[0001] The invention relates to the field of bacterial resistance, and more particularly to detection of bacteria that are resistant to carbapenem antibiotics.

BACKGROUND OF THE INVENTION

[0002] b-lactams including penicillins, cephalosporins, monobactams and carpabenems are the principal therapeutic choices for the treatment of gram-negative bacteria infections. Carbapenems have proved particularly useful as they have a broad spectrum and have a structure that renders them generally effective against most beta-lactamases producing bacteria which may be resistant to other beta-lactam antibiotics. Therefore, carbapenems are the last line of defence against multi-resistant bacterial infections, particularly multi-resistant gram negative bacteria. However, carbapenemase-producing organisms (CPO), including carbapenemase-producing Enterobacteriaceae (CPE) and non-fermenters (e.g. Pseudomonas aeruginosa and Acinetobacter baumannii) have been increasingly reported worldwide (Bonomo RA et al., Clinical Infectious Diseases (2018) 66:1290-1297). The emergence of CPO has become concern as there are few therapeutic options for treating infections caused by carbapenem-resistant bacteria. Actually, bacterial resistance to antibacterial drugs has been increasing relentlessly over the past two decades. In September 2017, the World Health Organization has declared that antibiotic resistance is one of the biggest threats to global health, food security, and development today.

[0003] Rapid detection of carbapenemase-producing organisms has thus become imperative. For instance, CPO pose a serious health risk when people become infected with them, because infections may be very difficult to treat. A particular problem is also that such bacteria are easily transmitted from human to human, from human to animal and from animal to human. In addition, CPO can transfer their carbapenem resistance to other bacteria in many ways, implicating that a person carrying a CPO may easily transmit the resistant bacteria to others with which he/she is in close contact. This is a major problem in hospital wards, making rapid and accurate detection of CPO very important, both for patient treatment as well as hospital hygiene.

[0004] To limit the spread of CPO, many countries have implemented strict infection control measures for infected and colonized patients. However, implementation of these control measures is costly. More over the infection control measures are not entirely effective as CPO- positive patients may sometimes be wrongly considered CPO-negative and thus propagate the harmful resistant bacteria.

[0005] The most clinically relevant carbapenemases encountered in CPO belong to Ambler class A (KPC type), Ambler class B or metallo- -lactamases (MBLs) such as IMP, VIM and NDM types, or Ambler class D (OXA-48-like). In the United States and Europe, a mixture of KPC, NDM, VIM and OXA-48-like carbapenemases dominates, while IMP-producing organisms are more prevalent in the Far East (Bonomo RA et al., Clinical Infectious Diseases (2018) 66:1290-1297).

[0006] The OXA carbapenemase name is the acronym of "OXAcillin-hydrolyzinq" carbapenemase. OXA-48 and OXA-48-like are genes that confer high-level resistance to penicillins, including temocillin, and hydrolyzes carbapenems at a relatively low but signifant level, but spares extended-spectrum cephalosporins. The bla ₀ x _A -48-u _ke gene family currently comprises 30 variants of protein sequences, namely bla ₀ x _A -48, b/a _0XA - 54, bia ₀ x _A -162, bla _0y,A-163 , b/a _0XA -181 , d/ao _XA -199, biaQXA-204, biaQXA-232, ^ ^a OX _A -244, b/a _OXA -245, blaox _A -247, bla ₀ XA-252, bla _O XA-370, blaoxA- 405, b/a _OXA -416, biaQXA-438, bla ₀ XA-438, blaoXA-439, bla ₀ XA-484, bla _O XA-505, d/a _OXA -514, d/a _OXA -515, blaoxA- 517, d/a _OXA -5i9, blaoxA-535, blaoxA-538, biaoxA-548, blaoxA-547 et biaoxA-zee, d/ao _XA -567· Out of the thirty OXA-48-like variants that have been identified, the classical OXA-48 being the most widespread (Bacterial Antimicrobial Resistance Reference Gene Database, NCBI, BioProject 313047; Mairi A et al., European Journal of Clinical Microbiology & Infectious Diseases (2018) 37:587-604; Bacterial Antimicrobial Resistance Reference Gene Database, NCBI, BioProject 313047, last reviewed on July 1 1 , 2019).

[0007] The VIM carbapenemase name is the acronym of "Verona tegron-encoded Metallo-beta-lactamase". The b/a _{V IM} gene currently comprises 64 variants of protein sequences, known as VIM-1 to VIM-66 (Bacterial Antimicrobial Resistance Reference Gene Database, NCBI, BioProject 313047, last reviewed on July 1 1 , 2019).

[0008] The IMP carbapenemase name is the acronym of "active on !MiPenem". The bia _Mp gene currently comprises 76 variants of protein sequences, known as IMP-1 to IMP-80 (Bacterial Antimicrobial Resistance Reference Gene Database, NCBI, BioProject 313047, last reviewed on July 1 1 , 2019). [0009] As used herein, the term“variant" (e.g. VIM-1 , VIM-2, VIM-3) refers to an enzyme which differs by one or more amino acids from the first protein sequence described and characterized for each carbapenemase (Widmann M et al., 2012, Antimicrobial Agents & Chemotherapy 56:3481 -3491 ). These variants differ by one or more amino acid mutation, which could be a substitution, a deletion, or an insertion. Deletion and insertion in OXA-48-like variants are mostly located in the loop connecting the b5 and b6 strands, a structural element involved in hydrolysis of carbapenems (Docquier JD et al., Chemistry & Biology, (2009) 16:540-547). These include for instance OXA-163 (Poirel L et al., Antimicrobial Agents & Chemotherapy (201 1 ) 55:2546-2551 ) and OXA-405 (Dortet L et al., Antimicrobial Agents & Chemotherapy (2015) 59:3823-3828).

[00010] During the recent years, several diagnostic tests have been developed for identification of CPO. These include (i) tests for carbapenemase inhibition activity; (ii) the carbapenem inactivation method; (iii) detection of carbapenem hydrolysis by matrix-assisted laser desorption ionization-time of flight mass spectrometry, by biochemical tests or by an electrochemical method; (iv) immunochromatographic assays aiming to detect OXA-48-like CPO, IMP-like CPO and OXA-48/KPC CPO; and (v) diverse molecular tools able to detect the most prevalent carbapenemase-encoding genes (Dortet L and Nass T, Journal of Clinical Microbiology (2017) 55:654-655).

[00011] Various nucleic acid-based assays and screening methods known in the art enable fast screening and provide a method for testing on presence or absence of pathogenic bacteria. For instance, primers and probes have previously been described for OXA-48-like genes in U.S. patent No. 9,593,381 , in International PCT publications WO 2016/174642, WO 2016/094607; WO 2016/067047. Methods and kits for detecting drug resistant microorganisms have been described also in patent publications WO 2017/160779 and US 2013/0065790. [00012] Therefore, it is clear that, in view of the increasing threat and global prevalence of carbapenem-resistant bacteria, new strategies are required for more effective prevention, treatment, and diagnosis of carbapenem-resistant bacteria infection.

[00013] There is particularly a clinical need for the rapid detection of the carriers of carbapenem-resistant organisms containing NDM, KPC, IMP, VIM and OXA-48-like genes. [00014] There is also a need to rapidly identify patients carrying or suspected of carrying CPOs so that appropriate infection control measures and therapeutic regimens are selected for a given patient and the likelihood of the spread of resistant bacteria is reduced.

[00015] Yet, there is an imperative need for the rapid detection of carbapenem-resistant organisms, particularly for screening methods and tools enabling the rapid and efficient detection of carbapenemase-producing bacteria. Early detection of infection typically allows for a more effective therapeutic treatment with a correspondingly more favourable clinical outcome, as well as improves hospital hygiene and reduces nosocomial infection.

[00016] There is an urgent need for accurate and fast diagnostic tests and molecular tools able to make a distinction between (i) a clinical sample comprising bacteria having a clinically significant carbapenemase-producing activity and (ii) a clinical sample comprising bacteria having a non-clinically significant carbapenemase-producing activity. Such discrimination will allow saving costs and avoiding unnecessary complicated infection control measures because only CPO-positive patients carrying or infected with bacteria having a clinically significant carbapenemase-producing activity are of medical concern and strict infection control measures only need to be implemented for them.

[00017] Moreover, many CPO have various carbapenemase gene variants, and such gene variants may provide very different characteristics to CPO. Accordingly, there is also a need for methods and tools that accurately, rapidly, and simultaneously detect a plurality of different carbapenemase enzyme genes at a single point in time.

[00018] The present invention addresses these needs and other needs as it will be apparent from review of the disclosure and description of the features of the invention hereinafter.

BRIEF SUMMARY OF THE INVENTION

[00019] According to one aspect, the invention relates to a method for detecting a presence or an absence of an OXA-48-carbapenemase-producing bacteria in a sample, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria;

b) amplifying specifically nucleic acids from carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity while avoiding amplification of nucleic acids from carbapenemase-producing bacteria having a non-clinically significant carbapenemase-producing activity; and c) detecting presence or absence of amplified nucleic acids;

wherein presence of amplified nucleic acids is indicative of the presence of carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity; and

wherein absence of amplified nucleic acids is indicative of the absence of carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity.

[00020] According to another aspect, the invention relates to a nucleic acid-based method for detection of OXA-48-carbapenemase-producing bacteria, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying specifically nucleic acids from carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity while avoiding amplification of nucleic acids from carbapenemase-producing bacteria having a non-clinically significant carbapenemase-producing activity; and

c) detecting amplified nucleic acids;

wherein positive detection of amplified nucleic acids indicates the presence of OXA-48- carbapenemase-producing bacteria having clinically significant carbapenemase activity.

[00021] According to another aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of bla ₀ x _A -48-n _ke gene variants in a sample, comprising: a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla ₀ x _A -48-n _ke gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids;

wherein presence or absence of amplified nucleic acids for a given bla ₀ x _A -48-n _ke gene variant is indicative of the presence or absence of said bla ₀ x _A -48-n _ke gene variant in the sample, and

wherein a set of primers consisting of only one forward primer and only one reverse primer provides for selective amplification of nucleic acids from at least 5, 10, 1 1 , 12, 13, 14 or more different bla ₀ x _A -48-n _ke variants having a clinically significant carbapenemase-producing activity. [00022] According to another aspect, the invention relates to a nucleic acid-based method for detection of a plurality of bla ₀ x _A -48- _Mke gene variants, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of bla ₀ x _A - 4 ₈ -ii _ke gene; and

c) detecting amplified nucleic acids;

wherein said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 1 1 , 12, 13, 14 or more different bla ₀ x _A -48-n _ke variants having a clinically significant carbapenemase-producing activity with only one forward primer and only one reverse primer.

[00023] According to another aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of b/a _{V IM} gene variants in a sample, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria;

b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla _{V IM} gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids;

wherein presence or absence of amplified nucleic acids for a given b/a _{V IM} gene variant is indicative of the presence or absence of said b/a _{V IM} gene variant in the sample, and

wherein a set of primers consisting of only one forward primer and only one reverse primer said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 62, 64 or more different b/a _ViM gene variants.

[00024] According to another aspect, the invention relates to a nucleic acid-based method for detection of a plurality of b/a _{V IM} gene variants, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of b/a _V|M gene;

c) detecting amplified nucleic acids; wherein said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 62, 64 or more different bla _VM gene variants with only one forward primer and only one reverse primer.

[00025] According to another aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of bla _MP gene variants in a sample, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla _MP gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids;

wherein presence or absence of amplified nucleic acids for a given bla _lMP gene variant is indicative of the presence or absence of said bla _MP gene variant in the sample, and

wherein a set of primers consisting of only 8 forward primers and only 7 reverse primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 72, 74, 76 or more different bla _MP gene variants.

[00026] According to another aspect, the invention relates to a nucleic acid-based method for detection of a plurality of bla _lMP gene variants, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of bla _lMP gene; and

c) detecting amplified nucleic acids;

wherein said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 72, 74, 76or more different b/ai _MP gene variants with only 8 forward primers and only 7 reverse primers.

[00027] According to another aspect, the invention relates to a nucleic acid-based method for simultaneous detection of a plurality of a plurality of bla ₀ x _A -48-n _ke gene variants, a plurality of b/a _{v iM} gene variants, and a plurality of bla _MP gene variants comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with (i) a first set of forward and reverse primers hybridizing specifically to multiple variants of bla ₀ x _A-48 -ii _ke gene; (ii) a second set of forward and reverse primers hybridizing specifically to multiple variants of b/a _v IM gene; and (iii) a third set of forward and reverse primers hybridizing specifically to multiple variants of bla _lMP gene;

c) detecting amplified nucleic acids;

wherein said first, second and third sets of primers are selected from Table 6.

