s, 1H), 8.78 (s, 1H), 8.52 (s, 2H), 8.43 (d, J = 2.5 Hz, 1H), 8.31 (dd, J = 8.7, 2.6 Hz, 1H), 8.09 (dd, J = 9.0, 2.4 Hz, 1H), 7.88 (d, J = 8.7 Hz, 1H), 7.48 (d, J = 8.5 Hz, 1H), 2.92 (p, J = 8.6 Hz, 1H), 2.06 – 1.95 (m, 2H), 1.82 - 1.72 (m, 2H), 1.69 - 1.58 (m, 2H), 1.56 - 1.46 (m, 2H) Example 63: 2-[(2-cyanophenyl)sulfanyl]-N-(5-cyclopentylpyrimidin-2-yl)- 5- nitrobenzamide

Using the same procedure as in example 59, 2-[(2-cyanophenyl)sulfanyl]-N-(5- cyclopentylpyrimidin-2-yl)-5-nitrobenzamide was obtained as a light-yellow solid (39 mg; 0.09 mmol; 33% yield; 99% purity). LC-MS method L: MS: m/z = 446.1 (M+H); Rt: 1.77 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.40 (s,1H), 8.63 (s, 2H), 8.42 (d, J = 2.5 Hz, 1H), 8.19 (dd, J = 8.9, 2.6 Hz, 1H), 7.44 (t, J = 8.0 Hz, 1H), 7.16 – 7.01 (m, 4H), 3.05 – 2.93 (m, 1H), 2.11 – 1.99 (m, 2H), 1.85 – 1.51 (m, 6H) Example 64: N-(5-cyclopentylpyrimidin-2-yl)-2-[(3-methoxyphenyl)sulfanyl ]-5- nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(3- methoxyphenyl)sulfanyl]-5-nitrobenzamide was obtained as a light-yellow solid (36 mg; 0.08 mmol; 29% yield; 100% purity). LC-MS method L: MS: m/z = 451.1 (M+H); Rt: 1.91 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.40 (s,1H), 8.63 (s,2H), 8.42 (d, J = 2.5 Hz, 1H), 8.19 (dd, J = 8.9, 2.6 Hz, 1H), 7.44 (t, J = 8.0 Hz, 1H), 7.16 - 7.03 (m, 4H), 3.78 (s,3H), 3.02 - 2.92 (m,1H), 2.11 - 2.00 (m,2H), 1.87 - 1.50 (m,6H) Example 65: 2-[(4-chlorophenyl)sulfanyl]-N-(5-cyclopentylpyrimidin-2-yl) -5- nitrobenzamide Using the same procedure as in example 59, 2-[(4-chlorophenyl)sulfanyl]-N-(5- cyclopentylpyrimidin-2-yl)-5-nitrobenzamide was obtained as a white solid (40 mg; 0.09 mmol; 26% yield; 97% purity). LC-MS method D: MS: m/z = 455.1 (M+H); Rt: 2.02 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.40 (s, 1H), 8.62 (s, 2H), 8.43 (d, J = 2.5 Hz, 1H), 8.18 (dd, J = 8.9, 2.6 Hz, 1H), 7.57 (s, 4H), 7.08 (d, J = 8.8 Hz, 1H), 3.07 – 2.91 (m, 1H), 2.11i – 2.00 (m, 2H), 1.86 – 1.51 (m, 6H) Example 66: N-(5-cyclopentylpyrimidin-2-yl)-2-[(4-fluorophenyl)sulfanyl] -5- nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(4- fluorophenyl)sulfanyl]-5-nitrobenzamide was obtained as a light-yellow solid (49 mg; 0.11 mmol; 41% yield; 100% purity). LC-MS method G: MS: m/z = 439.1 (M+H); Rt: 1.60. ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.41 (s, 1H), 8.63 (s, 2H), 8.43 (d, J = 2.5 Hz, 1H), 8.17 (dd, J = 8.9, 2.6 Hz, 1H), 7.66 – 7.61 (m, 2H), 7.43 – 7.34 (m, 2H), 6.99 (d, J = 8.9 Hz, 1H), 2.99 (p, J = 8.3, 7.7 Hz, 1H), 2.13 – 2.00 (m, 2H), 1.83 – 1.49 (m, 6H) Example 67: 2-[(3-cyanopyridin-2-yl)sulfanyl]-N-(5-cyclopentylpyrimidin- 2-yl)-5- nitrobenzamide Using the same procedure as in example 59, 2-[(3-cyanopyridin-2-yl)sulfanyl]-N-(5- cyclopentylpyrimidin-2-yl)-5-nitrobenzamide was obtained as a yellow solid (47 mg; 0.10 mmol; 37% yield; 95% purity). LC-MS method D: MS: m/z = 447.18M+H); Rt: 1.70 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 8.64 (dd, J = 4.9, 1.8 Hz, 1H), 8.56 (s, 2H), 8.47 - 8.46 (m, 1H), 8.36 (dd, J = 7.8, 1.8 Hz, 1H), 8.29 (dd, J = 8.8, 2.6 Hz, 1H), 7.73 (d, J = 8.7 Hz, 1H), 7.49 (dd, J = 7.8, 4.9 Hz, 1H), 2.96 (p, J = 8.6, 8.0 Hz, 1H), 2.10 – 1.95 (m, 2H), 1.78 - 1.50 (m, 6H) Example 68: 2-[(2-chloro-6-fluorophenyl)sulfanyl]-N-(5-cyclopentylpyrimi din-2-yl)-5- nitrobenzamide Using the same procedure as in example 59, 2-[(2-chloro-6-fluorophenyl)sulfanyl]-N-(5- cyclopentylpyrimidin-2-yl)-5-nitrobenzamide was obtained as a light yellow solid (49 mg; 0.10 mmol; 37% yield; 99% purity). LC-MS method G: MS: m/z = 473.0 (M+H); Rt: 1.62 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.54 (s, 1H), 8.66 (s, 2H), 8.58 (d, J = 2.6 Hz, 1H), 8.19 (dd, J = 8.9, 2.6 Hz, 1H), 7.76 - 7.62 (m, 2H), 7.49 (td, J = 8.1, 1.6 Hz, 1H), 6.87 (d, J = 8.9 Hz, 1H), 3.02 (q, J = 9.0 Hz, 1H), 2.13 - 2.03 (m, 2H), 1.85 - 1.53 (m, 6H) Example 69: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(pyridazin-3- ylsulfanyl)benzamide hydrochloride Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2- (pyridazin-3-ylsulfanyl)benzamide hydrochloride was obtained as an off-white solid (28 mg; 0.06 mmol; 21% yield; 99% purity). LC-MS method G: MS: m/z = 423.1 (M+H); Rt: 1.17 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.45 (s, 1H), 9.14 (s, 1H), 8.56 (s, 2H), 8.46 (d, J = 2.6 Hz, 1H), 8.29 (dd, J = 8.6, 2.6 Hz, 1H), 7.71 (d, J = 8.7 Hz, 1H), 7.67 (d, J = 3.2 Hz, 2H), 2.96 (p, J = 8.9 Hz, 1H), 2.07 - 2.00 (m, 2H), 1.83 - 1.50 (m, 6H) Example 70: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(1,3-thiazol-2- ylsulfanyl)benzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(1,3- thiazol-2-ylsulfanyl)benzamide was obtained as a yellow solid (45 mg; 0.11 mmol; 32% yield; 100% purity). LC-MS method D: MS: m/z = 428.1 (M+H); Rt: 1.70 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.54 (s, 1H), 8.64 (s, 2H), 8.54 (d, J = 2.6 Hz, 1H), 8.27 (dd, J = 8.9, 2.6 Hz, 1H), 8.07 (s, 2H), 7.30 (d, J = 8.9 Hz, 1H), 3.08 - 2.91 (m, 1H), 2.13 – 2.00 (m, 2H), 1.85 - 1.51 (m, 6H) Example 71: N-(5-cyclopentylpyrimidin-2-yl)-2-[(4-methyl-1,3-thiazol-2-y l)sulfanyl]-5- nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(4-methyl-1,3- thiazol-2-yl)sulfanyl]-5-nitrobenzamide was obtained as a yellow solid (90 mg; 0.19 mmol; 58% yield; 99% purity). LC-MS method D: MS: m/z = 442.0 (M+H); Rt: 1.50 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.37 (s, 1H), 8.64 (s, 2H), 8.52 (d, J = 2.6 Hz, 1H), 8.27 (dd, J = 8.9, 2.6 Hz, 1H), 7.60 (q, J = 0.9 Hz, 1H), 7.33 (d, J = 8.9 Hz, 1H), 3.06 - 2.93 (m, 1H), 2.43 (d, J = 1.0 Hz, 3H), 2.11 – 2.00 (m, 2H), 1.84 - 1.49 (m, 6H) Example 72: N-(5-cyclopentylpyrimidin-2-yl)-2-[(5-methyl-1,3,4-oxadiazol -2-yl)sulfanyl]- 5-nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(5-methyl- 1,3,4-oxadiazol-2-yl)sulfanyl]-5-nitrobenzamide was obtained as a yellow solid (25 mg; 0.06 mmol; 22% yield; 93% purity). LC-MS method D: MS: m/z = 427.0 (M+H); Rt: 1.57 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.67 (s, 1H), 8.70 - 8.63 (m, 3H), 8.28 (dd, J = 8.9, 2.6 Hz, 1H), 7.50 (d, J = 8.9 Hz, 1H), 2.99 (p, J = 8.6, 7.8 Hz, 1H), 2.55 (s, 3H), 2.13 – 2.00 (m, 2H), 1.84 - 1.50 (m, 6H) Example 73: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-{[5-(propan-2-yl)- 1,3,4-oxadiazol- 2-yl]sulfanyl}benzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-{[5- (propan-2-yl)-1,3,4-oxadiazol-2-yl]sulfanyl}benzamide was obtained as a light orange solid (9 mg; 0.02 mmol; 4% yield; 95% purity). LC-MS method G: MS: m/z = 455.1 (M+H); Rt: 1.41 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.65 (s,1H), 8.66 - 8.65 (m, 3H), 8.30 (dd, J = 8.8, 2.6 Hz, 1H), 7.47 (d, J = 8.8 Hz, 1H), 3.28 - 3.19 (m, 1H), 3.06 – 2.95 (m, 1H), 2.14 – 2.00 (m, 2H), 1.87 – 1.48 (m, 6H), 1.30 (d, J = 7.0 Hz, 6H) Example 74: N-(5-cyclopentylpyrimidin-2-yl)-2-[(5-cyclopropyl-4-methyl-4 H-1,2,4-triazol- 3-yl)sulfanyl]-5-nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(5-cyclopropyl- 4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide was obtained as a yellow solid (50 mg; 0.11 mmol; 38% yield; 99% purity). LC-MS method G: MS: m/z = 466.1 (M+H); Rt: 1.16 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.54 (s, 1H), 8.65 (s, 2H), 8.57 (d, J = 2.5 Hz, 1H), 8.21 (dd, J = 8.9, 2.5 Hz, 1H), 6.89 (d, J = 8.9 Hz, 1H), 3.55 (s, 3H), 3.01 (p, J = 8.7 Hz, 1H), 2.18- 1.88 (m, 3H), 1.82-1.56 (m, 6H), 1.06 - 1.00 (m, 4H) Example 75: N-(5-cyclopentylpyrimidin-2-yl)-2-[(4,5-dimethyl-4H-1,2,4-tr iazol-3- yl)sulfanyl]-5-nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(4,5-dimethyl- 4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide was obtained as a yellow solid (39 mg; 0.09 mmol; 25% yield; 99% purity). LC-MS method D: MS: m/z = 440.2 (M+H); Rt: 1.37 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.58 (s, 1H), 8.66 (s, 2H), 8.57 (d, J = 2.5 Hz, 1H), 8.20 (dd, J = 8.9, 2.5 Hz, 1H), 6.89 (d, J = 8.9 Hz, 1H), 3.44 (s, 3H), 3.07 - 2.93 (m, 1H), 2.44 (s, 3H), 2.14 – 2.00 (m, 2H), 1.87 - 1.51 (m, 6H) Example 76: N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H-imidazol-2-y l)sulfanyl]-5- nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H- imidazol-2-yl)sulfanyl]-5-nitrobenzamide was obtained as a yellow solid (30 mg; 0.07 mmol; 32% yield; 100% purity). LC-MS method D: MS: m/z = 425.1 (M+H); Rt: 1.51 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.51 (s, 1H), 8.65 (m, 2H), 8.51 (d, J = 2.5 Hz, 1H), 8.21 (dd, J = 8.9, 2.5 Hz, 1H), 7.57 (d, J = 1.2 Hz, 1H), 7.21 (d, J = 1.2 Hz, 1H), 6.68 (d, J = 8.8 Hz, 1H), 3.59 (s, 3H), 3.00 (p, J = 8.2, 7.6 Hz, 1H), 2.13 - 2.00 (m,2H), 1.86 - 1.51 (m, 6H) Example 77: 2-[(5-tert-butyl-1,3-oxazol-2-yl)sulfanyl]-N-(5-cyclopentylp yrimidin-2-yl)-5- nitrobenzamide hydrochloride Using the same procedure as in example 59, 2-[(5-tert-butyl-1,3-oxazol-2-yl)sulfanyl]-N-(5- cyclopentylpyrimidin-2-yl)-5-nitrobenzamide hydrochloride was obtained as a light yellow solid (32 mg; 0.06 mmol; 23% yield; 99% purity). LC-MS method G: MS: m/z = 468.1 (M+H); Rt: 1.73 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.57 (s, 1H), 8.66 (s, 2H), 8.60 (d, J = 2.6 Hz, 1H), 8.32 (dd, J = 8.9, 2.5 Hz, 1H), 7.16 (s, 1H), 7.14 (d, J = 8.8 Hz, 1H), 3.01 - 2.98 (m, 1H), 2.14 - 2.00 (m, 2H), 1.84 - 1.55j (m, 4H), 1.26 (m, 9H) Example 78: N-(5-cyclopentylpyrimidin-2-yl)-2-[(2-fluorophenyl)sulfanyl] -5- nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(2- fluorophenyl)sulfanyl]-5-nitrobenzamide was obtained as a light yellow solid (22 mg; 0.05 mmol; 22% yield; 100% purity). LC-MS method D: MS: m/z = 439.1 (M+H); Rt: 1.90 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.47 (s, 1H), 8.64 (s, 2H), 8.49 (d, J = 2.6 Hz, 1H), 8.20 (dd, J = 8.9, 2.6 Hz, 1H), 7.74 - 7.58 (m, 2H), 7.48 – 7.35 (m, 2H), 6.98 (d, J = 8.8 Hz, 1H), 3.07 - 2.95 (m, 1H), 2.14 – 2.00 (m, 2H), 1.87 - 1.51 (m, 4H) Example 79: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(pyrimidin-2- ylsulfanyl)benzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2- (pyrimidin-2-ylsulfanyl)benzamide was obtained as a yellow solid (4 mg; 0.01 mmol; 1% yield; 88% purity). LC-MS method G: MS: m/z = 423.0 (M+H); Rt: 1.24 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.33 (s, 1H), 8.62 – 8.60 (m, 2H), 8.52 (s, 2H), 8.40 – 8.36 (m, 1H), 8.36 – 8.30 (m, 1H), 8.02 (d, J = 8.6 Hz, 1H), 7.33 – 7.28 (m, 1H), 2.99 – 2.85 (m, 1H), 2.10 – 1.94 (m, 2H), 1.85 – 1.45 (m, 6H) Example 80: 2-(1,3-benzothiazol-2-ylsulfanyl)-N-(5-cyclopentylpyrimidin- 2-yl)-5- nitrobenzamide Using the same procedure as in example 59, 2-(1,3-benzothiazol-2-ylsulfanyl)-N-(5- cyclopentylpyrimidin-2-yl)-5-nitrobenzamide was obtained as a pink solid (32 mg; 0.07 mmol; 15% yield; 97% purity). LC-MS method G: MS: m/z = 478.1 (M+H); Rt: 1.62 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.55 (s, 1H), 8.58 (s, 2H), 8.53 (d, J = 2.6 Hz, 1H), 8.32 (dd, J = 8.8, 2.6 Hz, 1H), 8.09 (dd, J = 8.0, 1.3 Hz, 1H), 7.99 (dd, J = 8.0, 1.3 Hz, 1H), 7.84 (d, J = 8.8 Hz, 1H), 7.55 (ddd, J = 8.3, 7.2, 1.4 Hz, 1H), 7.52 - 7.44 (m, 1H), 2.96 (ddd, J = 17.0, 9.7, 7.4 Hz, 1H), 2.07 - 2.01 (m, 2H), 1.79 - 1.62 (m, 4H), 1.56 - 1.51 (m, 2H) Example 81: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(1,3-thiazol-5- ylsulfanyl)benzamide Using the same procedure as in example 54, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(1,3- thiazol-5-ylsulfanyl)benzamide was obtained as a dark red solid (46 mg; 0.11 mmol; 47% yield; 99% purity). LC-MS method B: (M+H) 428.1; Rt: 1.66 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.50 (s, 1H), 9.48 (d, J = 0.8 Hz, 1H), 8.66 - 8.64 (m, 2H), 8.53 (d, J = 2.5 Hz, 1H), 8.27 (d, J = 0.8 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.11 (d, J = 8.9 Hz, 1H), 3.05 - 2.97 (m, 1H), 2.11 - 2.04 (m, 2H), 1.84 - 1.76 (m, 2H), 1.72 - 1.64 (m, 2H), 1.64 - 1.55 (m, 2H) Example 82: N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-cyclopropyl-1H-1,2,3,4 -tetrazol-5- yl)sulfanyl]-5-nitrobenzamide 2-chloro-N-(5-cyclopentylpyrimidin-2-yl)-5-nitrobenzamide (32.0 mg; 0.09 mmol; 1.0 eq.) and 1-cyclopropyl-1H-1,2,3,4-tetrazole-5-thiol (19.3 mg; 0.13 mmol; 1.5 eq.) were dissolved in DCM and TEA (0.2 mL; 1.44 mmol; 16.8 eq.) was added. The reaction mixture was stirred in an open vial at 90 °C for 2 h and concentrated under reduced pressure. The residue was then diluted with aqueous 5% NaHCO ₃ solution and extracted with AcOEt twice. The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure. The residue was purified by flash chromatography eluted starting with 100% DCM to DCM/EtOAc (8/2) to afford N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-cyclopropyl-1H-1,2,3,4 - tetrazol-5-yl)sulfanyl]-5-nitrobenzamide in pure form (15 mg; 0.03 mmol; 38% yield, 99% purity) as a yellow foam. LC-MS method B: (M+H) 453.1; Rt: 1.67 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.66 (s, 1H), 8.66 (s, 2H), 8.64 (d, J = 2.6 Hz, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 7.30 (d, J = 8.9 Hz, 1H), 3.73 - 3.69 (m, 1H), 3.04 - 2.98 (m, 1H), 2.10 - 2.05 (m, 2H), 1.84 - 1.77 (m, 2H), 1.71 - 1.64 (m, 2H), 1.62 - 1.56 (m, 2H), 1.22 - 1.19 (m, 2H), 1.15 - 1.11 (m, 2H) Example 83: N-(5-cyclopentylpyrimidin-2-yl)-2-[(4-methyl-4H-1,2,4-triazo l-3-yl)sulfanyl]- 5-nitrobenzamide 2-Chloro-N-(5-cyclopentylpyrimidin-2-yl)-5-nitrobenzamide (40 mg; 0.11 mmol; 1.0 eq.) and 3- mercapto-4-methyl-1,2,4-triazol (38 mg; 0.32 mmol; 3.0 eq.) were suspended in 0.5 mL acetonitrile and TEA (44.6 µL; 0.32 mmol; 3.0 eq.) was added. The reaction mixture was stirred in a closed vial at 80 °C for 30 min. The reaction suspension was filtered off and evaporated under reduced pressure. The residue was dissolved in EtOAc and extracted once with aqueous 5% NaHCO ₃ solution and once with brine. The organic layer was dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure. The residue was purified by flash chromatography eluted from 100% DCM to DCM/MeOH (8/2) to afford N-(5- cyclopentylpyrimidin-2-yl)-2-[(4-methyl-4H-1,2,4-triazol-3-y l)sulfanyl]-5-nitrobenzamide in pure form (25 mg; 0.06 mmol; 55% yield; 100% purity) as a yellow foam. LC-MS method B: (M+H) 426.1; Rt: 1.44 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.53 (s, 1H), 8.85 (s, 1H), 8.66 - 8.64 (m, 2H), 8.57 (d, J = 2.5 Hz, 1H), 8.21 (dd, J = 8.9, 2.6 Hz, 1H), 6.89 (d, J = 8.9 Hz, 1H), 3.57 (s, 3H), 3.05 - 2.97 (m, 1H), 2.11 - 2.04 (m, 2H), 1.85 - 1.76 (m, 2H), 1.73 - 1.64 (m, 2H), 1.64 - 1.54 (m, 2H) Example 84: 2-cyclopentyl-5-(2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl ]-5- nitrobenzamido)benzamide Using the same procedure as in example 54, 2-cyclopentyl-5-(2-[(4-methyl-4H-1,2,4-triazol-3- yl)sulfanyl]-5-nitrobenzamido)benzamide was obtained as white solid (29 mg; 0.06 mmol; 37% yield; 99% purity). LC-MS method A: (M+H) 467.1; Rt: 0.87 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.86 (s, 1H), 8.87 (s, 1H), 8.64 (d, J = 2.6 Hz, 1H), 8.23 (dd, J = 8.9, 2.6 Hz, 1H), 7.80 - 7.76 (m, 1H), 7.74 (dd, J = 8.4, 2.4 Hz, 1H), 7.68 (d, J = 2.3 Hz, 1H), 7.42 - 7.38 (m, 1H), 7.40 - 7.35 (m, 1H), 6.89 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H), 3.32 - 3.25 (m, 1H), 2.03 - 1.94 (m, 2H), 1.83 - 1.73 (m, 2H), 1.68 - 1.57 (m, 2H), 1.59 - 1.50 (m, 2H) Example 85: 2-cyclopentyl-5-(2-[(1-methyl-1H-1,2,4-triazol-5-yl)sulfanyl ]-5- nitrobenzamido)benzamide Using the same procedure as in example 54, 2-cyclopentyl-5-(2-[(1-methyl-1H-1,2,4-triazol-5- yl)sulfanyl]-5-nitrobenzamido)benzamide was obtained as yellow-orange solid (36 mg; 0.08 mmol; 52% yield; 100% purity). UPLC-MS method A: (M+H) 467.2; Rt: 0.97 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.87 (s, 1H), 8.63 (d, J = 2.6 Hz, 1H), 8.27 - 8.24 (m, 1H), 8.25 (s, 1H), 7.79 - 7.76 (m, 1H), 7.73 (dd, J = 8.5, 2.4 Hz, 1H), 7.67 (d, J = 2.4 Hz, 1H), 7.40 - 7.38 (m, 1H), 7.39 - 7.37 (m, 1H), 7.03 (d, J = 8.9 Hz, 1H), 3.88 (s, 3H), 3.30 - 3.26 (m, 1H), 2.02 - 1.94 (m, 2H), 1.82 - 1.74 (m, 2H), 1.67 - 1.57 (m, 2H), 1.59 - 1.50 (m, 2H) Example 86: 5-cyclopentyl-2-[5-nitro-2-(1,3-thiazol-5-ylsulfanyl) benzamido]pyridine-4- carboxamide Using the same procedure as in example 54, 5-cyclopentyl-2-[5-nitro-2-(1,3-thiazol-5- ylsulfanyl)benzamido]pyridine-4-carboxamide was obtained as white solid (9 mg; 0.02 mmol; 20% yield; 97% purity). UPLC-MS method A: (M+H) 470.1; Rt: 0.99 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.49 (s, 1H), 9.48 (d, J = 0.7 Hz, 1H), 8.58 (d, J = 2.5 Hz, 1H), 8.43 (s, 1H), 8.28 (d, J = 0.8 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 8.05 - 8.04 (m, 1H), 8.04 - 8.02 (m, 1H), 7.69 - 7.66 (m, 1H), 7.12 (d, J = 8.9 Hz, 1H), 3.25 - 3.17 (m, 1H), 2.07 - 1.99 (m, 2H), 1.84 - 1.76 (m, 2H), 1.70 - 1.60 (m, 4H) Example 87: 5-cyclopentyl-2-(2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl ]-5- nitrobenzamido)pyridine-4-carboxamide Using the same procedure as in example 54, 5-cyclopentyl-2-(2-[(4-methyl-4H-1,2,4-triazol-3- yl)sulfanyl]-5-nitrobenzamido)pyridine-4-carboxamide was obtained as a white solid (12 mg; 0.03 mmol; 28% yield; 83% purity). UPLC-MS method A: (M+H) 468.1; Rt: 0.87 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.57 - 11.53 (m, 1H), 8.86 (s, 1H), 8.65 (d, J = 2.5 Hz, 1H), 8.43 (s, 1H), 8.22 (dd, J = 8.9, 2.5 Hz, 1H), 8.07 - 8.05 (m, 1H), 8.05 - 8.03 (m, 1H), 7.69 - 7.67 (m, 1H), 6.90 (d, J = 8.9 Hz, 1H), 3.58 (s, 3H), 3.26 - 3.17 (m, 1H), 2.07 - 1.99 (m, 2H), 1.84 - 1.76 (m, 2H), 1.70 - 1.60 (m, 4H) Example 88: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[6 -(propan-2- yl)pyridazin-3-yl]benzamide Step 1: 2-iodo-5-nitro-N-[6-(propan-2-yl)pyridazin-3-yl]benzamide Using the same procedure as in step 1 of the synthesis of amide intermediate 25, 2-iodo-5- nitro-N-[6-(propan-2-yl)pyridazin-3-yl]benzamide was obtained as white solid (51 mg; 0.12 mmol; 50 yield; 99% purity). UPLC-MS method A: (M+H) 413.0; Rt: 1.0 min Step 2: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[6 -(propan-2- yl)pyridazin-3-yl]benzamide Using the same procedure as in example 54, 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitro-N-[6-(propan-2-yl)pyridazin-3-yl]benzamide was obtained as white solid (22 mg; 0.05 mmol; 45% yield; 98% purity). UPLC-MS method A: (M+H) 401.1; Rt: 0.97 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 12.12 - 12.05 (m, 1H), 8.80 (d, J = 2.6 Hz, 1H), 8.30 (d, J = 9.2 Hz, 1H), 8.27 (dd, J = 8.9, 2.6 Hz, 1H), 7.75 (d, J = 9.2 Hz, 1H), 7.20 (d, J = 8.9 Hz, 1H), 4.04 (s, 3H), 3.30 - 3.21 (m, 1H), 1.32 (d, J = 7.0 Hz, 6H) Example 89: 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitro-N-[5-(p ropan-2- yl)pyrimidin-2-yl]benzamide Step 1: 2-iodo-5-nitro-N-[5-(propan-2-yl)pyrimidin-2-yl]benzamide Using the same procedure as in step 1 of amide intermediate 25, 2-iodo-5-nitro-N-[5-(propan- 2-yl)pyrimidin-2-yl]benzamide was obtained as white solid (190 mg; 0.41 mmol; 40% yield; 90% purity). LC-MS method B: (M+H) 412.9; Rt: 1.55 min Step 2: 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitro-N-[5-(p ropan-2-yl)pyrimidin-2- yl]benzamide Using the same procedure as in example 54, 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5- nitro-N-[5-(propan-2-yl)pyrimidin-2-yl]benzamide was obtained as a yellow solid (26 mg; 0.65 mmol; 51% yield; 95% purity). LC-MS method B: (M+H) 400.0; Rt: 1.32 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.55 (s, 1H), 8.85 (s, 1H), 8.66 (s, 2H), 8.58 (d, J = 2.5 Hz, 1H), 8.21 (dd, J = 8.9, 2.5 Hz, 1H), 6.89 (d, J = 8.9 Hz, 1H), 3.59 - 3.55 (m, 3H), 3.03 - 2.91 (m, 1H), 1.27 (d, J = 7.0 Hz, 6H) Example 90: N-(5-cyclopentylpyrimidin-2-yl)-2-[(4,5-dimethyl-1H-imidazol -2-yl)sulfanyl]- 5-nitrobenzamide Step 1: 4,5-dimethyl-1-{[2-(trimethylsilyl)ethoxy]methyl}-1H-imidazo le-2-thiol To a stirred mixture of 4,5-dimethyl-1H-imidazole-2-thiol (500 mg; 3.71 mmol; 1.0 eq.) in 5.0 mL THF was added NaH (300 mg; 7.50 mmol; 2.0 eq.) in portions at 0 ^o C.. The resulting mixture was stirred for 15 min at 0 ^o C. To the above mixture SEM-Cl (618 mg; 3.71 mmol; 1.0 eq.) was added at 0 ^o C and it was then stirred for 2 h at room temperature. The reaction was quenched by the addition of water and the aqueous layer was extracted with DCM three times. The combined organic phases were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (1/1) to afford 4,5-dimethyl-1-[[2-(trimethylsilyl)ethoxy]methyl]imidazole-2 -thiol (300 mg, 1.16 mmol, 31% yield, 100% purity) as a white solid. LC-MS method G: (M+H) 259.0; Rt: 0.53 min Step 2: N-(5-cyclopentylpyrimidin-2-yl)-2-[(4,5-dimethyl-1-{[2- (trimethylsilyl)ethoxy]methyl}-1H-imidazol-2-yl)sulfanyl]-5- nitrobenzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-2-[(4,5-dimethyl- 1-{[2-(trimethylsilyl)ethoxy]methyl}-1H-imidazol-2-yl)sulfan yl]-5-nitrobenzamide was obtained as a yellow solid (100 mg; 0.17 mmol; 37% yield; 97% purity). LC-MS method G: (M+H) 569.2; Rt: 0.79 min Step 3: N-(5-cyclopentylpyrimidin-2-yl)-2-[(4,5-dimethyl-1H-imidazol -2-yl)sulfanyl]-5- nitrobenzamide To a stirred mixture of N-(5-cyclopentylpyrimidin-2-yl)-2-[(4,5-dimethyl-1-[[2- (trimethylsilyl)ethoxy]methyl]imidazol-2-yl)sulfanyl]-5-nitr obenzamide (90 mg; 0.15 mmol; 1.0 eq.) in 3.0 mL DCM, TFA (1.0 mL; 13.46 mmol; 88.0 eq.) was added at room temperature. The resulting mixture was stirred for 1 h at room temperature and it was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (1/1). A second purification was performed by reverse phase preparative HPLC: mobile phase A: Water (10 mM NH ₄ HCO ₃ + 0.1% NH ₄ OH); phase B: ACN (30% Phase B up to 60% in 8 min) to obtain N-(5-cyclopentylpyrimidin-2-yl)-2-[(4,5-dimethyl-1H-imidazol -2- yl)sulfanyl]-5-nitrobenzamide was obtained as a yellow solid (15 mg; 0.03 mmol; 20% yield; 94% purity). LC-MS method D: MS: (M+H) 439.2; Rt: 1.54 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 12.49 (s, 1H), 8.65 (s, 2H), 8.49 (d, J = 2.5 Hz, 1H), 8.23 (dd, J = 8.9, 2.6 Hz, 1H), 6.90 (d, J = 8.9 Hz, 1H), 3.07 - 2.95 (m, 1H), 2.18 – 2.00 (m, 8H), 1.84 – 1.55 (m, 6H) Example 91: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(4H-1,2,4-triazol- 3- ylsulfanyl)benzamide

Step 1: 4-{[2-(trimethylsilyl)ethoxy]methyl}-4H-1,2,4-triazole-3-thi ol To a stirred mixture of mercaptotriazole (1.00 g; 9.39 mmol; 1.0 eq.) in 10.0 mL THF 60% NaH (0.75 g; 18.79 mmol; 2.0 eq.) was added in portions at room temperature. After stirring the reaction for 30 min at 0 ^o C, SEM-Cl (3.13 g; 18.77 mmol; 2.0 eq.) was added in portions at 0 °C. The reaction mixture was stirred overnight at room temperature and the reaction was quenched by the addition of iced water at room temperature. The aqueous layer was extracted with DCM three times, the combined organic phases were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (1/1) to afford 4-[[2- (trimethylsilyl)ethoxy]methyl]-1,2,4-triazole-3-thiol (1.0 g; 4.10 mmol; 44% yield; 95% purity) as a white solid. LC-MS method G: (M+H) 232.0; Rt: 0.66 min Step 2: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-[(4-{[2-(trimethyl silyl)ethoxy]methyl}- 4H-1,2,4-triazol-3-yl)sulfanyl]benzamide Using the same procedure as in example 59, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-[(4-{[2- (trimethylsilyl)ethoxy]methyl}-4H-1,2,4-triazol-3-yl)sulfany l]benzamide was obtained as a light yellow solid (40 mg; 0.07 mmol; 7% yield; 100% purity). LC-MS method G: (M+H) 542.2; Rt: 1.12 min Step 3: N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(4H-1,2,4-triazol- 3- ylsulfanyl)benzamide Using the same procedure as in example 42, N-(5-cyclopentylpyrimidin-2-yl)-5-nitro-2-(4H- 1,2,4-triazol-3-ylsulfanyl)benzamide was obtained as a white solid (5 mg; 0.01 mmol; 14% yield; 95% purity). LC-MS Method G: (M+H) 412.0; Rt: 1.12 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 8.65 (s, 2H), 8.36 (d, J = 2.6 Hz, 1H), 8.18 - 8.07 (m, 2H), 7.09 (d, J = 8.9 Hz, 1H), 3.01 (m, 1H), 2.08 (m, 2H), 1.86 - 1.52 (m, 6H) Example 92: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-{6 -[4-(propan-2-yl) phenyl]-[1,2,4]triazolo[1,5-a]pyridin-2-yl} benzamide Using the general procedure C of amide coupling afforded 2-[(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-5-nitro-N-{6-[4-(propan-2-yl) phenyl]-[1,2,4]triazolo[1,5-a]pyridin-2-yl} benzamide as a beige solid (53.7 mg; 0.101 mmol; 51% yield; 97% purity). UPLC-MS method A: (M+H) 516.2; Rt: 1.16 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 12.00 - 11.93 (m, 1H), 9.26 - 9.24 (m, 1H), 8.78 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 8.03 (dd, J = 9.2, 1.9 Hz, 1H), 7.85 - 7.82 (m, 1H), 7.76 - 7.72 (m, 2H), 7.41 - 7.38 (m, 2H), 7.19 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 3.01 - 2.92 (m, 1H), 1.26 (d, J = 6.9 Hz, 6H) Example 93: N-(4-cyclopentyl-2,6-difluorophenyl)-2-[(1-methyl-1H-1,2,3,4 -tetrazol-5- yl)sulfanyl]-5-nitrobenzamide

