Field of the Invention This invention relates to a method for transporting a nucleic acid derivative across a membrane by binding the nucleic acid to a receptor that utilizes molecular recognition, and to receptors for binding nucleic acid derivatives.

Background of the Invention

The desirability of recognizing and transporting nucleic acid derivatives across a membrane has become increasingly important. Nucleic acid pharmaceuticals, including nucleotide analogues, antisense nucleic acids and ribozymes, have been proposed for a number of diseases, including viral infections.

A central problem has been the difficulty of transporting highly charged nucleic acid derivatives across membranes to their targets. Approaches that have been tried include constructing methylated phosphonates and sulfur containing nucleic acids such as dithioates, phosphorothioates, and other methods that suppress either the polarity or the nuclease susceptibility of the phosphodiester linkage of the nucleic acid derivatives. Others have attempted to develop selective carriers for nucleic acid related compounds.

Early experiments reported the binding and transport of the nucleotide mono- and di-phosphates AMP and ADP across a liquid membrane using a lipophilic diammonium salt as a receptor. Tabushi et al. , J. Am. Chem. Sci. 102: 1744-1745 (1980). More recently, Li and Diederich, J. Orq. Chem. 57:3449-3454 (1992), have demonstrated the transport of nucleotide triphosphates across a liquid membrane using certain polyammonium carriers. Experiments also have been reported showing transport through a liquid membrane of

nucleosides and analogues using hydrophobic recognition agents that interact with the nucleoside substrates via complementary base pairing. Furuta et al., J. Am. Chem. Soc. 113:4706-4707 (1991). Transport through a liquid membrane of GMP and other nucleotide monophosphates using sapphyrin as a carrier which undergoes phosphate binding with the nucleotide monophosphates, has also been described. Furuta et al. , J. Am. Chem. Soc. 113:6677-6678 (1991). Receptors which bind to mononucleotides that utilize salt bridging interactions of a guanidinium moiety on the receptor to the phosphate moiety on the mononucleotide have been described. Schmidtchen, F.P., Tetrahedron Letters 3^:4493-4496 (1989). Receptors which bind to the nucleotide monophosphate GMP using H bonding and salt bridging have also been reported. Furuta et al. , J. Am. Chem. Soc. 113: 978-985 (1991). A receptor has also been synthesized which binds to the nucleosides adenosine and deoxyadenosine by hydrogen bonding, chelation and aromatic stacking and is able to transport the compounds across a liquid membrane. Benzing et al. , Science 242:266-268 (1988). Binding to the nucleotide monophosphate AMP by receptors that utilize H bonding, salt bridging and aromatic stacking has also been demonstrated. Galan et al . , Tetrahedron Letters 32:1827-1830 (1991).

As far as is known, however, no one has developed a widely accepted feasible working transporter for nucleic acid derivatives. Furthermore, no one has reported the development of a receptor which binds to oligonucleotides, as opposed to nucleosides or nucleotide mono-and di-phosphates.

Summary of the Invention The present invention provides a method of transporting a nucleic acid derivative across a membrane by binding on one side of the membrane the nucleic acid derivative to a receptor. The receptor uses salt bridging, aromatic stacking, H bonding and chelation to recognize the nucleic

acid derivative. The bound nucleic acid derivative is then released on the other side of the membrane. The membrane can be a liquid membrane, a cell membrane, or part of the blood/brain barrier. The types of nucleic acid derivatives that can be bound by the receptor include an oligonucleotide, a nucleotide and analogues thereof. The nucleic acid derivatives may be linked to a different dosing material, and thus this dosing material is transported across the membrane along with the nucleic acid derivative.

This invention also pertains to a method of transporting an oligonucleotide across a membrane by binding on one side of the membrane the oligonucleotide through molecular recognition to a receptor. The bound oligonucleotide is then released on the other side of the membrane. The membrane can be a liquid membrane, a cell membrane, or part of the blood/brain barrier.

This invention also includes a method of binding a nucleic acid derivative by contacting the nucleic acid derivative with a receptor. The receptor uses salt bridging, aromatic stacking, H bonding and chelation to recognize the nucleic acid derivative.

This invention also includes a method of binding an oligonucleotide by contacting the oligonucleotide with a receptor. The receptor uses molecular recognition to recognize the oligonucleotide.

This invention also relates to a method for diagnosing a disease in which the pathology of the disease involves release of a nucleic acid derivative into a medium. The medium is put into contact with a receptor having a high affinity for the nucleic acid derivative and the nucleic acid derivative is allowed to bind to the receptor. The medium includes a test solution or suspension, or biological fluids, e.g. , urine, blood, saliva, tears, sweat, semen, cytoplasm and nucleoplasm.

This invention further relates to a method for monitoring the presence of a nucleic acid derivative in a medium by contacting the medium with a receptor having a high affinity for the nucleic acid derivative and allowing the nucleic acid derivative to bind to the receptor.

This invention also includes a receptor with at least one pair of H bonding sites which result in chelation, at least one salt bridging site and at least one aromatic stacking site, to allow a nucleic acid derivative to be bound to the receptor. The nucleic acid derivative is able to be released from the receptor under preselected conditions.

This invention further includes a receptor with a molecular recognition site that allows an oligonucleotide to be bound to the receptor, and to be released therefrom under preselected conditions.

This invention also pertains to a receptor for binding a nucleic acid derivative which is a compound having the following formula:

I:

AM AM ₂

\ /

AS

1

AL— G— BLy

1

BS

/ \

BM_ BM ₂

G is an anion complement. An a ion complement includes a phosphate, phoεphorothioate, phosphorodithioate, sulfate, or

any other anionic species which forms the backbone of a nucleic acid derivative. AL and BL are linkers. AL can be the same as, or different from, BL. y is an integer selected from 0 and 1. Preferably, y = 1. When y = 0, BL is replaced with an organic or inorganic group that does not substantially interfere with the binding capacity of the receptor to nucleic acid derivative. AS and BS are aromatic spacers and can be the same as or different from each other. AM.., AM ₂ , BM.. and BM ₂ are H bonding complements and can be the same as or different from each other.

Preferably, G is a guanidinium derivative, and most preferably a 1,3 disubstituted guanidinium. Preferably, AL and BL are compounds of the formula:

AS and BS are aromatic compounds. Preferably, they are 3,6 disubstituted carbazoles for binding purines, and 2,7 disubstituted naphthalenes for binding pyrimidines. AM ,

AM ₂ , BM and BM _? preferably binding are imideε for binding purines and lactams for binding pyrimidines.

This invention also pertains to a receptor for binding a nucleic acid derivative which is a compound having the following formula:

I

AG — CL — BG

AG and BG are anion complements and can be the same as or different from each other. CL is a linker, S is an aromatic spacer, and AM and AM_ are H bonding complements and can be the same as or different from each other.

This invention further relates to a receptor for binding a nucleic acid derivative which is a compound having the following formula: •—

BM ₂

AG and BG are anion complements; AL, BL and CL are linkers wherein CL is one class of linker and AL and BL are another class, and where AL and BL can be the same as or different from each other; AS, BS and CS are aromatic spacers and can be the same as or different from each other; AM., AM„,

BM ., , B—M ₂ , _\' C _"" M _"l , ^an d- CM_ are H bonding complements and can be the same as or different from each other; and n is an integer selected from 0 to 10.

This invention also relates to a receptor for binding a nucleic acid derivative which is a compound having the following formula: Mi AM s

S is an aromatic spacer and AM and AM_ are H bonding complements.

