Field of the Invention The present invention relates to oncology and more particularly to identification of oncogenes and oncoproteins and to diagnosis, prognosis and therapy associated with cancer.

Description of Related Art Chromosomal rearrangements (translocations) have been observed in certain cancerous malignancies. Various histologic subtypes of leukemia and lymphoma have been associated with diagnostic chromosome translocations. See, e. g., Rabbitts, Chromosomal translocations in human cancer. Nature 372,143-149 (1994); Offit et al., Chromosomal aberrations in non-Hodgkin's lymphoma. Biologic and clinical correlations. Hematol. Oncol. Clin. North Am. 5,853-869 (1991); and Croce, Molecular biology of lymphomas. Semin. Oncol. 20,31-46 (1993).

A novel variety of stem-cell leukemia lymphoma involving T-cell, B-cell, and myeloid lineages has recently been described. Most patients present with peripheral lymphadenopathy, and lymph node biopsies typically reveal T-cell lymphoblastic lymphoma (T-LL). Concomitant bone marrow biopsy, on the other hand, generally demonstrates myeloid hyperplasia with pronounced eosinophilia. The lymphoma responds well to therapy, but most patients progress to a full-blown, rapidly fatal, acute myelogenous leukemia (AML). The biphenotypic T-LL/AML syndrome (also referred to as stem-cell leukemia/lymphoma (SCLL) syndrome) was associated with an identical balanced translocation involving the short arm of chromosome 8 and the long arm of chromosome 13. Naeem et al., Translocation t(8;13) (p11;q11-12) in stem cell leukemia/lymphoma of T-cell and myeloid lineages. Genes Cancer 12, 148-151 (1995). Several groups independently reported the translocation (8; 13) in a syndrome of T-LL/AML, but the exact chromosome bands containing the translocation breakpoints were debatable in these reports. Some investigators assigned the chromosome 8p breakpoint to a region immediately adjacent to the centromere, whereas others assigned the breakpoint to a region half-way along the short arm. See, e. g., Abruzzo et al., T-cell lymphoblastic lymphoma with eosinophilia associated with subsequent myeloid malignancy, Am J Surg Pathol,

16: 236-245 (1992); Fagan et al., Translocation (8; 13) and T-cell lymphoma. A case report.

Cancer Gene Cytogenet, 65: 71-73 (1993); Inhorn et al., A Syndrome of lymphoblastic lymphoma, eosinophilia, and myeloid hyperplasia/malignancy associated with t (8; 13) (pl l; ql 1): description of a distinctive clinicopathologic entity, Blood 85: 1881-1887 (1995); Leslie, t (8; 13) (pl 1; q 12) translocation in a myeloproliferative disorder associated with a T-cell non-Hodgkin lymphoma, Br JHaematol, 86: 876-878 (1994); Kempski et al., Localization of the (8; 13) translocation breakpoint associated with myeloproliferative disease to a 1.5 Mbp region of chromosome 13, Genes Chromosome Cancer, 12: 238-287 (1995); Behringer et al., Translocation t (8; 13) in a patient with T cell lymphoma and features of a myeloproliferative syndrome, Leukemia, 9: 988-992 (1995); and Rao et al., Cytogenetic evidence for extramedullary blast crisis with t (8; 13) (ql l; pl 1) in chronic myelomonocytic leukemia, Acta Haematol, 88: 201-203 (1992).

Effective treatment of cancer is often dependent upon an early and proper diagnosis of malignancy. Molecular characterization of the translocation (8; 13) T-LL/AML syndrome provides an effective tool for diagnostic and therapeutic modalities relating to the T-LL/AML syndrome.

Summary of the Invention In accordance with the present invention, an oncogene designated ZNF198-FGFRI has been identified which incorporates an FGFR1 tyrosine kinase domain fused through tranlocation to ZNF198, a zinc finger gene, and is associated with stem-cell leukemia/lymphoma syndrome. In accordance therewith, an isolated ZNFl98-FGFRI nucleic acid is provided. As used herein, a"ZNF198-FGFRI nucleic acid", refers to a nucleic acid which contains, from 5'to 3', a ZNFl98-derived nucleic acid sequence and an FGFR1-derived nucleic acid sequence. The exact number of nucleotides in the ZNFl98-derived nucleic acid sequence and the FGFRl-derived nucleic acid sequence can vary, provided that the ZNF198-FGFRI nucleic acid contains a sufficient number of nucleotides from the respective source genes to identify the ZNF198-FGFR1 nucleic acid as a unique nucleic acid sequence that is derived from each of these source genes.

The locus in the ZNFl98-FGFRI nucleic acid which marks the boundary between the sequence derived from the ZNF198 nucleic acid and the sequence derived from the FGFR1 nucleic acid is referred to as the"translocation fusion juncture". Accordingly, the ZNF198-FGFRI nucleic acids of the invention also are said to contain a"ZNFl98-FGFRI

fusion sequence", i. e., the minimum nucleotide sequence which identifies the ZNFl98-FGFRI nucleic acid as a unique nucleic acid sequence that is derived from each of the source genes.

The translation product of a ZNF198-FGFR1 fusion sequence is referred to as a ZNF198-FGFRI polypeptide fusion sequence. Accordingly, the ZNF198-FGFR1 polypeptides of the invention also are said to contain a"ZNFl98-FGFRI polypeptide fusion sequence", i. e., the minimum amino acid sequence which identifies the ZNFI98-FGFRI polypeptide as a unique polypeptide that includes an amino acid sequence coded for by each of the source genes.

According to one aspect of the invention, an isolated ZNF198-FGFR1 nucleic acid is provided which is selected from the following nucleic acid molecules: (a) a nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule consisting of a nucleic acid of SEQ ID NO: 1 and which codes for a ZNFl98-FGFRI polypeptide; (b) deletions, additions and substitutions of (a) which code for a respective ZNFl98-FGFRI polypeptide; (c) a nucleic acid molecule that differs from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code; and (d) complements of (a), (b) or (c).

The preferred ZNF198-FGFRI nucleic acid molecules have a sequence selected from the group consisting of SEQ ID NO: 1, and SEQ ID NO: 15 (GTTCCTACTACAGTTCCTGTTCCTGTGTCTGCTGACTCCAGTGCATCC). SEQ ID NO: 1 codes for the ZNFl98-FGFRI polypeptide of SEQ ID NO: 2; SEQ ID NO: 15 codes for the ZNFl98-FGFRI polypeptide of SEQ ID NO: 16 (VPTTVPVPVSADSSAS) which is also contained within the sequence depicted in SEQ ID N0: 2.

According to yet another aspect of the invention, an isolated ZNF198-FGFR1 nucleic acid molecule is provided which is selected from the group consisting of: (a) a unique fragment of a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 15 (of sufficient length to represent a sequence unique within the human genome); and (b) complements of (a), provided that the unique fragment includes a sequence of contiguous nucleotides which excludes a sequence selected from the group consisting of : (1) sequences having the SEQ ID NOs or GenBank accession numbers of Table I or other previously published sequences as of

the date of invention or the filing date of this application., (2) complements of (1), and (3) fragments of (1) and (2).

According to another aspect of the invention, an expression vector comprising the nucleic acid molecules disclosed herein operably linked to a promoter are provided. Host cells containing (e. g., transformed or transfected with) with said expression vectors also are provided.

In certain preferred embodiments, the host cells are eukaryotic cells.

The isolated ZNFl98-FGFRI nucleic acid molecules disclosed herein have various utilities, including their use as probes and primers as diagnostic reagents for identifying the presence of ZNF198-FGFR1 nucleic acids in biological or other samples, and as agents for generating ZNFl98-FGFRI polypeptides and ZNFl98-FGFRI binding agents (agents such as antibodies which selectively bind to a ZNFl98-FGFRI nucleic acid or to a ZNFl98-FGFRI polypeptide) that can be used as reagents in diagnostic and therapeutic assays to identify the presence, absence, and/or amounts of a ZNF198-FGFR1 nucleic acid or polypeptide in a biological or other sample. Thus, the ZNF198-FGFRI nucleic acids, polypeptides, and binding agents of the invention can be used, interalia, in the diagnosis or treatment of conditions characterized by the presence of aberrant levels of a ZNFl98-FGFRI nucleic acid or of a ZNFl98-FGFRI polypeptide.

According to yet another aspect of the invention, an isolated ZNFl98-FGFRI polypeptide is provided. The isolated ZNFl98-FGFRI polypeptide molecule is encoded by one or more ZNFl98-FGFRI nucleic acid molecules of the invention. Preferably, the ZNF198-FGFRI polypeptide is selected from the group consisting of the polypeptides having SEQ ID NOs. 2 and 16. More preferably, the ZNFI98-FGFRI polypeptide is SEQ ID NO: 16 or a unique fragment of SEQ ID NO: 2 which contains at least two, preferably three, and, more preferably, four amino acids from the ZNF198-and FGFRI-derived polypeptide sequences.

According to another aspect of the invention, isolated ZNF198-FGFR1 binding agents (e.g., binding polypeptides such as antibodies) are provided which selectively bind to a ZNFl98-FGFRI nucleic acid molecule or to a ZNFl98-FGFRI polypeptide encoded by the isolated nucleic acid molecules of the invention. Preferably, the isolated binding agents selectively bind to a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ; ID NO: 15; or to a polypeptide having a sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 16, or to unique fragments of the foregoing nucleic acids and polypeptides. In the preferred embodiments, the isolated binding polypeptides

include antibodies and fragments of antibodies (e. g., Fab, F (ab) 2, Fd and antibody fragments which include a CDR3 region which binds selectively to the ZNF198-FGFRI nucleic acid or polypeptide). Accordingly, throughout this application, the term"antibody"is meant to embrace antibody fragments which selectively bind to the target antigen. Preferably, the antibodies for human therapeutic applications are human antibodies.

According to another aspect of the invention, a method of identifying stem cell leukemia/lymphoma syndrome is provided. The method includes obtaining tissue or fluid from a patient and analyzing the tissue or fluid for the presence of a nucleic acid sequence containing a ZNF198-FGFRI nucleic acid molecule (e. g., SEQ ID NO: 1 or SEQ ID NO: 15), a ZNFl98-FGFRI polypeptide (e. g., SEQ ID NO: 2 or SEQ ID NO: 16), or unique fragments of the foregoing nucleic acid molecules and polypeptides, wherein the presence of such a nucleic acid sequence or polypeptide identifies stem cell leukemia/lymphoma syndrome.

According to still another aspect of the invention, a method of identifying the presence of a ZNF198-FGFRI nucleic acid in a sample is provided. The method involves contacting the sample with at least two nucleic acid amplification primers, wherein a first amplification primer hybridizes to the ZNF198 nucleic acid sequence and a second amplification primer hybridizes to the FGFR1 nucleic acid sequence encoding the tyrosine kinase domain; amplifying the primed sequences in the sample which hybridize to the two primers; and detecting the presence of amplified nucleic acid sequence in the sample which contains the ZNF198-FGFRI nucleic acid sequence.

According to yet another aspect of the invention, a method of identifying the presence of ZNFl98-FGFRI nucleic acid sequence in a sample is provided. The method involves contacting the sample with at least two nucleic acid probes, wherein a first probe hybridizes to the ZNF198 nucleic acid sequence and a second probe hybridizes to the FGFRI tyrosine kinase domain nucleic acid sequence; and detecting the presence of a nucleic acid sequence in the 4 sample which hybridizes to both the first probe ("ZNFl98-specific probe") and to the second probe ("FGFRI-specific probe").

According to a further aspect of the invention, a method of identifying the presence of the ZNF198-FGFRl fusion sequence in a sample is provided. The method involves contacting the sample with a nucleic acid probe which hybridizes to the locus of the junction between the the ZNF198 portion and the FGFRI portion of the ZNFl98-FGFRI fusion sequence; and detecting the presence of a nucleic acid sequence in the sample which hybridizes to the probe.

According to yet another aspect of the invention, a method of identifying the presence of ZNFl98-FGFRI polypeptide in a sample is provided. The method involves contacting the sample with at least two binding agents (e. g., an antibody), wherein a first binding agent selectively binds to ZNF198 and a second binding agent selectively binds to the tyrosine kinase domain of FGFRI; and detecting the presence of a polypeptide in the sample which binds both the first and the second binding agents.

According to a further aspect of the invention, a method of identifying the presence of ZNFl98-FGFRI polypeptide fusion sequence in a sample is provided. The method involves contacting the sample with a binding agent (e. g., an antibody) which binds selectively to the ZNF198-FGFRI polypeptide fusion sequence, and detecting the presence of a polypeptide in the sample which selectively binds to the binding agent.

According to another aspect of the invention, a pharmaceutical composition containing a therapeutically effective amount of an isolated ZNFl98-FGFRI nucleic acid, an isolated ZNF198-FGFRI polypeptide, or an isolated ZNFl98-FGFRI binding agent in a pharmaceutically acceptable carrier is provided. The pharmaceutical compositions are useful in accordance with the therapeutic methods, including the diagnostic imaging applications, disclosed herein.