Using the general procedure A of amide coupling afforded N-(4-cyclopentyl-2,6- difluorophenyl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfan yl]-5-nitrobenzamide as a white solid (12.3 mg; 0.025 mmol; 18% yield; 94% purity) UPLC-MS mmethod A: (M+H) 461.1; Rt: 1.19 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 10.83 (s, 1H), 8.79 (d, J = 2.5 Hz, 1H), 8.28 (dd, J = 8.9, 2.5 Hz, 1H), 7.20 - 7.15 (m, 2H), 7.09 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 3.09 - 3.01 (m, 1H), 2.09 - 2.01 (m, 2H), 1.84 - 1.74 (m, 2H), 1.70 - 1.61 (m, 2H), 1.61 - 1.52 (m, 2H) Example 94: N-[3-fluoro-5-(pyrrolidin-1-yl)pyridin-2-yl]-2-[(1-methyl-1H -1,2,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure D of amide coupling afforded N-[3-fluoro-5-(pyrrolidin-1-yl)pyridin- 2-yl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitr obenzamide as an orange solid (49.4 mg; 0.104 mmol; 39% yield; 94% purity) UPLC-MS method A: (M+H) 445.1; Rt: 1.02 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.96 (s, 1H), 8.79 - 8.73 (m, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.69 - 7.66 (m, 1H), 7.07 (d, J = 8.8 Hz, 1H), 6.96 (dd, J = 12.6, 2.5 Hz, 1H), 4.05 (s, 3H), 3.33 - 3.28 (m, 4H), 2.02 - 1.95 (m, 4H) Example 95: N-{3-fluoro-5-[(3S)-3-methylpyrrolidin-1-yl]pyridin-2-yl}-2- [(1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure D of amide coupling afforded N-{3-fluoro-5-[(3S)-3- methylpyrrolidin-1-yl]pyridin-2-yl}-2-[(1-methyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5- nitrobenzamide as a yellow orange solid (17.9 mg; 0.038 mmol; 15% yield; 97% purity UPLC-MS method A: (M+H) 459.1; Rt: 1.08 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.96 (s, 1H), 8.80 - 8.72 (m, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 7.67 - 7.62 (m, 1H), 7.07 (d, J = 8.9 Hz, 1H), 6.93 (dd, J = 12.5, 2.5 Hz, 1H), 4.05 (s, 3H), 3.49 (dd, J = 9.5, 7.2 Hz, 1H), 3.43 - 3.36 (m, 1H), 3.35 - 3.29 (m, 1H), 2.87 (dd, J = 9.6, 7.5 Hz, 1H), 2.45 - 2.34 (m, 1H), 2.18 - 2.08 (m, 1H), 1.67 - 1.56 (m, 1H), 1.10 (d, J = 6.6 Hz, 3H) Example 96: N-{3-fluoro-5-[(3R)-3-fluoropyrrolidin-1-yl]pyridin-2-yl}-2- [(1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure D of amide coupling afforded N-{3-fluoro-5-[(3R)-3- fluoropyrrolidin-1-yl]pyridin-2-yl}-2-[(1-methyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5- nitrobenzamide as a pale brown solid (14.4 mg; 0.027 mmol; 12% yield; 86% purity) UPLC-MS method A: (M+H) 463.1; Rt: 0.97 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.00 (s, 1H), 8.80 - 8.73 (m, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.74 - 7.71 (m, 1H), 7.07 (d, J = 8.9 Hz, 1H), 7.06 (dd, J = 12.5, 2.5 Hz, 1H), 5.58 - 5.40 (m, 1H), 4.06 (s, 3H), 3.68 - 3.59 (m, 1H), 3.58 - 3.53 (m, 1H), 3.54 - 3.47 (m, 1H), 3.46 - 3.38 (m, 1H), 2.34 - 2.14 (m, 2H) Example 97: N-{3-fluoro-5-[(3S)-3-fluoropyrrolidin-1-yl]pyridin-2-yl}-2- [(1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure D of amide coupling afforded N-{3-fluoro-5-[(3S)-3- fluoropyrrolidin-1-yl]pyridin-2-yl}-2-[(1-methyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5- nitrobenzamide as a beige yellow solid (6.2 mg; 0.013 mmol; 6% yield; 96% purity) UPLC-MS method A: (M+H) 463.1; Rt: 0.98 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.00 (s, 1H), 8.79 - 8.74 (m, 1H), 8.25 (dd, J = 8.9, 2.6 Hz, 1H), 7.72 (d, J = 1.9 Hz, 1H), 7.07 (d, J = 8.9 Hz, 1H), 7.06 (dd, J = 12.4, 2.5 Hz, 1H), 5.58 - 5.41 (m, 1H), 4.05 (s, 3H), 3.67 - 3.60 (m, 1H), 3.57 - 3.48 (m, 2H), 3.46 - 3.38 (m, 1H), 2.32 - 2.13 (m, 2H) Example 98: N-(4-cyclopentyl-2,6-difluorophenyl)-2-[(4-methyl-4H-1,2,4-t riazol-3- yl)sulfanyl]-5-nitrobenzamide Using the general procedure of Buchwald coupling afforded N-(4-cyclopentyl-2,6- difluorophenyl)-2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl] -5-nitrobenzamide as a beige solid (63.2 mg; 0.138 mmol; 57% yield; 100% purity) UPLC-MS method A: (M+H) 460.1; Rt: 1.84 min 1H NMR (700 MHz, DMSO-d ₆ ) δ 10.74 (s, 1H), 8.89 (s, 1H), 8.73 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 9.0, 2.5 Hz, 1H), 7.18 - 7.15 (m, 2H), 6.85 (d, J = 8.9 Hz, 1H), 3.60 (s, 3H), 3.08 - 3.02 (m, 1H), 2.07 - 2.02 (m, 2H), 1.82 - 1.76 (m, 2H), 1.69 - 1.62 (m, 2H), 1.61 - 1.53 (m, 2H) Example 99: 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4 -(pentafluoro-6- sulfanyl)phenyl]benzamide Using the general procedure A of amide coupling afforded 2-[(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-5-nitro-N-[4-(pentafluoro-6-sulfanyl)phenyl]ben zamide as a white solid (25.7 mg; 0.052 mmol; 38% yield; 99% purity). UPLC-MS method A: (M+H) 483.1; Rt: 1.15 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 11.27 (s, 1H), 8.77 (d, J = 2.5 Hz, 1H), 8.29 (dd, J = 8.9, 2.5 Hz, 1H), 8.00 - 7.94 (m, 4H), 7.24 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H) Example 100: 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitro-N-[4-(p entafluoro-6- sulfanyl)phenyl]benzamide Using the general procedure A of amide coupling afforded 2-[(4-methyl-4H-1,2,4-triazol-3- yl)sulfanyl]-5-nitro-N-[4-(pentafluoro-6-sulfanyl)phenyl]ben zamide as a white solid (22 mg; 0.046 mmol; 33% yield; 99% purity). LC-MS method B: (M+H) 491.9; Rt: 1.7 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 11.22 (s, 1H), 8.86 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 8.01 - 7.94 (m, 4H), 6.93 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H) Example 101: N-[2,6-difluoro-4-(pyrrolidin-1-yl)phenyl]-2-[(4-methyl-4H-1 ,2,4-triazol-3- yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-[2,6-difluoro-4-(pyrrolidin-1- yl)phenyl]-2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-ni trobenzamide as a white solid (23 mg; 0.05 mmol; 41% yield; 100% purity). UPLC-MS method A: (M+H) 461.1; Rt: 1.03 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.33 (s, 1H), 8.88 (s, 1H), 8.69 (d, J = 2.6 Hz, 1H), 8.23 (dd, J = 8.9, 2.5 Hz, 1H), 6.83 (d, J = 8.9 Hz, 1H), 6.37 - 6.29 (m, 2H), 3.60 (s, 3H), 3.28 - 3.22 (m, 4H), 2.00 - 1.95 (m, 4H) Example 102: N-[2,6-difluoro-4-(pyrrolidin-1-yl)phenyl]-2-[(1-methyl-1H-1 ,2,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-[2,6-difluoro-4-(pyrrolidin-1- yl)phenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5 -nitrobenzamide as a yellow solid (44 mg; 0.095 mmol; 79% yield; 100% purity). UPLC-MS method A: (M+H) 462.1; Rt: 1.11 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.43 (s, 1H), 8.75 (d, J = 2.6 Hz, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 7.08 (d, J = 8.9 Hz, 1H), 6.37 - 6.29 (m, 2H), 4.06 (s, 3H), 3.28 - 3.22 (m, 4H), 2.00 - 1.94 (m, 4H) Example 103: N-[4-(3,3-difluoropyrrolidin-1-yl)-2,6-difluorophenyl]-2-[(1 -methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-[4-(3,3-difluoropyrrolidin-1-yl)-2,6- difluorophenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfan yl]-5-nitrobenzamide as a beige solid (23 mg; 0.045 mmol; 52% yield; 98% purity). UPLC-MS method A: (M+H) 498.1; Rt: 1.09 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.50 (s, 1H), 8.75 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 6.51 - 6.44 (m, 2H), 4.06 (s, 3H), 3.76 (t, J = 13.2 Hz, 2H), 3.52 (t, J = 7.3 Hz, 2H), 2.63 - 2.51 (m, 2H) Example 104: N-{2,6-difluoro-4-[(3R)-3-fluoropyrrolidin-1-yl]phenyl}-2-[( 1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-{2,6-difluoro-4-[(3R)-3- fluoropyrrolidin-1-yl]phenyl}-2-[(1-methyl-1H-1,2,3,4-tetraz ol-5-yl)sulfanyl]-5-nitrobenzamide as a grey solid (20 mg; 0.039 mmol; 45% yield; 96% purity). UPLC-MS method A: (M+H) 480.1; Rt: 1.06 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.45 (s, 1H), 8.75 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 6.45 - 6.37 (m, 2H), 5.55 - 5.38 (m, 1H), 4.06 (s, 3H), 3.63 - 3.53 (m, 1H), 3.52 - 3.48 (m, 1H), 3.48 - 3.42 (m, 1H), 3.41 - 3.33 (m, 1H), 2.34 - 2.12 (m, 2H) Example 105: N-{2,6-difluoro-4-[(3S)-3-fluoropyrrolidin-1-yl]phenyl}-2-[( 1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-{2,6-difluoro-4-[(3S)-3- fluoropyrrolidin-1-yl]phenyl}-2-[(1-methyl-1H-1,2,3,4-tetraz ol-5-yl)sulfanyl]-5-nitrobenzamide as a grey solid (12 mg; 0.025 mmol; 60% yield; 99% purity). UPLC-MS method A: (M+H) 480.1; Rt: 1.07 min 1H NMR (700 MHz, DMSO-d ₆ ) δ 10.49 (s, 1H), 8.76 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 9.0, 2.5 Hz, 1H), 7.07 (d, J = 8.9 Hz, 1H), 6.44 - 6.39 (m, 2H), 5.53 - 5.41 (m, 1H), 4.06 (s, 3H), 3.59 - 3.49 (m, 2H), 3.48 - 3.44 (m, 1H), 3.41 - 3.36 (m, 1H), 2.32 - 2.16 (m, 2H) Example 106: N-{2,6-difluoro-4-[(3S)-3-methylpyrrolidin-1-yl]phenyl}-2-[( 4-methyl-4H- 1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling to get N-{2,6-difluoro-4-[(3S)-3- methylpyrrolidin-1-yl]phenyl}-2-[(4-methyl-4H-1,2,4-triazol- 3-yl)sulfanyl]-5-nitrobenzamide as a beige solid (15 mg; 0.032 mmol; 26% yield; 98% purity). LC-MS Method B: (M+H) 475.0; Rt: 1.70 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.33 (s, 1H), 8.88 (s, 1H), 8.69 (d, J = 2.5 Hz, 1H), 8.23 (dd, J = 8.9, 2.5 Hz, 1H), 6.83 (d, J = 8.9 Hz, 1H), 6.34 - 6.26 (m, 2H), 3.59 (s, 3H), 3.43 (dd, J = 9.6, 7.2 Hz, 1H), 3.34 - 3.21 (m, 2H), 2.83 (dd, J = 9.5, 7.5 Hz, 1H), 2.43 - 2.33 (m, 1H), 2.20 - 2.07 (m, 1H), 1.66 - 1.56 (m, 1H), 1.09 (d, J = 6.7 Hz, 3H) Example 107: N-{2,6-difluoro-4-[(3S)-3-methylpyrrolidin-1-yl]phenyl}-2-[( 1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-{2,6-difluoro-4-[(3S)-3- methylpyrrolidin-1-yl]phenyl}-2-[(1-methyl-1H-1,2,3,4-tetraz ol-5-yl)sulfanyl]-5-nitrobenzamide as a grey solid (18 mg; 0.037 mmol; 47% yield; 100% purity). LC-MS method B: (M+H) 476.1.1; Rt: 1.84 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.41 (s, 1H), 8.75 (d, J = 2.5 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.08 (d, J = 8.9 Hz, 1H), 6.34 - 6.26 (m, 2H), 4.05 (s, 3H), 3.43 (dd, J = 9.6, 7.2 Hz, 1H), 3.38 - 3.32 (m, 1H), 3.29 - 3.21 (m, 1H), 2.83 (dd, J = 9.6, 7.5 Hz, 1H), 2.43 - 2.32 (m, 1H), 2.16 - 2.07 (m, 1H), 1.66 - 1.56 (m, 1H), 1.09 (d, J = 6.6 Hz, 3H) Example 108: N-[2,6-difluoro-4-(thiomorpholin-4-yl)phenyl]-2-[(4-methyl-4 H-1,2,4- triazol-3-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-[2,6-difluoro-4-(thiomorpholin-4- yl)phenyl]-2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-ni trobenzamide as a grey-yellow solid (10 mg; 0.021 mmol; 17% yield; 100% purity). UPLC-MS method A: (M+H) 493.1.1; Rt: 1.00 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.43 (s, 1H), 8.88 (s, 1H), 8.69 (d, J = 2.6 Hz, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 6.84 (d, J = 8.9 Hz, 1H), 6.82 - 6.74 (m, 2H), 3.72 - 3.67 (m, 4H), 3.60 (s, 3H), 2.66 - 2.61 (m, 4H) Example 109: N-[2,6-difluoro-4-(thiomorpholin-4-yl)phenyl]-2-[(1-methyl-1 H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-[2,6-difluoro-4-(thiomorpholin-4- yl)phenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5 -nitrobenzamide as a grey-yellow solid (15 mg; 0.031 mmol; 39% yield; 99% purity). UPLC-MS method A: (M+H) 494.1.1; Rt: 1.09 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.52 (s, 1H), 8.75 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.10 (d, J = 8.9 Hz, 1H), 6.81 - 6.74 (m, 2H), 4.06 (s, 3H), 3.71 - 3.66 (m, 4H), 2.66 - 2.62 (m, 4H) Example 110: N-[4-(4,4-difluoropiperidin-1-yl)-2,6-difluorophenyl]-2-[(1- methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-[4-(4,4-difluoropiperidin-1-yl)-2,6- difluorophenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfan yl]-5-nitrobenzamide as a grey solid (24 mg; 0.044 mmol; 65% yield; 94% purity). UPLC-MS method A: (M+H) 512.1.1; Rt: 1.11 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.55 (s, 1H), 8.75 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.10 (d, J = 8.8 Hz, 1H), 6.92 - 6.85 (m, 2H), 4.06 (s, 3H), 3.50 - 3.44 (m, 4H), 2.10 - 1.97 (m, 4H) Example 111: N-[4-(2,5-dimethylpyrrolidin-1-yl)-2,6-difluorophenyl]-2-[(1 -methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-[4-(2,5-dimethylpyrrolidin-1-yl)- 2,6-difluorophenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)su lfanyl]-5-nitrobenzamide as a beige solid (7 mg; 0.015 mmol; 22% yield; 99% purity). UPLC-MS method A: (M+H) 490.1; Rt: 1.18 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.43 (s, 1H), 8.74 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 6.37 - 6.29 (m, 2H), 4.06 (s, 3H), 3.84 - 3.75 (m, 2H), 2.12 - 2.02 (m, 2H), 1.77 - 1.68 (m, 2H), 1.22 (d, J = 6.1 Hz, 6H) Example 112: N-[4-(3,3-difluoropiperidin-1-yl)-2,6-difluorophenyl]-2-[(1- methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure A of amide coupling afforded N-[4-(3,3-difluoropiperidin-1-yl)-2,6- difluorophenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfan yl]-5-nitrobenzamide as a beige solid (9 mg; 0.016 mmol; 30% yield; 91% purity). UPLC-MS method A: (M+H) 512.1; Rt: 1.10 min 1H NMR (400 MHz, DMSO-d ₆ ) δ 10.53 (s, 1H), 8.75 (d, J = 2.6 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 6.90 - 6.83 (m, 2H), 4.06 (s, 3H), 3.66 (t, J = 12.0 Hz, 2H), 3.40 - 3.35 (m, 2H), 2.14 - 2.01 (m, 2H), 1.81 - 1.73 (m, 2H) Example 113: N-{2-cyano-4-[(3R)-3-methylpyrrolidin-1-yl]phenyl}-2-[(4-met hyl-4H-1,2,4- triazol-3-yl)sulfanyl]-5-nitrobenzamide Under argon atmosphere 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzoic acid (0.18 mmol; 50 mg) was dissolved in 1 mL dry DMF. Then 4-methylmorpholine (0.44 mmol; 250 mol%; 48.1 µL), 2-amino-5-[(3R)-3-methylpyrrolidin-1-yl]benzonitrile (0.18 mmol; 100 mol%; 46 mg) and then HATU (0.26 mmol; 150 mol%; 100 mg) were added and the brown solution was stirred 2 h at rt. The solution was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 90% ACN + 0.1% TFA). The corresponding vials were combined and the ACN was removed by vacuo. A yellow precipitate occured, which was filtered off and was dried by vacuo to get N- {2-cyano-4-[(3R)-3-methylpyrrolidin-1-yl]phenyl}-2-[(4-methy l-4H-1,2,4-triazol-3-yl)sulfanyl]-5- nitrobenzamide (15.3 mg; 0.03 mmol; 18.8%; yellow solid). LC-MS method B: 99.7% purity; (M+H) 464.1; Rt: 1.67 min 1H NMR (700 MHz, DMSO-d ₆ ) δ 10.81 (s, 1H), 8.88 (s, 1H), 8.73 (d, J = 2.5 Hz, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 7.39 (d, J = 8.8 Hz, 1H), 6.91 (d, J = 2.8 Hz, 1H), 6.88 (dd, J = 8.9, 2.8 Hz, 1H), 6.87 (d, J = 8.8 Hz, 1H), 3.59 (s, 3H), 3.47 (dd, J = 9.4, 7.1 Hz, 1H), 3.39 - 3.36 (m, 1H), 3.31 - 3.27 (m, 1H), 2.86 (dd, J = 9.4, 7.5 Hz, 1H), 2.43 - 2.35 (m, 1H), 2.16 - 2.10 (m, 1H), 1.65 - 1.58 (m, 1H), 1.10 (d, J = 6.7 Hz, 3H) Example 114: N-{2-cyano-4-[(3S)-3-methylpyrrolidin-1-yl]phenyl}-2-[(4-met hyl-4H-1,2,4- triazol-3-yl)sulfanyl]-5-nitrobenzamide Under argon atmosphere, 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzoic acid (0.18 mmol; 50 mg) was dissolved in 1 mL anhydrous DMF. Then 4-methylmorpholine (0.44 mmol; 250 mol%; 48.1 µL), 2-amino-5-[(3S)-3-methylpyrrolidin-1-yl]benzonitrile (0.18 mmol; 100 mol%; 42 mg) and then HATU (0.26 mmol; 150 mol%; 100 mg) were added and the brown solution was stirred 2 h at rt. The solution was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 90% ACN + 0.1% TFA). The product-containing vials were combined and the ACN was removed by vacuo. A yellow precipitate occured, which was filtered off and was dried by vacuo to afford N-{2-cyano-4-[(3S)-3-methylpyrrolidin-1-yl]phenyl}-2-[(4-met hyl-4H-1,2,4- triazol-3-yl)sulfanyl]-5-nitrobenzamide (19.1 mg; 0.04 mmol; 23.5%; yellow solid) LC-MS method B: 98% purity; (M+H) 464.1; Rt: 1.671 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.82 (s, 1H), 8.88 (s, 1H), 8.73 (d, J = 2.5 Hz, 1H), 8.25 (dd, J = 9.0, 2.5 Hz, 1H), 7.39 (d, J = 8.9 Hz, 1H), 6.91 (d, J = 2.8 Hz, 1H), 6.88 (dd, J = 8.8, 2.9 Hz, 1H), 6.87 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H), 3.47 (dd, J = 9.4, 7.1 Hz, 1H), 3.40 - 3.35 (m, 1H), 3.31 - 3.26 (m, 1H), 2.86 (dd, J = 9.4, 7.5 Hz, 1H), 2.43 - 2.35 (m, 1H), 2.16 - 2.10 (m, 1H), 1.65 - 1.59 (m, 1H), 1.10 (d, J = 6.7 Hz, 3H) Example 115: N-[3-fluoro-5-(propan-2-yl)pyridin-2-yl]-2-[(1-methyl-1H-1,2 ,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide In a sealed-cap-vial under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzoic acid (0.13 mmol; 50 mg) and 3-fluoro-5-(propan-2-yl)pyridin-2-amine (0.13 mmol; 100 mol%; 22.5 mg) were dissolved in 1 mL dry pyridine. The mixture was cooled in an ice bath. Then a solution of phosphoryl chloride (0.14 mmol; 110 mol%; 22 mg; 13 µL) in 0.5 mL dried DCM was added dropwise. The reaction mixture was stirred at rt overnight. The reaction mixture was quenched with some water and evaporated to dryness. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 90% ACN + 0.1% TFA) to afford N-[3-fluoro-5-(propan-2-yl)pyridin-2-yl]-2-[(1-methyl-1H-1,2 ,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide (27.1 mg; 0.06 mmol; 49.1%; beige solid). LC-MS method B: 97% purity; (M+H) 418.0; Rt: 1.631 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.40 (s, 1H), 8.79 (d, J = 2.5 Hz, 1H), 8.28 - 8.27 (m, 1H), 8.27 (dd, J = 8.8, 2.6 Hz, 1H), 7.83 (dd, J = 11.1, 1.9 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 3.10 - 3.01 (m, 1H), 1.27 (d, J = 7.0 Hz, 6H) Example 116: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-[(4-methyl-4H-1,2,4 -triazol-3- yl)sulfanyl]-5-nitrobenzamide In a sealed-cap-vial under argon atmosphere 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5- nitrobenzoic acid (0.17 mmol; 50 mg) and 5-cyclopentyl-3-fluoropyridin-2-amine (0.17 mmol; 100 mol%; 32.7 mg) were dissolved in 1.5 mL dried pyridine and 150 µL dried DMSO. The mixture was cooled in an ice bath. Then a solution of phosphoryl chloride (0.19 mmol; 110 mol%; 17 µL) in 0.5 mL dried dichloromethane was added dropwise. The reaction mixture was stirred at rt overnight. Water was then added to the suspension and the resulting mixture was evaporated to residue. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 85% ACN + 0.1% TFA) to get N-(5-cyclopentyl-3- fluoropyridin-2-yl)-2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfa nyl]-5-nitrobenzamide (12.5 mg; 0.03 mmol; 15.3%; yellow solid). LC-MS method B: 92% purity; (M+H) 443.0; Rt: 1.569 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.89 (s, 1H), 8.74 (d, J = 2.5 Hz, 1H), 8.27 - 8.25 (m, 1H), 8.27 - 8.23 (m, 1H), 7.80 (dd, J = 11.1, 1.9 Hz, 1H), 6.83 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H), 3.14 - 3.06 (m, 1H), 2.12 - 2.05 (m, 2H), 1.86 - 1.76 (m, 2H), 1.72 - 1.63 (m, 2H), 1.64 - 1.56 (m, 2H) Example 117: N-(5-cyclohexyl-3-fluoropyridin-2-yl)-2-[(1-methyl-1H-1,2,3, 4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide In a sealed-cap-vial under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzoic acid (0.08 mmol; 25 mg) and 5-cyclohexyl-3-fluoropyridin-2-amine (0.08 mmol; 100 mol%; 17 mg) were dissolved in 0.25 mL dried pyridine. The mixture was cooled in an ice bath. Then a solution of phosphoryl chloride (0.09 mmol; 110 mol%; 9 µL) in 0.5 mL dried DCM was added dropwise. The reaction mixture was stirred at rt overnight. The reaction mixture was evaporated to residue. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% TFA/15 - 100% ACN + 0.1% TFA to afford N-(5- cyclohexyl-3-fluoropyridin-2-yl)-2-[(1-methyl-1H-1,2,3,4-tet razol-5-yl)sulfanyl]-5- nitrobenzamide (13 mg; 0.03 mmol; 33.4%; brown solid). LC-MS method B: 100% purity; (M+H) 458.0; Rt: 1.819 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.38 (s, 1H), 8.78 (d, J = 2.6 Hz, 1H), 8.27 (dd, J = 9.0, 2.5 Hz, 1H), 8.26 - 8.24 (m, 1H), 7.79 (dd, J = 11.1, 2.0 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 2.70 - 2.65 (m, 1H), 1.87 - 1.79 (m, 4H), 1.75 - 1.70 (m, 1H), 1.52 - 1.45 (m, 2H), 1.42 - 1.35 (m, 2H), 1.30 - 1.23 (m, 1H) Example 118: N-[5-(butan-2-yl)-3-fluoropyridin-2-yl]-2-[(1-methyl-1H-1,2, 3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide In a sealed-cap-vial under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzoic acid (0.17 mmol; 50 mg) and 5-(butan-2-yl)-3-fluoropyridin-2-amine (0.17 mmol; 31 mg) were dissolved in 0.5 mL dried pyridine. The mixture was cooled in an icebath. Then a solution of phosphoryl chloride (0.19 mmol; 110 mol%; 17 µL) in 1 mL dried DCM was added dropwise. The reaction mixture was stirred at rt for 1 h. After adding some water the reaction mixture was evaporated to residue. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 90% ACN + 0.1% TFA) to get N-[5-(butan-2-yl)- 3-fluoropyridin-2-yl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl) sulfanyl]-5-nitrobenzamide (38 mg; 0.09 mmol; 50.7%; yellow solid). LC-MS method B: 98% purity; (M+H) 432.0; Rt: 1.709 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.39 (s, 1H), 8.78 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.6 Hz, 1H), 8.24 - 8.22 (m, 1H), 7.80 (dd, J = 11.0, 1.9 Hz, 1H), 7.10 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 2.80 - 2.74 (m, 1H), 1.67 - 1.58 (m, 2H), 1.26 (d, J = 7.0 Hz, 3H), 0.81 (t, J = 7.4 Hz, 3H) Example 119: N-[3-fluoro-5-(1,1,1-trifluoropropan-2-yl)pyridin-2-yl]-2-[( 1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide In a sealed-cap-vial under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzoic acid (0.17 mmol; 50 mg) and 3-fluoro-5-(1,1,1-trifluoropropan-2-yl)pyridin-2- amine (0.17 mmol; 41 mg) were dissolved in 1 mL dried pyridine. The mixture was cooled in an icebath. Then a solution of phosphoryl chloride (0.19 mmol; 110 mol%; 17 µL) in 2.5 mL dried DCM was added dropwise. The reaction mixture was stirred at rt for 1 h. Then a solution of 3-fluoro-5-(1,1,1-trifluoropropan-2-yl)pyridin-2-amine (0.17 mmol; 41 mg) in 0.5 mL dried DCM was added and the mixture was stirred for additional 2 h. After adding some water the reaction mixture was evaporated to residue. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 90% ACN + 0.1% TFA) to afford N- [3-fluoro-5-(1,1,1-trifluoropropan-2-yl)pyridin-2-yl]-2-[(1- methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide (34 mg; 0.07 mmol; 39.7%; yellow solid). LC-MS method B: 93% purity; (M+H) 472.0; Rt: 1.656 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.56 (s, 1H), 8.80 (d, J = 2.5 Hz, 1H), 8.42 (d, J = 1.9 Hz, 1H), 8.28 (dd, J = 8.9, 2.5 Hz, 1H), 8.03 (dd, J = 10.8, 1.9 Hz, 1H), 7.11 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 4.10 - 4.02 (m, 1H), 1.53 (d, J = 7.2 Hz, 3H) Example 120: N-[4-(1,1,1,2,3,3,3-heptafluoropropan-2-yl)phenyl]-2-[(1-met hyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.14 mmol; 40 mg; 1.0 eq.) was dissolved in 0.8 mL DMF. 4-methylmorpholine (0.35 mmol; 39 µL; 2.5 eq.), 4- (1,1,1,2,3,3,3-heptafluoropropan-2-yl)aniline (0.14 mmol; 37.7 mg; 1.0 eq.) and HATU (0.21 mmol; 80.3 mg; 1.5 eq.) were added under argon atmosphere and the yellow reaction solution was stirred for 3 h at rt. The reaction solution was poured into water and stirred for 5 min. The formed precipitate was collected by vacuum filtration, washed with water and dried under vacuum to get N-[4-(1,1,1,2,3,3,3-heptafluoropropan-2-yl)phenyl]-2-[(1-met hyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (45 mg; 0.08 mmol; 59%; yellow solid) LC-MS method B: 95% purity; (M+H) 524.9; Rt: 1.937 min Example 121: N-[4-(1,1,1,2,3,3,3-heptafluoropropan-2-yl)phenyl]-2-[(4-met hyl-4H-1,2,4- triazol-3-yl)sulfanyl]-5-nitrobenzamide 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzoic acid (0.14 mmol; 40 mg; 1.0 eq.) was dissolved in 0.8 mL dried DMF. 4-methylmorpholine (0.34 mmol; 38 µL; 2.5 eq.), 4- (1,1,1,2,3,3,3-heptafluoropropan-2-yl)aniline (0.14 mmol; 36.5 mg; 1.0 eq.) and HATU (0.20 mmol; 77.8 mg; 1.5 eq.) were added under argon atmosphere and the yellow reaction solution was stirred over the weekend at rt. The reaction solution was poured into water, extracted twice with DCM, the organic phase was washed twice with water and brine, dried over Na ₂ SO ₄ , filtrated and evaporated. The residue was purified by chromatography (sunfire prep C18 OBD 5 µm, 30x150 mm; gradient: water 0.1% TFA, 5 - 100% acetonitrile TFA 0.1%, 220 nm) to afford N-[4-(1,1,1,2,3,3,3-heptafluoropropan-2-yl)phenyl]-2-[(4-met hyl-4H-1,2,4-triazol-3- yl)sulfanyl]-5-nitrobenzamide (14.5 mg; 0.03 mmol; 20%; white solid) LC-MS method B: 95% purity; (M+H) 524.0; Rt: 1.801 min Example 122: 5-nitro-N-[4-(propan-2-yl)phenyl]-2-(pyrimidin-4-ylsulfanyl) benzamide Step 1: 2-iodo-5-nitro-N-[4-(propan-2-yl)phenyl]benzamide 2-iodo-5-nitrobenzoic acid (0.67 mmol; 200 mg; 1.0 eq.) was dissolved in 6 mL dried DMF.4- methylmorpholine (1.67 mmol; 184 µl; 2.5 eq.), 4-isopropylaniline (0.67 mmol; 92.4 µL; 1.0 eq) and HATU (1.0 mmol; 381.5 mg; 1.5 eq.) were added under argon atmosphere and the orange reaction solution was stirred overnight at RT. The reaction was poured into water, the beige precipitate was sucked off and washed with water. The beige solid was triturated and sonicated with acetonitrile. The white precipitate was filtered and dried under vacuum to get 2-iodo-5- nitro-N-[4-(propan-2-yl)phenyl]benzamide (170.2 mg; 0.41 mmol; 62%; off white solid). LC-MS method B: 99% purity; (M+H) 410.9; Rt: 1.873 min Step 2: 5-nitro-N-[4-(propan-2-yl)phenyl]-2-(pyrimidin-4-ylsulfanyl) benzamide 2-iodo-5-nitro-N-[4-(propan-2-yl)phenyl]benzamide (0.24 mmol; 100 mg; 1.0 eq.) and pyrimidine-4(3H)-thione (0.32 mmol; 37 mg; 1.3 eq.) were dissolved in 3 mL dried 1,4-dioxane and DIPEA (0.73 mmol; 124 µL; 3.0 eq.) was added. Under argon atmosphere tris(dibenzylideneacetone)dipalladium(0) (0.01 mmol; 11.5 mg; 0.05 eq.) and xantphos (0.02 mmol; 14.5 mg; 0.1 eq.) were added. The vial was closed with a septum and stirred overnight at 100 °C. The reaction mixture was diluted with saturated NaHCO ₃ acqueous solution and extracted twice with AcOEt. The combined organic layers were washed with brine, dried over Na ₂ SO ₄ , filtered and evaporated. The residue was purified twice by chromatography (Chromolith preparative RP18 100x25mm; gradient: water - 0.1% HCOOH/5 - 100% acetonitrile - 0.1% HCOOH, 214 nm) and (Sunfire prep C18 OBD 5 µm, 30x150 mm; gradient: water 0.1% TFA/5 - 100% acetonitrile TFA 0.1%, 220 nm) to get 5-nitro-N-[4-(propan-2- yl)phenyl]-2-(pyrimidin-4-ylsulfanyl)benzamide (4 mg; 0.01 mmol; 4%; beige solid) LC-MS method B: 94% purity; (M+H) 395.0; Rt: 1.762 min Example 123: N-(4-cyclopentyl-2,6-difluorophenyl)-2-[(1-methyl-1H-1,2,3,4 -tetrazol-5- yl)sulfanyl]-4-(methylsulfanyl)-5-nitrobenzamide To 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-4-(methylsul fanyl)-5-nitrobenzoic acid (0.06 mmol; 20 mg) was added phosphoryl chloride (0.09 mmol; 150 mol%; 8 µL) (dissolved in 0.4 mL dried pyridine). The mixture was stirred at rt for 30 min. Then 4-cyclopentyl-2,6- difluoroaniline (0.06 mmol; 100 mol%; 13 mg) was dissolved in 1 mL dried dichloromethane and the resulting solution was added to the reaction mixture which was stirred at rt for 1 h. Some water was added, and the resulting mixture was evaporated to dryness. The residue was dissolved in ACN/MeOH, absorbed onto diatomaceous earth (Isolute HM-N) and purified by flash chromatography (silica gel; n-heptane/0 - 50% EA) to get 21 mg of 76% purity. The residue was then dissolved in DMSO and purified by preparative HPLC (C18; water + 0.1% TFA/15 - 100% ACN + 0.1% TFA). The product-containing vials were combined and the ACN was removed in vacuo. The resulting precipitate was filtered off and dried to get N-(4- cyclopentyl-2,6-difluorophenyl)-2-[(1-methyl-1H-1,2,3,4-tetr azol-5-yl)sulfanyl]-4- (methylsulfanyl)-5-nitrobenzamide (8.50 mg; 0.02 mmol; 28.5%; yellow solid). LC-MS method B: 100% purity; (M+H) 507.0; Rt: 1.963 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.73 (s, 1H), 8.89 (s, 1H), 7.18 - 7.12 (m, 2H), 6.85 (s, 1H), 4.09 (s, 3H), 3.10 - 3.00 (m, 1H), 2.23 (s, 3H), 2.09 - 2.00 (m, 2H), 1.84 - 1.73 (m, 2H), 1.71 - 1.60 (m, 2H), 1.62 - 1.50 (m, 2H) Example 124: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-[(1-methyl-1H-1,2,3 ,4-tetrazol-5- yl)sulfanyl]-4-(methylsulfanyl)-5-nitrobenzamide To 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-4-(methylsul fanyl)-5-nitrobenzoic acid (0.09 mmol; 30 mg) phosphoryl chloride (0.13 mmol; 150 mol%; 12 µL) (dissolved in 0.6 mL dried pyridine) was added. The mixture was stirred at rt for 30 min. Then 5-cyclopentyl-3- fluoropyridin-2-amine (0.09 mmol; 100 mol%; 17 mg) was dissolved in 1 mL dried DCM and the resulting solution was added to the reaction mixture which was stirred at rt for 1 h. Some water was added, and the experiment was evaporated to residue. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% TFA/10 - 100% ACN + 0.1% TFA). The product-containing vials were combined and the ACN was removed by vacuo. The ocurring precipitate was filtered off and was dried to get N-(5-cyclopentyl-3-fluoropyridin- 2-yl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-4-(met hylsulfanyl)-5-nitrobenzamide (18.9 mg; 0.04 mmol; 44%; yellow solid). LC-MS method B: 100% purity; (M+H) 490.0; Rt: 1.831 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.89 (s, 1H), 8.27 - 8.24 (m, 1H), 7.78 (dd, J = 11.1, 2.0 Hz, 1H), 6.84 (s, 1H), 4.09 (s, 3H), 3.16 - 3.05 (m, 1H), 2.23 (s, 3H), 2.13 - 2.03 (m, 2H), 1.87 - 1.74 (m, 2H), 1.73 - 1.54 (m, 4H) Example 125: N-[3-fluoro-5-(2-methylpropyl)pyridin-2-yl]-2-[(1-methyl-1H- 1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Under argon atmosphere a solution of phosphoryl chloride (0.19 mmol; 110 mol%; 29 mg; 17 µL) in 1 mL dried pyridine was added to 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzoic acid (0.17 mmol; 50 mg). The mixture was stirred at rt for 30 min. Then a solution of 3-fluoro-5-(2-methylpropyl)pyridin-2-amine (0.17 mmol; 100 mol%; 31 mg) in 2.5 mL dried DCM was added. The mixture was stirred at rt for 1 h. After adding some water, the reaction mixture was evaporated to dryness. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 95% ACN + 0.1% TFA) to get N-[3-fluoro-5-(2- methylpropyl)pyridin-2-yl]-2-[(1-methyl-1H-1,2,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide (46 mg; 60%; light brown solid). LC-MS method B: 95.3% purity; (M+H) 432.0; Rt: 1.712 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.39 (s, 1H), 8.79 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 8.19 - 8.17 (m, 1H), 7.76 (dd, J = 10.7, 1.9 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 2.56 (d, J = 7.1 Hz, 2H), 1.95 - 1.89 (m, 1H), 0.90 (d, J = 6.6 Hz, 6H) Example 126: N-(4-cyclopentyl-2,5-difluorophenyl)-2-[(1-methyl-1H-1,2,3,4 -tetrazol-5- yl)sulfanyl]-5-nitrobenzamide 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.16 mmol; 46 mg) was dissolved in 2 mL DMF. Then 4-methylmorpholine (0.48 mmol; 300 mol%; 53 µL), HATU (0.24 mmol; 150 mol%; 92 mg) and then 4-cyclopentyl-2,5-difluoroaniline (0.16 mmol; 100 mol%; 35 mg) were added. The yellow solution was stirred at rt overnight. The yellow solution was purified by preparative HPLC (C18; water + 0.1% TFA/20 - 100% ACN + 0.1% TFA) to get N- (4-cyclopentyl-2,5-difluorophenyl)-2-[(1-methyl-1H-1,2,3,4-t etrazol-5-yl)sulfanyl]-5- nitrobenzamide (26 mg; 0.06 mmol; 35%; white solid). LC-MS method B: 99.5% purity; (M+H) 461.0; Rt: 1.970 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.88 (s, 1H), 8.73 (d, J = 2.6 Hz, 1H), 8.27 (dd, J = 8.9, 2.6 Hz, 1H), 7.62 (dd, J = 11.2, 6.5 Hz, 1H), 7.33 (dd, J = 11.4, 6.8 Hz, 1H), 7.18 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H), 3.25 - 3.14 (m, 1H), 2.06 - 1.97 (m, 2H), 1.84 - 1.73 (m, 2H), 1.72 - 1.54 (m, 4H) Example 127: N-(4-cyclopentyl-2,5-difluorophenyl)-2-[(4-methyl-4H-1,2,4-t riazol-3- yl)sulfanyl]-5-nitrobenzamide 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzoic acid (0.16 mmol; 46 mg) was dissolved in 2 mm DMF. Then 4-methylmorpholine (0.48 mmol; 300 mol%; 53 µL), HATU (0.24 mmol; 150 mol%; 92 mg) and then 4-cyclopentyl-2,5-difluoroaniline (0.16 mmol; 100 mol%; 35 mg) were added. The yellow solution was stirred at rt overnight. The residue was purified by preparative HPLC (C18; water + 0.1% TFA/10 - 100% ACN + 0.1% TFA) to get N-(4- cyclopentyl-2,5-difluorophenyl)-2-[(4-methyl-4H-1,2,4-triazo l-3-yl)sulfanyl]-5-nitrobenzamide (30.5 mg; 0.06 mmol; 39%; white solid). LC-MS method B: 95.1% purity; (M+H) 460.0; Rt: 1.829 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.81 (s, 1H), 8.87 (s, 1H), 8.68 (d, J = 2.6 Hz, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 7.63 (dd, J = 11.2, 6.4 Hz, 1H), 7.33 (dd, J = 11.4, 6.8 Hz, 1H), 6.90 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H), 3.25 - 3.14 (m, 1H), 2.07 - 1.96 (m, 2H), 1.85 - 1.73 (m, 2H), 1.72 - 1.53 (m, 4H) Example 128: N-{3-fluoro-5-[(3R)-3-methylpyrrolidin-1-yl]pyridin-2-yl}-2- [(1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure D of amide coupling afforded N-{3-fluoro-5-[(3R)-3- methylpyrrolidin-1-yl]pyridin-2-yl}-2-[(1-methyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5- nitrobenzamide (16.8mg; 0.04 mmol; 19% yield; 98.4% purity) as an orange solid UPLC-MS method A: (M+H) 445.1; Rt: 1.02 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 8.81 - 8.73 (m, 1H), 8.25 (dd, J = 8.9, 2.6 Hz, 1H), 7.67 - 7.62 (m, 1H), 7.06 (d, J = 8.8 Hz, 1H), 6.94 (dd, J = 12.5, 2.5 Hz, 1H), 4.05 (s, 3H), 3.52 - 3.46 (m, 1H), 3.43 - 3.36 (m, 1H), 3.34 - 3.26 (m, 1H), 2.91 - 2.84 (m, 1H), 2.44 - 2.34 (m, 1H), 2.18 - 2.08 (m, 1H), 1.67 - 1.56 (m, 1H), 1.10 (d, J = 6.6 Hz, 3H) Example 129: N-(5-cyclohexyl-3-fluoropyridin-2-yl)-2-[(4-methyl-4H-1,2,4- triazol-3- yl)sulfanyl]-5-nitrobenzamide Using the general procedure of Buchwald reaction afforded N-(5-cyclohexyl-3-fluoropyridin-2- yl)-2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenz amide (8.2 mg; 0.02 mmol; 19% yield; 98.9% purity) as a beige solid UPLC-MS method A: (M+H) 455.2; Rt: 1.05 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.27 (s, 1H), 8.88 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.27 - 8.22 (m, 2H), 7.78 (dd, J = 11.2, 1.9 Hz, 1H), 6.84 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H), 2.72 - 2.62 (m, 1H), 1.89 - 1.77 (m, 4H), 1.76 - 1.68 (m, 1H), 1.55 - 1.43 (m, 2H), 1.45 - 1.33 (m, 2H), 1.32 - 1.20 (m, 1H) Example 130: N-(2-cyano-4-5-cyclopentyl-6-fluorophenyl3-fluoropyridin-2-y l)-2-[(-{[4- methyl-5-(oxetan-3-yl)-4H-1,2,4-triazol-3-yl)]sulfanyl]-}-5- nitrobenzamide Using the general procedure of Buchwald coupling afforded N-(2-cyano-4-cyclopentyl-6- fluorophenyl)-2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5 -nitrobenzamide as a beige solid (14.0 mg; 0.03 mmol; 59% yield; beige solid) LC-MS method B: 98.9% purity; (M+H) 466.9; Rt: 1.73 min 1H NMR (700 MHz, DMSO-d ₆ ) δ 11.28 - 11.20 (m, 1H), 8.89 (s, 1H), 8.75 (d, J = 2.6 Hz, 1H), 8.29 (dd, J = 8.9, 2.5 Hz, 1H), 7.76 - 7.74 (m, 1H), 7.73 - 7.70 (m, 1H), 6.89 (d, J = 8.9 Hz, 1H), 3.60 (s, 3H), 3.14 - 3.06 (m, 1H), 2.10 - 2.04 (m, 2H), 1.84 - 1.77 (m, 2H), 1.70 - 1.63 (m, 2H), 1.63 - 1.56 (m, 2H) Example 131: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[4-methyl-5-(oxeta n-3-yl)-4H- 1,2,4-triazol-3-yl]sulfanyl}-5-nitrobenzamide N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-iodo-5-nitrobenzami de (0.07 mmol; 50 mg), 4-methyl- 5-(oxetan-3-yl)-4H-1,2,4-triazole-3-thiol (0.18 mmol; 250 mol%; 31 mg) were dissolved in 2 mL anhydrous 1,4-dioxane. Then TEA (0.21 mmol; 300 mol%; 30 µlL), 4,5- bis(diphenylphosphino)-9,9-dimethylxanthene (0.01 mmol; 10 mol%; 4 mg) and tris(dibenzylideneacetone)dipalladium (5 mol%; 3 mg) were added, closed with a septum and heated in a microwave reactor (80 °C; 15 min). The solution was evaporated to residue and was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 85% ACN + 0.1% TFA) to get N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[4-methyl-5-(oxeta n-3-yl)-4H-1,2,4-triazol-3- yl]sulfanyl}-5-nitrobenzamide (26 mg; 0.05 mmol; 67%; yellow solid). LC-MS method B: 90% purity; (M+H) 498.9; Rt: 1.60 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.30 (s, 1H), 8.74 (d, J = 2.6 Hz, 1H), 8.27 - 8.24 (m, 1H), 8.22 (dd, J = 8.9, 2.5 Hz, 1H), 7.80 (dd, J = 11.0, 1.9 Hz, 1H), 6.90 (d, J = 8.9 Hz, 1H), 4.97 - 4.91 (m, 4H), 4.58 - 4.53 (m, 1H), 3.39 (s, 3H), 3.13 - 3.07 (m, 1H), 2.11 - 2.05 (m, 2H), 1.85 - 1.77 (m, 2H), 1.71 - 1.64 (m, 2H), 1.64 - 1.56 (m, 2H) Example 132: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[4-(2-methoxyethyl )-4H-1,2,4- triazol-3-yl]sulfanyl}-5-nitrobenzamide N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-iodo-5-nitrobenzami de (0.33 mmol; 100 mol%; 150 mg) and 4-(2-methoxyethyl)-4H-1,2,4-triazole-3-thiol (0.49 mmol; 150 mol%; 83 mg) were dissolved in 5 mL anhydrous 1,4-dioxane. TEA (0.99 mmol; 300 mol%; 137 µL) was added. The vial was flushed with argon (approx. 2 min) and then 4,5-bis(diphenylphosphino)-9,9- dimethylxanthene (0.03 mmol; 10 mol%; 19 mg) and tris((1E,4E)-1,5-diphenylpenta-1,4-dien- 3-one)dipalladium (0.02 mmol; 5 mol%; 15 mg) were added. The vial was closed with a septum and heated in a microwave reactor (100 °C; 30 min). The brown solution was evaporated to residue and was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 90% ACN + 0.1% TFA to get N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[4-(2-methoxyethyl )-4H-1,2,4-triazol-3- yl]sulfanyl}-5-nitrobenzamide (71.3 mg; 0.15 mmol; 44%; yellow solid). LC-MS method B: 99.5% purity; (M+H) 486.9; Rt: 1.65 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.90 (s, 1H), 8.72 (d, J = 2.6 Hz, 1H), 8.27 (dd, J = 9.0, 2.6 Hz, 1H), 8.27 - 8.25 (m, 1H), 7.80 (dd, J = 11.2, 1.9 Hz, 1H), 6.85 (d, J = 8.9 Hz, 1H), 4.17 (t, J = 5.1 Hz, 2H), 3.54 (t, J = 5.1 Hz, 2H), 3.13 (s, 3H), 3.13 - 3.07 (m, 1H), 2.11 - 2.05 (m, 2H), 1.85 - 1.78 (m, 2H), 1.72 - 1.64 (m, 2H), 1.64 - 1.57 (m, 2H) Example 133: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[4-(3-methoxypropy l)-4H-1,2,4- triazol-3-yl]sulfanyl}-5-nitrobenzamide The same method as in example 132 was used to afford N-(5-cyclopentyl-3-fluoropyridin-2-yl)- 2-{[4-(3-methoxypropyl)-4H-1,2,4-triazol-3-yl]sulfanyl}-5-ni trobenzamide (16 mg; 0.03 mmol; 57%; yellow solid). LC-MS method B: 99.5% purity; (M+H) 500.9; Rt: 1.68 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.29 (s, 1H), 8.94 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.27 - 8.25 (m, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 7.79 (dd, J = 11.1, 1.9 Hz, 1H), 6.89 (d, J = 8.9 Hz, 1H), 4.02 (t, J = 7.2 Hz, 2H), 3.23 (t, J = 5.9 Hz, 2H), 3.12 (s, 3H), 3.16 - 3.05 (m, 1H), 2.14 - 2.04 (m, 2H), 1.93 - 1.84 (m, 2H), 1.85 - 1.74 (m, 2H), 1.74 - 1.54 (m, 4H) Example 134: N-(5-{3-azabicyclo[3.1.0]hexan-3-yl}-3-fluoropyridin-2-yl)-2 -[(1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure D of amide coupling afforded N-(5-{3-azabicyclo[3.1.0]hexan-3- yl}-3-fluoropyridin-2-yl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5 -yl)sulfanyl]-5-nitrobenzamide as ochre solid (35 mg; 0.076 mmol; 35% yield; 99% purity) LC-MS method A: (M+H) 457.0; Rt: 0.88 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 8.75 (s, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 7.70 - 7.64 (m, 1H), 7.07 (d, J = 8.9 Hz, 1H), 6.99 (dd, J = 12.5, 2.5 Hz, 1H), 4.05 (s, 3H), 3.55 (d, J = 9.5 Hz, 2H), 3.34 - 3.25 (m, 2H), 1.77 - 1.70 (m, 2H), 0.80 - 0.73 (m, 1H), 0.28 - 0.22 (m, 1H) Example 135: N-(5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-yl)-2-[(1- methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure D of amide coupling afforded N-(5-{bicyclo[3.1.0]hexan-1-yl}-3- fluoropyridin-2-yl)-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)su lfanyl]-5-nitrobenzamide as ochre solid (17 mg; 0.037 mmol; 22% yield; 100% purity) LC-MS method A: (M+H) 456.1; Rt: 0.923 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 8.75 (s, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 7.70 - 7.64 (m, 1H), 7.07 (d, J = 8.9 Hz, 1H), 6.99 (dd, J = 12.5, 2.5 Hz, 1H), 4.05 (s, 3H), 3.55 (d, J = 9.5 Hz, 2H), 3.34 - 3.25 (m, 2H), 1.77 - 1.70 (m, 2H), 0.80 - 0.73 (m, 1H), 0.28 - 0.22 (m, 1H) Example 136: N-(4-cyclopentyl-2,6-difluorophenyl)-2-{[4-(2-methoxyethyl)- 4H-1,2,4- triazol-3-yl]sulfanyl}-5-nitrobenzamide Using the general procedure of Buchwald reaction afforded N-(4-cyclopentyl-2,6- difluorophenyl)-2-{[4-(2-methoxyethyl)-4H-1,2,4-triazol-3-yl ]sulfanyl}-5-nitrobenzamide (59 mg; 0.12 mmol; 94% yield, 100% purity) as a pale yellow solid UPLC-MS method A: (M+H) 504.1; Rt: 1.11 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.74 (s, 1H), 8.90 (s, 1H), 8.73 - 8.70 (m, 1H), 8.30 - 8.26 (m, 1H), 7.19 - 7.14 (m, 2H), 6.87 (d, J = 8.9 Hz, 1H), 4.17 (t, J = 5.1 Hz, 2H), 3.54 (t, J = 5.1 Hz, 2H), 3.13 (s, 3H), 3.08 - 3.01 (m, 1H), 2.07 - 2.02 (m, 2H), 1.82 - 1.76 (m, 2H), 1.69 - 1.62 (m, 2H), 1.60 - 1.53 (m, 2H) Example 137: N-(4-cyclopentyl-2,6-difluorophenyl)-2-{[4-(3-methoxypropyl) -4H-1,2,4- triazol-3-yl]sulfanyl}-5-nitrobenzamide Using the general procedure of Buchwald reaction afforded N-(4-cyclopentyl-2,6- difluorophenyl)-2-{[4-(3-methoxypropyl)-4H-1,2,4-triazol-3-y l]sulfanyl}-5-nitrobenzamide (34 mg; 0.07 mmol; 73% yield; 99% purity) as a pale yellow solid UPLC-MS method A: (M+H) 518.9; Rt: 1.14 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.72 (s, 1H), 8.94 (s, 1H), 8.71 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 7.19 - 7.13 (m, 2H), 6.90 (d, J = 8.9 Hz, 1H), 4.02 (t, J = 7.2 Hz, 2H), 3.23 (t, J = 5.9 Hz, 2H), 3.12 (s, 3H), 3.10 - 3.00 (m, 1H), 2.10 - 2.00 (m, 2H), 1.93 - 1.84 (m, 2H), 1.83 - 1.74 (m, 2H), 1.71 - 1.61 (m, 2H), 1.62 - 1.51 (m, 2H) Example 138: N-[3-fluoro-5-(2-methylpropyl)pyridin-2-yl]-2-[(1-methyl-1H- 1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Under argon atmosphere 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (40 mg; 0.134 mmol; 1.00 eq.) was dissolved in 0.8 mL dried pyridine, then phosphoryl chloride (13.5 µL; 0.147 mmol; 1.10 eq.) was added and the yellow solution was stirred for 60 min at rt. Then a solution of 5-(2-cyclopropylethyl)-3-fluoropyridin-2-amine hydrochloride (36.2 mg; 0.134 mmol; 1.00 eq.) in 0.3 mL dried DCM was added. The mixture was stirred at rt overnight. After adding some water the reaction mixture was evaporated to residue. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% HCOOH/10 - 95% ACN + 0.1% HCOOH) to get N-[3-fluoro-5-(2-methylpropyl)pyridin-2-yl]-2-[(1-methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide (6.6 mg; 11%; light yellow solid). LC-MS method B: 96.4% purity; (M+H) 443.9; Rt: 1.77 min Example 139: 2-[(4-tert-butyl-4H-1,2,4-triazol-3-yl)sulfanyl]-N-(5-cyclop entyl-3- fluoropyridin-2-yl)-5-nitrobenzamide The same method as in example 132 was used to get 2-[(4-tert-butyl-4H-1,2,4-triazol-3- yl)sulfanyl]-N-(5-cyclopentyl-3-fluoropyridin-2-yl)-5-nitrob enzamide (13 mg; 0.03 mmol; 45%; yellow solid). LC-MS method B: 94% purity; (M+H) 485.0; Rt: 1.76 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.29 (s, 1H), 8.91 (s, 1H), 8.70 (d, J = 2.5 Hz, 1H), 8.26 - 8.25 (m, 1H), 8.25 (dd, J = 8.9, 2.6 Hz, 1H), 7.79 (dd, J = 11.1, 1.9 Hz, 1H), 6.90 (d, J = 8.9 Hz, 1H), 3.16 - 3.05 (m, 1H), 2.13 - 2.04 (m, 2H), 1.86 - 1.74 (m, 2H), 1.73 - 1.54 (m, 4H), 1.60 (s, 9H) Example 140: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-[(4-ethyl-4H-1,2,4- triazol-3- yl)sulfanyl]-5-nitrobenzamide The same method as in example 132 afforded N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-[(4- ethyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzamide (9 mg; 40%; yellow solid). LC-MS method B: 100% purity; (M+H) 456.9; Rt: 1.67 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.34 - 11.23 (m, 1H), 8.98 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 8.26 - 8.25 (m, 1H), 7.79 (dd, J = 11.2, 1.9 Hz, 1H), 6.86 (d, J = 8.9 Hz, 1H), 3.99 (q, J = 7.3 Hz, 2H), 3.16 - 3.05 (m, 1H), 2.14 - 2.03 (m, 2H), 1.86 - 1.74 (m, 2H), 1.73 - 1.54 (m, 4H), 1.27 (t, J = 7.3 Hz, 3H) Example 141: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[4-(2-fluoroethyl) -4H-1,2,4- triazol-3-yl]sulfanyl}-5-nitrobenzamide The same method as in example 132 was used to afford N-(5-cyclopentyl-3-fluoropyridin-2-yl)- 2-{[4-(2-fluoroethyl)-4H-1,2,4-triazol-3-yl]sulfanyl}-5-nitr obenzamide (26 mg; 0.05 mmol; 78%; yellow solid). LC-MS Method B: 99% purity; (M+H) 474.9; Rt: 1.66 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.97 (s, 1H), 8.74 (d, J = 2.5 Hz, 1H), 8.27 - 8.26 (m, 1H), 8.28 - 8.25 (m, 1H), 7.80 (dd, J = 11.1, 2.0 Hz, 1H), 6.86 (d, J = 9.0 Hz, 1H), 4.67 (dt, J = 47.1, 4.7 Hz, 2H), 4.36 (dt, J = 27.3, 4.7 Hz, 2H), 3.13 - 3.07 (m, 1H), 2.11 - 2.06 (m, 2H), 1.85 - 1.78 (m, 2H), 1.71 - 1.64 (m, 2H), 1.63 - 1.57 (m, 2H) Example 142: N-(5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-yl)-2-[(4- methyl-4H-1,2,4- triazol-3-yl)sulfanyl]-5-nitrobenzamide Using the general procedure of Buchwald reaction afforded N-(5-{bicyclo[3.1.0]hexan-1-yl}-3- fluoropyridin-2-yl)-2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfa nyl]-5-nitrobenzamide (22 mg; 0.048 mmol; 36% yield; 100% purity) as white solid. LC-MS method B: (M+H) 455,0; Rt: 1.57 min 1H NMR (700 MHz, DMSO-d ₆ ) δ 11.29 (s, 1H), 8.89 (s, 1H), 8.74 (d, J = 2.5 Hz, 1H), 8.25 (dd, J = 9.0, 2.5 Hz, 1H), 8.21 - 8.19 (m, 1H), 7.64 (dd, J = 11.2, 2.1 Hz, 1H), 6.83 (d, J = 8.9 Hz, 1H), 3.59 (s, 3H), 2.14 - 2.10 (m, 1H), 2.05 - 1.99 (m, 1H), 1.90 - 1.84 (m, 1H), 1.86 - 1.82 (m, 1H), 1.81 - 1.77 (m, 1H), 1.73 - 1.68 (m, 1H), 1.39 - 1.31 (m, 1H), 1.02 (t, J = 4.7 Hz, 1H), 0.93 - 0.90 (m, 1H) Example 143: N-(5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-yl)-2-{[1- (2- hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-nitrobenz amide Using the general procedure of Buchwald reaction afforded N-(5-{bicyclo[3.1.0]hexan-1-yl}-3- fluoropyridin-2-yl)-2-{[1-(2-hydroxyethyl)-1H-1,2,3,4-tetraz ol-5-yl]sulfanyl}-5-nitrobenzamide (16 mg; 0.03 mmol; 37% yield; 96% purity) as a pale yellow solid UPLC-MS method A: (M+H) 486.1; Rt: 1.06 min 1H NMR (700 MHz, DMSO-d ₆ ) δ 11.37 (s, 1H), 8.77 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 8.21 - 8.19 (m, 1H), 7.64 (dd, J = 11.2, 2.1 Hz, 1H), 7.15 (d, J = 9.0 Hz, 1H), 5.09 (t, J = 5.5 Hz, 1H), 4.51 (t, J = 5.3 Hz, 2H), 3.78 (q, J = 5.5 Hz, 2H), 2.12 (dd, J = 12.0, 7.8 Hz, 1H), 2.04 - 1.99 (m, 1H), 1.90 - 1.85 (m, 1H), 1.85 - 1.82 (m, 1H), 1.79 (dd, J = 12.1, 7.7 Hz, 1H), 1.73 - 1.68 (m, 1H), 1.39 - 1.31 (m, 1H), 1.02 (t, J = 4.8 Hz, 1H), 0.93 - 0.90 (m, 1H) Example 144: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[1-(2-hydroxyethyl )-1H-1,2,3,4- tetrazol-5-yl]sulfanyl}-5-nitrobenzamide N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-iodo-5-nitrobenzami de (0.10 mmol; 100 mol%; 75 mg), 1-(2-hydroxyethyl)-1H-tetrazole-5(2H)-thione (0.21 mmol; 200 mol%; 32 mg) and TEA (0.31 mmol; 300 mol%; 43 µL) were dissolved in 2 mL anhydrous 1,4-dioxane. The vial was flushed with argon (approx. 2 min) and then 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene (0.01 mmol; 10 mol%; 6 mg) and tris(dibenzylideneacetone)dipalladium(0) (0.01 mmol; 5 mol%; 5 mg) were added. The experiment was evaporated to residue. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; water + 0.1% TFA/5 - 90% ACN + 0.1% TFA) to get N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[1-(2-hydroxyethyl )-1H-1,2,3,4-tetrazol-5- yl]sulfanyl}-5-nitrobenzamide (33 mg; 0.07 mmol; 67%; yellow solid). LC-MS method B: 100% purity; (M+H) 473.9; Rt: 1.71 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.35 (s, 1H), 8.76 (d, J = 2.5 Hz, 1H), 8.26 (dd, J = 8.9, 2.6 Hz, 1H), 8.27 - 8.25 (m, 1H), 7.79 (dd, J = 11.2, 2.0 Hz, 1H), 7.17 (d, J = 8.9 Hz, 1H), 5.15 - 4.96 (m, 1H), 4.51 (t, J = 5.2 Hz, 2H), 3.78 (t, J = 5.2 Hz, 2H), 3.16 - 3.05 (m, 1H), 2.13 - 2.04 (m, 2H), 1.87 - 1.74 (m, 2H), 1.73 - 1.54 (m, 4H) Example 145: N-(4-cyclopentyl-2,6-difluorophenyl)-2-{[1-(2-hydroxyethyl)- 1H-1,2,3,4- tetrazol-5-yl]sulfanyl}-5-nitrobenzamide The same method as in example 144 was used to get N-(4-cyclopentyl-2,6-difluorophenyl)-2- {[1-(2-hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-ni trobenzamide (29 mg; 84%; yellow solid). LC-MS method B: 95% purity; (M+H) 490.8; Rt: 1.87 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.79 (s, 1H), 8.75 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 7.20 - 7.16 (m, 1H), 7.18 - 7.13 (m, 2H), 5.38 - 4.70 (m, 1H), 4.51 (t, J = 5.2 Hz, 2H), 3.79 (t, J = 5.2 Hz, 2H), 3.10 - 3.00 (m, 1H), 2.09 - 2.00 (m, 2H), 1.85 - 1.72 (m, 2H), 1.71 - 1.51 (m, 4H) Example 146: N-(4-cyclopentyl-2,6-difluorophenyl)-2-{[4-(2-hydroxyethyl)- 4H-1,2,4- triazol-3-yl]sulfanyl}-5-nitrobenzamide Step 1: N-(4-cyclopentyl-2,6-difluorophenyl)-2-{[4-(2-methoxyethyl)- 4H-1,2,4-triazol-3- yl]sulfanyl}-5-nitrobenzamide Using the general procedure of Buchwald reaction afforded N-(4-cyclopentyl-2,6- difluorophenyl)-2-{[4-(2-methoxyethyl)-4H-1,2,4-triazol-3-yl ]sulfanyl}-5-nitrobenzamide (59 mg; 0.12 mmol; 95% yield; 100% purity) as a pale yellow solid UPLC-MS method A: (M+H) 504.1; Rt: 1.11 min Step 2: N-(4-cyclopentyl-2,6-difluorophenyl)-2-{[4-(2-hydroxyethyl)- 4H-1,2,4-triazol-3- yl]sulfanyl}-5-nitrobenzamide N-(4-cyclopentyl-2,6-difluorophenyl)-2-{[4-(2-methoxyethyl)- 4H-1,2,4-triazol-3-yl]sulfanyl}-5- nitrobenzamide (45 mg; 0.09 mmol) was dissolved in 3 mL anhydrous DCM and cooled to - 78 °C. Then boron tribromide (54 µL; 0.56 mmol) was added dropwise and stirred at this temperature for 6.5 h. Further boron tribromide (54 µL; 0.56 mmol) was added and the orange solution was still stirred at -78 °C. The reaction mixture was quenched with 5% NaHCO ₃ aqueous solution at 0 °C and extracted with DCM. The organic phase was dried over Na ₂ SO ₄ , filtered off, reduced and purified by preparative chromatography to afford N-(4-cyclopentyl-2,6- difluorophenyl)-2-{[4-(2-hydroxyethyl)-4H-1,2,4-triazol-3-yl ]sulfanyl}-5-nitrobenzamide (16 mg; 0.03 mmol; 30% yield; 99% purity) as a beige solid. UPLC-MS method A: (M+H) 490.1; Rt: 1.05 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.73 (s, 1H), 8.89 (s, 1H), 8.71 (d, J = 2.5 Hz, 1H), 8.25 (dd, J = 9.0, 2.5 Hz, 1H), 7.19 - 7.14 (m, 2H), 6.89 (d, J = 8.9 Hz, 1H), 5.03 (t, J = 5.3 Hz, 1H), 4.04 (t, J = 5.3 Hz, 2H), 3.60 (q, J = 5.1 Hz, 2H), 3.08 - 3.01 (m, 1H), 2.07 - 2.02 (m, 2H), 1.82 - 1.75 (m, 2H), 1.69 - 1.61 (m, 2H), 1.61 - 1.53 (m, 2H) Example 147: N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[3-(methylamino)p ropyl]-4H- 1,2,4-triazol-3-yl}sulfanyl)-5-nitrobenzamide Step 1: tert-butyl N-{3-[3-({2-[(4-cyclopentyl-2,6-difluorophenyl)carbamoyl]-4- nitrophenyl}sulfanyl)-4H-1,2,4-triazol-4-yl]propyl}-N-methyl carbamate Using the general precedure of the Buchwald reaction afforded tert-butyl N-{3-[3-({2-[(4- cyclopentyl-2,6-difluorophenyl)carbamoyl]-4-nitrophenyl}sulf anyl)-4H-1,2,4-triazol-4- yl]propyl}-N-methylcarbamate (89 mg; 0.13 mmol; 96% yield; 91% purity) as a pale brown oil UPLC-MS method A: (M+H) 617.2; R: 1.26 min Step 2: N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[3-(methylamino)p ropyl]-4H-1,2,4- triazol-3-yl}sulfanyl)-5-nitrobenzamide tert-butyl N-{3-[3-({2-[(4-cyclopentyl-2,6-difluorophenyl)carbamoyl]-4- nitrophenyl}sulfanyl)-4H- 1,2,4-triazol-4-yl]propyl}-N-methylcarbamate (89 mg; 0.13 mmol) was suspended in 3 mL anhydrous DCM. Then trifluoroacetic acid (202 µL; 2.62 mmol) was added and the yellow solution was stirred 5.5 h at rt. The solvent was removed and the residue purified by preparative chromatography. The pure product fractions were combined, the ACN removed and saturated aqueous NaHCO ₃ solution was added until pH 8, then diluted with DCM and extracted twice with water. The organic phase was dried over Na ₂ SO ₄ , filtered off, reduced to dryness and lyophilisated to get N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[3-(methylamino)p ropyl]-4H- 1,2,4-triazol-3-yl}sulfanyl)-5-nitrobenzamide (32 mg; 0.06 mmol; 46% yield; 99% purity) as a beige solid UPLC-MS method A: (M+H) 516.6; Rt: 0.84 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 8.94 (s, 1H), 8.73 - 8.68 (m, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 7.19 - 7.12 (m, 2H), 6.90 (d, J = 8.9 Hz, 1H), 4.02 (t, J = 7.2 Hz, 2H), 3.10 - 2.99 (m, 1H), 2.39 (t, J = 6.7 Hz, 2H), 2.18 (s, 3H), 2.10 - 2.00 (m, 2H), 1.85 - 1.71 (m, 4H), 1.71 - 1.50 (m, 4H) Example 148: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[4-(2- hydroxyethyl)-4H-1,2,4-triazol-3-yl]sulfanyl}-5-nitrobenzami de N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-iodo-5-nitrobenzamide (0.04 mmol; 100 mol%; 25 mg) and 4-(2-hydroxyethyl)-4,5-dihydro-1H-1,2,4-triazole-5-thione (0.09 mmol; 200 mol%; 14 mg) were dissolved in 1 mL anhydrous 1,4-dioxane. DIPEA (0.18 mmol; 400 mol%; 31 µL); tris(dibenzylideneacetone)dipalladium(0) (0 mmol; 10 mol%; 4 mg) and 9,9- dimethyl-4,5-bis(diphenylphosphino)xanthene (0.01 mmol; 20 mol%; 5 mg) were added under argon atmosphere and the reaction solution was stirred in a microwave oven at 80 °C for 2.5 h. The reaction solution was evaporated and purified by preparative chromatography (C18; water 0.1% TFA/5 - 100% acetonitrile TFA 0.1%) to get N-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-yl]-2-{[4-(2-hydroxyethyl)-4H-1, 2,4-triazol-3-yl]sulfanyl}-5- nitrobenzamide (8 mg; 26%; white solid). LC-MS method B: 84% purity; (M+H) 572.8; Rt:1.63 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.85 - 11.81 (m, 1H), 8.90 (s, 1H), 8.77 (d, J = 2.5 Hz, 1H), 8.73 (d, J = 2.0 Hz, 1H), 8.45 (dd, J = 10.0, 2.1 Hz, 1H), 8.26 (dd, J = 8.9, 2.5 Hz, 1H), 6.92 (d, J = 8.9 Hz, 1H), 4.07 - 4.02 (m, 2H), 3.62 - 3.57 (m, 2H) Example 149: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[5-(hydroxymethyl) -4-methyl-4H- 1,2,4-triazol-3-yl]sulfanyl}-5-nitrobenzamide Using the general procedure of the Buchwald reaction afforded N-(5-cyclopentyl-3- fluoropyridin-2-yl)-2-{[5-(hydroxymethyl)-4-methyl-4H-1,2,4- triazol-3-yl]sulfanyl}-5- nitrobenzamide (19 mg; 0.04 mmol; 12% yield; 98% purity) as an off-white solid UPLC-MS method A: (M+H) 471.0; Rt: 0.94 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.73 (d, J = 2.5 Hz, 1H), 8.27 - 8.25 (m, 1H), 8.24 (dd, J = 8.9, 2.5 Hz, 1H), 7.80 (dd, J = 11.0, 1.9 Hz, 1H), 6.86 (d, J = 8.9 Hz, 1H), 5.72 - 5.62 (m, 1H), 4.69 (s, 2H), 3.57 (s, 3H), 3.13 - 3.07 (m, 1H), 2.11 - 2.06 (m, 2H), 1.84 - 1.78 (m, 2H), 1.72 - 1.63 (m, 2H), 1.64 - 1.56 (m, 2H) Example 150: N-(5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-yl)-2-{[4- (2- hydroxyethyl)-4H-1,2,4-triazol-3-yl]sulfanyl}-5-nitrobenzami de Using the general procedure of the Buchwald reaction afforded N-(5-{bicyclo[3.1.0]hexan-1- yl}-3-fluoropyridin-2-yl)-2-{[4-(2-hydroxyethyl)-4H-1,2,4-tr iazol-3-yl]sulfanyl}-5-nitrobenzamide (7.5 mg; 0.01 mmol; 16% yield; 88% purity) as a yellow solid UPLC-MS method A: (M+H) 485.0; Rt: 0.96 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.29 (s, 1H), 8.89 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.24 (dd, J = 9.0, 2.5 Hz, 1H), 8.21 - 8.19 (m, 1H), 7.64 (dd, J = 11.3, 2.0 Hz, 1H), 6.87 (d, J = 8.9 Hz, 1H), 5.03 (t, J = 5.3 Hz, 1H), 4.04 (t, J = 5.3 Hz, 2H), 3.59 (q, J = 5.3 Hz, 2H), 2.12 (dd, J = 12.1, 7.8 Hz, 1H), 2.05 - 1.99 (m, 1H), 1.90 - 1.84 (m, 1H), 1.85 - 1.82 (m, 1H), 1.79 (dd, J = 12.1, 7.7 Hz, 1H), 1.73 - 1.67 (m, 1H), 1.40 - 1.31 (m, 1H), 1.02 (t, J = 4.8 Hz, 1H), 0.92 (dd, J = 8.2, 5.1 Hz, 1H) Example 151: N-(5-{bicyclo[3.1.0]hexan-1-yl}-3-fluoropyridin-2-yl)-2-{[4- (2- methoxyethyl)-4H-1,2,4-triazol-3-yl]sulfanyl}-5-nitrobenzami de Using the general procedure of the Buchwald reaction afforded N-(5-{bicyclo[3.1.0]hexan-1- yl}-3-fluoropyridin-2-yl)-2-{[4-(2-methoxyethyl)-4H-1,2,4-tr iazol-3-yl]sulfanyl}-5- nitrobenzamide (26 mg; 0.05 mmol; 58% yield; 97% purity) as a pale orange solid UPLC-MS method A: (M+H) 499.0; Rt: 1.08 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.29 (s, 1H), 8.90 (s, 1H), 8.72 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 8.21 - 8.19 (m, 1H), 7.64 (dd, J = 11.2, 2.0 Hz, 1H), 6.85 (d, J = 8.9 Hz, 1H), 4.17 (t, J = 5.1 Hz, 2H), 3.54 (t, J = 5.1 Hz, 2H), 3.13 (s, 3H), 2.12 (dd, J = 12.1, 7.8 Hz, 1H), 2.05 - 1.99 (m, 1H), 1.91 - 1.85 (m, 1H), 1.86 - 1.82 (m, 1H), 1.79 (dd, J = 12.2, 7.8 Hz, 1H), 1.73 - 1.68 (m, 1H), 1.40 - 1.31 (m, 1H), 1.02 (t, J = 4.8 Hz, 1H), 0.92 (dd, J = 8.2, 5.1 Hz, 1H) Example 152: N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[3-(N-methylforma mido) propyl]-4H-1,2,4-triazol-3-yl}sulfanyl)-5-nitrobenzamide Step 1: tert-butyl N-{3-[3-({2-[(4-cyclopentyl-2,6-difluorophenyl)carbamoyl]-4- nitrophenyl}sulfanyl)-4H-1,2,4-triazol-4-yl]propyl}-N-methyl carbamate Using the general procedure of the Buchwald reaction afforded tert-butyl N-{3-[3-({2-[(4- cyclopentyl-2,6-difluorophenyl)carbamoyl]-4-nitrophenyl}sulf anyl)-4H-1,2,4-triazol-4- yl]propyl}-N-methylcarbamate (218 mg; 0.34 mmol; 106% yield; 97% purity) as a yellow oil UPLC-MS method A: (M+H) 617.1; Rt: 1.27 min Step 2: N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[3-(methylamino)p ropyl]-4H-1,2,4- triazol-3-yl}sulfanyl)-5-nitrobenzamide N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[3-(methylamino)p ropyl]-4H-1,2,4-triazol-3- yl}sulfanyl)-5-nitrobenzamide (218 mg; 0.34 mmol) was suspended in 3 mL anhydrous DCM. Then trifluoroacetic acid (526 µL; 6.82 mmol) was added and the yellow solution was stirred 5 h at rt. The solvent was removed and the residue purified by preparative HPLC. The fractions containing the pure product were combined, the ACN removed and saturated aqueous NaHCO ₃ solution was added until pH 8 was reached, then diluted with DCM and extracted twice with water. The organic phase was dried over Na ₂ SO ₄ , filtered off, reduced to dryness and lyophilisated to get N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[3-(methylamino)p ropyl]- 4H-1,2,4-triazol-3-yl}sulfanyl)-5-nitrobenzamide (62 mg; 0.12 mmol; 35% yield; 100% purity) as a pale yellow solid UPLC-MS method A: (M+H) 516.8; R : 0.88 min Step 3: N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[3-(N-methylforma mido)propyl]-4H- 1,2,4-triazol-3-yl}sulfanyl)-5-nitrobenzamide Using the general procedure of amide coupling A with HATU afforded N-(4-cyclopentyl-2,6- difluorophenyl)-2-({4-[3-(N-methylformamido)propyl]-4H-1,2,4 -triazol-3-yl}sulfanyl)-5- nitrobenzamide (13 mg; 0.02 mmol; 40% yield; 100% purity) as a white solid UPLC-MS method A: (M+H) 545.1; Rt: 1.10 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.76 - 10.74 (m, 1H), 9.00 - 8.98 (m, 1H), 8.75 - 8.71 (m, 1H), 8.28 - 8.24 (m, 1H), 7.93 - 7.90 (m, 1H), 7.19 - 7.15 (m, 2H), 6.90 - 6.85 (m, 1H), 3.96 - 3.90 (m, 2H), 3.23 - 3.17 (m, 2H), 3.08 - 3.02 (m, 1H), 2.80 - 2.63 (m, 3H), 2.08 - 2.02 (m, 2H), 1.93 - 1.80 (m, 2H), 1.82 - 1.76 (m, 2H), 1.69 - 1.62 (m, 2H), 1.60 - 1.53 (m, 2H) Example 153: N-[3-fluoro-5-(3-methylcyclopentyl)pyridin-2-yl]-2-[(1-methy l-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (30 mg; 0.10 mmol) and 3- fluoro-5-(3-methylcyclopentyl)pyridin-2-amine (20 mg; 0.10 mmol; 1 eq.) were suspended in 1.2 mL dried pyridine under argon atmosphere. phosphoryl chloride (11 µL; 0.12 mmol; 1.15 eq.) was added and the yellow solution was stirred 2 h at rt. Then additional phosphoryl chloride (1.4 µL; 0.02 mmol; 0.15 eq.) was added and the reaction solution was stirred for 20 min at rt. The mixture was diluted with AcOEt and washed 4 x with water and brine. The organic phase was dried over Na ₂ SO ₄ , filtrated and evaporated. The residue was purified by flash chromatography (4 g silica gel, heptane/0 - 100% AcOEt) to get N-[3-fluoro-5-(3- methylcyclopentyl)pyridin-2-yl]-2-[(1-methyl-1H-1,2,3,4-tetr azol-5-yl)sulfanyl]-5- nitrobenzamide (32 mg; 0.07 mmol; 67%; beige solid). LC-MS method B: 98% purity; (M+H) 195.0; Rt: 1.22 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.40 - 11.38 (m, 1H), 8.79 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 8.26 - 8.24 (m, 1H), 7.81 (dd, J = 11.1, 2.0 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 3.20 - 3.14 (m, 1H), 2.22 - 2.17 (m, 1H), 2.13 - 2.06 (m, 2H), 1.94 - 1.88 (m, 1H), 1.74 - 1.67 (m, 1H), 1.42 - 1.36 (m, 1H), 1.28 - 1.22 (m, 1H), 1.07 (d, J = 6.6 Hz, 3H) Example 154: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[4-(3-hydroxypropy l)-4H-1,2,4- triazol-3-yl]sulfanyl}-5-nitrobenzamide The same method as in example 132 was used to get N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2- {[4-(3-hydroxypropyl)-4H-1,2,4-triazol-3-yl]sulfanyl}-5-nitr obenzamide (11 mg; 0.02 mmol; 39%; brown solid). LC-MS method B: 91% purity; (M+H) 486.9; Rt: 1.53 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.95 (s, 1H), 8.73 (d, J = 2.6 Hz, 1H), 8.27 - 8.26 (m, 1H), 8.28 - 8.24 (m, 1H), 7.80 (dd, J = 10.9, 1.9 Hz, 1H), 6.85 (d, J = 8.9 Hz, 1H), 4.77 - 4.36 (m, 1H), 4.04 (t, J = 7.3 Hz, 2H), 3.36 - 3.31 (m, 2H), 3.14 - 3.07 (m, 1H), 2.12 - 2.05 (m, 2H), 1.85 - 1.77 (m, 4H), 1.71 - 1.64 (m, 2H), 1.64 - 1.57 (m, 2H) Example 155: N-{3-fluoro-5-[(trifluoromethyl)sulfanyl]pyridin-2-yl}-2-[(1 -methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (40 mg; 0.13 mmol) and 3- fluoro-5-[(trifluoromethyl)sulfanyl]pyridin-2-amine (29 mg; 0.13 mmol; 1 eq.) were suspended in 1.6 mL dried pyridine under argon atmosphere. Phosphoryl chloride (15 µL; 0.16 mmol; 1.2 eq.) was added and the reaction mixture wasstirred for 3 h at 50 °C and overnight at rt. The mixture was diluted with EA and was washed 4 times with water and brine. The organic phase was dried over Na ₂ SO ₄ , filtrated and evaporated. The residue was purified by flash chromatography (4 g silica gel, heptane/0 - 100% AcOEt) to get N-{3-fluoro-5- [(trifluoromethyl)sulfanyl]pyridin-2-yl}-2-[(1-methyl-1H-1,2 ,3,4-tetrazol-5-yl)sulfanyl]-5- nitrobenzamide (31 mg; 0.06 mmol; 46%; white solid). LC-MS Method B: 94% purity; (M+H) 475.8; Rt: 1.74 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.80 (s, 1H), 8.82 (d, J = 2.5 Hz, 1H), 8.65 (d, J = 1.9 Hz, 1H), 8.44 (dd, J = 9.6, 1.9 Hz, 1H), 8.29 (dd, J = 8.9, 2.6 Hz, 1H), 7.13 (d, J = 8.9 Hz, 1H), 4.05 (s, 3H) Example 156: N-[5-(2,2-difluorocyclopentyl)-3-fluoropyridin-2-yl]-2-[(1-m ethyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Using the general procedure of the Buchwald reaction afforded N-[5-(2,2-difluorocyclopentyl)- 3-fluoropyridin-2-yl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl) sulfanyl]-5-nitrobenzamide (12 mg; 0.03 mmol; 27% yield; 99% purity) as a pale orange solid. UPLC-MS method A: (M+H) 480.2; Rt: 1.05 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.50 (s, 1H), 8.81 (d, J = 2.6 Hz, 1H), 8.31 - 8.29 (m, 1H), 8.28 (dd, J = 9.0, 2.6 Hz, 1H), 7.87 (dd, J = 10.9, 1.9 Hz, 1H), 7.10 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H), 3.68 - 3.58 (m, 1H), 2.36 - 2.21 (m, 2H), 2.25 - 2.18 (m, 1H), 2.16 - 2.09 (m, 1H), 1.96 - 1.84 (m, 2H) Example 157: 2-{[1-(3-aminopropyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-N-( 5-cyclopentyl- 3-fluoropyridin-2-yl)-5-nitrobenzamide Step 1: tert-butyl N-{3-[5-({2-[(5-cyclopentyl-3-fluoropyridin-2-yl)carbamoyl]- 4- nitrophenyl}sulfanyl)-1H-1,2,3,4-tetrazol-1-yl]propyl}carbam ate Using the general procedure of the Buchwald reaction afforded tert-butyl N-{3-[5-({2-[(5- cyclopentyl-3-fluoropyridin-2-yl)carbamoyl]-4-nitrophenyl}su lfanyl)-1H-1,2,3,4-tetrazol-1- yl]propyl}carbamate (52 mg; 0.09 mmol; 50% yield; 97% purity) as a yellow oil. UPLC-MS method A: (M+H) 587.2; Rt: 1.19 min Step 2: 2-{[1-(3-aminopropyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-N-( 5-cyclopentyl-3- fluoropyridin-2-yl)-5-nitrobenzamide Tert-butyl N-{3-[5-({2-[(4-cyclopentyl-2,6-difluorophenyl)carbamoyl]-4- nitrophenyl}sulfanyl)- 1H-1,2,3,4-tetrazol-1-yl]propyl}carbamate (77 mg; 0.12 mmol) was suspended in 3 mL anhydrous DCM, then trifluoroacetic acid (0.13 mL; 1.73 mmol) was added and the pale yellow solution was stirred 2.5 h at rt. The solvent was removed, and the residue purified by preparative HPLC (reversed phase; Sunfire; water/ACN/0.1% HCOOH; gradient 5-50% ACN/0.1% HCOOH). The pure product fractions were combined, the ACN removed and saturated aqueous NaHCO ₃ solution was added until pH 8 was reached, then thinned with DCM and extracted twice with water. The organic phase was dried over Na ₂ SO ₄ , filtered off, reduced to dryness and lyophilisated to get 2-{[1-(3-aminopropyl)-1H-1,2,3,4-tetrazol-5- yl]sulfanyl}-N-(5-cyclopentyl-3-fluoropyridin-2-yl)-5-nitrob enzamide (29 mg; 0.06 mmol; 68% yield; 99% purity) as a pale yellow solid. UPLC-MS method A: (M+H) 487.1; Rt: 0.79 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 11.44 (s, 1H), 8.84 (d, J = 2.5 Hz, 1H), 8.29 - 8.27 (m, 1H), 8.28 - 8.26 (m, 1H), 7.93 - 7.83 (m, 3H), 7.81 (dd, J = 11.1, 2.0 Hz, 1H), 7.10 (d, J = 8.9 Hz, 1H), 4.52 (t, J = 7.2 Hz, 2H), 3.13 - 3.07 (m, 1H), 2.91 - 2.86 (m, 2H), 2.15 (p, J = 7.3 Hz, 2H), 2.12 - 2.06 (m, 2H), 1.85 - 1.78 (m, 2H), 1.71 - 1.64 (m, 2H), 1.63 - 1.57 (m, 2H) Example 158: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-({5-[(dimethylamino )methyl]-4- methyl-4H-1,2,4-triazol-3-yl}sulfanyl)-5-nitrobenzamide The same method as in example 132 was used to get N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2- ({5-[(dimethylamino)methyl]-4-methyl-4H-1,2,4-triazol-3-yl}s ulfanyl)-5-nitrobenzamide (19.2 mg; 0.04 mmol; 29%; yellow solid). LC-MS method B: 98% purity; (M+H) 500.1; Rt: 1.36 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.78 (d, J = 2.5 Hz, 1H), 8.27 - 8.25 (m, 1H), 8.22 (dd, J = 8.9, 2.5 Hz, 1H), 7.79 (dd, J = 11.2, 1.9 Hz, 1H), 6.93 (d, J = 8.9 Hz, 1H), 4.65 (s, 2H), 3.61 (s, 3H), 3.16 - 3.06 (m, 1H), 2.94 (s, 6H), 2.14 - 2.04 (m, 2H), 1.88 - 1.74 (m, 2H), 1.74 - 1.54 (m, 4H) Example 159: N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[2-(N-methylforma mido)ethyl]- 4H-1,2,4-triazol-3-yl}sulfanyl)-5-nitrobenzamide