In the receptor formulas given supra the same designation, such as AM , indicates the same materials in each formula where that designation appears.

It is an object of the invention to provide a receptor which can transport an oligonucleotide across a membrane.

It is another object of the invention to provide a

receptor which exhibits high affinity for nucleic acid derivatives.

It is yet another object of the invention to provide a receptor which exhibits high selectivity for particular nucleic acid derivatives.

It is yet another object of the invention to provide a receptor having improved binding properties to nucleic acid derivatives when compared to known receptors.

It is yet another object of the invention to provide a receptor which uses molecular recognition to selectively complex with a nucleic acid derivative.

It is yet another object of the invention to provide a receptor which uses H bonding, salt bridging, aromatic stacking and chelation to selectively complex with a nucleic acid derivative.

It is yet another object of the invention to provide a receptor that is able to bind to oligonucleotides which are at least 75 nucleotides long.

It is yet another object of the invention to provide a receptor that is capable of monitoring the presence of a nucleic acid derivative in a variety of different media.

It is yet another object of the invention to provide a receptor which is capable of efficiently transporting a nucleic acid derivative across a membrane.

It is yet another object of the invention to provide a receptor which is capable of transporting therapeutic nucleotides, including nucleotide analogues, antisense oligonucleotides and nucleic acid enzymes, across a membrane

It is yet another object of the invention to provide a receptor which is capable of efficiently transporting a nucleic acid derivative across a membrane as a means for transporting a dosing material that is attached to the nucleic acid derivative, across the membrane.

It is yet another object of the invention to provide a receptor which is capable of transporting anti-tumor agents,

dyes, peptides, hormones, antibodies, antibiotics, antisense oligonucleotides and nucleic acid enzymes across a membrane.

It is yet another object of the invention to provide a receptor useful for diagnosing diseases that result in release of a nucleic acid derivative intracellularly or into body fluids or parts such as the urine, blood, saliva, tears, sweat, or semen.

Still another object of the invention is to provide a receptor for treating diseases which require transport across a cell membrane of a therapeutic nucleic acid derivative or other type of material which can be attached to a nucleic acid derivative.

It is a feature of this invention that a large number of diagnostic tests and/or drug treatments can be carried out using the transporter materials of this invention. Such transporter materials can be designed to enhance transport across a membrane or binding of specific predetermined nucleotide containing materials or in some cases of any nucleotide containing material.

Detailed Description

The prior art reveals the difficulties that have been encountered in transporting charged nucleic acid derivatives across membranes. The present invention describes receptors that exhibit both a high affinity and selectivity in binding their nucleic acid targets by utilizing various molecular recognition interactions.

According to the invention, a method is provided for transporting a nucleic acid derivative across a membrane by binding the nucleic acid derivative through molecular recognition to a receptor that uses H bonding, salt bridging, aromatic stacking and chelation to recognize the nucleic acid derivative. The bound nucleic acid derivative is then allowed to be released on the other side of the membrane.

By nucleic acid derivative it is meant an oligonucleotide, a nucleotide, or analogues thereof. By oligonucleotide it is meant a compound containing more than one nucleotide. By analogue it is meant a nucleic acid derivative which contains one or more variant nucleotides. Analogues include sequence analogues and isotope-labeled analogues. The nucleic acid derivative can be DNA or RNA or any modified nucleic acid containing a modified sugar or base or internucleotide linkage. Nucleic acid derivatives include the nucleotide related phosphorothioates and phosphorodithioates. The size of the nucleic acid derivative can range from a single nucleotide to any length that can be feasibly transported across a membrane. Depending upon the contemplated use, different size nucleic acid derivative molecules will be targeted. Preferably, the size range is 1-500 nucleotides long.

The nucleic acid derivative may be linked to a different dosing material. In this way, the dosing material is transported along with the nucleic acid derivative across the membrane. The linkage between the nucleic acid derivative and the dosing material can be arranged such that the dosing material is released or clipped from the nucleic acid derivative upon transport across the membrane. For example, intracellular esterases can clip the dosing material from the nucleic acid derivative. By dosing material it is meant a material which is desired to be transported across the membrane. Dosing materials include anti-tumor agents, dyes, peptides, hormones, antibodies, antibiotics, antisense oligonucleotides, nucleic acid enzymes, and any other material that is desired to be transported. Examples of anti-tumor drugs are intercalating anti-tumor drugs, groove binding anti-tumor drugs and nucleotides or analogues which form triple helices. Anti-tumor drugs include adriamycin, cis-platinum, mitomycin, calichaemycin, fluorodeoxyuridine, neocarzinostatin, CC-1065 (NSC 298223) and Hoescht 33528 (a

product of Hoescht AG, Frankfurt, Germany). Examples of dyes are fluorescein, rhodamine, acridine, ethidium and Congo Red. Examples of peptides are nuclear localization sequences, angiotension, ricin, bradykinin and oxytocin. Examples of hormones are steroids, cortisone, insulin and human growth hormone. Examples of antibiotics are calichaemycin and tetracycline. Antisense oligonucleotides include sequences complementary to mRNA and viral RNA. Examples of antisense oligonucleotides are ACACCCAATTCTGAAAATGG (Sequence I.D. No. 1, inhibits replication of HIV), d(AATGGTAAAATGG) (Sequence I.D. No. 2, inhibits replication of Rous sarcoma virus), and CATTCAAATGGTTTGCCTGC (Sequence I.D. No. 3, inhibits replication of influenza virus). Nucleic acid enzymes include ribozymes. Examples of ribozymes are Group I self-splicing intron, Group II self-splicing intron and the hammerhead domain of RNA catalysis.

Attachment of the dosing material to the nucleotide derivative can be accomplished in many ways. For example, the dosing material can be attached to ApA by a variety of different types of linkages: (i) ApA can be modified with either an amino tether or 5 \'-deoxy-5\'-amino adenosine at the 5\'-nucleotide. An amino tether can be introduced during the synthesis of the oligonucleotide using commercially available phosphoramidite reagents (CLONTECH Laboratories, Palo Alto, CA) . An amide bond is then made with a carboxylic acid of the dosing material. This reaction is illustrated by: 1 equivalent of a protected Peptide-COOH + l equivalent

H_N ApA + 3 equivalents EDC in a minimum amount of H ₂ 0 > Peptide-C(0)NH ApA. EDC is l-(3-dimethylaminopropyl)-3-ethylcarbodiimide methiodide. Alternatively, a carboxyl terminated ApA derivative is coupled with an amino group of the dosing material. The carboxylic acid can be introduced during the synthesis of the

oligonucleotide using, for example, a phosphoramidite reagent of the following formula:

wherein iPr is isopropyl. (ii) An ester linkage can be prepared with a hydroxyl group and a carboxylic acid on either the ApA or dosing material. (iii) A phosphodiester, thioate, or dithioate linkage between the dosing material and the ApA can be introduced. (iv) A disulfide linkage between

H_N ApA and a dosing material having a thiol (-SH), can be prepared using SPDP (a crosslinking reagent sold by Pierce Chemical Co., Rockford, Illinois).

Also, essentially any suitably protected drug can be attached to the oligonucleotide by preparation of its phosphoramidite and coupling this derivative to the oligonucleotide, to give a compound of the formula:

O^ I iPr ₂ N ^OCH ₂ CH ₂ CN

wherein R is the drug and iPr is isopropyl. The drug is thus attached via a phosphodiester, phosphorothioate, phosphorodithioate, or similar type linkage.