[00028] According to another aspect, the invention relates to a primer for amplification of nucleic acids molecules, said primer comprising a polynucleotide sequence selected from the group of primers defined in Table 6, or a sequence exactly complementary thereto.

[00029] According to another aspect, the invention relates to a set of primers for amplification of b/a ₀ x _A-48 -ii _ke variants comprising at least one forward primer and at least one reverse primer selected from Table 6.

[00030] According to another aspect, the invention relates to a set of primers for amplification of b/a _{V IM} variants comprising at least one forward primer and at least one reverse primer selected from Table 6.

[00031] According to another aspect, the invention relates to a set of primers for amplification of b/ai _MP variants comprising at least one forward primer and at least one reverse primer selected from Table 6. [00032] According to another aspect, the invention relates to a probe for detection of nucleic acids molecules, said probe comprising a polynucleotide sequence selected from the group selected from the group of probes as defined Table 7, or a sequence exactly complementary thereto.

[00033] According to another aspect, the invention relates to the use of a primer as defined herein, or the use of a set of primers as defined herein, or the use a probe as defined herein, for identification of subjects carrying carbapenemase-producing bacteria, and/or for identification of presence or absence of carbapenemase-producing bacteria in environmental samples.

[00034] According to another aspect, the invention relates to the use of a primer as defined herein, or the use of a set of primers as defined herein, or the use a probe as defined herein, for differentiating between subjects carrying bacteria having a clinically significant carbapenemase- producing activity from those subjects carrying bacteria having a non-clinically significant carbapenemase-producing activity.

[00035] According to another aspect, the invention relates to a detection kit comprising one or more primer as defined herein and/or one or more probes as defined herein.

[00036] According to another aspect, the invention relates to a kit for detection of carbapenemase-producing bacteria comprising at least one forward primer, at least one reverse primer and at least one probe selected from the group of primers defined in Table 6 and probes defined in Table 7.

[00037] According to another aspect, the invention relates to a kit for the detection of OXA- 48-like carbapenemase genes, comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6.

[00038] According to another aspect, the invention relates to a kit the detection of VIM carbapenemase genes, comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6.

[00039] According to another aspect, the invention relates to a kit the detection of IMP carbapenemase genes, comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6.

[00040] According to another aspect, the invention relates to a multiplex detection kit for simultaneous detection of at least two different carbapenemase genes comprising:

i) a first set of oligonucleotide molecules for the detection of OXA-48-like carbapenemase genes, said first set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7;

and

ii) at least a second set of oligonucleotide molecules for the detection of at least one of VIM carbapenemase genes and IMP carbapenemase genes, said at least second set comprising:

a) for the detection of VIM carbapenemase genes at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7; b) for the detection of IMP carbapenemase genes at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7.

[00041] According to another aspect, the invention relates to a multiplex detection kit for simultaneous detection of OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes, comprising:

i) a first set of oligonucleotide molecules for the detection of OXA-48-like carbapenemase genes, said first set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7;

ii) a second set of oligonucleotide molecules for the detection of VIM carbapenemase genes, said second set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7;

iii) a third set of oligonucleotide molecules for the detection of IMP carbapenemase genes, said third set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7.

[00042] According to another aspect, the invention relates to the use of any of the probes, primers, kits and methods described herein, for the diagnostic of patients carrying or not carbapenemase-producing bacteria, and/or for identification of presence or absence of carbapenemase-producing bacteria in environmental samples. [00043] According to another aspect, the invention relates to a method for the treatment of a subject, comprising:

(i) identifying a subject carrying carbapenemase-producing bacteria with any of the probes, primers, kits and methods described herein; and

(ii) providing appropriate treatment to said subject. [00044] Additional aspects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of preferred embodiments which are exemplary and should not be interpreted as limiting the scope of the invention. BRIEF DESCRIPTION OF FIGURES

[00045] In order that the invention may be readily understood, embodiments of the invention are illustrated by way of example in the accompanying drawings.

[00046] FIGURE 1 is a sequence of a fragment of the gene bla ₀ x _A -48 from Klebsiella pneumoniae (SEQ ID NO: 2; accession No. NG_049762.1 ) showing examples of the regions targeted by the primers and probes for the gene bla ₀ x _A -48, according to one embodiment of the invention. The regions targeted by the primers are in bold and the amplified region is in shaded grey. The region targeted by the probe is double-underlined.

[00047] FIGURE 2 is a sequence of a fragment of the gene b/a _{V IM} from Pseudomonas aeruginosa (SEQ ID NO: 3; accession No. Y18050) showing example of the regions targeted by the primers and probes for the gene b/a _V iM-i > according to one embodiment of the invention. The regions targeted by the primers are in bold and the amplified region is in shaded grey. The region targeted by the probe is double-underlined.

[00048] FIGURE 3 is a sequence of a fragment of the gene bla _lMP from Acinetobacter baumannii (SEQ ID NO: 4; accession No. AF244145) showing example of the regions targeted by the primers and probes for the gene bla _Mp-A , according to one embodiment of the invention. The regions targeted by the primers are in bold and the amplified region is in shaded grey. The region targeted by the probe is double-underlined.

[00049] FIGURE 4 is a schematic representation of options 1 and 2 for positioning primer pair(s) (black arrows) and probe(s) (white rectangle), for selective amplification and detection of clinically significant carbapenemase-producing activity OXA-48-like variants (group A) over non- clinically significant carbapenemase-producing activity OXA-48-like variants (group C), according to embodiments of the invention. Option 3 show the positioning of primer pair(s) for an amplification of group A and C variants, and a selective detection of Group A variants over Group C variants. Mutation(s) (substitution(s), and/or deletion(s), and/or, insertion(s)) region is represented by the dashed box. Important features such as the conserved motifs KTG and WWV encompassing the mutation region are illustrated, position numbering is relative to OXA- 48 type protein sequence (translated from type sequence NG_049762.1 (positions: 101 to 898)). [00050] FIGURE 5 is an amino acid sequence alignment of selected OXA-48-like variants. A solid box delimits a region with mutation(s) (substitution(s), and/or deletion(s), and/or, insertion(s)) in carbapenemase-producing bacteria having a non-clinically significant carbapenemase-producing activity, in accordance with the present invention. The region with mutation(s) is flanked by conserved motifs KTG (Lys - Thr - Gly) and WWV (Trp - Trp - Val) in dotted boxes.

[00051] FIGURE 6 is a nucleotide sequence alignment of selected OXA-48-like gene variants showing the targeted region for the specific amplification of Group A variants, comprising mutation(s) (substitution(s), and/or deletion(s), and/or, insertion(s)) in carbapenemase- producing bacteria having a non-clinically significant carbapenemase-producing activity.

[00052] FIGURE 7 is a neighbor-joining tree of multiple variants of the OXA-48-like clustering. OXA-48-like variant genes targeted by the invention are in bold and identified as "(Group A)". OXA-48-like variants harbouring mutation(s) (substitution(s), and/or deletion(s), and/or, insertion(s)) in accordance with the invention are identified with“(Group C)”. OXA-48- like variants present only (until now) in Shewanella, are identified by“(Group B)”.

[00053] FIGURES 8A, 8B and 8C are graphs showing dynamic range and PCR efficiency of multiplex assay b/a _ox A-48/VIM/IMP with Bio-Rad CFX96™ thermal cycler with genomic DNA from K. pneumoniae CCRI-22264 (FIG. 8A), genomic DNA from K. pneumoniae CCRI-19585 (b/a _ViM -i) (FIG. 8B) and genomic DNA from K. pneumoniae CCRI-19582 (b/ai _Mp -i) (FIG. 8C).

[00054] FIGURE 9 is a panel showing pattern of DNA sequence variability in the mutated region of OXA-48-like gene. The region corresponds to amino acid 21 1 to 220 of OXA-48 protein translated from type sequence NG_049762.1 (positions 101 to 898). Patterns have been defined for all OXA-48-like variants (Group A-B-C; SEQ ID NO: 5), for group A only (Group A; SEQ ID NO: 6), and for group C only (Group C; SEQ ID NO: 7). IUPAC code was used to illustrate degeneracies of the code. Protein reference sequence of OXA-48-like is illustrated under the DNA pattern.

[00055] FIGURE 10 is a panel showing consensus nucleotides sequences derived from combinations of primers and probes in a particular region of OXA-48-like. Boxed sequences represent a conserved pattern among oligonucleotides combined. Underlined region indicates nucleotide that can be absent in one or many oligonucleotides. IUPAC code was used to illustrate degeneracies. [00056] FIGURE 11 is a panel showing consensus nucleotides sequences derived from combinations of primers and probes in a particular region of b/a _{v iM} - Boxed sequences represent a conserved pattern among oligonucleotides combined. IUPAC code was used to illustrate degeneracies. [00057] FIGURE 12 is a panel showing consensus nucleotides sequences derived from combinations of primers and probes in a particular region of bla _Mp · Boxed sequences represent a conserved pattern among oligonucleotides combined. Underlined region indicates nucleotide that can be absent in one or many oligonucleotides. IUPAC code was used to illustrate degeneracies. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[00058] In the following description of the embodiments, references to the accompanying drawings are by way of illustration of an example by which the invention may be practiced. It will be understood that other embodiments may be made without departing from the scope of the invention disclosed. A) General overview

[00059] The invention aims to provide methods and molecular tools (e.g. primers, probes, kits) for the rapid detection of bacteria that may be resistant to carbapenem antibiotics. The invention may find numerous applications for detecting the presence and/or absence of resistant bacteria in various biological samples. In embodiments, the invention relates to the rapid detection of carbapenem-resistant bacteria containing OXA-48-like, IMP, and VIM genes.

[00060] In embodiments the bacteria may be present in a biological sample from a subject. As used herein the term“subject” includes animals such as mammals. Preferably, the subject is a mammal, including, but not limited to, species such as a human, a dog, a cat, a horse, a bovine, a rabbit, a rat, a mouse, and wild animals living in zoos (e.g. lion, tiger, elephant, panda, bear, etc.). More preferably, the subject is human subject, even more preferably a human patient suspected of carrying or infected with carbapenemase-producing bacteria.

[00061] In embodiments, the invention aims to detect carbapenemase-producing bacteria from human pathogens. Exemplary list of bacterial species pathogenic for human can be found in Taylor et al. 2001 and Woo et al. 2008 (Taylor LH et al., Philosophical Transactions of the Royal Society B: Biological Sciences (2001 ) 356:983-989; Woo PC et al., Clinical Microbiology & Infection (2008) 14:908-934).

[00062] As used herein, the term“biological sample” includes direct clinical sample (e.g. a biological specimen obtained from bodily fluids such as blood or urine, or throat swabs, nasal swabs, rectal swabs, dermal swabs, sputum, feces, bronchial aspirates, etc.), as well as processed specimens such as clinical isolates obtained following bacterial culture, and purified nucleic acids. The term“biological sample” also encompasses pure cultures of bacteria from various environments as well as various environmental samples that may originate from the environment including, but not limited to, hospitals (e.g. swabs of laboratory working surfaces, swabs of medical instruments, swabs of a patient room, etc.), public spaces (e.g. swabs of object from school, shopping malls, etc.), nature (e.g. water, air, soil, etc.), and the like.

[00063] In embodiments, the invention aims to detect carbapenemase-producing bacteria and to differentiate those bacteria having a clinically significant carbapenemase-producing activity from those having a non-clinically significant carbapenemase-producing activity.