Step 1: tert-butyl N-{2-[3-({2-[(4-cyclopentyl-2,6-difluorophenyl)carbamoyl]-4- nitrophenyl}sulfanyl)-4H-1,2,4-triazol-4-yl]ethyl}-N-methylc arbamate Using the general precedure of the Buchwald reaction afforded tert-butyl N-{2-[3-({2-[(4- cyclopentyl-2,6-difluorophenyl)carbamoyl]-4-nitrophenyl}sulf anyl)-4H-1,2,4-triazol-4-yl]ethyl}- N-methylcarbamate (95 mg; 0.15 mmol; 49% yield; 96% purity) as a beige solid. UPLC-MS method A: (M+H) 603.3; Rt: 1.23 min Step 2: N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[2-(methylamino)e thyl]-4H-1,2,4- triazol-3-yl}sulfanyl)-5-nitrobenzamide hydrochloride Tert-butyl N-{2-[3-({2-[(4-cyclopentyl-2,6-difluorophenyl)carbamoyl]-4- nitrophenyl}sulfanyl)- 4H-1,2,4-triazol-4-yl]ethyl}-N-methylcarbamate (95 mg; 0.15 mmol) was dissolved in 380 µL dried 1,4-dioxane, then 4.0 M hydrogen chloride solution in 1,4-dioxane (0.48 mL) was added and the pale yellow solution was stirred first 3 h at rt, then 4 h at 50 °C. The mixture was stirred for another 2 h at 50 °C and was then worked up. The solvent was removed to get N-(4- cyclopentyl-2,6-difluorophenyl)-2-({4-[2-(methylamino)ethyl] -4H-1,2,4-triazol-3-yl}sulfanyl)-5- nitrobenzamide hydrochloride (97 mg; 0.09 mmol; 60% yield; 50% purity) as a pale yellow solid. UPLC-MS method A: (M+H) 503.3; Rt: 0.88 min Step 3: N-(4-cyclopentyl-2,6-difluorophenyl)-2-({4-[2-(N-methylforma mido)ethyl]-4H- 1,2,4-triazol-3-yl}sulfanyl)-5-nitrobenzamide Using the general procedure A of HATU amide coupling afforded N-(4-cyclopentyl-2,6- difluorophenyl)-2-({4-[2-(N-methylformamido)ethyl]-4H-1,2,4- triazol-3-yl}sulfanyl)-5- nitrobenzamide (11 mg; 0.02 mmol; 34% yield; 96% purity) as a pale yellow solid. UPLC-MS method A: (M+H) 531.1; Rt: 1.04 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.76 - 10.73 (m, 1H), 8.94 - 8.90 (m, 1H), 8.73 - 8.70 (m, 1H), 8.28 - 8.24 (m, 1H), 7.80 - 7.54 (m, 1H), 7.19 - 7.14 (m, 2H), 6.98 - 6.89 (m, 1H), 4.17 - 4.13 (m, 2H), 3.57 - 3.53 (m, 2H), 3.08 - 3.02 (m, 1H), 2.82 - 2.66 (m, 3H), 2.09 - 2.02 (m, 2H), 1.83 - 1.76 (m, 2H), 1.69 - 1.62 (m, 2H), 1.61 - 1.53 (m, 2H) Example 160: 2-({5-[(dimethylamino)methyl]-4-methyl-4H-1,2,4-triazol-3-yl }sulfanyl)-N- [3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl]-5 -nitrobenzamide Under argon atmosphere N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-iodo-5- nitrobenzamide (80 mg; 0.14 mmol) and 5-((dimethylamino)methyl)-4-methyl-4H-1,2,4- triazole-3-thiol (37 mg; 0.22 mmol; 1.5 eq.) were dissolved in 3.2 mL dried 1,4-dioxane. Then TEA (80 µL; 0.58 mmol; 4 eq.), Xantphos (17 mg; 0.03 mmol; 0.2 eq.) and tris(dibenzylideneacetone)dipalladium(0) (13 mg; 0.01 mmol; 0.1 eq.) were added and stirred at 90 °C for 1 h. The solution was evaporated. The residue was purified by chromatography (C18; water + 0.1% TFA/5 - 100% acetonitrile + TFA 0.1%) to get 2-({5- [(dimethylamino)methyl]-4-methyl-4H-1,2,4-triazol-3-yl}sulfa nyl)-N-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-yl]-5-nitrobenzamide (15.9 mg; 0.03 mmol; 18%; off white solid). LC-MS method B: 100% purity; (M+H) 600.0; Rt: 1.46 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.86 (s, 1H), 10.47 - 10.10 (m, 1H), 8.83 (d, J = 2.6 Hz, 1H), 8.75 - 8.72 (m, 1H), 8.49 - 8.44 (m, 1H), 8.25 (dd, J = 8.9, 2.5 Hz, 1H), 6.94 (d, J = 8.9 Hz, 1H), 4.65 - 4.47 (m, 2H), 3.60 (s, 3H), 2.96 - 2.78 (m, 6H) Example 161: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-({1-[2-(dimethylami no)ethyl]-1H- 1,2,3,4-tetrazol-5-yl}sulfanyl)-5-nitrobenzamide

To a solution of 2-({1-[2-(dimethylamino)ethyl]-1H-1,2,3,4-tetrazol-5-yl}sulf anyl)-5-nitrobenzoic acid (0.046 g, 0.14 mmol, 1 eq.) in dry pyridine (1.14 mL), 5-cyclopentyl-3-fluoropyridin-2- amine (0.030 g, 0.14 mmol, 1 eq.) was added. The reaction mixture was cooled to 0 °C and POCl ₃ (0.023 g, 0.15 mmol, 1.1 eq.) was slowly added. After 10 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated. The product was purified by column chromatography using hexane/AcOEt (1/1 to 2/8) (white solid, 0.023 g, 0.046 mmol, 31% yield, 91% purity). HPLC-MS Method C: (M+H) 501.20; Rt: 3.52 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.53 - 1.85 (m, 6 H) 2.02 (s, 6 H) 2.04 - 2.12 (m, 2 H) 2.63 - 2.68 (m, 2 H) 3.03 - 3.15 (m, 1 H) 4.54 (t, J=5.72 Hz, 2 H) 7.11 (d, J=9.00 Hz, 1 H) 7.81 (dd, J=11.13, 1.83 Hz, 1 H) 8.21 - 8.32 (m, 2 H) 8.75 (d, J=2.44 Hz, 1 H) 11.40 (s, 1 H) HRMS (ESI) calcd for C ₂₂ H ₂₅ FN ₈ O ₃ S [M + H] ⁺ 523.1646, found 523.1647 Example 162: N-(3-cyano-5-cyclopentylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3, 4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.045 g, 0.16 mmol, 1 eq.) in dry pyridine (1.44 mL), 2-amino-5-cyclopentylpyridine-3-carbonitrile (0.03 g, 0.16 mmol, 1 eq.) was added. The reaction mixture, which appears as a beige-brown suspension, was cooled to 0 °C and POCl ₃ (0.027 g, 0.18 mmol, 1.1 eq.) was slowly added. After 10 min the reaction turned to a pale-yellow solution; water was then added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated. The crude was purified by column chromatography using hexane/AcOEt (8/2 to 3/7) to afford the target product as a white solid (0.031g, 0.07 mmol, 36% yield, 100% purity). HPLC-MS Method C: (M+H) 451.3; Rt: 4.97 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.52 - 1.72 (m, 4 H) 1.75 - 1.87 (m, 2 H) 2.03 - 2.15 (m, 2 H) 3.05 - 3.16 (m, 1 H) 4.06 (s, 3 H) 7.12 (d, J=8.85 Hz, 1 H) 8.29 (dd, J=8.92, 2.52 Hz, 1 H) 8.37 (d, J=2.14 Hz, 1 H) 8.71 (s, 1 H) 8.76 - 8.85 (m, 1 H) 11.89 (br. s., 1 H) HRMS (ESI) calcd for C ₂₀ H ₁₈ N ₈ O ₃ S [M + H] ⁺ 451.1296, found 451.1277 Example 163: N-(4-cyano-5-cyclopentylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3, 4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.075 g, 0.27 mmol, 1 eq.) in dry pyridine (2.43 mL), 2-amino-5-cyclopentylpyridine-4-carbonitrile (0.05 g, 0.27 mmol, 1 eq.) was added. The reaction mixture (a beige-brown suspension) was cooled to 0 °C and POCl ₃ (0.045 g, 0.29 mmol, 1.1 eq.) was slowly added. After 15 min a formation of an orange solution was observed and water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a solution of 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated. The product was precipitated with DCM/Et ₂ O (1/1) to afford the title compound as a pale beige solid (0.076 g, 0.169 mmol, 63% yield, 96% purity). HPLC-MS Method C: (M+H) 451.2; Rt: 5.47 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.63 - 1.93 (m, 6 H) 2.05 - 2.20 (m, 2 H) 3.22 - 3.32 (m, 1 H) 4.04 (s, 3 H) 7.20 (d, J=8.85 Hz, 1 H) 8.27 (dd, J=8.92, 2.52 Hz, 1 H) 8.40 (s, 1 H) 8.69 (s, 1 H) 8.74 (d, J=2.59 Hz, 1 H) 11.95 (s, 1 H) Example 164: 5-cyclopentyl-2-{2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfa nyl]-5- nitrobenzamido}pyridine-4-carboxamide

In a reactor N-(4-cyano-5-cyclopentylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3, 4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide (0.06 g, 0.13 mmol, 1 eq.), acetaldehyde oxime (0.159 g, 2.66 mmol, 20 eq.), indium(III) chloride (0.003 g, 0.01 mmol, 0.1 eq.) and toluene (1.8 mL) were added. The reaction mixture was stirred at 80 °C for 6 h. The HPLC-MS analysis showed the presence of the planned product. The product precipitated by cooling the reaction mixture to room temperature, the solid was collected and washed with DCM, MeOH and water to obtain the purified title compound as white solid (0.019 g, 0.04 mmol, 31% yield, 93% purity). HPLC-MS Method C: (M+H) 469.2; Rt: 4.06 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.47 - 1.71 (m, 4 H) 1.74 - 1.87 (m, 2 H) 1.93 - 2.11 (m, 2 H) 3.20 (t, J=7.32 Hz, 1 H) 4.04 (s, 3 H) 7.18 (d, J=8.85 Hz, 1 H) 7.71 (s, 1 H) 8.04 (s, 1 H) 8.07 (s, 1 H) 8.25 (dd, J=8.85, 2.59 Hz, 1 H) 8.44 (s, 1 H) 8.71 (d, J=2.44 Hz, 1 H) 11.66 (s, 1 H) Example 165: N-[4-(3,3-difluoroazetidin-1-yl)phenyl]-2-[(1-methyl-1H-1,2, 3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.025 g, 0.09 mmol, 1 eq.) in dry pyridine (0.88 mL), 4-(3,3-difluoroazetidin-1-yl)aniline (0.018 g, 0.09 mmol, 1 eq.) was added. The reaction mixture, which appears as a beige-brown suspension, was then cooled to 0 °C and POCl ₃ (0.015 g, 0.1 mmol, 1.1 eq.) was slowly added. The formation of an orange-red solution was then observed and after 15 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated. The product was purified by column chromatography using hexane/acetone (8/2 to 6/4) to afford the title compound as a pale orange solid (0.01 g, 0.022 mmol, 24% yield, 92% purity). HPLC-MS Method C: (M+H) 448.10; Rt: 4.75 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.05 (s, 3 H) 4.27 (t, J=12.35 Hz, 4 H) 6.63 (d, J=8.85 Hz, 2 H) 7.14 (d, J=8.85 Hz, 1 H) 7.62 (d, J=8.85 Hz, 2 H) 8.24 (dd, J=8.92, 2.52 Hz, 1 H) 8.69 (d, J=2.59 Hz, 1 H) 10.75 (s, 1 H) Example 166: N-(2-cyclopentylpyrimidin-5-yl)-2-[(1-methyl-1H-tetrazol-5-y l)sulfanyl]-5- nitrobenzamide To a suspension of 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitrobenzoyl chloride (0.105 g, 0.35 mmol, 1 eq.) in dry DCM (4 mL), 2-cyclopentylpyrimidin-5-amine (0.060 g, 0.37 mmol, 1,05 eq.) and DIPEA (0.130 mL, 0.70 mmol, 2 eq.) were added and the mixture was stirred at room temperature overnight. The reaction mixture was diluted with DCM, washed with saturated aqueous NaHCO ₃ solution, 1N aqueous HCl, brine and then dried over Na ₂ SO ₄ , filtered. Finally, the solvent was evaporated and the crude was purified by chromatographic column hexane/AcOEt (6/4 to 2/8) to give the title compound as white solid (0.074 g, 0.17 mmol, 49% yield, 99.1% purity). HPLC-MS Method F: (M+H) 427.11; Rt: 9.99 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.58 - 1.91 (m, 6 H) 1.98 - 2.10 (m, 2 H) 4.02 - 4.10 (m, 3 H) 7.18 (d, J=9.00 Hz, 1 H) 8.28 (dd, J=8.92, 2.52 Hz, 1 H) 8.81 (d, J=2.59 Hz, 1 H) 9.04 (s, 2 H) 11.22 (s, 1 H) HRMS (ESI) calcd for C ₁₈ H ₁₈ N ₈ O ₃ S [M + H] 427.1296, found 427.1289 Example 167: N-[2-(cyclopent-1-en-1-yl)pyrimidin-5-yl]-2-[(1-methyl-1H-1, 2,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide To a suspension of 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitrobenzoyl chloride (0.047 g, 0.16 mmol, 1 eq.) in dry DCM (2.0 mL), 2-(cyclopenten-1-yl)pyrimidin-5-amine (0.026 g, 0.16 mmol, 1 eq.) and DIPEA (0.48 mL, 2.70 mmol, 17 eq.) were added and the mixture was stirred at room temperature overnight. The reaction mixture was diluted with DCM, washed with 1N aqueous NaOH, 1N aqueous HCl and brine then dried on Na ₂ SO ₄ , filtered and the solvent evaporated. The crude was purified by column chromatography using hexane/AcOEt (6/4 to 3/7) to give the target compound as light orange solid (0.023 g, 0.05 mmol, 33% yield, 94% purity). HPLC-MS Method F: (M+H) 425.09; Rt: 10.05 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.29 (s, 1H) 9.09 (s, 1H) 8.82 (d, J = 2.59 Hz, 1H) 8.29 (dd, J = 8.85, 2.59 Hz, 1H) 7.18 (d, J = 8.85 Hz, 1H) 6.89 (t, J = 2.14 Hz, 1H) 4.06 (s, 3H) 2.74 - 2.81 (m, 2H) 2.57 (td, J = 7.36, 2.82 Hz, 2H) 1.97 – 2.04 (m, 3H) HRMS (ESI) calcd for C ₁₈ H ₁₆ N ₈ O ₃ S [M + H] 425.1139, found 425.1133 Example 168: N-[5-(cyclopent-1-en-1-yl)pyrazin-2-yl]-2-[(1-methyl-1H-1,2, 3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide To a suspension of 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitrobenzoyl chloride (0.042 g, 0.14 mmol, 1 eq.) in dry DCM (3.0 mL), 5-(cyclopent-1-en-1-yl)pyrazin-2-amine (0.025 g, 0.16 mmol, 1.1 eq,) and DIPEA (0.05 mL, 0.28 mmol, 2 eq.) were added and the mixture was stirred at room temperature overnight. The reaction mixture was diluted with DCM, washed with saturated aqueous solution of NaHCO ₃ , brine and dried on Na ₂ SO ₄ , filtered then solvent was evaporated. The crude was purified by chromatographic column using hexane/AcOEt (8/2 to 4/6) to give the title compound as solid (0.025 g, 0.06 mmol, 40% yield, 95% purity). HPLC-MS Method F: (M+H) 425.102; Rt: 10.50 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.93 - 2.08 (m, 2 H) 2.52 - 2.60 (m, 2 H) 2.74 - 2.84 (m, 2 H) 4.00 - 4.09 (m, 3 H) 6.76 (t, J=1.98 Hz, 1 H) 7.19 (d, J=8.85 Hz, 1 H) 8.27 (dd, J=8.85, 2.59 Hz, 1 H) 8.68 - 8.82 (m, 2 H) 9.32 (d, J=1.37 Hz, 1 H) 11.85 (s, 1 H) HRMS (ESI) calcd for C ₁₈ H ₁₆ N ₈ O ₃ S [M + H] 425.1139, found 425.1136 Example 169: N-(5-cyclopentylpyrazin-2-yl)-2-[(1-methyl-1H-1,2,3,4-tetraz ol-5- yl)sulfanyl]-5-nitrobenzamide To a suspension of 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitrobenzoyl chloride (0.054 g, 0.18 mmol, 1 eq.) in dry DCM (6.0 mL), 5-cyclopentylpyrazin-2-amine (0.070 g, 0.43 mmol, 2.4 eq.) and DIPEA (0.150 mL, 0.86 mmol, 4.8 eq.) were added and the mixture was stirred at room temperature overnight. The reaction mixture was diluted with DCM, washed with saturated aqueous solution of NaHCO ₃ , 0.5N aqueous HCl, brine and dried on Na ₂ SO ₄ , filtered then solvent was evaporated. The crude was purified by chromatographic column hexane/AcOEt (7/3 to 1/1) to give the title compound as light-yellow solid (0.070 g, 0.15 mmol, 83% yield, 91% purity). HPLC-MS Method F: (M+H) 427.11; Rt: 10.49 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.77 (s, 1H) 9.29 (d, J = 1.37 Hz, 1H) 8.77 (d, J = 2.59 Hz, 1H) 8.44 (d, J = 1.37 Hz, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 7.19 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 3.26 (m, 1H) 2.00 – 2.08 (m, 2H) 1.64 – 1.84 (m, 6H) HRMS (ESI) calcd for C ₁₈ H ₁₈ N ₈ O ₃ S [M + H] 427.1296, found 427.1295 Example 170: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-4-methyl-2-[(1-methyl -1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide To a mixture of 4-methyl-2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro-benzoic acid (0.100 g, 0.34 mmol, 1 eq.) and 2-cyclopentylpyrimidin-5-amine (0.061 g, 0.34 mmol, 1 eq.) in dry pyridine (3 mL), POCl3 (0.035 mL, 0.37 mmol, 1.1 eq.) at 0 °C was added. After addition, the cooling bath was removed and the reaction mixture was stirred at room temperature for 10 min then it was evaporated to dryness and the residue dissolved in DCM, washed with H ₂ O, dried on Na ₂ SO ₄ , filtered then solvent was evaporated. The crude was purified by chromatographic column hexane/AcOEt (7/3 to 1/1) to give the title compound as pale-yellow solid (0.033 g, 0.072 mmol, 21% yield, 94% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.48 -1.73 (m, 4H) 1.77 – 1.84 (m, 2H) 1.96 – 2.14 (m, 2H) 2.47 (s, 3 H) 3.09 (t, J=9.53 Hz, 1 H) 4.05 (s, 3 H) 6.96 (s, 1 H) 7.79 (dd, J=11.13, 1.68 Hz, 1 H) 8.25 (s, 1 H) 8.60 (s, 1 H) 11.27 (s, 1 H) HRMS (ESI) calcd for C ₂₀ H ₂₀ FN ₇ O ₃ S [M + H] ⁺ 458.1405, found 458.1387 Example 171: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-{[1-(2-isocyanoethy l)-1H-1,2,3,4- tetrazol-5-yl]sulfanyl}-5-nitrobenzamide To a solution of 2-{[1-(2-formamidoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}- 5-nitrobenzoic acid (0.020 g, 0.05 mmol, 1 eq.) in dry pyridine (0.53 mL), 5-cyclopentyl-3-fluoropyridin-2-amine (0.010 g, 0.05 mmol, 1 eq.) was added. The reaction mixture (a solution) was cooled to 0 °C and POCl ₃ (0.009 g, 0.06 mmol, 1.1 eq.) was slowly added. After 15 min water was added to quench the reaction, resulting in an orange yellow suspension. The mixture was then extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated. The resulting isonitrile was purified by chromatographic column using hexane/AcOEt (7/3 to 4/6) and by trituration with MeOH to obtain the title compound as a white solid (0.004 g, 0.008 mmol, 17% yield, 91% purity). HPLC-MS Method C: (M+H) 483.1; Rt: 5.17 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.48 - 1.74 (m, 4 H) 1.74 - 1.88 (m, 2 H) 2.03 - 2.16 (m, 2 H) 3.03 - 3.16 (m, 1 H) 3.94 - 4.29 (m, 2 H) 4.76 (t, J=5.41 Hz, 2 H) 7.15 (d, J=9.00 Hz, 1 H) 7.82 (dd, J=10.98, 1.68 Hz, 1 H) 8.15 - 8.35 (m, 2 H) 8.82 (d, J=2.29 Hz, 1 H) 11.43 (s, 1 H) Example 172: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-[(1-ethenyl-1H-1,2, 3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-ethenyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenz oic acid (0.020 g, 0.06 mmol, 1 eq.) in dry pyridine (0.61 mL), 5-cyclopentyl-3-fluoropyridin-2-amine (0.013 g, 0.06 mmol, 1 eq.) was added. The reaction mixture (a yellow solution) was cooled to 0 °C and POCl3 (0.011 g, 0.07 mmol, 1.1 eq.) was slowly added. After 10 min water was added to quench the reaction, resulting in a yellow suspension. The mixture was then extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated. The crude was purified by chromatographic column hexane/AcOEt (9/1 to 6/4) to give the target compound as a white solid (0.017 g, 0.037 mmol, 63% yield, 92% purity). HPLC-MS Method C: (M+H) 456.1; Rt: 5.41 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.48 - 1.73 (m, 4 H) 1.74 - 1.90 (m, 2 H) 1.98 - 2.15 (m, 2 H) 3.00 - 3.18 (m, 1 H) 5.55 (dd, J=8.69, 1.37 Hz, 1 H) 6.09 (dd, J=15.25, 1.37 Hz, 1 H) 7.08 (d, J=9.00 Hz, 1 H) 7.38 (dd, J=15.40, 8.69 Hz, 1 H) 7.81 (dd, J=11.13, 1.83 Hz, 1 H) 8.15 - 8.32 (m, 2 H) 8.81 (d, J=2.29 Hz, 1 H) 11.42 (s, 1 H) Example 173: N-(4-cyanophenyl)-2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro- benzamide To a suspension of 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (0.024 g, 0.085 mmol, 1 eq.) in dry DCM (2 mL), 1-chloro-N,N,2-trimethyl-1-propenylamine (0.023 mL, 0.17 mmol, 2 eq.) was added. The reaction mixture was stirred at room temperature for 1 h. Then a solution of 4-aminobenzonitrile (0.020 g, 0.17 mmol, 2 eq.) and TEA (0.1 mL, 0.72 mmol, 8.5 eq.) in dry DCM (2 mL) was added to the reaction mixture was then stirred at room temperature for 3 days. The mixture was extracted with DCM 3 times, organic layers were combined and washed with 1N aqueous HCl and brine, dried on Na ₂ SO ₄ and evaporated. The product was purified by column chromatography using hexane/AcOEt (7/3 to 6/4) to obtain a white solid (0.012 g, 0.031 mmol, 37% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.05 (s, 3 H) 7.20 - 7.25 (m, 1 H) 7.90 (s, 2 H) 7.94 (s, 2 H) 8.26 - 8.31 (m, 1 H) 8.74 - 8.78 (m, 1 H) 11.25 - 11.31 (m, 1 H) HRMS (ESI) calcd for C ₁₆ H ₁₁ N ₇ O ₃ S [M + H] ⁺ 382.0717, found 382.0720 Example 174: N-(4-ethyl-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-n itro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.05 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-ethyl-phenylamine (0.027 mL, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed wit H ₂ O and the aqueous layer was extracted with AcOEt three times. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the planned product as a pale yellow solid (0.037 g, 0.096 mmol, 54% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.70 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.85, 2.59 Hz, 1H) 7.66 (d, J = 8.39 Hz, 2H) 7.25 (d, J = 8.54 Hz, 2H) 7.17 (d, J = 8.85 Hz, 1H) 4.04- 4.07 (m, 3H) 2.57-2.64 (m, 2H) 1.19 (t, J = 7.63 Hz, 3H) HRMS (ESI) calcd for C ₁₇ H ₁₆ N ₆ O ₃ S [M + H] ⁺ 385.1078, found 385.1080 Example 175: N-indan-5-yl-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-b enzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.05 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and indan-5-ylamine (0.03 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt three times. The combined organic layers were washed with a saturated aqueous solutionof NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the target product as a yellow solid (0.055 g, 0.14 mmol, 70% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.82 (s, 1H) 8.69 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.85, 2.59 Hz, 1H) 7.67 (s, 1H) 7.45 (dd, J = 8.08, 1.83 Hz, 1H) 7.24 (d, J = 8.08 Hz, 1H) 7.17 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 2.87 (dt, J = 18.87, 7.42 Hz, 4H) 1.98-2.09 (m, 2H) HRMS (ESI) calcd for C ₁₈ H ₁₆ N ₆ O ₃ S [M + H] ⁺ 397.1078, found 397.1075 Example 177: 2-(4-methyl-4H-[1,2,4]triazol-3-ylsulfanyl)-5-nitro-N-(4-tri fluoromethyl- phenyl)-benzamide A solution of 2-fluoro-5-nitro-N-(4-trifluoromethyl-phenyl)-benzamide (0.05 g, 0.15 mmol, 1 eq.) and 4-methyl-4H-[1,2,4]triazole-3-thiol (0.018 g, 0.15 mmol, 1 eq.) in the presence of TEA (0.042 mL, 0.30 mmol, 2 eq.) as the base in dry ACN (3 mL) was heated at 50 °C until the disappearance of the starting material (8 h). Two regioisomers were formed corresponding to the S/N-substituted compounds. The reaction mixture was diluted with AcOEt, the organic phase was washed with H ₂ O, 1N aqueous HCl and brine, dried over Na ₂ SO ₄ , filtered and concentrated. The crude was purified by preparative-HPLC to afford the title compound as a yellow solid (0.029 g, 0.069 mmol, 45% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.18 (s, 1H) 8.87 (s, 1H) 8.71 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.99 (d, J = 8.54 Hz, 2H) 7.79 (d, J = 8.54 Hz, 2H) 6.91 (d, J = 8.85 Hz, 1H) 3.59 (s, 3H) HRMS (ESI) calcd for C ₁₇ H ₁₂ N ₅ O ₃ S [M + H] ⁺ 424.0686, found 424.0678 Example 178: 2-(1-methy-1H-imidazol-2-ylsulfanyl)-5-nitro-N-(4-trifluorom ethy- phenyl)benzamide A solution of 2-fluoro-5-nitro-N-(4-trifluoromethyl-phenyl)-benzamide (0.033 g, 0.10 mmol, 1 eq.) in ACN dry (3 mL) and 1-methyl-1H-imidazole-2-thiol (0.017 g, 0.15 mmol, 1.5 eq.) in the presence of TEA (0.042 mL, 0.30 mmol, 3 eq.) as the base was heated to 80 °C for 16 h under nitrogen. After almost complete conversion, the solvent was evaporated to dryness and the resulting solid was rinsed with AcOEt. The organic phase was washed with H ₂ O and brine and dried over Na ₂ SO ₄ . The solid was then rinsed with AcOEt, filtered, rinsed with Et ₂ O, collected and dried in vacuo to afford the title compound as a white solid (0.016 g, 0.04 mmol, 38% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.27 (s, 1H) 8.79 (d, J = 2.44 Hz, 1H) 8.30 (dd, J = 8.85, 2.59 Hz, 1H) 8.03 (d, J = 8.54 Hz, 2H) 7.77-7.88 (m, 3H) 7.61 (br s, 1H) 6.87 (d, J = 8.85 Hz, 1H) 3.75 (s, 3H) HRMS (ESI) calcd for C ₁₈ H ₁₃ F ₃ N ₄ O ₃ S [M + H] ⁺ 423.0733, found 423.0742 Example 179: 5-nitro-2-(pyrimidin-2-ylsulfanyl)-N-(4-trifluoromethyl-phen yl)benzamide A solution of 2-fluoro-5-nitro-N-(4-trifluoromethyl-phenyl)-benzamide (0.066 g, 0.20 mmol, 1 eq.) and pyrimidine-2-thiol (0.028 g, 0.25 mmol, 1.25 eq.) in the presence of TEA (0.084 mL, 0.60 mmol, 3 eq.) as the base in dry ACN (4 mL) was heated to 80 °C for 5 h under nitrogen. HPLC-MS analysis showed that the conversion was complete. The solvent was then evaporated to dryness and the resulting solid was rinsed with AcOEt. The organic phase was washed with H ₂ O and brine and dried over Na ₂ SO ₄ . The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2 to 6/4) to afford the title compound as a white solid (0.055 g, 0.131 mmol, 65% yield, 98% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.05 (s, 1H) 8.62 (d, J = 4.88 Hz, 2H) 8.53 (d, J = 2.59 Hz, 1H) 8.38 (dd, J = 8.69, 2.59 Hz, 1H) 8.09 (d, J = 8.69 Hz, 1H) 7.85 (d, J = 8.54 Hz, 2H) 7.72 (d, J = 8.69 Hz, 2H) 7.30 (t, J = 4.88 Hz, 1H) HRMS (ESI) calcd for C ₁₆ H ₁₁ F ₃ N ₆ O ₄ S [M + H] ⁺ 421.0577, found 421.0575 Example 180: 5-nitro-2-(pyridin-2-ylsulfanyl)-N-(4-trifluoromethyl-phenyl )-benzamide A solution of 2-fluoro-5-nitro-N-(4-trifluoromethyl-phenyl)-benzamide (0.066 g, 0.20 mmol, 1 eq.) and pyridine-2-thiol (0.028 g, 0.25 mmol, 1.25 eq.) in the presence of TEA (0.084 mL, 0.60 mmol, 3 eq.) as the base in dry ACN (4 mL) was heated to 80 °C for 2 h under nitrogen. HPLC- MS analysis showed that the conversion was complete. The solvent was then evaporated to dryness and the resulting solid was rinsed with AcOEt. The organic phase was washed with H ₂ O and brine and dried over Na ₂ SO ₄ . The crude was purified by flash chromatography on silica gel eluting with PE/AcOEt (7/3) to afford the title compound as a pale pink solid (0.070 g, 0.167 mmol, 83% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.07 (s, 1H) 8.54 (d, J = 2.44 Hz, 1H) 8.51 (dt, J = 3.89, 0.95 Hz, 1H) 8.29 (dd, J = 8.85, 2.59 Hz, 1H) 7.90 (d, J = 8.54 Hz, 2H) 7.81 (td, J = 7.70, 1.98 Hz, 1H) 7.74 (d, J = 8.69 Hz, 2H) 7.62 (d, J = 8.85 Hz, 1H) 7.52 (d, J = 7.93 Hz, 1H) 7.35 (ddd, J = 7.51, 4.84, 0.91 Hz, 1H) HRMS (ESI) calcd for C ₁₉ H ₁₂ F ₃ N ₃ O ₃ S [M + H] ⁺ 420.0624, found 420.0627 Example 181: 5-nitro-2-(pyridin-4-ylsulfanyl)-N-(4-trifluoromethyl-phenyl )-benzamide A solution of 2-fluoro-5-nitro-N-(4-trifluoromethyl-phenyl)-benzamide (0.066 g, 0.20 mmol, 1 eq.) and pyridine-4-thiol (0.028 g, 0.25 mmol, 1.25 eq.) in the presence of TEA (0.084 mL, 0.60 mmol, 3 eq.) as the base in dry ACN (4 mL) was heated to 80 °C for 2 h under nitrogen. HPLC- MS analysis showed that the conversion was complete. The solvent was then evaporated to dryness and the resulting solid was rinsed with AcOEt. The organic phase was washed with H ₂ O and brine and dried over Na ₂ SO ₄ . The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (1/1) to afford the title compound as a yellow solid (0.058 g, 0.130 mmol, 69% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.09 (s, 1H) 8.61 (d, J = 2.59 Hz, 1H) 8.52-8.57 (m, 2H) 8.32 (dd, J = 8.69, 2.59 Hz, 1H) 7.90 (d, J = 8.54 Hz, 2H) 7.75 (d, J = 8.69 Hz, 2H) 7.58 (d, J = 8.69 Hz, 1H) 7.37-7.40 (m,2H) HRMS (ESI) calcd for C ₁₉ H ₁₂ F ₃ N ₃ O ₃ S [M + H] ⁺ 420.0624, found 420.0625 Example 182: 5-cyano-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-N-(4-trifluoro methyl- phenyl)-benzamide A solution of 5-cyano-2-fluoro-N-(4-trifluoromethyl-phenyl)-benzamide (0.062 g, 0.20 mmol, 1 eq.) and 1-methyl-1H-tetrazole-5-thiol (0.023 g, 0.25 mmol, 1.25 eq.) in the presence of TEA (0.080 mL, 0.60 mmol, 3 eq.) as the base in dry ACN (4 mL) was heated at 130 °C for 2 h under microwave irradiations. HPLC-MS analysis revealed still the presence of some starting material left. After cooling, the solvent was evaporated to dryness, the resulting residue was rinsed wit AcOEt and the organic phase was washed with H ₂ O and brine, dried over Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (75/25 to 6/4) to afford the title compound as a white solid (0.020 g, 0.05 mmol, 24% yield, 96% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.07 (s, 1H) 8.42 (d, J = 1.83 Hz, 1H) 7.96 (d, J = 8.54 Hz, 2H) 7.92 (dd, J = 8.39, 1.83 Hz, 1H) 7.79 (d, J = 8.54 Hz, 2H) 7.14-7.20 (m, 1H) 4.03 (s, 3H) HRMS (ESI) calcd for C ₁₇ H ₁₁ F ₃ N ₆ OS [M + H] ⁺ 405.0740, found 405.0750 Example 183: 5-nitro-2-[(1-phenyl-1H-tetrazol-5-yl)sulfanyl]-N-[4- (trifluoromethyl)phenyl]benzamide

A solution of 2-fluoro-5-nitro-N-[4-(trifluoromethyl)phenyl]benzamide (50 mg, 0.15 mmol, 1 eq.) and the sodium salt of 1-phenyl-1H-tetrazole-5-thiolate (0.061 mg, 0.30 mmol, 2 eq.) in dry ACN (3 mL) was heated at 80 °C until the disappearance of the starting material (8 h). The solvent was evaporated under reduced pressure and the resulting solid was rinsed with AcOEt, the organic layer was washed with H ₂ O and brine, dried over Na ₂ SO ₄ and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a white solid (0.030 g, 0.062 mmol, 41% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.17 (s, 1H) 8.69 (d, J = 2.44 Hz, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 7.91 (d, J = 8.54 Hz, 2H) 7.77 (d, J = 8.69 Hz, 2H) 7.57-7.71 (m, 2H) 7.57-7.62 (m, 3H) 7.46 (d, J = 8.85 Hz, 1H) HRMS (ESI) calcd for C ₂₁ H ₁₃ F ₃ N ₆ O ₃ S [M + H] ⁺ 487.0795, found 487.0806 Example 184: N-[4-(cyclopentyloxy)phenyl]-2-[(1-methyl-1H-tetrazol-5-yl)s ulfanyl]-5- nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.100 g, 0.36 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.191 mL, 1.08 mmol, 3 eq.), TBTU (0.141 g, 0.44 mmol, 1.2 eq.) and 4-cyclopentyloxyl-phenylamine (0.083 g, 0.47 mmol, 1.3 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated under reduced pressure and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.093 g, 0.21 mmol, 59% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.79 (s, 1H) 8.69 (d, J = 2.44 Hz, 1H) 8.24 (dd, J = 8.85, 2.59 Hz, 1H) 7.61 – 7.66 (m, 2H) 7.15 (d, J = 8.85 Hz, 1H) 6.91 – 6.97 (m, 2H) 4.81 (t, J = 5.72 Hz, 1H) 4.05 (s, 3H) 1.84 – 1.97 (m, 2H) 1.51 – 1.76 (m, 6H) HRMS (ESI) calcd for C ₂₀ H ₂₀ N ₆ O ₄ S [M + H] ⁺ 441.1340, found 441.1346 Example 185: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-(4- propylphenyl)benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-propyl-phenylamine (0.032 mL, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated under reduced pressure and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a pale-yellow solid (0.048 g, 0.12 mmol, 68% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.70 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.66 (d, J = 8.54 Hz, 2H) 7.22 (d, J = 8.39 Hz, 2H) 7.17 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 2.55 (t, J = 7.40 Hz, 2H) 1.53 – 1.66 (m, 2H) 0.90 (t, J = 7.32 Hz, 3H) HRMS (ESI) calcd for C ₁₈ H ₁₈ N ₆ O ₃ S [M + H] ⁺ 399.1234, found 399.1245 Example 186: 2-(1-methy-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-p-tolyl-benza mide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and p-tolyl-amine (0.024 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target product as a yellow solid (0.050 g, 0.135 mmol, 75% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.31 (s, 3H) 4.04 (s, 3H) 7.17 (d, J = 9.00 Hz, 1H) 7.22 (d, J = 8.24 Hz, 2H) 7.64 (d, J = 8.39 Hz, 2H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 8.70 (d, J = 2.59 Hz, 1H) 10.85 (s, 1H) HRMS (ESI) calcd for C ₁₆ H ₁₄ N ₆ O ₃ S [M + H] ⁺ 371.0921, found 371.0921 Example 187: N-(4-tert-butyl-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl )-5-nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-tert-butyl-phenylamine (0.032 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. The combined organic phases were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.050 g, 0.12 mmol, 67% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.87 (s, 1H) 8.69 (d, J = 2.59 Hz, 1H) 8.25 (dd, J =8.92, 2.52 Hz, 1H) 7.67 (d, J = 8.85 Hz, 2H) 7.38-7.46 (m, 2H) 7.17 (d, J = 9.00 Hz, 1H) 4.05 (s, 3H) 1.22-1.33 (m, 9H) HRMS (ESI) calcd for C ₁₉ H ₂₀ N ₆ O ₃ S [M + H] ⁺ 413.1391, found 413.1386 Example 188: N-(4-chloro-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5- nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-chloro-phenylamine (0.028 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.048 g, 0.123 mmol, 68% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.04 (s, 1H) 8.73 (d, J = 2.59 Hz, 1H) 8.26 (dd, J = 8.85, 2.59 Hz, 1H) 7.74-7.81 (m, 2H) 7.44-7.51 (m, 2H) 7.19 (d, J = 8.85 Hz, 1H) 4.04 (s, 3H) HRMS (ESI) calcd for C ₁₅ H ₁₁ N ₆ O ₃ S [M + H] ⁺ 391.0375, found 391.0373 Example 189: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(4-trifluoro methoxy- phenyl)-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-trifluoromethoxy-phenylamine (0.039 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.050 g, 0.11 mmol, 63% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.10 (s, 1H) 8.74 (d, J = 2.59 Hz, 1H) 8.27 (dd, J = 8.92, 2.52 Hz, 1H) 7.83-7.90 (m, 2H) 7.44 (d, J = 8.39 Hz, 2H) 7.20 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₁ F ₃ N ₆ O ₄ S [M + H] ⁺ 441.0588, found 441.0585 Example 190: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(4-phenoxy-p henyl)- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-phenoxy-phenylamine (0.041 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.055 g, 0.123 mmol, 68% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.96 (s, 1H) 8.72 (d, J = 2.59 Hz, 1H) 8.26 (dd, J = 8.85, 2.59 Hz, 1H) 7.74-7.81 (m, 2H) 7.40 (dd, J = 8.69, 7.47 Hz, 2H) 7.18 (d, J = 8.85 Hz, 1H) 7.12- 7.16 (m, 1H) 7.06-7.11 (m, 2H) 6.99-7.05 (m, 2H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₂₁ H ₁₆ N ₆ O ₄ S [M + H] ⁺ 449.1027, found 449.1020 Example 191: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(3-trifluoro methyl-phenyl)- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 3-trifluoromethyl-phenylamine (0.035 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target product as a yellow solid (0.047 g, 0.11 mmol, 61% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.21 (s, 1H) 8.79 (d, J = 2.44 Hz, 1H) 8.28 (dd, J = 8.85, 2.59 Hz, 1H) 8.22 (s, 1H) 8.00 (d, J = 8.54 Hz, 1H) 7.67 (t, J = 8.01 Hz, 1H) 7.55 (d, J = 7.78 Hz, 1H) 7.20 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₁ F ₃ N ₆ O ₃ S [M + H] ⁺ 425.0638, found 425.0644 Example 192: N-(3-chloro-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5- nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 3-chloro-phenylamine (0.041 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.053 g, 0.136 mmol, 75% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.07 (s, 1H) 8.74 (d, J = 2.59 Hz, 1H) 8.27 (dd, J = 8.92, 2.52 Hz, 1H) 7.93 (t, J = 1.98 Hz, 1H) 7.64-7.69 (m, 1H) 7.45 (t, J = 8.08 Hz, 1H) 7.25 (ddd, J = 8.01, 2.06, 0.91 Hz, 1H) 7.20 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₅ H ₁₁ ClN ₆ O ₃ S [M + H] ⁺ 391.0375, found 391.0374 Example 193: N-isoquinolin-1-yl-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-n itro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and isoquinolin-1-ylamine (0.032 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.053 g, 0.13 mmol, 75% yield, 86% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 14.60 (d, J = 3.66 Hz, 1H) 9.22 (d, J = 2.75 Hz, 1H) 8- 94-9.00 (m, 1H) 8.20 (dd, J = 8.85, 2.75 Hz, 1H) 7.98 (d, J = 3.81 Hz, 2H) 7.90 (t, J = 6.33 Hz, 1H) 7.84 (dt, J = 8.39 Hz, 4.04 Hz, 1H) 7.46 (d, J = 6.86 Hz, 1H) 6.83 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₈ H ₁₃ N ₇ O ₃ S [M + H] ⁺ 408.0874, found 408.0875 Example 194: N-isoquinolin-5-yl-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-n itro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and isoquinolin-5-ylamine (0.032 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.055 g, 0.135 mmol, 73% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.16 (s, 1H) 9.40 (s, 1H) 8.96 (s, 1H) 8.58 (d, J = 6.10 Hz, 1H) 8.30 (dd, J = 8.92, 2.52 Hz, 1H) 8.12 (d, J = 8.24 Hz, 1H) 8.02 (d, J = 7.47 Hz, 1H) 7.99 (d, J = 5.95 Hz, 1H) 7.78 (t, J = 7.85 Hz, 1H) 7.19 (d, J = 8.85 Hz, 1H) 4.06 (s, 3H) HRMS (ESI) calcd for C ₁₈ H ₁₃ N ₇ O ₃ S [M + H] ⁺ 408.0874, found 408.0882 Example 195: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-pyridin-3-yl -benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and pyridine-3-ylamine (0.021 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target product as a yellow solid (0.048 g, 0.134 mmol, 75% yield, 100% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.12 (s, 1H) 8.91 (d, J = 2.29 Hz, 1H) 8.78 (d, J = 2.59 Hz, 1H) 8.39 (dd, J = 4.73, 1.53 Hz, 1H) 8.28 (dd, J = 8.85, 2.59 Hz, 1H) 8.13-8.22 (m, 1H) 7.46 (dd, J = 8.01, 4.65 Hz, 1H) 7.19 (d, J = 9.00 Hz, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₄ H ₁₁ N ₇ O ₃ S [M + H] ⁺ 358.0717, found 358.0715 Example 196: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-quinolin-3-y l-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and isoquinolin-5-ylamine (0.032 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.055 g, 0.135 mmol, 73% yield, 95% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.38 (s, 1H) 9.11 (d, J = 2.59, 1H) 8.87 (dd, J = 6.33, 2.36 Hz, 2H) 8.30 (dd, J = 8.92, 2.52 Hz, 1H) 8.00- 8.07 (m, 2H) 7.72 (ddd, J = 8.35, 6.90, 1.37 Hz, 1H) 7.63 ( td, J = 7.47, 1.22 Hz, 1H) 7.21 (d, J = 8.85 Hz, 1H) 4.06 (s, 3H) HRMS (ESI) calcd for C ₁₈ H ₁₃ N ₇ O ₃ S [M + H] ⁺ 408.0874, found 408.0884 Example 197: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-m-tolyl-benz amide O O To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and m-tolylamine (0.024 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.045 g, 0.12 mmol, 68% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.85 (s, 1H) 8.70 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.85, 2.59 Hz, 1H) 7.61 (s, 1H) 7.54 (d, J = 8.24 Hz, 1H) 7.29 (t, J = 7.78 Hz, 1H) 7.18 (d, J = 8.85 Hz, 1H) 7.01 (d, J = 7.63 Hz, 1H) 4.05 (s, 3H) 2.34 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₄ N ₆ O ₃ S [M + H] ⁺ 371.0921, found 371.0918 Example 198: N-(4-difluoromethoxy-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsul fanyl)-5- nitro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-difluoromethoxy-phenylamine (0.035 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitroge. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target product as a yellow solid (0.050 g, 0.12 mmol, 66% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.05 (s, 3 H) 7.04 – 7.40 (m, 4 H) 7.73 - 7.80 (m, 2 H) 8.26 (dd, J=8.85, 2.59 Hz, 1 H) 8.72 (d, J=2.59 Hz, 1 H) 11.00 (s, 1 H) HRMS (ESI) calcd for C ₁₆ H ₁₂ F ₂ N ₆ O ₄ S [M + H] ⁺ 423.0682, found 423.0670 Example 199: N-(4-chloro-phenyl)-N-methyl-2-(1-methyl-1H-tetrazol-5-ylsul fanyl)-5- nitro-benzamide) O O To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-chloro-phenyl-methyl-amine (0.031 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.050 g, 0.124 mmol, 70% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 8.17 (br. s., 1 H) 8.07 (d, J=8.18 Hz, 1 H) 7.39 (q, J=8.64 Hz, 5 H) 4.06 (s, 3 H) 3.40 (s, 3 H) HRMS (ESI) calcd for C ₁₆ H ₁₃ ClN ₆ O ₃ S [M + H] ⁺ 405.0531, found 405.0538 Example 200: N-(1H-indol-6-yl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-ni tro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 1H-indol-6-ylamine (0.035 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target product as a yellow solid (0.050 g, 0.127 mmol, 70% yield, 97% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.14 (s, 1H) 10.85 (s, 1H) 8.72 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.85, 2.59 Hz, 1H) 8.07 (s, 1H) 7.53 (d, J = 8.39 Hz, 1H) 7.33-7.36 (m, 1H) 7.26 (dd, J = 8.391.83 Hz, 1H) 7.18 (d, J = 8.85 Hz, 1H) 6.42 (t, J = 1.98 Hz, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₇ H ₁₃ N ₇ O ₃ S [M + H] ⁺ 396.0874, found 396.0887 Example 201: 2-(1-Methy-1H-tetrazol-5-ylsulfanyl)-N-naphthalen-1-yl-5-nit ro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and naphthalene-1-ylamine (0.031 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.045 g, 0.11 mmol, 61% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.08 (s, 1H) 8.95 (d, J = 1.52 Hz, 1H) 8.30 (dd, J = 8.92, 2.36 Hz, 1H) 8.09-8.14 (m, 1H) 7-99- 8.04 (m, 1H) 7.92 (d, J = 8.24 Hz, 1H) 7.72 (d, J = 7.32 Hz, 1H) 7.57-7.63 (m, 3H) 7.18 (d, J = 8.85 Hz, 1H) 4.07 (s, 3H) HRMS (ESI) calcd for C ₁₉ H ₁₄ N ₆ O ₃ S [M + H] ⁺ 407.0921, found 407.0924 Example 202: N-(4-ethoxy-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5- nitro- benzamide) To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-ethoxy-phenylamine (0.030 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a yellow solid (0.052 g, 0.13 mmol, 72% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.80 (s, 1H) 8.69 (d, J = 2.44Hz, 1H) 8.24 (dd, J = 8.92, 2.52 Hz, 1H) 7-62-7.68 (m, 2H) 7.15 (d, J = 8.85 Hz, 1H) 6.94-6.99 (m, 2H) 4.04 (s, 3H) 3.99- 4.04 (m, 2H) 1.33 (t, J = 6.94 Hz, 3H) HRMS (ESI) calcd for C ₁₇ H ₁₆ N ₆ O ₄ S [M + H] ⁺ 401.1027, found 401.1029 Example 203: N-(4-cyclohexyl-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl )-5- nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-cyclohexyl-phenylamine (0.039 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a white solid (0.058 g, 0.132 mmol, 73% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.85 (s, 1H) 8.69 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.65 (d, J = 8.54 Hz, 2H) 7.25 (d, J = 8.54 Hz, 2H) 7.17 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 2.50 (m, 1H) 1.79 (d, J = 11.59 Hz, 4H) 1.67-1.75 (m, 1H) 1.39 (d, J = 9.00 Hz, 4H) 1.18-1.29 (m, 1H) HRMS (ESI) calcd for C ₂₁ H ₂₂ N ₆ O ₃ S [M + H] ⁺ 439.1547, found 439.1551 Example 204: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(3-oxo-indan -5-yl)- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 6-amino-indan-1-one (0.032 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a white solid (0.050 g, 0.12 mmol, 67% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.24 (s, 1H) 8.76 (d, J = 2.59 Hz, 1H) 8.28 (dd, J = 8.85, 2.59 Hz, 1H) 8.08 (s, 1H) 7.71 (d, J = 1.53 Hz, 1H) 7.67-7.70 (m, 1H) 7.23 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 3.10-3.16 (m, 2H) 2.63-2.67 (m, 2H) HRMS (ESI) calcd for C ₁₈ H ₁₄ N ₆ O ₄ S [M + H] ⁺ 411.0870, found 411.0885 Example 205: 2-(1-methy)-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-phenyl-benza mide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and phenylamine (0.020 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a white solid (0.042 g, 0.12 mmol, 66% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.92 (s, 1H) 8.71 (d, J = 2.44 Hz, 1H) 8.26 (dd, J = 8.92, 2.52 Hz, 1H) 7.76 (d, J = 7.63 Hz, 2H) 7.38-7.45 (m, 2H) 7.16-7.21 (m, 2H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₅ H ₁₂ N ₆ O ₃ S [M + H] ⁺ 357.0765, found 357.0774 Example 206: N-[4-(4-methyl-piperazin-1-yl)-phenyl]-2-(1-methyl-1H-tetraz ol-5- ylsulfanyl)-5-nitro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-(4-methyl-piperazin-1-yl)-phenylamine (0.042 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a beige solid (0.060 g, 0.132 mmol, 73% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.73 (s, 1H) 8.68 (d, J = 2.59 Hz, 1H) 8.23 (dd, J = 8.85 2.59 Hz, 1H) 7.59 (d, J = 9.00 Hz, 2H) 7.14 (d, J = 8.85 Hz, 1H) 6.97 (d, J = 9.15 Hz, 2H) 4.04 (s, 3H) 3.09-3.15 (m, 4H) 2.43-2.47 (m, 5H) 2.22 (s, 3H) HRMS (ESI) calcd for C ₂₀ H ₂₂ N ₈ O ₃ S [M + H] ⁺ 455.1609, found 455.1604 Example 207: N-(4-imidazol-1-yl-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfa nyl)-5-nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-imidazol-1-yl-phenylamine (0.035 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a pale yellow solid (0.054 g, 0.128 mmol, 71% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.07 (s, 1H) 8.75 (d, J = 2.44 Hz, 1H) 8.26-8.29 (m, 1H) 8.26 (s, 1H) 7.88 (d, J = 8.85 Hz, 2H) 7.75 (s, 1H) 7.66-7.73 (m, 2H) 7.20 (d, J = 8.85 Hz, 1H) 7.12 (s, 1H) 4.06 (s, 3H) HRMS (ESI) calcd for C ₁₈ H ₁₄ N ₈ O ₃ S [M + H] ⁺ 423.0983, found 423.0984 Example 208: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(4-piperidin -yl-phenyl)- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-piperidin-1-yl-phenylamine (0.039 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a white solid (0.057 g, 0.13 mmol, 72% yield, 99% purity) 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.71 (s, 1H) 8.68 (d, J = 2.59 Hz, 1H) 8.23 (dd, J = 8.92, 2.52 Hz, 1H) 7.55-7.61 (m, 2H) 7.14 (d, J = 8.85 Hz, 1H) 6.96 (d, J = 9.00 Hz, 2H) 4.04 (s, 3H) 3.09-3.15 (m, 4H) 1.59-1.67 (m, 4H) 1.47-1.57 (m, 2H) HRMS (ESI) calcd for C ₂₀ H ₂₁ N ₇ O ₃ S [M + H] ⁺ 440.1500, found 440.1503 Example 209: N-[4-(ethyl-isopropyl-amino)-phenyl]-2-(1-methyl-1H-tetrazol -5- ylsulfanyl)-5-nitro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and N-ethyl-N-isopropyl-benzene-1,4-diamine (0.039 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a white solid (0.050 g, 0.11 mmol, 63% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.64 (s, 1H) 8.67 (d, J = 2.59 Hz, 1H) 8.22 (dd, J = 8.92, 2.52 Hz, 1H) 7.53 (d, J = 9.15 Hz, 2H), 7.12 (d, J = 8.85 Hz, 1H) 6.76 (d, J = 9.15 Hz, 2H) 4.05 (s, 3H) 4.01 (d, J = 6.71 Hz, 1H) 3.22 (q, J = 6.96 Hz, 2H) 1.14 (d, J = 6.56 Hz, 6H) 1.07-1.11 (m, 3H) HRMS (ESI) calcd for C ₂₀ H ₂₃ N ₇ O ₃ S [M + H] ⁺ 442.1656, found 442.1653 Example 210: 2-(1-methy-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(4-phenylamin o-phenyl)- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and N-phenylbenzene-1,4-diamine (0.039 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a white solid (0.050 g, 0.11 mmol, 63% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.82 (s, 1H) 8.73 (d, J = 2.44 Hz, 1H) 8.28 ( dd, J = 8.85, 2.59 Hz, 1H) 8.22 (s, 1H) 7.66 (d, J = 8.85 Hz, 2H) 7.23-7.29 (m, 2H) 7.18 (d, J = 8.85 Hz, 1H) 7.13-7.17 (m, 2H) 7.10 (d, J = 7.63 Hz, 2H) 6.84 (t, J = 7.24 Hz, 1H) 4.06-4.10 (m, 3H) HRMS (ESI) calcd for C ₁₂ H ₁₇ N ₇ O ₃ S [M + H] ⁺ 448.1187, found 448.1198 Example 211: N-(9H-fluoren-2-yl)-2-(1-methy-1H-tetrazol-5-ylsulfanyl)-5-n itro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 9H-fluoren-2-yl)-methyl-amine (0.043 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a pale-yellow solid (0.063 g, 0.14 mmol, 79% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.02 (s, 1H) 8.75 (d, J = 2.44 Hz, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 8.10 (s, 1H) 7.93 (d, J = 8.24 Hz, 1H) 7.88 (d, J = 7.47 Hz, 1H) 7.72 (dd, J = 8.31, 1.60 Hz, 1H) 7.59 (d, J = 7.47 Hz, 1H) 7.36-7.41 (m, 1H) 7.27-7.33 (m, 1H) 7.20 (d, J = 8.85 Hz, 1H) 4.06 (s, 3H) 3.98 (s, 2H) HRMS (ESI) calcd for C ₂₂ H ₁₆ N ₆ O ₃ S [M + H] ⁺ 445.1078, found 445.1082 Example 212: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(6-trifluoro methoxy- benzothiazol-2-yl)-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 6-trifluoromethoxy-benzothiazol-2-ylamine (0.051 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a beige solid (0.071 g, 0.143 mmol, 80% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.07 (s, 3 H) 7.11 (br. s., 1 H) 7.50 (dd, J=8.60, 1.50 Hz, 1 H) 7.85 (br. s., 1 H) 8.19 (br. s., 1 H) 8.28 (dd, J=8.85, 1.68 Hz, 1 H) 9.03 (br. s., 1 H) 13.72 (br. s., 1 H) HRMS (ESI) calcd for C ₁₇ H ₁₀ F ₃ N ₇ O ₄ S2 [M + H] ⁺ 498.0261, found 498.0254 Example 213: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(5,6,7,8-tet rahydro-4H- cycloheptathiazol-2-yl)benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 5,6,7,8-tetrahydro-4H-cycloheptathiazol-2-ylamine (0.037 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a beige solid (0.060 g, 0.139 mmol, 78% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.58 - 1.74 (m, 4 H) 1.81 (br. s., 2 H) 2.70 (br. s., 2 H) 2.76 (br. s., 2 H) 4.04 (s, 3 H) 6.80 (br. s., 1 H) 8.18 (d, J=7.17 Hz, 1 H) 9.06 (br. s., 1 H) 13.26 (br. s., 1 H) HRMS (ESI) calcd for C ₁₇ H ₁₇ N ₇ O ₃ S ₂ [M + H] ⁺ 432.0907, found 432.0909 Example 214: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(3-trifluoro methoxy- phenyl)-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 3-trifluoromethoxy-phenylamine (0.039 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature under nitrogen. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a white solid (0.055 g, 0.125 mmol, 70% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.17 (s, 1H) 8.76 (d, J = 2.59 Hz, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 7.89 (s, 1H) 7.73 (ddd, J = 8.24, 1.70, 0.60, Hz, 1H) 7.55 (t, J = 8.16 Hz, 1H) 7.20 (d, J = 8.85 Hz, 1H) 7.19 (br. d J = 8.20 Hz, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₁ F ₃ N ₆ O ₄ S [M + H] ⁺ 441.0588, found 441.0586 Example 215: N-(5-methyl-4,5,6,7-tetrahydro-thiazolo[5,4-c]pyridin-2-yl)- 2-(1-methyl-1H- tetrazol-5-ylsulfanyl)-5-nitro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 5-methyl-4,5,6,7-tetrahydro-thiazolo[5,4-c]pyridine-2-ylamin e (0.037 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography eluting on silica gel with hexane/cOEt (8/2) to afford the title compound as a white solid (0.060 g, 0.139 mmol, 77% yiled, 90% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 13.10 (br s, 1H) 8.99 (d, J = 2.29 Hz, 1H) 8.19 (dd, J = 8.85, 2.44 Hz, 1H) 6.92 (d, J = 8.08 Hz, 1H) 4.04 (s, 3H) 3.57 (br s, 2H) 2.80 (br s, 2H) 2.70 (t, J = 4.00, 2H) 2.44 (br s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₆ N ₈ O ₃ S ₂ [M + H] ⁺ 433.0860, found 433.0854 Example 216: N-benzothiazol-2-yl-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5- nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and benzothiazol-2-ylamine (0.038 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at 50 °C, cooled to room temperature and the solvent was evaporated under vacuum. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a pale-yellow solid (0.008 g, 0.019 mmol, 11% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 8.91 - 9.36 (m, 1 H) 8.20 - 8.33 (m, 1 H) 8.26 (d, J=5.34 Hz, 1 H) 7.97 - 8.14 (m, 1 H) 7.63 - 7.86 (m, 1 H) 7.49 - 7.56 (m, 1 H) 7.39 (t, J=8.01 Hz, 1 H) 6.80 - 7.27 (m, 1 H) 4.06 (s, 3 H) HRMS (ESI) calcd for C ₁₆ H ₁₁ N ₇ O ₃ S ₂ [M + H] ⁺ 414.0438, found 414.0446 Example 217: N-(5,6-difluoro-benzothiaol-2-yl)-2-(1-methyl-1H-tetrazol-5- ylsulfanyl)-5- nitro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 5,6-difluoro-benzothiazol-2-ylamine (0.038 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at 50 °C. The reaction mixture was then cooled to room temperature and the solvent was evaporated under reduced pressure. The resulting crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target compound as a beige solid (0.005 g, 0.011 mmol, 7% yield, 94% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 13.72 (br. s., 1H) 9.01 (d, J = 2.44 Hz, 1H) 8.24 (dd, J = 8.62, 1.91 Hz, 1H) 8.13 (t, J = 8.77 Hz, 1H) 7.80 (dd, J = 10.29, 8.01 Hz, 1H) 7.02 (br s, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₉ F ₂ N ₇ O ₃ S ₂ [M + H] ⁺ 450.0249, found 450.0250 Example 218: N-[4-(4-methyl-piperidin-1-yl)-phenyl]-2-(1-methyl-1H-tetraz ol-5- ylsulfanyl)-5-nitro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-(4-methyl-piperidin-1-yl)-phenylamine (0.042 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at 50 °C. After cooling to room temperature, the solvent was evaporated and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target compound as a white solid (0.030 g, 0.066 mmol, 40% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.71 (s, 1H) 8.68 (d, J = 2.44 Hz, 1H) 8.23 (dd, J = 8.85, 2.59 Hz, 1H) 7.58 (d, J = 9.15 Hz, 2H) 7.14 (d, J= 8.85 Hz, 1H) 6.96 (d, J = 9.00 Hz, 2H) 4.04 (s, 3H) 3.65 (d, J = 12.35 Hz, 2H) 2.63 (td, J = 12.20, 2.29 Hz, 2H) 1.69 (d, J = 11.44 Hz, 2H) 1.42-1.57 (m, 1H) 1.15-1.30 (m, 2H) 0.94 (d, J= 6.56 Hz, 3H) HRMS (ESI) calcd for C ₁₂ H ₂₃ N ₇ O ₃ S [M + H] ⁺ 454.1656, found 454.1658 Example 219: N-(4-azepan-1-yl-phenyl)-2-(1-methyl)-1H-tetrazol-5-ylsulfan yl)-5-nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-azepan-1-yl-phenylamine (0.042 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at 50 °C. After cooling to room temperature, the solvent was concentrated to dryness and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a solid (0.036 g, 0.079 mmol, 45% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.61 (s, 1H) 8.66 (d, J = 2.59 Hz, 1H) 8.22 (dd, J = 8.85, 2.59 Hz, 1H) 7.52 (d, J = 9.00 Hz, 2H) 7.12 (d, J = 8.85 Hz, 1H) 6.70 (d, J = 9.15 Hz, 2H) 4.05 (s, 3H) 3.46 (t, J = 6.02 Hz, 4H) 1.73 (br s, 4H) 1.36-1.54 (m, 4H) HRMS (ESI) calcd for C ₂₁ H ₂₃ N ₇ O ₃ S [M + H] ⁺ 454.1656, found 454.1655 Example 220: N-[4-(4,4-difluoro-piperidin-1-yl)-phenyl]-2-(1-methyl-1H-te trazol-5- ylsulfanyl)-5-nitro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.100 g, 0.36 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.1 mL, 0.54 mmol, 1.5 eq.), TBTU (0.142 g, 0.44 mmol, 1.2 eq.) and 4-(4,4-difluoro-piperidin-1-yl)-phenylamine (0.093 g, 0.44 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at 50 °C. After cooling to room temperature, the reaction mixture was concentrated under reduced pressure and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a solid (0.085 g, 0.179 mmol, 50% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.76 (s, 1H) 8.68 (d, J = 2.44 Hz, 1H) 8.24 (dd, J = 8.85, 2.59 Hz, 1H) 7.62 (d, J = 9.15 Hz, 2H) 7.14 (d, J = 8.85 Hz, 1H) 7.05 (d, J = 9.15 Hz, 2H) 4.05 (s, 3H) 3.25 – 3.47 (m, 4H) 1.93-2.15 (m, 4H) HRMS (ESI) calcd for C ₂₀ H ₁₉ F ₂ N ₇ O ₃ S [M + H] ⁺ 476.1311, found 476.1311 Example 221: N-[4-(3-aza-bicyclo[3,2,2]non-3-yl-phenyl]-2-(1-methyl-1H-te trazol-5- ylsulfanyl)-5-nitro-benzamide