All of the preceding linkages between the dosing material and the ApA are "labile" i.e., they may be cleaved after delivery to the target. More resistant linkages, e.g. , ethers, amides or carbon-carbon, are prepared if an increase in the in vivo lifetime of the conjugate is desired.

Membranes include liquid membranes, cell membranes and the lipid-like blood/brain barrier. By liquid membrane it is meant a layer of one liquid between two layers of another liquid which is immiscible with the first liquid. Liquid membranes may consist of a hydrophobic inner layer with water comprising the outer layers. Examples of a hydrophobic inner layer include chloroform, benzene, carbon tetrachloride, liquid hydrocarbons and esters of fatty acids. By cell membrane it is meant any intracellular or extracellular membrane. Cell membranes may be derived from the cells of any organism, including plants, animals, fungi, bacteria and viruses. Examples of cell membranes include lipid bilayer membranes, nuclear membranes, endoplasmic reticulum and Golgi bodies. By blood brain barrier it is meant brain capillary endothelial cells with continuous tight junctions and with no detectable transendothelial pathways. Such structures provide a cellular barrier between the blood and the interstitial fluid, thus controlling the exchange of materials between the blood and the central nervous system.

By binding through molecular recognition it is meant that the receptor is tailored to a specific target or class of targets so as to permit non-covalent molecular binding interactions to occur specifically with that target. Molecular recognition of specific parts of compounds thereby allows for selective complexation. Specific parts of nucleic acid derivatives that may be used for molecular recognition include the purine and pyrimidine heterocyclic nuclei of nucleic acids, the phosphate backbone of the nucleic acid and the flat surface of the nucleic acid. Preferably, the receptor employs multiple contact sites. Molecular

recognition interactions include H bonding, chelation, salt bridging and aromatic stacking.

By H bonding it is meant an intermolecular force arising from two heavy atoms, one of which has a non-bonded pair of electrons and the other of which has a H atom. In a H bond, the distance between the two non-H atoms is between 2.5 and 3.3 Angstroms, and the idealized geometry between the heavy atom, the H and the other heavy atom is 160° to 200°. Preferably, the receptor has a cleft-like shape permitting formation of optimal hydrogen bonds between the concave surface of the receptor and the convex surface of the nucleic acid derivative. By chelation it is meant simultaneous H bonding to two edges of the nucleic acid derivative.

By salt bridging it is meant the close contact of two functional groups of opposite charge, often involving H bonds. By close contact it is meant the approximate distance of a H bond, i.e., 2.5 to 3.3 Angstroms. Examples of salt bridging include a carboxylate in contact with an ammonium ion, a phosphate in contact with a guanidinium ion, a carboxylate in contact with a guanidinium ion, and a phosphate in contact with an ammonium ion.

By aromatic stacking it is meant a weak intermolecular force arising from two aromatic flat surfaces that are arranged in a parallel manner at approximately 3.5 Angstroms from each other. Examples of such weak intermolecular forces include van der Waals interactions, dipole-dipole interactions, dipole induced dipole interactions and charge transfer interactions.

The binding of the nucleic acid derivative to the receptor preferably takes place in essentially instantaneous reactions. Since the binding of the nucleic acid derivative to the receptor is weak and reversible, the nucleic acid can be released from the receptor. Release of the bound nucleic acid derivative on the other side of a membrane is generally a function of the concentration gradient of the nucleic acid

derivative. Thus, uptake and release of the nucleic acid derivative can occur until the concentration of the nucleic acid derivative is equivalent on both sides of the membrane. These reactions are essentially instantaneous and generally require only a few seconds. Preferably, ten minutes should be allowed to ensure complete uptake, transfer and release. These reactions can occur at room temperautre or any other temperature in which the materials are not adversely affected or destroyed.

Thus, in the method of transporting a nucleic acid derivative across a membrane, the nucleic acid is bound on one side of the membrane by salt bridging, aromatic stacking, H bonding and chelation. Such binding is accomplished by having the receptor at a concentration sufficient to bind each of the nucleic acid derivative molecules that are desired to be transported. Preferably, the receptors are present at a concentration that is comparable to the nucleic acid derivative that is desired to be bound or transported. Any suspending vehicle in which the materials are soluble may be used, e.g. , H_0 or organic solvents, or combinations thereof. The bound nucleic acid derivative is then released on the other side of the gradient as a function of concentration. The receptor thereby becomes free to repeat the binding to another nucleic acid derivative molecule. All transports can be designed to transport gross amounts or predetermined amounts of nucleic acid derivatives.

A method of transporting an oligonucleotide across a membrane by binding on one side of the membrane the oligonucleotide through molecular recognition to a receptor is also provided. The bound oligonucleotide is then released on the other side of the membrane. The oligonucleotide may be linked to a different dosing material such that the dosing material is transported along with the oligonucleotide across the membrane. The membrane can be a liquid membrane, a cell membrane, or part of the blood/brain barrier. Molecular

recognition includes salt bridging, aromatic stacking, H bonding and chelation. The receptor uses any one or more of different types of molecular recognition interactions to bind the oligonucleotide.

A method of binding a nucleic acid derivative by contacting the nucleic acid derivative with a receptor can be carried out using the receptors of this invention. The receptor uses H bonding, salt bridging, aromatic stacking and chelation to recognize the nucleic acid derivative. In some cases, the receptors may be mounted on solid supports and a solution of the nucleic acid derivative passed thereover, whereupon the nucleic acid becomes bound via the receptor to the solid support. The nucleic acid derivatives that becomes bound to the receptors can be tested while still attached to the receptors, by qualitative or quantitative means, including radioactive or fluorescent measurements. All tests can be designed to bind gross amounts or predetermined amounts of nucleic acid derivatives.

A method of binding an oligonucleotide by contacting the oligonucleotide with a receptor can also be carried out using the receptors of this invention. The receptor uses molecular recognition to recognize the oligonucleotide. The receptor uses any one or more of different types of molecular recognition interactions to bind the oligonucleotide.

A method for diagnosing a disease in which the pathology of the disease involves release of a nucleic acid derivative into a medium can be carried out using the receptors of this invention. The medium is put into contact -with a receptor having a high affinity for the nucleic acid derivative in an amount effective to assay, and the nucleic acid derivative is allowed to bind to the receptor. The receptor includes compounds of Formulas I-XII shown below.

By medium it is meant to include any material into which the nucleic acid derivative may be released, excreted or transported. The medium may be intracellular or

extracellular. The medium includes any biological fluid, or test solution or suspension of an aqueous, organic or inorganic liquid. Examples of biological fluids include the cytoplasm, nucleoplasm, urine, blood, saliva, tears, sweat and semen.

By a receptor having a high affinity for the nucleic acid derivative it is meant a receptor which binds to the nucleic acid derivative through molecular recognition such that the bound nucleic acid derivative can be effectively assayed. Preferably, the affinity of the receptor is high enough to bind to a nucleic acid derivative when the nucleic acid derivative is at a concentration that exists in biological systems.

A method for monitoring the presence of a nucleic acid derivative in a medium by contacting the medium with a receptor having a high affinity for the nucleic acid derivative in an amount effective to assay and allowing the nucleic acid derivative to bind to the receptor can be carried out using the receptors of this invention. The receptor includes compounds of Formulas I-XII shown below.