Thus, according to a further aspect of the invention, a method of locating cells containing a ZNFl98-FGFRI polypeptide (e. g., SEQ ID NO: 2 or SEQ ID NO: 16) in a patient is provided. The method involves providing a binding agent to which is coupled a detectable tag (e. g., a radio labeled antibody) which selectively binds to the ZNFl98-FGFRI polypeptide fusion sequence; injecting the labeled binding agent into a patient suspected of having cells containing the ZNF198-FGFRI polypeptide; and observing the locus of label (e. g., radioactivity) in the patient.

According to another aspect of the invention, a method of delivering a toxic substance to '. cells in a patient containing a ZNFl98-FGFRI polypeptide is provided. The method involves providing a toxin-conjugated binding agent (e. g., a toxin-conjugated antibody or antibody fragment) that selectively binds to the ZNF198-FGFRI polypeptide fusion sequence; and injecting the toxin-conjugated binding agent (e. g., toxin-conjugated antibody) into the patient suspected of having cells containing a ZNF198-FGFR1 polypeptide.

The invention also discloses the nucleic acid and predicted amino acid sequence for a novel gene, referred to herein as"ZNF198". SEQ ID NO: 3 is the nucleotide sequence of

ZNF198 cDNA. SEQ ID NO: 4 is the amino acid sequence of ZNF198 protein. As described above, sequences derived from the ZNF198 nucleic acid sequence are contained within the ZNFI98-FGFRI nucleic acid molecules of the invention. The ZNF198 cDNA sequence is presented in SEQ ID NO: 3; the ZNF198 amino acid sequence is presented in SEQ ID NO: 4.

Accordingly, the invention also provides an isolated ZNF198 nucleic acid molecule is provided.

These isolated nucleic acid molecules of the invention are selected from the following nucleic acid molecules: (a) a nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule consisting of a nucleic acid of SEQ ID NO: 3 and which codes for a ZNF198 polypeptide; (b) deletions, additions and substitutions of (a) which code for a respective ZNF198 polypeptide; (c) a nucleic acid molecule that differs from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c).

Exemplary ZNF198 nucleic acids have SEQ ID NO: 3 or have nucleic acid sequences which encode SEQ ID NO: 4.

According to yet another aspect of the invention, an isolated ZNF198 nucleic acid molecule is provided which is selected from the group consisting of : (a) a unique fragment of a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1 (of sufficient length to represent a sequence unique within the human genome); and (b) complements of (a), provided that the unique fragment includes a sequence of contiguous nucleotides which excludes a sequence selected from the group consisting of : (1) sequences having the SEQ ID NOs or GenBank accession numbers of Table II or other previously published sequences as of the date of invention or the filing date of this application., (2) complements of (1), and (3) fragments of (1) and (2).

According to another aspect of the invention, expression vectors comprising the ZNF198 nucleic acid molecules disclosed herein operably linked to a promoter, and host cells containing said expression vectors also are provided.

The isolated nucleic acid molecules disclosed herein have various utilities, including their use as probes and primers as diagnostic reagents for identifying the presence of ZNF198 nucleic acids in biological or other samples, and as agents for generating ZNF198 polypeptides

and ZNF198 binding agents (e. g., antibodies) that can be used as reagents in diagnostic and therapeutic assays to identify the presence, absence, and/or amounts of a ZNF198 nucleic acid or polypeptide in a biological or other sample. Thus, the foregoing nucleic acids, polypeptides, and binding agents can be used, inter alia, in the diagnosis or treatment of conditions characterized by the expression or presence of a ZNF198 nucleic acid or polypeptide (e. g., stem cell leukemia/lymphoma syndrome).

According to yet another aspect of the invention, an isolated ZNF198 polypeptide is provided. The isolated ZNF198 polypeptide molecule is encoded by one or more ZNF198 nucleic acid molecules of the invention.

According to another aspect of the invention, isolated ZNF198 binding agents (e. g., binding polypeptides such as antibodies) are provided which selectively bind to a ZNF198 nucleic acid molecule or to a ZNF198 polypeptide encoded by the isolated nucleic acid molecules of the invention. Preferably, the isolated binding agents selectively bind to a nucleic acid of SEQ ID NO: 3 or to a polypeptide of SEQ ID NO: 4, or to unique fragments of the foregoing nucleic acids and polypeptides. More preferably, the isolated ZNF198 binding agents do not bind to DXS6673DE, a candidate gene in X-linked mental retardation, or an expression product thereof. In the preferred embodiments, the isolated binding polypeptides include antibodies and fragments of antibodies (e. g., Fab, F (ab) 2, Fd and antibody fragments which include a CDR3 region which binds selectively to a ZNF198 nucleic acid or polypeptide).

As used herein, the term antibody is meant to include such fragments. Preferably, the antibodies for human therapeutic applications are human antibodies.

According to another aspect of the invention, a method of identifying stem cell leukemia/lymphoma syndrome is provided. The method includes obtaining tissue or fluid from a patient and analyzing the tissue or fluid for the presence of a nucleic acid sequence containing a ZNF198 nucleic acid molecule (e.g., SEQ ID NO: 3), αZNF198 polypeptide (e.g., SEQ ID NO: 4), or unique fragments thereof wherein the presence of such a nucleic acid sequence or polypeptide identifies stem cell leukemia/lymphoma syndrome.

According to still another aspect of the invention, a method of identifying the presence of ZNF198 nucleic acid sequence in a sample is provided. The method involves contacting the sample with at least two nucleic acid amplification primers, wherein the first primer hybridizes to a first unique sequence within the ZNF198 nucleic acid sequence and the second primer hybridizes to a second unique sequence within the ZNF198 nucleic acid sequence; amplifying

the primed sequences in the sample which hybridizes to the two primers; and detecting the presence of amplified nucleic acid sequence in the sample which contains the ZNF198 nucleic acid sequence.

According to yet another aspect of the invention, a method of identifying the presence of a ZNF198 nucleic acid sequence in a sample is provided. The method involves contacting the sample with at least two nucleic acid probes, wherein the first probe hybridizes to a first unique sequence within the ZNF198 nucleic acid sequence and the second probe hybridizes to a second unique sequence within the ZNF198 nucleic acid sequence; and detecting the presence of a nucleic acid sequence in the sample which hybridizes to both the first probe and to the second probe.

According to yet another aspect of the invention, a method of identifying the presence of a ZNF198 polypeptide in a sample is provided. The method involves contacting the sample with at least two binding agents (e. g., an antibody), wherein the first binding agent selectively binds to a first unique sequence within the ZNF198 polypeptide and the second binding agent selectively binds to a second unique sequence within the ZNF198 polypeptide; and detecting the presence of a protein in the sample to which each of the first and the second binding agents bind.

According to another aspect of the invention, a pharmaceutical composition containing a therapeutically effective amount of an isolated ZNF198 nucleic acid, an isolated ZNF198 polypeptide, or an isolated ZNF198 binding agent in a pharmaceutically acceptable carrier also is provided. The pharmaceutical compositions are useful in accordance with therapeutic methods disclosed herein.

According to a further aspect of the invention, a method of locating cells containing a ZNF198 polypeptide in a patient is provided. The method involves providing a binding agent to which is coupled a detectable tag (e.g., a radio labeled antibody) which selectively binds to the ZNF198 polypeptide; injecting the labeled binding agent into a patient suspected of having cells containing a ZNF198; and observing the locus of detectable tag (e. g., by detecting radioactivity) in the patient.

According to another aspect of the invention, a method of delivering a toxic substance to cells in a patient containing a ZNF198 polypeptide is provided. The method involves providing a toxin-conjugated binding agent (e. g., a toxin-conjugated antibody) that selectively binds to a ZNF198 polypeptide; and injecting the toxin-conjugated binding agent into the patient

suspected of having cells containing a ZNF198 polypeptide.

In summary, the invention provides isolated ZNF198 nucleic acid molecules and isolated ZNF198-FGFR1 nucleic acid molecules, unique fragments thereof, expression vectors containing the foregoing, and host cells containing the foregoing. The invention also provides isolated ZNF198 polypeptides and isolated ZNF198-FGFRI polypeptides, binding agents which selectively bind such nucleic acids and polypeptides, including antibodies, and pharmaceutical compositions containing the foregoing molecules. The compositions of the invention can be used, interalia, in the diagnosis or treatment of conditions characterized by the aberrant expression levels and/or the presence of a ZNF198 or ZNF198-FGFR1 nucleic acid or polypeptide.

Brief Description of the Drawings Fig. 1 depicts ZNF198 cDNA and the corresponding encoded amino acid sequence of ZNF198 protein.

Fig. 2 depicts a Southern blot of t (8; 13) lymphoma (T) and normal peripheral blood leukocytes (N) using a 3.3 kb FGFRI cDNA. Rearranged fragments are seen in Hindlll, Rvull and Xba digested tumor DNAs.

Figs. 3a and 3b depict Northern blot analysis of ZNF198 expression in multiple tissues.

Figs. 3c and 3d depict PCR analysis relating to ZNF198-FGFRI in lymphomas and control tissues.

Fig. 3e depicts a PCR analysis or relative expression of ZNF198, FGFR1, and ZNFl98-FGFRI in frozen lymphomas.

Fig. 4a graphically depicts ZNF198, FGFR1, and the domains and translocation involved in the ZNFl98-FGFRI gene.

Fig. 4b depicts specific breakpoints in ZNF198 (SEQ ID NO: 11) and FGFR1 (SEQ ID NO: 13) and their corresponding proteins (SEQ ID NO: 12 and SEQ ID NO: 14) along with an illustration of a translocation fusion juncture in ZNFl98-FGFRI (SEQ ID NO: 15) and corresponding protein (SEQ ID NO: 16).

Fig. 4c depicts nucleic acid sequences showing differences in genomic translocation breakpoints in t (8; 13) lymphoma cases 1 (SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19) and 2 (SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22).

Abbreviated Sequence Listing SEQ ID NO: 1 is the nucleotide sequence of ZNF198-FGFRI cDNA.

SEQ ID NO: 2 is the amino acid sequence of ZNF198-FGFRI protein.

SEQ ID NO: 3 is the nucleotide sequence of ZNF198 cDNA.

SEQ ID NO: 4 is the amino acid sequence of ZNF198 protein.

SEQ ID NO: 5 is the nucleotide sequence designated F/ZNF198/154 which hybridizes to ZNF198 cDNA and was used to amplify SEQ ID NO: 15, SEQ ID NO: 19 and SEQ ID NO: 22.

SEQ ID NO: 6 is the nucleotide sequence designated R/FGFRI/1979 which hybridizes to FGFR1 cDNA and was used to amplify SEQ ID NO: 15, SEQ ID NO: 19 and SEQ ID NO: 22.

SEQ ID NO: 7 is the nucleotide sequence designated R/FGFR1/2128 which hybridizes to FGFR1 cDNA.

SEQ ID NO: 8 is the nucleotide sequence designated F/FGFRl/INTR which hybridizes to FGFRI genomic DNA.

SEQ ID NO: 9 is the nucleotide sequence designated F/ZNFl98/INTR which hybridizes to ZNF198 genomic DNA.

SEQ ID NO: 10 is the nucleotide sequence designated R/ZNF198/INTR which hybridizes to ZNF198 genomic DNA.

SEQ ID NO: 11 is the nucleotide sequence including and surrounding the translocation breakpoint in the ZNF/98 DNA from 4/6 samples analyzed.

SEQ ID NO: 12 is the amino acid sequence including and surrounding the translocation breakpoint in the ZNF198 protein from 4/6 samples analyzed.

SEQ ID NO: 13 is the nucleotide sequence including and surrounding the translocation breakpoint in the FGFR1 from 4/6 samples analyzed.

SEQ ID NO: 14 is the amino acid sequence including and surrounding the translocation breakpoint in the FGFR1 from 4/6 samples analyzed.

SEQ ID NO: 15 is the nucleotide sequence including and surrounding the translocation fusion juncture in the ZNFl98/FGFR1 DNA from 4/6 samples analyzed.

SEQ ID NO: 16 is the amino acid sequence including and surrounding the translocation fusion juncture in the ZNFl98/FGFR1 protein from 4/6 samples analyzed.

SEQ ID NO: 17 is the nucleotide sequence including and surrounding the translocation breakpoint in the ZNF198 DNA from Case 1.

SEQ ID NO : 18 is the nucleotide sequence including and surrounding the translocation

breakpoint in the FGFR1 DNA from Case 1.

SEQ ID NO: 19 is the nucleotide sequence including and surrounding the translocation fusion juncture in the ZNFl98/FGFR1 DNA from Case 1.

SEQ ID NO: 20 is the nucleotide sequence including and surrounding the translocation breakpoint in the ZNF198 DNA from Case 2.

SEQ ID NO: 21 is the nucleotide sequence including and surrounding the translocation breakpoint in the FGFRI DNA from Case 2.

SEQ ID NO: 22 is the nucleotide sequence including and surrounding the translocation fusion juncture in the ZNFl98/FGFR1 DNA from Case 2.

SEQ ID NO: 23 is the amino acid sequence of a ZNF198 atypical zinc finger motif.

SEQ ID NO: 24 is the amino acid sequence of a ZNF198 atypical zinc finger motif.