To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-(3-aza-bicyclo[3,2,2]non-3-yl)-phenylamine (0.048 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated under reduced pressure and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a white solid (0.036 g, 0.075 mmol, 44% yield, 94% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.68 (s, 1H) 8.68 (d, J = 2.44 Hz, 1H) 8.23 (dd, J = 8.85, 2.59 Hz, 1H) 7.55 (d, J = 9.15 Hz, 2H) 7.13 (d, J = 8.85 Hz, 1H) 6.92 (d, J = 9.15 Hz, 2H) 4.05 (s, 3H) 3.37 (d, J = 4.12 Hz, 4H) 2.09 (d, J = 13.42 Hz, 2H) 1.58-1.76 (m, 8H) HRMS (ESI) calcd for C ₂₃ H ₂₅ N ₇ O ₃ S [M + H] ⁺ 480.1813, found 480.1821 Example 222: N-(4-ethynyl-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5 -nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-ethynyl-phenylamine (0.048 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. After cooling to room temperature, the solvent was evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a white solid (0.009 g, 0.024 mmol, 15% yield, 99% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.07 (s, 1H) 8.73 (d, J = 2.59 Hz, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 7.78 (d, J = 8.69 Hz, 2H) 7.51-7.56 (m, 2H) 7.20 (d, J = 8.85 Hz, 1H) 4.17 (s, 1H) 4.04 (s, 3H) HRMS (ESI) calcd for C ₁₇ H ₁₂ N ₆ O ₃ S [M + H] ⁺ 381.0765, found 381.0775 Example 223: N-[4-(bicyclo[2,2,1]hept-2-ylamino)-phenyl]-2-(1-methyl-1H-t etrazol-5- ylsulfanyl)-5-nitro-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and N-bicyclo[2,2,1]hept-2-yl-benzene-1,4-diamine (0.045 g, 0.22 mmol. 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was then evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target product as a solid (0.005 g, 0.011 mmol, 6% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.56 (s, 1 H) 8.65 (d, J=2.59 Hz, 1 H) 8.22 (dd, J=8.92, 2.52 Hz, 1 H) 7.42 (d, J=9.00 Hz, 2 H) 7.11 (d, J=8.85 Hz, 1 H) 6.61 (d, J=9.00 Hz, 2 H) 5.70 (d, J=6.41 Hz, 1 H) 4.04 (s, 3 H) 3.54 - 3.65 (m, 1 H) 2.46 (t, J=3.51 Hz, 1 H) 2.17 (t, J=3.74 Hz, 1 H) 2.02 (br. s., 1 H) 1.61 - 1.71 (m, 1 H) 1.40 - 1.52 (m, 2 H) 1.19 - 1.34 (m, 3 H) 0.86 (dt, J=12.09, 3.79 Hz, 1 H) HRMS (ESI) calcd for C ₂₂ H ₂₃ N ₇ O ₃ S [M + H] ⁺ 466.1656, found 466.1667 Example 224: N-(4-hydroxy-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5 -nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-amino-phenol (0.024 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was then evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (1/1) to afford as a white solid (0.032 g, 0.086 mmol, 50% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.71 (s, 1H) 9.40 (s, 1H) 8.68 (d, J = 2.59 Hz, 1H) 8.23 (dd, J = 8.85, 2.59 Hz, 1H) 7.51-7.57 (m, 2H) 7.14 (d, J = 8.85 Hz, 1H) 6.76-6.82 (m, 2H) 4.04 (s, 3H) HRMS (ESI) calcd for C ₁₅ H ₁₂ N ₆ O ₄ S [M + H] ⁺ 373.0714, found 373.0711 Example 225: N-(4-isopropoxy-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl )-5-nitro- benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-isopropoxy-phenylamine (0.036 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solution was then diluited with AcOEt and water. The aqueous phase was extracted with AcOEt. The organic extracts were combined and washed with saturated aqueous solution of NaHCO ₃ , 1N aqueous HCl and brine and finally dried over Na ₂ SO ₄ . The solvent was evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a solid (0.043 g, 0.10 mmol, 58% yield, 100% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.79 (s, 1H) 8.69 (d, J = 2.59 Hz, 1H) 8.24 (dd, J = 8.85, 2.59 Hz, 1H) 7.64 (d, J = 9.00 Hz, 2H) 7.15 (d, J = 8.85 Hz, 1H) 6.96 (d, J = 9.00 Hz, 2H) 4.54- 4.64 (m, 1H) 4.05 (s, 3H) 1.27 (d, J = 6.10 Hz, 6H) HRMS (ESI) calcd for C ₁₈ H ₁₈ N ₆ O ₄ S [M + H] ⁺ 415.1183, found 415.1190 Example 226: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(4-prop-2-yn -yloxy- phenyl)-benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.100 g, 0.36 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.1 mL, 0.54 mmol, 1.5 eq.), TBTU (0.142 g, 0.44 mmol, 1.2 eq.) and 4-prop-2-ynyloxy-phenylamine (0.106 g, 0.72 mmol, 2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The mixture was then diluted with AcOEt and H ₂ O. The aqueous phase was extracted with AcOEt. The organic extracts were combined and washed with saturated aqueous solution of NaHCO ₃ , 1N aqueous HCl and brine and finally dried over Na ₂ SO ₄ . The solvent was evaporated under vacuum and the the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (6/4) to afford the target compound as a solid (0.063 g, 0.153 mmol, 45% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.84 (s, 1H) 8.70 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.63-7.70 (m, 2H) 7.16 (d, J = 9.00 Hz, 1H) 7.00-7.07 (m, 2H) 4.81 (d, J= 2.44 Hz, 2H) 4.05 (s, 3H) 3.58 (t, J = 2.36 Hz, 1H) HRMS (ESI) calcd for C ₁₈ H ₁₄ N ₆ O ₄ S [M + H] ⁺ 411.0870, found 411.0877 Example 227: N-[4-(4,4-dimethylpiperidin-1-yl)phenyl]-2-[(1-methyl-1H-tet razol-5- yl)sulfanyl]-5-nitrobenzamide

To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-(4,4-dimethyl-piperidin-1-yl)-phenylamine (0.045 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture for stirred for 3 h at room temperature. The reaction mixture was then concentrated under reduced pressure and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a beige solid (0.05 g, 0.11 mmol, 55% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.71 (s, 1H) 8.68 (d, J = 2.44 Hz, 1H) 8.23 (dd, J = 8.85, 2.44 Hz, 1H) 7.58 (d, J = 9.15 Hz, 2H) 7.14 (d, J = 8.85 Hz, 1H) 6.97 (d, J = 9.15 Hz, 2H) 4.05 (s, 3H) 3.07-3.20 (m, 4H) 1.37-1.51 (m, 4H) 0.96 (s, 6H) HRMS (ESI) calcd for C ₂₂ H ₂₅ N ₇ O ₃ S [M + H] ⁺ 468.1813, found 468.1806 Example 228: N-(biphenyl-4-yl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5- nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and biphenyl-4-ylamine (0.038 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was then evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target compound as a white solid (0.035 g, 0.081 mmol, 45% yield, 99% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.03 (s, 1H) 8.74 (d, J = 2.44 Hz, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 7.86 (d, J = 8.54 Hz, 2H) 7.74 (d, J = 8.69 Hz, 2H) 7.68 – 7.71 (m, 2H) 7.45 -7.50 (m, 2H) 7.34 – 7.38 (m, 1H) 7.20 (d, J = 9.00 Hz, 1H) 4.06 (s, 3H) HRMS (ESI) calcd for C ₂₁ H ₁₆ N ₆ O ₃ S [M + H] ⁺ 433.1078, found 433.1083 Example 229: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(pyridi n-3- yl)phenyl]benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-pyridin-3-yl-phenylamine (0.040 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was then evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford a solid (0.030 g, 0.069 mmol, 40% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.06 (s, 3 H) 7.21 (d, J=9.00 Hz, 1 H) 7.47 - 7.52 (m, 1 H) 7.82 (d, J=8.69 Hz, 2 H) 7.88 - 7.92 (m, 2 H) 8.11 (dt, J=8.24, 1.83 Hz, 1 H) 8.28 (dd, J=8.85, 2.59 Hz, 1 H) 8.57 (dd, J=4.73, 1.37 Hz, 1 H) 8.75 (d, J=2.44 Hz, 1 H) 8.93 (d, J=1.98 Hz, 1 H) 11.07 (s, 1 H) HRMS (ESI) calcd for C ₂₀ H ₁₅ N ₇ O ₃ S [M + H] ⁺ 434.1030, found 434.1031 Example 230: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(pyridi n-3- yloxy)phenyl]benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-pyridin-3-yloxy-phenylamine (0.041 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was then evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford a pale-yellow solid (0.054 g, 0.12 mmol, 67% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.02 (s, 1H) 8.76 (d, J = 2.59 Hz, 1H) 8.43 (s, 1H) 8.40 (t, J = 2.97 Hz, 1H) 8.29 (dd, J = 8.85, 2.59 Hz, 1H) 7.84 (d, J = 9.00 Hz, 2H) 7.45-7.48 (m, 2H) 7.15-7.23 (m, 3H) 4.09 (s, 3H) HRMS (ESI) calcd for C ₂₀ H ₁₅ N ₇ O ₄ S [M + H] ⁺ 450.0979, found 450.0972 Example 231: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(piperi din-1- ylmethyl)phenyl]benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-piperidin-1-ylmethyl-phenylamine (0.042 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was then evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford a beige solid (0.064 g, 0.14 mmol, 40% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.91 (br. s., 1H) 8.71 (d, J = 2.44 Hz, 1H) 8.26 (dd, J = 8.85, 2.44 Hz, 1H) 7.71 (d, J = 7.17 Hz, 2H) 7.33 (br. s., 2H) 7.18 (d, J = 9.00 Hz, 1H) 4.01- 4.07 (m, 3H) 3.42 (br. s., 2H) 2.14-2.44 (m, 4H) 1.30-1.61 (m, 6H) HRMS (ESI) calcd for C ₂₁ H ₂₃ N ₇ O ₃ S [M + H] ⁺ 454.1656, found 454.1661 Example 232: N-[4-(1-cyanocyclopentyl)phenyl]-2-[(1-methyl-1H-tetrazol-5- yl)sulfanyl]- 5-nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 1-(4-amino-phenyl)-cyclopentanecarbonitrile (0.041 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was then evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford a solid (0.035 g, 0.078 mmol, 45% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.01 (s, 1H) 8.72 (d, J = 2.59 Hz, 1H) 8.26 (dd, J = 8.85, 2.44 Hz, 1H) 7.80 (d, J = 8.69 Hz, 2H) 7.52-7.57 (m, 2H) 7.18 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 2.39-2.46 (m, 2H) 2.04-2.15 (m, 2H) 1.82-1.97 (m, 4H) HRMS (ESI) calcd for C ₂₁ H ₁₉ N ₇ O ₃ S [M + H] ⁺ 450.1343, found 450.1346 Example 233: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(piperi din-3- yl)phenyl]benzamide hydrochloride Step 1: tert-butyl 3-[4-[[2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro- benzoyl]amino]phenyl]piperidine-1-carboxylate To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and tert-butyl 3-(4-aminophenyl)piperidine-1-carboxylate (0.061 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was then evaporated under vacuum and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford a solid (0.090 g, 0.167 mmol, 92% yield, 100% purity). HPLC-MS Method A: (M+H) 540.50; Rt:5.50 min Step 2: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(piperi din-3- yl)phenyl]benzamide hydrochloride To a suspension of tert-butyl 3-[4-[[2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro- benzoyl]amino]phenyl]piperidine-1-carboxylate (0.09 g, 0.17 mmol, 1 eq.) in MeOH (0.5 mL) 4M HCl in 1,4-dioxane (0.175 mL, 0.70 mmol, 4 eq.) was added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated to dryness and the resulting solid was collected by filtration and washed with Et ₂ O to give the target compound as a pale- yellow solid (0.040 g, 0.091 mmol, 47% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.95 (s, 1H) 8.90 (d, J = 10.98 Hz, 1H) 8.70 (d, J = 2.44 Hz, 1H) 8.62 (d, J = 9.46 Hz, 1H) 8.26 (dd, J = 8.85, 2.44 Hz, 1H) 7.73 (d, J = 8.54 Hz, 1H) 7.33 (d, J = 8.54 Hz, 1H) 7.18 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 3.64-3.75 (m, 1H) 4.05 (s, 3H) 3.64-3.75 (m, 1H) 3.44-3.53 (m, 1H) 2.84-3.08 (m, 2H) 1.90 (d, J = 11.13 Hz, 1H) 1.62-1.84 (m, 1H) HRMS (ESI) calcd for C ₂₀ H ₂₁ N ₇ O ₃ S [M + H] ⁺ 440.1499, found 440.1502 Example 234: 2-[(1-ethyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4- (trifluoromethyl)phenyl]benzamide To a solution of 2-(1-ethyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.045 g, 0.15 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 2 eq.), TBTU (0.071 g, 0.22 mmol, 1.5 eq.) and 4-trifluoromethyl-phenylamine (0.022 mL, 0.18 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. After dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a white solid (0.023 g, 0.053 mmol, 35% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.24 (s, 1H) 8.78 (d, J = 2.59 Hz, 1H) 8.29 (dd, J = 8.92, 2.52 Hz, 1H) 7.98 (d, J = 8.54 Hz, 2H) 7.80 (d, J = 8.85 Hz, 2H) 7.16 (d, J = 8.85 Hz, 1H) 4.43 (q, J = 7.32 Hz, 2H) 1.40 (t, J = 7.32 Hz, 3H) HRMS (ESI) calcd for C ₁₇ H ₁₃ F ₃ N ₆ O ₃ S [M + H] ⁺ 439.0795, found 439.0797 Example 235: N-(4-tert-butoxyphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfan yl]-5- nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-tert-butoxy-phenylamine (0.036 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred at room temperature until the disappearance of the starting material (3 h). The solvent was evaporated under reduced pressure and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.065 g, 0.15 mmol, 84% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.69 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.85, 2.44 Hz, 1H) 7.64-7.69 (m, 2H) 7.17 (d, J = 8.85 Hz, 1H) 6.98-7.04 (m, 2H) 4.04 (s, 3H) 1.30 (s, 9H) HRMS (ESI) calcd for C ₁₉ H ₂₀ N ₆ O ₄ S [M + H] ⁺ 429.1340, found 429.1339 Example 236: N-(4-chlorophenyl)-5-nitro-2-[(1-phenyl-1H-tetrazol-5- yl)sulfanyl]benzamide A solution of N-(4-chloro-phenyl)-2-fluoro-5-nitro-benzamide (250 mg, 0.85 mmol, 1 eq.) and the sodium salt of the 1-phenyl-1H-tetrazole-5-thiol (200 mg, 1.00 mmol, 1.18 eq.) in dry ACN (5 mL) was heated overnight at 80 °C under nitrogen. The reaction mixture was cooled to room temperature and the solvent was evaporated under reduced pressure. The resulting residue was purified with flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford a pale-yellow solid (0.075 g, 0.165 mmol, 20% yield, 90% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.97 (s, 1H) 8.66 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.85, 2.44 Hz, 1H) 7.72 (d, J = 8.85 Hz, 2H) 7.67 – 7.69 (m, 2H) 7.56 – 7.64 (m, 3H) 7.41 – 7.48 (m, 3H) HRMS (ESI) calcd for C ₂₀ H ₁₃ ClN ₆ O ₃ S [M + H] ⁺ 453.0531, found 453.0531 Example 237: N-(2’’-methylbiphenyl-4-yl)-2-[(1-methyl-1H-tetrazol-5-y l)sulfanyl]-5- nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 2-methyl-biphenyl-4-ylamine (0.060 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated in vacuo and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.053 g, 0.12 mmol, 66% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.02 (s, 1H) 8.74 (d, J = 2.44 Hz, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 7.83 (d, J = 8.54 Hz, 2H) 7.37 – 7.42 (m, 2H) 7.22 – 7.34 (m, 4H) 7.18 – 7.22 (m, 1H) 4.06 (s, 3H) 2.27 (s, 3H) HRMS (ESI) calcd for C ₂₂ H ₁₈ N ₆ O ₃ S [M + H] ⁺ 447.1234, found 47.1235 Example 238: N-(4’’-tert-butylbiphenyl-4-yl)-2-[(1-methyl-1H-tetrazol -5-yl)sulfanyl]-5- nitrobenzamide

To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-tert-butyl-biphenyl-4-ylamine (0.055 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated under vacuum and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.051 g, 0.105 mmol, 58% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.01 (s, 1H) 8.73 (d, J = 2.59 Hz, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 7.84 (d, J = 8.69 Hz, 2H) 7.71 (d, J = 8.69 Hz, 2H) 7.59 – 7.65 (m, 2H) 7.48 (d, J = 8.39 Hz, 2H) 7.20 (d, J = 8.85 Hz, 1H) 4.06 (s, 3H) 1.32 (s, 9H) HRMS (ESI) calcd for C ₂₅ H ₂₄ N ₆ O ₃ S [M + H] ⁺ 489.1704, found 489.1703 Example 239: N-(4-cyclobutylphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfany l]-5- nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-cyclobutyl-phenylamine (0.033 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated under vacuum and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target compound as a white solid (0.053 g, 0.129 mmol, 72% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.87 (s, 1H) 8.70 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.67 (d, J = 8.54 Hz, 2H) 7.27 (d, J = 8.54 Hz, 2H) 7.17 (d, J = 9.00 Hz, 1H) 4.05 (s, 3H) 3.52 (quin, J = 8.69 Hz, 1H) 2.24 – 2.34 (m, 2H) 2.03 – 2.16 (m, 2H) 1.91 – 2.03 (m, 1H) 1.76 – 1.88 (m, 1H) HRMS (ESI) calcd for C ₁₉ H ₁₈ N ₆ O ₃ S [M + H] ⁺ 411.1234, found 411.1243 Example 240: N-(4-cyclohexylphenyl)-2-[(1-ethyl-1H-tetrazol-5-yl)sulfanyl ]-5- nitrobenzamide To a solution of 2-(1-ethyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.100 g, 0.34 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.100 mL, 0.54 mmol, 1.6 eq.), TBTU (0.142 g, 0.44 mmol, 1.3 eq.) and 4-cyclohexyl-phenylamine (0.105 g, 0.60 mmol, 1.8 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated under vacuum and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target compound as a white solid (0.107 g, 0.237 mmol, 70% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.69 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.65 (d, J = 8.54 Hz, 2H) 7.25 (d, J = 8.69 Hz, 2H) 7.11 (d, J = 9.00 Hz, 1H) 4.42 (q, J = 7.32 Hz, 2H) 1.79 (d, J = 11.29 Hz, 4H) 1.71 (d, J = 12.66 Hz, 1H) 1.40 (t, J = 7.30 Hz, 3H) 1.30-1.48 (m, 5H) 1.15 – 1.30 (m, 1H) HRMS (ESI) calcd for C ₂₅ H ₂₄ N ₆ O ₃ S [M + H] ⁺ 453.1704, found 453.1700 Example 241: N-(4-cyclopropylphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfan yl]-5- nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.050 g, 0.18 mmol, 1 eq.) in DMA (2 mL), DIPEA (0.050 mL, 0.29 mmol, 1.6 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-cyclopropyl-phenylamine (0.030 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated under vacuum and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solutionof NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was rinsed with MeOH and the title compound was obtained as a pale-yellow precipitate (0.030 g, 0.076 mmol, 42% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.84 (s, 1H) 8.69 (d, J = 9.00 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.63 (d, J = 8.54 Hz, 2H) 7.16 (d, J = 9.00 Hz, 1H) 7.11 (d, J = 8.54 Hz, 2H) 4.03 - 4.05 (m, 3H) 1.88 – 1.96 (m, 1H) 0.92 -0.97 (m, 2H) 0.64 – 0.69 (m, 2H) HRMS (ESI) calcd for C ₁₈ H ₁₆ N ₆ O ₃ S [M + H] ⁺ 397.1078, found 397.1083 Example 242: N-(4-cyclohexylphenyl)-1-[(1-methyl-1H-tetrazol-5-yl)sulfany l]-4- nitronaphthalene-2-carboxamide To a solution of 1-(1-methyltetrazol-5-yl)sulfanyl-4-nitro-naphthalene-2-carb oxylic acid (0.100 g, 0.3 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.083 mL, 0.48 mmol, 1.6 eq.), TBTU (0.125 g, 0.39 mmol, 1.3 eq.) and 4-cyclohexyl-phenylamine (0.068 g, 0.39 mmol, 1.3 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated in vacuo and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated acqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the target compound as a pale yellow solid (0.043 g, 0.088 mmol, 29% yield, 94% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.63 (s, 1H) 8.55 (s, 1H) 8.25 – 8.34 (m, 1H) 7.88 – 7.95 (m, 2H) 7.76 – 7.83 (m, 1H) 7.52 (d, J = 8.54 Hz, 2H) 7.20 (d, J = 8.54 Hz, 2H) 3.89 – 3.96 (m, 3H) 1.68-1.83 (m,5H) 1.20-1.44 (m, 6H) HRMS (ESI) calcd for C ₂₅ H ₂₄ N ₆ O ₃ S [M + H] ⁺ 489.1704, found 489.1707 Example 243: N-(4-cyclohexylphenyl)-5-fluoro-2-[(1-methyl-1H-tetrazol-5- yl)sulfanyl]benzamide A solution of 2-[(4-cyclohexylphenyl)carbamoyl]-4-fluorophenyl trifluoromethanesulfonate (0.200 g, 0.45 mmol, 1 eq.) and 1-methyl-1H-tetrazole-5-thiol (0.063 g, 0.54 mmol, 1.2 eq.) in dry 1,4-dioxane (6 mL) was treated with DIPEA (0.160 mL, 0.86 mmol, 1.9 eq.), xantphos (0.035 g, 0.06 mmol, 0.13 eq.) and Pd ₂ (dba) ₃ (0.041 g, 0.045 mmol, 0.1 eq.) under nitrogen and heated to reflux until the disappearance of the starting material (8 h). The reaction mixture was cooled to room temperature, volatiles were removed under reduced pressure and the resulting crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a yellow powder (0.043 g, 0.1 mmol, 23% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.56 (s, 1H) 7.67 (dd, J = 8.77, 2.82 Hz, 1H) 7.61 (d, J = 8.54 Hz, 2H) 7.37 – 7.43 (m, 1H) 7.32 – 7.37 (m, 1H) 7.22 (d, J = 8.54 Hz, 2H) 3.97 (s, 3H) 2.42 – 2.49 (m, 1H) 1.78 (dd, J = 8.46, 4.04 Hz, 4H) 1.70 (d, J = 12.51 Hz, 1H) 1.29 – 1.44 (m, 4H) 1.19 – 1.26 (m, 1H) HRMS (ESI) calcd for C ₂₁ H ₂₂ FN ₅ OS [M + H] ⁺ 412.1602, found 412.1600 Example 244: N-(4-cyclohexylphenyl)-2,3-difluoro-6-[(1-methyl-1H-tetrazol -5- yl)sulfanyl]benzamide A solution of 2-[(4-cyclohexylphenyl)carbamoyl]-3,4-difluorophenyl trifluoromethanesulfonate (0.120 g, 0.26 mmol, 1 eq.) and 1-methyl-1H-tetrazole-5-thiol (0.036 g, 0.31 mmol, 1.2 eq.) in dry 1,4-dioxane (4 mL) was treated with DIPEA (0.1 mL, 0.52 mmol, 2 eq.), xantphos (0.019 g, 0.03 mmol, 0.13 eq.) and Pd ₂ (dba) ₃ (0.024 g, 0.026 mmol, 0.1 eq.) under nitrogen and let to reflux until the disappearance of the starting material (8 h). The reaction mixture was cooled to room temperature, volatiles were removed under reduced pressure and the resulting crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1 to 7/3) to afford the target compound as a yellow powder (0.012 g, 0.02 mmol, 9% yield, 97% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.82 (s, 1H) 7.62 – 7.70 (m, 1H) 7.56 (d, J = 8.54 Hz, 2H) 7.41 – 7.46 (m, 1H) 7.23 (d, J = 8.54 Hz, 2H) 3.95 (s, 3H) 1.75 – 1.84 (m, 4H) 1.70 (d, J = 12.51 Hz, 1H) 1.30 -1.44 (m, 4H) 1.17 – 1.28 (m, 2H) HRMS (ESI) calcd for C ₂₁ H ₂₁ F ₂ N ₅ OS [M + H] ⁺ 430.1508, found 430.1508 Example 245: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-{4- [(trifluoromethyl)sulfanyl]phenyl}benzamide To a suspension of 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitrobenzoyl chloride (0.105 g, 0.35 mmol, 1eq.) in dry DCM (3.0 mL), 4-trifluoromethylsulfanyl-phenylamine (0.06 mL, 0.42 mmol, 1.2 eq.) and DIPEA (0.1 mL, 0.52 mmol, 1.5 eq.) were added and the mixture was stirred at room temperature until the disappearance of the starting material (4 h). The reaction mixture was diluted with DCM, washed with saturated aqueous solution of NaHCO ₃ , 1N acqueous HCl, brine and then dried on Na ₂ SO ₄ and filtered. The solvent was evaporated and the crude was purified by chromatographic column hexane/AcOEt (9/1) to give the title compound as white solid (0.052 g, 0.11 mmol, 33% yield, 95% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.20 (s, 1H) 8.75 (d, J = 2.59 Hz, 1H) 8.28 (dd, J = 8.85, 2.59 Hz, 1H) 7.90 – 7.95 (m, 2H) 7.78 (d, J = 8.69 Hz, 2H) 7.21 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₁ F ₃ N ₆ O ₃ S ₂ [M + H] ⁺ 457.0359, found 457.0354 Example 246: N-(4-cyclohexylphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfony l]benzamide N-(4-cyclohexyl-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl )-benzamide (0.750 g, 1.91 mmol, 1 eq.) was treated with mCPBA (2.63 g, 15.3 mmol, 8 eq.) in dry DCM (20 mL) overnight at room temperature. The conversion was complete. The solvent was evaporated in vacuo and the residue was rinsed with MeOH and DCM until a precipitate was formed. The latter was filtered, washed with Et ₂ O and then purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to give the title compound as a white solid (0.215 g, 0.5 mmol, 24% yield, 91% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.79 (s, 1H) 8.43 (dd, J = 7.93, 0.92 Hz, 1H) 7.99 – 8.05 (m, 1H) 7.93 (td, J = 7.78, 1.22 Hz, 1H) 7.84 (dd, J = 7.55, 0.99 Hz, 1H) 7.53 – 7.58 (m, 2H) 7.21 (d, J = 8.54 Hz, 2H) 4.31 (s, 3H) 2.47 (d, J = 3.20 Hz, 1H) 1.78 (dd, J = 7.78, 4.42 Hz, 4H) 1.70 (d, J = 12.66 Hz, 1H) 1.30 – 1.49 (m, 4H) 1.10 – 1.29 (m, 1H) HRMS (ESI) calcd for C ₂₁ H ₂₃ N ₅ O ₃ S [M + H] ⁺ 426.1595, found 426.1595 Example 247: N-(4-cyclohexylphenyl)-5-(dimethylsulfamoyl)-2-[(1-methyl-1H -tetrazol-5- yl)sulfanyl]benzamide To a solution of 5-(dimethylsulfamoyl)-2-(1-methyltetrazol-5-yl)sulfanyl-benz oic acid (0.130 g, 0.26 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.068 mL, 0.39 mmol, 1.5 eq.), TBTU (0.099 g, 0.31 mmol, 1.2 eq.) and 4-cyclohexyl-phenylamine (0.072 g, 0.41 mmol, 1.58 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated in vacuo and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the target compound as a white solid (0.041 g, 0.082 mmol, 24% yield, 100% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.80 (s, 1H) 8.09 (d, J = 1.83 Hz, 1H) 7.78 (dd, J = 8.54, 1.98 Hz, 1H) 7.63 (d, J = 8.54 Hz, 2H) 7.24 (d, J = 8.54 Hz, 3H) 7.22 (d, J = 8.54 Hz, 1H) 4.03 (s, 3H) 2.67 (s, 6H) 1.79 (d, J = 11.74 Hz, 4H) 1.70 (d, J = 12.35 Hz, 1H) 1.31 – 1.46 (m, 4H) 1.19 – 1.30 (m, 1H) HRMS (ESI) calcd for C ₂₃ H ₂₈ N ₆ O ₃ S ₂ [M + H] ⁺ 501.1737, found 501.1741 Example 248: N-(4-cyclohexylphenyl)-2-[(4-methyl-4H-1,2,4-triazol-3-yl)su lfanyl]-5- nitrobenzamide A solution of N-(4-cyclohexyl-phenyl)-2-fluoro-5-nitro-benzamide (0.410 g, 1.19 mmol, 1 eq.) and the (4-methyl-1,2,4-triazol-3-yl)sulfanylpotassium (0.345 g, 3.00 mmol, 2.52 eq.) (for synthesis see Acid intermediate 8) in dry ACN (8 mL) in the presence of TEA (1.26 mL, 9.00 mmol, 7.56 eq.) was heated to reflux until the disappearance of the starting material (3 h). The HPLC-MS analysis revealed the formation of two regioisomers which were separated by fractional crystallization with Et ₂ O. The title compound was obtained as a white solid (0.165 g, 0.378 mmol, 32% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.79 (s, 1H) 8.87 (s, 1H) 8.63 (br. s., 1H) 8.22 (d, J = 8.42 Hz, 1H) 7.66 (d, J = 8.08 Hz, 2H) 7.25 (d, J = 8.16 Hz, 2H) 6.88 (d, J = 8.85 Hz, 1H) 3.58 (s, 3H) 2.45 – 2.55 (m, 1H) 1.80 (d, J = 10.05 Hz, 4H) 1.71 (d, J = 13.15 Hz, 1H) 1.32 – 1.51 (m, 4H) 1.24 (d, J = 11.17 Hz, 1H) HRMS (ESI) calcd for C ₂₂ H ₂₃ N ₅ O ₃ S [M + H] ⁺ 438.1595, found 438.1585 Example 249: 5-(dimethylsulfamoyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl ]-N-[4- (propan-2-yl)phenyl]benzamide To a solution of 5-(dimethylsulfamoyl)-2-(1-methyltetrazol-5-yl)sulfanyl-benz oic acid (0.089 g, 0.26 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.068 mL, 0.39 mmol, 1.5 eq.), TBTU (0.099 g, 0.31 mmol, 1.2 eq.) and 4-isopropyl-phenylamine (0.042 mL, 0.31 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated in vacuo and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (1/1) to afford the target compound as a white solid (0.030 g, 0.065 mmol, 25% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.80 (s, 1H) 8.09 (d, J = 1.83 Hz, 1H) 7.78 (dd, J = 8.46, 2.06 Hz, 1H) 7.64 (d, J = 8.39 Hz, 2H) 7.27 (d, J = 8.39 Hz, 2H) 7.22 (d, J = 8.54 Hz, 1H) 4.03 (s, 3H) 2.82 – 2.96 (m, 1H) 2.67 (s, 6H) 1.17 – 1.24 (m, 6H) HRMS (ESI) calcd for C ₂₀ H ₂₄ N ₆ O ₃ S ₂ [M + H] ⁺ 461.1424, found 460.1422 Example 250: N-(4-cyclobutylphenyl)-5-(dimethylsulfamoyl)-2-[(1-methyl-1H -tetrazol-5- yl)sulfanyl]benzamide To a solution of 5-(dimethylsulfamoyl)-2-(1-methyltetrazol-5-yl)sulfanyl-benz oic acid (0.089 g, 0.26 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.068 mL, 0.39 mmol, 1.5 eq.), TBTU (0.099 g, 0.31 mmol, 1.2 eq.) and 4-cyclobutyl-phenylamine (0.046 g, 0.31 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated in vacuo and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by preparative HPLC to afford the target compound as a white solid (0.020 g, 0.138 mmol, 16% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.81 (s, 1H) 8.10 (d, J = 1.83 Hz, 1H) 7.78 (dd, J = 8.54, 1.98 Hz, 1H) 7.65 (d, J = 8.54 Hz, 2H) 7.26 (d, J = 8.39 Hz, 2H) 7.22 (d, J = 8.39 Hz, 1H) 4.03 (s, 3H) 3.51 (m, 1H) 2.67 (s, 6H) 2.25 – 2.34 (m, 2H) 2.04 – 2.16 (m, 2H) 1.88 – 2.02 (m, 1H) 1.73 – 1.85 (m, 1H) HRMS (ESI) calcd for C ₂₁ H ₂₄ N ₆ O ₃ S ₂ [M + H] ⁺ 473.1424, found 473.1433 Example 251: N-(4-cyclohexylphenyl)-5-nitro-2-(pyridin-4-ylsulfanyl)benza mide A solution of N-(4-cyclohexyl-phenyl)-2-fluoro-5-nitro-benzamide (0.080 g, 0.23 mmol, 1 eq.), pyridine-4-thiol (0.031 mg, 0.26 mmol, 1.1 eq.) and TEA (0.042 mL, 0.35 mmol, 1.5 eq.) in dry ACN (4 mL) was heated at 80 °C for 2 h. The reaction mixture was cooled to room temperature, concentrated in vacuo to dryness and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a yellow solid (0.041 g, 0.095 mmol, 40% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.56 (m, 2H) 8.52 (d, J=2.4, 1H) 8.28 (dd, J8.6, 2.4, 1H) 7.60-7.53 (m, 3H) 7-39 (m, 2H) 7.20 (m,2H) 2.48 (m, 1H) 1.84-1.67 (m, 5H) 1.46- 1.19 (m,5H) HRMS (ESI) calcd for C ₂₄ H ₂₃ N ₃ O ₃ S [M + H] ⁺ 434.1533, found 434.1543 Example 252: N-(4-cyclohexylphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfany l]-5- [(trifluoromethyl)sulfonyl]benzamide A solution of N-(4-cyclohexyl-phenyl)-2-fluoro-5-(trifluoromethanesulfonyl )-benzamide (0.044 g, 0.103 mmol, 1 eq.) and 1-methyl-1H-tetrazole-5-thiol (0.024 g, 2.05 mmol, 2 eq.) in dry ACN (2 mL) in the presence of TEA (0.029 mL, 2.05 mmol, 2 eq.) under nitrogen was heated at 80 °C until the disappearance of the starting material (3 h). The solvent was concentrated to dryness and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a white solid (0.018 g, 0.034 mmol, 33% yield, 100% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.92 (s, 1H) 8.51 (d, J = 1.98 Hz, 1H) 8.12 (dd, J = 8.62, 1.91 Hz, 1H) 7.64 (d, J = 8.39 Hz, 2H) 7.30 (d, J = 8.54 Hz, 1H) 7.26 (d, J = 8.39 Hz, 2H) 4.07 (s, 3H) 2.48 (m, 1H)1.79 (d, J = 10.68 Hz, 4H) 1.71 (d, J = 12.96 Hz, 1H) 1.31 – 1.49 (m, 4H) 1.24 (d, J = 9.15 Hz, 1H) HRMS (ESI) calcd for C ₂₂ H ₂₂ F ₃ N ₅ O ₃ S ₂ [M + H] ⁺ 526.1189, found 526.1196 Example 253: N-(4-cyclohexylphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfany l]-5- sulfamoylbenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-sulfamoyl-benzoic acid (0.100 g, 0.32 mmol, 1 eq.) in DMA (4 mL), DIPEA (0.083 mL, 0.48 mmol, 1.5 eq.), TBTU (0.122 g, 0.38 mmol, 1.2 eq.) and 4-cyclohexyl-phenylamine (0.066 g, 0.38 mmol, 1.2 eq.) were added and the reaction mixture was stirred overnight at room temperature. The solvent was evaporated in vacuo and after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.072 g, 0.153 mmol, 48% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.83 (s, 1H) 8.13 (d, J = 2.14 Hz, 1H) 7.85 (dd, J = 8.46, 2.06 Hz, 1H) 7.62 (d, J = 8.54 Hz, 2H) 7.54 (s, 2H) 7.29 (d, J = 8.54 Hz, 1H) 7.23 (d, J = 8.54 Hz, 2H) 4.01 (s, 3H) 2.48 (m, 1H) 1.79 (d, J = 11.74 Hz, 4H) 1.70 (d, J = 12.35 Hz, 1H) 1.31 - 1.48 (m, 4H) 1.24 (d, J = 5.03 Hz, 1H) HRMS (ESI) calcd for C ₂₁ H ₂₄ N ₆ O ₃ S ₂ [M + H] ⁺ 473.1424, found 473.1422 Example 254: N-(4-cyclopentylphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfan yl]-5- [(trifluoromethyl)sulfonyl]benzamide A solution of 2-(1H-1,2,3-benzotriazol-1-yloxy)-N-(4-cyclopentylphenyl)-5- trifluoromethanesulfonylbenzamide (0.160 g, 0.3 mmol, 1 eq.) and 1-methyl-1H-tetrazole-5- thiol (0.069 g, 0.59 mmol, 2 eq.) in dry ACN (5 mL) in the presence of TEA (0.13 μL, 0.89 mmol, 3 eq.) under nitrogen was heated at 80 °C until the disappearance of the starting material (4 h). After cooling to room temperature, the solvent was concentrated, and the residue was rinsed with AcOEt and washed with H ₂ O. The organic phase was dried over Na ₂ SO ₄ and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1 to 8/2) to afford the title compound as a white solid (0.072 g, 0.14 mmol, 47% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.92 (s, 1H) 8.52 (d, J = 1.98 Hz, 1H) 8.12 (dd, J = 8.69, 1.98 Hz, 1H) 7.64 (d, J = 8.54 Hz, 2H) 7.29 (dd, J = 8.54, 6.25 Hz, 3H) 4.07 (s, 3H) 2.90 – 3.03 (m, 1H) 1.98 – 2.07 (m, 2H) 1.46 – 1.82 (m, 6H) HRMS (ESI) calcd for C ₂₁ H ₂₀ F ₃ N ₅ O ₃ S ₂ [M + H] ⁺ 512.1033, found 512.1038 Example 255: N-(4-cyclohexylphenyl)-2-{[1-(2-hydroxyethyl)-1H-tetrazol-5- yl]sulfanyl}- 5-nitrobenzamide A solution of N-(4-cyclohexyl-phenyl)-2-fluoro-5-nitro-benzamide (0.068 g, 0.20 mmol, 1 eq.) and the potassium salt of the 2-(5-mercapto-tetrazol-1-yl)-ethanol (0.060 g, 0.32 mmol, 1.6 eq.) in dry ACN (2 mL) in the presence of TEA (0.420 mL, 0.40 mmol, 2 eq.) under nitrogen was heated at 80 °C until the disappearance of the starting material (6 h). After cooling to room temperature, the solvent was concentrated and the residue was rinsed with AcOEt and washed with H ₂ O. The organic phase was dried over Na ₂ SO ₄ and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a white solid (0.027 g, 0.058 mmol, 28% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.85 (s, 1H) 8.66 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.65 (d, J = 8.54 Hz, 2H) 7.25 (d, J = 8.69 Hz, 2H) 7.23 (d, J = 9.00 Hz, 1H) 5.12 (t, J = 5.57 Hz, 1H) 4.51 (t, J = 5.19 Hz, 2H) 3.77 (q, J = 5.44 Hz, 2H) 2.48 (m, 1H) 1.79 (d, J = 11.29 Hz, 4H) 1.71 (d, J = 12.66 Hz, 1H) 1.32 – 1.49 (m, 4H) 1.09 – 1.29 (m, 1H) HRMS (ESI) calcd for C ₂₂ H ₂₄ N ₆ O ₄ S [M + H] ⁺ 469.1653, found 469.1659 Example 256: N-(4-cyclopentylphenyl)-2-[(4-methyl-4H-1,2,4-triazol-3-yl)s ulfanyl]-5- nitrobenzamide To a solution of 2-[(4-methyl-4H-1,2,4-triazol-3-yl)sulfanyl]-5-nitrobenzoic acid (0.085 g, 0.30 mmol, 1 eq.) in DMA (3 mL), DIPEA (0.078 mL, 0.45 mmol, 1.5 eq.), TBTU (0.116 g, 0.34 mmol, 1.13 eq.) and 4-cyclopentyl-phenylamine (0.058 g, 0.36 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solvent was then evaporated in vacuo and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.040 g, 0.095 mmol, 31% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.79 (s, 1H) 8.87 (s, 1H) 8.63 (d, J = 2.44 Hz, 1H) 8.22 (dd, J = 8.85, 2.44 Hz, 1H) 7.66 (d, J = 8.54 Hz, 2H) 7.28 (d, J = 8.54 Hz, 2H) 6.87 (d, J = 8.85 Hz, 1H) 3.58 (s, 3H) 2.94 – 3.03 (m, 1H) 1.96 – 2.08 (m, 2H) 1.47 – 1.85 (m, 6H) HRMS (ESI) calcd for C ₂₁ H ₂₁ N ₅ O ₃ S [M + H] ⁺ 424.1438, found 424.1441 Example 257: N-(4-benzylphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5 - nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (3 mL), DIPEA (0.047 mL, 0.27 mmol, 1.5 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-benzyl-phenylamine (0.04 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solvent was then evaporated in vacuo and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.019 g, 0.043 mmol, 23% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.89 (s, 1H) 8.66 (d, J = 2.44 Hz, 1H) 8.24 (dd, J = 8.85, 2.44 Hz, 1H) 7.65 (d, J = 8.54 Hz, 2H) 7.22 – 7.32 (m, 6H) 7.17- 7.20 (m, 1H) 7.15 (d, J = 8.85 Hz, 1H) 4.03 (s, 3H) 3.93 (s, 2H) HRMS (ESI) calcd for C ₂₂ H ₁₈ N ₆ O ₃ S [M + H] ⁺ 447.1234, found 447.1236 Example 258: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(2-phen ylpropan-2- yl)phenyl]benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (3 mL), DIPEA (0.047 mL, 0.27 mmol, 1.5 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-(1-methyl-1-phenyl-ethyl)-phenylamine (0.055 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solvent was then evaporated in vacuo and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.017 g, 0.036 mmol, 20% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.89 (s, 1H) 8.66 (d, J = 2.59 Hz, 1H) 8.24 (dd, J = 8.92, 2.52 Hz, 1H) 7.64 (d, J = 8.69 Hz, 2H) 7.21 – 7.31 (m, 6H) 7.14 – 7.19 (m, 2H) 4.03 (s, 3H) 1.64 (s, 6H) HRMS (ESI) calcd for C ₂₄ H ₂₂ N ₆ O ₃ S [M + H] ⁺ 475.1547, found 475.1543 Example 259: N-[4-(1-hydroxy-2-methylpropan-2-yl)phenyl]-2-[(1-methyl-1H- tetrazol-5- yl)sulfanyl]-5-nitrobenzamide ^O To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (3 mL), DIPEA (0.047 mL, 0.27 mmol, 1.5 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 2-(4-amino-phenyl)-2-methyl-propan-1-ol (0.037 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solvent was then evaporated in vacuo and, after dilution with AcOEt and MeOH a precipitate was formed. It was filtered and washed with Et ₂ O to afford the target compound as a pale yellow solid (0.023 g, 0.054 mmol, 29% yield, 97% purity). 1H NMR (500 MHz, DMSO- d6) δ ppm 10.87 (s, 1H) 8.67 (d, J = 2.44 Hz, 1H) 8.24 (dd, J = 8.85, 2.44 Hz, 1H) 7.64 (d, J = 8.69 Hz, 2H) 7.39 (d, J = 8.69 Hz, 2H) 7.16 (d, J = 9.00 Hz, 1H) 4.73 (t, J = 5.41 Hz, 1H) 4.04 (s, 3H) 3.41 (m, 2H) 1.22 (s, 6H) HRMS (ESI) calcd for C ₁₉ H ₂₀ N ₆ O ₄ S [M + H] ⁺ 429.1340, found 429.1338 Example 260: N-[4-(2-amino-2-oxoethyl)phenyl]-2-[(1-methyl-1H-tetrazol-5- yl)sulfanyl]- 5-nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (3 mL), DIPEA (0.047 mL, 0.27 mmol, 1.5 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 2-(4-amino-phenyl)-acetamide (0.033 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solvent was then evaporated in vacuo and the resulting solid was diluted with AcOEt and MeOH and the obtained precipitate was collected by filtration and washed with Et ₂ O to afford the target compound as a pale yellow solid (0.027 mg, 0.065 mmol, 36% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.90 (s, 1H) 8.68 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.85, 2.59 Hz, 1H) 7.66 (d, J = 8.54 Hz, 2H) 7.49 (br. s., 1H) 7.29 (d, J = 8.54 Hz, 2H) 7.16 (d, J = 8.85 Hz, 1H) 6.89 (br. s., 1H) 4.04 (s, 3H) 3.37 (s, 2H) HRMS (ESI) calcd for C ₁₇ H ₁₅ N ₇ O ₄ S [M + H] ⁺ 414.0979, found 414.0985 Example 261: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-{4-[2-oxo- 2-(pyrrolidin-1- yl)ethyl]phenyl}benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (3 mL), DIPEA (0.047 mL, 0.27 mmol, 1.5 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 2-(4-amino-phenyl)-1-pyrrolidin-1-yl-ethanone (0.053 mg, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solvent was then evaporated in vacuo and the resulting solid was diluted with AcOEt and MeOH. The obtained precipitate was collected by filtration and washed with Et ₂ O to afford the target compound as a pale yellow solid (0.013 mg, 0.028 mmol, 15% yield, 97% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.89 (s, 1H) 8.71 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.85, 2.44 Hz, 1H) 7.67 (d, J = 8.39 Hz, 2H) 7.26 (d, J = 8.54 Hz, 2H) 7.17 (d, J = 8.85 Hz, 1H) 4.02 – 4.07 (m, 3H) 3.62 (s, 2H) 3.47 (t, J = 6.86 Hz, 2H) 3.30 (t, J = 6.86 Hz, 2H) 1.85 – 1.92 (m, 2H) 1.68 – 1.83 (m, 2H) HRMS (ESI) calcd for C ₂₁ H ₂₁ N ₇ O ₄ S [M + H] ⁺ 468.1449, found 468.1446 Example 262: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(pyridi n-4- ylmethyl)phenyl]benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (3 mL), DIPEA (0.047 mL, 0.27 mmol, 1.5 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-pyridin-4-ylmethyl-phenylamine (0.041 g, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solvent was then evaporated in vacuo and the resulting solid was diluted with AcOEt and MeOH filtrated and washed with Et ₂ O to afford the target compound as a pale yellow solid (0.013 mg, 0.029 mmol, 16% yield, 96% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.90 (s, 1H) 8.66 – 8.71 (m, 1H) 8.47 (d, J = 5.19 Hz, 2H) 8.25 (dd, J = 8.85, 2.59 Hz, 1H) 7.67 – 7.73 (m, 2H) 7.30 (d, J = 8.54 Hz, 2H) 7.25 (d, J = 5.95 Hz, 2H) 7.17 (d, J = 8.85 Hz, 1H) 4.03 – 4.06 (m, 3H) 3.97 (s, 2H) HRMS (ESI) calcd for C ₂₁ H ₁₇ N ₇ O ₃ S [M + H] ⁺ 448.1187, found 448.1187 Example 263: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(2- phenylethyl)phenyl]benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.05 g, 0.18 mmol, 1 eq.) in DMA (3 mL), DIPEA (0.047 mL, 0.27 mmol, 1.5 eq.), TBTU (0.071 g, 0.22 mmol, 1.2 eq.) and 4-(phenethyl-phenylamine (0.052 mg, 0.22 mmol, 1.2 eq.) were added and the reaction mixture was stirred for 3 h at room temperature. The solvent was then evaporated in vacuo and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.032 g, 0.07 mmol, 39% yield, 97% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.70 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.85, 2.59 Hz, 1H) 7.66 (s, 2H) 7.22 – 7.31 (m, 6H) 7.14 – 7.20 (m, 2H) 4.05 (s, 3H) 2.89 (s, 4H) HRMS (ESI) calcd for C ₂₃ H ₂₀ N ₆ O ₃ S [M + H] ⁺ 461.1391, found 461.1390 Example 264: N-(4-cyclopentylphenyl)-2-{[1-(2-hydroxyethyl)-1H-tetrazol-5 -yl]sulfanyl}- 5-[(trifluoromethyl)sulfonyl]benzamide A solution of 2-(1H-benzotriazol-2-yloxy)-N-(4-cyclopentyl-phenyl)-5-trifl uoromethanesulfonyl- benzamide (0.150 g, 0.28 mmol, 1 eq.) and [1-(2-hydroxyethyl)tetrazol-5-yl]sulfanylpotassium (0.080 g, 0.42 mmol, 1.5 eq.) in dry ACN (6 mL) under nitrogen was heated for 8 h at 80 °C. After cooling the mixture at room temperature, the solvent was concentrated and the residue was rinsed with AcOEt and washed with H ₂ O. The organic phase was dried over Na ₂ SO ₄ and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a beige solid (0.013 g, 0.024 mmol, 9% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.93 (s, 1H) 8.49 (d, J = 2.14 Hz, 1H) 8.12 (dd, J = 8.69, 1.98 Hz, 1H) 7.63 (d, J = 8.54 Hz, 2H) 7.37 (d, J = 8.54 Hz, 1H) 7.29 (d, J = 8.54 Hz, 2H) 5.13 (t, J = 5.49 Hz, 1H) 4.53 (t, J = 5.19 Hz, 2H) 3.78 (q, J = 5.49 Hz, 2H) 2.90 – 3.04 (m, 1H) 1.95 – 2.07 (m, 2H) 1.45 – 1.83 (m, 6H) HRMS (ESI) calcd for C ₂₂ H ₂₂ F ₃ N ₅ O ₄ S ₂ [M + H] ⁺ 542.1138, found 542.1145 Example 265: N-(4-cyclopentylphenyl)-2-{[1-(2-hydroxyethyl)-1H-tetrazol-5 -yl]sulfanyl}- 5-nitrobenzamide A solution of N-(4-cyclopentyl-phenyl)-2-fluoro-5-nitro-benzamide (0.100 mg, 0.3 mmol, 1 eq.) and [1-(2-hydroxyethyl)tetrazol-5-yl]sulfanylpotassium (0.066 g, 0.36 mmol, 1.2 eq.) in dry ACN (6 mL) under nitrogen was heated for 8 h at 80 °C. After cooling the mixture at room temperature, the solvent was concentrated and the residue was rinsed with AcOEt and washed with H ₂ O. The organic phase was dried over Na ₂ SO ₄ and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a beige solid (0.020 g, 0.044 mmol, 15% yield, 95% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.87 (s, 1H) 8.67 (m, 1H) 8.24 (m, 1H) 7.66 (m, 2H) 7.28 (m, 2H) 7.22 (m, 1H) 5.12 (br. s, 1H) 4.52 (m, 2H) 3.78 (m, 2H) 2.97 (m, 1H) 2-05-1.47 (m, 8H) HRMS (ESI) calcd for C ₂₁ H ₂₂ N ₆ O ₄ S [M + H] ⁺ 455.1496, found 455.1485 Example 266: N-(4-cyclopentylphenyl)-2-{[1-(2-methoxyethyl)-1H-tetrazol-5 -yl]sulfanyl}- 5-nitrobenzamide A solution of N-(4-cyclopentyl-phenyl)-2-fluoro-5-nitro-benzamide (0.100 g, 0.30 mmol, 1 eq.) and the 1-(2-methoxy-ethyl)-1H-tetrazole-5-thiol (0.096 g, 0.60 mmol, 2 eq.) in dry ACN (4 mL) in the presence of TEA (0.126 mL, 0.90 mmol, 3 eq.) under nitrogen was heated for 8 h at 80 °C. After cooling the mixture at room temperature, the solvent was concentrated and the residue was rinsed with AcOEt and washed with H ₂ O. The organic phase was dried over Na ₂ SO ₄ and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a white solid (0.033 g, 0.071 mmol, 23% yield, 75% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.68 (d, J = 2.59 Hz, 1H) 8.28 (dd, J = 8.92, 2.52 Hz, 1H) 7.65 (d, J = 8.54 Hz, 2H) 7.28 (d, J = 8.54 Hz, 2H) 7.13 (d, J = 8.85 Hz, 1H) 4.64 (t, J = 5.03 Hz, 2H) 3.71 (t, J = 5.03 Hz, 2H) 3.10 (s, 3H) 2.89 – 3.04 (m, 1H) 1.95 -2.08 (m, 2H) 1.46 – 1.82 (m, 6H) HRMS (ESI) calcd for C ₂₂ H ₂₄ N ₆ O ₄ S [M + H] ⁺ 469.1653, found 469.1642 Example 267: N-(4-cyclopentylphenyl)-2-({1-[2-(dimethylamino)ethyl]-1H-te trazol-5- yl}sulfanyl)-5-nitrobenzamide