[00064] As used herein, the term“bacteria having a clinically significant carbapenemase- producing activity” refers to bacteria showing positive carbapenemase activity with any clinically recommended phenotypic carbapenemase production test including, but not limited to, the tests recommended by the Clinical and Laboratory Standards Institute (CLSI) (CLSI, Performance Standards for Antimicrobial Susceptibility Testing. 28 ^th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards; 201 8 such as (i) the Carba NP test (Carbapenemase Nordmann-Poirel test) (see Nordmann P et al., Emerg Infect Dis (2012) 18:1503-1507; Dortet L et al., J Clin Microbiol (2012) 50:3773-3776), and (ii) the modified Carbapenem Inactivation Method (CIM) (see Pierce VM et al,. J Clin Microbiol (2017) 55:2321 - 2333), and (iii) the RAPIDEC ^® CARBA NP (bioMerieux, MarcyTEtoile, France), and (iv) the Rapid CARB Screen® (Rosco Diagnostica A/S, Taastrup, Denmark) also known as the Neo- Rapid CARB™ Kit (Rosco Diagnostica A/S, Taastrup, Denmark). As such, these bacteria are considered to be of concern by medical and/or clinical authorities. Typically, patient carrying bacteria having a clinically significant carbapenemase-producing activity require strict infection control measures. In embodiments the bacteria produces OXA-48-like b-lactamases. In embodiments, the bacteria are multi-resistant gram-negative bacteria (e.g. carbapenemase- producing Enterobacteriaceae (CPE)). [00065] As used herein, the term “bacteria having a non-clinically significant carbapenemase-producing activity” refers to bacteria showing negative carbapenemase activity with any clinically recommended phenotypic carbapenemase production test including, but not limited to, the tests recommended by the Clinical and Laboratory Standards Institute (CLSI) (CLSI, Performance Standards for Antimicrobial Susceptibility Testing. 28 ^th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards; 2018 such as (i) the Carba NP test and (ii) the modified Carbapenem Inactivation Method (mCIM), or commercial tests such as (iii) the RAPIDEC ^® CARBA NP (bioMerieux, Marcy-l’Etoile, France) and (iv) the Rapid CARB Screen® (Rosco Diagnostica A/S, Taastrup, Denmark) also known as the Neo-Rapid CARB™ Kit (Rosco Diagnostica A/S, Taastrup, Denmark), the test being negative because of the absence of carbapenemase or the production of b-lactamase with non-significant carbapenemase activity. For example, the OXA-48-like b-lactamase OXA-163 which does not possess significant carbapenemase activity has a catalytic efficiency ( k _ca Jk _m ) for imipenem at least 500 times lower than OXA-48 (Poirel L et al., Antimicrobial Agents and Chemotherapy (201 1 ) 55:2546-2551 ; Oueslati S et al., Journal of Antimicrobial Chemotherapy (2015) 70:1059-

1063; Stojanoski Stojanoski et al., Biochemistry (2015) 54:3370-3380). As such, bacteria having a non-clinically significant carbapenemase-producing activity are not considered to be a concern by medical and clinical authorities. Typically, patients carrying these bacteria do not require strict infection control measures. In embodiments, bacteria having a non-clinically significant carbapenemase-producing activity does not produce, or only produce a non-significant carbapenemase activity of OXA-48-like b-lactamases. In embodiments, these bacteria are gram-negative bacteria (e.g. carbapenemase-producing Enterobactehaceae (CPE)).

[00066] The present invention may also be amenable to the detection of various types of carbapenemase-producing organisms (CPO), including non-pathogenic bacteria having OXA- 48-like, VIM, or IMP genes that may serve as reservoir of carbapenemase gene. Examples of CPO representatives for which resistance genes could be detected in accordance with the present invention include, but are not limited to:

OXA-48 like gene: Acinetobacter baumannii Providencia alcalifaciens

Chromobacterium haemolyticum Providencia rettgeri

Citrobacter freundii Pseudomonas aeruginosa Enterobacter aerogenes Pseudomonas geniculata

Enterobacter asburiae Pseudomonas hibiscicola

Enterobacter cancerogenus Pseudomonas monteilii

Enterobacter cloacae Pseudomonas otitidis Enterobacter cloacae complex Pseudomonas protegens

Enterobacter hormaechei Pseudomonas putida

Enterobacter ludwigii Pseudomonas taiwanensis Enterobacter xiangfangensis Raoultella planticola

Escherichia coli Serratia marcescens

Klebsiella pneumoniae Shewanella baltica

Klebsiella variicola Shewanella bicestrii

Morganella morganii Shewanella fodinae

Myroides odoratimimus Shewanella oneidensis Pantoea agglomerans Shewanella putrefaciens Pantoea eucalypti Shewanella xiamenensis Proteus mirabilis Stenotrophomonas maltophilia

IMP gene: Achromobacter xylosoxidans Klebsiella oxytoca

Acinetobacter baumannii Klebsiella pneumoniae Acinetobacter baylyi Leclercia adecarboxylata Acinetobacter berezinae Morganella morganii Acinetobacter calcoaceticus Proteus mirabilis

Acinetobacter genomospecies 13BJ Proteus penned

Acinetobacter genomospecies 3 Providencia rettgeri

Acinetobacter junii Pseudomonas aeruginosa Acinetobacter nosocomialis Pseudomonas fluorescens Acinetobacter pittii Pseudomonas fulva

Acinetobacter soli Pseudomonas mendocina Aeromonas caviae Pseudomonas monteilii Aeromonas punctata Pseudomonas putida

Citrobacter freundii Ralstonia pickettii

Delftia tsuruhatensis Raoultella ornithinolytica Enterobacter aerogenes Salmonella enterica

Enterobacter aerogenes Serratia marcescens

Enterobacter cloacae Shigella flexneri

Enterobacter hormaechei Stenotrophomonas maltophilia Escherichia coli

VIM gene: Achromobacter denitrificans Morganella morganii

Achromobacter xylosoxidans Nocardia farcinica

Acinetobacter baumannii Paenibacillus sp.

Acinetobacter berezinae Proteus mirabilis

Acinetobacter genomospecies 3 Providencia rettgeri

Acinetobacter haemolyticus Providencia stuartii

Aeromonas caviae Providencia vermicola Alcaligenes faecalis Pseudomonas aeruginosa Burkholderia cenocepacia Pseudomonas chlororaphis Citrobacter freundii Pseudomonas geniculata Elizabethkingia meningoseptica Pseudomonas monteilii

Enterobacter aerogenes Pseudomonas oleovorans

Enterobacter cloacae Pseudomonas pseudoalcaligenes Enterobacter cloacae complex Pseudomonas putida

Enterobacter hormaechei Pseudomonas stutzeri

Enterobacter xiangfangensis Ralstonia pickettii

Escherichia coli Salmonella enterica supsp. Enterica Klebsiella oxytoca Serratia marcescens

Klebsiella pneumoniae Staphylococcus sp.

Kluyvera cryocrescens Stenotrophomonas maltophilia Leclercia adecarboxylata Vibrio alginolyticus

Vibrio cholerae

[00067] The present invention is directed to amplification and/or detection of bacterial genomic DNA. As used herein, the term“bacterial genomic DNA” encompasses the different types of DNA that may be present in a bacterial cell, including plasmidic DNA and chromosomal DNA. [00068] In preferred embodiments, the methods described herein are“sensitive”, i.e. they allow the detection of a low number of copies of bacterial genomic DNA.

[00069] In embodiments, the methods described herein are sufficiently“sensitive” to allow the detection of a reduced number of copies of bacterial genomic DNA. In embodiments, the detection methods described herein provide for detection, during the amplification/detection steps, of as low as less than 100 copies, or as low as less than 50 copies, or as low as less than 25 copies, or as low as less than 10 copies, or as low as less than 5 copies, or as low as only one copy of bacterial genomic DNA. Preferably, the methods, primers and probes of the invention provides for suitable analytical sensitivity. As used herein, the terms "Analytical Sensitivity" or "Sensitivity" or "Sensitive" encompass two concepts, the "limit of detection (LOD)" and the "Analytical Reactivity" or "Inclusivity". The LOD refers to the minimum concentration of nucleic acid or number of cells, which always gives a positive PCR result in all replicates tested, or in the major part (over 95%) of them. The analytical reactivity represents the ability to detect all or most targeted micro-organisms (FDA, Class II Special Controls Guideline: Multiplex Nucleic Acid Assay for Identification of Microorganisms and Resistance Markers from Positive Blood Cultures, 2015).

[00070] In preferred embodiments, the methods described herein are“selective”, i.e. these methods only allow the detection of a desired target molecule (e.g. a target nucleic acid or target sequence of genomic DNA from a resistant bacteria). Accordingly, the preferred selectivity of the invention allows to discriminate for amplification and/or detection of genomic DNA from a predetermined bacteria (e.g. b/a _{ox A} -48-u _ke , d/a _{V IM} and bla _Mp genes) while avoiding amplification and/or detection of non-resistant bacteria (e.g. bacteria having a non-clinically significant carbapenemase-producing activity). Preferably, the methods, primers and probes of the invention provides for suitable analytical specificity and/or reduced cross-reactivity. As used herein, the terms“Analytical specificity” or "Cross-reactivity" refers to the ability of an assay to amplify and/or detect a target(s) in one particular organism, rather than others, in a sample (see FDA, Class II Special Controls Guideline: Multiplex Nucleic Acid Assay for Identification of Microorganisms and Resistance Markers from Positive Blood Cultures, 2015).

B) Primers and Probes

[00071] The present inventors have designed a series of primers and probes that may be used in amplification and detection of carbapenemase-producing bacteria.

[00072] Particularly, the primers and probes of the present invention are directed to genes from carbapenemase-producing organisms (CPO), including the genes OXA-48, IMP, VIM and genetic variants thereof.

[00073] As used herein, the term“amplifying” or“amplification” refers to the process of synthesizing nucleic acid molecules that are complementary to one or both strands of a template nucleic acid molecule (e.g., OXA-48, IMP, VIM). Amplifying a nucleic acid molecule typically includes denaturing the template nucleic acid, annealing primers to the template nucleic acid under suitable conditions and temperature for specific recognition of the template, and enzymatically elongating from the primers to generate an amplification product. Amplification typically requires the presence of deoxyribonucleoside triphosphates, a DNA polymerase enzyme (e.g., Platinum® Taq, AptaTaq™), an appropriate buffer, and co-factors for optimal activity of the polymerase enzyme (e.g. MgCI ₂ ). In embodiments, amplification is only meaningful if it can be detected. Accordingly reference to “absence of amplification”, “no amplification”, “avoids amplification” or similar expressions used herein, encompasses embodiments where there is a complete absence of amplification as well as embodiments where amplification is present, but below a minimal detectable threshold value. It is within the skill of those in the art to determine what is a suitable threshold value for the amplification and/or for the detection. [00074] As used herein,“amplifying specifically” or“specific amplification” refers to the selection of amplification conditions maximizing amplification of one or a plurality of desired nucleic acid molecules, while avoiding amplification of other undesirable nucleic acid molecule in order to obtain solely or at least predominantly predetermined amplification products. The selection of the amplification conditions may include selection of one or more amplification parameters such as sequences of the primers, annealing temperatures, time of elongation, concentrations of the materials (primers, salts, polymerase, etc.), pH, the number of cycles in the thermoprotocol, etc.

[00075] The term "primer" is used herein as known to those skilled in the art and refers to oligomeric compounds, primarily to oligonucleotides but also to modified oligonucleotides, that are able to“prime” or initiate DNA synthesis by a template-dependent DNA polymerase. When placed in the proper environment, a primer is able to functionally act as an initiator of template- dependent nucleic acid synthesis. When presented with an appropriate nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as appropriate temperature and pH, the primer may be extended at its 3' terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product. According to the present invention, the primer may be either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically. The primer may vary in length depending on the particular conditions and requirement of the application. A primer in accordance with the present invention may be 10 to 50 or more nucleotides in length (e.g., 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, or 50 nucleotides long). The primer may comprise additional nucleotides, for example 1 , 2 or 3 nucleotides that may be added to either or both ends. Alternatively, 1 , 2 or 3 nucleotides may be deleted from or substituted in either or both ends of the primers. In some cases, 1 , 2 or 3 nucleotides may be added, deleted or substituted in the middle i.e. in other parts than the terminal parts of the primer. The primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able to anneal with the desired template strand in a manner sufficient to provide the 3' hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represents an exact complement of the desired template. For example, a non-complementary nucleotide sequence may be attached to the 5' end of an otherwise complementary primer. Alternatively, non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product.

[00076] Nucleic acid amplification in accordance with the invention requires a set of at least two primers comprising at least one forward primer and at least one reverse primer, each forward-reverse primer combination forming a primer pair. The two primers are designed to hybridize individually to opposite strands of a double-stranded nucleic acid molecule, leading to the generation of an amplification product (i.e. an amplicon) by extending from the 3' end of each primer. In some embodiments, a primer set may comprise more than two primers (e.g. 3, 4, 5, 6, 7, 8, or more primers) forming more than one primer pair, each primer pair having the potential of generating a different amplicon. For instance, the primer set according to the invention may comprise 1 forward primer and 2 reverse primers (for potentially generating up to

2 different amplicons), 2 forward primers and 1 reverse primers (for potentially generating up to

2 different amplicons), 2 forward primers and 2 reverse primers (for potentially generating up to

4 different amplicons), 2 forward primers and 3 reverse primers (for potentially generating up to

6 amplicons), 3 forward primers and 2 reverse primers (for potentially generating up to 6 amplicons), etc. Those skilled in the art will appreciate that generation of an amplicon may be dependent from various factors including, for instance, the presence or absence of the bacteria to be detected, the limit of detection, the amplifications conditions, etc. Preferably the primers of the invention have a melting temperature suitable for most nucleic acid amplification methods such as PCR and are minimally interfering with each other in a multiplex reaction.