This invention also includes a receptor with at least one pair of H bonding sites which result in chelation, at least one salt bridging site and at least one aromatic stacking site, to allow a nucleic acid derivative to be bound to the receptor. The nucleic acid derivative is able to be released from the receptor under preselected conditions. The requirements for the various molecular recognition interactions- are the same as described supra. Each pair of H bonding sites results in chelation of a base on a nucleic acid derivative. In embodiments with more than one pair of H bonding sites, each pair results in chelation of a different base. The different bases can be on the same nucleic acid derivative or on different nucleic acid derivatives.

A receptor with a molecular recognition site that allows an oligonucleotide to be bound to the receptor, and to be

released therefrom under preselected conditions is also provided. The receptor uses any one or more of different types of molecular recognition interactions to bind the oligonucleotide.

A receptor in accordance with this invention for binding a nucleic acid derivative comprises a compound of the formula:

^I: AM_! AM ₂

\ /

AS

1

AL— G— BLy

BS

/ \

B ₁ BM ₂

G is an anion complement. An anion includes a phosphate, phosphorothioate, phosphorodithioate, sulfate, or any other anionic species used for the backbone of a nucleic acid derivative. AL and BL are linkers. AL can be the same as, or different from, BL. y is an integer selected from 0 and 1. Preferably y = 1. When y = 0, BL is replaced with any organic or inorganic group that does not substantially interfere with the binding capacity of the receptor to nucleic acid derivatives. AS and BS are aromatic spacers and AM , A ₂ , BM ₁ and BM_ are hydrogen bonding complements.

By G, an anion complement, it is meant a moiety that is of an opposite charge to a functional salt bridging site on the nucleic acid derivative and which is able to be positioned at a distance of 2.5 to 3.3 Angstroms to the nucleic acid derivative salt bridging site. G is thus able to bind to the phosphate, phosphorothioate, phosphorodithioate, sulfate, or other anionic species used for the backbone of the nucleic acid derivative, through a

salt bridge interaction. Preferably, G is a 1,3 disubstituted guanidinium derivative of the formula:

The free valences attach to AL and BL, as shown in the formula, supra. R. and R ₂ include secondary and tertiary alkyl groups or aryl and heterocyclic moieties that do not substantially interfere with the binding capacity of the receptor to nucleic acid derivative. The alkyl or aryl groups, which are attached to AL or BL and the guanidinium group of G, are no more than 8 Angstroms apart. Preferably, R. and R ₂ are CH ₂ CH ₂ or substituted or unsubstituted phenyl, naphthyl, pyridyl, furanyl, isoquinolyl or anthracyl. R ₃ and R. include H (hydrogen) or substituted or unsubstituted alkyl or aryl groups that do not substantially interfere with the binding capacity of the receptor to nucleic acid derivative. Preferably, R_ and R. are H, methyl, ethyl, phenyl or naphthyl. Most preferably, G is a tetrasubstituted bicyclic guanidinium where R-, R ₃ and R ₂ ,R, are of the formula: n

In such an embodiment, G is shown by the formula:

H H * ^~

The free valences attach to AL and BL. Z includes CH ₂ , NH and 0 (oxygen). Preferably, Z is CH ₂ . R ₅ includes

secondary and tertiary alkyl groups or aryl and heterocyclic moieties that do not substantially interfere with the binding capacity of the receptor to nucleic acid derivative. Preferably, R_ is CH ₂ , CH ₂ CH ₂ or substituted or unsubstituted phenyl, naphthyl, pyridyl, furanyl, isoqumolyi or anthracyl. Any other anion complement that does not substantially interfere with the binding capacity of the receptor to nucleic acid derivative may also be used.

By AL and BL linkers is meant a functional group which links G, the anion complement, to the AS and BS aromatic spacers, respectively. The linkers are a compound of the formula:

The free valence on T attaches to G, and the free valence on D attaches to BS or AS, as shown in the formula supra. F includes C (carbon), S (sulfur), P (phosphorous), N (nitrogen) and O (oxygen). T includes NH, O, CH ₂ , S, NH-R, O-R, CH-R, CR ₂ and S-R, wherein R has a free valence and includes secondary and tertiary alkyl groups or aryl and heterocyclic moieties that do not substantially interfere with the binding capacity of the receptor to nucleic acid derivative. Preferably, R is CH ₂ CK ₂ or substituted or unsubstituted phenyl, naphthyl, pyridyl, furanyl, isoqumolyi or anthracyl. For example, NH-R includes:

which is a histidine derivative, but any other amino acid derivative would also work, such as glycine or alanine. Q includes one or two oxygen atoms, S, one or two H atoms, or, for some F\'s, e.g. , oxygen, there may be no Q. D includes C _; .-C ₁₀ alkyl and aryl groups that are disubstituted, e.g. , phenyl, naphthyl, pyridyl and pyrrole. Any other element that does not substantially interfere with the binding capacity of the receptor to nucleic acid derivatives may also be used in the above linker compounds, n is an integer selected from 1 to 10.

Preferred linkers include compounds of the formula:

0

Ii

-0-C-CH ₂ -

O

I!

-N-C-CH - H

O

O H II -N-C-0-CH ₂ -

O

H II H -N-C-N-CH ₂ -

-CH ₂ -S-CH ₂ -

O Ii

-CH ₂ -S-CH ₂ -

O

II -CH ₂ -S-CH ₂ -

O

The most preferred linker is shown by the formula:

By AS and BS aromatic spacers it is meant an aromatic compound with a flat surface that is able to be positioned in a parallel configuration at a distance of about 3.5 Angstroms from the flat surface of the nucleic acid derivative. The aromatic spacer is thus able to bind to the nucleic acid derivative through an aromatic stacking interaction. The aromatic spacers also provide the scaffolding for the AM , AM ₂ , BM ₁ and BM ₂ H bonding complements. The aromatic spacer is an aromatic compound of the formula: o

6-9A

wherein W is an aromatic moiety and X are groups attached to W such that a space of 6 to 9 Angstroms exists between the groups X, and the bonds of groups X to the aromatic moiety diverge at 90° to 180°. Any polynuclear aromatic that does not substantially interfere with the binding capacity of the receptor to nucleic acid derivative may be used.

The aromatic spacer includes compounds of the formula:

wherein Z includes CH and S; X includes 0, N and S; and Y includes N, O, CH ₂ and S. The heterocyclic aromatic spacers thus include carbazole (where Y=N) , dibenzofuran (wherein Y=0) , dibenzothiophene (where Y=S) and fluorene (where =CH ₂ ) .

The preferred aromatic spacer for binding purines, including adenine, guanine and hypoxanthine, is 3,6 disubstituted carbazole of the formula:

wherein X includes N, 0 and S. Preferably, X is N, and the aromatic spacer is a 3,6 diamino carbazole.

The aromatic spacer also includes naphthalene derivatives of the formula:

ubstituted

1,6 disubstituted

2,6 disubstituted

wherein all the Z\'s are C, or any one or more of the Z\'s is N and the remaining Z\'s are C, and wherein X includes 0, N and S.

Thus, for example, in the 2,7 disubstituted embodiment, the aromatic spacers include naphthalene (where all the Z\'s are C) , quinoline (where Z.,, Z , Z ₅ or Z _g is N) , iεoquinoline (where Z J_ or ZD, is N) , cinnoline (where Z«_> and Z. are N) , benzotriazine (where ^~ . , Z_, and Z. are N) , and pteridine (where Z , Z_, Z-. and Z_ are N).