To a solution of 2-[1-(2-dimethylamino-ethyl)-1H-tetrazol-5-ylsulfanyl]-5-nit ro-benzoic acid (0.5 g, 2.6 mmol, 1 eq.) in DMA (15 mL), DIPEA (0.6 mL, 3.12 mmol, 1.2 eq.), TBTU (1 g, 3.12 mmol, 1.2 eq.) and 4-cyclopentyl-phenylamine (0.502 g, 3.12 mmol, 1.2 eq.) were added. The reaction mixture was stirred for 4 h at room temperature. The solvent was evaporated in vacuo and, after dilution with AcOEt, the organic phase was washed with H ₂ O and the aqueous layer was extracted with AcOEt. The combined organic layers were washed with a saturated aqueous solution of NaHCO ₃ , H ₂ O and brine. All the organics were dried over Na ₂ SO ₄ , filtered and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the target compound as a white solid (0.150 g, 0.312 mmol, 12% yield, 96% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.66 (d, J = 2.59 Hz, 1H) 8.28 (dd, J = 8.92, 2.52 Hz, 1H) 7.64 (d, J = 8.54 Hz, 2H) 7.28 (d, J = 8.54 Hz, 2H) 7.18 (d, J = 8.85 Hz, 1H) 4.53 (t, J = 5.80 Hz, 2H) 2.91 – 3.02 (m, 1H) 2.64 (t, J = 5.80 Hz, 2H) 1.96 – 2.08 (m, 8H) 1.42 – 1.86 (m, 6H) HRMS (ESI) calcd for C ₂₃ H ₂₇ N ₇ O ₃ S [M + H] ⁺ 482.1969, found 482.1960 Example 268: N-(4-cyclopentylphenyl)-2-({1-[2-(dimethylamino)ethyl]-1H-te trazol-5- yl}sulfanyl)-5-nitrobenzamide hydrochloride N-(4-cyclopentylphenyl)-2-({1-[2-(dimethylamino)ethyl]-1H-te trazol-5-yl}sulfanyl)-5-nitro benzamide (0.050 g, 0.10 mmol, 1 eq.) in MeOH (0.5 mL) was treated with 4M HCl in 1,4- dioxane (0.025 mL) overnight at room temperature. The solvent was evaporated to dryness and the resulting solid was collected by filtration and washed with Et ₂ O to give the target compound as a pale yellow solid (0.040 g, 0.077 mmol, 77% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.91 (s, 1H) 9.91 (br. s., 1H) 8.74 (d, J = 2.29 Hz, 1H) 8.27 (dd, J = 8.92, 2.52 Hz, 1H) 7.66 (d, J = 8.54 Hz, 2H) 7.24 – 7.33 (m, 3H) 4.86 (br. s., 2H) 3.67 (br. s., 2H) 2.92 – 3.04 (m, 1H) 2.84 (br. s., 5H) 1.96 – 2.07 (m, 2H) 1.46 – 1.87 (m, 6H) HRMS (ESI) calcd for C ₂₃ H ₂₇ N ₇ O ₃ S [M + H] ⁺ 482.1969, found 482.1946 Example 269: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-(pyrimidin -2- yl)benzamide To a solution of 2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro-benzoyl chloride (0.051 g, 0.17 mmol, 1 eq.) in DCM dry (3 mL), DIPEA (0.037 mL, 0.20 mmol, 1.18 eq.) and pyrimidin-2-ylamine (0.016 g, 0.17 mmol, 1 eq.) were added and the mixture was stirred at room temperature for 4 h. The solvent was then evaporated in vacuo and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2 to 2/8) to afford the title compound as a white solid (0.016 g, 0.045 mmol, 27% yield, 93% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.73 (s, 1H) 8.75 (d, J = 4.88 Hz, 2H) 8.65 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.31 (t, J = 4.80 Hz, 1H) 7.18 (d, J = 9.00 Hz, 1H) 4.02 – 4.05 (m, 3H) HRMS (ESI) calcd for C ₁₃ H ₁₀ N ₈ O ₃ S [M + H] ⁺ 359.0669, found 359.0672 Example 270: N-(5-cyclopentylpyrimidin-2-yl)-2-({1-[2-(dimethylamino)ethy l]-1H- tetrazol-5-yl}sulfanyl)-5-nitrobenzamide A solution of 2-[(5-cyclopentylpyrimidin-2-yl)carbamoyl]-4-nitrophenyl trifluoromethanesulfonate (0.250 g, 0.54 mmol, 1 eq.) and 1-[2-(dimethylamino)ethyl]tetrazole- 5-thiol (0.350 g, 2.02 mmol, 3.7 eq.) in dry ACN (10 mL) in the presence of TEA (0.03 mL, 2.13 mmol, 4 eq.) was heated for 2 h at 50 °C. After cooling the mixture at room temperature, the solvent was concentrated and the residue was rinsed with DCM and washed with H ₂ O. The organic phase was dried over Na ₂ SO ₄ and concentrated to dryness. The crude was purified by flash chromatography on silica gel eluting with DCM/MeOH (95/5) to afford the title compound as a white solid (0.015 g, 0.03 mmol, 5% yield, 94% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.68 (s, 1H) 8.66 (s, 2H) 8.63 (d, J=2.59, 1H) 8.27 (dd, J = 8.85, 2.59 Hz, 1H) 7.19 (d, J = 9.00 Hz, 1H) 4.56 ( br. s., 2H) 2.92 – 3.07 (m, 1H) 2.70 (br, s, 2H) 2.00 – 2.13 (m, 8H) 1.74 - 1.86 (m, 2H) 1.63 – 1.71 (m, 2H) 1.53 – 1.63 (m, 2H) HRMS (ESI) calcd for C ₂₁ H ₂₅ N ₉ O ₃ S [M + H] ⁺ 506.1693, found 506.1700 Example 271: N-(5-cyclopentylpyrimidin-2-yl)-2-[(1-methyl-1H-tetrazol-5-y l)sulfanyl]-5- [(trifluoromethyl)sulfonyl]benzamide To a solution of 2-(1-methyltetrazol-5-yl)sulfanyl-5-(trifluoromethylsulfonyl )benzoyl chloride (0.084 g, 0.217 mmol, 1 eq.) in dry DCM (3 mL), DIPEA (0.045 mL, 0.25 mmol, 1.15 eq.) and 5-cyclopentyl-pyrimidin-2-ylamine (0.052 g, 0.32 mmol, 1.5 eq.) were added and the mixture was stirred at room temperature for 2 h. The mixture was then diluted with DCM and washed with H ₂ O, 1N aqueous HCl and brine. The organic phase was dried over Na ₂ SO ₄ and evaporated to dryness in vacuo. The crude was purified by preparative HPLC to afford the title compound as a white solid (0.035 g, 0.068 mmol, 32% yield, 93% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.82 (s, 1H) 8.65 (s, 2H) 8.43 (d, J = 1.98 Hz, 1H) 8.10 (dd, J = 8.62, 2.21 Hz, 1H) 7.29 (d, J = 8.69 Hz, 1H) 4.07 (s, 3H) 2.94 – 3.06 (m, 1H) 2.01 – 2.10 (m, 2H) 1.49 – 1.90 (m, 6H) HRMS (ESI) calcd for C ₁₉ H ₁₈ F ₃ N ₇ O ₃ S ₂ [M + H] ⁺ 514.0938, found 514.0934 Example 272: 5-amino-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-N-(4-trifluoro methyl- phenyl)-benzamide 2-(1-Methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-N-(4-trifluoro methyl-phenyl)-benzamide (0.780 g, 1.84 mmol, 1 eq.) was dissolved in EtOH (12 mL) under nitrogen. Ammonium formate (1.10 g, 18 mmol, 10 eq.) and Pd/C 10% (0.117 g, 15% w/w) were added and the reaction mixture was heated at 90 °C until the disappearance of the starting material (4 h). The reaction mixture was then cooled to room temperature and filtered throught celite. The filtrate was concentrated in vacuo and the resulting solid was diluted with DCM and washed with H ₂ O and brine. The organic phase was dried over Na ₂ SO ₄ , evaporated and the crude was purified by flash chromatography on silica gel eluting with DCM/MeOH (99/1) to afford a pale yellow solid (0.550 g, 1.4 mmol, 75% yield, 94% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.81 (s, 1H) 7.89 (d, J = 8.54 Hz, 2H) 7.71 (d, J = 8.69 Hz, 2H) 7.28 (d, J = 8.54 Hz, 1H) 6.78 (d, J = 2.44 Hz, 1H) 6.70 (dd, J = 8.54, 2.59 Hz, 1H) 5.90 (s, 2H) 3.86 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₃ F ₃ N ₆ OS [M + H] ⁺ 395.0897, found 395.0896 Example 273: 5-iodo-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-N-(4-trifluorom ethyl-phenyl)- benzamide To a solution of 5-amino-2-(1-methyl-1H-tetrazol-5-ylsulfanyl-N-(4-trifluorom ethyl-phenyl)- benzamide (0.100 g, 0.25 mmol, 1 eq.) in a mixture of H ₂ O/concentrated aqueous HCl 1/1 (2 mL) at 0 °C, a solution of NaNO ₂ (0.021 g, 0.30 mmol, 1.2 eq.) in 1.6 mL of H ₂ O was added. After 20 min KI (0.042 g, 0.25 mmol, 1 eq.) was added and the reaction mixture was stirred overnight at room temperature. Despite the incomplete conversion, as judged by HPLC-MS, the reaction was quenched by adding a saturated aqueous solution of NaHCO ₃ and the aqueous layer was extracted with DCM. All the organics were evaporated after being dried over Na ₂ SO ₄ and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the desired compound as a white solid (0.040 g, 0.079 mmol, 32% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.99 (s, 1H) 8.17 (d, J = 1.98 Hz, 1H) 7.93 (d, J = 8.54 Hz, 2H) 7.86 (dd, J = 8.39, 1.98 Hz, 1H) 7.76 (d, J = 8.54 Hz, 2H) 6.95 (d, J = 8.39 Hz, 1H) 3.98 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₁ F ₃ IN ₅ OS [M + H] ⁺ 505.9754, found 505.9757 Example 274: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-trifluoromethyl-N-(4 - trifluoromethyl-phenyl)-benzamide To a solution of 2-fluoro-5-trifluoromethyl-N-(4-trifluoromethyl-phenyl)-benz amide (0.020 g, 0.06 mmol, 1 eq.) in NMP (0.3 mL), 18-crown-6 ether (0.044 g, 0.166 mmol, 2.8 eq.) and (1- methyltetrazol-5-yl)sulfanylpotassium (0.025 g, 0.17 mmol, 2.8 eq.) were added and the reaction mixture was heated at 120 °C for 6 h. The reaction mixture was cooled to room temperature and diluted with H ₂ O and the aqueous phase was extracted with DCM. All the organics were dried over Na ₂ SO ₄ and concentrated. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to give the target compound as a pale-yellow solid (0.012 g, 0.027 mmol, 48% yield, 82% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.11 (s, 1H) 8.25 (d, J = 1.53 Hz, 1H) 7.96 (d, J = 8.54 Hz, 2H) 7.85 (dd, J = 8.54, 1.68 Hz, 1H) 7.78 (d, J = 8.54 Hz, 2H) 7.27 (d, J = 8.39 Hz, 1H) 4.03 (s, 3H) HRMS (ESI) calcd for C ₁₇ H ₁₁ F ₆ N ₅ OS [M + H] ⁺ 448.0661, found 448.0663 Example 275: 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-N-(4-trifluoromethyl-p henyl)- benzamide To a solution of 5-amino-2-(1-methyl-1H-tetrazol-5-ylsulfanyl-N-(4-trifluorom ethyl-phenyl)- benzamide (0.050 g, 0.13 mmol, 1 eq.) in a mixture of H ₂ O/concentrated aqueous HCl 1/1 (1 mL) at 0 °C, a solution of NaNO ₂ (0.011 g, 0.15 mmol, 1.15 eq.) in 0.8 mL H ₂ O was added. After 20 min, 50% aqueous H ₃ PO ₂ (0.026 mL, 0.25 mmol, 1.67 eq.) was added and, after removal of the ice bath, the reaction mixture was stirred at room temperature until the disappearance of the starting material (4 h). A saturated aqueous solution of NaHCO ₃ was then added and the aqueous layer was extracted with DCM. The organic phase was washed with H ₂ O and brine and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (6/4) to give the title compound as a yellow solid (0.020 g, 0.053 mmol, 42% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.98 (s, 1H) 7.96 (d, J = 8.54 Hz, 2H) 7.81-7.85 (m, 1H) 7.75 (d, J = 8.69 Hz, 2H) 7.50-7.56 (m, 2H) 7.16-7.21 (m, 1H) 3.98(s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₂ N ₅ OS [M + H] ⁺ 380.0788, found 380.0784 Example 276: 5-chloro-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-N-(4-trifluor omethyl- phenyl)-benzamide To a solution of 5-amino-2-(1-methyl-1H-tetrazol-5-ylsulfanyl-N-(4-trifluorom ethyl-phenyl)- benzamide (0.050 g, 0.13 mmol, 1eq.) in a mixture of H ₂ O/concentrated aqueous HCl 1/1 (1mL) at 0 °C, a solution of NaNO ₂ (0.011 g, 0.15 mmol, 1.15 eq.) in 0.8 mL of H ₂ O was added. After 20 min CuCN (0.023 g, 0.25 mmol, 1.67 eq.) was added and the reaction mixture was stirred at room temperature until the disappearance of the starting material (4 h). The reaction mixture was then neutralized with a saturated aqueous solution of NaHCO ₃ and the aqueous layer was extracted with DCM. The combined organics were concentrated after being dried over Na ₂ SO ₄ and the residue was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a white solid (0.025 g, 0.061 mmol, 48% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.02 (s, 1H) 7.96 (d, J = 2.44 Hz, 1H) 7.94 (d, J = 8.54 Hz, 2H) 7.76 (d, J = 8.54 Hz, 2H) 7.60 (dd, J = 8.62, 2.36 Hz, 1H) 7.23 (d, J = 8.54 Hz, 1H) 3.99 (s, 3H) HRMS (ESI) calcd for C ₁₆ H ₁₁ ClF ₃ N ₅ OS [M + H] ⁺ 414.0398, found 414.0396 Example 277: 5-acetylamino-2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-N-(4-tri fluoromethyl- phenyl)-benzamide To a solution of 5-amino-2-(1-methyl-1H-tetrazol-5-ylsulfanyl-N-(4-trifluorom ethyl-phenyl)- benzamide (0.050 g, 0.13 mmol, 1 eq.) in pyridine (1.5 mL) Ac ₂ O (0.015 mL, 0.15 mmol, 1.15 eq.) and a catalytic amount of DMAP were added under nitrogen. The reaction mixture was stirred overnight at room temperature. HPLC-MS analysis showed that the conversion was completed and after evaporation of the solvent, the resulting residue was rinsed with DCM and washed with a 1N aqueous HCl solution, saturated aqueous solution of NaHCO ₃ and brine. The organic phase was dried over Na ₂ SO ₄ and concentrated in vacuo. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (1/1) to afford the title product as a white solid (0.040 g, 0.092 mmol, 55% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.99 (s, 1 H) 10.34 (s, 1 H) 7.96 (d, J=2.29 Hz, 1 H) 7.91 (d, J=8.39 Hz, 2 H) 7.74 (d, J=8.69 Hz, 2 H) 7.70 (dd, J=8.69, 2.44 Hz, 1 H) 7.37 (d, J=8.69 Hz, 1 H) 3.93 (s, 3 H) 2.08 (s, 3 H) HRMS (ESI) calcd for C ₁₈ H ₁₅ F ₃ N ₆ O ₂ S [M + H] ⁺ 437.1002, found 437.1009 Example 278: 2-[(1-cyclopropyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4- (trifluoromethyl)phenyl]benzamide ^O A solution of 2- fluoro-5-nitro-N-(4-trifluoromethyl-phenyl)-benzamide (0.060 g, 0.18 mmol, 1 eq.) in ACN (1 mL) was treated with 1-cyclopropyl-1H-tetrazole-5-thiol (0.026 g, 0.18 mmol, 1 eq.) in the presence of TEA (0.050 mL, 0.36 mmol, 2 eq.) and the reaction mixture was heated at 70 °C under microwave conditions for 5 h. After cooling to room temperature, the solvent was evaporated in vacuo and the residue was rinsed with DCM and washed with a 1N aqueous HCl solution, saturated aqueous solution of NaHCO ₃ and brine. The organic phase was dried over Na ₂ SO ₄ and the solvent was concentrated. The crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to give the title compound as a white solid (0.040 g, 0.089 mmol, 50% yield, purity: 100%). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.25 (s, 1H) 8.76 (d, J = 2.59 Hz, 1H) 8.29 (dd, J = 8.85- 2.59 Hz, 1H) 7.98 (d, J = 8.54 Hz, 2H) 7.79 (d, J = 8.69 Hz, 2H) 7.34 (d, J = 8.85 Hz, 1H) 3.75 (dt, J = 7.28, 3.60 Hz, 1H) 1.17-1.23 (m, 2H) 1.10-1.14 (m, 2H) HRMS (ESI) calcd for C ₁₈ H ₁₃ F ₃ N ₆ O ₃ S [M + H] ⁺ 452.079, found 452.0797 Example 279: N-(4-cyclohexylphenyl)-2-[(1-cyclopropyl-1H-tetrazol-5-yl)su lfanyl]-5- nitrobenzamide To a solution of 2-(1-cyclopropyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.150 g, 0.49 mmol, 1 eq.) in dry DMF (4 mL) TBTU (0.173 g, 0.54 mmol, 1.1 eq.), DIPEA (0.130 mL, 0.73 mmol, 1.5 eq.) and 4-cyclohexylaniline (0.103 g, 0.59 mmol, 1.2 eq.) were added under nitrogen and the reaction mixture was stirred for 2 h at room temperature. The HPLC-MS analysis revealed the formation of the target product. The solvent was concentrated in vacuo and the resulting residue was rinsed with DCM and washed with H ₂ O. The organic phase was dried over Na ₂ SO ₄ and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title product as a white solid (0.040 g, 0.086 mmol, 18% yield, 96% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.68 (d, J = 2.59 Hz, 1H) 8.26 (dd, J = 8.85, 2.59 Hz, 1H) 7.65 (d, J = 8.54 Hz, 2H) 7.29 (d, J = 8.85 Hz, 1H) 7.25 (d, J = 8.54 Hz, 2H) 3.66- 3.76 (m, 1H) 2.45 – 2.55 (m, 1H) 1.79 (d, J = 11.59 Hz, 5H) 1.29-1.53 (m, 4H) 1.17-1.28 (m, 3H) 1.08-1.16 (m, 2H) HRMS (ESI) calcd for C ₂₃ H ₂₄ N ₆ O ₃ S [M + H] ⁺ 465.1704, found 465.1713 Example 280: N-(4-cyclohexylphenyl)-5-nitro-2-[(1-phenyl-1H-tetrazol-5- yl)sulfanyl]benzamide

To a solution of 5-nitro-2-(1-phenyl-1H-tetrazol-5-ylsulfanyl)-benzoic acid (0.200 g, 0.58 mmol, 1 eq.) in dry DMF (3 mL) DIPEA (0.155 mL, 0.87 mmol, 1.5 eq.), TBTU (0.205 g, 0.64 mmol, 1.1 eq.) and 4-cyclohexyl-aniline (0.122 g, 0.70 mmol, 1.2 eq.) were added under nitrogen. The reaction mixture was stirred at room temperature until the disappearance of the starting material (2 h). The solvent was evaporated in vacuo, the resulting residue was rinsed with AcOEt and washed with 1N aqueous HCl solution, saturated aqueous solution of NaHCO ₃ and brine. The organic phase was dried over Na ₂ SO ₄ , concentrated and the crude was purified on preparative-HPLC to give the title compound as a white solid (0.020 g, 0.04 mmol, 7% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.79 (s,1H) 8.62 (d, J = 2.44 Hz, 1H) 8.24 (dd, J = 8.85, 2.59 Hz, 1H) 7.68-7.72 (m, 2H) 7.57-7.63 (m, 5H) 7.41 (d, J = 8.85 Hz, 1H) 7.24 (d, J = 8.54 Hz, 2H) 2.53 (m, 1H)1.68-1.84 (m, 5H) 1.18-1.47 (m, 5H) HRMS (ESI) calcd for C ₂₆ H ₂₄ N ₆ O ₃ S [M + H] ⁺ 501.1704, found 501.1704 Example 281: N-[4-(1-methylcyclohexyl)phenyl]-2-[(1-methyl-1H-tetrazol-5- yl)sulfanyl]- 5-nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.025 g, 0.09 mmol, 1 eq.) in dry DMF (1.5 mL) DIPEA (0.024 mL, 0.14 mmol, 1.56 eq.), TBTU (0.032 g, 0.10 mmol, 1.1 eq.) and 4-(1-methylcyclohexyl)aniline (0.019 g, 0.10 mmol, 1.1 eq.) were added under nitrogen. The reaction mixture was stirred at room temperature overnight. The solvent was then evaporated in vacuo, the resulting residue was rinsed with AcOEt and washed with 1N aqueous HCl solution, saturated aqueous solution of NaHCO ₃ and brine. The organic phase was dried over Na ₂ SO ₄ , concentrated and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a white solid (0.014 g, 0.031 mmol, 35% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.87 (s, 1H) 8.69 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.69 (d, J = 8.69 Hz, 2H) 7.41 (d, J = 8.69 Hz, 2H) 7.17 (d, J = 9.00 Hz, 1H) 4.03 – 4.06 (m, 3H) 1.94 – 2.05 (m, 2H) 1.31 – 1.60 (m, 8H) 1.13 – 1.16 (m, 3H) HRMS (ESI) calcd for C ₂₂ H ₂₄ N ₆ O ₃ S [M + H] ⁺ 453.1704, found 453.1710 Example 282: 2-[(1-methyl-1H-tetrazol-5-yl)sulfonyl]-5-nitro-N-[4-(propan -2-yl)phenyl] benzamide N-(4-isopropyl-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl) -5-nitro-benzamide (0.060 g, 0.16 mmol, 1 eq.) was dissolved in dry DCM (4 mL) under nitrogen and was treated with m-CPBA (75%) (0.109 g, 0.63 mmol, 4 eq.). The reaction mixture was stirred overnight at room temperature. HPLC-MS showed that the conversion was complete. The solvent was then removed under reduced pressure, the resulting solid was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a white solid (0.050 g, 0.116 mmol, 74% yield, 95% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.01 (s, 1H) 8.66 – 8.73 (m, 2H) 8.63 (d, J = 1.68 Hz, 1H) 7.57 (d, J = 8.54 Hz, 2H) 7.27 (d, J = 8.54 Hz, 2H) 4.33 (s, 3H) 2.88 (d, J = 6.86 Hz, 1H) 1.20 (d, J = 7.02 Hz, 6H) HRMS (ESI) calcd for C ₁₈ H ₁₈ N ₆ O ₅ S [M + H] ⁺ 431.1132, found 431.1138 Example 283: N-(4-cyclohexylphenyl)-2-[(1-methyl-1H-tetrazol-5-yl)sulfany l]-5-(2,2,2- trifluoro-1,1-dihydroxyethyl)benzamide A solution of N-(4-cyclohexyl-phenyl)-2-fluoro-5-(2,2,2-trifluoro-1,1-acet yl)-benzamide (0.043 g, 0.11 mmol, 1 eq.) and (1-methyltetrazol-5-yl)sulfanylpotassium (0.017 g, 0.11 mmol, 1 eq.) in dry ACN (1.5 mL) under nitrogen was heated to reflux until the disappearance of the starting material (5 h). After cooling to room temperature, the solvent was concentrated to dryness and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a pale yellow solid (0.030 g, 0.059 mmol, 55% yield, 95% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.66 (s, 1H) 7.88 (d, J = 1.37 Hz, 1H) 7.80 (br. s, 2H) 7.65 (dd, J = 8.54, 1.68 Hz, 1H) 7.62 (d, J = 8.54 Hz, 2H) 7.23 (dd, J = 9.84, 8.62 Hz, 3H) 3.98 (s, 3H) 2.48 (m,1H) 1.79 (d, J = 11.90 Hz, 4H) 1.67 – 1.72 (m, 1H) 1.32 – 1.49 (m, 4H) 1.08 – 1.29 (m, 1H) HRMS (ESI) calcd for C ₂₃ H ₂₄ F ₃ N ₅ O ₃ S [M + H] ⁺ 508.1625, found 508.1633 Example 284: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(tetrah ydro-2H-pyran- 4-yl)phenyl]benzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.080 g, 0.28 mmol, 1 eq.) in dry DMF (2 mL) DIPEA (0.074 mL, 0.42 mmol, 1.5 eq.), TBTU (0.108 g, 0.34 mmol, 1.2 eq.) and 4-(tetrahydro-pyran-4-yl)-phenylamine (0.050 g, 0.28 mmol, 1 eq.) were added under nitrogen. The reaction mixture was stirred at room temperature overnight. The solvent was then evaporated under reduced pressure and the crude was purified by flash chromatography on silica gel eluting with DCM/MeOH (99/1) to afford the title compound as a pale yellow solid (0.110 g, 0.25 mmol, 90% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.88 (s, 1H) 8.69 (d, J = 2.59 Hz, 1H) 8.25 (dd, J = 8.92, 2.52 Hz, 1H) 7.68 (d, J = 8.39 Hz, 2H) 7.30 (d, J = 8.54 Hz, 2H) 7.17 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 3.96 (dd, J = 10.52, 2.90 Hz, 2H) 3.44 (td, J = 11.21, 3.05 Hz, 2H) 2.77 (s, 1H) 1.58 – 1.80 (m, 4H) HRMS (ESI) calcd for C ₂₀ H ₂₀ N ₆ O ₄ S [M + H] ⁺ 441.1340, found 441.1338 Example 285: N-(4-cyclohexylphenyl)-N-methyl-2-[(1-methyl-1H-tetrazol-5-y l)sulfanyl]- 5-nitrobenzamide N-(4-cyclohexyl-phenyl)-2-(1-methyl-1H-tetrazol-5-ylsulfanyl )-5-nitrobenzamide (0.020 g, 0.05 mmol, 1 eq.) was treated with Cs ₂ CO ₃ (0.022 g, 0.07 mmol, 1.4 eq.) and methyl iodide (0.003 mL, 0.05 mmol, 1 eq.) in dry DMF (1 mL) under nitrogen. The reaction mixture was stirred at room temperature until the disappearance of the starting material (6 h). The solvent was evaporated in vacuo and the resulting residue was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a pale-yellow solid (0.018 g, 0.04 mmol, 90% yield, 97% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 7.96 (d, J = 9.76 Hz, 2H) 6.99 – 7.37 (m, 5H) 4.06 (s, 3H) 3.43 (m, 3H) 2.40 (br. s., 1H) 1.50 – 1.85 (m, 5H) 1.12 – 1.38 (m, 5H) HRMS (ESI) calcd for C ₂₂ H ₂₄ N ₆ O ₃ S [M + H] ⁺ 453.1704, found 453.1710 Example 286: N-[4-(butan-2-yl)phenyl]-2-[(1-methyl-1H-tetrazol-5-yl)sulfa nyl]-5- nitrobenzamide To a solution of 2-(1-methyl-1H-tetrazol-5-ylsulfanyl)-5-nitro-benzoic acid (0.080 g, 0.28 mmol, 1 eq.) in dry DMF (2 mL) DIPEA (0.074 mL, 0.42 mmol, 1.5 eq.), TBTU (0.108 g, 0.34 mmol, 1.2 eq.) and 4-sec-butyl-phenylamine (0.043 mL, 0.28 mmol, 1 eq.) were added under nitrogen. The reaction mixture was stirred at room temperature overnight. The solvent was then evaporated in vacuo and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (8/2) to afford the title compound as a pale-yellow solid (0.070 g, 0.17 mmol, 60% yield, 99% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.86 (s, 1H) 8.70 (d, J = 2.44 Hz, 1H) 8.25 (dd, J = 8.85, 2.59 Hz, 1H) 7.67 (d, J = 8.54 Hz, 2H) 7.23 (d, J = 8.54 Hz, 2H) 7.17 (d, J = 8.85 Hz, 1H) 4.05 (s, 3H) 2.56 – 2.63 (m, 1H) 1.49 – 1.64 (m, 2H) 1.20 (d, J = 6.86 Hz, 3H) 0.78 (t, J = 7.32 Hz, 3H) HRMS (ESI) calcd for C ₁₉ H ₂₀ N ₆ O ₃ S [M + H] ⁺ 413.1391, found 413.1393 Example 287: N-(4-cyclohexylphenyl)-5-(methylsulfonyl)-2-[(1-methyl-1H-te trazol-5- yl)sulfanyl]benzamide A solution of 5-methylsulfonyl-2-(1-methyltetrazol-5-yl)sulfanyl-benzoyl chloride (0.086 g, 0.26 mmol, 1 eq.) in dry DCM (3 mL) was cooled to 0 °C. DIPEA (0.069 mL, 0.39 mmol, 1.5 eq.) and 4-cyclohexyl-phenylamine (0.045 g, 0.26 mmol, 1 eq.) were added to the solution and the reaction mixture was stirred at room temperature until the disappearance of the starting material (2 h). The mixture was diluted with DCM and washed with H ₂ O, 1N aqueous HCl and brine. The organic phase was dried over Na ₂ SO ₄ and evaporated to dryness in vacuo. The crude was purified by flash chromatography on silica gel eluting with DCM/MeOH (99/1) to afford the title compound as a white solid (0.045 g, 0.096 mmol, 37% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.80 (s, 1H) 8.30 (d, J = 1.98 Hz, 1H) 7.94 (dd, J = 8.46, 2.06 Hz, 1H) 7.63 (d, J = 8.54 Hz, 2H) 7.24 (t, J = 8.08 Hz, 3H) 4.03 (s, 3H) 3.29 (s, 3H) 2.48 (m, 1H) 1.79 (d, J = 11.29 Hz, 4H) 1.67 – 1.73 (m, 1H) 1.31 – 1.47 (m, 4H) 1.17 – 1.29 (m, 1H) HRMS (ESI) calcd for C ₂₂ H ₂₅ N ₅ O ₃ S ₂ [M + H] ⁺ 472.1472, found 472.1477 Example 288: N-(4-cyclohexylphenyl)-N-(2-hydroxyethyl)-2-[(1-methyl-1H-te trazol-5- yl)sulfanyl]-5-nitrobenzamide A solution of 2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro-benzoyl chloride (0.054 g, 0.18 mmol, 1 eq.) in dry DCM (3 mL) was cooled to 0 °C. DIPEA (0.064 mL, 0.36 mmol, 2 eq.) and 2-[(4- cyclohexylphenyl)amino]ethan-1-ol (0.040 g, 0.18 mmol, 1 eq.) were added to the solution and the reaction mixture was stirred at room temperature until the disappearance of the starting material (2 h). The solvent was evaporated in vacuo and the crude was purified by preparative- HPLC to afford the title compound as a white solid (0.030 g, 0.062 mmol, 35% yield, 97% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 7.90 – 8.01 (m, 2H) 7.25 (d, J = 7.93 Hz, 2H) 7.18 – 7.22 (m, 1H) 7.11 (d, J = 7.93 Hz, 2H) 4.95 (t, J = 5.41 Hz, 1H) 4.06 (s, 3H) 3.92 (t, J = 5.34 Hz, 2H) 3.65 (d, J = 5.64 Hz, 2H) 2.39 (br. s., 1H) 1.50 – 1.84 (m, 5H) 1.06 – 1.42 (m, 5H) HRMS (ESI) calcd for C ₂₃ H ₂₆ N ₆ O ₄ S [M + H] ⁺ 483.1809, found 483.1804 Example 289: 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitro-N-[4-(propan -2-yl)-2- (trifluoromethyl)phenyl]benzamide A solution of 2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro-benzoyl chloride (0.108 g, 0.36 mmol, 1 eq.) in dry DCM (5 mL) was cooled to 0 °C. DIPEA (0.123 mL, 0.70 mmol, 2 eq.) and 4- isopropyl-2-trifluoromethyl-phenylamine (0.060 mL, 0.36 mmol, 1 eq.) were added to the solution and the reaction mixture was stirred at room temperature overnight. The solvent was then evaporated in vacuo and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (7/3) to afford the title compound as a white solid (0.050 g, 0.107 mmol, 30% yield, 91% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 10.82 (s, 1 H) 8.72 (d, J=2.14 Hz, 1 H) 8.27 (dd, J=8.85, 2.59 Hz, 1 H) 7.65 - 7.70 (m, 2 H) 7.55 (d, J=8.69 Hz, 1 H) 7.14 (d, J=9.00 Hz, 1 H) 4.05 (s, 3 H) 2.99 - 3.15 (m, 1 H) 1.24 - 1.30 (m, 6 H) HRMS (ESI) calcd for C ₁₉ H ₁₇ F ₃ N ₆ O ₃ S [M + H] ⁺ 467.1108, found 467.1101 Example 290: N-(5-cyclopentylpyrimidin-2-yl)-2-(1,3-thiazol-2-ylsulfanyl) -5- [(trifluoromethyl)sulfonyl]benzamide A solution of 2-thiazol-2-ylsulfanyl-5-(trifluoromethylsulfonyl)benzoyl chloride (0.097 g, 0.25 mmol, 1 eq.) in dry DCM (3 mL) was cooled to 0 °C. DIPEA (0.092 mL, 0.51 mmol, 2 eq.) and 5-cyclopentyl-pyrimidin-2-ylamine (0.041 g, 0.25 mmol, 1 eq.) were added to the solution and the reaction mixture was stirred for 2 h at room temperature. The solvent was evaporated in vacuo and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (6/4) to afford the title compound as a white solid (0.030 g, 0.058 mmol, 23% yield, 94% purity). ¹ H NMR (600 MHz, CDCl ₃ -d) δ ppm 9.95 (br. s, 1H) 8.61 (s, 2 H) 8.38 (s, 1 H) 8.03 (d, J=3.08 Hz, 1 H) 7.96 (d, J=8.48 Hz, 1 H) 7.61 (d, J=3.34 Hz, 1 H) 7.52 (d, J=8.48 Hz, 1 H) 3.05 (quin, J=8.54 Hz, 1 H) 2.10 - 2.22 (m, 2 H) 1.84 - 1.93 (m, 2 H) 1.77 (m, J=7.19, 4.88 Hz, 2 H) 1.60 (dd, J=11.30, 8.73 Hz, 2 H) HRMS (ESI) calcd for C ₂₀ H ₁₇ F ₃ N ₄ O ₃ S ₃ [M + H] ⁺ 515.0488, found 515.0487 Example 291: N-(4-cyclopentylphenyl)-5-nitro-2-{[1-(2,2,2-trifluoroethyl) -1H-1,2,3,4- tetrazol-5-yl]sulfanyl}benzamide To a solution of 5-nitro-2-{[1-(2,2,2-trifluoroethyl)-1H-1,2,3,4-tetrazol-5-y l]sulfanyl}benzoic acid (0.020 g, 0.06 mmol, 1 eq.) in dry DMF (1 mL), DIPEA (0.022 mL, 0.123 mmol, 20 eq.), TBTU (0.031 g, 0.097 mmol, 1.6 eq.) and 4-cyclopentylaniline (0.009 g, 0.06 mmol, 1 eq.) were added under nitrogen. The reaction mixture was stirred at room temperature overnight. The solvent was then evaporated in vacuo and the crude was purified by flash chromatography on silica gel eluting with hexane/AcOEt (9/1) to afford the title compound as a pale-yellow solid (0.012 g, 0.024 mmol, 41% yield, 97% purity). ¹ H NMR (500 MHz, DMSO- d6) δ ppm 1.45 – 1.82 (m, 6 H) 1.97 - 2.08 (m, 2 H) 2.90 - 3.03 (m, 1 H) 5.71 (q, J=8.80 Hz, 2 H) 7.27 (dd, J=8.62, 7.40 Hz, 3 H) 7.65 (d, J=8.54 Hz, 2 H) 8.20 - 8.40 (m, 1 H) 8.72 (d, J=2.59 Hz, 1 H) 10.90 (s, 1 H) HRMS (ESI) calcd for C ₂₁ H ₁₉ F ₃ N ₆ O ₃ S [M + H] ⁺ 493.1264, found 493.1246 Example 292: tert-butyl N-{2-[5-({2-[(5-cyclopentyl-3-fluoropyridin-2-yl)carbamoyl]- 4- nitrophenyl}sulfanyl)-1H-1,2,3,4-tetrazol-1-yl]ethyl}carbama te

To a solution of lithium 2-{[1-(2-{[(tert-butoxy)carbonyl]amino}ethyl)-1H-1,2,3,4-tet razol-5- yl]sulfanyl}-5-nitrobenzoate (0.0285 g, 0.06 mmol, 1 eq.) in dry pyridine (0.60 mL), 5- cyclopentyl-3-fluoropyridin-2-amine (0.0153 g, 0.08 mmol, 1.2 eq.) was added. The reaction mixture was cooled to 0 °C and then POCl3 (0.015 g, 0.1 mmol, 1.5 eq.) was slowly added. After 15 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt (7/3 to 1/1) to afford the title compound as a white solid (0.033 g, 0.06 mmol, 88% yield, 98% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.22 (s, 9 H) 1.51 - 1.72 (m, 4 H) 1.74 - 1.89 (m, 2 H) 2.00 - 2.16 (m, 2 H) 3.04 - 3.17 (m, 1 H) 3.37 (m, 2 H) 4.47 (t, J=5.34 Hz, 2 H) 7.01 (t, J=5.87 Hz, 1 H) 7.19 (d, J=9.00 Hz, 1 H) 7.80 (dd, J=11.21, 1.75 Hz, 1 H) 8.23 (dd, J=8.92, 2.52 Hz, 1 H) 8.26 (s, 1 H) 8.80 (d, J=2.29 Hz, 1 H) 11.41 (s, 1 H) HRMS (ESI) calcd for C ₂₅ H ₂₉ FN ₈ O ₅ S [M + H] ⁺ 573.2038, found 573.2042 Example 293: 2-{[1-(2-aminoethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-N-(5 -cyclopentyl-3- fluoropyridin-2-yl)-5-nitrobenzamide hydrochloride To a solution of tert-butyl N-{2-[5-({2-[(5-cyclopentyl-3-fluoropyridin-2-yl)carbamoyl]- 4- nitrophenyl}sulfanyl)-1H-1,2,3,4-tetrazol-1-yl]ethyl}carbama te (0.030 g, 0.05 mmol, 1 eq.) in a mixture of DCM (0.5 mL) and MeOH (0.5 mL), 4M HCl in 1,4-dioxane (0.1 mL) was added. The reaction mixture was stirred at room temperature for 8 h. The solvent was evaporated to dryness and the residue was rinsed with DCM-Et ₂ O. The solid was washed with Et ₂ O 3 times to obtain the title compound as pale pink solid (0.020 g, 0.04 mmol, 75% yield, 98% purity). 1H NMR (500 MHz, DMSO- d ₆ ) δ ppm 1.53 - 1.73 (m, 4 H) 1.74 - 1.87 (m, 2 H) 2.03 - 2.19 (m, 2 H) 2.99 - 3.19 (m, 1 H) 3.42 (m, 2 H) 4.68 (t, J=6.10 Hz, 2 H) 7.20 (d, J=9.00 Hz, 1 H) 7.81 (dd, J=11.13, 1.68 Hz, 1 H) 8.09 (br. s., 2 H) 8.19 - 8.33 (m, 2 H) 8.85 (d, J=2.59 Hz, 1 H) 11.46 (s, 1 H) HRMS (ESI) calcd for C ₂₀ H ₂₁ FN ₈ O ₃ S [M + H] ⁺ 473.1514, found 473.1519 Example 294: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-5-nitro-2-({1-[2-(oxa n-2- yloxy)ethyl]-1H-1,2,3,4-tetrazol-5-yl}sulfanyl)benzamide To a solution of lithium 5-nitro-2-({1-[2-(oxan-2-yloxy)ethyl]-1H-1,2,3,4-tetrazol-5- yl}sulfanyl)benzoate (0.096 g, 0.24 mmol, 1 eq.) in dry pyridine (1.76 mL), 5-cyclopentyl-3- fluoropyridin-2-amine (0.057 g, 0.29 mmol, 1.2 eq.) was added. The reaction mixture was cooled to 0 °C and then POCl3 (0.056 g, 0.36 mmol, 1.5 eq.) was slowly added. After 15 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt (7/3 to 1/1) to afford the title compound as a white solid (0.080 g, 0.14 mmol, 60% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.05 - 2.17 (m, 14 H) 2.93 - 3.18 (m, 1 H) 3.30 (m, 2 H) 3.67 - 3.86 (m, 1 H) 3.89 - 4.04 (m, 1 H) 4.48 (d, J=4.12 Hz, 1 H) 4.62 - 4.74 (m, 2 H) 7.17 (d, J=8.85 Hz, 1 H) 7.80 (dd, J=11.06, 1.60 Hz, 1 H) 8.24 - 8.27 (m, 1 H) 8.27 - 8.31 (m, 1 H) 8.76 (d, J=2.44 Hz, 1 H) 11.40 (s, 1 H) HRMS (ESI) calcd for C ₂₅ H ₂₈ FN ₇ O ₅ S [M + H] ⁺ 558.1929, found 558.1927 Example 298: N-(4-{2-azaspiro[3.3]heptan-2-yl}phenyl)-2-[(1-methyl-1H-1,2 ,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.020 g, 0.07 mmol, 1 eq.) in dry pyridine (0.63 mL), 4-{2-azaspiro[3.3]heptan-2-yl}aniline (0.013 g, 0.07 mmol, 1 eq.) was added. The reaction mixture was cooled to 0 °C and POCl3 (0.012 g, 0.08 mmol, 1.1 eq.) was slowly added. After 10 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt (7/3) to afford the title compound as orange solid (0.005 g, 0.01 mmol, 16% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.83 (quin, J=7.63 Hz, 2 H) 2.17 (t, J=7.55 Hz, 4 H) 3.76 (s, 4 H) 3.99 - 4.08 (m, 3 H) 6.44 (d, J=8.85 Hz, 2 H) 7.12 (d, J=8.85 Hz, 1 H) 7.53 (d, J=8.69 Hz, 2 H) 8.22 (dd, J=8.92, 2.52 Hz, 1 H) 8.67 (d, J=2.44 Hz, 1 H) 10.66 (s, 1 H) HRMS (ESI) calcd for C ₂₁ H ₂₁ N ₇ O ₃ S [M + H] ⁺ 452.1499, found 452.1503 Example 299: N-(4-{6,6-difluoro-2-azaspiro[3.3]heptan-2-yl}phenyl)-2-[(1- methyl-1H- 1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.020 g, 0.07 mmol, 1 eq.) in dry pyridine (0.63 mL), 4-{6,6-difluoro-2-azaspiro[3.3]heptan-2-yl}aniline (0.016 g, 0.07 mmol, 1 eq.) was added. The reaction mixture was cooled to 0 °C and POCl3 (0.012 g, 0.08 mmol, 1.1 eq.) was slowly added. After 10 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt (1/1) to afford the title compound as orange solid (0.0038 g, 0.01 mmol, 11% yield, 100% purity). ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.86 (t, J=12.58 Hz, 4 H) 3.89 (s, 4 H) 4.04 (s, 3 H) 6.48 (d, J=8.85 Hz, 2 H) 7.13 (d, J=8.85 Hz, 1 H) 7.55 (d, J=8.69 Hz, 2 H) 8.23 (dd, J=8.85, 2.44 Hz, 1 H) 8.67 (d, J=2.44 Hz, 1 H) 10.68 (s, 1 H) HRMS (ESI) calcd for C ₂₁ H ₁₉ F ₂ N ₇ O ₃ S [M + H] ⁺ 488.1311, found 488.1313 Example 300: N-(5-cyano-4-cyclopentyl-2-fluorophenyl)-2-[(1-methyl-1H-1,2 ,3,4-tetrazol- 5-yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.149 g, 0.53 mmol, 1 eq.) in dry pyridine (4.7 mL), 5-amino-2-cyclopentyl-4-fluorobenzonitrile (0.119 g, 0.58 mmol, 1.1 eq.) was added. The reaction mixture was cooled to 0 °C and POCl3 (0.090 g, 0.58 mmol, 1.1 eq.) was slowly added. After 30 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt (7/3) to afford the title compound as a white solid (0.088 g, 0.19 mmol, 36% yield, 94% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.51 - 1.76 (m, 4 H) 1.77 - 1.93 (m, 2 H) 2.09 (d, J=8.39 Hz, 2 H) 3.30 (m, 1H) 4.05 (s, 3 H) 7.04 - 7.24 (m, 1 H) 7.59 (d, J=11.74 Hz, 1 H) 8.19 (d, J=7.47 Hz, 1 H) 8.28 (dd, J=8.92, 2.52 Hz, 1 H) 8.77 (d, J=2.44 Hz, 1 H) 11.06 (br. s., 1 H) HRMS (ESI) calcd for C ₂₁ H ₁₈ FN ₇ O ₃ S [M + H] ⁺ 468.1249, found 468.1244 Example 301: 2-cyclopentyl-4-fluoro-5-{2-[(1-methyl-1H-1,2,3,4-tetrazol-5 -yl)sulfanyl]-5- nitrobenzamido}benzamide In a reactor N-(5-cyano-4-cyclopentyl-2-fluorophenyl)-2-[(1-methyl-1H-1,2 ,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide (0.084 g, 0.18 mmol, 1 eq.), acetaldehyde oxime (0.215 g, 3.60 mmol, 20 eq.), indium(III) chloride (0.004 g, 0.02 mmol, 0.1 eq.) and toluene (0.5 mL) were added. The reaction mixture was stirred at 100 °C for 6 h. The HPLC-MS analysis showed the presence of the planned product. Water was added and the mixture was extracted with AcOEt 3 times, organic layers were combined and washed brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column DCM/MeOH (97/3) to afford the title compound as a white solid (0.029 g, 0.06 mmol, 33% yield, 96% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.44 - 1.70 (m, 4 H) 1.72 - 1.90 (m, 2 H) 1.91 - 2.05 (m, 2 H) 3.38 (q, J=7.02 Hz, 1 H) 4.06 (s, 3 H) 7.13 (d, J=9.00 Hz, 1 H) 7.32 (d, J=12.20 Hz, 1 H) 7.46 (s, 1 H) 7.63 (d, J=7.78 Hz, 1 H) 7.85 (s, 1 H) 8.26 (dd, J=8.92, 2.52 Hz, 1 H) 8.75 (d, J=2.44 Hz, 1 H) 10.87 (s, 1 H) HRMS (ESI) calcd for C ₂₁ H ₂₀ FN ₇ O ₄ S [M + H] ⁺ 486.1354, found 486.1351 Example 302: N-(4-cyclopentyl-2-methylphenyl)-2-[(1-methyl-1H-1,2,3,4-tet razol-5- yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.090 g, 0.32 mmol, 1 eq.) in dry pyridine (3 mL), 4-cyclopentyl-2-methylaniline (0.062 g, 0.35 mmol, 1.1 eq.) was added. The reaction mixture was cooled to 0 °C and POCl3 (0.055 g, 0.35 mmol, 1.1 eq.) was slowly added. After 30 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt (7/3) to afford the title compound as a white solid (0.033 g, 0.08 mmol, 24% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.44 - 1.60 (m, 2 H) 1.61 - 1.72 (m, 2 H) 1.73 - 1.87 (m, 2 H) 1.94 - 2.09 (m, 2 H) 2.27 (s, 3 H) 2.88 - 3.03 (m, 1 H) 4.06 (s, 3 H) 7.10 - 7.16 (m, 2 H) 7.18 (s, 1 H) 7.30 (d, J=7.93 Hz, 1 H) 8.25 (dd, J=8.85, 2.59 Hz, 1 H) 8.74 (d, J=2.29 Hz, 1 H) 10.48 (s, 1 H) HRMS (ESI) calcd for C ₂₁ H ₂₂ N ₆ O ₃ S [M + H] ⁺ 439.1547, found 439.1551 Example 303: N-(4-cyclopentyl-2-fluoro-6-methylphenyl)-2-[(1-methyl-1H-1, 2,3,4- tetrazol-5-yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.090 g, 0.32 mmol, 1 eq.) in dry pyridine (3 mL), 4-cyclopentyl-2-fluoro-6-methylaniline (0.068 g, 0.35 mmol, 1.1 eq.) was added. The reaction mixture was cooled to 0 °C and POCl3 (0.055 g, 0.35 mmol, 1.1 eq.) was slowly added. After 30 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt (7/3) to afford the title compound as a white solid (0.089 g, 0.19 mmol, 61% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.47 - 1.61 (m, 2 H) 1.61 - 1.73 (m, 2 H) 1.73 - 1.88 (m, 2 H) 1.96 - 2.11 (m, 2 H) 2.28 (s, 3 H) 2.88 - 3.08 (m, 1 H) 4.06 (s, 3 H) 6.98 - 7.15 (m, 3 H) 8.27 (dd, J=8.85, 2.59 Hz, 1 H) 8.75 (d, J=2.44 Hz, 1 H) 10.55 (s, 1 H) HRMS (ESI) calcd for C ₂₁ H ₂₁ FN ₆ O ₃ S [M + H] ⁺ 457.1453, found 457.1457 Example 304: N-(5-cyclopentyl-3-methylpyridin-2-yl)-2-[(1-methyl-1H-1,2,3 ,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide To a solution of 2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzo ic acid (0.116 g, 0.41 mmol, 1 eq.) in dry pyridine (3.8 mL), 5-cyclopentyl-3-methylpyridin-2-amine (0.080 g, 0.45 mmol, 1.1 eq.) was added. The reaction mixture was cooled to 0 °C and POCl ₃ (0.070 g, 0.45 mmol, 1.1 eq.) was slowly added. After 30 min water was added to quench the reaction. The mixture was extracted with DCM 3 times, organic layers were combined and washed with a 10% aqueous solution of citric acid and brine, dried on Na ₂ SO ₄ and evaporated to dryness. The crude was purified by chromatographic column hexane/AcOEt (7/3) to afford the title compound as a beige solid (0.020 g, 0.05 mmol, 11% yield, 100% purity). 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.49 - 1.63 (m, 2 H) 1.63 - 1.74 (m, 2 H) 1.73 - 1.90 (m, 2 H) 1.97 - 2.15 (m, 2 H) 2.28 (s, 3 H) 2.94 - 3.07 (m, 1 H) 4.05 (s, 3 H) 7.09 (d, J=8.85 Hz, 1 H) 7.67 (br. s., 1 H) 8.17 - 8.30 (m, 2 H) 8.74 (br. s., 1 H) 11.12 (br. s., 1 H) HRMS (ESI) calcd for C ₂₀ H ₂₁ FN ₇ O ₃ S [M + H] ⁺ 459.1483, found 459.1485 Example 305: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[1-(3- hydroxypropyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-nitroben zamide N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-iodo-5-nitrobenzamide (80 mg; 0.14 mmol; 1.0 eq.) and 1(3-hydroxypropyl)-4,5-dihydro-1H-1,2,3,4-tetrazole-5-thione (51 mg; 0.29 mmol; 2.0 eq.) were dissolved in 3.2 mL dry 1,4-dioxane. To this solution DIPEA (98 µL; 0.58 mmol; 4.0 eq.); tris((dibenzylideneacetone)dipalladium(0) (13 mg; 0.01 mmol; 0.1 eq.) and 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (17 mg; 0.03 mmol; 0.2 eq.) were added under argon atmosphere and th e mixture was stirred at 90 °C for 45 min. The reaction solution was evaporated to dryness. Purification by preparative HPLC (C18; water + 0.1% TFA/5 - 100% ACN + 0.1% TFA) to get N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2- {[1-(3-hydroxypropyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-n itrobenzamide (51.3 mg; 0.09 mmol; 60% yield; 99.5% purity) as a white solid. LC-MS method B: (M+H) 588.1; Rt: 1.75 min 1H NMR (500 MHz, DMSO-d ₆ ) δ 11.95 - 11.91 (m, 1H), 8.87 - 8.82 (m, 1H), 8.74 (d, J = 2.1 Hz, 1H), 8.47 (dd, J = 9.9, 2.1 Hz, 1H), 8.32 - 8.26 (m, 1H), 7.18 - 7.09 (m, 1H), 4.55 - 4.45 (m, 2H), 3.41 (t, J = 5.9 Hz, 2H), 2.34 - 1.93 (m, 2H) Example 306: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[1-(1- hydroxy-2-methylpropan-2-yl)-1H-1,2,3,4-tetrazol-5-yl]sulfan yl}-5-nitrobenzamide

N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-iodo-5-nitrobenzamide (100 mg; 0.18 mmol; 1.0 eq.) and 2-methyl-2-(5-sulfanyl-1H-1,2,3,4-tetrazol-1-yl)propan-1-ol (63 mg; 0.36 mmol; 2.0 eq.) were dissolved in 4.0 mL dry 1,4-dioxane. DIPEA (122 µL; 0.72 mmol; 4.0 eq.); tris(dibenzylideneacetone)dipalladium(0) (16.5 mg; 0.02 mmol; 0.1 eq.) and 9 ,9-dimethyl- 4,5-bis(diphenylphosphino)xanthene (21 mg; 0.04 mmol; 0.2 eq.) were added under argon atmosphere and the reaction mixture was stirred in the microwave at 80 °C for 1 h. The reaction mixture was evaporated to dryness, diluted with AcOEt, washed 2 x with water and brine, dried over Na ₂ SO ₄ , filtrated and evaporated to dryness. Purification by flash chromatography (silica gel, heptane/0 - 100% AcOEt) and by preparative HPLC (C18; water + 0.1% TFA/5 - 100% ACN + 0.1% TFA) to get N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[1-(1- hydroxy-2-methylpropan-2-yl)-1H-1,2,3,4-tetrazol-5-yl]sulfan yl}-5-nitrobenzamide (70.3 mg; 0.11 mmol; 62% yield; 99% purity) as a white solid. LC-MS method B: (M+H) 602.1; Rt: 1.82 min 1H NMR (500 MHz, DMSO-d ₆ ) δ 11.93 (s, 1H), 8.79 (d, J = 2.6 Hz, 1H), 8.73 (d, J = 2.0 Hz, 1H), 8.46 (dd, J = 10.1, 2.0 Hz, 1H), 8.30 (dd, J = 8.9, 2.5 Hz, 1H), 7.21 (d, J = 8.9 Hz, 1H), 3.74 (s, 2H), 1.71 (s, 6H) Example 307: 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5-(2-{[1-(2-hydroxyethyl )-1H-1,2,3,4- tetrazol-5-yl]sulfanyl}-5-nitrobenzamido)benzamide N-[3-carbamoyl-4-(1,1,2,2,3,3,3-heptafluoropropyl)phenyl]-2- iodo-5-nitrobenzamide (115 mg; 0.19 mmol; 1.0 eq.) and 1-(2-hydroxyethyl)-1H-tetrazole-5(2H)-thione (57 mg; 0.37 mmol; 2.0 eq.) were dissolved in 4.6 mL dry 1,4-dioxane. DIPEA (126 µL; 0.74 mmol; 4.0 eq.); tris(dibenzylideneacetone)dipalladium(0) (17 mg; 0.02 mmol; 0.1 eq.) and 9,9-dimethyl-4,5- bis(diphenylphosphino)xanthene (22 mg; 0.04 mmol; 0.2 eq.) were added under argon atmosphere and the reaction solution was stirred at 90 °C for 45 min. The reaction miture was evaporated to dryness. Purification by flash chromatography (silica gel, heptane/10 - 100% AcOEt). The light orange solid was suspended in DCM and sonicated. The white precipitate was sucked off and dried under vacuum to get 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5-(2-{[1-(2- hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-nitrobenz amido)benzamide (76.6 mg; 0.13 mmol; 68% yield; 99% purity) as a white solid. LC-MS method B: (M+H) 598.1; Rt: 1.56 min 1H NMR (500 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.76 (d, J = 2.5 Hz, 1H), 8.29 (dd, J = 8.9, 2.5 Hz, 1H), 8.01 (dd, J = 8.8, 2.2 Hz, 1H), 7.93 - 7.90 (m, 2H), 7.71 (d, J = 8.8 Hz, 1H), 7.61 - 7.57 (m, 1H), 7.29 (d, J = 8.9 Hz, 1H), 5.11 (t, J = 5.5 Hz, 1H), 4.52 (t, J = 5.2 Hz, 2H), 3.78 (q, J = 5.4 Hz, 2H) Example 308: N-[3-carbamoyl-4-(1,1,2,2,3,3,3-heptafluoropropyl)phenyl]-2- [(1-methyl- 1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-nitrobenzamide Under argon atmosphere N-[3-carbamoyl-4-(1,1,2,2,3,3,3-heptafluoropropyl)phenyl]-2- iodo-5- nitrobenzamide (100 mg; 0.16 mmol; 1.0 eq.) and 1-methyl-2,5-dihydro-1H-1,2,3,4-tetrazole- 5-thione (30 mg; 0.25 mmol; 1.5 eq.) were dissolved in 2 mL dry 1,4-dioxane, then DIPEA (84 µL; 0.49 mmol; 3.0 eq.), tris(dibenzylideneacetone)dipalladium(0) (15 mg; 0.02 mmol; 0.1 eq.) and xantphos, (20 mg; 0.03 mmol; 0.2 eq.) were added and the orange solution was heated for 45 min at 90 °C.The reaction miture was evaporated to dryness. Purification by flash chromatography (silica gel, heptane/20 - 100% AcOEt). The oily residue was dissolved in DCM, sonicated, this thick slurry was diluted with heptane, sucked off and dried under vacuum to get N-[3-carbamoyl-4-(1,1,2,2,3,3,3-heptafluoropropyl)phenyl]-2- [(1-methyl-1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide (57 mg; 0.10 mmol; 58% yield; 95.4% purity) as a off-white solid. LC-MS method P: (M+H) 569.0; Rt: 1.47 min 1H NMR (500 MHz, DMSO-d ₆ ) δ 11.31 (s, 1H), 8.78 (d, J = 2.5 Hz, 1H), 8.29 (dd, J = 8.9, 2.5 Hz, 1H), 8.02 (dd, J = 8.8, 2.2 Hz, 1H), 7.93 - 7.90 (m, 2H), 7.71 (d, J = 8.8 Hz, 1H), 7.61 - 7.58 (m, 1H), 7.22 (d, J = 8.9 Hz, 1H), 4.06 (s, 3H) Example 309: N-(5-cyclopentyl-3-fluoropyridin-2-yl)-2-[(1-methyl-1H-1,2,3 ,4-tetrazol-5- yl)sulfanyl]-5-nitrobenzamide To a mixture of 2-[(1-methyl-1H-tetrazol-5-yl)sulfanyl]-5-nitrobenzoic acid (0.018 g, 0.12 mmol, 1 eq.) and 2-cyclopentylpyrimidin-5-amine (0.022 g, 0.12 mmol, 1 eq.) in dry pyridine (0.5 mL), POCl3 (0.054 g, 0.18 mmol, 1.5 eq.) at 0 °C was added. After addition, the cooling bath was removed and the reaction mixture was stirred at room temperature for 30 min then the solvent was evaporated to dryness and the residue dissolved in DCM, washed with H ₂ O, dried on Na ₂ SO ₄ , filtered and the solvent was evaporated. The crude was purified by chromatographic column hexane/AcOEt (9/1 to 1/1) to give the target compound as a white solid (0.070 g, 0.15 mmol, 83% yield, 91% purity). HPLC-MS Method F: (M+H) 444.10; Rt: 10.55 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.40 (s, 1H) 8.79 (d, J = 2.44 Hz, 1H) 8.20 – 8.33 (m, 2H) 7.81 (dd, J = 11.13, 1.68 Hz, 1H) 7.08 (d, J = 9.00 Hz, 1H) 4.05 (s, 3H) 3.10 (m, J = 8.54, 8.54 Hz, 1H) 1.96 – 2.14 (m, 2H) 1.74 – 1.88 (m, 2H) 1.48 -1.73 (m, 4H) HRMS (ESI) calcd for C ₁₉ H ₁₈ FN ₇ O ₃ S [M + H] ⁺ 444.1249, found 444.1238 Example 310: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[1-(2- hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-nitrobenz amide