[00077] The term "probe" as used herein refers to an oligonucleotide which contains a specific nucleotide sequence allowing the probe to hybridize specifically, under predetermined stringencies, to a nucleic acid molecule having a sequence complementary to the probe (e.g. a target nucleic acid or target sequence). A probe may be either single-stranded or double- stranded, either RNA or DNA, and occurring naturally or being produced synthetically.

[00078] The exact length of the probe will depend upon many factors, including temperature, chemical composition of the probe, sequence of the target and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the probe may be 10 to 60 or more nucleotides in length (e.g., 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58 or 60 nucleotides long). In embodiments, probes are selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to "specifically hybridize" or anneal with their respective target strands under a set of pre determined conditions. Therefore, the probes sequence may not reflect the exact complementary sequence of the target nucleic acid. For example, a non-complementary nucleotide fragment may be attached to the 5' or 3' end of the probe, with the remainder of the probe sequence being complementary to the target strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity with the sequence of the target nucleic acid to anneal therewith specifically. Preferably the probes according to the invention have a melting temperature suitable for most detection methods including but not limited to capture probe hybridization and real-time PCR. When used in real-time PCR, probes are designed for minimally interfering with the primers and/or probes in a multiplex reaction. The probes are also designed for hybridizing specifically to a plurality of amplicons generated for the target sequence or same gene.

[00079] Primers and probes according to the present invention may comprise one or more modified nucleotide e.g. to alter nucleic acid hybridization properties relative to unmodified nucleotide. A "modified nucleotide" in the context of an oligonucleotide refers to an alteration in which at least one nucleotide of the oligonucleotide sequence is replaced by a different nucleotide that provides a desired property to the oligonucleotide. Exemplary modified nucleotides that can be substituted in the oligonucleotides described herein include, e.g., a C5- methyl-dC, a C5-ethyl-dC, a C5-methyl-dU, a C5-ethyl-dU, a 2,6-diaminopurine, a C5-propynyl- dC, a C5-propynyl-dU, a C7-propynyl-dA, a C7-propynyl-dG, a C5-propargylamino-dC, a C5- propargylamino-dU, a C7-propargylamino-dA, a C7-propargylamino-dG, a 7-deaza-2- deoxyxanthosine, a pyrazolopyrimidine analog, a pseudo-dU, a nitro pyrrole, a nitro indole, 2'-0- methyl Ribo-U, 2'-0-methyl Ribo-C, an N4-ethyl-dC, an N6-methyl-dA, and the like. Many other modified nucleotides that can be substituted in the oligonucleotides are referred to herein or are otherwise known in the art. In certain embodiments, modified nucleotide substitutions modify melting temperatures (Tm) of the oligonucleotides relative to the melting temperatures of corresponding unmodified oligonucleotides. To further illustrate, certain modified nucleotide substitutions can reduce non-specific nucleic acid amplification (e.g., minimize primer dimer formation or the like), increase the yield of an intended target amplicon, and/or the like in some embodiments. Examples of these types of nucleic acid modifications are described in, e.g., U.S. Pat. No. 6,001 ,61 1 , which is incorporated herein by reference. Therefore, there is, except possibly for the intended function, no fundamental difference between a “primer”, an “oligonucleotide”, or a“probe”. The present invention also encompasses nucleic acid molecules that are exactly complementary to the primers and probes defined herein.

[00080] The term“hybriziding” refers to the annealing of one or more primers and/or probes to a given nucleic acid sequence or molecule. Hybridization conditions typically include a temperature that is below the melting temperature of the primers and/or probes but that avoids non-specific hybridization of the primers and/or probes. Preferably, the primers and probes of the present invention are sufficiently complementary to a target sequence so as to be able to "specifically hybridize" to the target sequence or nucleic acid molecule. As used herein, the term "specifically hybridize", "specifically hybridizing" or“hybridizing specifically" refers to the association between two single-stranded polynucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined stringent conditions generally used in the art (sometimes termed "substantially complementary"). In particular embodiments, the term refers to hybridization of an oligonucleotide with a sequence substantially complementary to a sequence contained within a selected target nucleic acid molecule (e.g. a target molecule of the invention), while excluding hybridization of said oligonucleotide with single-stranded nucleic acids not having a complementary sequence. Appropriate conditions enabling specific hybridization of single-stranded nucleic acid molecules of varying complementarity are well known in the art. For instance, the equation below is known in the art to predict reasonably well the melting temperature of oligonucleotide, 14-70 nucleotides in length, in cation concentration of 0.4 M or less: (Sambrook and Russell, Chapter 8 in Molecular Cloning: A Laboratory Manual, Third Edition, Volume 2 2001 , Cold Spring Harbor Laboratory Press):

T _m (in °C)= 81 .5 °C +16.6 Log [K+] + 0.41 (% [G+C]) - (675 In)

where n is the number of bases in the oligonucleotide

[00081] In preferred embodiments, the hybridization conditions are stringent conditions including but not limited to optimal concentration of ions e.g. Mg ²⁺ , K ⁺ and NH ₄ and suitable temperature. Examples of stringent hybridization conditions include hybridization at 58°C +/- 7°C, preferably +/-3°C.

[00082] Nucleic acid molecules of the invention (e.g. primers and probes) may be prepared using general methods well known in the art, such as synthesis from appropriate nucleotide triphosphates, isolation from biological sources, etc. Synthetic oligonucleotides may be obtained using nucleic acid synthesizers or similar devices. The resultant construct may be purified according to methods known in the art, such as high performance liquid chromatography (HPLC). Long, double-stranded polynucleotides may be synthesized in stages, due to any size limitations inherent in the oligonucleotide synthesis methods.

[00083] The probes and/or primers according to the invention may be useful in various molecular biology methods, including but not limited to, PCR amplification, Mutational Analysis/Conformation Sensitive Gel Electrophoresis (CSGE), Isolation and Amplification of DNA, Allele Specific PCR, Oligonucleotide Screening Methods, Ligase Mediated Allele Detection Method, Single-Strand Conformation Polymorphism Analysis. Similarly, detection of amplified nucleic acids may be carried out by using any suitable method or technique known in the art including, but not limited to, gel electrophoresis, melting curves, mass spectrometry, sequencing, using probes having a fluorescent dye, etc.

[00084] The probes according to the present invention are preferably labeled, directly or indirectly with a reporter molecule, such that by assaying for the presence or absence of the probe, one can detect the presence or absence of the target sequence. Direct labeling methods include radioisotope labeling, such as, but not limited to, ³² P or ³⁵ S. Indirect labeling methods include fluorescent tags, biotin complexes which may be bound to avidin or streptavidin, or peptide or protein tags. Detection methods include, without limitation, photoluminescence, chemoluminescence, fluorescence, chromogenic and the like. In embodiments, the probes are labeled with a fluorophore including, but not limited to, Quasar 670™, Quasar 705™, CAL Fluor Red 610™, 6-FAM™, TET™, VIC™, ROX™, JOE™ and the like.

[00085] The primers and probes described herein may be useful for the amplification of selected regions of DNA from carbapenemases producing bacteria, particularly CPEs comprising one or more of the genes OXA-48, IMP, VIM and genetic variants thereof, as well as for the detection of such amplified nucleic acids. Such amplification may be carried out using standard amplification techniques including, but not limited to, polymerase chain reaction (PCR), real-time PCR (rtPCR), quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), real time reverse transcription PCR (RT-qPCR), digital PCR, nucleic acid sequence based amplification (NASBA), ligase chain reaction (LCR), transcription-mediated amplification (TMA), and other isothermal amplification methods (e.g. recombinase polymerase amplification (RPA) and loop mediated amplification (LAMP)). In embodiments, primers and probes for different variants and/or different genes are combined together and used in real-time PCR multiplexing methods for accurately, rapidly, and simultaneously detecting a plurality of different carbapenemase genes and/or variants thereof.

[00086] Preferably, PCR methods are used with the primers of the invention for the amplification of nucleic acids. In embodiments, a reaction mixture, including or not a nucleic acid template, is subjected to a cycling to realize the polymerase chain reaction. Typically, double- stranded nucleic acids are subjected to a denaturation step of 1 to 60 sec. at about 90°C to about 100°C. The reactional mix is then cooled down to allow the annealing of each primer to its target sequence. Annealing temperature may be from about 45°C to about 65°C. Annealing times may be from about 10 to about 60 sec. The reactional mix may then be heated to a temperature where thermostable DNA polymerase will produce an optimal primer extension (an optional step in some PCR methods). The newly double-stranded molecule generated can be used as template material in the further steps of the reaction. The repetition of those steps are referred as cycling, and these steps are repeated at least once, preferably about 20, 30, 40, 45, 50 or 60 times or more, until a suitable analytical sensitivity is achieved. [00087] Table 1 , Table 2 and Table 3 hereinafter provide information on selected examples of combinations of probes and primers according to the invention. In particular embodiments, the methods, primers, probes and kits according to the invention comprise the use of these particular examples. Underlined primer(s) and/or probe(s) in options 1 .2 or 2.2 and 2.3 compared to option 1 .1 or 2.1 , respectively, increases PCR analytical sensitivity (reducing limit of detection (LOD)) for the specified underlined variants.

Table 1 : Combinations of primers and probes for the amplification and detection of

bla ₀ x _A -48- _Mke variants in accordance with embodiments of the invention

Table 2: Combinations of primers and probes for the amplification and detection of b/a _ViM variants in accordance with embodiments of the invention

Table 3: Combinations of primers and probes for the amplification and detection of bla _{m p} variants in accordance with embodiments of the invention

[00088] Sequences for the primers and probes of Tables 1-3 are provided hereinafter in the Example (Tables 6 and 7). In embodiments, the primers, and/or the probes of the present invention comprises a nucleotide sequence having at least 90%, 95%, 97%, 98%, 99%, 100% identity with the sequences provided in the Example (Tables 6 and 7). In embodiments, the primers, and/or the probes of the present invention comprise a nucleotide sequence as defined in Figures 10 to 12.

[00089] Figure 1 provides the nucleic acid sequence of a fragment of the gene bla ₀ x _A -48 from Klebsiella pneumoniae (accession No. NG.1 , positions 101 to 898) showing an example of the regions targeted by primers and probes for the gene bla ₀ x - ₄₈ , according to one embodiment of the invention. Figure 2 provides the nucleic acid sequence of a fragment of the gene b/a _ViM from Pseudomonas aeruginosa (accession No. Y18050) showing an example of the regions targeted by primers and probes for the gene b/a _ViM -i , according to one embodiment of the invention. Figure 3 provides the nucleic acid sequence of a fragment of the gene b/ai _Mp from Acinetobacter baumannii (accession No. AF244145) showing an example of the regions targeted by the primers and probes for the gene b/ai _Mp -4 _> according to one embodiment of the invention. Those figures are illustrative only of the positioning of the primers, the amplified region and region targeted by the probes in these particular bacteria, and the particular primers and probes. These parameters may vary in accordance with bacterial species or variants. [00090] In embodiments related to the detection, the differentiation and/or discrimination of

OXA-48-like carbapenemase-producing bacteria with different carbapenemase activity, the primer pair(s) are selected such that the amplification targets a region of bacterial nucleic acid that encodes amino acids that are mutated (e.g. by a deletion, insertion or substitution) in carbapenemase-producing bacteria having a non-clinically significant carbapenemase- producing activity. Accordingly, nucleic acids from bacteria carrying the mutation will not be amplified (or will be amplified below a minimal detectable threshold value) whereas nucleic acids from bacteria without the mutation will be amplified. This selective amplification will permit to selectively detect carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity. Nucleic acids from bacteria having non-clinically significant carbapenemase-producing activity are neither amplified nor detected. Additional information about this strategy is provided hereinafter in the section“Methods for detection”.

[00091] In embodiments, the primer pair(s) and/or the probe(s), are selected for detection and/or amplification of nucleic acids from at least 5, 10, 1 1 , 12, 13, 14 or more different OXA-48- like variants having carbapenemase-producing activity. [00092] In embodiments, the primer pair(s) and/or the probe(s), are selected for detection and/or amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 62, 64 or more different VIM variants having carbapenemase-producing activity.

[00093] In embodiments, the primer pair(s) and/or the probe(s), are selected for detection and/or amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 72, 74, 76 or more different IMP variants having carbapenemase-producing activity.

[00094] In embodiments, the primer pair(s) and/or the probe(s), are selected for a multiplex assay permitting simultaneous detection of at least two of OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes (e.g. OXA-48-like + VIM, OXA-48- like + IMP, VIM + IMP, and OXA-48-like + VIM + IMP).

[00095] In embodiments, the primer pair(s) and/or the probe(s), are selected for a multiplex assay permitting simultaneous detection of at least one of OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes, and at least one additional carbapenemase gene including, but not limited to, KPC carbapenemase genes and NDM carbapenemase genes.