SEQ ID N0: 25 is the amino acid sequence of the FGFR1 tyrosine kinase domain I.

SEQ ID N0: 26 is the amino acid sequence including and surrounding the translocation fusion juncture of the ZNF198/FGFRI protein in Case 1.

SEQ ID NO: 27 is the amino acid sequence including and surrounding the translocation fusion juncture of the ZNF198/FGFR1 protein in Case 2.

SEQ ID NO: 28 is the nucleotide sequence of FGFRI cDNA.

SEQ ID NO: 29 is the amino acid sequence of FGFRI protein.

Description of Preferred Embodiments Molecular characterization of the ZNF198-FGFR1 fusion oncogene and oncoprotein encoded thereby according to the present invention provides the ability to identify patients with the t (8; 13) (pl l; ql 1-12) syndrome prior to onset of myeloid leukemia. As a result, aggressive therapy can be instituted upon diagnosis of the syndrome to increase the possibility of remission and recovery.

The fibroblast growth factor receptor 1 (FGFR1) is a transmembrane protein which participates in signal transduction pathways. In accordance with the present invention, it was determined that the translocation involving chromosomes 8 and 13 associated with SCLL syndrome specifically involves the fibroblast growth factor receptor 1 gene (FGFR1) located on chromosome 8. This determination was made by mapping a yeast artificial chromosome (YAC) clone that spanned the chromosome 8 translocation breakpoint, establishing a cDNA library enriched for sequences mapping to that YAC, and then screening the cDNA library with a bacterial artificial chromosome (BAC) clone which also spanned the chromosome 8

translocation breakpoint. FGFRI was thereby identified as a candidate gene and subsequent molecular studies including Southern blotting, rapid amplification of cDNA ends (RACE) and sequencing showed that FGFRI was in fact rearranged by translocation in SCLL syndrome.

The translocations fused the 3'end of FGFRI including a tyrosine kinase domain with the 5' end of a novel gene from chromosome 13. The FGFRI translocation breakpoints are intronic, interrupting intron 8 immediately upstream of the FGFRI tyrosine kinase domain.

After establishing that FGFRI was the chromosome 8p oncogene, the chromosome 13 translocation partner gene was identified by 5'RACE amplification of cDNA ends. The chromosome translocation partner gene is designated ZNF198 and contributes four zinc finger domains to the 5'end of the t (8; 13) protein. The ZNFl98-FGFRI fusion gene is shown in SEQ ID NO: 1. The translocation breakpoint in ZNFl98-FGFRI which denotes the boundary between ZNF198 and FGFRI nucleotide sequence occurs at nucleotide number 1343. Transient expression studies show that the ZNFl98-FGFRI transcript directs the synthesis of a polypeptide of about 76kD localizing predominantly to the cytoplasm. The ZNFl98-FGFRI protein sequence is shown in SEQ ID NO: 2 with the breakpoint between ZNF198 and FGFRI amino acid sequence occurring at amino acid 293. An isolated nucleic acid sequence which encodes the ZNF198 protein is shown in SEQ ID NO: 3 and the corresponding amino acid sequence of ZNF198 is shown in SEQ ID NO: 4.

Thus, in accordance with the present invention, an oncogene designated ZNFl98-FGFRI has been identified which incorporates an FGFRI tyrosine kinase domain fused through tranlocation to ZNF198, a zinc finger gene, and is associated with stem-cell leukemia/lymphoma syndrome. In accordance therewith, an isolated ZNFl98-FGFRI nucleic acid is provided. As used herein, a"ZNF198-FGFRI nucleic acid", refers to a nucleic acid which contains, from 5'to 3', a ZNFl98-derived nucleic acid sequence and an FGFRl-derived nucleic acid sequence. The exact number ofnucleotides in the ZNF198-derived nucleic acid sequence and the FGFR1-derived nucleic acid sequence can vary, provided that the ZNFl98-FGFRI nucleic acid contains a sufficient number of nucleotides from the respective source genes to identify the ZNFI98-FGFRI nucleic acid as a unique nucleic acid sequence that is derived from each of these source genes.

The locus in the ZNF198-FGFRI nucleic acid which marks the boundary between the sequence derived from the ZNF198 nucleic acid and the sequence derived from the FGFR1 nucleic acid is referred to as the"translocation fusion juncture". Accordingly, the

ZNF198-FGFRI nucleic acids of the invention also are said to contain a"ZNFl98-FGFRI fusion sequence", i. e., the minimum nucleotide sequence which identifies the ZNFl98-FGFRI nucleic acid as a unique nucleic acid sequence that is derived from each of the source genes.

The translation product of a ZNF198-FGFR1 fusion sequence is referred to as a ZNFl98-FGFRI polypeptide fusion sequence. Accordingly, the ZNFl98-FGFRI polypeptides of the invention also are said to contain a"ZNFI98-FGFRI polypeptide fusion sequence", i. e., the minimum amino acid sequence which identifies the ZNFl98-FGFRI polypeptide as a unique polypeptide that includes an amino acid sequence coded for by each of the source genes.

According to one aspect of the invention, an isolated ZNF198-FGFRI nucleic acid is provided which is selected from the following nucleic acid molecules: (a) a nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule consisting of a nucleic acid of SEQ ID NO: 1 and which codes for a ZNFl98-FGFRI polypeptide; (b) deletions, additions and substitutions of (a) which code for a respective ZNFl98-FGFRI polypeptide; (c) a nucleic acid molecule that differs from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code; and (d) complements of (a), (b) or (c).

The preferred ZNFl98-FGFRI nucleic acid molecules have a sequence selected from the group consisting of SEQ ID NO: 1, and SEQ ID NO: 15 (GTTCCTACTACAGTTCCTGTTCCTGTGTCTGCTGACTCCAGTGCATCC). SEQ ID NO: 1 codes for the ZNFl98-FGFRI polypeptide of SEQ ID N0: 2; SEQ ID NO: 15 codes for the ZNF198-FGFRI polypeptide of SEQ ID NO: 16 (VPTTVPVPVSADSSAS) which is also contained within the sequence depicted in SEQ ID NO: 2.

According to yet another aspect of the invention, an isolated ZNF198-FGFRI nucleic acid molecule is provided which is selected from the group consisting of : (a) a unique fragment of a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 15 (of sufficient length to represent a sequence unique within the human genome); and (b) complements of (a), provided that the unique fragment includes a sequence of contiguous nucleotides which excludes a sequence selected from the group consisting of : (1) sequences having the SEQ ID

NOs or GenBank accession numbers of Table I or other previously published sequences as of the date of invention or the filing date of this application., (2) complements of (1), and (3) fragments of (1) and (2).

In certain embodiments, the sequence of contiguous nucleotides is selected from the group consisting of (1) at least two contiguous nucleotides nonidentical to the sequence group, (2) at least three contiguous nucleotides nonidentical to the sequence group, (3) at least four contiguous nucleotides nonidentical to the sequence group, (4) at least five contiguous nucleotides nonidentical to the sequence group, (5) at least six contiguous nucleotides nonidentical to the sequence group, (6) at least seven contiguous nucleotides nonidentical to the sequence group.

In other embodiments, the unique fragment has a size selected from the group consisting of at least: 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16 nucleotides, 18 nucleotides, 20, nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 75 nucleotides, 100 nucleotides, 200 nucleotides, 1000 nucleotides and every integer length therebetween.

According to another aspect of the invention, expression vectors comprising the ZNF198-FGFRI nucleic acid molecules disclosed herein operably joined to a promoter and host cells containing said expression vectors are provided. In certain preferred embodiments, the host cells are eukaryotic cells. As used herein, a coding sequence and regulatory sequences are said to be"operably"joined when they are covalently linked in such a way as to place the expression or transcription of the coding sequence under the influence or control of the regulatory sequences. If it is desired that the coding sequences be translated into a functional protein, two DNA sequences are said to be operably joined if induction of a promoter in the 5' regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region would be operably joined to a coding sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide.

The precise nature of the regulatory sequences needed for gene expression may vary between species or cell types, but shall in general include, as necessary, 5'non-transcribed and

5'non-translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. Especially, such 5'non-transcribed regulatory sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined gene. Regulatory sequences may also include enhancer sequences or upstream activator sequences as desired.

The vectors of the invention may optionally include 5'leader or signal sequences. The choice and design of an appropriate vector is within the ability and discretion of one of ordinary skill in the art.

Insertion of any of the nucleic acid sequences described herein into an appropriate vector allows production of large quantities of such sequences. Indeed, vectors, methods for inserting nucleic acids into vectors, and use of such vectors for production of desired nucleic acids, peptides and proteins are well known to those with skill in the art. Thus, the nucleic acid sequences disclosed herein can also be inserted into cloning and/or expression vectors to produce peptides and proteins according to the present invention.

Procedures and materials for preparation of replicable vectors, transformation of host cells with vectors, and host cell expression of polypeptides are described in Maniatis et al., Molecular Cloning: A laboratory manual, Cold Spring Harbor (1982) incorporated herein by reference. Any replicable vector known to those with skill in the art may be used to clone or amplify ZNFl98-FGFRI nucleic acids and/or to produce polypeptides encoded thereby. For example, suitable vectors include plasmids, phages, cosmids and artificial chromosomes. For example, bacteriophage lambda may be a useful cloning vector. This phage can accept pieces of foreign DNA up to about 20,000 base pairs in length. The lambda phage genome is a linear double stranded DNA molecule with single stranded complementary (cohesive) ends which can hybridize with each other when inside an infected host cell. The lambda DNA is cut with a restriction endonuclease and the foreign DNA, e.g., the DNA to be cloned, is ligated to the phage DNA fragments. The resulting recombinant molecule is then packaged into infective phage particles. Host cells are infected with the phage particles containing the recombinant DNA. The phage DNA replicates in the host cell to produce many copies of the desired DNA sequence.

Cosmids are hybrid plasmid/bacteriophage vectors which can be used to clone DNA fragments of about 40,000 base pairs. Cosmids have one or more DNA sequences called"cos" sites derived from bacteriophage lambda for packaging lambda DNA into infective phage

particles. Two cosmids are ligated to the DNA to be cloned. The resulting molecule is packaged into infective lambda phage particles and transfected into bacteria host cells. When the cosmids are inside the host cell they behave like plasmids and multiply under the control of a plasmid origin of replication. The origin of replication is a sequence of DNA which allows a plasmid to multiply within a host cell.

Yeast artificial chromosome vectors (YAC) are similar to plasmids but allow for the incorporation of much larger DNA sequences of about 400,000 base pairs. The yeast artificial chromosomes contain sequences for replication in yeast. The yeast artificial chromosome containing the DNA to be cloned is transformed into yeast cells where it replicates thereby producing many copies of the desired DNA sequence. Where phage, cosmids or yeast artificial chromosomes are employed as cloning vectors, expression of the fusion protein or ZNF198 may be obtained by culturing host cells that have been transfected or transformed with the cloning vector in a suitable culture medium.

Suitable host/vector systems are available for propagation of nucleic acid sequences and the expression of peptides and proteins. Replicable plasmids, viral vectors, and host cells such as CHO, COS, insect, yeast and bacterial are well-known for use in genetic engineering and can be used herein.

The isolated nucleic acid molecules disclosed herein have various utilities, including their use as probes and primers as diagnostic reagents for identifying the presence of ZNF198-FGFRI nucleic acids in biological or other samples, and as agents for generating ZNFl98-FGFRI polypeptides and ZNFl98-FGFRI binding agents (agents such as antibodies which selectively bind to a ZNFl98-FGFRI nucleic acid or to a ZNF198-FGFR1 polypeptide) that can be used as reagents in diagnostic and therapeutic assays to identify the presence, absence, and/or amounts of a ZNF198-FGFR1 nucleic acid or polypeptide in a biological or other sample. Thus, the foregoing ZNFl98-FGFRI nucleic acids, polypeptides, and binding agents can be used, inter alia, in the diagnosis or treatment of conditions characterized by the expression or presence of ZNF198-FGFR1 nucleic acid or polypeptide.

As used herein with respect to nucleic acids, the term"isolated"means: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector in

which 5'and 3'restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art.

As used herein with respect to polypeptides (discussed below), the term"isolated" means separated from its native environment in sufficiently pure form so that it can be manipulated or used for any one of the purposes of the invention. Thus, isolated means sufficiently pure to be used (i) to raise and/or isolate antibodies, (ii) as a reagent in an assay, or (iii) for sequencing, etc.

Homologs and alleles of the ZNFl98-FGFRI nucleic acids of the invention can be identified by conventional techniques. Thus, an aspect of the invention is those nucleic acid sequences which code for ZNFl98-FGFRI polypeptides and which hybridize to a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 15, under stringent conditions. The term"stringent conditions"as used herein refers to parameters with which the art is familiar. Nucleic acid hybridization parameters may be found in references which compile such methods, e. g. Molecular Cloning : A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F. M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. More specifically, stringent conditions, as used herein, refers, for example, to hybridization at 65°C in hybridization buffer (3.5 x SSC, 0.02% Ficoll, 0.02% polyvinyl pyrolidone, 0.02% Bovine Serum Albumin, 2.5mM NaH2PO4 (pH7), 0.5% SDS, 2mM EDTA). SSC is 0.15M sodium chloride/0.15M sodium citrate, pH7 ; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetraacetic acid. After hybridization, the membrane upon which the DNA is transferred is washed at 2 x SSC at room temperature and then at 0.1 x SSC/0.1 x SDS at temperatures up to 68°C.