The preferred aromatic spacer for binding pyrimidines, including thymine, cytosine and uracil, is 2,7 disubstituted naphthalene of the formula:

X includes N, 0 and S. Most preferably, the X groups are N, and the aromatic spacer is a 2,7 diamino naphthalene. By AM , AM ₂ , BM. and BM ₂ H bonding complements it is meant a molecular recognition element which is able to undergo H bonding with the nucleic acid derivative.

Preferably, these elements have a cleft-like shape permitting formation of optimal hydrogen bonds between the concave surface of the receptor and the convex surface of the nucleic acid derivative.

The H bonding complements preferably are derivatives of 1,3,5 cis cis trialkylcyclohexane 1,3,5 cis cis tricarboxylic acid of the formula:

wherein R includes CH_, CH ₂ OH, CH ₂ CH ₂ CH ₃ , CHOCH ₂ R\' and CH ₂ -0-CO-R" , where R\' includes aryl and alkyl and R" includes aryl and alkyl. Preferably, C is C. to C _9n , but can be any number provided that the resulting R group does not substantially interfere with the binding capacity of the receptor to nucleic acid derivatives. An example is Kemp\'s triacid, where R is CH_ .

The H bonding complements include compounds of the formula:

The R groups are the same as those just described supra for the tricarboxylic acid. The three R groups on a given H bonding complement can be the same or different from each other, but preferably, they are the same. The R groups on one of the H bonding complements that is attached to a given aromatic spacer can be the same or different from the other H bonding complement that is attached to that same aromatic spacer. And, the R groups that are attached to a given aromatic spacer can be the same or different from the R groups that are attached to a different aromatic spacer. E includes 0, H ₂ , OH, H and S.

The preferred H bonding complement for binding adenine and guanine is an imide of the formula:

The R groups are the same as those just described supra for the tricarboxylic acid.

The preferred H bonding complement for binding cytosine is a hydroxylactam of the formula:

The R groups are the same as those described supra for the tricarboxylic acid.

The preferred H bonding complement for binding thymine, uracil or hypoxanthine is a lactam of the formula:

The R groups are the same as those described supra for the tricarboxylic acid.

In the preferred embodiment, AM and AM ₂ are simultaneously able to H bond to two edges of one base of a nucleic acid derivative, resulting in chelation of a nucleic acid derivative, and BM and BM- are also simultaneously able to H bond to- two edges of another base of a nucleic acid derivative, thus also resulting in chelation of a nucleic acid derivative. The two bases which are bound may be part of the same nucleic acid derivative or different nucleic acid derivatives.

Attachment of the A and AM ₂ linkers to the AS aromatic spacer and the BM _] and BM_ linkers to the BS aromatic spacer is depicted in the following formula:

where D includes an amide (NHCO) , ester (OCO), ether (0CH ₂ ), thioether (SCH ₂ ) and amine (NHCH ₂ ). The R groups are the same as those described supra for the tricarboxylic acid. The preferred attachment is an amide shown in the following formula:

The R groups are the same as those described supra for the tricarboxylic acid.

In the preferred embodiment of the invention, y = 1 and the receptor has one anion complement (G), two linkers (AL and BL), two aromatic spacers (AS and BS) and two pairs of H bonding complements (A and AM ₂ ; B and BM ₂ ). The preferred receptors include compounds of the formulas:

II:

wherein R is propyl. This receptor can be used, for example, to bind to ApA.

III:

wherein R is O-benzyloxymethyl . This receptor can be used, for example, to bind to ApA.

IV :

This receptor can be used, for example, to bind to ApA.

In another embodiment of Formula I, y = 0 and the receptor has one anion complement (G), one linker (AL) , one aromatic spacer (AS) and one pair of H bonding complements (AM. and AM-). BL is replaced with a group which includes compounds of the formula:

-CH ₂ -OH

-CH ₂ -SH

-CH ₂ -NH ₂

-O-alkyl

— O— acyl

-S-alkyl

-NH-acyl

wherein the alkyl and acyl moieties preferably are C. to C _2Q . Any other organic or inorganic group that does not substantially interfere with the binding capacity of the receptor to nucleic acid derivative can be used.

Preferred receptors for this embodiment are compounds of the formula:

V:

where R is methyl, propyl or 0-benzyloxymethyl, and:

where R is methyl, propyl or 0-benzyloxymethyl.

Receptors V and VI can be used, for example, to bind to AMP or cAMP.

This invention also includes a receptor for binding a nucleic acid derivative comprising a compound of the formula

VII:

A _χ AM ₂

\ /

AS

I

AG — CL — BG

AG and BG are anion complements, CL is a linker, AS is an aromatic spacer, and AM., and A - are H bonding complements.

The linker is an alkyl or aryl group having three free valences. CL comprises three links, AL, BL and L-(R) , as shown by the formula:

I

<*>n

I

-AL-L-BL-

The first link is AL, described supra, with one free valence which attaches to AG. The second link is BL, described

supra, with one free valence which attaches to BG. The third link is L-R, which is attached to AL and BL and has a free valence which attaches to AS. L is any atom or molecule with three free valences, such as N, S, CH, or CX, where X is H, alkyl, aryl, heterocyclic or any other group that does not substantially interfere with the bonding capacity of the receptor to nucleic acid derivative. For example, it can be any tri-substituted alkyl or aryl group, such as, 1,2,2 tri-substituted ethyl, 1,3,5 tri-substituted phenyl, 2,4,6 trisubstituted pyridyl, or 1,2,3 tri-substituted propyl. R can be AL, BL, or any other group that does not substantially interfere with the binding capacity of the receptor to nucleic acid derivative. Preferably, R is an alkyl or aryl group having no more than 10 carbon atoms, n can be 0 or 1 and when n is 0, L is directly attached to AS.

The anion complements, aromatic spacer and H bonding complements include the same moieties as the corresponding groups described supra.

The preferred receptor is a compound of the formula:

VIII

wherein R is CH ₂ CH ₂ CH ₃ (propyl). This preferred receptor can be used, for example, to bind pAp.

This invention further embodies a receptor for binding a nucleic acid derivative which is a compound having the following formula:

IX:

AG and BG are anion complements; AL, BL and CL are linkers; AS, BS and CS are aromatic spacers; AM.., AM ₂ , BM.. , BM-, CVim and CM ₂ are H bonding complements.

The CL linker, which attaches to two anion complements and one aromatic spacer includes the same groups as described supra for the CL linker in Formula VII. One of the free valences on the CL linker attaches to one anion complement, the second free valence attaches to a second anion complement and the third free valence attaches to an aromatic spacer.

The AL and BL linkers, which each attach to one anion complement and one aromatic spacer include the same groups for linkers as described supra for the receptor with two pairs of H bonding groups. The anion complements, aromatic spacers and H bonding complements also include the same moieties as the corresponding groups described supra. n is an integer selected from 0 to 10. For example, when n is 0, the receptor has one anion complement and two aromatic spacers, each aromatic spacer having a pair of H bonding complements. When n is 1, the receptor has two anion

complements and three aromatic spacers, each aromatic spacer having a pair of H bonding complements. When n is 2, the receptor has three anion complements and four aromatic spacers, each aromatic spacer having a pair of H bonding complements. Thus, a receptor can be designed to interact by molecular recognition with multiple bases. The multiple bases can each be on one nucleotide derivative, or on different nucleotide derivatives.