C) Kits

[00096] A further aspect of the invention relates to kits, e.g. detection, screening or diagnostic kits. The kits of the invention may be useful for the practice of the methods of the invention, particularly for diagnostic applications in subjects (e.g. humans) for the detection of carbapenemase-producing bacteria, for differentiating between subjects carrying bacteria having a clinically significant carbapenemase-producing activity from those subjects carrying bacteria having a non-clinically significant carbapenemase-producing activity and/or for detecting presence and/or absence of bacteria in samples from various environments as well as various environmental samples as described hereinbefore.

[00097] Accordingly, a related aspect of the invention concerns kits (e.g. diagnostic, screening or detection kits) comprising at least one primer pair and at least one probe as defined herein.

[00098] In one embodiment, the kit comprises at least one primer pair and at least one probe from those provided in Tables 1-3. In embodiments the primers and/or the probes comprise a nucleotide sequence as defined in the Example (Tables 6 and 7). In embodiments the primers, and/or the probes of the present invention comprise a nucleotide sequence as defined in

Figures 10 to 12.

[00099] In particular embodiments, a kit of the invention comprises components of nucleic acid amplification systems (e.g. DNA), including PCR reaction materials such as buffers and a thermostable polymerase. In a one embodiment, the kit is optimized for real-time PCR, more preferably in real-time multiplex PCR. A kit of the invention may further comprise one or more of the following elements: biological specimens collecting materials (e.g. cotton swab, blood samples collecting tubes, a buffer for the homogenization or for the lysis of cells in the sample(s), purified nucleic acids molecules (e.g. DNA) to be used as controls, incubation buffer(s), substrate and assay buffer(s), modulator buffer(s) and modulators (e.g. enhancers), standards, detection materials (e.g. antibodies, fluorochromes, fluorescein-labelled derivatives, luminogenic substrates, detection solutions, quencher(s) such as TAMRA™, Black Hole Quencher®, Iowa Black® etc.), laboratory supplies (e.g. desalting columns, reaction tubes or microplates (e.g. 96- or 384-well plates)), a user manual or instructions, etc. Preferably, the kit and methods of the invention are configured such as to permit a semi-quantitative or quantitative detection or measurement of amplicons, DNA or desired gene(s). In other embodiments, the kit of the present invention can be used in conjunction with commercially available amplification kits. The kit may optionally include instructional material, positive or negative control reactions, templates, or markers, molecular weight size markers for gel electrophoresis, and the like.

[000100] In one embodiment a kit for the simultaneous detection of OXA-48-like + VIM + IMP genes comprises blaIMP primers and probes selected from the combo 4.4 listed in Table 3, blaVIM primers and probes selected from the combo 3.3 listed in Table 2 and blaOXA48-like primers and probes selected from the combo 1 .2 listed in Table 1. In another embodiment, the kit comprises blaIMP primers and probes selected from the combo 4.4 listed in Table 3, blaVIM primers and probes selected from the combo 3.3 listed in Table 2 and blaOXA48-like primers and probes selected from the combo 2.3 listed in Table 1. Those oligonucleotides may be combined with commonly used PCR reagents, such as 25 to 100 mM KCI, 10 to 200 mM Tris- HCI (pH from 8.0 to 9.0), 1 to 8 mM MgCI ₂ , 0.1 to 1 mg/mL bovine serum albumin, 0,005 to 0.020 % of non-ionic detergent (e.g. Tween 20™), 0.1 to 1.5 mM of each oligonucleotide, 0.5 to 5 U of thermostable DNA polymerase, and 50 to 350 mM of each dATP, dTTP, dCTP, dGTP (or one or more of analogs thereof). [000101] In embodiments, the kit comprises all of the components for a multiplex assay permitting simultaneous detection of at least two of OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes (e.g. OXA-48-like + VIM, OXA-48-like + IMP, VIM + IMP, and OXA-48-like + VIM + IMP). In embodiments, kit further comprises at least one additional set of primers and probe(s) for the detection of at least one of KPC carbapenemase genes and NDM carbapenemase genes. Nucleic acid sequences of primers and probes for KPC and NDM are provided in the US provisional application US 62/701 ,126 filed July 20, 2018, and the international PCT patent application claiming priority to US 62/701 ,126 filed concurrently, both applications being incorporated herein by reference in their entirety.

D) Methods for detection

Presence or absence of an OXA-48-carbapenemase-producing bacteria

[000102] As indicated hereinbefore and exemplified hereinafter, one aspect of the invention concerns methods for the detection of OXA-48-like carbapenemase-producing bacteria, and more particularly methods for the differentiation and/or discrimination of bacteria with different carbapenemase producing activity.

[000103] According to a one aspect, the invention relates to a nucleic acid-based method for detection, the differentiation and/or discrimination of OXA-48-like carbapenemase-producing bacteria with different carbapenemase activities.

[000104]0ne particular aspect of the invention concerns a method for detecting a presence or an absence of an OXA-48-carbapenemase-producing bacteria in a sample. In one embodiment the method comprises:

a. providing a sample susceptible to comprise carbapenemase-producing bacteria; b. amplifying specifically nucleic acids from carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity while avoiding amplification of nucleic acids from carbapenemase-producing bacteria having a non-clinically significant carbapenemase-producing activity; and

c. detecting presence or absence of amplified nucleic acids.

[000105] According to this method, presence of amplified nucleic acids is indicative of the presence of carbapenemase-producing bacteria having a clinically significant carbapenemase- producing activity, whereas absence of amplified nucleic acids is indicative of the absence of carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity.

[000106] According to the method described above and elsewhere herein, “detecting [...] absence of amplified nucleic acids” may not necessary require an active measurement or detection step for detecting such“absence”. For instance, the“absence” of amplified nucleic acids may simply be extrapolated, deducted and/or calculated based on other measurements or it may correspond to a measurement value that is below a defined threshold, nil or very low.

[000107] Another particular aspect of the invention concerns nucleic acid-based method for detection of OXA-48-carbapenemase-producing bacteria. In one embodiment the method comprises:

a. providing a sample susceptible to comprise carbapenemase-producing bacteria; b. amplifying specifically nucleic acids from carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity while avoiding amplification of nucleic acids from carbapenemase-producing bacteria having a non-clinically significant carbapenemase-producing activity; and

c. detecting amplified nucleic acids.

[000108] According to this method, positive detection of amplified nucleic acids indicates the presence of OXA-48-carbapenemase-producing bacteria having clinically significant carbapenemase activity.

[000109] In embodiments, it is the particular selection of primer pair used for amplification that provides for such selective detection. According to this strategy, nucleic acids from bacteria carrying a predetermined mutation will not be amplified, whereas nucleic acids from bacteria not having the mutation will be amplified. Thereafter the amplicons resulting from the amplification are detected using any suitable method, preferably by using a probe complementary to the amplified region.

[000110] For instance, as illustrated in Figure 4 (c.f. Options 1 and 2), in a set of primers for amplification, if one of the primer is designed to be complementary to a region of bacterial nucleic acid that is not mutated, under typical amplification conditions, that particular primer will only hybridize to bacterial nucleic acids from bacteria not having the targeted mutation and only nucleic acids from non-mutated bacteria will be amplified (i.e. nucleic acids from bacteria having the mutation will not be amplified).

[000111] As illustrated in Figure 4 also (c.f. Options 1 and 2), amplification may be carried out such that the amplicon generated corresponds to a region upstream (Option 1 ) or a downstream (Option 2) to the mutation. Since nucleic acid amplification always occurs in a 5’ 3’ direction, the positioning of the amplification with respect to the mutation will depend of the precise strand of the bacterial nucleic acid the primer is designed to be complementary. As described herein, the present description provides primer pairs designed for both options and the present invention encompasses amplification in both directions.

[000112] According to another option illustrated in Figure 4 (c.f. Option 3), primer pairs may be positioned for amplification of both, OXA-48-carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity and OXA-48-carbapenemase-producing bacteria not having a clinically significant carbapenemase-producing activity, followed by specific detection of only OXA-48-carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity using a probe positioned in region of the mutation.

[000113] Accordingly, an additional aspect of the present invention concerns a method for detecting a presence or an absence of an OXA-48-carbapenemase-producing bacteria comprising:

a. providing a sample susceptible to comprise carbapenemase-producing bacteria; b. amplifying nucleic acids from said carbapenemase-producing bacteria;

c. detecting specifically the presence or absence of amplified nucleic acids from

carbapenemase-producing bacteria having a clinically significant carbapenemase- producing activity while avoiding detection of nucleic acids from carbapenemase- producing bacteria having a non-clinically significant carbapenemase-producing activity.

[000114] According to this method, detection of amplified nucleic acids is indicative of the presence of carbapenemase-producing bacteria having a clinically significant carbapenemase- producing activity, whereas absence of detection is indicative of the absence of carbapenemase-producing bacteria having a clinically significant carbapenemase-producing activity. [000115] In embodiments, as illustrated in Figure 5 and Figure 6, the region targeted by the invention which may comprise mutation(s) (which can be substitution(s), and/or deletion(s) and/or insertion(s)) in the OXA-48-like carbapenemase gene is a region comprising about 10, or about 15, or about 20, or about 25 or about 30 contiguous nucleotides from a region between the nucleotides encoding a conserved KTG (i.e Lys - Thr - Gly) motif and a conserved WWV (i.e. Trp - Trp - Val) motif, these motifs being present in an OXA-48-like carbapenemase- producing bacteria (e.g. OXA-48 carbapenemase enzyme accession no. NG_049762.1 , positions 101 to 898). In embodiments, the targeted region comprises a deletion, the non- deleted region encoding amino acids 21 1 to 220 of the reference OXA-48 carbapenemase enzyme.

[000116] In embodiments, as illustrated in Figure 5 and Figure 6, the region targeted by the invention which may comprise mutation(s) (which can be substitution(s), and/or deletion(s) and/or insertion(s)) in the OXA-48-like carbapenemase gene is a region comprising about 10, or about 15, or about 20, or about 25 or about 30 contiguous nucleotides downstream the nucleotides encoding a conserved KTG (i.e Lys - Thr - Gly) motif present in an OXA-48-like carbapenemase-producing bacteria (e.g. OXA-48 carbapenemase enzyme accession no. NG_049762.1 , positions 101 to 898).

[000117] In embodiments, as illustrated in Figure 5 and Figure 6, the region targeted by the invention which may comprise mutation(s) (which can be substitution(s), and/or deletion(s) and/or insertion(s)) in the OXA-48-like carbapenemase gene is a region comprising about 10, or about 15, or about 20, or about 25 or about 30 contiguous nucleotides upstream the nucleotides encoding a conserved WWV (i.e. Trp - Trp - Val) motif present in an OXA-48-like carbapenemase-producing bacteria (e.g. OXA-48 carbapenemase enzyme accession no. NG_049762.1 , positions 101 to 898)

[000118] Figure 9 provides patterns of DNA sequence variability in the mutated region of OXA-48-like gene in many variants. In embodiments, one of the forward or reverse primers is designed to hybridize specifically the nucleotide sequence of Group A, as defined in Figure 9. In embodiments, one of the forward or reverse primers is designed for not hybridizing specifically the nucleotide sequence of Group C, as defined in Figure 9.

[000119] In embodiments the individual primer, primer pair(s) and the probe(s) are as defined herein, e.g. those provided in Tables 1-3. In embodiments the primer pair(s) and the probe(s) comprise a nucleotide sequence as defined in the Example (Tables 6 and 7) and/or as defined in Figures 10 to 12.

[000120] In embodiments, the region comprising mutation(s) that is targeted is a region that encodes for at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9 or at least 10 contiguous amino acids that are found between conserved motifs Lys - Thr - Gly (KTG) and Trp - Trp - Val (WWV) in the corresponding reference OXA-48 carbapenemase enzyme (accession no. NG_049762.1 , positions 101 to 898).

[000121] In embodiments, the region comprising mutation(s) that is targeted by the primer(s) encodes for at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9 or at least 10 contiguous amino acids selected from the following sequence:

Xaai - Xaa ₂ - Xaa ₃ - Xaa ₄ - Xaa ₅ - Xaa ₆ - Xaa ₇ - Xaa ₈ - Xaa ₉ - Xaai ₀ [SEQ ID NO : 1] where

Xaai = Tyr or Ser or absent

Xaa ₂ = Ser or Glu or Asp or Asn or Gly or absent

Xaa ₃ = Thr or Ala or Val or Gly or absent

Xaa ₄ = Arg or Gly or Ser or absent

Xaa ₅ = lie or Tyr or absent

Xaa ₆ = Glu or Asp or Lys or absent

Xaa ₇ = Pro or Thr or absent

Xaa ₈ = Lys or Gin or absent

Xaa _g = lie or Phe or absent

Xaa _i0 = Gly or absent.