There are other conditions, reagents, and so forth which can be used, and would result in a similar degree of stringency. The skilled artisan will be familiar with such conditions, and thus they are not given here. It will be understood, however, that the skilled artisan will be able

to manipulate the conditions in a manner to permit the clear identification of homologs and alleles of the ZNF198-FGFRI nucleic acids of the invention. The skilled artisan also is familiar with the methodology for screening cells and libraries for expression of such molecules which then are routinely isolated, followed by isolation of the pertinent nucleic acid molecule and sequencing.

In general homologs and alleles typically will share at least 40% nucleotide identity and/or at least 50% amino acid identity to SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In some instances sequences will share at least 50% nucleotide identity and/or at least 65% amino acid identity and in still other instances sequences will share at least 60% nucleotide identity and/or at least 75% amino acid identity. The homology can be calculated using various, publicly available software tools developed by NCBI (Bethesda, Maryland) that can be obtained through the internet (ftp:/ncbi. nlm. nih. gov/pub/). Exemplary tools include the BLAST system available at http://www. ncbi. nlm. nih. gov. Pairwise and ClustalW alignments (BLOSUM30 matrix setting) as well as Kyte-Doolittle hydropathic analysis can be obtained using the MacVetor sequence analysis software (Oxford Molecular Group). Watson-Crick complements of the foregoing nucleic acids also are embraced by the invention.

In screening for ZNF198-FGFRI related genes, such as homologs and alleles of ZNFl98-FGFRI, a Southern blot may be performed using the foregoing conditions, together with a radioactive probe. After washing the membrane to which the DNA is finally transferred, the membrane can be placed against X-ray film or a phosphoimager plate to detect the radioactive signal.

The invention also includes degenerate nucleic acids which include alternative codons to those present in the native materials. For example, serine residues are encoded by the codons TCA, AGT, TCC, TCG, TCT and AGC. Each of the six codons is equivalent for the purposes of encoding a serine residue. Thus, it will be apparent to one of ordinary skill in the art that any of the serine-encoding nucleotide triplets may be employed to direct the protein synthesis apparatus, in vitro or in vivo, to incorporate a serine residue into an elongating ZNFl98-FGFRI polypeptide. Similarly, nucleotide sequence triplets which encode other amino acid residues include, but are not limited to: CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA and AGG (arginine codons); ACA, ACC, ACG and ACT (threonine codons); AAC and AAT (asparagine codons); and ATA, ATC and ATT (isoleucine codons). Other amino acid residues may be encoded similarly by multiple nucleotide sequences. Thus, the invention

embraces degenerate nucleic acids that differ from the biologically isolated nucleic acids in codon sequence due to the degeneracy of the genetic code.

The invention also provides isolated unique fragments of a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 15. A unique fragment is one that is a'signature'for the larger nucleic acid. For example, the unique fragment is long enough to assure that its precise sequence is not found in molecules within the human genome outside of the ZNF198-FGFR1 nucleic acids defined above (and human alleles). Those of ordinary skill in the art may apply no more than routine procedures to determine if a fragment is unique within the human genome. The preferred unique fragments contain the ZNFl98-FGFRI fusion sequence.

Unique fragments of ZNF198-FGFR1 nucleic acids, however, exclude fragments completely composed of the nucleotide sequences of ZNF198 (SEQ ID NO: 3) or FGFRI (SEQ ID NO: 27). Unique fragments of ZNFl98-FGFRI nucleic acids also exclude fragments completely composed of the nucleotide sequences of any of GenBank accession numbers and SEQ ID NOs listed in Table I, or other previously published sequences as of the date of invention or the filing date of this application.

Unique fragments can be used as probes in Southern and Northern blot assays to identify such nucleic acids, or can be used in amplification assays such as those employing PCR. (See, e. g., the Examples.) As known to those skilled in the art, large probes such as 200,250,300 or more nucleotides are preferred for certain uses such as Southern and Northern blots, while smaller fragments will be preferred for uses such as PCR. Unique fragments also can be used to produce fusion proteins for generating antibodies or for determining binding of the polypeptide fragments, or for generating immunoassay components. Likewise, unique fragments can be employed to produce nonfused fragments of the ZNF198-FGFRI polypeptides, useful, for example, in the preparation of antibodies, immunoassays or therapeutic applications. Unique fragments further can be used as antisense molecules to inhibit the expression of ZNF198-FGFRI nucleic acids and polypeptides, respectively.

As will be recognized by those skilled in the art, the size of the unique fragment will depend upon its conservancy in the genetic code. Thus, some regions of SEQ ID NO: 1, SEQ ID NO: 15, and complements thereof will require longer segments to be unique while others will require only short segments, typically between 8 and 32 nucleotides long (e. g. 8,9,10,11,12, 28,29,30,31 and 32 bases) or more, up

to the entire length of the disclosed sequences. As mentioned above, this disclosure intends to embrace each and every fragment of each sequence, beginning at the first nucleotide, the second nucleotide and so on, up to within about 8 nucleotides short of the end, and ending anywhere from nucleotide number 8,9,10 and so on for each sequence, up to the very last nucleotide, (provided the sequence is unique as described above). Those skilled in the art are well versed in methods for selecting such sequences, typically on the basis of the ability of the unique fragment to selectively distinguish the sequence of interest from other sequences in the human genome of the fragment to those on known databases typically is all that is necessary, although in vitro confirmatory hybridization and sequencing analysis may be performed.

As mentioned above, the invention embraces antisense oligonucleotides that selectively bind to a nucleic acid molecule encoding a ZNF198-FGFRI polypeptide, to decrease ZNF198-FGFRI function. When using antisense preparations of the invention, slow intravenous administration is preferred.

As used herein, the term"antisense oligonucleotide"or"antisense"describes an oligonucleotide that is an oligoribonucleotide, oligodeoxyribonucleotide, modified oligoribonucleotide, or modified oligodeoxyribonucleotide which hybridizes under physiological conditions to DNA comprising a particular gene or to an mRNA transcript of that gene and, thereby, inhibits the transcription of that gene and/or the translation of that mRNA.

The antisense molecules are designed so as to interfere with transcription or translation of a target gene upon hybridization with the target gene or transcript. Antisense oligonucleotides that selectively bind to the ZNFl98-FGFRI fusion sequence are particularly preferred. Those skilled in the art will recognize that the exact length of the antisense oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence.

It is preferred that the antisense oligonucleotide be constructed and arranged so as to t bind selectively with the target under physiological conditions, i. e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological conditions. Based upon SEQ ID NO: 1 and/or SEQ ID NO: 15, or upon allelic or homologous genomic and/or cDNA sequences, one of skill in the art can easily choose and synthesize any of a number of appropriate antisense molecules for use in accordance with the present invention.

In order to be sufficiently selective and potent for inhibition, such antisense oligonucleotides should comprise at least about 10 and, more preferably, at least about 15 consecutive bases

which are complementary to the target, although in certain cases modified oligonucleotides as short as 7 bases in length have been used successfully as antisense oligonucleotides (Wagner et al., Nat. Med. 1 (11): 1116-1118,1995). Most preferably, the antisense oligonucleotides comprise a complementary sequence of 20-30 bases. Although oligonucleotides may be chosen which are antisense to any region of the gene or mRNA transcripts, in preferred embodiments the antisense oligonucleotides correspond to N-terminal or 5'upstream sites such as translation initiation, transcription initiation or promoter sites. In addition, 3'-untranslated regions may be targeted by antisense oligonucleotides. Targeting to mRNA splicing sites has also been used in the art but may be less preferred if alternative mRNA splicing occurs. In addition, the antisense is targeted, preferably, to sites in which mRNA secondary structure is not expected (see, e. g., Sainio et al., Cell Mol. Neurobiol. 14 (5): 439-457,1994) and at which proteins are not expected to bind. Finally, although, SEQ ID NO: 1 discloses a cDNA sequence, one of ordinary skill in the art may easily derive the genomic DNA corresponding to this sequence. Thus, the present invention also provides for antisense oligonucleotides which are complementary to the genomic DNA corresponding to SEQ ID NO: 1 and/or SEQ ID NO: 15. Similarly, antisense to allelic or homologous ZNFl98-FGFRI cDNAs and genomic DNAs are enabled without undue experimentation.

In one set of embodiments, the antisense oligonucleotides of the invention may be composed of"natural"deoxyribonucleotides, ribonucleotides, or any combination thereof. That is, the 5'end of one native nucleotide and the 3'end of another native nucleotide may be covalently linked, as in natural systems, via a phosphodiester internucleoside linkage. These oligonucleotides may be prepared by art recognized methods which may be carried out manually or by an automated synthesizer. They also may be produced recombinantly by vectors.

In preferred embodiments, however, the antisense oligonucleotides of the invention also 4 may include"modified"oligonucleotides. That is, the oligonucleotides may be modified in a number of ways which do not prevent them from hybridizing to their target but which enhance their stability or targeting or which otherwise enhance their therapeutic effectiveness.

The term"modified oligonucleotide"as used herein describes an oligonucleotide in which (1) at least two of its nucleotides are covalently linked via a synthetic internucleoside linkage (i. e., a linkage other than a phosphodiester linkage between the 5'end of one nucleotide and the 3'end of another nucleotide) and/or (2) a chemical group not normally associated with

nucleic acids has been covalently attached to the oligonucleotide. Preferred synthetic internucleoside linkages are phosphorothioates, alkylphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters and peptides.

The term"modified oligonucleotide"also encompasses oligonucleotides with a covalently modified base and/or sugar. For example, modified oligonucleotides include oligonucleotides having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3'position and other than a phosphate group at the 5'position. Thus modified oligonucleotides may include a 2'-O-alkylated ribose group.

In addition, modified oligonucleotides may include sugars such as arabinose instead of ribose.

The present invention, thus, contemplates pharmaceutical preparations containing modified antisense molecules that are complementary to and hybridizable with, under physiological conditions, nucleic acids encoding ZNFl98-FGFRI polypeptides, together with pharmaceutically acceptable carriers. Antisense oligonucleotides may be administered as part of a pharmaceutical composition. Such a pharmaceutical composition may include the antisense oligonucleotides in combination with any standard physiologically and/or pharmaceutically acceptable carriers which are known in the art. The compositions should be sterile and contain a therapeutically effective amount of the antisense oligonucleotides in a unit of weight or volume suitable for administration to a patient. The term"pharmaceutically acceptable"means a non- toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. The term"physiologically acceptable"refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism. The characteristics of the carrier will depend on the route of administration. Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art.

Since, as demonstrated herein, the ZNF198-FGFR1 fusion gene is found in both lymphomas and myeloid leukemia cells of patients, the oncogenic role of the fusion gene is clear. Without wishing to be bound by any particular theory, there are several mechanisms by which the ZNF198-FGFRI oncoprotein may mediate malignant transformation. One potential mechanism is constitutive activation of the FGFRI signal transduction pathways due to dimerization or oligomerization of the ZNF198-FGFRI oncoprotein. Oncogenic activation by dimerization has been demonstrated for several receptor tyrosine kinase oncoproteins, including

PDGFR, MET, and RET. See, e. g., Carroll et al., the TEL/platelet-derived growth factor beta receptor (PDGF, BR) fusion in chronic myelomonocytic leukemia is a transforming protein that self-associates and activates PDGF beta R kinase-dependent signaling pathways, Proc. Natl.

Acad. Sci. U. S. A. 93,14845-14850 (1996) ; Rodrigues, et al., Dimerization mediated through a leucine zipper activates the oncogenic potential of the met receptor tyrosine kinase, Mol. Cell Biol. 13,6711-6722 (1993); Santoro et al., Activation of RET as a dominant transforming gene by germline mutations of MEN2A and MEN2B, Science 267,381-383 (1995); and Tong et al., Leucine zipper-mediated dimerization is essential for the PTCI oncogenic activity. J. Biol.

Chem. 272,9043-9047 (1997). ZNFl98-FGFRI dimerization cannot result from ligand (FGF) binding, because the FGFRI extracellular and transmembrane domains are replaced by ZNF198 Cys-Cys-Cys-Cys zinc fingers in the ZNF198-FGFRI protein. However, there is convincing evidence that Cys-Cys-Cys-Cys zinc finger domains can dimerize in their native form. See, e. g., Luisi et al., Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA, Nature 352,497-505 (1991). The ZNF198 zinc fingers may mediate ligand-independent dimerization and constitutive tyrosine kinase activation of the ZNF198-FGFR1 oncoprotein.

The biologic effects of such activation may include constitutive activation of signal transduction cascades leading to uncontrolled proliferation of hematopoietic stem cells. In a second scenario, ZNF198-FGFRI may alter the activity of normal ZNF198 protein via heterodimer formation.