A preferred receptor is a compound of the formula:

wnerem R is CH ₂ CH ₂ CH ₃ (propyl). This preferred receptor can be used, for example, to bind ApApA.

This invention further includes a receptor for binding a nucleic acid derivative comprising a compound of the formula

XI

A _X A ₂

\ /

S

S is an aromatic spacer and AM and AM ₂ are H bonding complements, which include the same moieties as the corresponding groups described supra.

The preferred receptor is a compound of the formula:

wherein R is CH ₂ CH ₂ CH ₃ (propyl).

This preferred receptor can be used, for example, to bind uracil.

The above receptors can be prepared using well-known methods in the art. For example, the anion complement can be attached to the linker by the methods described in Galan et al., J. Am. Chem. Soc. 113:9424-9425 (1991); the linker can be attached to the aromatic spacer by the methods described in Deslongchamps et al. , Angewandte hemie 3_1:61-63 (1992); the aromatic spacer can be attached to the H bonding complements by the methods described in Askew et al., J. Am. Chem. Soc. 111:1082-1090 (1989).

The receptors of this invention preferably are in salt form. The salts preferably are soluble in H ₂ 0 and/or organic fluids. Any known soluble salts of organic or inorganic components can be used. The X depicted in the formulas includes halide, perchlorate, fluroborate, sulfate, phosphate, carbonate, hydroxide, acetate and the like.

The following non-limiting examples further illustrate the present invention.

Example 1: Binding of Oligonucleotides to the Receptor and Subsequent Release

100 pmol, approximately 31 μg, of receptor was dissolved in 200 μl of dichloroethane (DCE) . The receptor used was Formula III described supra. The resulting 50 μM solution was used to extract aqueous, buffered and unbuffered solutions of oligonucleotides with lengths ranging from 2 to 76 nucleotides. Phosphorthioate linked dinucleotides were also extracted. The oligonucleotide was dissolved in 200 μl of H ₂ 0 or NH.OAc buffer, 50 M pH 7, at various concentrations. The absorbance at 260 nm was measured on a UV-Visible spectrophotometer. The solution was removed from the UV cuvette and added to the DCE solution of receptor and vortexed for 30 seconds in a 500 μl eppendorf tube. The two phases were separated by centrifugation at 10,000 rpm for 30 seconds. The DCE layer was removed and the remaining aqueous layer was measured in a UV-Visible spectrophotometer. A _{26Q After} - A _{26Q βefore} /

^A 260 Before ^{= %} extracted.

To determine the amount released, the DCE solution containing the extracted oligonucleotide was extracted with 200 μl of H ₂ 0 or buffer and the A _2βf) of the aqueous extract was measured. A _{26Q Released} / (A _{26Q BeforΘ} - ^A 26 ₀ After^ ⁼ released. See Tables 1, 2 and 3.

TABLE 1

Extraction of Small to Medium Length Oligonucleotides

SEQUENCE Length MW

AA 2 660 d(AAA) 3 990 d(AAA AA) 5 1650 d(TAT ATA) 6 1980 d(AAA AAA A) 7 2310

I d(TTT TTA A) 7 2310 O o I d(GCA TTA A) 7 2310 d(TTT GGA A) 7 2310 d(A) ₈ 8 2640 d(T) ₈ 8 2640

CCC UCU AAA AA 11 3630

(Seguence I.D. No. 4)

(AG) ₈ -dT 17 5610

(Seguence I.D. No. 5)

A ₂₀ 20 6600

(Seguence I.D. No. 6)

Nucleic

SEQUENCE Receptor/NA Acid [ ]

1. RNA PCR Primer ....GG 2/1

2. HH* Ribozyme...d(GC) 2/1

3. HH Ribozyme GC 2/1

4 . HH Substrate GC 4/1

5. RNA PCR Primer....CC 4/1

6. HH Ribozyme GU 4/1

7. HH Ribozyme....d(GT) 4/1

8. Sun Y Ribozyme....UC 4/1

9. tRNA Alanine CCA 8/1

*HH = Hainπierhead St ruct u res

TABLE 3

RNA SEQUENCES:

5\' AGG CAU ACU AGU ACA AGU GG 3\' 20-mer (Seq.I.D

RNA PCR Primer No. 7)

E4B-A2(r)

5\' d(GGC UCG ACU GAU GAG GCG C) 3\' 19-mer (Seq.I.D

Hammerhead Bottom No. 8)

3. 5\' GGC UCG ACU GAU GAG GCG C 3\' 19-mer (Seq.I.D

Hammerhead Bottom No. 9)

4. 5\' GCG CCG AAA CAC CGU GUC UCG AGC 3\' 24-mer (Seq.I.D

Hammerhead Top No. 10)

5. 5\' GGA ACU UAG CGU GAA UUC GAU CCC 3\' 24-mer (Seq.I.D

RNA PCR Primer No. 11)

6. 5\' GCU CGU CUG AUG AGU CCG UGA GGA CGA AA(dG) ACC GU 3\'

RRID-Hyb id 35-mer (Seq. I.

Hammerhead No. 12)

5\' GCT CGT CT(rG)AT(rGrA)GT CCG TGA GGA CGA AA(rG) ACC GT 3\'

4R2-Hybrid 35-mer (Seq.I.D

Hammerhead No. 13)

5\' GCU GUA AAU GCC UAA CGA CUA CAC GGU AGA CAA CUC 3 \'

Sun-Y Ribozyme.2 36-mer (Seq.I.D

No. 14)

The sequences correspond to the numbered sequences in Table 2

Example 2: Transport of Oligonucleotide Across a Cell Membrane

Chick embryo fibroblast tissue cultures infected with Rous sarcoma virus (RSV-ts68) are spread on plates containing wells and are treated by dripping into the wells a 25% solution of DMSO (dimethyl sulfoxide) in H ₂ 0 containing receptors of Formula II. After 10 minutes, the cells are washed with H-O, and then immersed in an aqueous solution of 32P radioactively labeled antisense oligonucleotide d(AATGGTAAAATGG) (Sequence I.D. No. 2). After three hours, the cells are washed and then assayed to determine the transport of the antisense oligonucleotide into the cells. Assays are performed by measuring the amount of radioactively labeled antisense oligonucleotide that is present in the cell. It is found that the antisense oligonucleotide enters the cell through the cell wall (from measurements of radioactivity on lysed pellets from supematants of the tissue culture medium) . Inhibition of virus production is observed as a result of the presence of the antisense oligonucleotide (from measurements of reverse transcriptase activity on lysed pellets from supematants of the tissue culture medium) .

Example 3: Attachment of Anti-Cancer Dosing Material

The anti-cancer drug adriamycinone is attached to ApA. The drug is protected by methods described in Boeckman et al., J. Am. Chem. Soc. 105:4112-4113 (1983). Preparation of the phosphoramidite of the protected drug is accomplished using standard methods known in the art. This derivative is then coupled to the ApA, resulting in a compound of the formula:

R I o

{ iPr ₂ N-P-OCH ₂ CH ₂ CN

wherein R is adriamycinone and iPr is isopropyl. The adriamycinone is thus attached via a phosphodiester linkage. This compound is transported across the cell membrane using the receptor of formula II. Adriamycinone is thus delivered directly into the cells.