[000122] In embodiments, the forward and reverse primers are selected to provide for amplification of nucleic acids from at least 14 different OXA-48-like variants of human pathogens. Preferably these include OXA-48, OXA-162, OXA-181 , OXA-199, OXA-204, OXA- 232, OXA-244, OXA-245, OXA-370, OXA-436, OXA-484, OXA-505, OXA-519, and OXA-566.

[000123] In embodiments, the forward and reverse primers are selected to such that carbapenemase-producing bacteria having a non-clinically significant carbapenemase- producing activity are neither amplified nor detected and do not result in a positive signal in the test (e.g. because of complete absence of amplification or because amplification below minimal detectable threshold value). Examples of variants which detection is to be avoided includes OXA-163, OXA-247, OXA-405, OXA-438, OXA-439, OXA-517, and OXA-567. Preferably, the OXA-163 and OXA-405 variants are not detected. [000124] In embodiments, the forward and reverse primers are selected from those provided in Tables 6, including combinations thereof. In embodiments the forward and reverse primers comprise a nucleotide sequence as defined in Table 6 and/or as defined in Figure 10.

[000125] In embodiments, the detection of amplified nucleic acids comprises hybridizing amplified nucleic acids with a probe comprising as defined in Table 7. In embodiments the probe comprises a nucleotide sequence as defined in Table 7 and/or as defined in Figure 10.

[000126] In embodiments, the amplifying comprises using polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), quantitative PCR (qPCR) and combinations thereof.

[000127] In embodiments, the amplifying comprises simultaneous amplification of bacterial nucleic acids for at least one of VIM carbapenemase genes and IMP carbapenemase genes. Amplified VIM and/or IMP nucleic acids may then be detected as well, thereby allowing detecting simultaneously presence or absence of OXA-48, VIM and IMP in a sample. Accordingly, in embodiments the amplifying consists of a multiplex reaction for simultaneous detection of a multitude of OXA-48 carbapenemase genes, a multitude of VIM carbapenemase genes, and a multitude of IMP carbapenemase genes.

[000128] As used herein, the term “simultaneous” when referring to amplification and/or detection generally refers to events (e.g. amplification and/or detection) that are somewhat contemporaneous and/or synchronized in order to occur in a single tube or in the course of a single process (e.g. a PCR reaction). As such,“simultaneous” is not limited to events that occur exactly at the same time.

OXA-48-like variants

[000129] According to another particular aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of bla ₀ x _A -48-n _ke gene variants in a sample. In one embodiment the method comprises the steps of:

a. providing a sample susceptible to comprise carbapenemase-producing bacteria; b. providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla ₀ x _A -48-n _ke gene;

c. carrying out an amplification reaction; and

d. detecting presence or absence of amplified nucleic acids. [000130] According to this method presence or absence of amplified nucleic acids for a given bla ₀ x A-48-iike gene variant is indicative of the presence or absence of said bla ₀ x _A -48-uke gene variant in the sample. Also, in this method a set of primers consisting of only one forward primer and only one reverse primer is designed to provide for selective amplification of nucleic acids from at least 5, 10, 1 1 , 12, 13, 14 or more different bla ₀ x _A -48-u _ke variants having a clinically significant carbapenemase-producing activity (e.g. bla ₀ x A-48-nke variants of human pathogens).

[000131] According to another particular aspect, the invention relates to a nucleic acid-based method for selective detection of a plurality of bla ₀ x A-48-nke gene variants. In one embodiment the method comprises the steps of:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of bla ₀ x _A - 4 ₈ -ii _ke gene; and

c) detecting amplified nucleic acids. [000132] According to this method the set of primers is designed to provide for selective amplification of nucleic acids from at least 5, 10, 1 1 , 12, 13, 14 or more different bla ₀ x A-48-nke variants having a clinically significant carbapenemase-producing activity with only one forward primer and only one reverse primer.

[000133] In accordance with the present invention, OXA-48-like variants may be divided in different groups, as shown in Table 5 below.

Table 5: Groups of OXA-48-like variants

OXA-48-like variants Host

Group A

OXA-48 Gram-negative bacteria

OXA-162 Gram-negative bacteria

OXA-181 Gram-negative bacteria

OXA-199 Shewanella xiamenensis ; Acinetobacter baumannii

OXA-204 Gram-negative bacteria

OXA-232 Gram-negative bacteria

OXA-244 Gram-negative bacteria

OXA-245 Gram-negative bacteria

OXA-370 Gram-negative bacteria

OXA-436 Gram-negative bacteria ; Shewanella putrefaciens

OXA-484 Gram-negative bacteria OXA-48-like variants Host

OXA-505 Gram-negative bacteria

OXA-51 9 Gram-negative bacteria

OXA-566 Gram-negative bacteria

Group B

OX A- 54 Shewanella oneidensis

OXA-252 Shewanella sp.

OXA-41 6 Shewanella xiamenensis

OXA-514 Shewanella xiamenensis

OXA-51 5 Shewanella sp.

OXA-538 Shewanella xiamenensis

OXA-546 Shewanella xiamenensis

OXA-547 Shewanella xiamenensis

Group C

OXA-163 Gram-negative bacteria

OXA-247 Gram-negative bacteria

OXA-405 Gram-negative bacteria

OXA-438 Gram-negative bacteria

OXA-439 Gram-negative bacteria

OXA-51 7 Gram-negative bacteria

OXA-567 Gram-negative bacteria

[000134] In embodiments, the detection methods of the invention are configured and designed such that: (i) variants from Group A will be amplified and detected; (ii) variants from Group B, which are not considered to be clinically relevant, may or may not be amplified and detected; and (iii) variants from Group C will not be amplified nor detected . Typically, variants from Group A are found in Gram-negative bacteria and characterized by a clinically significant carbapenemase-producing activity and the absence of a deletion in the region corresponding to amino acids 21 1 to 220 of the reference OXA-48 protein (accession no. NG_049762.1 , positions 101 to 898). Variants from Group B are variants present in Shewanella. Variants from Group C are found in Gram-negative bacteria and characterized by a non-clinically significant carbapenemase-producing activity and the presence of mutation(s) (particularly a deletion) in the region corresponding to amino acids 21 1 to 220 of a reference OXA-48 protein which sequence is available as accession no. NG_049762.1 , positions 101 to 898. [000135] In embodiments, with only one forward primer and only one reverse primer it is possible to amplify selectively the following blaOXA-48-like gene variants: OXA-48, OXA-162, OXA-181 , OXA-199, OXA-204, OXA-232, OXA-244, OXA-245, OXA-370, OXA-436, OXA-484, OXA-505, OXA-519, OXA-566.

[000136] In embodiments, the amplifying avoids amplification of nucleic acids from at least 3, 4, 5, 6 or 7 carbapenemase-producing bacteria from human pathogens having a non-clinically significant carbapenemase-producing activity. In embodiments, the OXA-48-like variants having a non-clinically significant carbapenemase-producing activity are selected from OXA-163, OXA- 247, OXA-405, OXA-438, OXA-439, OXA-517, and OXA-567.

[000137] In embodiments, the amplifying comprises using a primer pair(s) as defined herein, for instance as defined in Table 1. In embodiments the forward and reverse primers comprise a nucleotide sequence as defined in Table 6 and/or as defined in Figure 10.

[000138] In embodiments, the detecting comprises using one or more probes as defined herein, for instance as defined in Table 1. In embodiments, the detecting comprises hybridizing amplified nucleic acids with at least OXA48-Probe1 . In embodiments the probe comprises a nucleotide sequence as defined in Table 7 and/or as defined in Figure 10. [000139] Figure 7 provides the inferred evolutionary relationships among various variants from the different groups. As illustrated, the invention provides for detection of variants that are not necessarily closely related, for instance blaOXA-436 versus most other variants of Group A. Also, the invention is selective enough to avoid detecting variants of Group C that are somewhat closely related to the targeted Group A (e.g. blaOXA-439 and blaOXA-370). [000140] Those skilled in the art will understand that the lists of variants in Table 5 and

Figure 7 are not definitive and that additional variants may be added to each group as these variants are being classified or discovered. Those skilled in the art should be able to determine in which groups the variants belong, based on information provided herein and criteria known in the field. VIM variants

[000141] According to another particular aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of b/a _V|M gene variants in a sample. In one embodiment the method comprises the steps of:

a. providing a sample susceptible to comprise carbapenemase-producing bacteria; b. providing a set of forward and reverse primers hybridizing specifically to multiple variants of b/a _{v IM} gene;

c. carrying out an amplification reaction; and

d. detecting presence or absence of amplified nucleic acids.

[000142] According to this method, presence or absence of amplified nucleic acids for a given b/a _{v IM} gene variant is indicative of the presence or absence of said b/a _ViM gene variant in the sample. Also, in this method a set of primers consisting of only one forward primer and only one reverse primer is designed to provide for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 62, 64 or more different b/a _v IM gene variants.

[000143] According to another particular aspect, the invention relates to a nucleic acid-based method for selective detection of a plurality of b/a _ViM gene variants. In one embodiment the method comprises the steps of:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of blay IM gene; and

c) detecting amplified nucleic acids.

[000144] According to this method, the set of primers is designed to provide for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 62, 64 or more different blay IM gene variants with only a pair of primers.

[000145] In embodiments, the amplifying comprises using individual primer(s) and/or primer pair(s) as defined in Table 2 (e.g. combo 3.1 , 3.2, or 3.3), and the said detecting comprises hybridizing amplified nucleic acids with a probe as defined in Table 2. In embodiments the primers comprise a nucleotide sequence as defined in Table 6. In embodiments the probe comprises a nucleotide sequence as defined in Table 7.

[000146] In embodiments, the blay IM gene variants which are amplified and detected are selected from the group consisting of blay IM-I , d/aviM-2i blay IM-3, b/aviM-4i blay IM-S, b/aviM-6i b/aviM-si

IMP variants

[000147] According to another particular aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of bla _Mp gene variants in a sample. In one embodiment the method comprises the steps of:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria;

b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of b/ai _MP gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids.

[000148] According to this method, the presence or absence of amplified nucleic acids for a given bla _lMP gene variant is indicative of the presence or absence of said bla _lMP gene variant in the sample. According to the method also, a set of primers consisting of only 8 forward primers and only 7 reverse primers is designed to provide for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 72, 74, 76 or more different bla _MP gene variants.

[000149] According to another particular aspect, the invention relates to a nucleic acid-based method for detection of a plurality of bla _MP gene variants. In one embodiment the method comprises:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of bla _MP gene; and

c) detecting amplified nucleic acids.

[000150] According to this method, the set of primers is designed to provide for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 72, 74, 76 or more different bla _MP gene variants with only 10 forward primers and only 9 reverse primers. [000151] In embodiments, the bla _lMp gene variants which are amplified and detected are selected from the group consisting of bla _Mp gene variants 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13,

14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 51 , 52, 53, 54, 55, 56, 58, 59, 60, 61 , 62, 63, 64, 66, 67, 68, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80.

[000152] In embodiments, the amplifying comprises using individual primers and/or primer pair(s) as defined in Table 3 (e.g. combo 4.1 , 4.2, 4.3 or 4.4), and the detecting comprises hybridizing amplified nucleic acids with a probe as defined in Table 3.

[000153] In embodiments, the individual primers and/or primer pairs comprise IMP-Primer1 , IMP-Primer2, IMP-Primer3, IMP-Primer4, IMP-Primer5, IMP-Primer6, IMP-Primer7, IMP- Primer8, IMP-Primer9, IMP-Primer10, IMP-Primer1 1 , IMP-Primer12, IMP-Primer13, IMP- Primer14, IMP-Primer15, IMP-Primer16, IMP-Primer17, IMP-Primer18, and IMP-Primer19 as defined in Table 3 (e.g. combo 4.1 , 4.2 4.3, or 4.4), and the said detecting comprises hybridizing amplified nucleic acids with a probe as defined in Table 3. In embodiments the primers comprise a nucleotide sequence as defined in Table 6. In embodiments the probe comprises a nucleotide sequence as defined in Table 7.

Simultaneous detection o and bla _P qene variants

[000154] In certain aspects, the invention relates to methods for simultaneous detection of a plurality of gene variants from different genes, i.e. any combination of at least two genes among d/aox _A-48 -ii _kei blsyiu, and b/aiMP genes.