Since the ZNFI98-FGFRI oncogene is present in T-LL/AMC syndrome, methods of assaying for the presence of the gene and/or its expression products provide methods for detection of the syndrome. Assays which amplify and/or detect nucleic acids, peptides and proteins are well-known. Nucleic acid amplification techniques such as the polymerase chain reaction (PCR) may be utilized to increase the number of nucleic acids which encode all or portions such as unique fragments of the ZNFI98-FGFRI protein based on the one or more preexisting copies contained in a tissue sample. Nucleic acid detection techniques based on hybridization of labeled probes, e.g., fluorescent in-situ hybridization (FISH), are capable of detecting small amounts of target sequences and are extremely useful herein.

PCR amplification of either DNA or mRNA encoding the ZNFl98-FGFRI protein will increase detectable nucleic acid encoding ZNF198-FGFRI thereby providing a greater number of targets for detection with labeled probes. PCR techniques are well-known and described, for example, in Alberts et al., Molecular Biology of the Cell, 2nd ed., pp. 269-276 (1989), incorporated herein by reference. Briefly, PCR is performed by heating the sample to separate

complementary nucleic acid strands which are then annealed to complementary primer oligonucleotides which serve as primers for DNA synthesis catalyzed by polymerase enzymes between the primers. Multiple cycles of PCR provide multiple copies of the target sequence as long as the target sequence was originally present in the sample.

Thus, in one aspect, the present invention provides a method for amplifying and detecting the presence of ZNF198-FGFR1 nucleic acid sequence in a sample by contacting the sample with at least two nucleic acid amplification primers such that the first primer hybridizes to the nucleic acid sequence encoding ZNF198 or a complementary sequence thereto and the second primer hybridizes to the nucleic acid sequence encoding the tyrosine kinase domain of FGFR1 or a complementary sequence thereto; amplifying the primed nucleic acid sequences in the sample; and detecting the presence of amplified nucleic acid sequence in the sample.

An example of an amplification primer for ZNF198 is F/ZNF 198/154 (SEQ ID NO: 5) and an amplification primer for FGFR1 is R/FGFR1/1979 (SEQ ID NO: 6). It should be understood that amplification primers may be derived from any region of the ZNF198 sequence and any region of the FGFR1 sequence which encodes the tyrosine kinase binding domain including intronic DNA sequences, e. g., an FGFRI specific antisense primer designated R/FGFR1/2128 (SEQ ID NO: 7) and a ZNF198 sense primer designated F/ZNF 198/154 (SEQ ID NO: 5); or an intronic primer for FGFRI designated F/FGFR1/INTR (SEQ ID NO: 8) and intronic primers for ZNF198 designated F/ZNF 198/INTR (SEQ ID NO: 9) and R/ZNF198/INTR (SEQ ID NO: 10). The target sequence for amplification can include genomic DNA or mRNA which encode all or unique fragments of the ZNFl98-FGFRI DNA. It is apparent to those skilled in the art that other unique fragments derived from the ZNF198 and FGFRI nucleic acid sequences or sequences complementary thereto can also be used as primers.

Detection of a ZNF198-FGFR1 nucleic acid sequence containing the ZNFI98-FGFRI fusion sequence in a sample may be accomplished with any technique known to those with skill in the art. Since the ZNFl98-FGFRI nucleic acid sequence is known in accordance with the present invention, existing detection techniques for amplified or unamplified nucleic acid such as in situ hybridization, Southern blotting of DNA, Northern blotting of RNA and PCR assays can be utilized. Immuno-histochemical detection methods are also utilizable herein. Size separation techniques such as electrophoresis may be utilized to resolve nucleic acids, peptides and/or proteins prior to institution of other detection techniques.

Nucleic acid probes for hybridization which are derived from ZNF198-FGFRI can be synthesized on an oligonucleotide synthesizer such as those commercially available from Applied Biosystems (California). DNA or RNA probes can also be derived by PCR using two primers from the ZNF198-FGFRI gene.

Thus, in accordance with the present invention, a ZNF198-FGFRI nucleic acid sequence (containing a ZNF198-FGFRI fusion sequence) contained within a sample can be detected by contacting the sample with a first and a second nucleic acid probe wherein the first probe hybridizes to the nucleic acid sequence encoding ZNF198 and the second probe hybridizes to the nucleic acid sequence encoding the ZNF198 tyrosine kinase domain, and detecting the presence of a nucleic acid sequence within the sample that hybridizes to both the first and the second probes. Alternatively, a single probe which spans the translocation fusion juncture can be utilized to detect the presence of the ZNF198-FGFRI fusion sequence in a sample. Thus, the presence of a ZNF198-FGFRI nucleic acid sequence can be detected by contacting the sample with a nucleic acid probe which spans and hybridizes to the translocation fusion juncture of the ZNF198-FGFRI gene and detecting the presence of nucleic acid sequences in the sample which hybridize to the probe.

As is well-known in the art, probes utilized in the detection of ZNF198-FGFRI nucleic acid sequences can be labeled directly by attaching a label to the probe or indirectly by causing a labeled binding partner to couple to the probe after hybridization. Examples of labels include fluorochromes such as fluorescein, Texas Redut and green fluorescent protein, enzymes such as horse radish peroxidase and radioactive isotopes. Signal amplification systems may also be utilized herein, e. g., avidin, streptavidin and biotin complexes or antibody hapten complexes.

Such methods and systems are well known and are discussed generally, e. g., in Alberts et al., Molecular Biology of the Cell, 2nd ed., pp. 174 through 193, incorporated herein by reference.

The availability of different labels provides convenient techniques for determining the presence of the ZNF198-FGFRI gene when, e. g., a first label is directed to the ZVF7P-derived sequence via a probe and a second different label is directed to the FGFRI-derived sequence via a probe thus allowing visualization of different colors to confirm the fusion of ZNF198 and FGFR1 sequences to each other. For example, a green fluorescent protein label appears as one color and Texas Red (O appears as another color when using fluorescence, microscopy, spectrophotometry, fluorescent plate readers and flow sorters. Observation of distinct colors in close proximity confirms the presence of the ZNFl98-FGFRI oncogene.

According to yet another aspect of the invention, an isolated ZNF198-FGFRI polypeptide is provided. The isolated ZNF198-FGFRI polypeptide molecule is encoded by one or more ZNF198-FGFRI nucleic acid molecules of the invention. Preferably, the isolated ZNF198-FGFRI polypeptides of the invention are encoded by the nucleic acid molecule of SEQ ID NO: 1 or a unique fragment thereof containing the ZNF198-FGFRI fusion sequence. In yet other embodiments, the isolated ZNF198-FGFRI polypeptides of the invention have the amino acid sequence of SEQ ID NO: 2, or unique fragments thereof containing the ZNF198-FGFRI polypeptide fusion sequence. The isolated ZNFl98-FGFRI polypeptides are of sufficient length to represent a sequence unique within the human genome. Thus, the preferred embodiments include a sequence of contiguous amino acids, provided that the unique fragment includes a sequence of contiguous nucleotides which excludes a sequence selected from the group consisting of : (1) sequences having the SEQ ID NOs or GenBank accession numbers of Table I or other previously published sequences as of the date of invention or the filing date of this application.

In the preferred embodiments, the isolated ZNF198-FGFRI polypeptides are immunogenic and can be used to generate binding agents (e. g., binding polypeptides such as antibodies) for use in diagnostic and therapeutic applications. Such binding agents also are useful for detecting the presence, absence, and/or amounts of a ZNF198-FGFRI polypeptide in a sample such as a biological fluid or biopsy sample. Preferably, the ZNF198-FGFRI polypeptides that are useful for generating binding polypeptides are unique polypeptides and, therefore, binding of the antibody to a ZNF198-FGFRI polypeptide in a sample is selective for the ZNF198-FGFRI polypeptide.

A unique fragment of an ZNFl98-FGFRI polypeptide, in general, has the features and characteristics of unique fragments as discussed above in connection with nucleic acids. As will be recognized by those skilled in the art, the size of the unique fragment will depend upon factors such as whether the fragment constitutes a portion of a conserved protein domain. Thus, some regions of SEQ ID NO: 2 and/or SEQ ID NO: 16 will require longer segments to be unique while others will require only short segments, typically between 5 and 12 amino acids (e. g. 5,6, 7,8,9,10,11 and 12 amino acids long or more, including each integer up to the full length, >1,000 amino acids long). Virtually any segment of SEQ ID NO: 2 and/or SEQ ID NO: 16, excluding the ones that share identity with it (e. g., the ZNF198 polypeptide, the FGFR1 polypeptide, and fragments of the foregoing, or other polypeptides published prior to the

invention or application filing date) that is 9 or more amino acids in length will be unique.

One important aspect of a unique fragment is its ability to act as a signature for identifying the polypeptide. Another is its ability to provide an immune response in an animal.

Those skilled in the art are well versed in methods for selecting unique amino acid sequences, typically on the basis of the ability of the unique fragment to selectively distinguish the sequence of interest from unrelated proteins. A comparison of the sequence of the fragment to those on known databases typically is all that is necessary.

The invention embraces variants of the ZNF198-FGFRI polypeptides described above.

As used herein, a"variant"of a ZNF198-FGFRI polypeptide is a polypeptide which contains one or more modifications to the primary amino acid sequence of a ZNF198-FGFRI polypeptide. Modifications which create a ZNF198-FGFRI polypeptide variant are typically made to the nucleic acid which encodes the ZNF198-FGFRI polypeptide, and can include deletions, point mutations, truncations, amino acid substitutions and addition of amino acids or non-amino acid moieties to: 1) reduce or eliminate a functional activity of a ZNF198-FGFRI polypeptide; 2) enhance a property of a ZNF198-FGFRI polypeptide, such as protein stability in an expression system or the stability of protein-protein binding; 3) provide a novel activity or property to a ZNF198-FGFRI polypeptide, such as addition of an antigenic epitope or addition of a detectable moiety; or 4) to provide equivalent or better binding to a ZNF198-FGFRI polypeptide cognate molecule. Alternatively, modifications can be made directly to the polypeptide, such as by cleavage, addition of a linker molecule, addition of a detectable moiety, such as biotin, addition of a fatty acid, and the like. Modifications also embrace fusion proteins comprising all or part of the ZNF198-FGFRI amino acid sequence. One of skill in the art will be familiar with methods for predicting the effect on protein conformation of a change in protein sequence, and can thus"design"a variant ZNF198-FGFRI polypeptide according to known methods. One example of such a method is described by Dahiyat and Mayo in Science 278:82-87, 1997, whereby proteins can be designed denovo. The method can be applied to a known protein to vary only a portion of the polypeptide sequence. By applying the computational methods of Dahiyat and Mayo, specific variants of a ZNF198-FGFRI calcium channel polypeptide can be proposed and tested to determine whether the variant retains a desired conformation.

Variants can include ZNF198-FGFRI polypeptides which are modified specifically to alter a feature of the polypeptide unrelated to its physiological activity. For example, cysteine

residues can be substituted or deleted to prevent unwanted disulfide linkages. Similarly, certain amino acids can be changed to enhance expression of a ZNF198-FGFRI polypeptide by eliminating proteolysis by proteases in an expression system.

Mutations of a nucleic acid which encodes a ZNF198-FGFR1 polypeptide preferably preserve the amino acid reading frame of the coding sequence and, preferably, do not create regions in the nucleic acid which are likely to hybridize to form secondary structures, such a hairpins or loops, which can be deleterious to expression of the variant polypeptide.

Mutations can be made by selecting an amino acid substitution, or by random mutagenesis of a selected site in a nucleic acid which encodes the polypeptide. Variant polypeptides are then expressed and tested for one or more activities to determine which mutation provides a variant polypeptide with the desired properties. Further mutations can be made to variants (or to non-variant ZNF198-FGFRI polypeptides) which are silent as to the amino acid sequence of the polypeptide, but which provide preferred codons for translation in a particular host. Still other mutations can be made to the noncoding sequences of a ZNFl98-FGFRI gene or cDNA clone to enhance expression of the polypeptide.

The skilled artisan will realize that conservative amino acid substitutions may be made in ZNF198-FGFRI polypeptides to provide functionally equivalent variants of the foregoing polypeptides, i. e, the variants retain the functional capabilities of the ZNF198-FGFRI polypeptides. As used herein, a"conservative amino acid substitution"refers to an amino acid substitution which does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for altering polypeptide sequence known to one of ordinary skill in the art such as are found in references which compile such methods, e. g. Molecular Cloning: A Laboratory Manual, J.

Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F. M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Exemplary functionally equivalent variants of the ZNFI98-FGFRI polypeptides include conservative amino acid substitutions of SEQ ID NO: 2.

Conservative substitutions of amino acids include substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.