N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2- yl]-2-iodo-5-nitrobenzamide (1.5 g; 2.66 mmol; 1.0 eq.) and 1-(2-hydroxyethyl)-1H-tetrazole-5(2H)-thione (716 mg; 4.65 mmol; 1.75 eq.) were dissolved in 60 ml dry 1,4-dioxane. To this solution DIPEA (1.81 ml; 10.6 mmol; 4.0 eq.); tris(dibenzylideneacetone)dipalladium(0) (243 mg; 0.27 mmol; 0.1 eq.) and 9,9- dimethyl-4,5-bis(diphenylphosphino)xanthene (311 mg; 0.53 mmol; 0.2 eq.) were added under argon atmosphere and the mixture was stirred at 90 °C for 45 min. The reaction solution was evaporated. Purification by flash chromatography (silica gel, heptane/0-100% AcOEt) to get N- [3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl]-2 -{[1-(2-hydroxyethyl)-1H-1,2,3,4- tetrazol-5-yl]sulfanyl}-5-nitrobenzamide (1.3 g; 2.26 mmol; 85% yield; 100% purity) as a light yellow solid LC-MS method B: (M+H) 574.0; Rt: 1.74 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.92 (s, 1H), 8.81 (d, J = 2.5 Hz, 1H), 8.74 (d, J = 2.0 Hz, 1H), 8.46 (dd, J = 10.0, 2.0 Hz, 1H), 8.30 (dd, J = 8.9, 2.6 Hz, 1H), 7.20 (d, J = 8.9 Hz, 1H), 5.09 (t, J = 5.5 Hz, 1H), 4.51 (t, J = 5.2 Hz, 2H), 3.78 (q, J = 5.3 Hz, 2H). Example 311: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-2 -[1-[2-(2- methoxyethoxy)ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide In a microwave vessel N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-2 -iodo-5- nitro-benzamide (0.400 g, 0.721 mmol, 1.00 eq) and 1-[2-(2-methoxyethoxy)ethyl]tetrazole-5- thiol (0.221 g, 1.08 mmol, 1.50 eq) were dissolved in 1,4-dioxane (7.21 mL). DIPEA (0.37 mL, 2.16 mmol, 3.00 eq) was added. The mixture was flushed with argon (10 min) and then tris(dibenzylideneacetone)dipalladium (0.0660 g, 0.0721 mmol, 0.100 eq) and 4,5- Bis(diphenylphosphino)-9,9-dimethylxanthene (0.0834 g, 0.144 mmol, 0.200 eq) were added. The vial was closed with a septum and heated by microwave (100 °C, 1 h). The reaction was diluted with AcOEt and extracted with water. The organic layer was washed with brine, dried over anhydrous Na ₂ SO ₄ and evaporated to dryness. The crude was purified by flash- chromatography (hexane/AcOEt: 6/4) to give the planned compound N-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-2-[1-[2-(2-meth oxyethoxy)ethyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (0.298 g, 0.4719 mmol, 0.655 eq, 65.5% yield, 97% purity ) as a white solid. HPLC-MS Method D: (M+H) 632; Rt: 3.11 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 3.08 (s, 3 H) 3.21 - 3.28 (m, 2 H) 3.38 - 3.44 (m, 2 H) 3.82 (t, J=5.18 Hz, 2 H) 4.64 (t, J=5.18 Hz, 2 H) 7.13 (d, J=8.90 Hz, 1 H) 8.30 (dd, J=8.90, 2.54 Hz, 1 H) 8.46 (d, J=9.81 Hz, 1 H) 8.73 (s, 1 H) 8.82 (d, J=2.54 Hz, 1 H) 11.94 (s, 1 H). Example 312: N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[1-[2-(2- methoxyethoxy)ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide In a microwave vessel N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-iodo-5-nitro-benzamid e (0.250 g, 0.549 mmol, 1.00 eq) and 1-[2-(2-methoxyethoxy)ethyl]tetrazole-5-thiol (0.168 g, 0.824 mmol, 1.50 eq) were dissolved in 1,4-dioxane (5.49 mL). DIPEA (0.28 mL, 1.65 mmol, 3.00 eq) was added. The mixture was flushed with argon (10 min) and then tris(dibenzylideneacetone)dipalladium (0.0503 g, 0.0549 mmol, 0.100 eq) and 4,5- bis(diphenylphosphino)-9,9-dimethylxanthene (0.0636 g, 0.110 mmol, 0.20 eq) were added. The vial was closed with a septum and heated by microwave (100 °C, 1 h). The reaction was diluted with AcOEt and extracted with water. The organic layer was washed with brine, dried over anhydrous Na ₂ SO ₄ and evaporated to dryness. The crude was purified by flash- chromatography (DCM/acetone 95/5). The obtained solid was treated with Et ₂ O and stirred for 30 min. The resulting suspension was filtered to give the planned compound N-(5-cyclopentyl- 3-fluoro-2-pyridyl)-2-[1-[2-(2-methoxyethoxy)ethyl]tetrazol- 5-yl]sulfanyl-5-nitro-benzamide (0.197 g, 0.3706 mmol, 0.675 eq, 67.5% yield, 100% purity) as a orange-beige solid. HPLC-MS Method D: (M+H) 532; Rt: 2.59 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 1.51 - 1.74 (m, 4 H) 1.74 - 1.90 (m, 2 H) 2.02 - 2.14 (m, 2 H) 3.00 - 3.15 (m, 4 H) 3.21 - 3.27 (m, 2 H) 3.39 - 3.43 (m, 2 H) 3.83 (t, J=5.09 Hz, 2 H) 4.63 (t, J=5.09 Hz, 2 H) 7.09 (d, J=8.90 Hz, 1 H) 7.80 (dd, J=11.08, 1.82 Hz, 1 H) 8.25 - 8.27 (m, 1 H) 8.28 (dd, J=8.90, 2.54 Hz, 1 H) 8.77 (d, J=2.54 Hz, 1 H) 11.39 (s, 1 H). Example 313: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-2 -[1-[2-(2- methoxyethoxy)ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide To a solution of N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-2 -[1-[2-(2- methoxyethoxy)ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide (0.380 g, 0.602 mmol, 1.00 eq) in acetonitrile (150 mL), iodotrimethylsilane (0.722 g, 0.491 mL, 3.61 mmol, 6.00 eq) was added and the solution was stirred at 40 °C overnight, under argon. Methanol was added and the reaction was stirred at rt for 10 min, then solvent was removed under reduced pressure. The brown crude was re-dissolved in DCM and washed with a 10% w/v solution of Na ₂ S ₂ O ₃ .The organic layer was washed with brine, dried over anhydrous Na ₂ SO ₄ and evaporated to dryness. The crude was purified by flash-chromatography (hexane/AcOEt 4/6) to give the compound as a beige solid. It was suspended in hexane/Et ₂ O and stirred for 1 h. Then it was filtered and washed with Et ₂ O to give the planned compound N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-2 -[1-[2-(2- hydroxyethoxy)ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide (0.255 g, 0.4130 mmol, 0.686 eq, 68.6% yield, 100% purity) as a white solid. HPLC-MS Method D: (M+H) 618; Rt: 2.25 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 11.93 (br. s., 1 H) 8.81 (d, J=2.50 Hz, 1 H) 8.74 (s, 1 H) 8.47 (d, J=8.99 Hz, 1 H) 8.31 (dd, J=8.92, 2.52 Hz, 1 H) 7.13 (d, J=8.95 Hz, 1 H) 4.64 (t, J=5.11 Hz, 2 H) 4.52 (br. s., 1 H) 3.84 (t, J=5.13 Hz, 2 H) 3.27 – 3.25 (m, 4H). Example 314: N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[1-[2-(2-hydroxyethox y) ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide To a solution of N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[1-[2-(2-methoxyethox y)ethyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (0.195 g, 0.367 mmol, 1.00 eq) in acetonitrile (91.7 mL), iodotrimethylsilane (0.440 g, 0.300 mL, 2.20 mmol, 6.00 eq) was added and the brown solution was stirred at 70 °C for 6 h, under argon. Methanol was added and the reaction was stirred at rt for 10 min, then solvent was removed under reduced pressure. The brown crude was re- dissolved in DCM and washed with a 10% w/v solution of Na ₂ S ₂ O ₃ . The organic layer was washed with brine, dried over anhydrous Na ₂ SO ₄ and evaporated to dryness. The crude was purified by preparativechromatography (Interchim Puriflash XS470 equipped with a HB102 C18 column and eluted with A: ACN 95%/H ₂ O 5% (30 to 100%) and B: NH30.05% ACN 5%/H ₂ O 95% (70 to 0%). Fractions were collected and psudo-lyophilized to give the desired product N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[1-[2-(2-hydroxyethox y)ethyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (0.017 g, 0.051 mmol, 14.2% yield, 100% purity) as a white solid. HPLC-MS Method D: (M+H) 518; Rt: 2.08 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 1.52 - 1.88 (m, 6 H) 2.02 - 2.14 (m, 2 H) 3.02 - 3.18 (m, 1 H) 3.23 - 3.41 (m, 67 H) 3.84 (t, J=5.18 Hz, 2 H) 4.52 (dt, J=5.45, 2.91 Hz, 1 H) 4.63 (t, J=5.09 Hz, 2 H) 7.09 (d, J=8.90 Hz, 1 H) 7.80 (dd, J=11.08, 1.82 Hz, 1 H) 8.23 - 8.33 (m, 2 H) 8.77 (d, J=2.54 Hz, 1 H) 11.39 (s, 1 H). Example 315: N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[[4-(2-hydroxyethyl)- 1,2,4-triazol-3- yl]sulfanyl]-5-nitro-benzamide N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[[4-(2-methoxyethyl)- 1,2,4-triazol-3-yl]sulfanyl]-5-nitro- benzamide (110 mg, 0.2261 mmol, 1.00 eq) was suspended in Dichloromethane (3.2 mL) and cooled to 0°C. Then Boron tribromide, 1M soln. in dichloromethane (1.131 mL, 1.131 mmol, 5.00 eq) was added dropwise and stirred overnight (T was allowed to reach rt). The reaction mixture was quenched with 5% NaHCO ₃ solution at 0°C till pH=7 and extracted with DCM. The organic phase was dried over Na ₂ SO ₄ , filtered off and evaporated to residue. The residue was dissolved in DMSO and was purified by preparative HPLC (C18; A: ACN 95%/H ₂ O 5% (10 to 90%) and B: HCOOH 0.1% ACN 5%/H ₂ O 95%. Fractions containing the desired compound were collected and pseudo-lyophilized to get the desired product N-(5-cyclopentyl-3-fluoro-2- pyridyl)-2-[[4-(2-hydroxyethyl)-1,2,4-triazol-3-yl]sulfanyl] -5-nitro-benzamide (60 mg, 0.1270 mmol, 0.5616 eq, 56.16% yield, 97% purity) as a pale yellow solid. HPLC-MS Method C: (M+H) 473; Rt: 3.31 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 1.53 - 1.73 (m, 4 H) 1.75 - 1.87 (m, 2 H) 2.02 -2.13 (m, 2 H) 3.04 - 3.15 (m, 1 H) 3.59 (q, J=5.27 Hz, 2 H) 4.00 - 4.07(m, 2 H) 5.04 (t, J=5.27 Hz, 1 H) 6.88 (d, J=9.08 Hz, 1 H) 7.80 (dd, J=11.17, 1.73 Hz, 1 H) 8.24 (dd, J=8.90, 2.54 Hz, 1 H) 8.26 (s, 1 H) 8.72 (d, J=2.54 Hz, 1H) 8.89 (s, 1 H) 11.30 (br. s., 1 H). Example 316: N-(5-cyclopentyl-3-fluoro-2-pyridyl)-4-[(dimethylamino)methy l]-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide To a solution of lithium 4-[(dimethylamino)methyl]-2-(1-methyltetrazol-5-yl)sulfanyl- 5-nitro- benzoate (0.062 mmol, 0.021 g) in pyridine (0.1 M, 7.7 mmol, 0.62 mL), 5-cyclopentyl-3-fluoro- pyridin-2-amine (1 equiv., 0.062 mmol, 11 mg) was added. The reaction mixture (a yellow solution) was cooled at 0 °C and phosphorus(V) oxychloride 10% Volume in dry DCM (1.5 equiv., 0.093 mmol, 0.087 mL) was slowly added and the final orange solution was stirred at 0 °C. After 20 min HPLC/MS analysis showed complete conversion into the desired product. The reaction was quenched with water at 0 °C, diluted with DCM, the organic phase was partitioned and the aqueous layer was extracted twice with DCM. The organic phases were collected dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure. 39 mg of crude were purified by silica gel flash chromatography: crude dissolved in minimum amount of DCM, eluant (DCM /AcOEt 50:50). Fractions containing the desired compound were collected and dried affording N-(5- cyclopentyl-3-fluoro-2-pyridyl)-4-[(dimethylamino)methyl]-2- (1-methyltetrazol-5-yl)sulfanyl-5- nitro-benzamide (11.2 mg, 0.0224 mmol, 36% yield) as yellow wax. HPLC-MS Method C: (M+H) 501.1; Rt: 4.74 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 1.44 - 1.70 (m, 5 H) 1.72 - 1.84 (m, 2 H) 2.01 - 2.09 (m, 2 H) 2.15 - 2.31 (m, 6 H) 2.86 - 3.13 (m, 1 H) 3.63 - 3.80 (m, 2 H) 3.82 - 4.17 (m, 3 H) 7.33 (br. s., 1 H) 7.70 (d, J=10.90 Hz, 1 H) 8.02 - 8.33 (m, 2 H) 10.65 - 11.21 (m, 1 H) Example 317: N-(5-cyclopentyl-3-fluoro-2-pyridyl)-4-(hydroxymethyl)-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide Step 1: 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-N-(5-cyclopentyl-3- fluoro-2-pyridyl)-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide To a solution of 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-2-(1-methyltetrazol -5-yl)sulfanyl-5-nitro- benzoic acid (82 mg, 0.1492 mmol) in dry pyridine (0.1 M, 18.5 mmol, 1.49 mL), 5-cyclopentyl- 3-fluoro-pyridin-2-amine (1 equiv., 0.149 mmol, 26.9 g) was added. The reaction mixture (a yellow solution) was cooled at 0 °C and phosphorus(V) oxychloride 10% volume in dry DCM (1.5 equiv., 0.224 mmol, 0.209 mL) was slowly added and the final orange solution was stirred at 0°C. After 20 min HPLC/MS analysis showed complete conversion into the desired product. The reaction was quenched with water at 0 °C, diluted with DCM, the organic phase was partitioned and the aqueous layer was extracted twice with DCM. The organic phases were collected dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure.65 mg of crude were purified by flash chromatography (silica gel): crude dissolved in minimum amount of DCM, eluant (hexane/AcOEt 7:3). Fractions containing the product were collected and dried affording 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-N-(5-cyclopentyl-3- fluoro-2-pyridyl)- 2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide (38 mg, 53.4 mmol, 35.8% yield) as colourless oil. HPLC-MS Method C: (M+H) 712.5; Rt: 5.72 min Step 2: N-(5-cyclopentyl-3-fluoro-2-pyridyl)-4-(hydroxymethyl)-2-(1- methyltetrazol-5- yl)sulfanyl-5-nitro-benzamide In round bottom flask equipped with a CaCl ₂ valve, 1.0 M TBAF sol in THF (1.5 equiv., 0.059 mmol, 59 uL) was added dropwise to a solution of 4-[[tert-butyl(diphenyl)silyl]oxymethyl]-N-(5- cyclopentyl-3-fluoro-2-pyridyl)-2-(1-methyltetrazol-5-yl)sul fanyl-5-nitro-benzamide (28 mg, 0.039 mmol) in THF (1 mL, 12.2 mmol), the solution immediately turned from light to dark yellow. The final solution was stirred for 1 h at rt, during which time it became orange. HPLC/MS analysis showed complete conversion. It was quenched with water, extracted twice with AcOEt, the combined organics were washed with brine, dried on Na ₂ SO ₄ and filtered. The volatiles were removed in rotavapor affording 27 mg of crude which waspurified by flash chromatography (silica): crude was dissolved in the minimum amount of DCM, eluant (hexane/AcOEt 4:6). The fractions containing the product were collected, dried and triturated with Et ₂ O. N-(5-cyclopentyl-3-fluoro-2-pyridyl)-4-(hydroxymethyl)-2-(1- methyltetrazol-5- yl)sulfanyl-5-nitro-benzamide (8.9 mg, 0.019 mmol, 48% yield) was recovered a white powder after filtration. HPLC-MS Method C: (M+H) 474.3; Rt: 4.37 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 1.52 - 1.72 (m, 4 H) 1.74 - 1.85 (m, 2 H) 2.02 - 2.12 (m, 2 H) 3.01 - 3.15 (m, 1 H) 3.94 - 4.09 (m, 3 H) 4.80 (d, J=5.63 Hz, 2 H) 5.60 (t, J=5.54 Hz, 1 H) 7.19 (s, 1 H) 7.80 (dd, J=11.08, 1.63 Hz, 1 H) 8.26 (s, 1 H) 8.72 (s, 1 H) 11.33 (s, 1 H) Example 318: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-2 -[1-(2- hydroxyethyl)tetrazol-5-yl]sulfanyl-4-methyl-5-nitro-benzami de In a microwave vessel 2-bromo-N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-py ridyl]-4- methyl-5-nitro-benzamide (60 mg, 0.1149 mmol) and 2-(5-sulfanyltetrazol-1-yl)ethanol (2 equiv., 0.2298 mmol, 33.6 mg) were dissolved in 1,4-dioxane (1.8 mL). TEA (3 equiv., 0.3448 mmol, 0.048 mL) was added. The vial was flushed with argon (15 min) and then tris(dibenzylideneacetone)dipalladium (0.1 equiv., 0.01149 mmol, 10.52 mg) and 4,5- bis(diphenylphosphino)-9,9-dimethylxanthene (0.2 equiv., 0.02298 mmol, 13.3 mg) were added. The vial was closed with a septum and heated by microwave (80 °C, 1 h). The reaction was diluted with AcOEt and extracted with water. The organic layer was washed twice with brine, dried over anhydrous Na ₂ SO ₄ and evaporated to dryness. The residue (green oil) was treated with DCM and stirred for 10 min at rt. The resulting suspension was filtered and the solid was washed with Et ₂ O to give N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]- 2-[1-(2-hydroxyethyl)tetrazol-5-yl]sulfanyl-4-methyl-5-nitro -benzamide (23.4 mg, 0.0398 mmol, 34.7% yield) as a white powder. HPLC-MS Method D: (M+H) 588.3; Rt: 2.55 min ¹ H NMR (600 MHz, DMSO- d ₆ ) δ ppm 2.46 (s, 3 H) 3.80 (q, J=5.45 Hz, 2 H) 4.51 (t, J=5.09 Hz, 2 H) 5.13 (t, J=5.45 Hz, 1 H) 7.07 (s, 1 H) 8.45 (d, J=9.99 Hz, 1 H) 8.63 (s, 1 H) 8.72 (s, 1 H) 11.81 (s, 1 H) Example 319: N-[5-(1,1,2,2,3,3,3-heptafluoropropyl)-3-methyl-2-pyridyl]-2 -(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide To a solution of 5-(1,1,2,2,3,3,3-heptafluoropropyl)-3-methyl-pyridin-2-amine (1.1 equiv., 0.19556 mmol, 54 mg) and 2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro-benzoic acid (50 mg, 0.17778 mmol) in pyridine (0.1 M, 22.1 mmol, 1.78 mL), under argon atmosphere at 0 °C, phosphorus(V) oxychloride 10% volume in dry DCM (0.8 equiv., 0.142 mmol, 0.133 mL) was added and the yellow solution was stirred at 0 °C for 30 min, than 1 h at rt (dark green solution). HPLC-MS analysis showed partial conversion of the amine and the presence of the desired product. phosphorus(V) oxychloride 10% volume in dry DCM (0.8 equiv., 0.142 mmol, 0.133 mL) was added and the reaction stirred at room temp for 3 h. The reaction was quenched with water, diluted with DCM, the organic phase was partitioned and the aqueous layer was extracted twice with DCM. The organic phases were collected dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure. The crude (92 mg) that at 254 nm showed 41% of the desired product and 28% of bis-amide was purified by flash chromatography (silica): crude dissolved in minimum amount of DCM, eluant (hexane/AcOEt: 7/3). Fractions containing the product were collected and dried affording 43 mg of a mixture of desired product and starting amine. The solid was dissolved in DCM and washed twice with HCl 0.1N aqueous the organic phase was dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure. N-[5-(1,1,2,2,3,3,3-heptafluoropropyl)-3-methyl-2-pyridyl]-2 -(1-methyltetrazol-5- yl)sulfanyl-5-nitro-benzamide (31.4 mg, 0.0582 mmol, 32.7% yield) was collected as off-white powder. HPLC-MS Method C: (M+H) 540.2; Rt: 3.15 min ¹ H NMR (600 MHz, DMSO- d6) δ ppm 2.40 (s, 3 H) 4.06 (s, 3 H) 7.14 (d, J=8.90 Hz, 1 H) 8.20 (d, J=1.82 Hz, 1 H) 8.28 (dd, J=8.90, 2.54 Hz, 1 H) 8.67 (d, J=1.82 Hz, 1 H) 8.78 (d, J=2.54 Hz, 1 H) 11.54 (s, 1 H) Example 320: N'-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-(1-methyltetrazol-5- yl)sulfanyl-5- nitro-benzohydrazide Step 1: 2-bromo-5-cyclopentyl-3-fluoro-pyridine 5-cyclopentyl-3-fluoro-pyridin-2-amine (400 mg, 2.219 mmol) was dissolved in hydrogen bromide 48% in water (0.5 M, 39.2 mmol, 4.44 mL) at 0 °C and bromine (3 equiv., 6.65 mmol, 0.341 mL) was added dropwise over a period of 5 min. A solution of sodium nitrite (2.5 equiv., 5.5488 mmol, 0.3828 g) in water (1.5 M, 1.48 mL) was added dropwise at -5 to 0 °C in 20 min. The resulting suspension was stirred for 30 min at 0-5 °C then sodium hydroxide (20 equiv., 44.4 mmol, 1.77 g) in water (0.25 M, 8.88 mL) was added dropwise.. The resulting suspension was allowed to warm to room temperature. The mixture was extracted with ether (3 x 100 mL). The combined organic phases were washed with brine, dried over Na ₂ SO ₄ , filtered, and concentrated to afford 2-bromo-5-cyclopentyl-3-fluoro-pyridine (507 mg, 2.08 mmol, 0.507 g, 93.6% yield) as green oil. HPLC-MS Method C: (M+H) 246.1; Rt: 3.37 min Step 2: 2-bromo-5-cyclopentyl-3-fluoro-pyridine In a CEM vial (5 mL) a solution of 2-bromo-5-cyclopentyl-3-fluoro-pyridine (100 mg, 0.41 mmol), isopropyl alcohol (0.5 M, 11 mmol, 0.819 mL), DIPEA (3 equiv., 1.2290 mmol, 0.214 mL) and hydrazine monohydrate (1.5 equiv., 0.614 mmol, 29.8 uL) was heated in microwave for 30 min at 100°C. HPLC-MS analysis showed no reaction. The mixture was then heated in microwave at 120° for 30 min again without any change.3 equivalents of hydrazine were added and the reaction was heated at 14 0°C for 30 min, HPLC-MS analysis showed partial conversion, according to the MW are present the both the products of substitution of the bromine and the fluorine atom (6 and 12% respectively). A total 5 h of heating at 140 °C were performed. Complete conversion was not achieved, the crude showed 30% of the desired product according to MW and 42% of the product of fluorine displacement at 254 nm. The mixture was evaporated to dryness and the crude was dissolved in 300 µL of DMA and injected in an Interchim Puriflash XS470 equipped with a HB100 C18 column and eluted with A: ACN 95% /H ₂ O 5% (20 to 100%) and B: NH ₄ OH 5% 95%/ACN 5% (80 to 0%). Pure fractions were collected and dried affording (5-cyclopentyl-3-fluoro-2-pyridyl)hydrazine (35 mg, 0.17927 mmol, 43.7% yield) as a yellow oil. HPLC-MS Method B : (M+H) 196.2; Rt: 3.96 min Step 3: N'-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-(1-methyltetrazol-5- yl)sulfanyl-5-nitro- benzohydrazide To a solution of (5-cyclopentyl-3-fluoro-2-pyridyl)hydrazine (1.1 equiv., 0.176 mmol, 34.3 mg) and 2-(1-methyltetrazol-5-yl)sulfanyl-5-nitro-benzoic acid (45 mg, 0.160 mmol) in pyridine (0.1 M, 19.9 mmol, 1.60 mL), under argon atmosphere at 0°C (ice bath), phosphorus(V) oxychloride 10% volume in dry DCM (0.8 equiv., 0.128 mmol, 0.120 mL) was added and the yellow solution was stirred at 0 °C for 30 min, than 1 h at rt.. HPLC-MS analysis showed partial conversion of the amine and the presence of the desired product. Further phosphorus(V) oxychloride 10% volume in dry DCM (0.8 equiv., 0.128 mmol, 0.120 mL) was added and the reaction stirred at room temp for 3 h. The majority of the starting hydrazine was converted into mono or bis amide derivative. The reaction was quenched with water, diluted with DCM, the organic phase was partitioned and the aqueous layer was extracted twice with DCM. The organic phases were collected dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure. The crude (82 mg) was dissolved in 300 µL of DMA and injected in an Interchim Puriflash XS470 equipped with a HB100 C18 column and eluted with a: ACN 95% /H ₂ O 5% (20 to 100%) and B: HCOOH 5% 95%/ACN 5% (80 to 0%). Fractions containing product were collected affording N'-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-(1-methyltetrazol-5- yl)sulfanyl-5-nitro-benzohydrazide (20 mg, 0.0436 mmol, 27.2% Yield) as yellow solid. HPLC-MS Method C: (M+H) 459.3; Rt: 4.37 min ¹ H NMR (600 MHz, DMSO- d6) δ ppm 1.40 - 1.55 (m, 2 H) 1.58 - 1.64 (m, 2 H) 1.71 - 1.78 (m, 2 H) 1.92 - 2.02 (m, 2 H) 2.86 - 2.96 (m, 1 H) 4.05 (s, 3 H) 7.06 (d, J=8.90 Hz, 1 H) 7.47 (dd, J=12.62, 1.73 Hz, 1 H) 7.84 (s, 1 H) 8.25 (dd, J=8.90, 2.54 Hz, 1 H) 8.73 (d, J=2.54 Hz, 1 H) 8.82 (s, 1 H) 10.90 (d, J=1.82 Hz, 1 H) Example 321: tert-butyl N-[[4-[(5-cyclopentyl-3-fluoro-2-pyridyl)carbamoyl]-5-(1- methyltetrazol-5-yl)sulfanyl-2-nitro-phenyl]methyl]carbamate To a solution of 4-[(tert-butoxycarbonylamino)methyl]-2-(1-methyltetrazol-5-y l)sulfanyl-5-nitro- benzoic acid (0.117 mmol, 48 mg) in pyridine (0.1 M, 14.5 mmol, 1.17 mL), 5-cyclopentyl-3- fluoro-pyridin-2-amine (1 equiv., 0.117 mmol, 21 mg) was added. The reaction mixture (a yellow solution) was cooled at 0°C and phosphorus(V) oxychloride 10% volume in dry DCM (1.5 equiv., 0.175 mmol, 0.164 mL) was slowly added and the final brown solution was stirred at 0 °C. After 20 min HPLC/MS analysis showed partial conversion conversion into the desired product. 5-cyclopentyl-3-fluoro-pyridin-2-amine (1 equiv., 0.117 mmol, 21 mg) and phosphorus(V) oxychloride 10% volume in dry DCM (1.5 equiv., 0.175 mmol, 0.164 mL) were newly added at 0 °C. After further 30 min the reaction was quenched with water at 0 °C, diluted with DCM, the organic phase was partitioned and the aqueous layer was extracted twice with DCM. The organic phases were collected dried over anhydrous Na ₂ SO ₄ , filtered and evaporated under reduced pressure. 90 mg of brown-orange solid were purified by flash chromatography (silica): the stationary phase was preconditioned with (hexane/AcOEt/TEA 6:3.5:0.5). Crude dissolved in minimum amount of DCM was eluted with (hexane/AcOEt 6:4 to 1:1). Fractions containing product were collected and dried affording tert-butyl N-[[4-[(5- cyclopentyl-3-fluoro-2-pyridyl)carbamoyl]-5-(1-methyltetrazo l-5-yl)sulfanyl-2-nitro- phenyl]methyl]carbamate (38 mg, 0.066 mmol, 56.7% yield) as white solid. HPLC-MS Method C : (M+H) 573.2; Rt: 0.45 min ¹ H NMR (600 MHz, DMSO- d ₆ ) δ ppm 1.36 - 1.44 (m, 9 H) 1.51 - 1.63 (m, 2 H) 1.63 - 1.74 (m, 2 H) 1.75 - 1.87 (m, 2 H) 2.02 - 2.15 (m, 2 H) 3.03 - 3.15 (m, 1 H) 4.00 (s, 3 H) 4.41 (d, J=5.99 Hz, 2 H) 6.81 (s, 1 H) 7.30 - 7.43 (m, 1 H) 7.80 (dd, J=11.08, 1.82 Hz, 1 H) 8.26 (s, 1 H) 8.70 (s, 1 H) 11.34 (s, 1 H) Example 322: 4-(aminomethyl)-N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-(1-me thyltetrazol- 5-yl)sulfanyl-5-nitro-benzamide;hydrochloride In round-bottom flask at room temperature tert-butyl N-[[4-[(5-cyclopentyl-3-fluoro-2- pyridyl)carbamoyl]-5-(1-methyltetrazol-5-yl)sulfanyl-2-nitro -phenyl]methyl]carbamate (14 mg, 0.024 mmol) was dissolved in 1,4-dioxane (0.05 M, 5.738 mmol, 0.489 mL) and Hydrogen chloride, 4M in 1,4-dioxane (15 equiv., 0.3667 mmol, 0.092 mL) was added. The clear solution was stirred at room temperature overnight.The main part of the solution was pipetted away while the light-yellow solid was dried in vacuum. The residue was triturated with Et ₂ O, the solution was eliminated by pipetting and the final light-yellow solid 4-(aminomethyl)-N-(5- cyclopentyl-3-fluoro-2-pyridyl)-2-(1-methyltetrazol-5-yl)sul fanyl-5-nitro-benzamide hydrochloride (9 mg, 0.0177 mmol, 72.3% Yield) was collected. HPLC-MS Method C: (M-H) 473.2; Rt: 0.95 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 1.50 - 1.64 (m, 2 H) 1.64 - 1.75 (m, 2 H) 1.75 - 1.90 (m, 2 H) 2.03 - 2.13 (m, 2 H) 3.01 - 3.18 (m, 1 H) 4.05 (s, 3 H) 4.29 (q, J=5.51 Hz, 2 H) 7.08 (s, 1 H) 7.81 (dd, J=11.17, 1.73 Hz, 1 H) 8.26 (s, 1 H) 8.33 (br. s., 3 H) 8.77 (s, 1 H) 11.46 (s, 1 H) Example 323: 4-(acetamidomethyl)-N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-( 1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide In round-bottom flask 4-(aminomethyl)-N-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide;hydrochloride (17 mg, 0.033 mmol) was dissolved in dry DCM (0.02 M, 26 mmol, 1.7 mL) (flask equipped with a CaCl ₂ valve), acetyl chloride (1.2 equiv., 0.040 mmol, 28 uL) and DIPEA (3 equiv., 0.099 mmol, 17 uL) were added. The final solution was stirred at room temperature for 1 h. The reaction mixture was diluted with DCM and quenched with saturated aqueous NaHCO ₃ solution. The organic phase was separated and the aqueous phase re-extracted with DCM. The organics were collected and dried over anhydrous Na ₂ SO ₄ , filtered and evaporated to dryness under reduce pressure affording a crude of 22 mg as a yellow oil that was purified by flash chromatography (silica): crude dissolved in minimum amount of DCM was eluted with (hexane/AcOEt 2:8 to 0:10). Fractions containing the desired compound were collected, affording 4-(acetamidomethyl)-N- (5-cyclopentyl-3-fluoro-2-pyridyl)-2-(1-methyltetrazol-5-yl) sulfanyl-5-nitro-benzamide (3.26 mg, 6.34 micromol, 19% yield) as yellow film. HPLC-MS Method C: (M+H) 515.2; Rt: 1.55 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ ppm 1.54 - 1.64 (m, 2 H) 1.65 - 1.72 (m, 2 H) 1.77 (s, 3 H) 1.77 - 1.85 (m, 2 H) 2.02 - 2.14 (m, 2 H) 3.05 - 3.14 (m, 1 H) 3.98 (s, 3 H) 4.49 (d, J=5.81 Hz, 2 H) 6.56 (s, 1 H) 7.80 (dd, J=11.17, 1.73 Hz, 1 H) 8.26 (s, 1 H) 8.38 (t, J=5.90 Hz, 1 H) 8.76 (s, 1 H) 11.35 (s, 1 H) Example 324: {N}-[2,6-difluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)phenyl] -2-[1-(3- hydroxypropyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 318 was used to afford {N}-[2,6-difluoro-4-(1,1,2,2,3,3,3- heptafluoropropyl)phenyl]-2-[1-(3-hydroxypropyl)tetrazol-5-y l]sulfanyl-5-nitro-benzamide (24 mg; 0.04 mmol; 33% yield; pale yellow solid). LC-MS Method B: (M+H) 904.9; Rt: 1.95 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.28 (s, 1 H) 8.83 (d, J=2.48 Hz, 1 H) 8.31 (dd, J=8.92, 2.53 Hz, 1 H) 7.81 (d, J=7.53 Hz, 2 H) 7.12 (d, J=8.87 Hz, 1 H) 4.61 (br s, 1 H) 4.48 (t, J=7.15 Hz, 2 H) 3.37 - 3.46 (m, 2 H) 2.07 (s, 1 H) 1.92 - 2.02 (m, 2 H) Example 325: 2-[(4-{tert}-butyl-1,2,4-triazol-3-yl)sulfanyl]-~{N}-[2,6-di fluoro-4- (1,1,2,2,3,3,3-heptafluoropropyl)phenyl]-5-nitro-benzamide The same method as in example 318 was used to afford 2-[(4-~{tert}-butyl-1,2,4-triazol-3- yl)sulfanyl]-~{N}-[2,6-difluoro-4-(1,1,2,2,3,3,3-heptafluoro propyl)phenyl]-5-nitro-benzamide (48 mg; 0.08 mmol; 59% yield; beige solid). LC-MS Method A: (M+H) 602.0; Rt: 1.73 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.22 (s, 1 H) 8.92 (s, 1 H) 8.73 (d, J=2.48 Hz, 1 H) 8.29 (dd, J=8.96, 2.48 Hz, 1 H) 7.81 (br d, J=7.44 Hz, 1 H) 6.94 (d, J=8.96 Hz, 1 H) 3.27 - 3.29 (br.s., 1 H) 1.60 (s, 9 H) Example 326: {N}-[2,6-difluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)phenyl] -2-[1-[2-(2- hydroxyethoxy)ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 318 was used to get {N}-[2,6-difluoro-4-(1,1,2,2,3,3,3- heptafluoropropyl)phenyl]-2-[1-[2-(2-hydroxyethoxy)ethyl]tet razol-5-yl]sulfanyl-5-nitro- benzamide (14 mg; 0.02 mmol; 23% yield; white solid). LC-MS Method B: (M+H) 635.1; Rt: 1.85 min 1H NMR (700 MHz, DMSO-d ₆ ) δ ppm 11.28 (s, 1 H) 8.81 (d, J=2.58 Hz, 1 H) 8.32 (dd, J=8.93, 2.47 Hz, 1 H) 7.81 (d, J=7.53 Hz, 2 H) 7.13 (d, J=9.03 Hz, 1 H) 4.64 (t, J=5.16 Hz, 2 H) 4.50 - 4.55 (m, 4 H) 3.85 (t, J=5.16 Hz, 2 H) 3.30 (br.s., 1 H) Example 327: 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5-[[2-[1-(2-hydroxy-1,1- dimethyl- ethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzoyl]amino]benzamide The same method as in example 318 was used to afford 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5- [[2-[1-(2-hydroxy-1,1-dimethyl-ethyl)tetrazol-5-yl]sulfanyl- 5-nitro-benzoyl]amino]benzamide (32 mg; 0.05 mmol; 62% yield; white solid). LC-MS Method B: (M+H) 626.1; Rt: 1.65 min 1H NMR (700 MHz, DMSO-d ₆ ) δ ppm 11.28 (s, 1 H) 8.81 (d, J=2.58 Hz, 1 H) 8.32 (dd, J=8.93, 2.47 Hz, 1 H) 7.81 (d, J=7.53 Hz, 2 H) 7.13 (d, J=9.03 Hz, 1 H) 4.64 (t, J=5.16 Hz, 2 H) 4.50 - 4.55 (m, 4 H) 3.85 (t, J=5.16 Hz, 2 H) 3.30 (br.s., 1 H) Example 328: 5-[[2-[(4-{tert}-butyl-1,2,4-triazol-3-yl)sulfanyl]-5-nitro- benzoyl]amino]-2- (1,1,2,2,3,3,3-heptafluoropropyl)benzamide The same method as in example 318 was used to get 5-[[2-[(4-~{tert}-butyl-1,2,4-triazol-3- yl)sulfanyl]-5-nitro-benzoyl]amino]-2-(1,1,2,2,3,3,3-heptafl uoropropyl)benzamide (34 mg; 0.06 mmol; 69% yield; white solid). LC-MS Method B: (M+H) 609.1; Rt: 1.65 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.32 (s, 1 H) 8.94 (s, 1 H) 8.73 (d, J=2.58 Hz, 1 H) 8.27 (dd, J=8.96, 2.57 Hz, 1 H) 8.04 (br d, J=8.96 Hz, 1 H) 7.97 (s, 1 H) 7.91 (d, J=2.00 Hz, 1 H) 7.72 (d, J=8.77 Hz, 1 H) 7.65 (s, 1 H) 6.91 (d, J=8.96 Hz, 1 H) 1.60 (s, 9 H) Example 329: 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5-[[2-(1-isopropyltetraz ol-5-yl)sulfanyl- 5-nitro-benzoyl]amino]benzamide

The same method as in example 318 was used to get 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5- [[2-(1-isopropyltetrazol-5-yl)sulfanyl-5-nitro-benzoyl]amino ]benzamide (15 mg; 0.02 mmol; 40% yield; white solid). LC-MS Method B: (M+H) 596.0; Rt: 1.78 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.31 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 8.02 (br d, J=8.77 Hz, 1 H) 7.89 - 7.94 (m, 2 H) 7.71 (d, J=8.77 Hz, 1 H) 7.59 (s, 1 H) 7.11 (d, J=8.87 Hz, 1 H) 4.88 (spt, J=6.64 Hz, 1 H) 1.48 (d, J=6.58 Hz, 6 H) Example 330: 5-[[2-(1-{tert}-butyltetrazol-5-yl)sulfanyl-5-nitro-benzoyl] amino]-2- (1,1,2,2,3,3,3-heptafluoropropyl)benzamide The same method as in example 318 was used to afford 5-[[2-(1-~{tert}-butyltetrazol-5- yl)sulfanyl-5-nitro-benzoyl]amino]-2-(1,1,2,2,3,3,3-heptaflu oropropyl)benzamide (17 mg; 0.03 mmol; 49% yield; white solid). LC-MS Method B: (M+H) 610.1; Rt: 1.81 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.31 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 8.02 (br d, J=8.77 Hz, 1 H) 7.89 - 7.94 (m, 2 H) 7.71 (d, J=8.77 Hz, 1 H) 7.59 (s, 1 H) 7.11 (d, J=8.87 Hz, 1 H) 4.88 (spt, J=6.64 Hz, 1 H) 1.48 (d, J=6.58 Hz, 6 H) Example 331: 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5-[[2-[1-(3-hydroxypropy l)tetrazol-5- yl]sulfanyl-5-nitro-benzoyl]amino]benzamide The same method as in example 318 was used to get 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5- [[2-[1-(3-hydroxypropyl)tetrazol-5-yl]sulfanyl-5-nitro-benzo yl]amino]benzamide (16 mg; 0.03 mmol; 42% yield; white solid). LC-MS Method B: (M+H) 612.2; Rt: 1.59 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.30 (s, 1 H) 8.78 (d, J=2.48 Hz, 1 H) 8.29 (dd, J=8.87, 2.48 Hz, 1 H) 8.01 (d, J=8.58 Hz, 1 H) 7.88 - 7.95 (m, 2 H) 7.71 (d, J=8.77 Hz, 1 H) 7.59 (s, 1 H) 7.19 (d, J=8.96 Hz, 1 H) 4.61 (t, J=4.91 Hz, 1 H) 4.48 (t, J=7.15 Hz, 2 H) 3.32 - 3.44 (m, 2 H) 1.92 - 2.03 (m, 2 H) Example 332: 5-[[2-(1-ethyltetrazol-5-yl)sulfanyl-5-nitro-benzoyl]amino]- 2-(1,1,2,2,3,3,3- heptafluoropropyl)benzamide The same method as in example 318 was used to afford 5-[[2-(1-ethyltetrazol-5-yl)sulfanyl-5- nitro-benzoyl]amino]-2-(1,1,2,2,3,3,3-heptafluoropropyl)benz amide (27 mg; 0.05 mmol; 71% yield; white solid). LC-MS Method B: (M+H) 582.1; Rt: 1.72 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.30 (s, 1 H) 8.79 (d, J=2.48 Hz, 1 H) 8.29 (dd, J=8.92, 2.53 Hz, 1 H) 8.02 (d, J=8.53 Hz, 1 H) 7.89 - 7.94 (m, 2 H) 7.71 (d, J=8.77 Hz, 1 H) 7.58 (s, 1 H) 7.17 (d, J=8.87 Hz, 1 H) 4.43 (q, J=7.31 Hz, 2 H) 1.41 (t, J=7.30 Hz, 3 H) Example 333: 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5-[[2-[1-[(1- hydroxycyclobutyl)methyl]tetrazol-5-yl]sulfanyl-5-nitro-benz oyl]amino]benzamide

The same method as in example 318 was used to get 2-(1,1,2,2,3,3,3-heptafluoropropyl)-5- [[2-[1-[(1-hydroxycyclobutyl)methyl]tetrazol-5-yl]sulfanyl-5 -nitro-benzoyl]amino]benzamide (40 mg; 0.06 mmol; 63% yield; white solid). LC-MS Method B: (M+H) 638.1; Rt: 1.70 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.28 (s, 1 H) 8.70 (d, J=2.58 Hz, 1 H) 8.30 (dd, J=8.87, 2.57 Hz, 1 H) 7.98 (d, J=8.61 Hz, 1 H) 7.90 (d, J=2.19 Hz, 2 H) 7.70 (d, J=8.68 Hz, 1 H) 7.58 (s, 1 H) 7.44 (d, J=8.87 Hz, 1 H) 5.69 (s, 1 H) 4.57 (s, 2 H) 2.15 - 2.22 (m, 2 H) 1.91 - 2.00 (m, 2 H) 1.61 - 1.74 (m, 2 H) Example 334: 5-[[2-[[4-(difluoromethyl)-5-[(dimethylamino)methyl]-1,2,4-t riazol-3- yl]sulfanyl]-5-nitro-benzoyl]amino]-2-(1,1,2,2,3,3,3-heptafl uoropropyl)benzamide The same method as in example 318 was used to obtain 5-[[2-[[4-(difluoromethyl)-5- [(dimethylamino)methyl]-1,2,4-triazol-3-yl]sulfanyl]-5-nitro -benzoyl]amino]-2-(1,1,2,2,3,3,3- heptafluoropropyl)benzamide (78 mg; 0.10 mmol; 61% yield; white solid). LC-MS Method B: (M+H) 660.1; Rt: 1.35 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.30 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 8.28 (dd, J=8.92, 2.53 Hz, 1 H) 7.87 - 8.11 (m, 4 H) 7.72 (d, J=8.77 Hz, 1 H) 7.60 (s, 1 H) 7.18 (d, J=8.87 Hz, 1 H) 4.73 (br s, 2 H) 2.91 (br s, 6 H) Example 335: {N}-[3-fluoro-5-(1,1,2,2,2-pentafluoroethylsulfanyl)-2-pyrid yl]-2-[1-(2- hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide

N-{3-fluoro-5-[(1,1,2,2,2-pentafluoroethyl)sulfanyl]pyrid in-2-yl}-2-iodo-5 nitrobenzamide (50.0 mg; 0.09 mmol) and 1-(2-hydroxyethyl)-1H-tetrazole-5(2H)-thione (28 mg; 0.18 mmol) were dissolved in anhydrous 1,4-dioxane, (2 mL). DIPEA (0.061 mL; 0.36 mmol), tris(dibenzylideneacetone)dipalladium(0) (8.2 mg; 0.01 mmol) and 9,9-dimethyl-4,5- bis(diphenylphosphino)xanthene (10.5 mg; 0.02 mmol) were added under argon atmosphere and the reaction solution was stirred at 90 °C for 45 min. The reaction mixture was evaporated to dryness and the crude was purified by flash chromatography (silica): crude dissolved in minimum amount of DCM was eluted with (hexane/AcOEt 2:8). Fractions were collected affording {N}-[3-fluoro-5-(1,1,2,2,2-pentafluoroethylsulfanyl)-2-pyrid yl]-2-[1-(2- hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide (33 mg, 0.06 mmol, 67% yield) as white solid. LC-MS Method B: (M+H) 560.0; Rt: 1.74 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.30 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 8.28 (dd, J=8.92, 2.53 Hz, 1 H) 7.87 - 8.11 (m, 4 H) 7.72 (d, J=8.77 Hz, 1 H) 7.60 (s, 1 H) 7.18 (d, J=8.87 Hz, 1 H) 4.73 (br s, 2 H) 2.91 (br s, 6 H) Example 336: {N}-[3-fluoro-5-(1,1,2,2,2-pentafluoroethylsulfanyl)-2-pyrid yl]-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide The same method as in example 335 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,2- pentafluoroethylsulfanyl)-2-pyridyl]-2-(1-methyltetrazol-5-y l)sulfanyl-5-nitro-benzamide (30 mg; 0.06 mmol; 62% yield; white solid). LC-MS Method B: (M+H) 526.0; Rt: 1.84 min 1H NMR (700 MHz, DMSO-d ₆ ) δ ppm 11.84 (s, 1 H) 8.83 (d, J=2.58 Hz, 1 H) 8.65 (d, J=1.72 Hz, 1 H) 8.46 (dd, J=9.57, 1.83 Hz, 1 H) 8.29 (dd, J=8.93, 2.47 Hz, 1 H) 7.12 (d, J=9.03 Hz, 1 H) 4.06 (s, 3 H) Example 337: {N}-[3-fluoro-5-(1,1,2,2,2-pentafluoroethylsulfanyl)-2-pyrid yl]-2-[1-(2- hydroxy-1,1-dimethyl-ethyl)tetrazol-5-yl]sulfanyl-5-nitro-be nzamide The same method as in example 335 was used to get {N}-[3-fluoro-5-(1,1,2,2,2- pentafluoroethylsulfanyl)-2-pyridyl]-2-[1-(2-hydroxy-1,1-dim ethyl-ethyl)tetrazol-5-yl]sulfanyl-5- nitro-benzamide (34 mg; 0.06 mmol; 60% yield; white solid). LC-MS Method B: (M+H) 584.1; Rt: 1.80 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.87 (s, 1 H) 8.79 (d, J=2.48 Hz, 1 H) 8.65 (d, J=1.72 Hz, 1 H) 8.47 (dd, J=9.54, 1.81 Hz, 1 H) 8.30 (dd, J=8.96, 2.57 Hz, 1 H) 7.19 (d, J=8.96 Hz, 1 H) 3.72 - 3.75 (m, 4 H) 1.71 (s, 6 H) Example 338: {N}-(5-cyclopentyl-3-fluoro-2-pyridyl)-5-nitro-2-[1-[3-(2-ox opyrrolidin-1- yl)propyl]tetrazol-5-yl]sulfanyl-benzamide The same method as in example 131 was used to get {N}-(5-cyclopentyl-3-fluoro-2-pyridyl)-5- nitro-2-[1-[3-(2-oxopyrrolidin-1-yl)propyl]tetrazol-5-yl]sul fanyl-benzamide (22 mg; 0.06 mmol; 62% yield; light yellow solid). LC-MS Method B: (M+H) 555.2; Rt: 1.70 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.40 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 8.25 - 8.28 (m, 2 H) 7.80 (dd, J=11.16, 1.81 Hz, 1 H) 7.06 (d, J=8.96 Hz, 1 H) 4.35 (t, J=7.25 Hz, 2 H) 3.25 (t, J=7.00 Hz, 2 H) 3.20 (t, J=6.95 Hz, 2 H) 3.03 - 3.16 (m, 1 H) 1.99 - 2.15 (m, 6 H) 1.75 - 1.87 (m, 4 H) 1.56 - 1.73 (m, 4 H) Example 339: {N}-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[1-[(1-methylpyrazo l-4- yl)methyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 131 was used to afford {N}-(5-cyclopentyl-3-fluoro-2-pyridyl)- 2-[1-[(1-methylpyrazol-4-yl)methyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide (29 mg; 0.06 mmol; 89% yield; light yellow solid). LC-MS Method B: (M+H) 524.1; Rt: 1.13 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.41 (s, 1 H) 8.79 (d, J=2.48 Hz, 1 H) 8.27 (s, 1 H) 8.16 (dd, J=8.92, 2.53 Hz, 1 H) 7.81 (dd, J=11.16, 1.81 Hz, 1 H) 7.59 (s, 1 H) 7.26 (s, 1 H) 6.81 (d, J=8.87 Hz, 1 H) 5.53 (s, 2 H) 3.68 (s, 3 H) 3.06 - 3.15 (m, 1 H) 2.06 - 2.12 (m, 2 H) 1.74 - 1.86 (m, 2 H) 1.57 - 1.72 (m, 4 H) Example 340: {N}-[3-fluoro-5-(1,1,2,2,3,3,4,4-octafluorobutyl)-2-pyridyl] -2-[1-(2- hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 148 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,4,4- octafluorobutyl)-2-pyridyl]-2-[1-(2-hydroxyethyl)tetrazol-5- yl]sulfanyl-5-nitro-benzamide (54 mg; 0.09 mmol; 80% yield; white solid). LC-MS Method B: (M+H) 605.9; Rt: 1.69 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.94 (s, 1 H) 8.82 (d, J=2.57 Hz, 1 H) 8.72 (s, 1 H) 8.44 (dd, J=10.01, 1.72 Hz, 1 H) 8.30 (dd, J=8.96, 2.48 Hz, 1 H) 7.02 - 7.32 (m, 2 H) 5.12 (t, J=5.53 Hz, 1 H) 4.52 (t, J=5.20 Hz, 2 H) 3.78 (q, J=5.40 Hz, 2 H) Example 341: {N}-[3-fluoro-5-(1,1,2,2,3,3,4,4-octafluorobutyl)-2-pyridyl] -2-[1-(2-hydroxy- 1,1-dimethyl-ethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 148 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,3,3,4,4- octafluorobutyl)-2-pyridyl]-2-[1-(2-hydroxyethyl)tetrazol-5- yl]sulfanyl-5-nitro-benzamide (40 mg; 0.06 mmol; 78% yield; beige foam). LC-MS Method B: (M+H) 633.9; Rt: 1.76 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.95 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 8.71 (s, 1 H) 8.43 (dd, J=9.97, 1.57 Hz, 1 H) 8.30 (dd, J=8.96, 2.48 Hz, 1 H) 7.03 - 7.30 (m, 2 H) 5.36 (br t, J=5.53 Hz, 1 H) 3.73 (d, J=5.05 Hz, 2 H) 1.71 (s, 6 H) Example 342: {N}-[3-fluoro-5-(1,1,2,2,3,3,4,4-octafluorobutyl)-2-pyridyl] -2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide The same method as in example 148 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,3,3,4,4- octafluorobutyl)-2-pyridyl]-2-(1-methyltetrazol-5-yl)sulfany l-5-nitro-benzamide (30 mg; 0.05 mmol; 67% yield; white solid). LC-MS Method B: (M+H) 676.0; Rt: 1.80 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.94 (s, 1 H) 8.84 (d, J=2.58 Hz, 1 H) 8.71 (s, 1 H) 8.44 (dd, J=9.97, 1.57 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 7.11 (d, J=8.87 Hz, 1 H) 7.17 (tt, J=50.17, 5.42 Hz, 1 H) 4.06 (s, 3 H) Example 343: {N}-[3-fluoro-5-(1,1,2,2,3,3,4,4,4-nonafluorobutyl)-2-pyridy l]-2-[1-(2- hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 148 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,4,4,4- nonafluorobutyl)-2-pyridyl]-2-[1-(2-hydroxyethyl)tetrazol-5- yl]sulfanyl-5-nitro-benzamide (55 mg; 0.10 mmol; 85% yield; white solid). LC-MS Method B: (M+H) 624.0; Rt: 1.82 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.96 (s, 1 H) 8.82 (d, J=2.48 Hz, 1 H) 8.75 (s, 1 H) 8.49 (dd, J=9.97, 1.38 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 7.19 (d, J=8.96 Hz, 1 H) 5.11 (t, J=5.48 Hz, 1 H) 4.52 (t, J=5.15 Hz, 2 H) 3.78 (q, J=5.34 Hz, 2 H) Example 344: {N}-[5-(1,1,2,2,3,3,3-heptafluoropropyl)pyrimidin-2-yl]-2-(1 -methyltetrazol- 5-yl)sulfanyl-5-nitro-benzamide The same method as in example 81 was used to obtain {N}-[5-(1,1,2,2,3,3,3- heptafluoropropyl)pyrimidin-2-yl]-2-(1-methyltetrazol-5-yl)s ulfanyl-5-nitro-benzamide (39 mg; 0.07 mmol; 85% yield; white solid). LC-MS Method G: (M+H) 527.0; Rt: 0.98 min 1H NMR (300MHz, DMSO-d ₆ ) δ ppm 12.24 (s, 1H), 9.16 (s, 2H), 8.73 (d, J= 2.5 Hz, 1H), 8.28 (dd, J = 8.9, 2.6 Hz, 1H), 7.21 (d, J = 8.9 Hz, 1H), 4.04 (s, 3H). Example 345: 2-[1-[2-(dimethylamino)-2-oxo-ethyl]tetrazol-5-yl]sulfanyl-~ {N}-[3-fluoro- 5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benza mide