[000155] In one particular aspect the invention relates to a nucleic acid-based method for simultaneous detection of a plurality of b/a _{ox A} -48-uke gene variants, a plurality of b/a _v gene variants, and a plurality of bla _Mp gene variants. In one embodiment the method comprises the steps of:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with (i) a first set of forward and reverse primers hybridizing specifically to multiple variants of b/aox _A -48-ii _ke gene; (ii) a second set of forward and reverse primers hybridizing specifically to multiple variants of b/a _v IM gene; and (iii) a third set of forward and reverse primers hybridizing specifically to multiple variants of bla _Mp gene; and c) detecting amplified nucleic acids. [000156] In this method, the first, second and third sets of primers are selected from Table 1 , Table 2 and Table 3, respectively. Preferably the primers comprise a nucleotide sequence as defined herein, for instance the sequences provided in Table 6. In embodiments the probe comprises a nucleotide sequence as defined in Table 7 [000157] In accordance with the nucleic acid-based methods described herein, any suitable method may be used for amplification of the nucleic acids. Preferably, the amplifying comprises at least one of polymerase chain reaction (PCR), and quantitative PCR (qPCR).

E) Diagnostic and treatment methods

[000158] As can be appreciated, the probes, primers, kits and methods described herein may be useful for bacterial detection, clinical diagnostic and/or treatment purposes.

[000159] Accordingly, the present invention encompasses the use of any of the probes, primers, kits and methods described herein for diagnostic of subjects, e.g. human patient, carrying or not carrying carbapenemase-producing bacteria.

[000160] In one embodiment, a kit for the detection of OXA-48-like carbapenemase genes comprises at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7.

[000161] In one embodiment, a kit for the detection of VIM carbapenemase genes comprises at least one forward primer, at least one reverse primer and at least one probe as defined in

Table 6 and Table 7. [000162] In one embodiment, a kit for the detection of IMP carbapenemase genes, comprises at least one forward primer, at least one reverse primer and at least one probe as defined in

Table 6 and Table 7.

[000163] One particular aspect the invention relates to a multiplex detection kit for simultaneous detection of at least two different carbapenemase genes. In one embodiment the kit comprises:

i) a first set of oligonucleotide molecules for the detection of OXA-48-like carbapenemase genes, the first set comprising at least one forward primer, at least one reverse primer and at least one probe as listed in Table 6 and Table 7;

and ii) at least a second set of oligonucleotide molecules for the detection of at least one of VIM carbapenemase genes and IMP carbapenemase genes, said at least one second set comprising:

a) for the detection of VIM carbapenemase genes with at least one forward primer, at least one reverse primer and at least one probe as listed in Table 6 and Table 7;

b) for the detection of IMP carbapenemase genes with at least one forward primer, at least one reverse primer and at least one probe as listed in Table 6 and Table 7.

[000164] Another particular aspect the invention relates to a multiplex detection kit for simultaneous detection of OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes. In one embodiment the kit comprises:

i) a first set of oligonucleotide molecules for the detection of OXA-48-like carbapenemase genes, the first set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7;

ii) a second set of oligonucleotide molecules for the detection of VIM carbapenemase genes, the second set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7;

iii) a third set of oligonucleotide molecules for the detection of IMP carbapenemase genes, the third set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 6 and Table 7.

[000165] Advantageously, the kits of the present invention may further comprise at least one additional set of primers and/or additional probe(s) for the detection of at least one of KPC carbapenemase genes and NDM carbapenemase genes. The methods and kits of the present invention may further be used in combination and/or comprise additional set of primers and/or additional probe(s) for the detection of additional resistance genes including but not limited to CTX-M, SHV, TEM b-lactamases and/or for the detection of bacterial species, including, but not limited to, Klebsiella pneumoniae, Escherichia coli and/or Pseudomonas aeruginosa. The present invention also encompasses the use of any of the probes, primers, kits and methods described herein in the treatment of subjects carrying or suspected of carrying carbapenemase- producing bacteria. [000166] For instance, a treatment method according to the invention may comprise the steps of: (i) identifying a subject (e.g. human patient) carrying carbapenemase-producing bacteria with the probes, primers, kits and methods described herein; and (ii) providing appropriate treatment to such infected subject. The appropriate treatment may comprise providing to the infected subject adequate antibiotic therapy and/or implementing strict infection control measures around the infected subject and/or around any subject that may have been in contact with the infected subject.

[000167] The probes, primers, kits and methods described herein may also be useful in implementing adequate hygiene procedures, for instance by providing detection of presence or absences of bacteria in various environments including, but not limited to, hospitals (e.g. laboratory working surfaces, medical instruments, patient rooms, etc.), public spaces (e.g. schools, shopping malls, etc.), nature (e.g. water, air, soil, etc.) and the like. The invention may also find applications in epidemiologic studies.

[000168] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents are considered to be within the scope of this invention, and covered by the claims appended hereto. The invention is further illustrated by the following example, which should not be construed as further or specifically limiting.

EXAMPLES

[000169] Example 1 : Multiplex assay for simultaneous detection of OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes in human subjects

[000170] Design of primer and probes

[000171] The bla ₀ x _A -48-n _ke family currently comprises 30 variants of protein sequences, namely d/aoXA-48! b/a ₀ XA-54, d/aoXA-162, d/aoXA-163! b/aoXA-181. b/aoXA-199, d/aoXA-204, d/aoXA-232, d/aoXA-244, d/aoXA-245! d/aoXA-247, d/aoXA-252, d/aoXA-370! d/aoXA-405! d/aoXA-416! d/aoXA-436! d/aoXA-438! d/aoXA-439! d/aoXA-484, d/aoXA-505! d/aoXA-514, d/aoXA-515! d/aoXA-517, d/aoXA-519! d/aoXA-535! d/aoXA-538! d/aoXA-546! bla ₀ x _A -547 et b/aox _A -566, bla ₀ x _A -567 (Bacterial Antimicrobial Resistance Reference Gene Database, NCBI, BioProject 313047, last reviewed on July 1 1 , 2019). Some of these genetic variants

(b/a ₀ XA-54, d/aoXA-252, b/a ₀ XA-416, b/a ₀ XA-514, ^¾)XA-515, d/aoXA-535! d/aoXA-538! d/aoXA-546! and b/aoXA-547) are found, until now, only in the genus Shewanella, a rare opportunistic human pathogen (Janda JM and SL Abbott (2014) Critical Reviews in Microbiology 40:293-312). These variants considered to be the reservoir of bla ₀ x _A -48-uke genes found in Gram-negative bacteria.

[000172] In order to obtain a specific and ubiquitous PCR assay, conserved regions were identified on 82 sequences of the bla ₀ x A-48-nke gene that were available in the NCBI public databases (NR and WGS). These different bla ₀ x _A -48-uke genes show percentages of identity at the nucleotide level ranging from 92.5 to 99.8%. Primers and probes were thus designed for the specific and ubiquitous amplification of 14 variants (referred as Group A): bla ₀ x -48, bia ₀ x -162,

bla ₀ x _A -505, b/a ₀ x _A-5i9 , and bla ₀ x _A-566 · The design of primer pairs was made to ensure that 7 variants (referred as Group C) having a non-clinically significant carbapenemase-producing activity will not be amplified: b/aoxA-163 _! d/aoxA-247, biaoxA-mz, blaoxA-438, blaoxA-433, d/aoxA-517, and bla ₀ x A-567· Primers and probes were designed to amplify and detect all the 14 Group A variants, including the most prevalent variants OXA-48 and OXA-181 , by using a minimal set of oligonucleotides while achieving the highest analytical sensitivity.

[000173] The b/a _{V IM} gene currently comprises 64 variants of protein sequences (known as VIM-1 to VIM-66). Analysis of the sequences available in the NCBI public databases (NR and WGS) shows percentages of identity at the nucleotide level ranging from 87.9% to 99.9% between the different b/a _{v iM} - In order to obtain a specific and ubiquitous PCR assay, conserved regions were identified on 330 sequences. Primers and probes were thus designed with the objective of targeting 60 out of 64 VIM variants, including the most prevalent variants VIM-1 and VIM-2, by using a minimal set of oligonucleotides while achieving the highest analytical sensitivity.

[000174] The bia _Mp gene currently comprises 76 variants of protein sequences (known as IMP-1 to IMP-80). Analysis of the sequences available in the NCBI public databases (NR and WGS) shows percentages of identity at the nucleotide level ranging from 79.5% to 99.9% between the different bla _lMP . In order to obtain a specific and ubiquitous PCR assay, conserved regions were identified on 223 sequences. Primers and probes were thus designed with the objective of targeting all the 76 IMP variants, including the most prevalent variants IMP-1 and IMP-8, by using a minimal set of oligonucleotides while achieving the highest analytical sensitivity. [000175] Table 6 hereinafter provides the nucleic acid sequence and other features of the selected primers.

[000176] Table 7 hereinafter provides the nucleic acid sequence and other features of the selected probes. Table 6: Features of the primers useful for the amplification of bla _ox A48-Mk _e! bla^ _!M , and bacterial genes

Identification Size Nucleotidic sequence SEQ ID NO: Amplicon

(nuc.) (5 ¹ - 3') (bp)

OXA48-Primerl ^a 20 TCAGTTGTGCCTGTTTATCA 8

GCCAATCTTAGGTTCGATTC 9 309

OXA48-Primer2 ^a 20

OXA48-Primer3 ^a 21 AACCGATTTTCGGTTCAATTC 10

OXA48-Primer4 ^b 20 AT AC T C GACT AGAAT C GAAC 11

OXA48-Primer6 ^b 20 AT AC GAGACT AGAAT C GAAC 12

OXA48-Primer7 ^b 20 C TAT TCGGTCAGAATT GAAC 13 131 OXA48-Primer5 ^b 16 TGATGGCTTGGCGCAG 14

OXA48-Primer8 ^b 18 CGTAATGGTTTGACGCAA 15

VIM-Primerl 21 T C T AGAAG GAC T C T CAT C GAG 16

VIM-Primer2 17 C CAT T CAG C CAGAT C GG 17 196

VIM-Primer3 17 CCATTCAGCCAGGTCGG 18

IMP-Primerl 26 ACTGAAAAATTAGTTAATTGGTTTAT 19

IMP-Primer2 25 CTGAAAATTTAGTTAATTGGTTTGT 20

IMP-Primer3 23 GAAAAGTTAGTCAATTGGTTTGT 21

IMP-Primer4 23 GAAAAATTAGTCAATTGGTTTGT 22

IMP-Primer5 23 GAAAAGTTAGTTACTTGGTTTGT 23

IMP-Primer6 23 GAAAAGTTAGTAAATTGGTTTGT 24

145-153

IMP-Primer7 21 AAAATTAGTTGCTTGGTTTGT 25

IMP-Primer8 20 AAATTAGTCCGCTGGTTTGT 26

IMP-Primer9 20 AAGTTAGGCACTTGGTTTGT 27

IMP-PrimerlO 20 AAGTTAGTCACCTGGTTTGT 27

IMP-Primerll 22 G CAG CT CAT T AGT T AAT T CAGA 29

IMP-Primerl2 24 AAGAAGT T CAT T T G T T AAT T CAGA 30

IMP-Primerl3 24 G AGAAGT T CAT T T G T T AAT AC AGA 31

IMP-Primerl4 24 C AAAAGT T CAT T T G T T AAT T CAGA 32

IMP-Primerl5 22 GAAG GT CAT TTGTTAATT CAGA 33 Identification Size Nucleotidic sequence SEQ ID NO: Amplicon

(nuc.) (S' - S') (bp)

IMP-Primerl6 24 AAGAAGCTCATTTGTTAATTTAGA 34

IMP-Primerl7 22 GAAGTTCATTTGTTAACTCAGA 34

IMP-Primerl8 22 GAAGTTCGTTTGTTAATTCAGA 36

IMP-Primerl9 22 GAAGTTCATTCGTTAATTCAGA 37

Primers for OXA-48-like option 1; ^b Primers for OXA-48-like option 2

Table 7: Features of the probes selected for the detection of amplified bla _{ox A} 48- _Mke! bla _{v !M} , and b/ai _MP bacterial genes fragments

Identification Size Nucleotidic sequence SEQ ID NO: Fluorophore

(nuc.) (5' - 3')

OXA48-Probel 21 CATGCTGACCGAAGCCAATGG 38 Quasar 705™

OXA48-Probe2 21 CATGCTGACCGAGGCAAATGC 39 Quasar 705™

OXA48-Probe3 25 TTGCGATGAATATGGATATGCCCAC 40 Quasar 705™

OXA48-Probe4 25 TCGCGACAAATATGGATATGCCCAC 41 Quasar 705™

VIM-Probel 18 ACGTTCCCCGCAGACGTG 42 Quasar 705™

VIM-Probe2 18 ACGTTCCCCACAGACGTG 43 Quasar 705™

VIM-Probe3 18 ACGTTTCCCGCGGATGTG 44 Quasar 705™

IMP-Probel 24 TGAGAATTAAGCCACTCTATTCCG 45 CAL Fluor Red 610™

IMP-Probe2 24 TGAGAGTTAAGCCACTCTATTCCC 46 CAL Fluor Red 610™

IMP-Probe3 24 TGAGAGTTAAGCCATTCTATTCCA 47 CAL Fluor Red 610™

IMP-Probe4 24 TGAGAATTAAGCCACTCAATTCCA 48 CAL Fluor Red 610™

[000177] Analytical reactivity (inclusivitv) and analytical specificity (cross-reactivity) analysis of the selected primers and probes

[000178] Analytical reactivity (inclusivity) and analytical specificity (cross-reactivity) of the selected primers and probes was analysed in silico with the BLASTn software (Altschul SF et al., Journal of Molecular Biology (1990) 215:403-410). The software searched among all the DNA sequences available in the NCBI public databases (NR and WGS; NCBI Resource Coordinators. (2016). Database resources of the National Center for Biotechnology Information. Nucleic Acids NCBI Resource Coordinators. (2016). Database resources of the National Center for Biotechnology Information. Nucleic Acids Research 44(Database issue):D7-D19. http://doi.Org/10.1093/nar/gkv1290).