Thus functionally equivalent variants of ZNF198-FGFRI polypeptides, i. e., variants of ZNF198-FGFRI polypeptides which retain the function of the natural ZNF198-FGFRI

polypeptides, are contemplated by the invention. Conservative amino-acid substitutions in the amino acid sequence of ZNF198-FGFRI polypeptides to produce functionally equivalent variants of ZNF198-FGFRI polypeptides typically are made by alteration of a nucleic acid encoding ZNF198-FGFRI polypeptides (e. g., SEQ ID NOs: 1,15). Such substitutions can be made by a variety of methods known to one of ordinary skill in the art. For example, amino acid substitutions may be made by PCR-directed mutation, site-directed mutagenesis according to the method of Kunkel (Kunkel, Proc. Nat. Acad Sci. U. S. A. 82: 488-492,1985), or by chemical synthesis of a gene encoding a ZNF198-FGFRI polypeptide. The activity of functionally equivalent fragments of ZNF198-FGFRI polypeptides can be tested by cloning the gene encoding the altered ZNF198-FGFRI polypeptide into a bacterial or mammalian expression vector, introducing the vector into an appropriate host cell, expressing the altered ZNF198-FGFRI polypeptide, and testing for a functional capability of the ZNF198-FGFRI polypeptides as disclosed herein.

The ZNF198-FGFRI polypeptides may be purified from cells which naturally produce the polypeptide by chromatographic means or immunological recognition. Alternatively, an expression vector may be introduced into cells to cause production of the polypeptide. In another method, mRNA transcripts may be micro injected or otherwise introduced into cells to cause production of the encoded polypeptide. Translation of ZNF198-FGFRI mRNA in cell-free extracts such as the reticulocyte lysate system also may be used to produce ZNFl98-FGFRI polypeptides. Those skilled in the art also can readily follow known methods for isolating ZNF198-FGFRI polypeptides. These include, but are not limited to, immunochromatography, HPLC, size-exclusion chromatography, ion-exchange chromatography and immune-affinity chromatography.

The invention also provides, in certain embodiments,"dominant negative"polypeptides derived from ZNF198-FGFR1 polypeptides. A dominant negative polypeptide is an inactive variant of a protein, which, by interacting with the cellular machinery, displaces an active protein from its interaction with the cellular machinery or competes with the active protein, thereby reducing the effect of the active protein. The end result of the expression of a dominant negative polypeptide in a cell is a reduction in function of active proteins. One of ordinary skill in the art can assess the potential for a dominant negative variant of a protein, and using standard mutagenesis techniques to create one or more dominant negative variant polypeptides.

See, e. g., U. S. Patent No. 5,580,723 and Sambrook et al., 1989, MolecularCloning. A

Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press. The skilled artisan then can test the population of mutagenized polypeptides for diminution in a selected and/or for retention of such an activity. Other similar methods for creating and testing dominant negative variants of a protein will be apparent to one of ordinary skill in the art.

According to another aspect of the invention, isolated ZNF198-FGFRI binding agents (e. g., binding polypeptides such as antibodies) which selectively bind to a ZNFl98-FGFRI nucleic acid molecule or to a ZNFl98-FGFRI polypeptide encoded by the isolated nucleic acid molecules of the invention are provided. Preferably, the isolated binding agents selectively bind to a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ; ID NO: 15; or to a polypeptide having a sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 16, or to unique fragments of the foregoing nucleic acids and polypeptides. In the preferred embodiments, the isolated binding polypeptides include antibodies and fragments of antibodies (e. g., Fab, F (ab) 2, Fd and antibody fragments which include a CDR3 region which binds selectively to a ZNFl98-FGFRI nucleic acid or polypeptide). Preferably, the antibodies for human therapeutic applications are human antibodies.

As is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W. R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I.

(1991) Essential Immunologv, 7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc'region has been enzymatically cleaved, or which has been produced without the pFc'region, designated an F (ab') 2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule.

Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope-binding ability in isolation.

Within the antigen-binding portion of an antibody, as is well-known in the art, there are

complementarity determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity determining regions (CDR1 through CDR3). The CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3, are largely responsible for antibody specificity.

It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of"humanized"antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc'regions to produce a functional antibody. Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized murine RSV antibodies in which at least a portion of the murine FR regions have been replaced by FR regions of human origin. Such antibodies, including fragments of intact antibodies with antigen-binding ability, are often referred to as"chimeric"antibodies.

Thus, as will be apparent to one of ordinary skill in the art, the present invention also provides for F (ab') 2, Fab, Fv and Fd fragments; chimeric antibodies in which the Fc and/or FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric F (ab') 2 fragment antibodies in which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric Fab fragment antibodies in which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; and chimeric Fd fragment antibodies in which the FR and/or CDR1 and/or CDR2 regions have been replaced by homologous human or non-human sequences. The present invention also includes so-called single chain antibodies.

Thus, the invention involves binding polypeptides of numerous size and type that bind selectively to ZNF198-FGFRI polypeptides, and complexes containing ZNF198-FGFRI polypeptides. These binding polypeptides also may be derived also from sources other than antibody technology. For example, such polypeptide binding agents can be provided by degenerate peptide libraries which can be readily prepared in solution, in immobilized form, as bacterial flagella peptide display libraries or as phage display libraries. Combinatorial libraries

also can be synthesized of peptides containing one or more amino acids. Libraries further can be synthesized of peptides and non-peptide synthetic moieties.

Phage display can be particularly effective in identifying binding peptides useful according to the invention. Briefly, one prepares a phage library (using e. g. ml3, fd, or lambda phage), displaying inserts from 4 to about 80 amino acid residues using conventional procedures. The inserts may represent, for example, a completely degenerate or biased array.

One then can select phage-bearing inserts which bind to the ZNF198-FGFRI polypeptide or a complex containing a ZNFl98-FGFRI polypeptide. This process can be repeated through several cycles of reselection of phage that bind to the ZNF198-FGFRI polypeptide or complex.

Repeated rounds lead to enrichment of phage bearing particular sequences. DNA sequence analysis can be conducted to identify the sequences of the expressed polypeptides. The minimal linear portion of the sequence that binds to the ZNF198-FGFR1 polypeptide or complex can be determined. One can repeat the procedure using a biased library containing inserts containing part or all of the minimal linear portion plus one or more additional degenerate residues upstream or downstream thereof. Yeast two-hybrid screening methods also may be used to identify polypeptides that bind to the ZNF198-FGFRI polypeptides. Thus, the ZNF198-FGFRI polypeptides of the invention, or a unique fragment thereof, or complexes of ZNF198-FGFRI can be used to screen peptide libraries, including phage display libraries, to identify and select peptide binding polypeptides that selectively bind to the ZNFl98-FGFRI polypeptides of the invention. Such molecules can be used, as described, for screening assays, for purification protocols, for interfering directly with the functioning of ZNF198-FGFR1 and for other purposes that will be apparent to those of ordinary skill in the art.

A ZNF198-FGFR1 polypeptide, or a unique fragment thereof, also can be used to isolate naturally occurring, polypeptide binding partners which may associate with the ZNFl98-FGFRI polypeptide in a cell. Isolation of binding partners may be performed according to well-known w methods. For example, isolated ZNFl98-FGFRI polypeptides can be attached to a substrate, and then a solution suspected of containing an ZNFI98-FGFRI binding partner may be applied to the substrate. If the binding partner for ZNF198-FGFR1 polypeptides is present in the solution, then it will bind to the substrate-bound ZNF198-FGFR1 polypeptide. The binding partner then may be isolated. Other proteins which are binding partners for ZNF198-FGFR1, may be isolated by similar methods without undue experimentation.

The invention also provides novel kits which could be used to measure the levels of the

nucleic acids of the invention, expression products of the invention or anti-ZNF198-FGFRI antibodies. In the case of nucleic acid detection, pairs of primers for amplifying ZNF198-FGFRI nucleic acids can be included. The preferred kits would include controls such as known amounts of nucleic acid probes, ZNF198-FGFRI epitopes (such as ZNF198-FGFR1 expression products) or anti-ZNFl98-FGFRI antibodies, as well as instructions or other printed material. In certain embodiments the printed material can characterize the risk of developing a disorder, e. g., SCLL, that is characterized by aberrant ZNFl98-FGFRI polypeptide expression based upon the outcome of the assay. The reagents may be packaged in containers and/or coated on wells in predetermined amounts, and the kits may include standard materials such as labeled immunological reagents (such as labeled anti-IgG antibodies) and the like. One kit is a packaged polystyrene microtiter plate coated with a ZNFl98-FGFRI polypeptide and a container containing labeled anti-human IgG antibodies. A well of the plate is contacted with, for example, serum, washed and then contacted with the anti-IgG antibody. The label is then detected. A kit embodying features of the present invention is comprised of the following major elements: packaging an agent of the invention, a control agent, and instructions.

Packaging is a box-like structure for holding a vial (or number of vials) containing an agent of the invention. a vial (or number of vials) containing a control agent, and instructions.

Individuals skilled in the art can readily modify packaging to suit individual needs.

In another aspect, a ZNFl98-FGFRI nucleic acid and the corresponding encoded polypeptide can be detected using binding agents such as antibodies, labels on antibodies, fragments of antibodies (embraced within the definition of antibodies, herein) and labels, and signal amplification techniques involving antibodies. Indeed, it is well-known to use immunochemical techniques to detect target nucleic acids, peptides and proteins and such techniques are well-suited for use herein. Antibodies which are immunoreactive to portionsZNF198-FGFR1or thereof or to the ZNF198-FGFR1 protein or portions thereof are generated by known techniques, e.g., by immunization of animals such as mice with ZNFl98-FGFRI nucleic acids, or polypeptides, or fragments thereof which include the translocation fusion juncture. Polyclonal and monoclonal antibodies may be generated using immortal cell lines for continuous production. Antibodies to ZNFl98-FGFRI nucleic acid or to the ZNFl98-FGFRI polypeptide or to unique fragments of each which include the translocation fusion juncture are then conjugated to labels such as those described herein. Alternatively, if the so-called primary antibody is not labeled, it can be detected with a second labeled antibody

which is immunoreactive with the first antibody.

Thus, ZNFl98-FGFRI or fragments thereof which include the translocation fusion juncture can be detected in a sample using antibodies by contacting the sample with one antibody which binds to ZNF198 and another antibody which binds the tyrosine kinase domain of FGFR1 and detecting the presence of protein which binds to both antibodies. Alternatively, ZNFl98-FGFRI or unique fragments thereof which include the translocation fusion juncture can be detected in a sample by contacting the sample with at least one antibody which binds to an epitope in the locus of the translocation fusion juncture and detecting the presence of proteins which bind to the antibody. Detection of such bound antibodies and proteins or peptides is accomplished by techniques well known to those skilled in the art. Use of hapten conjugates such as digoxigenin or dinitrophenyl is also well suited herein. Antibody/antigen complexes which form in response to hapten conjugates are easily detected by linking a label to the hapten or to antibodies which recognize the hapten and then observing the site of the label.

It should be understood that kits which include reagents that are used to detect ZNF198-FGFR1 nucleic acid sequence and polypeptides encoded thereby can be assembled which provide convenient access and use in clinical settings. For example, a kit can include a container which holds one or more amplification primers, a container which holds enzymes used for amplification, a container which holds washing solution (s), a container which holds detection reagents, and a sample well. Alternatively, a kit can include a container which holds one or more antibodies directed to a ZNF198 nucleic acid or polypeptide, a container which holds one or more antibodies directed to the FGFRI tyrosine kinase domain or the peptide or protein encoded thereby, a container which holds washing solution (s), a container which holds detection reagents, and a sample well. Alternatively, antibody contained in the container can be directed to an epitope in the locus of the translocation fusion juncture of ZNF198-FGFR1 or the protein encoded thereby. It is also contemplated that a kit can include a container having one or more labeled or unlabeled probes capable of hybridizing to the ZNF198 gene or corresponding mRNA, a container having one or more labeled or unlabeled probes capable of hybridizing to the FGFR1 nucleic acid sequence encoding the tyrosine kinase or corresponding mRNA and, if the probe is unlabeled, a container having a labeled specific binding partner of the probe or to a recognition site on the probe, e. g., biotinylated probe, a container which holds washing solution (s), a container which holds detection reagents, and a sample well. Alternatively, a kit may contain a single probe which is capable of hybridizing to the translocation fusion juncture

of ZNF198-FGFRI along with other suitable components such as washing solution and the like.

Examples of detection reagents include radiolabeled probes, enzymatic labeled probes (horse radish peroxidase, alkaline phosphatase), and affinity labeled probes (biotin, avidin, or streptavidin). For antibodies, examples of detecting reagents include, but are not limited to, labeled secondary antibodies or antibody fragments or, if the primary antibody is labeled, the chromophoric, enzymatic, or antibody binding reagents which are capable of reacting with the labeled antibody. The antibodies, primers and nucleic acid probes described herein can readily be incorporated into one of the established kit formats which are well known in the art.

Molecular characterization of ZNF198-FGFR1 nucleic acid and protein encoded thereby allows production of therapeutic agents which selectively locate and/or destroy cells containing the fusion gene, its mRNA or corresponding protein. For example, radiolabeled antibodies or fragments of antibodies which bind to the gene, mRNA or corresponding protein can be injected into a patient suspected of having SCLL syndrome. Since the injected radiolabeled antibodies or antibody fragments collect in the area of cells having the gene, mRNA or corresponding protein, such cells may be detected and localized within a patient by observing the locus of radioactivity generated by the antibodies or fragments of antibodies. Methods of cancer localization using radiolabeled antibodies or fragments of antibodies (radioimmunodetection) are well-known in the art. See, e. g., U. S. Patent No. 4,348,376 incorporated herein by reference.