Example 4: Diagnostic Use for Receptor

Trauma to the body results in release of nucleic acids into the urine. A diagnostic test for this disease uses the receptors of this invention to assay for the presence of such nucleic acids in a person\'s urine. A sample of 1 ml urine, putatively containing the nucleic acid, is extracted with 1 ml of 50μM receptor of Formula IV, in dichloroethane. The layers are separated by centrifugation at 10,000 rpm for 30 seconds. The dichloroethane layer is analyzed by UV spectroscopy at _ _g0 for the presence of the target nucleic acid. It is found that nucleic acids are present in the urine sample from persons suffering from the trauma.

Example 5: Therapeutic Use for Receptor

A premixed 0.5 ml of a 25% DMSO (dimethyl sulfoxide) solution in H ₂ 0 containing 0.5mM therapeutic nucleic acid anti herpes virus family drug and an equal concentration of receptor of Formula III is applied topically to genital warts. The resulting organic solution consisting of the receptor bound nucleic acid therapeutic is absorbed by the cells at the affected site. It is found that the wart decreases in size.

Example 6: Synthesis of Receptor of-Formula II

The receptor of Formula II was synthesized by the following procedure.

Pr is propyl . ^a (a)K ₂ C0 ₃ , DMF, 40-60°C, 1.5h; methyl bromoacetate,

50°C, 2h; (b)H ₂ (1 atm), 10% Pd/C, MeOH, glac. HOAc, room temperature, 5.5 H; (c) pyridine, reflux, 6.5 h; (d) THF, 95%

EtOH, IN NaOH, room temperature, 30 min.

All commercially available compounds (Aldrich) were used without further purification unless otherwise indicated. Tetrahydrofuran and ether used in anhydrous conditions were distilled from sodium-benzophenone ketyl; dichloromethane and pyridine were distilled from calcium hydride; and N,N-dimethylformamide was dried over molecular sieves for several days. Thin layer chromatography was performed on Merck Silica 60 F-254 precoated TLC plates. Column

chromatography was performed on Merck Silica Gel 60 (230-400 mesh) according to Still et al. , J. Org. Chem. 4J3:2923-2925 (1978). Glassware used for anhydrous conditions was either baked overnight at 150°C, assembled hot, cooled under vacuum, and filled with argon; or was flamed dry under vacuum, cooled and filled with argon before use. Standard inert-atmosphere techniques were used for syringe and cannula transfers of liquids and solutions. HPLC was performed on a Waters 600 Multisolvent Delivery System equipped with a Lambda Max Model 481 LC spectrophotometer using a Waters μ-Porasil column.

3,6-dinitrocarbazole (8_) was synthesized according to Grotta et al. , J. Org. Chem. , 29 _^ :2474-2476 (1964), and was purified by dissolving the crude mixture in hot 5:1 DMF/MEK (8 mL/g), filtering, cooling overnight at 3°C, filtering and washing with cold 5:1 DMF/MEK, 5:3 DMF/MEK, and ether. The recovered solid was dried under vacuum (hot water bath) to yield the pure 3,6-dinitrocarbazole.

N-(Methyl carboxymethyl)-3,6-dinitrocarbazole (9_) . 3,6-dinitrocarbazole ji (10.12 g, 39 mmol) was stirred with dry potassium carbonate (11 g, 2eq.) in dry DMF (130 mL) at 40-60°C for 1.5 hours under argon. Methyl bromoacetate (8 mL, 2.2 eq. ) was added to the dark red solution. The resulting cloudy orange mixture was stirred for 2 hours at room temperature and for 1 hour at 45-55°C. The reaction was quenched with water (130 mL) and cooled on ice. The yellow product was filtered, washed with water, sucked dry overnight, and dried under vacuum (hot water bath) to yield 9_ (12.73 g, 99%) as a yellow solid: mp 314-315 °C; IR (KBr) 1750, 1340, 1310 cm-1; ^X H NMR (300 MHz, d _c D-DMSO) δ

9.538 (d, 2 H, J=2.4 Hz), 8.445 (dd, 2H, J=9, 2.4 Hz), 7.924

(d, 2H, J=9 Hz), 5.639 (s, 2H) , 3.708 (s, 3 H); HRMS (El)

C,alcd for 329.06478 Found: 329.0654.

H NMR spectra were obtained at 250 MHz on Bruker AC-250 and WM-250 instruments, at 300 MHz on Varian GE-300, XL-300, and UN-300 instruments, and at 500 MHz on a Varian VXR-500

instrument in solvents as indicated. Chemical shifts are reported as parts per million (δ) relative either to tetramethyisilane or to residual solvent peak. Melting points were obtained on an Electrothermal IA9100 digital melting point apparatus and are calibrated. IR spectra were recorded on a Mattson Cygnus 100 FT-IR spectrometer. High resolution mass spectra were obtained on a Finnegan MAT 8200 mass spectrometer.

N-(Methyl carboxymethyl)-3,6-diaminocarbazole (1_0) A mixture of dinitro compound 9_ (2.41 g, 7.3 mmol), 10% palladium on carbon (520 mg, 22 wt %), methanol (500 mL) , and glacial acetic acid (50 mL) was hydrogenated at atmospheric pressure under a balloon for 5.5 hours. The product mixture was filtered through a cake of Celite and the methanol removed by rotary evaporation under reduced pressure. Saturated aqueous NaHCO_ was added to neutralize the acetic acid and the crude suspension was extracted with chloroform. The combined organic layers were washed with saturated aqueous NaHC0 ₃ , and dried over anhydrous sodium sulfate. Evaporation of the solvent under reduced pressure yielded 1.52 g (77%) of white solid 1_0 which darkens rapidly on exposure to light or air. The crude product is extremely sensitive to air and light and was used without further purification. ¹ H NMR (product only) (300 MHz, CDC13) δ 7.314 (dd, 2 H, J=2.1, 1.2 Hz), 7.079 (dd, 2 H, J=8.7, 1.5 Hz), 6.865 (dd, 2 H, J=8.4, 1.8 Hz), 4.879 (s, 2H) , 3.695 (s, 3 H) , 3.596 (br s, 2H) . cis,cis-l,3,5-Tripropylcyclohexyl-l,3,5- tricarboxylate imide acid chloride (1_1) was made according to Jeong et al . , J. Am. Chem. Soc. , li_2:6144-6145 (1990).

N-(Methylcarboxymethyl)-3,6-bis(cis,cis-l,3,5- tricarboxylate imide amide)carbazole (1_2) . Diamine 1_0 (0.4 g, 1.5 mmol) and acid chloride XL (1.055g, 2.06 eq. ) were refluxed in dry pyridine under argon for 6.5 hours. Solvent was removed by rotary evaporation and the crude was suspended

in chloroform (100 mL) . The organic layer was washed with

10% aqueous HC1 (100 mL) and brine (60 mL) and the aqueous layers were back extracted with chloroform (100 mL) . The combined organic layers were concentrated by rotary evaporation to give a brown oil which was triturated with cold methanol (6 mL) to give a beige powder which was filtered and sucked dry. A second crop was recovered from the filtrate. Both crops of crystals and the final filtrate were purified by column chromatography to yield pale beige powder 12 (520 mg, 39%): mp 227-229°C; IR 3450, 3381, 3227,

3111, 2960, 2935, 2873, 1700, 1492, 1467, 1198 cm ^-1 ; ^X H

NMR (250 MHz, ) δ 10.40 (s, 2 H) , 9.16 (s, 2 H) ,

9.16 (s, 2 H), 8.11 (S, 2 H) , 7.43 (dd, 4 H) , 5.30 (s, 2 H) , 3.63 (s, 3 H), 2.66 (d, 4 H, J=13.7 Hz), 2.03 (d, 2 H, J=12.3 Hz), 1.8-0.77 (m, 48 H); HRMS (El) Calcd for C ₅₁ H _6g N ₅ O _g :879.5146 Found: 879.5146.