[000179] For the gene bla ₀ x _A -48-n _ke , the sequences were obtained from the public databases (270 sequences from NCBI (NR) and 184 sequences from partially assembled genomes (WGS)). Short sequences that did not encompass all the oligonucleotides hybridization regions and sequences under 50% of the complete gene were excluded from the analysis. Overall, 430 sequences of b/a _{ox A} -48-u _ke from group A (targeted group) were recovered. The results of in silico inclusivity analysis showed that 429/430 sequences are 100% identical with the selected oligonucleotides set.

[000180] For the gene fa/o _{v !M} , the sequences were obtained from the public databases (484 sequences from NCBI (NR) and 244 sequences from partially assembled genomes (WGS)). Short sequences that did not encompass all the oligonucleotides hybridization regions and sequences under 50% of the complete gene were excluded from the analysis. The results of in silico inclusivity analysis showed that 724/728 sequences are 100% identical with the selected oligonucleotides set. Sequences with mismatches originate from VIM-7/VIM-61 variant, which are not targeted by the assay.

[000181] For the gene bla _mP , the sequences were obtained from the public databases (407 sequences from NCBI (NR) and 177 sequences from partially assembled genomes (WGS)). Short sequences that did not encompass all the oligonucleotides hybridization regions and sequences under 50% of the complete gene were excluded from the analysis. The results of in silico inclusivity analysis showed that 221 /584 sequences are 100% identical with the selected oligonucleotides set. Representatives of variants having sequences presenting mismatches were tested in vitro which confirmed that the analytical sensitivity was not affected by the presence of one or more mismatches.

[000182] PCR testing

[000183] PCR amplifications were carried out to test the primers and probes under real-life multiplex conditions for simultaneous detection of OXA-48/VI M/IMP genes. The composition of the PCR mix was in accordance with the materials and concentrations indicated hereinbefore in the section“Kits”. The primers and probes that were used are selected from the combinations presented in Table 1 , Table 2 and Table 3. [000184] The PCR efficiency and the dynamic range for each target of the OXA-48/VIM/IMP multiplex were determined.

[000185] PCR efficiency is defined as the measurement of the amplification yield after each PCR cycle. The dynamic range determines the concentration variation of the target for which the slope of the calibration curve remains linear and with an R ² > 0.98. Six concentrations were tested, these concentrations covering six logs, i.e. 10 ⁶ , 10 ⁵ , 10 ⁴ , 1000, 100 and 10 copies of genomic DNA from K. pneumoniae CCRI-22264 (b/a _{ox A} -i _8i ), CCRI-19585 (b/a _v , _M -i) and CCRI- 19582 (b/ai _MP -i) (5 replicates for each dilution).

[000186] The dynamic range of the multiplex for b/a _OXA-48/ vi _M/iMP revealed to be linear from 10 to 10 ⁶ copies with genomic DNA (including chromosomal and plamidic DNA) from the strains

K. pneumoniae CCRI-22264 (b/a _{ox A.181} ), CCRI-19585 (b/a _v IM-I ) and CCRI-19582 (b/a, _Mp -i) (Figures 8A-8C). The PCR efficiencies were 94.3% with genomic DNA from K. pneumoniae CCRI-22264 (b/a _{ox A} -isi), 94.1 % with genomic DNA from K. pneumoniae CCRI-19585 (b/a _ViM -i) and 97.6% with genomic DNA from K. pneumoniae CCRI-19582 (b/ai _Mp -i). R ² values were greater than 0.99 for the 3 targets. All these data were considered entirely satisfactory, at least in terms of PCR efficiency and dynamic range.

[000187] The limit of detection (LOD) was subsequently determined for each of the targets in presence of 1 .25, 2.5, 5, 10, 15, 20 and 25 copies of genomic DNA from K. pneumoniae CCRI- 22264 (b/a _0XA - iai), CCRI-19585 (b/a _ViM -i) and CCRI-19582 (b/ai _Mp -i). The limit of detection was also determined in the presence of 3.1 , 6.25, 12.5, 25, 50, 100, 150, 200 copies of plasmidic DNA only containing the b/a _0XA -i _8i , b/a _ViM -i and bia _Mp- genes. Fifteen replicates for each quantity of genomic DNA or plasmidic DNA were tested to establish the LODs. The results obtained are shown in Table 8.

Table 8: Limit of detection (LOD) of the targets in the b/a ₀ x _A -48 _/ viiwi _MP multiplex assay

[000188] The cross-reactivity of the b/a ₀ x _A -48 _/ vi _M/iMP multiplex assay was evaluated using crude lysates (~ 1 .5x10 ⁸ CFUs) or genomic DNA between 4 ng (~ 4x10 ⁵ genome copies) and 12 ng (~ 1 .2x10 ⁶ genome copies) from a range of bacterial species (64) possessing other carbapenemase genes or other antibiotic resistance genes (23), OXA-48-like genes having a deletion in their sequence (4), and bacterial species found in the intestinal flora (34). Recombinant Escherichia coli strains containing bla ₀ x _A -247, bla ₀ x _A -405, and bla ₀ x _A -438 genes were also tested. The list of species targeted for cross-reactivity tests is presented in Table 9. None of these 64 strains were detected with the b/a ₀ x _A -48 _/ vi _M/iMP multiplex assay.

Table 9: Bacterial species used for cross-reactivity tests with the b/a ₀ x _A -48 _/ vnwi _MP multiplex assay

[000189] Inclusivity of the b/a ₀ x _A -48 _/ vi _M/iMP multiplex assay was also tested using genomic DNA of eight strains other than those for which the LOD was determined, these strains carrying different variants of the bla ₀ x _A -48-n _k e, d/a _V IM and bla _lMP genes. Each of the targeted strains was amplified with an amount of genomic DNA corresponding of 2 to 4 times the LOD of the control strains carrying each gene. Of the eight strains targeted, four were amplified 10 times out of 10 (10/10) with an amount of genomic DNA corresponding to 2X the LOD, two other strains were amplified with 3X the LOD and the last two strains were amplified with 4X the LOD. The list of strains carrying genes bla ₀ x A-48-nke, d/a _v IM and bla _lMP for which genomic DNA was assessed for inclusivity testing is presented in Table 10.

Table 10. Results of inclusivity testing for the b/a ₀ x _A -48 _/ vi _M/iMP multiplex assay with genomic

DNA of strains carrying genes b/a ₀ x _A -48- _Mke> blay _!M and bla _{M p} used at concentrations close to the LOD.

[000190] Furthermore, inclusivity of the b/a ₀ x _A-48/ vi M/IMP multiplex assay was also tested with plasmidic DNA from 20 plasmids carrying different gene variants of b/a ₀ x _A-48 -ii _ke , d/a _{v IM} and bla _lMP. Each of the plasmids was amplified with a quantity of plasmidic DNA corresponding to 2.5X LOD and, if necessary, 4X and 5X the LOD of the control plasmids carrying each gene. The results and list of plasmids carrying genes b/a ₀ x _A-48 -ii _ke , d/a _{v IM} and bla _MP for which plasmidic DNA was assessed for inclusivity testing is presented in Table 11. With the exception of the three plasmids carrying the genes the 17 other plasmids tested positive

(10/10) with 2.5 X LOD at 95%.

Table 11. Results of inclusivity testing for the bla _ox A-48/VIM/IMP multiplex assay with plasmid DNA of plasmids carrying genes b/a ₀ x _A -48- _Mke> bla _{v !M} and bla _mp -

[000191] Clinical performance [000192] The clinical performance of the b/a ₀ x _A -48 _/ vi _M/iMP multiplex assay was next tested with biological specimens. The biological specimens were obtained from the microbiology laboratory of different hospitals in the province of Quebec. These biological specimens were 320 residual swabs from anonymous patients tested with standard of care culture methods, of which 200 specimens were rectal swabs. [000193] Comparison of test results obtained for the b/a ₀ x _A -48 _/ vi _M/iMP multiplex assay compared with those of the reference culture methods are shown in Table 12. The results obtained were compiled to evaluate the overall clinical performance of the bla _ox A-48/VIM/IMP multiplex assay. The composition of primers and probes of the b/a ₀ x _A -48/viM/iMP multiplex assay is presented in

Table 13.

Table 12: Clinical performance of the b/a ₀ x _A -48 _/ viiwi _MP multiplex assay compared to standard of care culture methods

a The seven positive swabs were b/a ₀ xA-48-iike- ^b Two discordants were obtained. One was positive bla _{0 A} -48-n _ke and the other was positive for bla _WM with the PCR assay while the culture was negative.

Table 13: Primers and probes composing the b/a ₀ x _A -48 _/ vi _M/iMP multiplex assay

a Pool of blaIMP forward primers: IMP-Primer1 to 10; and blaIMP reverse primers: IMP-Primer1 1 to 19.

[000194] There were 2 discordant in the study and these remain discordant after a second run of the PCR (Table 12). A positive bla _{0 A} 48-ii _ke signal was obtained by PCR with one swab while the corresponding culture was negative. However, a previous specimen from this patient had been found positive for bla _{0 A} 48-ii _e with the culture, suggesting that this patient was positive for b/a _0XA 48- _Mke - The second discordant was a swab that was found positive for b/a _V|M with the PCR assay while the culture was negative.

[000195] We can thus conclude that the clinical performance of the multiplex assay is excellent with a clinical sensitivity of 100% and a clinical specificity 99.4%. [000196] Example 2: Multiplex assay for simultaneous detection of OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes in human subjects using a stand-alone diagnostic system

[000197] A kit for a b/a ₀ x _A -48 _/ vi _M/iMP multiplex assay was designed in accordance with the features defined hereinbefore in the section “Kit” hereinabove. The kit was assembled in a fluidic cartridge for use in the automated diagnostic platform revogene™ (GenePOC™, Quebec City, Canada).

[000198] The clinical performance of the b/a ₀ x _A -48 _/ vi _M/iMP multiplex kit and its associated multiplex assay were tested using biological specimens obtained from the microbiology laboratory of different hospitals in the province of Quebec. These biological specimens were 21 residual rectal swabs from anonymous patients tested with standard of care culture methods of each hospital.

[000199] Table 14 provides the test results obtained with the fluidic cartridge multiplex assay kit with those of the standard of care culture methods. In this table, specimens with NEG status (i.e. negative) for the culture method or the present kit/assay were exempt of any of the b/a _{ox A-48,} bla _{v im} or bla _lMP genes _. Positive samples are identified in the table by the gene for which the specimen is found positive (e.g. OXA, VIM or IMP). As can be appreciated, the results obtained using the fluidic cartridge multiplex assay kit match those of the standard of care culture methods, the assay further identifying presence of clinically significant carbapenemase- producing bacteria in specimens #33 and #34 while these were not detected by standard of care culture methods. These results confirm the sensitivity and robustness of the kit and assay according to the present invention.

Table 14. Detection of resistant bacteria using a fluidic cartridge compared with standard of care culture methods

[000200] Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein, and these concepts may have applicability in other sections throughout the entire specification. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

[000201] The singular forms“a”,“an” and“the” include corresponding plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a primer" includes one or more of such primer, and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.

[000202] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, concentrations, properties, and so forth used in the specification and claims are to be understood as being modified in all instances by the term“about”. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the present specification and attached claims are approximations that may vary depending upon the properties sought to be obtained. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the embodiments are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors resulting from variations in experiments, testing measurements, statistical analyses and such.

[000203] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the present invention and scope of the appended claims.