Cells containing the ZNF198-FGFRI nucleic acid or protein encoded thereby may be selectively destroyed by conjugating toxins to antibodies or fragments of antibodies which bind to the gene or protein. Thus, by injecting a toxin/antibody or toxin/antibody fragment conjugate into a patient having ZNF198-FGFRI nucleic acid or protein encoded thereby, wherein the antibody or antibody fragment is directed to ZNFl98-FGFRI nucleic acid or protein encoded thereby, cells containing the fusion sequence or protein are preferentially destroyed by the toxin t which binds to the locus of the fusion sequence or protein. In this manner, lfocal delivery of the toxin can be effected which avoids widespread toxicity and typical resulting adverse reaction to generalized systemic administration of toxins in chemotherapy. Use of toxin conjugates antibodies or toxin conjugates antibody fragments is well-known in the art. See, e. g., U. S. Pat.

No. 4,671,958, incorporated herein by reference. Examples of suitable toxins include those derived from diphtheria toxin, ricin and the like.

In another aspect, production of ZNF198-FGFRI protein is inhibited by addition of

antisense RNA to cells which produce ZNF198-FGFRI protein. Thus, DNA is introduced into cells producing ZNF198-FGFRI protein, the DNA being configured to produce antisense RNA that is complementary to ZNF198-FGFR1 mRNA. Such antisense mRNA hybridizes with the sense ZNF198-FGFRI mRNA thereby inhibiting synthesis of ZNF198-FGFR1 protein.

Methods of producing antisense mRNA and use thereof for inhibition of protein sequences are well-known in the art. Indeed, expression vectors are constructed to produce high levels of antisense RNA in transfected cells. This approach has led to reduced expression of oncogenes in exemplary instances whereby antisense oncogene constructs have reverted the growth properties of tumor cells to near normal, slowed their growth or induced apoptosis. See Watson et al., Recombinant DNA, 2d ed., 1992. For example, Philadelphia human chronic myelogenous leukemia (CML) cells that contain the BCR/ABL translocation have been eradicated using antisense molecules targeted to this oncogene in clinical, pre-clinical, and laboratory settings. J.

Nat'l. Cancer Inst. Vol. 89, No. 2, January 15,1997. A similar approach is provided for the ZNFl98-FGFRl oncogene. For example, bone marrow contaminated with tumor cells harboring the ZNFl98-FGFRI oncogene is treated ex vivo with antisense molecules directed at the oncogene mRNA to induce apoptosis thereby purging the marrow of tumor cells prior to an autologous bone marrow transplant.

In another aspect, ribozymes, which are catalytic RNA sequences that cleave specific RNA molecules, are used to disrupt translation involving the ZNF198-FGFR1 oncogene.

Several studies have demonstrated that ribozymes can be employed to inhibit oncogene expression, cell growth or induce apoptosis in tumor cell lines. U. S. Patent No, 5,635,385 to Leopold, et al., incorporated herein by reference, describes a therapeutic method for the treatment of a leukemia patient resulting from a chromosomal translocation (BCR/ABL) using a ribozyme that cleaves the oncogene mRNA and inhibits the expression of the gene. A similar approach is employed according to the present invention using a synthetic ribozyme targeted to the ZNF198-FGFRI oncogene.

In yet another aspect, triplex forming oligonucleotides and RNA-DNA hybrid technology is used to disrupt or otherwise modify the ZNFl98-FGFRI oncogene.

Deoxyoligonucleotides and RNA-DNA hybrids are designed to bind directly to duplex DNA in a sequence-specific manner. Once bound, they can either prevent transcription, alter a specific base sequence to correct a mutation or mutagenize a sequence to disrupt function of the gene or its regulatory elements. This has been achieved in a number of model systems. See, e. g., J.

Biol. Chem. Vol. 271, No. 24 (1996). A similar approach is employed according to the present invention using triplex forming oligonucleotides and RNA-DNA hybrids targeted to the ZNFl98-FGFRI oncogene or its regulatory elements. For example, triplex forming oligonucleotides are designed to bind to a relatively polypurine stretch of nucleotides adjacent to the target area. The oligonucleotide is configured to serve as a carrier of DNA for the induction of recombination to insert a mutation or carry a DNA interacting agent (e. g., Mitomycin C) to directly mutagenize either the coding region or the regulatory region of the ZNFl98-FGFRI oncogene to disable its function or induce apoptosis.

It is also contemplated that the ZNF198-FGFR1 oncogene may be used in gene transfer studies by the transfer of the genomic DNA or cDNA of the gene into target cells to serve as a transforming agent for the production of vaccines, induction of apoptosis or other indications.

In one aspect, the ZNFl98-FGFRI oncogene is used to generate non-human transgenic animals which are useful in studying SCLL syndrome by providing animal models of the disease.

Methods of creating transgenic animals are well known in the art. For example, U. S. Patent No.

4,873,191, incorporated herein by reference, describes genetic transformation of zygotes.

Following such procedures, the ZNF198-FGFRI oncogene is micro injected into the nucleus of a zygote which is then allowed to undergo differentiation and development into a mature organism. Transgenic non-human animals such as mice or pigs whose somatic and germ line cells contain the ZNF198-FGFRI oncogene result in such animals having SCLL syndrome.

Such animals are useful animal models for SCLL syndrome which allow further development and testing of treatment modalities.

The invention also discloses the nucleic acid and predicted amino acid sequence for a novel gene, referred to herein as"ZNF198". The summary of the invention provides various aspects of the invention which are based upon the discovery of this novel gene. Accordingly, the invention provides isolated ZNF198 nucleic acid molecules, unique fragments thereof, expression vectors containing the foregoing, host cells containing the foregoing, isolated ZNF198 polypeptides, and unique fragments thereof. The invention also provides isolated binding agents which selectively bind such ZNF198 nucleic acids and ZNF198 polypeptides, including antibodies, and pharmaceutical compositions containing the foregoing molecules.

The terms,"unique fragments"and"isolated"as defined in reference to the ZNF198-FGFR1 nucleic acid and polypeptides have the same meanings as defined in reference to the ZNF198 nucleic acid and polypeptides disclosed herein. In general, each of the methods described above

in reference to the ZNFl98-FGFRI invention can be applied to the ZNF198 invention by, for example, substituting the ZNF198 nucleic acids and polypeptides for the ZNFl98-FGFRI nucleic acids and polypeptides in the above-described methods. For example. binding agents that selectively bind to the ZNF198 nucleic acid or polypeptide can be used for diagnostic applications, in vivo or in vitro, to identify the presence and/or amount of a ZNF198 nucleic acid or expression product thereof in a subject or in a biological sample obtained from a subject.

Accordingly, the compositions of the invention that are directed to the ZNF198 nucleic acid or ZNF198 polypeptide can be used, inter alia, in the diagnosis or treatment of conditions, such as SCLL, that are characterized by the aberrant expression levels and/or the presence of a ZNF198 nucleic acid or polypeptide.

TABLE IA. SEQ ID NO: 15 Blast Sequences AF035374, AJ224901, AF060181, Y13472, AF012126, X52833, X57121, M37722, M63889, Y00665, M63887, X57119, M60485, X66945, M34641, M63888, X57120, X57122, M34186, M34185, X51803, M28998, U22324, M65053, X51893, U23445, M33760, AL021816, D89168, AF029147, U06981, AC005246, AF058409, L19869, X60282, X58546, L19870, X60281, Z69722, X74332, L37101, AC005384, Y09236 AA067236, AA388928, AA637508, AA681096, AA675674, AA793734, AA690226, AA739329, W74888, AA068789, C85744, AA462379, AA536690, AA276218, AI159501, AA407086, AU019813, AA142746, AA410165, AA789977, AA270665, AA274134, AI117442, AU044212, AA798100, AA 174702, AA734284, AI180716, AA793012 M78197, AI299047, AA130286, AA425848, AA428400, W56354, AA370467, W85780, T28188, AI201914, AA779084, W93560, AA196510, T03427, AA613252, R32612, W81363, AI216700, AA594234, H17048, AA513778, AA130195, AA778690, AA643895, W56380 AI296173, AI293407, AI297385, AI293430, AI296042, AI296580, AI007716, F23192, AA606010, H33896, AA785295, A1228033 A29216, 166313, E03799,E03335, AR020617, AR007137, AR007135, I38462, A31598, A58395, E05543, I96182, I67864, AR018808, I57339, I67863, A37262, E07930, E05541, E05544

TABLE IB. SEQ ID NO: 1 Blast Sequences X66945, M34185, M34186, M34641, M63887, M60485, M37722, AF012126, X51803, M63888, X52833, Y00665, X57122, X57121, X57120, X57119, AF035374, AJ224901, AF060181, Y13472, S54008, M33760, X51893, D12498, M28998, M65053, U23445, U22324, M24637, M63889, AJ004952, M58051, M64347, U58466, X58255, S56291, AF024638, X59380, X75603, X76885, M35195, Z35138, Z35139, D13552, L19109, L19868, L03840, X57205, M23362, X55441, M86441, M63503, Z68150, M87770, X52832, Z69641, M87771, M97193, M35718, X56191, M55614, L19870, L19869, M80634, M81342, X65943, U24491, M62322, X59927, X61692, M91599, D17225, X74332, D13553, L19110, AB007035, M59373, M59374, M55163, D13551, D13550, U23839, X65059, U59800, Y16161, X61992, M35196, Z68149, Y16166, AB007036, D31761, Y13901, Y16165, L07296, J03278, M21616, U52463, X89807, X04367, AB007037 AA981374, AA542013, AA645339, AA681096, AA104915, AA692210, AA981061, W11596, AA793734, AA518712, AA822965, AA266222, AA060259, AA675674, AA044482, AA388928, AA068167, AA044486, AA119481, AI326934, AI152737, AA067236, AA790472, AA272097, AA472371, AA690226, AA637508, AA545105, AI325368, W34175, AF064932, AA510671, AA171195, AA437687, AI036016, i AA423307, AA591866, AA616115, AI324400, AA816181, AI155034, AA616214, AA711529, AA145951, AA276844, AA437673, AA692051, AI159428, AI116024, AA869202, W78531, AA561631 AI002948, AI126344, AI005374, AA446431, AI341373, AI338128, AI049904, AA442053, AA922587, AI092048, AA288012, AA441940, AA757478, AA419611, AI341329, AA446123, AA152209, R54610, AA910578, AA731115, AA545799, AA088648, AA088248, R80475, AI074256, AI341894, AA598537, AA939114, AA738073, AA372212, T29711, AA902794, AA643845, AA232084, AA599664, AA774439, AA435557, AA419484, AA658115, T28486, AA678868, AI085805, AI050058, R54846, AA635556, AA152243, H87878, H89538, AA446994, H89352, AA706746, F12130, H89545, W25267, AI127918, H89359, R80670, T84335, AA621461, T28903, AA039600, F05643, AA902796, R13671, R07269, AI266461, H87341, AA022483, AA551848, AA516449, M78197, T20118, AA442030, AA223868, T20119, R92676, N77733, T89898, AI052335, AI052334, T83672, T29093, W87790, AI266466, H11702, AA730226, AA234783, W07572, AA776527, AA464876, AA350935, N64188, H24996, H57195, AA446747 C83185, C83052, C94739, AI234909, AA900710, AI235915, AI031124, AA997118, C42637, AA750290, AA944171, R86582, R86522, AA942601, AA741815, R86465 E03799, E03335, AR019675, A29216, I66313, AR020617, AR007134, AR007136, A27171, AR007160, AR007135, AR007159, AR007137, AR007157, AR007158, AR007156, AR007163, AR016569, I44520, AR016568, I44515,106337,107567, I73451, I27715, I16107, A29208,144732, I25169, I96184, I21124, I34992, I15525, I15526, I96182, A16753, AR020621, A16754, A39857, I80848, A39858, A39860, A39859, I80844, I25171, A37476, A43598, I21129, I78448, E03080, A27685, I38462,107261, AR007164, A50039, AR002596, E01787, A31598, I60497, A50042,138461

TABLE II. SEQ ID NO: 3 Blast Sequences AF012126, AJ224901, AF060181, Y13472, AF035374, X51803, M60485, M34641, X52833, M63887, X57120, M34185, X57121, M37722, X57119, X66945, M34186, Y00665, X57122, M63888, M63889, AF077546, AB007885, S53301, D63790, S53307, L28807, AC005658, AF064868, AF078788, Z69382, Z71386, L22494, Z71387, AF064869, Z49809, U88666, M84464, M11012, AC001052, Z98601, U67495, U39733, U39727, AF043695, AJ001024, X07891 AA798296, AA210440, AA981374, AA204514, AA681096, AA710968, W36451, AA793734, AA981061, AI047555, AA267676, AA675674, AA161918, AA690226, AA960263, AA497405, AA497406, AA254301, AA921124, AA501136, AA880265, AA510671, AA117254, AA692051, AA137972, AA437687, AA171195, AA591866, AA816181, AA472881, AA051239, AA437673 AA452383, AA767826, AA421981, D81220, AA282776, N79268, AA251581, AA993582, AI051311, AA663837, AA034499, H72750, AA361348, AA860937, H54365, AA370562, C14750, AA115047, AA435557, D11944, D60911, AI273953, AA329832, AA629081, AI150524, AA872477, C14749, AA872945, AA135989, D59995, AA863063, AA091256, AA452155, AI125726, AA115537, AA505638, AA251580, AA283078, C14507, C14328, C14354, AA247959, N71855, D80504, AA746706, AA370561, AA251034, AA907077, R28037, AA134608, N44592, T31473, N36518, AA333475, AI338073, H97032, AI073760, AA548744, AA704914, AA704721, AA721085, AI131522, H08999, R93033, N62550, AA005339, AA173160, AA743523, AI161066, AA167048, AA186668, AA258288, AA376279, AA420537, AA181113, AA287821, AA677001, AI002167, AI073770, AI262055, AI341739, T75172, N71430, AA807382, AA977876, W84709, AI191619, AA421698, AA743896, AA137070, AA843321, AA884702, AI025231, H11339 AI111670, C83052, C83185, AA926013, AI112706, AA851515, AI296042, AI293430, AI296173, AI297385, AI296580, AI293407, C62662, AI061501, AI132823, C42637, N97597, AA950193, N38709, C91115, N98064, C92862, AA695692, AU034811, AA550668, AA676052 AR019675, E03335, E03799, A29216, I66313,123471, A63538, AR020617, AR007135, A51089, AR007137, A37476, E05541, A43598, E05543,108658, E05544 Each of the references, patents, and patent documents identified in this document is incorporated in its entirety herein by reference.