Step 1: 2-{5-[(2-{[3-fluoro-5-(1,1,2,2, 3,3,3-heptafluoropropyl)pyri din-2-yl]carbamoyl}-4- nitrophenyl)sulfanyl]-1H-1,2,3,4-te trazol-1-yl}acetic acid Using the same procedure as in example 305, 2-{5-[(2-{[3-fluoro-5-(1,1,2,2, 3,3,3- heptafluoropropyl)pyri din-2-yl]carbamoyl}-4-nitrophenyl)sulfanyl]-1H-1,2,3,4-te trazol-1- yl}acetic acid was obtained as a light yellow solid (150 mg; 0.25 mmol; 65% yield). HRMS (ESI) calcd for C ₁₈ H ₁₀ F ₈ N ₇ O ₅ S [M + H] ⁺ 588.0331, found 588.0338 Step 2: 2-[1-[2-(dimethylamino)-2-oxo-ethyl]tetrazol-5-yl]sulfanyl-~ {N}-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de Under argon atmosphere 2-{5-[(2-{[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyrid in-2- yl]carbamoyl}-4-nitrophenyl)sulfanyl]-1H-1,2,3,4-tetrazol-1- yl}acetic acid (150.000 mg; 0.252 mmol) was dissolved in DMF (4.5 ml), 4-methylmorpholine (69.273 µL; 0.630 mmol), dimethylamine (2.0 M in THF; 151.220 µL; 0.302 mmol) and then HATU (143.746 mg; 0.378 mmol) were added and the yellow orange solution was stirred for 2 h at rt. The mixture was diluted with AcOEt and washed with saturated aqueous NaHCO ₃ solution. The organic phase was dried over Na ₂ SO ₄ , filtered off, concentrated and purified by flash chromatography (silica gel; n-heptane/AcOEt: 4/6) to obtain 2-[1-[2-(dimethylamino)-2-oxo-ethyl]tetrazol-5-yl]sulfanyl- ~{N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl ]-5-nitro-benzamide. (29 mg; 0.05 mmol; 85% yield; white solid). LC-MS Method B: (M+H) 614.9; Rt: 1.77 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.92 (br s, 1 H) 8.79 (d, J=2.48 Hz, 1 H) 8.75 (s, 1 H) 8.47 (dd, J=9.97, 1.48 Hz, 1 H) 8.35 (dd, J=8.96, 2.48 Hz, 1 H) 7.38 (d, J=8.96 Hz, 1 H) 5.72 (s, 2 H) 3.06 (s, 3 H) 2.84 (s, 3 H) Example 346: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-[2-(3- methyldiazirin-3-yl)ethylamino]-2-oxo-ethyl]tetrazol-5-yl]su lfanyl-5-nitro-benzamide The same method as in example 345 (step 2) was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-[2-(3-methyldiazirin-3 -yl)ethylamino]-2-oxo-ethyl]tetrazol- 5-yl]sulfanyl-5-nitro-benzamide (58 mg; 0.09 mmol; 85% yield; off-white solid). LC-MS Method B: (M+H) 668.9; Rt: 1.87 min 1H NMR (500 MHz, DMSO- d ₆ ) δ ppm 11.89 (s, 1 H) 8.81 (d, J=2.58 Hz, 1 H) 8.73 (s, 1 H) 8.54 (t, J=5.58 Hz, 1 H) 8.45 (br d, J=9.54 Hz, 1 H) 8.33 (dd, J=8.96, 2.48 Hz, 1 H) 7.31 (d, J=8.96 Hz, 1 H) 5.29 (s, 2 H) 2.96 - 3.03 (m, 2 H) 1.40 (t, J=7.10 Hz, 2 H) 0.94 (s, 3 H) Example 347: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-[2- (oxetan-3-ylamino)-2-oxo-ethyl]tetrazol-5-yl]sulfanyl-benzam ide The same method as in example 345 (step 2) was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-[2-(oxetan-3-ylam ino)-2-oxo-ethyl]tetrazol-5- yl]sulfanyl-benzamide (9 mg; 0.01 mmol; 16% yield; off-white solid). LC-MS Method B: (M+H) 662.9; Rt: 1.72 min 1H NMR (700 MHz, DMSO-d ₆ ) δ ppm 11.93 (br s, 1 H) 9.30 (d, J=6.67 Hz, 1 H) 8.81 (d, J=2.58 Hz, 1 H) 8.74 (s, 1 H) 8.43 - 8.50 (m, 1 H) 8.33 (dd, J=8.93, 2.47 Hz, 1 H) 7.29 (d, J=8.82 Hz, 1 H) 5.34 (s, 2 H) 4.69 - 4.79 (m,1 H) 4.67 (t, J=6.45 Hz, 2 H) 4.36 (t, J=6.35 Hz, 2 H) Example 348: 2-[1-[2-(ethylamino)-2-oxo-ethyl]tetrazol-5-yl]sulfanyl-~{N} -[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de The same method as in example 345 (step 2) was used to obtain 2-[1-[2-(ethylamino)-2-oxo- ethyl]tetrazol-5-yl]sulfanyl-~{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (52 mg; 0.08 mmol; 59% yield; pale rose solid). LC-MS Method B: (M+H) 614.9; Rt: 1.78 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.90 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 8.73 (s, 1 H) 8.42 - 8.49 (m, 2 H) 8.33 (dd, J=8.96, 2.57 Hz, 1 H) 7.33 (d, J=8.96 Hz, 1 H) 5.27 (s, 2 H) 3.03 - 3.10 (m, 2 H) 0.98 (t, J=7.25 Hz, 3 H) Example 349: 2-[1-[2-(ethylamino)-2-oxo-ethyl]tetrazol-5-yl]sulfanyl-~{N} -[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de The same method as in example 345 (step 2) was used to obtain 2-[1-[2-(ethylamino)-2-oxo- ethyl]tetrazol-5-yl]sulfanyl-~{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (24 mg; 0.04 mmol; 65% yield; white solid). LC-MS Method B: (M+H) 632.9; Rt: 1.76 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.90 (br s, 1 H) 8.77 - 8.82 (m, 2 H) 8.73 (s, 1 H) 8.45 (br d, J=9.92 Hz, 1 H) 8.33 (dd, J=8.92, 2.53 Hz, 1 H) 7.33 (d, J=8.96 Hz, 1 H) 5.34 (s, 2 H) 4.39 (dt, J=47.47, 4.92 Hz, 2 H) 3.32 - 3.43 (m, 2 H) Example 350: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-[(3-{R})- 3-fluoropyrrolidin-1-yl]-2-oxo-ethyl]tetrazol-5-yl]sulfanyl- 5-nitro-benzamide The same method as in example 345 (step 2) was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-[(3-{R})-3-fluoropyrro lidin-1-yl]-2-oxo-ethyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (39 mg; 0.06 mmol; 70% yield; white solid). LC-MS Method B: (M+H) 658.9; Rt: 1.80 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.92 (s, 1 H) 8.78 - 8.80 (m, 1 H) 8.73 (s, 1 H) 8.45 (dd, J=9.97, 1.67 Hz, 1 H) 8.34 (d, J=8.82 Hz, 1 H) 7.37 (d, J=8.96 Hz, 1 H) 5.70 (s, 1 H) 5.24 - 5.83 (m, 2 H) 5.23 - 5.53 (m, 1 H) 3.38 - 4.07 (m, 3 H) 1.91 - 2.33 (m, 2 H) Example 351: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-[2- (2-oxa-7-azaspiro[3.4]octan-7-yl)-2-oxo-ethyl]tetrazol-5-yl] sulfanyl-benzamide The same method as in example 345 (step 2) was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-[2-(2-oxa-7-azasp iro[3.4]octan-7-yl)-2-oxo- ethyl]tetrazol-5-yl]sulfanyl-benzamide (50 mg; 0.07 mmol; 88% yield; white solid). LC-MS Method B: (M+H) 682.9; Rt: 1.74 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.91 (s, 1 H) 8.79 (d, J=2.48 Hz, 1 H) 8.73 (s, 1 H) 8.46 (dd, J=9.97, 1.67 Hz, 1 H) 8.34 (dd, J=8.96, 2.48 Hz, 1 H) 7.37 (dd, J=8.96, 2.48 Hz, 1 H) 5.60 (d, J=16.31 Hz, 2 H) 4.42 - 4.57 (m, 4 H) 3.84 (s, 1 H) 3.59 (t, J=6.96 Hz, 1 H) 3.53 (s, 1 H) 3.33 - 3.33 (m, 1 H) 2.22 (t, J=7.01 Hz, 1 H) 2.09 (t, J=7.15 Hz, 1 H) Example 352: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-[(3-{S})- 3-fluoropyrrolidin-1-yl]-2-oxo-ethyl]tetrazol-5-yl]sulfanyl- 5-nitro-benzamide The same method as in example 345 (step 2) was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-[(3-{S})-3-fluoropyrro lidin-1-yl]-2-oxo-ethyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (26 mg; 0.07 mmol; 60% yield; white solid). LC-MS Method B: (M+H) 659.9; Rt: 1.80 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.92 (s, 1 H) 8.78 - 8.80 (m, 1 H) 8.73 (s, 1 H) 8.45 (dd, J=9.97, 1.67 Hz, 1 H) 8.34 (d, J=8.82 Hz, 1 H) 7.37 (d, J=8.96 Hz, 1 H) 5.70 (s, 1 H) 5.24 - 5.83 (m, 2 H) 5.23 - 5.53 (m, 1 H) 3.38 - 4.07 (m, 3 H) 1.91 - 2.33 (m, 2 H) Example 353: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-[(3~{R})- 3-methoxypyrrolidin-1-yl]-2-oxo-ethyl]tetrazol-5-yl]sulfanyl -5-nitro-benzamide The same method as in example 345 (step 2) was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-[(3~{R})-3-methoxypyrr olidin-1-yl]-2-oxo-ethyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (29 mg; 0.04 mmol; 64% yield; white solid). LC-MS Method B: (M+H) 670.9; Rt: 1.60 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.91 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 8.65 - 8.73 (m, 1 H) 8.46 (dd, J=9.92, 1.72 Hz, 1 H) 8.25 - 8.33 (m, 1 H) 7.38 (dd, J=8.96, 3.62 Hz, 1 H) 5.51 - 5.79 (m, 2 H) 3.89 - 4.11 (m, 1 H) 3.36 - 3.77 (m, 4 H) 3.18 - 3.29 (m, 3 H) 1.80 - 2.1 (m, 2 H) Example 354: 2-[1-[2-(1,3,3~{a},4,6,6-{a}-hexahydrofuro[3,4-c]pyrrol-5-yl )-2-oxo- ethyl]tetrazol-5-yl]sulfanyl--{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]- 5-nitro-benzamide The same method as in example 345 (step 2) was used to get 2-[1-[2-(1,3,3-{a},4,6,6-{a}- hexahydrofuro[3,4-c]pyrrol-5-yl)-2-oxo-ethyl]tetrazol-5-yl]s ulfanyl--{N}-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de (15 mg; 0.02 mmol; 64% yield; white solid). LC-MS Method B: (M+H) 682.9; Rt: 1.76 min 1H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.91 (s, 1 H) 8.79 (d, J=2.48 Hz, 1 H) 8.74 (s, 1 H) 8.46 (dd, J=9.92, 1.72 Hz, 1 H) 8.34 (dd, J=8.92, 2.53 Hz, 1 H) 7.38 (d, J=8.77 Hz, 1 H) 5.64 - 5.70 (m, 1 H) 5.51 - 5.61 (m, 1 H) 3.70 - 3.86 (m, 3 H) 3.47 - 3.62 (m, 4 H) 3.20 - 3.27 (m, 1 H) 2.95 - 3.06 (m, 1 H) 2.85 - 2.91 (m, 1 H) Example 355: {N}-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-hydroxy- phenyl]-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide

Step 1 N-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-[(4-methox yphenyl) methoxy] phenyl]-2-[(1-methyl-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-5-ni trobenzamide Using the same procedure as in example 305, N-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)- 6-[(4-methoxyphenyl)methoxy]phenyl]-2-[(1-methyl-1H-1,2,3,4- tetrazol-5-yl)sulfanyl]-5- nitrobenzamide was prepared. HRMS (ESI) calcd for C ₂₆ H ₁₉ F ₈ N ₆ O ₅ S [M + H] ⁺ 679.1010, found 679.1018 Step 2 {N}-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-hydroxy- phenyl]-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide A mixture of N-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-[(4- methoxyphenyl)methoxy]phenyl]-2-[(1-methyl-1H-1,2,3,4-tetraz ol-5-yl)sulfanyl]-5- nitrobenzamide (180.00 mg; 0.26 mmol; 1.00 eq.) and TFA (4.00 mL) was stirred for 1 h at r.t. The resulting mixture was concentrated under vacuum. The residue was purified by Prep- HPLC (Column, XSelect CSH Prep C18 OBD Column, 19 x 250 mm, 5 µm; Mobile phase, A:purity water and B: ACN (15% to 45% in 8 min); Detector, UV 220/254 nm) to afford 2-[1-[2- (1,3,3-{a},4,6,6-{a}-hexahydrofuro[3,4-c]pyrrol-5-yl)-2-oxo- ethyl]tetrazol-5-yl]sulfanyl--{N}-[3- fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitr o-benzamide (35 mg; 0.06 mmol; 23% yield; off-white solid). LC-MS Method I: (M+H) 559.1; Rt: 6.42 min 1H NMR (300MHz, DMSO- d ₆ ) δ ppm 11.03 (s, 1H), 10.71 (s, 1H), 8.88 (s, 1H), 8.28 (dd, J = 8.9, 2.5 Hz, 1H), 7.27 - 7.15 (m, 1H), 7.08 (d, J = 8.9 Hz, 2H), 4.07 (s, 3H). Example 356: {N}-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-hydroxyp henyl]-2-[1-(2- hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide Step 1 Step 2 Step 1 N-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-[(4-methox yphenyl) methoxy] phenyl]-2-[1-(2-hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro- benzamide The same method as in example 356 (step 1), to yield N-[2-fluoro-4-(1,1,2,2,3,3,3- heptafluoropropyl)-6-[(4-methoxyphenyl)methoxy]phenyl]-2-[1- (2-hydroxyethyl)tetrazol-5- yl]sulfanyl-5-nitro-benzamide HRMS (ESI) calcd for C ₂₇ H ₂₁ F ₈ N ₆ O ₆ S [M + H] ⁺ 709.1110, found 709.1122 Step 2 {N}-[2-fluoro-4-(1,1,2,2,3,3,3-heptafluoropropyl)-6-hydroxyp henyl]-2-[1-(2- hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 356 (step 2), to get {N}-[2-fluoro-4-(1,1,2,2,3,3,3- heptafluoropropyl)-6-hydroxy-phenyl]-2-[1-(2-hydroxyethyl)te trazol-5-yl]sulfanyl-5-nitro- benzamide (42 mg; 0.07 mmol; 25% yield; off-white solid). LC-MS Method I: (M+H) 586.8; Rt: 5.97 min 1H NMR (300MHz, DMSO-d ₆ ) δ ppm 11.02 (s, 1H), 10.73 (s, 1H), 8.86 (d, J = 2.5 Hz, 1H), 8.27 (dd, J = 8.9, 2.5 Hz, 1H), 7.17 (dd, J = 14.4, 9.3 Hz, 2H), 7.08 (s, 1H), 5.11 (s, 1H), 4.52 (t, J = 5.1 Hz, 2H), 3.80 (s, 2H). Example 357: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(2- hydroxy-1,1-dimethyl-ethyl)tetrazol-5-yl]sulfanyl-3-methyl-5 -nitro-benzamide

2-bromo-N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)py ridin-2-yl]-3-methyl-5- nitrobenzamide (40.0 mg; 0.08 mmol; 1.000 eq.) and 2-methyl-2-(5-sulfanyl-1H-1,2,3,4- tetrazol-1-yl)propan-1-ol (23.527 mg; 0.13 mmol; 1.750 eq.) were dissolved in 1,4-dioxane dry (1.6 mL). DIPEA (0.052 ml; 0.31 mmol; 4.0 eq.); tris(dibenzylideneacetone)dipalladium (0) (7 mg; 0.01 mmol; 0.100 eq.) and 9.9-dimethyl-4,5-bis(diphenylphosphino)xanthene (8.930 mg; 0.02 mmol; 0.200 eq.) were added under argon atmosphere and the reaction solution was stirred at 100 °C for 24 h. The reaction solution was evaporated. The crude was purified by chromatography (Puriflash Interchem; Sunfire prep C18 OBD 5 μm, 30 x 150mm; water 0.1% TFA, 5 - 100% acetonitrile TFA 0.1%, 220 nm) to get N-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-yl]-2-{[1-(1-hydroxy-2-methylpro pan-2-yl)-1H-1,2,3,4-tetrazol-5- yl]sulfanyl}-3-methyl-5-nitrobenzamide (14.9 mg; 0.02 mmol; 32% yield; white solid). LC-MS Method B: (M+H) 616.1; Rt: 1.83 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 11.59 (s, 1H), 8.61 (br s, 1H), 8.47 (d, 1H, J=2.4 Hz), 8.38 (br d, 1H, J=9.0 Hz), 8.30 (d, 1H, J=2.4 Hz), 3.70 (s, 2H), 2.5-2.5 (m, 3H), 1.65 (s, 6H). Example 358: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(2- hydroxyethyl)tetrazol-5-yl]sulfanyl-3-methyl-5-nitro-benzami de The same method as in example 357 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(2-hydroxyethyl)tetrazol- 5-yl]sulfanyl-3-methyl-5-nitro- benzamide (30.8 mg; 0.05 mmol; 27% yield; light yellow solid). LC-MS Method B: (M+H) 588.1; Rt: 1.74 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.52 - 2.52 (m, 3 H) 3.74 (q, J=5.21 Hz, 2 H) 4.46 (t, J=5.01 Hz, 2 H) 5.24 (t, J=5.29 Hz, 1 H) 8.30 (d, J=2.10 Hz, 1 H) 8.42 (br d, J=9.92 Hz, 1 H) 8.47 (d, J=2.29 Hz, 1 H) 8.66 (br s, 1 H) 11.67 (s, 1 H) Example 359: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(3- hydroxypropyl)tetrazol-5-yl]sulfanyl-3-methyl-5-nitro-benzam ide The same method as in example 358 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(3-hydroxypropyl)tetrazol -5-yl]sulfanyl-3-methyl-5-nitro- benzamide (9 mg; 0.01 mmol; 19% yield; light yellow gel). LC-MS Method B: (M+H) 602.1; Rt: 1.75 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.94 (quin, J=6.53 Hz, 2 H) 2.52 - 2.55 (m, 3 H) 3.34 - 3.43 (m, 2 H) 4.41 (t, J=7.15 Hz, 2 H) 4.66 (t, J=4.91 Hz, 1 H) 8.31 (d, J=2.38 Hz, 1 H) 8.38 (br d, J=9.16 Hz, 1 H) 8.47 (d, J=2.29 Hz, 1 H) 8.62 (br s, 1 H) 11.61 (s, 1 H) Example 360: {N}-[3-fluoro-5-[1,1,2,2-tetrafluoro-2-(trifluoromethoxy)eth yl]-2-pyridyl]-2- (1-methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide The same method as in example 309 was used to get {{N}-[3-fluoro-5-[1,1,2,2-tetrafluoro-2- (trifluoromethoxy)ethyl]-2-pyridyl]-2-(1-methyltetrazol-5-yl )sulfanyl-5-nitro-benzamide (24.8 mg; 0.04 mmol; 21% yield; white solid). LC-MS Method B: (M+H) 560.1; Rt: 1.88 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.06 (s, 3 H) 7.13 (d, J=8.96 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 8.47 (d, J=9.92 Hz, 1 H) 8.74 (s, 1 H) 8.83 (d, J=2.48 Hz, 1 H) 11.91 (s, 1 H) Example 361: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[[5- (hydroxymethyl)-4-methyl-1,2,4-triazol-3-yl]sulfanyl]-5-nitr o-benzamide N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[5-(methoxymethyl)-4-methyl- 4H-1,2,4-triazol-3-yl]sulfanyl}-5-nitrobenzamide (30.0 mg; 0.05 mmol; 1.000 eq.) was dissolved in Dichloromethane anhydrous (1.00 mL) and cooled to -78°C. Then boron tribromide (24.5 μL; 0.25 mmol; 5 eq.) was added dropwise and stirred for 2h at this temperature. The reaction mixture was allowed to warm up to rt and stirred overnight. The reaction mixture was added dropwise under ice cooling to a saturated NaHCO ₃ aqueous solution and extracted with AcOEt. The organic phase was dried over Na ₂ SO ₄ , filtered off and evaporated. Purification by chromatography (Puriflash Interchem; Sunfire prep C18 OBD 5 μm, 30 x 150 mm; water 0.1% TFA, 5 - 100% acetonitrile TFA 0.1%, 220 nm) to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[[5-(hydroxymethyl)-4-methyl -1,2,4-triazol-3-yl]sulfanyl]-5- nitro-benzamide (3.6 mg; 0.01 mmol; 12% yield; white solid). LC-MS Method B: (M+H) 573.1; Rt: 1.64 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.83 (s, 1H), 8.7-8.8 (m, 1H), 8.73 (s, 1H), 8.45 (dd, 1H, J=1.8, 10.0 Hz), 8.27 (dd, 1H, J=2.5, 8.9 Hz), 6.90 (d, 1H, J=8.8 Hz), 4.70 (s, 2H), 3.5-3.6 (m, 3H) Example 362: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -4-methyl-2-(1- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide

The same method as in example 357 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-4-methyl-2-(1-methyltetrazol-5 -yl)sulfanyl-5-nitro-benzamide (18.8 mg; 0.03 mmol; 27% yield; white solid). LC-MS Method B: (M+H) 558.0; Rt: 1.89 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.48 - 2.49 (m, 3 H) 4.05 (s, 3 H) 7.02 (s, 1 H) 8.44 (dd, J=10.01, 1.81 Hz, 1 H) 8.63 (s, 1 H) 8.72 (s, 1 H) 11.79 (s, 1 H) Example 363: 2-[1-(2,2-difluoro-3-hydroxy-propyl)tetrazol-5-yl]sulfanyl-{ N}-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de Step 1: 2-[(1-{3-[(tert-butyldiphenylsilyl)oxy]-2,2-difluoropropyl}- 1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl) pyridin-2-yl]-5 nitrobenzamide The same method as in example 357 was used to get 2-[(1-{3-[(tert-butyldiphenylsilyl)oxy]-2,2- difluoropropyl}-1H-1,2,3,4-tetrazol-5-yl)sulfanyl]-N-[3-fluo ro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-yl]-5 nitrobenzamide (42 mg; 0.042 mmol; 38% yield; white solid). HRMS (ESI) calcd for C ₃₅ H ₂₉ F ₁₀ N ₇ O ₄ SSi [M + H] ⁺ 862.1684, found 862.1681 Step 2: 2-[1-(2,2-difluoro-3-hydroxy-propyl)tetrazol-5-yl]sulfanyl-{ N}-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de A solution of 2-[(1-{3-[(tert-butyldiphenylsilyl)oxy]-2,2-difluoropropyl}- 1H-1,2,3,4-tetrazol-5- yl)sulfanyl]-N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl) pyridin-2-yl]-5 nitrobenzamide (42 mg; 0.042 mmol; 1.00 eq.) and tetrabutylammonium fluoride solution 1.0M in THF (115 mg; 0.127 mL; 0.127 mmol; 3.00 eq.) in dry DMSO (0.840 mL) was stirred at 30 °C for 3 h. The redbrown solution was diluted with water and extracted with DCM, the combined organic layer was washed with brine, dried over Na ₂ SO ₄ , filtered and reduced to dryness. The crude was purified by chromatography heptane/AcOEt 1-100% in order to furnish 2-[1-(2,2-difluoro-3- hydroxy-propyl)tetrazol-5-yl]sulfanyl-{N}-[3-fluoro-5-(1,1,2 ,2,3,3,3-heptafluoropropyl)-2- pyridyl]-5-nitro-benzamide (12 mg; 0.019 mmol; 45.3% yield; white solid). LC-MS Method B: (M+H) 624.0; Rt: 1.81 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.77 (td, J=13.38, 6.15 Hz, 2 H) 5.08 - 5.20 (m, 2 H) 5.84 (t, J=6.20 Hz, 1 H) 7.27 (d, J=8.96 Hz, 1 H) 8.35 (dd, J=8.92, 2.53 Hz, 1 H) 8.45 (dd, J=9.92, 1.53 Hz, 1 H) 8.73 (s, 1 H) 8.82 (d, J=2.48 Hz, 1 H) 11.93 (s, 1 H) Example 364: 5-[[2-[1-(2,2-difluoro-3-hydroxy-propyl)tetrazol-5-yl]sulfan yl-5-nitro- benzoyl]amino]-2-(1,1,2,2,3,3,3-heptafluoropropyl)benzamide The same method as in example 363 (step 2) was used to get 5-[[2-[1-(2,2-difluoro-3- hydroxy-propyl)tetrazol-5-yl]sulfanyl-5-nitro-benzoyl]amino] -2-(1,1,2,2,3,3,3- heptafluoropropyl)benzamide (2.6 mg; 6% yield; white solid). LC-MS Method B: (M+H) 648.1; Rt: 1.66 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 3.78 (br t, J=13.23 Hz, 2 H) 5.16 (br t, J=15.06 Hz, 2 H) 5.86 (br s, 1 H) 7.32 (d, J=9.03 Hz, 1 H) 7.60 (s, 1 H) 7.71 (d, J=8.60 Hz, 1 H) 7.89 - 7.93 (m, 2 H) 8.01 (br d, J=8.82 Hz, 1 H) 8.34 (dd, J=8.93, 2.47 Hz, 1 H) 8.78 (d, J=2.58 Hz, 1 H) 11.34 (s, 1 H) Example 365: 2-(1-acetonyltetrazol-5-yl)sulfanyl--{N}-[3-fluoro-5-(1,1,2, 2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-benzamide

N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2- yl]-2-({1-[(2R)-2-hydroxypropyl]-1H- 1,2,3,4-tetrazol-5-yl}sulfanyl)-5-nitrobenzamide (60 mg; 0.100 mmol) was dissolved in DCM dried (1.2 ml). Then Dess-Martin periodinane (48.034 mg; 0.110 mmol) was added while stirring. The beige solution, later suspension, was stirred at room temperature for 2.5 h.The mixture was diluted with DCM and extracted once with sodium thiosulfate solution and once with aqueous saturated NaHCO ₃ solution. The organic phase was dried over Na ₂ SO ₄ , filtered off and purified by chromatography (n-heptane/AcOEt, gradient 0-50% AcOEt). The solvent was removed and the partly greasy solid was treated with heptane. The precipitate was filtered off and washed with heptane to obtain 2-(1-acetonyltetrazol-5-yl)sulfanyl-{N}-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de (43.5 mg; 73% yield; white solid). LC-MS Method B: (M+H) 585.9; Rt: 1.81 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.28 (s, 3 H) 5.77 (s, 2 H) 7.29 (d, J=8.96 Hz, 1 H) 8.36 (dd, J=8.96, 2.57 Hz, 1 H) 8.45 (dd, J=9.92, 1.62 Hz, 1 H) 8.73 (s, 1 H) 8.80 (d, J=2.48 Hz, 1 H) 11.91 (s, 1 H) Example 366: 2-[1-[3-(dimethylamino)-3-oxo-propyl]tetrazol-5-yl]sulfanyl- {N}-[3-fluoro- 5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benza mide Step 1: 3-{5-[(2-{[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyrid in-2-yl]carbamoyl}-4- nitrophenyl)sulfanyl]-1H-1,2,3,4-tetrazol-1-yl}propanoic acid The same method as in example 357 was used to obtain 3-{5-[(2-{[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-yl]carbamoyl}-4-nitrophenyl)sulf anyl]-1H-1,2,3,4-tetrazol-1- yl}propanoic acid (100 mg; 57% yield; white solid). HRMS (ESI) calcd for C ₁₉ H ₁₁ F ₈ N ₇ O ₅ S [M + H] ⁺ 602.0488, found 602.0492 Step 2: 2-[1-[3-(dimethylamino)-3-oxo-propyl]tetrazol-5-yl]sulfanyl- {N}-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de

Under argon atmosphere 3-{5-[(2-{[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyrid in-2- yl]carbamoyl}-4-nitrophenyl)sulfanyl]-1H-1,2,3,4-tetrazol-1- yl}propanoic acid (60 mg; 0.099 mmol) was dissolved in DMF (1.8 mL), 4-methylmorpholine (27.2 μL; 0.247 mmol), dimethylamine 2.0 M solution in THF (59.4 μL; 0.119 mmol) and then HATU (56.4 mg; 0.148 mmol) were added and the yellow solution was stirred for 1.5 h at rt. The mixture was diluted with AcOEt and washed with saturated aqueous NaHCO ₃ solution. The organic phase was dried over Na ₂ SO ₄ , filtered off, concentrated to dryness and purified by chromatography n- heptane/AcOEt, gradient 0-100% AcOEt, to furnish 2-[1-[3-(dimethylamino)-3-oxo- propyl]tetrazol-5-yl]sulfanyl-{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (43.1 mg; 69% yield; white solid). LC-MS Method B: (M+H) 614.9; Rt: 1.77 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.72 - 2.77 (m, 3 H) 2.90 - 2.94 (m, 3 H) 3.07 (t, J=6.44 Hz, 2 H) 4.59 (t, J=6.44 Hz, 2 H) 7.21 (d, J=8.96 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 8.46 (dd, J=9.97, 1.57 Hz, 1 H) 8.74 (s, 1 H) 8.81 (d, J=2.57 Hz, 1 H) 11.92 (br s, 1 H) Example 367: 2-[1-[3-(ethylamino)-3-oxo-propyl]tetrazol-5-yl]sulfanyl-{N} -[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de The same method as in example 366 was used to yield 2-[1-[3-(ethylamino)-3-oxo- propyl]tetrazol-5-yl]sulfanyl-{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (39.4 mg; 63% yield; white solid). LC-MS Method B: (M+H) 614.9; Rt: 1.77 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 0.93 (t, J=7.25 Hz, 3 H) 2.79 (t, J=6.58 Hz, 2 H) 2.92 - 3.04 (m, 2 H) 4.60 (t, J=6.58 Hz, 2 H) 7.16 (d, J=8.96 Hz, 1 H) 7.97 (br t, J=5.20 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 8.47 (dd, J=9.97, 1.67 Hz, 1 H) 8.74 (s, 1 H) 8.83 (d, J=2.48 Hz, 1 H) 11.93 (s, 1 H) Example 368: 2-[1-[3-[ethyl(methyl)amino]-3-oxo-propyl]tetrazol-5-yl]sulf anyl-{N}-[3- fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitr o-benzamide The same method as in example 366 was used to afford 2-[1-[3-[ethyl(methyl)amino]-3-oxo- propyl]tetrazol-5-yl]sulfanyl-{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (30.9 mg; 49% yield; off-white solid). LC-MS Method B: (M+H) 642.9; Rt: 1.83 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 0.93 (t, J=7.10 Hz, 2 H) 1.05 (t, J=7.10 Hz, 1 H) 2.72 (s, 1 H) 2.89 (s, 2 H) 3.07 (dt, J=18.29, 6.45 Hz, 2 H) 3.19 - 3.29 (m, 2 H) 4.60 (td, J=6.37, 2.62 Hz, 2 H) 7.21 (d, J=8.96 Hz, 1 H) 8.30 (d, J=8.45 Hz, 1 H) 8.47 (d, J=10.30 Hz, 1 H) 8.74 (s, 1 H) 8.82 (d, J=2.38 Hz, 1 H) 11.93 (s, 1 H) Example 369: 2-[1-[3-(2-fluoroethylamino)-3-oxo-propyl]tetrazol-5-yl]sulf anyl-{N}-[3- fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitr o-benzamide The same method as in example 366 was used to get 2-[1-[3-(2-fluoroethylamino)-3-oxo- propyl]tetrazol-5-yl]sulfanyl-{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (37.7 mg; 58% yield; white solid). LC-MS Method B: (M+H) 646.9; Rt: 1.75 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.70 (s, 1 H) 2.86 (t, J=6.53 Hz, 2 H) 3.25 (q, J=5.25 Hz, 1 H) 4.34 (dt, J=47.49, 5.01 Hz, 2 H) 4.61 (t, J=6.58 Hz, 2 H) 7.16 (d, J=8.87 Hz, 1 H) 8.26 - 8.34 (m, 2 H) 8.47 (dd, J=9.97, 1.67 Hz, 1 H) 8.74 (s, 1 H) 8.83 (d, J=2.48 Hz, 1 H) 11.93 (s, 1 H) Example 370: 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]ethyl 2-methoxyacetate To a suspension of N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[1-(2- hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-nitrobenz amide (70 mg; 0.12 mmol; 1 eq.) in Dichloromethane dried (3.5 mL) were added methoxyacetic acid (10.3 μL; 0.13 mmol; 1.100 eq.), DMAP (14.915 mg; 0.12 mmol; 1 eq.), 1-hydroxybenzotrazole hydrate (9.4 mg; 0.06 mmol; 0.500 eq.) and (3-dimethylamino-propyl)-ethyl-carbodiimide hydrochloride (EDCI) (26.3 mg; 0.13 mmol; 1.1 eq.) under argon atmosphere. The clear reaction solution was stirred for 1 h at rt. The reaction solution was evaporated. The crude was purified by chromatography (Puriflash Interchem; Sunfire prep C18 OBD 5 μm, 30 x 150mm; water 0.1% TFA, 5 - 100% acetonitrile TFA 0.1%, 220 nm) to furnish 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)- 2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]et hyl 2-methoxyacetate (44.5 mg; 0.07 mmol; 56% yield; white solid). LC-MS Method B: (M+H) 646.0; Rt: 1.84 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.16 (s, 3 H) 3.86 (s, 2 H) 4.46 - 4.53 (m, 2 H) 4.77 (t, J=4.96 Hz, 2 H) 7.17 (d, J=8.96 Hz, 1 H) 8.33 (dd, J=8.96, 2.48 Hz, 1 H) 8.49 (dd, J=9.92, 1.43 Hz, 1 H) 8.75 (s, 1 H) 8.86 (d, J=2.57 Hz, 1 H) 11.99 (s, 1 H) Example 371: 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]ethyl 2-(2-methoxyethoxy)acetate

The same method as in example 370 was used to get 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethyl 2-(2- methoxyethoxy)acetate (79.100 mg; 0.11 mmol; 66% yield; white solid). LC-MS Method B: (M+H) 690.0; Rt: 1.84 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.17 (s, 3 H) 3.34 - 3.36 (m, 2 H) 3.42 - 3.48 (m, 2 H) 3.94 (s, 2 H) 4.49 (t, J=4.96 Hz, 2 H) 4.77 (t, J=4.96 Hz, 2 H) 7.16 (d, J=8.96 Hz, 1 H) 8.33 (dd, J=8.96, 2.57 Hz, 1 H) 8.49 (dd, J=10.01, 1.72 Hz, 1 H) 8.76 (s, 1 H) 8.87 (d, J=2.58 Hz, 1 H) 11.99 (s, 1 H) Example 372: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-(3- oxobutyl)tetrazol-5-yl]sulfanyl-benzamide The same method as in example 365 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-(3-oxobutyl)tetra zol-5-yl]sulfanyl-benzamide (48.200 mg; 52% yield; white solid). LC-MS Method B: (M+H) 599.9; Rt: 1.81 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.09 (s, 3 H) 3.22 (t, J=6.39 Hz, 2 H) 4.53 (t, J=6.39 Hz, 2 H) 7.15 (d, J=8.96 Hz, 1 H) 8.32 (dd, J=8.92, 2.53 Hz, 1 H) 8.49 (dd, J=9.97, 1.67 Hz, 1 H) 8.75 (s, 1 H) 8.84 (d, J=2.57 Hz, 1 H) 11.97 (s, 1 H) Example 373: 4-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]etho xy]-4-oxo-butanoic acid The same method as in example 370 was used to get 4-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethoxy]-4-oxo- butanoic acid (58.7 mg; 0.09 mmol; 49% yield; white solid). LC-MS Method B: (M+H) 674.0; Rt: 1.75 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.29 - 2.36 (m, 4 H) 4.42 (t, J=5.05 Hz, 2 H) 4.74 (t, J=5.05 Hz, 2 H) 7.16 (d, J=8.96 Hz, 1 H) 8.31 (dd, J=8.92, 2.53 Hz, 1 H) 8.45 (br d, J=9.92 Hz, 1 H) 8.73 (s, 1 H) 8.84 (d, J=2.48 Hz, 1 H) 11.94 (br s, 1 H) Example 374: ({E})-4-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoroprop yl)-2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]etho xy]-4-oxo-but-2-enoic acid The same method as in example 370 was used to get ({E})-4-[2-[5-[2-[[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nit ro-phenyl]sulfanyltetrazol-1- yl]ethoxy]-4-oxo-but-2-enoic acid (5.5 mg; 0.01 mmol; 4% yield; white solid). LC-MS Method B: (M+H) 672.0; Rt: 1.76 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.50 - 4.60 (m, 2 H) 4.74 - 4.88 (m, 2 H) 6.33 (d, J=15.74 Hz, 1 H) 6.51 (d, J=15.83 Hz, 1 H) 7.12 (d, J=8.96 Hz, 1 H) 8.28 (dd, J=8.92, 2.53 Hz, 1 H) 8.43 - 8.49 (m, 1 H) 8.74 (s, 1 H) 8.81 - 8.87 (m, 1 H) 11.90 - 11.96 (m, 1 H) Example 375: {O}4-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl) -2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]ethy l] {O}1-methyl butanedioate The same method as in example 370 was used to get {O}4-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethyl] {O}1-methyl butanedioate (16.4 mg; 48% yield; white solid). LC-MS Method B: (M+H) 688.0; Rt: 1.87 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.35 - 2.44 (m, 4 H) 3.53 (s, 3 H) 4.42 (t, J=5.05 Hz, 2 H) 4.74 (t, J=5.01 Hz, 2 H) 7.16 (d, J=8.96 Hz, 1 H) 8.31 (dd, J=8.96, 2.57 Hz, 1 H) 8.46 (dd, J=9.97, 1.48 Hz, 1 H) 8.74 (s, 1 H) 8.85 (d, J=2.48 Hz, 1 H) 11.94 (s, 1 H) Example 376: 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]ethyl acetate The same method as in example 370 was used to get 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethyl acetate (47.3 mg; 0.08 mmol; 44 % yield; white solid). LC-MS Method B: (M+H) 616.0; Rt: 1.85 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.08 (s, 3 H) 4.45 - 4.50 (m, 2 H) 4.77 (t, J=4.96 Hz, 2 H) 7.12 (d, J=8.96 Hz, 1 H) 8.30 (dd, J=8.96, 2.48 Hz, 1 H) 8.47 (dd, J=9.97, 1.67 Hz, 1 H) 8.74 (s, 1 H) 8.85 (d, J=2.57 Hz, 1 H) 11.94 (s, 1 H) Example 377: 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]ethyl {N},{N}-dimethylcarbamate N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[1-(2-hydroxyethyl)-1H-1,2,3,4- tetrazol-5-yl]sulfanyl}-5-nitrobenzamide (100 mg; 0.174 mmol), DMAP (1.6 mg; 0.013 mmol) and DIPEA (0.089 ml; 0.523 mmol) were dissolved in dry THF (1 mL). Then N,N- dimethylcarbamoyl chloride (21.3 mg; 0.192 mmol) was added and the pale yellow solution was at 70 °C overnight. The mixture was diluted with AcOEt and washed twice with water. The organic phase was dried over Na ₂ SO ₄ , filtered off, concentrated to dryness and purified by preparative chromatography (reversed phase; Sunfire; water/ACN/0.1% TFA; gradient 30-80% ACN/0.1% TFA) to get 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]ethy l {N}, {N} -dimethylcarbamate (30.9 mg; 26% yield; pale yellow solid). UPLC-MS Method A: (M+H) 645.2; Rt: 0.58 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.66 (br d, J=16.02 Hz, 6 H) 4.35 (t, J=4.96 Hz, 2 H) 4.73 (t, J=4.91 Hz, 2 H) 7.22 (d, J=8.96 Hz, 1 H) 8.32 (dd, J=8.92, 2.53 Hz, 1 H) 8.47 (dd, J=9.97, 1.57 Hz, 1 H) 8.74 (s, 1 H) 8.84 (d, J=2.48 Hz, 1 H) 11.94 (s, 1 H) Example 378: 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]ethyl methyl carbonate Under argon atmosphere, N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[1-(2- hydroxyethyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-nitrobenz amide (100 mg; 0.174 mmol), pyridine dried (0.014 mL; 0.174 mmol) and DMAP (4.5 mg; 0.035 mmol) were suspended in dry DCM (2 mL) and cooled in an ice bath. Then methyl chloroformate (0.027 ml; 0.349 mmol) was added and the resulting colorless solution was stirred overnight while the mixture was allowed to come to rt. The mixture was then diluted with AcOEt and washed twice with water. The organic phase was dried over Na ₂ SO ₄ , filtered off, concentrated and purified by preparative HPLC (reversed phase; Sunfire; water/ACN/0.1% TFA; gradient 30-80% ACN/0.1% TFA) to get 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]-4-nitro- phenyl]sulfanyltetrazol-1-yl]ethyl methyl carbonate (15 mg; 13% yield; white solid). UPLC-MS Method A: (M+H) 632.2; Rt: 0.59 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.57 (s, 3 H) 4.45 - 4.50 (m, 2 H) 4.77 (t, J=4.96 Hz, 2 H) 7.12 (d, J=8.96 Hz, 1 H) 8.30 (dd, J=8.96, 2.48 Hz, 1 H) 8.47 (dd, J=9.97, 1.67 Hz, 1 H) 8.74 (s, 1 H) 8.85 (d, J=2.57 Hz, 1 H) 11.94 (s, 1 H) Example 379: 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]ethyl 2-(dimethylamino)acetate The same method as in example 370 was used to yield 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethyl 2- (dimethylamino)acetate (62.2 mg; 0.094 mmol; 53.7% yield; white solid). LC-MS Method B: (M+H) 658.9; Rt: 1.44 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.78 (s, 6 H) 4.08 (s, 2 H) 4.61 (t, J=5.01 Hz, 2 H) 4.81 (t, J=4.96 Hz, 2 H) 7.18 (d, J=8.96 Hz, 1 H) 8.33 (dd, J=8.92, 2.53 Hz, 1 H) 8.48 (dd, J=9.97, 1.76 Hz, 1 H) 8.75 (s, 1 H) 8.89 (d, J=2.48 Hz, 1 H) 10.03 (br s, 1 H) 11.99 (br s, 1 H) Example 380: 5-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]etho xy]-5-oxo-pentanoic acid

The same method as in example 370 was used to afford 5-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethoxy]-5-oxo- pentanoic acid (64.2 mg; 0.093 mmol; 53,5% yield; white solid). LC-MS Method B: (M+H) 687.9; Rt: 1.75 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.59 (quin, J=7.46 Hz, 2 H) 2.09 - 2.19 (m, 4 H) 4.42 (t, J=5.01 Hz, 2 H) 4.75 (t, J=5.01 Hz, 2 H) 7.19 (d, J=8.96 Hz, 1 H) 8.33 (dd, J=8.92, 2.53 Hz, 1 H) 8.45 (dd, J=9.97, 1.76 Hz, 1 H) 8.74 (s, 1 H) 8.85 (d, J=2.48 Hz, 1 H) 11.94 (br s, 1 H) 12.02 (br s, 1 H) Example 381: 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]ethyl 3-(dimethylamino)propanoate The same method as in example 370 was used to get 2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethyl 3- (dimethylamino)propanoate (72 mg; 0.107 mmol; 81.8% yield; white solid). LC-MS Method B: (M+H) 673.0; Rt: 1.44 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 2.70 (t, J=7.53 Hz, 2 H) 2.72 (s, 6 H) 3.24 (br t, J=7.31 Hz, 2 H) 4.45 - 4.53 (m, 2 H) 4.78 (t, J=4.95 Hz, 2 H) 7.18 (d, J=8.82 Hz, 1 H) 8.33 (dd, J=9.03, 2.58 Hz, 1 H) 8.49 (dd, J=9.90, 1.72 Hz, 1 H) 8.76 (s, 1 H) 8.88 (d, J=2.37 Hz, 1 H) 12.00 (br s, 1 H) Example 382: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-(3- oxopentyl)tetrazol-5-yl]sulfanyl-benzamide Step 1: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-2 -[1-(3-methoxypentyl) tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 357 was used to yield N-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(3-methoxypentyl)tetrazol -5-yl]sulfanyl-5-nitro-benzamide (56% yield; white solid). HRMS (ESI) calcd for C ₂₂ H ₁₉ F ₈ N ₇ O ₄ S [M + H] ⁺ 630.1164, found 630.1169 Step 2: N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-{[1-(3- hydroxypentyl)-1H-1,2,3,4-tetrazol-5-yl]sulfanyl}-5-nitroben zamide The same method as in example 361 was used to get N-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)pyridin-2-yl]-2-{[1-(3-hydroxypentyl)-1H-1 ,2,3,4-tetrazol-5-yl]sulfanyl}-5- nitrobenzamide (16% yield; white solid). HRMS (ESI) calcd for C ₂₁ H ₁₇ F ₈ N ₇ O ₄ S [M + H] ⁺ 616.1008, found 616.1010 Step 3: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-(3- oxopentyl)tetrazol-5-yl]sulfanyl-benzamide

The same method as in example 365 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-(3-oxopentyl)tetr azol-5-yl]sulfanyl-benzamide (40.70 mg; 0.07 mmol; 23.6% yield; off-white solid). LC-MS Method I: (M+H) 614.5; Rt: 1.45 min ¹ H NMR (300 MHz, DMSO-d ₆ )11.95 (s, 1H), 8.83 (d, J = 2.5 Hz, 1H), 8.72 (d, J =1.8 Hz, 1H), 8.44 (d, J = 10.0 Hz, 1H), 8.29 (dd, J = 8.9, 2.5 Hz, 1H), 7.13 (d, J = 8.9 Hz, 1H), 4.54 (t, J = 6.4 Hz, 2H), 3.17 (t, J= 6.4 Hz, 2H), 2.43 (q, J = 7.3 Hz, 2H), 0.85 (t, J = 7.3 Hz, 3H). Example 383: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[1-(2- hydroxyethyl)pyrrolidin-3-yl]tetrazol-5-yl]sulfanyl-5-nitro- benzamide Step 1: 2-{[1-(1-{2-[(tert-butyldimethylsilyl)oxy]ethyl}pyrrolidin-3 -yl)-1H-1,2,3,4-tetrazol- 5-yl]sulfanyl}-N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropy l)pyridin-2-yl]-5- nitrobenzamide The same method as in example 357 was used to afford 2-{[1-(1-{2-[(tert- butyldimethylsilyl)oxy]ethyl}pyrrolidin-3-yl)-1H-1,2,3,4-tet razol-5-yl]sulfanyl}-N-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl]-5-nitrobenzam ide (200 mg; 0.26 mmol; 53% yield; white solid) HRMS (ESI) calcd for C ₂₈ H ₃ 2F ₈ N ₈ O ₄ SSi [M + H] ⁺ 757.1982, found 757.1984 Step 2: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[1-(2- hydroxyethyl)pyrrolidin-3-yl]tetrazol-5-yl]sulfanyl-5-nitro- benzamide

A mixture of 2-{[1-(1-{2-[(tert-butyldimethylsilyl)oxy]ethyl}pyrrolidin-3 -yl)-1H-1,2,3,4-tetrazol-5- yl]sulfanyl}-N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl) pyridin-2-yl]-5-nitrobenzamide (200 mg; 0.26 mmol; 1.00 eq.) and CsF (84 mg; 0.53 mmol; 1.99 eq.) in DMF (4.0 mL) was stirred for 16 h at 60 °C under N ₂ atmosphere.The resulting mixture was cooled down to room temperature and concentrated under vacuum. The crude was purified by reverse flash chromatography (C18; mobile phase, ACN : water = 0 to 20% gradient over 30 min) to afford N-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl] -2-({1-[1-(2-hydroxyethyl)pyrrolidin- 3-yl]-1H-1,2,3,4-tetrazol-5-yl}sulfanyl)-5-nitrobenzamide (16.1 mg; 0.02 mmol; 9.2% yield; light orange solid). LC-MS Method K: (M+H) 643.1; Rt: 1.38 min ¹ H NMR (300 MHz, DMSO-d ₆ ) 11.84 (s, 1H), 8.84 (d, J = 2.6 Hz, 1H), 8.72 (d, J = 2.0 Hz, 1H), 8.45 - 8.42 (m, 1H), 8.30 - 8.27 (m, 1H), 7.04 (d, J = 8.9 Hz, 1H), 5.20 - 5.14 (m, 1H), 4.46 (s, 1H), 3.46 (t, J = 6.2 Hz, 2H), 2.99 -2.97 (m, 1H), 2.89 - 2.82 (m, 2H), 2.69 - 2.62 (m, 1H), 2.36 - 2.12 (m, 2H) Example 384: 7-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]etho xy]-7-oxo-heptanoic acid The same method as in example 370 was used to get 7-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethoxy]-7-oxo- heptanoic acid (11.3 mg; 0.014 mmol; 5.2% yield; white solid). LC-MS Method B: (M+H) 716.1; Rt: 1.76 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 1.07 - 1.14 (m, 2 H) 1.37 (tt, J=14.76, 7.50 Hz, 4 H) 2.10 (dt, J=15.17, 7.48 Hz, 4 H) 4.39 - 4.43 (m, 2 H) 4.74 (t, J=5.06 Hz, 2 H) 7.20 (d, J=9.03 Hz, 1 H) 8.33 (dd, J=8.93, 2.47 Hz, 1 H) 8.46 (dd, J=9.79, 1.61 Hz, 1 H) 8.74 (s, 1 H) 8.85 (d, J=2.37 Hz, 1 H) 11.96 (br s, 2 H) Example 385: 2-[3-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl) -2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]etho xy]-3-oxo- propyl]pentanedioic acid The same method as in example 370 was used to get 2-[3-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethoxy]-3-oxo- propyl]pentanedioic acid (75.3 mg; 0.098 mmol; 37.4% yield; white solid). LC-MS Method B: (M+H) 760.0; Rt: 1.68 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.50 - 1.69 (m, 4 H) 2.07 - 2.20 (m, 5 H) 4.36 - 4.50 (m, 2 H) 4.75 (t, J=5.01 Hz, 2 H) 7.17 - 7.22 (m, 1 H) 8.32 (dd, J=8.92, 2.53 Hz, 1 H) 8.44 (dd, J=9.92, 1.62 Hz, 1 H) 8.73 (s, 1 H) 8.84 (d, J=2.48 Hz, 1 H) 11.93 (s, 1 H) Example 386: 4-[4-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl) -2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]etho xy]-4-oxo-butoxy]butanoic acid

The same method as in example 345 step 2 was used to get 4-[4-[2-[5-[2-[[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nit ro-phenyl]sulfanyltetrazol-1- yl]ethoxy]-4-oxo-butoxy]butanoic acid (74.6 mg; 0.099 mmol; 37,9% yield; white solid). LC-MS Method B: (M+H) 746.0; Rt: 1.78 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ ppm 1.55 - 1.69 (m, 4 H) 2.12 - 2.22 (m, 4 H) 3.18 - 3.28 (m, 4 H) 4.42 (t, J=5.04 Hz, 2 H) 4.74 (t, J=4.96 Hz, 2 H) 7.20 (d, J=8.85 Hz, 1 H) 8.32 (dd, J=8.93, 2.52 Hz, 1 H) 8.45 (dd, J=10.07, 1.83 Hz, 1 H) 8.71 - 8.75 (m, 1 H) 8.84 (d, J=2.44 Hz, 1 H) 11.87 - 11.99 (m, 2 H) Example 387: 3-[2-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl) -2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]etho xy]-2-oxo- ethyl]pentanedioic acid The same method as in example 370 was used to get 3-[2-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]ethoxy]-2-oxo- ethyl]pentanedioic acid (79 mg; 0.106 mmol; 40.5% yield; white solid). LC-MS Method B: (M+H) 745.9; Rt: 1.67 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.15 - 2.27 (m, 6 H) 2.29 - 2.44 (m, 1 H) 4.42 (t, J=5.01 Hz, 2 H) 4.74 (t, J=4.96 Hz, 2 H) 7.18 (d, J=8.96 Hz, 1 H) 8.32 (dd, J=8.92, 2.53 Hz, 1 H) 8.45 (dd, J=9.92, 1.62 Hz, 1 H) 8.74 (s, 1 H) 8.85 (d, J=2.48 Hz, 1 H) 11.93 (s, 1 H) 12.12 (br d, J=7.63 Hz, 1 H) Example 388: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2- hydroxy-1-(hydroxymethyl)ethyl]tetrazol-5-yl]sulfanyl-5-nitr o-benzamide Step 1: 2-{[1-(2,2-dimethyl-1,3-dioxan-5-yl)-1H-1,2,3,4-tetrazol-5-y l]sulfanyl}-N-[3-fluoro- 5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl]-5-nitrobenz amide The same method as in example 357 was used to get 2-{[1-(2,2-dimethyl-1,3-dioxan-5-yl)-1H- 1,2,3,4-tetrazol-5-yl]sulfanyl}-N-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)pyridin-2-yl]-5- nitrobenzamide (500 mg; 0.74 mmol; 48% yield; white solid). HRMS (ESI) calcd for C ₂₂ H ₁₇ F ₈ N ₇ O ₅ S [M + H] ⁺ 644.0957, found 644.0951 Step 2: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-hydroxy-1- (hydroxymethyl)ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamid e A mixture of 2-{[1-(2,2-dimethyl-1,3-dioxan-5-yl)-1H-1,2,3,4-tetrazol-5-y l]sulfanyl}-N-[3-fluoro- 5-(1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl]-5-nitrobenz amide (500 mg; 0.74 mmol; 1.00 eq.) in HCl in 1,4-dioxane (5.0 mL) was stirred for 2 h at 70 °C under N ₂ atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (C18; mobile phase, ACN : water (FA) = 0 to 60% gradient over 30 min) to afford 2-{[1-(1,3-dihydroxypropan-2-yl)-1H-1,2,3,4-tetrazol-5-yl]su lfanyl}-N-[3- fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)pyridin-2-yl]-5-nitrobenzam ide (92.3 mg; 0.15 mmol; 20.7% yield; off-white solid). LC-MS Method I: (M+H) 603.95; Rt: 0.97 min ¹ H NMR (400 MHz, DMSO-d ₆ ) 11.98 (s, 1H), 8.85 (d, J = 2.5 Hz, 1H), 8.76 (d, J = 2.0 Hz, 1H), 8.49 (dd, J = 10.0, 2.0 Hz, 1H), 8.29 (dd, J = 9.0, 2.5 Hz, 1H), 7.13 (d, J = 9.0 Hz, 1H), 5.15 (t, J = 5.6 Hz, 2H), 4.74 (tt, J = 9.1, 4.8 Hz, 1H), 3.89 -3.75 (m, 4H). Example 389: 2-cyclopentyl-5-[[2-[1-(2-hydroxyethyl)tetrazol-5-yl]sulfany l-5-nitro- benzoyl]amino]benzamide The same method as in example 9 was used to afford {N}-(3-cyano-4-cyclopentyl-phenyl)-2- [1-(2-hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide (13 mg; 20% yield; white solid). HPLC-MS Method C: (M+H) 498.2; Rt: 3.75 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ 10.95 (s, 1H), 8.68 (d, 1H, J=2.5 Hz), 8.25 (dd, 1H, J=2.5, 8.9 Hz), 7.79 (s, 1H), 7.73 (dd, 1H, J=2.3, 8.4 Hz), 7.68 (d, 1H, J=2.4 Hz), 7.39 (d, 1H, J=8.5 Hz), 7.23 (d, 1H, J=8.9 Hz), 5.12 (t, 1H, J=5.5 Hz), 4.5-4.6 (m, 1H), 3.78 (q, 1H, J=5.3 Hz), 3.2-3.3 (m, 1H), 1.9-2.0 (m, 1H), 1.7-1.9 (m, 1H), 1.4-1.7 (m, 1H). Example 390: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-(1- tetrahydrofuran-3-yltetrazol-5-yl)sulfanyl-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-(1-tetrahydrofuran-3 -yltetrazol-5-yl)sulfanyl-benzamide (80 mg; 91% yield; beige solid). LCMS Method M: (M+H) 600.0; Rt: 1.85 min ¹ H NMR ( 500 MHz, DMSO-d ₆ ) δ 11.92 (s, 1H), 8.85 (d, 1H, J=2.5 Hz), 8.74 (s, 1H), 8.47 (d, 1H, J=9.6 Hz), 8.30 (dd, 1H, J=2.5, 8.9 Hz), 7.09 (d, 1H, J=9.0 Hz), 5.35 (tdd, 1H, J=3.1, 5.7, 8.4 Hz), 4.06 (q, 1H, J=7.5 Hz), 3.9-4.0 (m, 2H), 3.84 (dt, 1H, J=5.2, 8.2 Hz), 2.40 (qd, 1H, J=7.9, 13.5 Hz), 2.3-2.3 (m, 1H). Example 391: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[[4-(2- hydroxy-1,1-dimethyl-ethyl)-1,2,4-triazol-3-yl]sulfanyl]-5-n itro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[[4-(2-hydroxy-1,1-dimethyl- ethyl)-1,2,4-triazol-3-yl]sulfanyl]-5- nitro-benzamide (51 mg; 48% yield; off-white solid). LCMS Method B: (M+H) 321.1 (fragment); Rt: 1.49 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.85 (s, 1H), 8.84 (s, 1H), 8.74 (d, 2H, J=9.4 Hz), 8.45 (br d, 1H, J=10.0 Hz), 8.27 (dd, 1H, J=2.6, 9.0 Hz), 6.93 (d, 1H, J=8.9 Hz), 5.24 (t, 1H, J=5.6 Hz), 3.67 (d, 2H, J=5.4 Hz), 1.54 (s, 6H). Example 392: 2-(6,8-dihydro-5-{H}-[1,2,4]triazolo[3,4-c][1,4]oxazin-3-yls ulfanyl)--{N}-[3- fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitr o-benzamide The same method as in example 305 was used to get 2-(6,8-dihydro-5-{H}-[1,2,4]triazolo[3,4- c][1,4]oxazin-3-ylsulfanyl)--{N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (32 mg; 22% yield; light yellow solid). LCMS Method B: (M+H) 585.0; Rt: 1.32 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.84 (s, 1H), 8.79 (d, 1H, J=2.6 Hz), 8.73 (s, 1H), 8.46 (dd, 1H, J=1.6, 10.0 Hz), 8.28 (dd, 1H, J=2.5, 8.9 Hz), 7.01 (d, 1H, J=9.0 Hz), 4.97 (s, 2H), 3.9-4.0 (m, 2H), 3.8-3.9 (m, 2H). Example 393: 2-[1-(1,4-dioxan-2-ylmethyl)tetrazol-5-yl]sulfanyl--{N}-[3-f luoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de The same method as in example 305 was used to get 2-[1-(1,4-dioxan-2-ylmethyl)tetrazol-5- yl]sulfanyl--{N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropy l)-2-pyridyl]-5-nitro-benzamide (16 mg; 14% yield; off-white solid). UPLC-MS Method A: (M+H) 629.9; Rt: 1.86 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.93 (s, 1 H) 8.81 (d, J=2.48 Hz, 1 H) 8.74 (s, 1 H) 8.47 (dd, J=9.97, 1.19 Hz, 1 H) 8.33 (dd, J=8.96, 2.48 Hz, 1 H) 7.03 - 7.29 (m, 1 H) 4.59 - 4.73 (m, 1 H) 4.51 (dd, J=14.54, 8.15 Hz, 1 H) 3.80 - 3.96 (m, 2 H) 3.52 - 3.58 (m, 2 H) 3.34 - 3.39 (m, 2 H) 3.29 (dd, J=11.25, 9.63 Hz, 1 H). Example 394: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-(2- tetrahydrofuran-3-yloxyethyl)tetrazol-5-yl]sulfanyl-benzamid e

The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-(2-tetrahydrofura n-3-yloxyethyl)tetrazol-5-yl]sulfanyl- benzamide (18 mg; 16% yield; white solid). LCMS Method M: (M+H) 643.9; Rt: 1.85 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.92 (s, 1H), 8.81 (d, 1H, J=2.5 Hz), 8.74 (s, 1H), 8.47 (d, 1H, J=9.8 Hz), 8.31 (dd, 1H, J=2.5, 8.9 Hz), 7.17 (d, 1H, J=9.0 Hz), 4.63 (t, 2H, J=5.1 Hz), 4.0- 4.1 (m, 1H), 3.7-3.8 (m, 2H), 3.4-3.6 (m, 4H), 1.8-1.8 (m, 1H), 1.6-1.7 (m, 1H). Example 395: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[(2-{R})-2- hydroxypropyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(2-{R})-2-hydroxypropyl] tetrazol-5-yl]sulfanyl-5-nitro- benzamide (53 mg; 52% yield; pale beige solid). LCMS Method B: (M+H) 587.9; Rt: 1.77 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.90 (br s, 1H), 8.79 (d, 1H, J=2.5 Hz), 8.72 (s, 1H), 8.44 (br d, 1H, J=10.1 Hz), 8.29 (dd, 1H, J=2.6, 8.9 Hz), 7.26 (d, 1H, J=8.8 Hz), 5.14 (d, 1H, J=4.8 Hz), 4.48 (dd, 1H, J=3.5, 13.9 Hz), 4.29 (dd, 1H, J=8.3, 13.9 Hz), 4.03 (br s, 1H), 1.13 (d, 3H, J=6.3 Hz). Example 396: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[(2-{S})-2- hydroxypropyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide

The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(2-{S})-2-hydroxypropyl] tetrazol-5-yl]sulfanyl-5-nitro- benzamide (12 mg; 40% yield; pale beige solid). LCMS Method B: (M+H) 587.9; Rt: 1.77 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.90 (br s, 1H), 8.79 (d, 1H, J=2.5 Hz), 8.72 (s, 1H), 8.44 (br d, 1H, J=10.1 Hz), 8.29 (dd, 1H, J=2.6, 8.9 Hz), 7.26 (d, 1H, J=8.8 Hz), 5.14 (d, 1H, J=4.8 Hz), 4.48 (dd, 1H, J=3.5, 13.9 Hz), 4.29 (dd, 1H, J=8.3, 13.9 Hz), 4.03 (br s, 1H), 1.13 (d, 3H, J=6.3 Hz). Example 397: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[[4-methyl-5- (2-methyl-1,3-dioxolan-2-yl)-1,2,4-triazol-3-yl]sulfanyl]-5- nitro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[[4-methyl-5-(2-methyl-1,3-d ioxolan-2-yl)-1,2,4-triazol-3- yl]sulfanyl]-5-nitro-benzamide (26 mg; 21% yield; white solid). LCMS Method B: (M+H) 349.0 - 629.1; Rt: 1.78 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.91 (s, 1H), 8.80 (d, 1H, J=2.5 Hz), 8.75 (s, 1H), 8.50 (d, 1H, J=9.9 Hz), 8.34 (dd, 1H, J=2.5, 8.9 Hz), 6.84 (d, 1H, J=9.0 Hz), 4.1-4.2 (m, 2H), 4.0-4.0 (m, 2H), 3.59 (s, 3H), 1.76 (s, 3H). Example 398: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[[5- (methoxymethyl)-4-methyl-1,2,4-triazol-3-yl]sulfanyl]-5-nitr o-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[[5-(methoxymethyl)-4-methyl -1,2,4-triazol-3-yl]sulfanyl]-5- nitro-benzamide (41 mg; 20% yield; light yellow solid). LCMS Method B: (M+H) 307.1 – 587.0; Rt: 1.78 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.32 (s, 3 H) 3.55 (s, 3 H) 4.68 (s, 2 H) 6.89 (d, J=8.87 Hz, 1 H) 8.29 (dd, J=8.92, 2.53 Hz, 1 H) 8.46 (d, J=8.96 Hz, 1 H) 8.73 (s, 1 H) 8.79 (d, J=2.48 Hz, 1 H) 11.85 (s, 1 H). Example 399: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(3- methylsulfonylpropyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamid e The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(3-methylsulfonylpropyl)t etrazol-5-yl]sulfanyl-5-nitro- benzamide (25 mg; 30% yield; beige solid). LCMS Method B: (M+H) 649.9; Rt: 1.78 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 2.24 - 2.29 (m, 2 H) 2.93 (s, 3 H) 3.19 - 3.24 (m, 2 H) 4.55 (t, J=7.10 Hz, 2 H) 7.11 (d, J=9.03 Hz, 1 H) 8.27 (dd, J=8.93, 2.47 Hz, 1 H) 8.46 (d, J=9.79 Hz, 1 H) 8.73 (s, 1 H) 8.86 (d, J=2.58 Hz, 1 H) 11.95 (br s, 1 H). Example 400: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(3- methylsulfinylpropyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamid e The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(3-methylsulfinylpropyl)t etrazol-5-yl]sulfanyl-5-nitro- benzamide (31 mg; 28% yield; pale yellow solid). LCMS Method B: (M+H) 633.9; Rt: 1.71 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 2.21 (quin, J=7.37 Hz, 2 H) 2.46 - 2.48 (m, 3 H) 2.67 (dt, J=13.28, 7.34 Hz, 1 H) 2.80 (dt, J=13.23, 7.80 Hz, 1 H) 4.55 (t, J=7.10 Hz, 2 H) 7.13 (d, J=9.03 Hz, 1 H) 8.28 (dd, J=8.93, 2.47 Hz, 1 H) 8.47 (d, J=9.84 Hz, 1 H) 8.75 (s, 1 H) 8.85 (d, J=2.58 Hz, 1 H) 11.94 (s, 1 H). Example 401: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[(1-{R})-2- hydroxy-1-methyl-ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzam ide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1-{R})-2-hydroxy-1-meth yl-ethyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide (27 mg; 38% yield; white solid). LCMS Method B: (M+H) 588.1; Rt: 1.81 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.91 (s, 1H), 8.81 (d, 1H, J=2.6 Hz), 8.73 (s, 1H), 8.46 (dd, 1H, J=1.6, 10.0 Hz), 8.29 (dd, 1H, J=2.5, 8.9 Hz), 7.18 (d, 1H, J=9.0 Hz), 5.16 (t, 1H, J=5.5 Hz), 4.7-4.8 (m, 1H), 3.73 (td, 1H, J=4.8, 11.4 Hz), 3.6-3.6 (m, 1H), 1.48 (d, 3H, J=6.9 Hz) Example 402: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(2- methylsulfinylethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(2-methylsulfinylethyl)te trazol-5-yl]sulfanyl-5-nitro- benzamide (29 mg; 31% yield; pale yellow solid). LCMS Method B: (M+H) 636.1; Rt: 1.82 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.84 - 12.02 (m, 1 H) 8.83 (d, J=2.58 Hz, 1 H) 8.74 (d, J=1.43 Hz, 1 H) 8.46 (m, J=9.30, 4.50, 2.20 Hz, 1 H) 8.30 (dd, J=8.96, 2.57 Hz, 1 H) 7.23 (d, J=8.87 Hz, 1 H) 4.89 (t, J=6.72 Hz, 2 H) 3.87 (t, J=6.72 Hz, 2 H) 3.06 (s, 3 H). Example 403: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(2- methylsulfinylethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(2-methylsulfinylethyl)te trazol-5-yl]sulfanyl-5-nitro- benzamide (25 mg; 30% yield; off-white solid). LCMS Method B: (M+H) 619.9; Rt: 1.70 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.57 - 2.59 (m, 3 H) 3.23 (dt, J=13.64, 6.15 Hz, 1 H) 3.44 (dt, J=13.66, 6.95 Hz, 1 H) 4.80 - 4.90 (m, 2 H) 7.21 (d, J=8.96 Hz, 1 H) 8.29 (dd, J=8.87, 2.57 Hz, 1 H) 8.45 (br d, J=8.77 Hz, 1 H) 8.73 (s, 1 H) 8.83 (d, J=2.48 Hz, 1 H) 11.92 (br s, 1 H). Example 404: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[(2-methyl- 1,3-dioxolan-2-yl)methyl]tetrazol-5-yl]sulfanyl-5-nitro-benz amide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1-{S})-2-hydroxy-1-meth yl-ethyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide (68 mg; 52% yield; beige solid). LCMS Method B: (M+H) 629.9; Rt: 1.98 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.33 (s, 3 H) 3.35 - 3.53 (m, 2 H) 3.73 - 3.96 (m, 2 H) 4.69 (s, 2 H) 7.37 (d, J=8.96 Hz, 1 H) 8.35 (dd, J=8.92, 2.53 Hz, 1 H) 8.46 (dd, J=9.92, 1.62 Hz, 1 H) 8.73 (s, 1 H) 8.77 (d, J=2.48 Hz, 1 H) 11.90 (s, 1 H). Example 405: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[(1{S})-2- hydroxy-1-methyl-ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzam ide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1{S})-2-hydroxy-1-methy l-ethyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide (41 mg; 50% yield; white solid).LCMS Method B: (M+H) 588.1; Rt: 1.81 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.91 (s, 1H), 8.81 (d, 1H, J=2.5 Hz), 8.74 (s, 1H), 8.46 (dd, 1H, J=1.8, 10.0 Hz), 8.29 (dd, 1H, J=2.5, 8.9 Hz), 7.18 (d, 1H, J=9.0 Hz), 5.15 (t, 1H, J=5.5 Hz), 4.7-4.8 (m, 1H), 3.73 (td, 1H, J=4.7, 11.5 Hz), 3.62 (ddd, 1H, J=5.8, 9.1, 11.3 Hz), 1.48 (d, 3H, J=6.8 Hz). Example 406: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-(1- tetrahydropyran-4-yltetrazol-5-yl)sulfanyl-benzamide The same method as in example 305 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-(1-tetrahydropyran-4 -yltetrazol-5-yl)sulfanyl-benzamide (41 mg; 50% yield; white solid). LCMS Method B: (M+H) 613.9; Rt: 1.88 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.95 (br dd, J=12.49, 2.29 Hz, 2 H) 2.01 - 2.11 (m, 2 H) 3.46 (td, J=11.75, 1.86 Hz, 2 H) 3.91 - 3.98 (m, 2 H) 4.86 (tt, J=11.32, 4.32 Hz, 1 H) 7.10 (d, J=8.96 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 8.47 (dd, J=10.01, 1.72 Hz, 1 H) 8.74 (s, 1 H) 8.84 (d, J=2.48 Hz, 1 H) 11.93 (s, 1 H). Example 407: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[(1- hydroxycyclobutyl)methyl]tetrazol-5-yl]sulfanyl-5-nitro-benz amide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1-hydroxycyclobutyl)met hyl]tetrazol-5-yl]sulfanyl-5-nitro- benzamide (39 mg; 62% yield; light yellow solid). LCMS Method B: (M+H) 614.0; Rt: 1.87 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.61 - 1.76 (m, 2 H) 1.93 - 2.00 (m, 2 H) 2.15 - 2.24 (m, 2 H) 3.27 - 3.29 (m, 1 H) 4.57 (s, 2 H) 7.34 (d, J=8.96 Hz, 1 H) 8.31 (dd, J=8.92, 2.53 Hz, 1 H) 8.45 (dd, J=9.97, 1.67 Hz, 1 H) 8.73 (d, J=1.33 Hz, 1 H) 8.75 (d, J=2.57 Hz, 1 H) 11.88 (s, 1 H). Example 408: 2-[[4-(difluoromethyl)-5-[(dimethylamino)methyl]-1,2,4-triaz ol-3- yl]sulfanyl]-{N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropy l)-2-pyridyl]-5-nitro- benzamide The same method as in example 305 was used to yield 2-[[4-(difluoromethyl)-5- [(dimethylamino)methyl]-1,2,4-triazol-3-yl]sulfanyl]-{N}-[3- fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-benzamide (5 mg; 8% yield; light yellow solid). LCMS Method B: (M+H) 356-636.0; Rt: 1.48 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.20 (s, 6 H) 3.82 (s, 2 H) 7.06 (d, J=8.87 Hz, 1 H) 7.92 (s, 1 H) 8.32 (dd, J=8.96, 2.57 Hz, 1 H) 8.45 (br d, J=9.73 Hz, 1 H) 8.73 (s, 1 H) 8.82 (d, J=2.57 Hz, 1 H) 11.89 (s, 1 H). Example 409: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1- [(1{R},2{S})-2-hydroxy-1-methyl-propyl]tetrazol-5-yl]sulfany l-5-nitro-benzamide The same method as in example 305 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1{R},2{S})-2-hydroxy-1- methyl-propyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (21 mg; 69% yield; white solid). LCMS Method B: (M+H) 601.9; Rt: 1.79 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.88 (s, 1H), 8.79 (d, 1H, J=2.4 Hz), 8.73 (s, 1H), 8.45 (dd, 1H, J=1.7, 9.9 Hz), 8.32 (dd, 1H, J=2.6, 8.8 Hz), 7.28 (d, 1H, J=9.0 Hz), 5.19 (d, 1H, J=5.3 Hz), 4.7-4.8 (m, 1H), 3.9-4.0 (m, 1H), 1.53 (d, 3H, J=6.9 Hz), 0.92 (d, 3H, J=6.4 Hz). Example 410: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1- [(1{S},2{R})-2-hydroxy-1-methyl-propyl]tetrazol-5-yl]sulfany l-5-nitro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1{S},2{R})-2-hydroxy-1- methyl-propyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (35 mg; 61% yield; off-white solid). LCMS Method B: (M+H) 601.9; Rt: 1.79 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ ppm 0.91 (d, J=6.41 Hz, 3 H) 1.52 (d, J=7.02 Hz, 3 H) 3.89 - 3.97 (m, 1 H) 4.67 - 4.75 (m, 1 H) 5.18 (d, J=5.19 Hz, 1 H) 7.27 (d, J=8.85 Hz, 1 H) 8.31 (dd, J=8.93, 2.52 Hz, 1 H) 8.44 (dd, J=10.07, 1.68 Hz, 1 H) 8.71 - 8.74 (m, 1 H) 8.78 (d, J=2.59 Hz, 1 H) 11.88 (s, 1 H). Example 411: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1- [(1{R},3{S})-3-hydroxycyclopentyl]tetrazol-5-yl]sulfanyl-5-n itro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1{R},3{S})-3-hydroxycyc lopentyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide (43 mg; 58% yield; beige solid). LCMS Method B: (M+H) 613.9; Rt: 1.76 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 1.72 - 1.84 (m, 2 H) 1.89 (dt, J=13.50, 6.70 Hz, 1 H) 1.98 - 2.09 (m, 1 H) 2.20 (dq, J=13.04, 7.91 Hz, 1 H) 2.34 - 2.39 (m, 1 H) 4.12 - 4.16 (m, 1 H) 4.84 (d, J=4.09 Hz, 1 H) 4.94 (quin, J=7.85 Hz, 1 H) 7.01 (d, J=9.03 Hz, 1 H) 8.31 (dd, J=8.93, 2.47 Hz, 1 H) 8.48 (dd, J=9.90, 1.72 Hz, 1 H) 8.74 (s, 1 H) 8.85 (d, J=2.58 Hz, 1 H) 11.94 (s, 1 H). Example 412: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[1- (hydroxymethyl)cyclopropyl]tetrazol-5-yl]sulfanyl-5-nitro-be nzamide The same method as in example 305 was used to yield {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[1-(hydroxymethyl)cyclopr opyl]tetrazol-5-yl]sulfanyl-5-nitro- benzamide (11 mg; 16% yield; white solid). LCMS Method B: (M+H) 599.9; Rt: 1.75 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 1.21 - 1.29 (m, 2 H) 1.30 - 1.36 (m, 2 H) 3.55 - 3.58 (m, 3 H) 7.48 (d, J=9.03 Hz, 1 H) 8.32 (dd, J=8.82, 2.58 Hz, 1 H) 8.46 (dd, J=9.90, 1.51 Hz, 1 H) 8.73 (d, J=1.08 Hz, 1 H) 8.76 (d, J=2.58 Hz, 1 H) 11.92 (s, 1 H). Example 413: 4-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyr idyl]carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]butanoic acid The same method as in example 305 was used to afford 4-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]butanoic acid (29 mg; 30% yield; off-white solid). LCMS Method B: (M+H) 615.9; Rt: 1.74 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.02 (quin, J=7.13 Hz, 2 H) 2.30 (t, J=7.15 Hz, 2 H) 4.46 (t, J=7.10 Hz, 2 H) 7.11 (d, J=8.96 Hz, 1 H) 8.29 (dd, J=8.96, 2.57 Hz, 1 H) 8.49 (dd, J=10.01, 1.62 Hz, 1 H) 8.75 (s, 1 H) 8.86 (d, J=2.48 Hz, 1 H) 11.97 (s, 1 H). Example 414: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(3- hydroxybutyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(3-hydroxybutyl)tetrazol- 5-yl]sulfanyl-5-nitro-benzamide (10 mg; 45% yield; beige greasy solid). LCMS Method B: (M+H) 601.9; Rt: 1.77 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.97 (s, 1H), 8.84 (d, 1H, J=2.6 Hz), 8.75 (s, 1H), 8.49 (dd, 1H, J=1.5, 9.9 Hz), 8.31 (dd, 1H, J=2.5, 8.9 Hz), 7.11 (d, 1H, J=9.0 Hz), 4.66 (d, 1H, J=4.8 Hz), 4.47 (t, 2H, J=7.3 Hz), 3.6-3.6 (m, 1H), 1.9-2.0 (m, 1H), 1.80 (qd, 1H, J=6.9, 15.4 Hz), 1.02 (d, 3H, J=6.2 Hz). Example 415: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-[2-(2- hydroxyethoxy)ethoxy]ethyl]tetrazol-5-yl]sulfanyl-5-nitro-be nzamide

The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-[2-(2-hydroxyethoxy)et hoxy]ethyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide (27 mg; 40% yield; brown solid). LCMS Method B: (M+H) 661.9; Rt: 1.72 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.23 - 3.30 (m, 2 H) 3.31 - 3.35 (m, 4 H) 3.39 - 3.43 (m, 3 H) 3.83 (t, J=5.05 Hz, 2 H) 4.65 (t, J=5.01 Hz, 2 H) 7.12 (d, J=8.96 Hz, 1 H) 8.30 - 8.35 (m, 1 H) 8.49 (dd, J=10.01, 1.62 Hz, 1 H) 8.75 (s, 1 H) 8.83 (d, J=2.57 Hz, 1 H) 11.96 (s, 1 H). Example 416: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-(2- methyltetrazol-5-yl)sulfanyl-5-nitro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-(2-methyltetrazol-5-yl)sulfa nyl-5-nitro-benzamide (51 mg; 77% yield; beige solid). LCMS Method B: (M+H) 543.8; Rt: 1.85 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.48 (s, 3 H) 7.23 (d, J=8.87 Hz, 1 H) 8.24 (dd, J=8.96, 2.48 Hz, 1 H) 8.48 (dd, J=9.97, 1.67 Hz, 1 H) 8.75 (d, J=1.43 Hz, 1 H) 8.77 (d, J=2.48 Hz, 1 H) 11.91 (s, 1 H). Example 417: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-[2- (2-oxopyrrolidin-1-yl)ethyl]tetrazol-5-yl]sulfanyl-benzamide

The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-[2-(2-oxopyrrolid in-1-yl)ethyl]tetrazol-5-yl]sulfanyl- benzamide (32 mg; 58% yield; white solid). LCMS Method B: (M+H) 641.1; Rt: 1.76 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.84 (quin, J=7.53 Hz, 2 H) 1.99 - 2.07 (m, 2 H) 3.35 - 3.38 (m, 2 H) 3.55 - 3.63 (m, 2 H) 4.59 - 4.67 (m, 2 H) 7.29 (d, J=8.87 Hz, 1 H) 8.31 (dd, J=8.92, 2.53 Hz, 1 H) 8.50 (dd, J=10.01, 1.53 Hz, 1 H) 8.76 (s, 1 H) 8.85 (d, J=2.48 Hz, 1 H) 11.98 (s, 1 H). Example 418: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[4-[2- methoxyethyl(methyl)amino]-4-oxo-butyl]tetrazol-5-yl]sulfany l-5-nitro-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[4-[2-methoxyethyl(methyl )amino]-4-oxo-butyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (35 mg; 49% yield; pale orange solid). LCMS Method B: (M+H) 687.0; Rt: 1.82 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.97 (d, J=1.72 Hz, 1 H) 8.86 (d, J=2.57 Hz, 1 H) 8.75 (d, J=1.33 Hz, 1 H) 8.49 (dd, J=9.97, 1.67 Hz, 1 H) 8.29 (dt, J=8.99, 2.13 Hz, 1 H) 7.11 (t, J=9.25 Hz, 1 H) 4.44 (q, J=6.77 Hz, 2 H) 3.27 - 3.42 (m, 4 H) 3.19 (d, J=3.15 Hz, 3 H) 2.69 (s, 3 H) 2.29 - 2.42 (m, 2 H) 1.97 - 2.07 (m, 2 H). Example 419: 2-[1-[4-[ethyl(methyl)amino]-4-oxo-butyl]tetrazol-5-yl]sulfa nyl--{N}-[3- fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitr o-benzamide The same method as in example 305 was used to get 2-[1-[4-[ethyl(methyl)amino]-4-oxo- butyl]tetrazol-5-yl]sulfanyl--{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (8 mg; 47% yield; pale orange solid). LCMS Method B: (M+H) 656.9; Rt: 1.85 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.96 (br s, 1H), 8.86 (d, 1H, J=2.6 Hz), 8.75 (s, 1H), 8.49 (br d, 1H, J=9.8 Hz), 8.29 (td, 1H, J=2.0, 8.9 Hz), 7.12 (dd, 1H, J=3.6, 9.0 Hz), 4.45 (dt, 2H, J=3.5, 7.0 Hz), 3.1-3.3 (m, 2H), 2.81 (s, 2H), 2.70 (s, 2H), 2.3-2.4 (m, 2H), 2.03 (quin, 2H, J=6.7 Hz), 1.01 (t, 1H, J=7.1 Hz), 0.8-0.9 (m, 2H). Example 420: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-(1- quinuclidin-4-yltetrazol-5-yl)sulfanyl-benzamide The same method as in example 305 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-(1-quinuclidin-4-ylt etrazol-5-yl)sulfanyl-benzamide (30 mg; 38% yield; pale beige solid). LCMS Method B: (M+H) 639.0 Rt: 0.80 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.18 - 2.25 (m, 6 H) 2.92 - 3.00 (m, 6 H) 7.07 (br d, J=8.77 Hz, 1 H) 8.26 (dd, J=8.87, 2.48 Hz, 1 H) 8.35 (br d, J=9.73 Hz, 1 H) 8.67 (s, 1 H) 8.84 (d, J=2.48 Hz, 1 H). Example 421: 2-[1-[4-(dimethylamino)-4-oxo-butyl]tetrazol-5-yl]sulfanyl-- {N}-[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-nitro-benzami de The same method as in example 305 was used to yield 2-[1-[4-(dimethylamino)-4-oxo- butyl]tetrazol-5-yl]sulfanyl--{N}-[3-fluoro-5-(1,1,2,2,3,3,3 -heptafluoropropyl)-2-pyridyl]-5-nitro- benzamide (10 mg; 22% yield; beige solid). LCMS Method B: (M+H) 642.9; Rt: 1.80 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.02 (quin, J=6.94 Hz, 2 H) 2.30 - 2.36 (m, 2 H) 2.72 (s, 3 H) 2.84 (s, 3 H) 4.45 (t, J=7.06 Hz, 2 H) 7.12 (d, J=8.96 Hz, 1 H) 8.29 (dd, J=8.92, 2.53 Hz, 1 H) 8.50 (dd, J=9.92, 1.53 Hz, 1 H) 8.75 (s, 1 H) 8.86 (d, J=2.48 Hz, 1 H) 11.97 (s, 1 H). Example 422: methyl {N}-[2-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)- 2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]ethy l]carbamate The same method as in example 305 was used to get methyl {N}-[2-[5-[2-[[3-fluoro-5- (1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nit ro-phenyl]sulfanyltetrazol-1- yl]ethyl]carbamate (55 mg; 56% yield; pale yellow solid). LCMS Method B: (M+H) 631.0; Rt: 1.79 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.36 (s, 3 H) 3.39 - 3.43 (m, 2 H) 4.50 (t, J=5.48 Hz, 2 H) 7.17 (d, J=8.96 Hz, 1 H) 7.28 (t, J=5.91 Hz, 1 H) 8.27 (dd, J=8.96, 2.48 Hz, 1 H) 8.50 (dd, J=9.92, 1.62 Hz, 1 H) 8.74 - 8.77 (m, 1 H) 8.86 (d, J=2.57 Hz, 1 H) 11.98 (s, 1 H). Example 423: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(3- hydroxypentyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide

The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(3-hydroxypentyl)tetrazol -5-yl]sulfanyl-5-nitro-benzamide (23 mg; 12% yield; white solid). LCMS Method I: (M+H) 613.9; Rt: 1.32 min ¹ H NMR (400 MHz, Chloroform-d) 9.95 (s, 1H), 8.67 (d, J = 2.5 Hz, 1H), 8.50 - 8.45 (m, 1H), 8.22 (dd, J = 8.8, 2.5 Hz, 1H), 7.76 (dd, J = 9.4, 2.0 Hz, 1H), 7.56 (d, J = 8.8 Hz, 1H), 4.60 - 4.51(m, 2H), 3.45 (dddd, J= 9.8, 7.9,5.5, 2.7 Hz, 1H), 2.10 (dtd, J = 14.2, 7.7, 2.8 Hz, 1H), 1.92 - 1.78 (m,1H), 1.54 -1.37 (m, 3H), 0.88 (t, J =7.4 Hz, 3H). Example 424: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-(2- hydroxy-2-methyl-propoxy)ethyl]tetrazol-5-yl]sulfanyl-5-nitr o-benzamide The same method as in example 305 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-(2-hydroxy-2-methyl-pr opoxy)ethyl]tetrazol-5-yl]sulfanyl- 5-nitro-benzamide (64.20 mg; 0.10 mmol; 31.3% yield; off-white solid). LCMS Method I: (M+H) 644.25; Rt: 1.49 min ¹ H NMR (300 MHz, Chloroform-d) 9.54 (s, 1H), 8.62 (s, 1H), 8.52 - 8.45 (m, 1H), 8.28 (s, 1H), 7.83 - 7.70 (m, 2H), 4.66 (s, 2H), 3.92 (s, 2H), 3.19 (t, J = 4.6 Hz, 2H), 1.01 (dd, J = 5.0, 2.7 Hz, 6H). Example 425: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[(1- methylpyrazol-4-yl)methyl]tetrazol-5-yl]sulfanyl-5-nitro-ben zamide

The same method as in example 305 was used to yield {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1-methylpyrazol-4-yl)me thyl]tetrazol-5-yl]sulfanyl-5-nitro- benzamide (52.1 mg; 0.08 mmol; 80% yield; light brown solid). LCMS Method B: (M+H) 624.1; Rt: 1.80 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.68 (s, 3 H) 5.54 (s, 2 H) 6.83 (d, J=8.96 Hz, 1 H) 7.26 (s, 1 H) 7.59 (s, 1 H) 8.18 (dd, J=8.92, 2.53 Hz, 1 H) 8.48 (dd, J=10.01, 1.72 Hz, 1 H) 8.75 (s, 1 H) 8.84 (d, J=2.48 Hz, 1 H) 11.95 (s, 1 H). Example 426: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-[3- (2-oxopyrrolidin-1-yl)propyl]tetrazol-5-yl]sulfanyl-benzamid e The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-[3-(2-oxopyrrolid in-1-yl)propyl]tetrazol-5-yl]sulfanyl- benzamide (27.3 mg; 0.04 mmol; 39% yield; beige solid). LCMS Method B: (M+H) 655.1; Rt: 1.78 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.83 (quin, J=7.49 Hz, 2 H) 2.01 - 2.16 (m, 4 H) 3.19 (t, J=6.68 Hz, 2 H) 3.25 (br t, J=6.96 Hz, 2 H) 4.35 (t, J=7.10 Hz, 2 H) 7.10 (d, J=8.96 Hz, 1 H) 8.29 (dd, J=8.92, 2.34 Hz, 1 H) 8.47 (br d, J=10.01 Hz, 1 H) 8.74 (s, 1 H) 8.84 (d, J=2.29 Hz, 1 H) 11.93 (br s, 1 H). Example 427: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-[2- (2-oxooxazolidin-3-yl)ethyl]tetrazol-5-yl]sulfanyl-benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-[2-(2-oxooxazolid in-3-yl)ethyl]tetrazol-5-yl]sulfanyl- benzamide (24 mg; 51% yield; white solid). LCMS Method B: (M+H) 643.0; Rt: 1.75 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 3.56 - 3.61 (m, 4 H) 4.16 (dd, J=8.60, 7.31 Hz, 2 H) 4.65 - 4.68 (m, 2 H) 7.23 (d, J=8.82 Hz, 1 H) 8.29 (dd, J=9.03, 2.58 Hz, 1 H) 8.48 (d, J=9.81 Hz, 1 H) 8.75 (s, 1 H) 8.85 (d, J=2.58 Hz, 1 H) 11.95 (s, 1 H). Example 428: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[(1-methyl- 5-oxo-pyrrolidin-3-yl)methyl]tetrazol-5-yl]sulfanyl-5-nitro- benzamide The same method as in example 305 was used to yield {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[(1-methyl-5-oxo-pyrrolid in-3-yl)methyl]tetrazol-5-yl]sulfanyl- 5-nitro-benzamide (37 mg; 47% yield; beige solid). LCMS Method B: (M+H) 640.9; Rt: 1.73 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.12 (dd, J=16.74, 6.91 Hz, 1 H) 2.32 - 2.39 (m, 1 H) 2.64 (s, 3 H) 2.90 (dquin, J=14.95, 7.52, 7.52, 7.52, 7.52 Hz, 1 H) 3.15 (dd, J=9.92, 6.01 Hz, 1 H) 3.40 (dd, J=9.92, 8.11 Hz, 1 H) 4.50 (d, J=7.44 Hz, 2 H) 7.15 (d, J=8.87 Hz, 1 H) 8.31 (dd, J=8.87, 2.57 Hz, 1 H) 8.46 (br d, J=9.73 Hz, 1 H) 8.73 (s, 1 H) 8.85 (d, J=2.48 Hz, 1 H) 11.93 (s, 1 H). Example 429: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[3-(3- hydroxypyrrolidin-1-yl)propyl]tetrazol-5-yl]sulfanyl-5-nitro -benzamide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[3-(3-hydroxypyrrolidin-1 -yl)propyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide (30 mg; 40% yield; off-white solid). LCMS Method B: (M+H) 656.9; Rt: 1.43 min ¹ H NMR (700 MHz, DMSO-d ₆ ) δ ppm 9.91 - 13.05 (m, 1 H) 8.84 (d, J=2.37 Hz, 1 H) 8.68 (s, 1 H) 8.37 (br d, J=8.60 Hz, 1 H) 8.27 (dd, J=8.93, 2.47 Hz, 1 H) 7.09 (br d, J=9.03 Hz, 1 H) 4.71 (br d, J=1.72 Hz, 1 H) 4.46 (t, J=6.88 Hz, 2 H) 4.10 (br s, 1 H) 1.19 - 2.81 (m, 10 H). Example 430: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2- thiazol-2-ylsulfanyl-benzamide The same method as in example 305 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-thiazol-2-ylsulfanyl -benzamide (42 mg; 74% yield; white solid). LCMS Method B: (M+H) 264.90 - 545.00; Rt: 1.91 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 7.27 (d, J=8.87 Hz, 1 H) 8.12 (s, 2 H) 8.33 (dd, J=8.92, 2.53 Hz, 1 H) 8.45 (dd, J=9.97, 1.76 Hz, 1 H) 8.73 (d, J=2.38 Hz, 2 H) 11.82 (s, 1 H). Example 431: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-(1,3,4- thiadiazol-2-ylsulfanyl)benzamide

The same method as in example 305 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-(1,3,4-thiadiazol-2- ylsulfanyl)benzamide (32 mg; 56% yield; off-white solid). LCMS Method B: (M+H) 545.9; Rt: 1.82 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 7.45 (d, J=8.87 Hz, 1 H) 8.34 (dd, J=8.87, 2.57 Hz, 1 H) 8.45 (dd, J=9.97, 1.76 Hz, 1 H) 8.72 (d, J=1.33 Hz, 1 H) 8.76 (d, J=2.48 Hz, 1 H) 9.87 (s, 1 H) 11.86 (s, 1 H). Example 432: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(3- hydroxy-3-methyl-butyl)tetrazol-5-yl]sulfanyl-5-nitro-benzam ide The same method as in example 305 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(3-hydroxy-3-methyl-butyl )tetrazol-5-yl]sulfanyl-5-nitro- benzamide (42 mg; 75% yield; white solid). LCMS Method B: (M+H) 615.9; Rt: 1.83 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.09 (s, 6 H) 1.88 - 1.96 (m, 2 H) 4.47 (t, J=7.92 Hz, 3 H) 7.16 (d, J=8.96 Hz, 1 H) 8.31 (dd, J=8.92, 2.53 Hz, 1 H) 8.47 (dd, J=9.97, 1.76 Hz, 1 H) 8.74 (s, 1 H) 8.83 (d, J=2.48 Hz, 1 H) 11.94 (s, 1 H). Example 433: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(2- hydroxy-2-methyl-propyl)tetrazol-5-yl]sulfanyl-5-nitro-benza mide The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(2-hydroxy-2-methyl-propy l)tetrazol-5-yl]sulfanyl-5-nitro- benzamide (30 mg; 73% yield; white solid). LCMS Method B: (M+H) 601.9; Rt: 1.81 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 11.89 (s, 1H), 8.73 (dd, 2H, J=2.0, 6.5 Hz), 8.45 (dd, 1H, J=1.8, 10.0 Hz), 8.31 (dd, 1H, J=2.5, 8.9 Hz), 7.39 (d, 1H, J=9.0 Hz), 4.98 (s, 1H), 4.40 (s, 2H), 1.15 (s, 6H). Example 434: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[[4-(3- hydroxy-1,1-dimethyl-propyl)-1,2,4-triazol-3-yl]sulfanyl]-5- nitro-benzamide The same method as in example 305 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[[4-(3-hydroxy-1,1-dimethyl- propyl)-1,2,4-triazol-3-yl]sulfanyl]- 5-nitro-benzamide (22 mg; 13% yield; white solid). LCMS Method I: (M+H) 615.05; Rt: 0.91 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.89 (s, 1H), 8.87 (s, 1H), 8.79-8.71 (m, 2H), 8.47 (d, J = 10.0 Hz, 1H), 8.28 (dd, J = 8.9, 2.5 Hz, 1H), 6.97 (d, J = 9.0 Hz, 1H), 4.41 (t, J = 4.8 Hz, 1H), 3.30-3.24 (m, 2H), 2.11 (t, J = 6.6 Hz, 2H), 1.62 (s, 6H). Example 435: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-(4- methylthiazol-2-yl)sulfanyl-5-nitro-benzamide

The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-(4-methylthiazol-2-yl)sulfan yl-5-nitro-benzamide (34 mg; 60% yield; white solid). LCMS Method B: (M+H) 559.0; Rt: 1.97 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 2.46 (d, J=0.86 Hz, 3 H) 7.31 (d, J=8.87 Hz, 1 H) 7.66 (d, J=0.95 Hz, 1 H) 8.33 (dd, J=8.96, 2.57 Hz, 1 H) 8.45 (dd, J=9.97, 1.76 Hz, 1 H) 8.71 (dd, J=4.43, 2.05 Hz, 2 H) 11.80 (s, 1 H). Example 436: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-(5- methylthiazol-2-yl)sulfanyl-5-nitro-benzamide The same method as in example 305 was used to deliver {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-(5-methylthiazol-2-yl)sulfan yl-5-nitro-benzamide (22 mg; 58% yield; off-white solid). UPLC MS Method A: (M-H) 557.0; Rt: 0.63 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ ppm 2.52 - 2.54 (m, 3 H) 7.26 (d, J=8.95 Hz, 1 H) 7.83 (d, J=1.17 Hz, 1 H) 8.32 (dd, J=8.95, 2.49 Hz, 1 H) 8.45 (br d, J=9.98 Hz, 1 H) 8.72 (d, J=3.64 Hz, 1 H) 8.72 (s, 1 H) 11.81 (s, 1 H). Example 437: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[3-(2- hydroxy-2-methyl-propoxy)propyl]tetrazol-5-yl]sulfanyl-5-nit ro-benzamide

The same method as in example 305 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[3-(2-hydroxy-2-methyl-pr opoxy)propyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (77 mg; 34% yield; yellow solid). LCMS Method I: (M+H) 660.1; Rt: 1.07 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ ppm 11.93 (s, 1H), 8.86 (d, J = 2.5 Hz, 1H), 8.74 (d, J = 1.9 Hz, 1H), 8.47 (d, J = 10.0 Hz, 1H), 8.31 (dd, J = 8.9, 2.5 Hz, 1H), 7.12 (d, J = 8.9 Hz, 1H), 4.49 (t, J = 6.9 Hz, 2H), 4.23 (s, 1H), 3.41 (d, J = 11.4 Hz, 2H), 3.03 (s, 2H), 2.07 (dd, J = 7.7, 4.9 Hz, 2H), 0.95 (s, 6H). Example 438: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -5-nitro-2-[1-[3- (2-oxooxazolidin-3-yl)propyl]tetrazol-5-yl]sulfanyl-benzamid e The same method as in example 305 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-5-nitro-2-[1-[3-(2-oxooxazolid in-3-yl)propyl]tetrazol-5-yl]sulfanyl- benzamide (45 mg; 21% yield; off-white solid). LCMS Method I: (M+H) 654.9; Rt: 1.02 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ ppm 11.94 (s, 1H), 8.85 (d, J = 2.5 Hz, 1H), 8.75 (d, J = 2.0 Hz, 1H), 8.47 (dd, J = 10.1, 2.0 Hz, 1H), 8.29 (dd, J = 8.9, 2.5 Hz, 1H), 7.12 (d, J = 8.9 Hz, 1H), 4.43 (t, J = 7.1 Hz, 2H), 4.27 - 4.14 (m, 2H), 3.53 - 3.42 (m, 2H), 3.20 (t, J = 6.8 Hz, 2H), 2.09 (p, J = 7.0 Hz, 2H). Example 439: methyl 3-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2- pyridyl]carbamoyl]-4-nitro-phenyl]sulfanyltetrazol-1-yl]pyrr olidine-1-carboxylate The same method as in example 305 was used to get methyl 3-[5-[2-[[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]carbamoyl]-4-nitro-phenyl]sulfa nyltetrazol-1-yl]pyrrolidine-1- carboxylate (17 mg; 8% yield; off-white solid). LCMS Method K: (M+H) 655.0; Rt: 1.54 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ ppm 11.93 (s, 1H), 8.87 (d, J = 2.6 Hz, 1H), 8.73 (d, J = 2.0 Hz, 1H), 8.45 (dd, J = 10.0, 2.0 Hz, 1H), 8.28 (dd, J = 8.9, 2.6 Hz, 1H), 7.08 (d, J = 8.9 Hz, 1H), 5.33 (s, 1H), 3.73 (d, J = 3.4 Hz, 2H), 3.57 (dd, J = 16.5, 10.0 Hz, 5H), 2.41 - 2.21 (m,2H). Example 440: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[4- (hydroxymethyl)thiazol-2-yl]sulfanyl-5-nitro-benzamide The same method as in example 305 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[4-(hydroxymethyl)thiazol-2- yl]sulfanyl-5-nitro-benzamide (38 mg; 53% yield; white solid). LCMS Method B: (M+H) 575.0; Rt: 1.77 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 4.64 (d, J=5.05 Hz, 2 H) 5.49 (t, J=5.67 Hz, 1 H) 7.33 (d, J=8.87 Hz, 1 H) 7.79 (s, 1 H) 8.32 (dd, J=8.92, 2.53 Hz, 1 H) 8.45 (dd, J=9.97, 1.76 Hz, 1 H) 8.69 - 8.74 (m, 2 H) 11.81 (s, 1 H). Example 441: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-(3- hydroxy-1,1-dimethyl-propyl)tetrazol-5-yl]sulfanyl-5-nitro-b enzamide The same method as in example 305 was used to yield {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-(3-hydroxy-1,1-dimethyl-p ropyl)tetrazol-5-yl]sulfanyl-5-nitro- benzamide (70 mg; 55% yield; off-white solid). LCMS Method B: (M+H) 616.0; Rt: 1.79 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.75 (s, 6 H) 2.22 (t, J=6.20 Hz, 2 H) 3.35 - 3.39 (m, 2 H) 4.41 (t, J=4.58 Hz, 1 H) 7.22 (d, J=8.96 Hz, 1 H) 8.30 (dd, J=8.92, 2.53 Hz, 1 H) 8.47 (br d, J=9.35 Hz, 1 H) 8.74 (s, 1 H) 8.82 (d, J=2.48 Hz, 1 H) 11.96 (s, 1 H). Example 442: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[3-(2- hydroxyethoxy)propyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamid e The same method as in example 305 was used to get {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[3-(2-hydroxyethoxy)propy l]tetrazol-5-yl]sulfanyl-5-nitro- benzamide (22 mg; 14% yield; light yellow solid). LCMS Method I: (M+H) 632.05; Rt: 1.00 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ ppm 11.95 (s, 1H), 8.84 (d, J = 2.6 Hz, 1H), 8.74 (d, J = 1.6 Hz, 1H), 8.48 (d, J = 10.1 Hz, 1H), 8.31 (dd, J = 8.9, 2.6 Hz, 1H), 7.14 (d, J = 8.9 Hz, 1H), 4.49 (t, J = 6.9 Hz, 3H), 3.43 - 3.34 (m, 4H), 3.29 (d, J = 5.1 Hz, 2H), 2.06 (p, J = 6.6 Hz, 2H). Example 443: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-(2- hydroxy-2-methyl-propoxy)-1,1-dimethyl-ethyl]tetrazol-5-yl]s ulfanyl-5-nitro-benzamide The same method as in example 305 was used to afford {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-(2-hydroxy-2-methyl-pr opoxy)-1,1-dimethyl-ethyl]tetrazol- 5-yl]sulfanyl-5-nitro-benzamide (20 mg; 12% yield; off-white solid). LCMS Method I: (M+H) 674.15; Rt: 1.11 min ¹ H NMR (300 MHz, DMSO-d ₆ ) δ ppm 11.98 (s, 1H), 8.80 (d, J = 2.6 Hz, 1H), 8.76 - 8.69 (m, 1H), 8.50 - 8.40 (m, 1H), 8.31 (dd, J = 8.9, 2.6 Hz, 1H), 7.19 (d, J = 8.9 Hz, 1H), 4.28 (s, 1H), 3.82 (s, 2H), 3.02 (s, 2H), 1.76 (s, 6H), 0.89 (s, 6H). Example 444: 2-[1-[1,1-dimethyl-2-(2-oxooxazolidin-3-yl)ethyl]tetrazol-5- yl]sulfanyl--{N}- [3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-n itro-benzamide The same method as in example 305 was used to afford 2-[1-[1,1-dimethyl-2-(2-oxooxazolidin- 3-yl)ethyl]tetrazol-5-yl]sulfanyl--{N}-[3-fluoro-5-(1,1,2,2, 3,3,3-heptafluoropropyl)-2-pyridyl]-5- nitro-benzamide (50 mg; 21% yield; white solid). LCMS Method I: (M+H) 671.05; Rt: 1.05 min ¹ H NMR (400 MHz, DMSO-d ₆ ) δ ppm 11.95 (s, 1H), 8.80 (d, J = 2.5 Hz, 1H), 8.73 (t, J = 1.4 Hz, 1H), 8.49 - 8.42 (m, 1H), 8.33 - 8.26 (m, 1H), 7.31 (d, J = 8.9 Hz, 1H), 4.18 (t, J = 7.9 Hz, 2H), 3.72 (s, 2H), 3.43 (t, J = 7.9 Hz, 2H), 1.78 (s, 6H). Example 445: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-(5- methyl-2-oxo-oxazolidin-3-yl)ethyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide The same method as in example 305 was used to yield {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-(5-methyl-2-oxo-oxazol idin-3-yl)ethyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (43 mg; 57% yield; off-white solid). LCMS Method B: (M+H) 657.0; Rt: 1.78 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.24 (d, J=6.20 Hz, 3 H) 3.17 (dd, J=8.58, 6.87 Hz, 1 H) 3.51 - 3.60 (m, 2 H) 3.67 (t, J=8.44 Hz, 1 H) 4.50 - 4.57 (m, 1 H) 4.61 - 4.70 (m, 2 H) 7.26 (d, J=8.96 Hz, 1 H) 8.29 (dd, J=8.96, 2.58 Hz, 1 H) 8.47 (dd, J=9.97, 1.76 Hz, 1 H) 8.74 (s, 1 H) 8.85 (d, J=2.48 Hz, 1 H) 11.94 (s, 1 H). Example 446: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[1-[2-(4- methyl-2-oxo-oxazolidin-3-yl)ethyl]tetrazol-5-yl]sulfanyl-5- nitro-benzamide The same method as in example 305 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[1-[2-(4-methyl-2-oxo-oxazol idin-3-yl)ethyl]tetrazol-5- yl]sulfanyl-5-nitro-benzamide (47 mg; 41% yield; pale yellow solid). LCMS Method B: (M+H) 657.1; Rt: 1.78 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.12 (d, J=6.20 Hz, 3 H) 3.52 - 3.71 (m, 3 H) 3.85 - 3.99 (m, 1 H) 4.29 (t, J=8.39 Hz, 1 H) 4.55 - 4.70 (m, 2 H) 7.26 (d, J=8.96 Hz, 1 H) 8.29 (dd, J=8.92, 2.53 Hz, 1 H) 8.46 (d, J=9.44 Hz, 1 H) 8.73 (s, 1 H) 8.85 (d, J=2.58 Hz, 1 H) 11.94 (br s, 1 H). Example 447: 2-[1-[2-(4,4-dimethyl-2-oxo-oxazolidin-3-yl)ethyl]tetrazol-5 -yl]sulfanyl-{N}- [3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-n itro-benzamide The same method as in example 305 was used to get 2-[1-[2-(4,4-dimethyl-2-oxo-oxazolidin- 3-yl)ethyl]tetrazol-5-yl]sulfanyl-{N}-[3-fluoro-5-(1,1,2,2,3 ,3,3-heptafluoropropyl)-2-pyridyl]-5- nitro-benzamide (62 mg; 53% yield; pale yellow solid). LCMS Method B: (M+H) 671.0; Rt: 1.81 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.12 (s, 6 H) 3.54 (t, J=5.77 Hz, 2 H) 3.85 (s, 2 H) 4.59 (t, J=5.77 Hz, 2 H) 7.31 (d, J=8.96 Hz, 1 H) 8.31 (dd, J=8.92, 2.53 Hz, 1 H) 8.46 (dd, J=9.92, 1.24 Hz, 1 H) 8.74 (s, 1 H) 8.84 (d, J=2.48 Hz, 1 H) 11.93 (s, 1 H). Example 448: 2-[1-[2-(5,5-dimethyl-2-oxo-oxazolidin-3-yl)ethyl]tetrazol-5 -yl]sulfanyl-{N}- [3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl]-5-n itro-benzamide The same method as in example 305 was used to afford 2-[1-[2-(5,5-dimethyl-2-oxo- oxazolidin-3-yl)ethyl]tetrazol-5-yl]sulfanyl-{N}-[3-fluoro-5 -(1,1,2,2,3,3,3-heptafluoropropyl)-2- pyridyl]-5-nitro-benzamide (45 mg; 39% yield; beige solid). LCMS Method B: (M+H) 671.0; Rt: 1.82 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 1.31 (s, 6 H) 3.35 (s, 2 H) 3.53 - 3.64 (m, 2 H) 4.61 - 4.70 (m, 2 H) 7.24 (d, J=8.87 Hz, 1 H) 8.27 (dd, J=8.92, 2.53 Hz, 1 H) 8.43 (br d, J=10.01 Hz, 1 H) 8.72 (s, 1 H) 8.85 (d, J=2.58 Hz, 1 H) 11.96 (br s, 1 H). Example 449: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[5-(2- hydroxyethyl)thiazol-2-yl]sulfanyl-5-nitro-benzamide The same method as in example 305 was used to yield {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[5-(2-hydroxyethyl)thiazol-2 -yl]sulfanyl-5-nitro-benzamide (26 mg; 25% yield; yellow solid). UPLC MS Method A: (M+H) 587.1; Rt: 0.56 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ ppm 3.00 - 3.05 (m, 2 H) 3.64 (q, J=5.44 Hz, 2 H) 4.87 - 4.95 (m, 1 H) 7.32 (br d, J=8.44 Hz, 1 H) 7.85 (s, 1 H) 8.31 (dd, J=8.92, 2.43 Hz, 1 H) 8.40 (br d, J=9.73 Hz, 1 H) 8.67 - 8.71 (m, 2 H) 11.73 (br s, 1 H). Example 450: {N}-[3-fluoro-5-(1,1,2,2,3,3,3-heptafluoropropyl)-2-pyridyl] -2-[5- (hydroxymethyl)thiazol-2-yl]sulfanyl-5-nitro-benzamide The same method as in example 305 was used to obtain {N}-[3-fluoro-5-(1,1,2,2,3,3,3- heptafluoropropyl)-2-pyridyl]-2-[5-(hydroxymethyl)thiazol-2- yl]sulfanyl-5-nitro-benzamide (23 mg; 23% yield; off-white solid). UPLC MS Method A: (M+H) 573.2; Rt: 0.55 min ¹ H NMR (500 MHz, DMSO-d ₆ ) δ 11.81 (br s, 1H), 8.72 (d, 2H, J=2.3 Hz), 8.45 (dd, 1H, J=1.5, 10.0 Hz), 8.3-8.4 (m, 1H), 7.93 (s, 1H), 7.31 (d, 1H, J=9.0 Hz), 5.7-5.8 (m, 1H), 4.75 (d, 2H, J=5.4 Hz). Example 451: {tert}-butyl-{N}-[2-[2-[5-[2-[(5-cyclopentyl-3-fluoro-2-pyri dyl)carbamoyl]- 4-nitro-phenyl]sulfanyltetrazol-1-yl]ethoxy]ethyl]--{N}-meth yl-carbamate The same method as in example 132 was used to yield {tert}-butyl-{N}-[2-[2-[5-[2-[(5- cyclopentyl-3-fluoro-2-pyridyl)carbamoyl]-4-nitro-phenyl]sul fanyltetrazol-1-yl]ethoxy]ethyl]-- {N}-methyl-carbamate (61 mg; 71% yield; yellow solid). HPLC-MS Method D: (M+H) 631.4; Rt: 3.70 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ 11.39 (s, 1H), 8.78 (d, 1H, J=2.5 Hz), 8.30 (dd, 1H, J=2.4, 8.9 Hz), 8.26 (s, 1H), 7.80 (dd, 1H, J=1.7, 11.2 Hz), 7.0-7.1 (m, 1H, J=8.4, 8.4 Hz), 4.64 (br s, 2H), 3.81 (br t, 2H, J=4.5 Hz), 3.4-3.4 (m, 2H, J=6.9 Hz), 3.11 (t, 2H, J=5.8 Hz), 3.0-3.1 (m, 1H, J=2.0 Hz), 2.6-2.7 (m, 3H), 2.0-2.2 (m, 2H), 1.6-1.9 (m, 4H), 1.5-1.6 (m, 2H), 1.2-1.4 (m, 9H). Example 452: {N}-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[1-[2-[2-(methylami no) ethoxy]ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide;hydroc hloride The same method as in example 147 was used to obtain {N}-(5-cyclopentyl-3-fluoro-2-pyridyl)- 2-[1-[2-[2-(methylamino) ethoxy]ethyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide;hydroc hloride (30 mg; 100% yield; light yellow foam). HPLC-MS Method B: (M+H) 531.3; Rt: 3.54 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ 11.39 (s, 1H), 8.78 (d, 1H, J=2.5 Hz), 8.30 (dd, 1H, J=2.4, 8.9 Hz), 8.26 (s, 1H), 7.80 (dd, 1H, J=1.7, 11.2 Hz), 7.0-7.1 (m, 1H, J=8.4, 8.4 Hz), 4.64 (br s, 2H), 3.81 (br t, 2H, J=4.5 Hz), 3.4-3.4 (m, 2H, J=6.9 Hz), 3.11 (t, 2H, J=5.8 Hz), 3.0-3.1 (m, 1H, J=2.0 Hz), 2.6-2.7 (m, 3H), 2.0-2.2 (m, 2H), 1.6-1.9 (m, 4H), 1.5-1.6 (m, 2H). Example 453: {tert}-butyl -{N}-[3-[5-[2-[(5-cyclopentyl-3-fluoro-2-pyridyl)carbamoyl]- 4- nitro-phenyl]sulfanyltetrazol-1-yl]propyl]--{N}-methyl-carba mate

The same method as in example 132 was used to obtain {tert}-butyl -{N}-[3-[5-[2-[(5- cyclopentyl-3-fluoro-2-pyridyl)carbamoyl]-4-nitro-phenyl]sul fanyltetrazol-1-yl]propyl]--{N}- methyl-carbamate (40 mg; 43% yield; yellow oil). HPLC-MS Method D: (M+H) 601.4; Rt: 3.76 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ 11.39 (s, 1H), 8.82 (br s, 1H), 8.2-8.3 (m, 2H), 7.80 (dd, 1H, J=1.7, 11.2 Hz), 7.07 (br d, 1H, J=8.2 Hz), 4.35 (t, 2H, J=7.3 Hz), 3.19 (t, 2H, J=6.9 Hz), 3.0- 3.1 (m, 1H), 2.71 (s, 3H), 1.2-1.4 (m, 9H). Example 454: {N}-(5-cyclopentyl-3-fluoro-2-pyridyl)-2-[1-[3- (methylamino)propyl]tetrazol-5-yl]sulfanyl-5-nitro-benzamide ;hydrochloride The same method as in example 147 was used to yield {N}-(5-cyclopentyl-3-fluoro-2-pyridyl)- 2-[1-[3-(methylamino)propyl]tetrazol-5-yl]sulfanyl-5-nitro-b enzamide; hydrochloride (14 mg; 55% yield; oily light yellow film). HPLC-MS Method B: (M+H) 501.3; Rt: 5.21 min ¹ H NMR (600 MHz, DMSO-d ₆ ) δ 11.39 (s, 1H), 8.82 (br s, 1H), 8.2-8.3 (m, 2H), 7.80 (dd, 1H, J=1.7, 11.2 Hz), 7.07 (br d, 1H, J=8.2 Hz), 4.35 (t, 2H, J=7.3 Hz), 3.19 (t, 2H, J=6.9 Hz), 3.0- 3.1 (m, 1H), 2.71 (s, 3H). Example 455: {N}-(3-cyano-4-cyclopentyl-phenyl)-2-[1-(2-hydroxyethyl)tetr azol-5- yl]sulfanyl-5-nitro-benzamide

The same method as in example 9 was used to afford {N}-(3-cyano-4-cyclopentyl-phenyl)-2- [1-(2-hydroxyethyl)tetrazol-5-yl]sulfanyl-5-nitro-benzamide (40 mg; 50% yield; white solid). HPLC-MS Method D: (M+H) 480.4; Rt: 2.54 min 1H NMR (600 MHz, DMSO-d ₆ ) δ 11.14 (s, 1H), 8.73 (d, 1H, J=2.5 Hz), 8.27 (dd, 1H, J=2.5, 8.9 Hz), 8.13 (d, 1H, J=2.4 Hz), 7.93 (dd, 1H, J=2.3, 8.6 Hz), 7.60 (d, 1H, J=8.7 Hz), 7.26 (d, 1H, J=8.9 Hz), 5.0-5.2 (m, 1H), 4.51 (t, 2H, J=5.3 Hz), 3.78 (t, 2H, J=5.0 Hz), 3.3-3.3 (m, 1H), 2.0- 2.1 (m, 2H), 1.8-1.9 (m, 2H), 1.7-1.8 (m, 2H), 1.63 (ddd, 2H, J=3.4, 5.8, 11.9 Hz). Table 1: Showing compounds numbered 1 to 26, numbered 28 to 59, numbered 61 to 175, numbered 177 to 294, numbered 298 to 386, numbered 388 to 435, numbered 437 to 450, numbered 452 and/or 454 as given in Table 1, preferably including analytical and/or biological activita data of said compounds

WRN helicase assay: WRN enzyme activity is measured based on ATPase and helicase activity: the ATPase activity is DNA-dependent and enhanced by enzyme binding to single or double stranded DNA and the helicase activity consumes ATP as co-substrate to unwind double-strand DNA. For the helicase assay a forked DNA duplex which is labelled with a fluorophore (Atto550-5’) and an adjacent quencher (BHQ-2-3’) is used as substrate. In the presence of ATP upon enzyme reaction the two DNA strands are separated and the fluorescence of Atto550 is not quenched anymore. The increase of fluorescence intensity (RFU) reflects thereby the activity of WRN helicase activity. The assay was performed in either 384 or 1536 well microtiter plates (black, medium binding, Greiner, Frickenhausen, Germany) in a total volume of 5 µL.2 nM fc of WRN (2-1432 aa) enzyme and the test compounds (10 concentration dilution rows in DMSO, starting concentration 30 µM to 1 nM, fc) were pre-incubated for 1h at 22 °C. Preparation of the DNA fork is performed in annealing buffer (40 mM Tris-HCl pH 8, 80 mM NaCl) by incubation of 100 µM of each oligonucleotide (TTTTTTCCAAGTAAAACGACGGCCAGTGC-BHQ2 and Atto550- GCACTGGCCGTCGTTTTACGGTCGTGACT, metabion, Planegg, Germany) for 6 min at 96 °C followed by down cooling to 16 °C. The reaction is started by addition of 5 nM duplex DNA and 25 µM ATP in 50 mM Tris/HCl buffer pH = 7.5, 2.5 mM MgCl ₂ , 0.02% (w/v) BSA, 1.5 mM DTT followed by an incubation at 22 °C for 30 min. Fluorescence intensity is measured on a BMG Pherastar at excitation 540 nm and emission 550 nm for Atto550. For normalization of data DMSO is used as neutral control and a reference molecule as inhibitor control. The inhibitory values (IC50) were calculated using Screener from GeneData. Cellular Viability Assay: HCT116 (ATCC CCL-247) cells are grown in McCoy5A medium (10% fetal bovine; including Glutamin), SW620 (ATCC CCL-227) in DMEM/F-12 medium (10% fetal bovine) and HT29 (ATCC-HTB-38) in DMEM medium (10% fetal bovine). Cells are seeded at 100 cells/well (HCT116), 150 cells/well (SW620) or 250 cells/well (HT29) in 200 µL of growth medium in clear 96-well cell culture microplates and are incubated at 37 °C in a humidified 5% CO ₂ (HCT116; SW620) or 10% CO2 (HT29) atmosphere for 48 h before the treatment. Cells are then treated with inhibitors at different concentrations (for example 24, 12, 6, 3, 1.5, 0.75, 0.375,0.187 and 0.09 µM in duplicate by using a digital dispenser and DMSO stock solutions). Control cells are treated with DMSO only (no inhibition). Medium only (no cells, blank control) is used for calculation of 100% inhibition. In 96 well plates consider possible edge/border effects (low growth of cells on the plate borders due to medium evaporation). Perform replicates in several positions, avoid borders or fill empty spaces with phosphate buffer saline (PBS) 1X. The plates are left in the incubator for 7 days (168 h). Colonies should not be confluent at the end of the experiment. Add 20 µL per well Alamar Blue (Bio Rad; BUF012B) to the cells and incubate the plates further for 4-6 h at 37 °C, 5-10% CO ₂ . The fluorescence is determined by excitation at 535 nm and emission at 595 nm by using a Reader. Table 2: Viability data (excerpt)