N-(Carboxymethyl)-3,6-bis(cis,cis-l,3,5- tripropylcyclohexyl-1,3,5-tricarboxylate imide amide)carbazole (1_3) . To a solution of ester V2 (499 mg, 0.57 mmol) in THF (20 mL) was added 95% ethanol (60 mL) , followed by IN aqueous NaOH (20 mL) . The reaction solution was stirred under argon for 30 minutes and acidified to pH 1 with concentrated aqueous HC1. The reaction was monitored by disappearance of starting material (R _f 0.3 in 5% MeOH/CHCl ₃ ) on TLC. Solvent was removed by rotary evaporation and water (20 mL) was added to the crude. The suspension was triturated on an ice-bath, filtered, washed with cold water, sucked dry, and dried under vacuum to yield a pale beige solid (421.7 mg, 85%) which was used without further purification: ¹ H NMR (300 MHz, DMSO-db,) δ 10.39

(s, 2 H, imide), 9.16 (s, 2 H, amide), 8.11 (s, 2 H) , 7.43 (dd, 4 H, J=14.4, 9 Hz), 5.16 (s, 2 H) , 2.67 (d, 4 H, J=13.2 Hz), 2.03 (d, 2 H, J=12.6 Hz), 1.6-0.7 (m, 48 H) . This structure features nearly ideal spacing of the imides for

simultaneous Watson-Crick and Hoogsteen base-pairing to the purine nucleus of adenine.

For the phosphodiester complement, the bicyclic guanidinium ion shown in the following formula, prepared by the method of Kurzmeier et al. , J. Org. Chem. 55:3749-3755 (1990) , was used:

Compound 13 was coupled with the phosphodiester complement (1, 1 \'-carbonyldiimidazole, DMF, 31%) to yield the receptor (mp 248°-250°C):

wherein Pr is propyl .

This synthesis is described in Galan et al . , J. Am. Chem, Soc. 113 :9424-9425 (1991), which is incorporated herein by reference in total.

Exa ple 7: A Model Transport System

Experimental Conditions

A U tube has been used as system of transport (external length: 8 cm each branch x 8 cm curvature; distance between branches: 3.08 cm). The volume of each aqueous solution was

2 ml, and the organic one (1, 2-Dichloroethane) was 6 ml.

2 The contact surface between them was 1.568 cm . The system was stirred with a magnetic bar (1 x 0.3 cm) at 1200 rpm.

The source phase was prepared by dissolving the nucleotide (10 μM or 15 μM as indicated in the Tables) in sterile bidistilled water. A 10 mM solution of NaCl was used as the receiving phase.

The process was followed by measuring the A _2gQ of aliquots taken at different times in both the source and the receiving phases. The experimental values were adjusted to exponential equations, and the rate of the transport was calculated taking the experimental values of the receiving phase in the first lineal region and adjusting them to a lineal equation. Every experiment was made at least two times.

Tables 4 and 5 show the results obtained for the transport of dinucleotides and mononucleotides, respectively, for the carriers shown below and designated la, lb, 3c and RE2 in the Tables. The results demonstrate that transport of the dinucleotides or mononucleotides across the dichloroethane membrane was not observed for carriers la and lb. In contrast, transport of the nucleotides across the dichloroethane membrane was observed using the receptors 3c and RE2.

3c RE2

lb

where Pr is propyl and Bn is benzyl.

Table 4

Transport of dinucleotides

nuc eo = ² a.t. = active transport

Table 5

Transport of nucleotides

^nucleotide] in source phase = 15μM ² a.t. - active transport

EQUIVALENTS

Those skilled in the art will be able to ascertain, using no more than routine expe imentation, many equivalents of the specific embodiments of the invention described herein. For example, in large structures of the receptors of this invention it is obvious that some substitutions can be made, such as salt forms and the like, which are within the scope of the invention and should be considered the full equivalent of the specific receptors shown, so long as such substitutions do not substantially affect the binding ability of the receptors. Each of the above-recited references is incorporated herein by reference.

These and all other equivalents are intended to be encompassed by the following claims.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: MASSACHUSETTS INSTITUTE OF TECHNOLOGY

(B) STREET: 28 Carleton Street

(C) CITY: Cambridge

(D) STATE: Massachusetts

(E) COUNTRY: United States of America

(F) ZIP: 02142

(G) TELEPHONE: 617-253-6966 (H) TELEFAX: 617-2558-6790

(ii) TITLE OF INVENTION: NUCLEIC ACID RECOGNITION AND TRANSPORT

(iii) NUMBER OF SEQUENCES: 14

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Wolf, Greenfield & Sacks, P.C.

(B) STREET: 600 Atlantic Avenue

(C) CITY: Boston

(D) STATE: Massachusetts

(E) COUNTRY: United States of America

(F) ZIP: 02210

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: NOT AVAILABLE

(B) FILING DATE: FILED HEREWITH

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 07/930,087

(B) FILING DATE: 14-AUG-1992

(viii) ATTORNEY/ GENT INFORMATION:

(A) NAME: Gates, Edward R.

(B) REGISTRATION NUMBER: 31,616

(C) REFERENCE/DOCKET NUMBER: M0636/7007WO

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 617-720-3500

(B) TELEFAX: 617-720-2441

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: ACACCCAATT CTGAAAATGG 20

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 13 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: AATGGTAAAA TGG 13

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CATTCAAATG GTTTGCCTGC 20

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 11 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: Synthetic RNA oligonucleotide.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CCCUCUAAAA A 11

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: Nucleotides 1-16 are ribonucleotides and nucleotide 17 is a deoxyribonucleotide.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: AGAGAGAGAG AGAGAGT 17

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: Synthetic RNA oligonucleotide.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: AAAAAAAAAA AAAAAAAAAA 20

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: RNA PCR Primer (E4B-A2(r)).

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: AGGCAUACUA GUACAAGUGG 20

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: Hammerhead bottom containing deoxyribonucleotides.

(iii) HYPOTHETICAL: NO

(iv) AN I-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: GGCUCGACUG AUGAGGCGC 19

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: Hammerhead bottom.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: GGCUCGACUG AUGAGGCGC 19

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid (A) DESCRIPTION: Hammerhead top.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GCGCCGAAAC ACCGUGUCUC GAGC 24

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: RNA PCR Primer.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: GGAACUUAGC GUGAAUUCGA UCCC 24

(2) INFORMATION FOR SEQ ID NO: 12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: RRlD-hybrid Hammerhead in which nucleotides 1-29 and 31-35 are ribonucleotides and nucleotide 30 is deoxyribonucleotide.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: GCUCGUCUGA UGAGUCCGUG AGGACGAAAG ACCGU 35

(2) INFORMATION FOR SEQ ID NO: 13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: 4R2-hybrid Hammerhead in which nucleotides 9, 12, 13 and 30 are ribonucleotides and the remaining nucleotides are deoxyribonucleotides.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GCTCGTCTGA TGAGTCCGTG AGGACGAAAG ACCGT 35

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(A) DESCRIPTION: Sun-Y Ribozyme.2.

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

( i) SEQUENCE DESCRIPTION: SEQ ID NO:14: GCUGUAAAUG CCUAACGACU ACACGGUAGA CAACUC 36