The following examples are included for purposes of illustration and are not intended to limit the scope of the invention. The Examples and additional illustrative figures originally were disclosed in the U. S. Patent Application Serial No. 09/004,688, filed January 8,1998, to which priority is claimed, the entire contents of which are incorporated herein by reference.

Examples Nodal lymphoma specimens obtained from four patients were disaggregated mechanically and enzymatically (collagenase) and metaphase cells were obtained following overnight exposure to Colcemid. See Naeem, et al., supra, incorporated herein by reference.

Metaphase harvesting, slide making and trypsin-Giemsa staining were performed as described previously. See Fletcher et al., Diagnostic relevance of clonal cytogenetic aberrations in malignant soft-tissue tumors. N. Engl. J. Med 324,436-442 (1991) incorporated hereby by reference.

Localization of stem-cell leukemia/lymphoma (SCLL) syndrome 8pl 1 translocation breakpoints was accomplished through bidirectional mega-YAC FISH walks initiated on the centromeric and telomeric sides of the breakpoints. Two mega-YACs, 770 c 2 (1390 kb) and 959 _a-4 (1260 kb), spanned the 8pl 1 translocation breakpoints in each of the four patients.

YAC and BAC clones were biotin-labeled by random octamer priming and hybridization conditions as previously described. See Xiao et al., Novel fluorescence in situ hybridization approaches in solid tumors: Characterization of frozen specimens, touch preparations and cytologic preparations. Am J. Pathol. 147,896-904 (1995), incorporated herein by reference.

Image analyses were performed using a cooled CCD camera (Photometrics) in conjunction with an Oncor Image Analysis System (available from Oncor, Inc., Gaithersburg, MA).

Translocation breakpoint locations within YAC clones were estimated by averaging the relative intensities of probe signal on the derivative chromosome 8, derivative chromosome 13, and normal chromosome 8 homologs in 10 metaphase cells from each lymphoma. Image analysis distance calculations, based on the relative intensities of FISH signals, indicated tight clustering of the breakpoints in a 1100 kb region adjacent to the telomeric end of YAC 856b8. See Dib et al., Characterization of the region of the short arm of chromosome 8 amplified in breast 4 carcinoma, Oncogene 10,995-1001 (1995), incorporated herein by reference.

A BAC library was then screened for clones containing the YAC 856b8 end sequence: one clone, BAC 7M15, was evaluated further by FISH and was shown to span the t (8; 13) 8pl 1 breakpoints. FGFRI-containing BAC 7M 15 also hybridized via FISH to a t (8; 13) lymphoma metaphase cell. BAC 7M15 was then used to probe colony lifts of a YAC 770 c 2 selected cDNA library. The cDNA library was created as follows: total yeast DNA from the YAC 770 c 2 clone was immobilized on nylon disks, then blocked by extensive preannealing with

ribosomal DNA, Cot-1 DNA, Poly (dI: dC), and yeast DNA. Disks were then hybridized with pooled, normalized, short-fragment, cDNA libraries (total fetus, fetal brain, adult thymus, adult spleen, adult liver, and adult testes) as described previously. See Parimoo et al., cDNA selection from total yeast DNA containing YACs. Nucleic Acids Res. 21,4422-4423 (1993), incorporated herein by reference.

After the disks were washed, the bound short-fragment cDNAs were rescued by PCR and taken through another two rounds of selection. The final selection cDNA library was digested with EcoRI and cloned into bacteriophage vector Agtl 0 (commercially available from Stratagene). The selected library was then plated at low density, and plaque lifts obtained using Hybond N (Amersham). The filters were prehybridized with sheared human placental DNA, then hybridized with BAC 7M15 which had also been preannealed with sheared human placental DNA. Repetitive sequence clones were eliminated from further consideration by hybridization of duplicate filters with Cot-1 and ribosomal DNA probes. Potential unique sequence clones were identified by autoradiography, amplified by PCR using vector primers, and sequenced. More particularly, eight candidate unique-sequence clones were picked randomly, and sequence analysis revealed that two of these were FGFRI clones.

A Southern blot of DNA from normal blood leukocytes and t (8; 13) lymphoma cells hybridized with a 3.3 kb FGFRI cDNA probe (FGFR1) revealed aberrant restriction fragments in HindIII, PvuII and XbaI digested tumor DNAs (Fig. 2) consistent with an intragenic FGFR1 breakpoint in lymphoma cells. The FGFR1 probe was obtained in accordance with Itoh et al.

The complete amino acid sequence of the shorter form of human basic fibroblast growth factor receptor was deduced from its cDNA, Biochem. Biophys. Res. Commun. 169,680-685 (1990), incorporated herein by reference.

High molecular weight DNA was isolated from frozen lymphoma tissue, restriction enzyme digested, electrophoresed, and transferred to Hybond N membranes (Amersham). The 3.3 kb FGFRI cDNA, FGFR1, was labeled with 32P-dCTP by random priming. Hybridization and washing were performed using standard methods. Human Multiple Tissue (#7760-1) and Immune System II (#7768-1) poly A+ northern blots were obtained from Clontech (Palo Alto, CA), and were hybridized according to manufacturer's protocols.

A potential FGFRI transcript was evaluated by rapid amplification of cDNA 5'ends (5' RACE) using poly A+RNA from t (8; 13) lymphoma cells (Case 1) and a Clontech Marathon cDNA (Clontech, Palo Alto, CA) amplification kit. First strand cDNA was synthesized from 1: g

of t (8; 13) lymphoma poly A+ RNA. Second-strand cDNA was synthesized and adaptor-ligated according to the manufacturer's protocol. The fusion transcript was amplified using an FGFRI specific antisense primer (R/FGFRI/2128: 5'GCCTGTGCCAACACCACCTGCCCAAAGC) (SEQ ID NO: 7) and adaptor primer API from the Marathon kit. PCR conditions were as follows: initial denaturation at 94°C for 2 minutes; then 94°C for 30 seconds and 68°C for 3 minutes x 25 cycles. Five u. I of 1: 50 diluted first-round PCR product were reamplified in a 50: 1 reaction using a nested FGFRI-specific antisense primer (R/FGFR1/1979: 5'GTGATGGCCGAACCAGAAGAACCCCAGAG) (SEQ ID NO: 6) and adaptor primer AP2.

PCR conditions were as for the first round amplification. The second-round PCR product was gel-purified in 1 % agarose and subcloned. Sequence analysis of a 1.4 kb 5'RACE product revealed in-frame fusion of a 1343 bp novel sequence followed immediately by FGFRI exon 9 (tyrosine kinase domain). The ZNF198-FGFRI transcript was validated by RT-PCR amplification of a 152bp fusion product using primers from the novel sequence (F/ZNFl98/154: 5'CCCTGTGCCTGTGTATATCCCAGTTCCTA) (SEQ ID NO: 5) and an FGFRI primer (R/FGFR1/1979) (SEQ ID NO: 6). PCR conditions were initial denaturation at 94°C for 2 minutes, then 94°C for 30 seconds and 68°C for 1 minute x 35 cycles.

The novel sequence (ZNF198) comprising the 5'end of the FGFRI transcript, was mapped using the CEPH mega-YAC library and Genebridge 4 radiation hybrid panel. The 3' end of ZNF198 was characterized by 3'RACE using placental poly A+RNA. These studies employed the same Marathon (Clontech) adaptor ligated cDNA preparation described above.

3'RACE was performed using an ZNF198 sense primer (FIZNF1981154) (SEQ ID NO: 5) and adaptor primer AP1. PCR conditions were: 94°C for 30 seconds, 68°C for 3 minutes, x30 cycles. The PCR product was gel purified in 1 % agarose, subcloned, and sequenced.

Sequencing was performed either manually (Amplicycle Kit, Perkin Elmer) or using an ABI 373A machine. Intronic sequences containing the FGFRI and ZNF198 translocation breakpoints were obtained by PCR amplification followed by sequencing. Primers for FGFRI were F/FGFR1/INTR: 5'GGAATTCCATCTTCCACAGAGCGG (SEQ ID NO: 8) and R/FGFR1/1979 (SEQ ID NO: 6). Primers for ZNF198 were F/ZNF198/INTR: 5'CCCAAATCACTTGCAGTACTTAGAAG (SEQ ID NO: 9) and R/ZNF198/INTR: 5'GAGCAGGCAGAAAAACAGGAACTGGCAC (SEQ ID NO: 10).

YAC screening identified a positive clone, 967bol, which had been mapped previously to the most centromeric Whitehead Institute contig (WC 13.0) on the chromosome 13 long arm.

Radiation hybrid mapping demonstrated strong linkage (lod< 3.0) centromeric to STS marker, WI-8572, which is 7.47 cR from the top of the Chromosome 13 linkage group. These determinations were consistent with the pericentromeric 13ql 1-12 assignments for t (8 ; 13) cytogenetic breakpoints. The complete coding sequence for the novel chromosome 13 gene, which is designated ZNF198, was determined by 3'RACE using an oligonucleotide primer 79 bp upstream of the FGFRI breakpoint. The sequence of the primer is depicted in SEQ ID NO: 5. A 2.2 kb PCR product was obtained from placental poly A+RNA, and alignment of overlapping 5'and 3'RACE fragments revealed a 3478 bp cDNA including a 464 bp 5'UTR, 2271 bp coding sequence and 743 bp 3'UTR (Fig. 1). BLAST, PIR, and SWISS PROT searches demonstrated substantial homology with DXS6673DE, a candidate gene in X-linked mental retardation.

An evaluation of ZNF198 cDNA and deduced amino acid sequence is shown in Fig. 1.

Cysteine residues in the four zinc fingers are circled. The zinc fingers are followed by two short proline repeats, and the carboxy end of the protein is acidic (boxed region, glutamic or aspartic acid=17.9%, pI4.71). The t (8; 13) breakpoint is indicated by a vertical line, the putative polyadenylation signal is underlined, and the stop codon is indicated by an asterisk. An in-frame stop codon (TAA) is 39bp 5'of the initiator methionine. The ZNF198 cDNA sequence predicts an 87.1kD protein with four atypical zinc fingers (Cys-X2-Cys-Xl920-Cys-X3-Cys) and a carboxy terminal acidic region wherein X is any amino acid residue.

The full-length ZNF198-FGFRI cDNA was amplified by RT-PCR using Pfu DNA polymerase, confirmed by sequencing, subcloned into the EcoR I site of the expression plasmid pcDNA3 (Invitrogen), and transfected into 293T cells and COS cells. COS cells and 293T cells were maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum under 5% CO,, and transfections were performed using a CaP04 precipitation method.

See Pear et al., Production ofhigh-titer helper-free retroviruses by transient transfection, Proc.

Natl. Acad. 90,U.S.A. 8392-8396 (1993), incorporated herein by reference. Western blot analysis of whole cell extracts and immunostaining of cultured cells were performed as described previously. See Aster et al., Oncogenic forms of NOTCHI lacking either the primary binding site for RBP-Jk or nuclear localization sequences retain the ability to associate with RBP-Jkandactivatetranscription, J. Biol. Chem. 272,11336-11343 (1997), incorporated herein by reference. Polyclonal rabbit antibody to FGFR1 and the peptide immunogen (corresponding to FGFR1 amino acids 808-822) were obtained from Santa Cruz Biotechnology, (Santa Cruz,

CA). Secondary anti-rabbit immunoglobulin antibodies were from Sigma (St. Louis, MO).

Western blotting demonstrated that 293T cells transfected with pcDNA3-ZNF198-FGFR1 synthesize a dominant cross-reactive polypeptide of 76kDa that is absent from extracts prepared from cells transfected with empty vector. Confocal immunofluorescent microscopy was performed on COS cells transiently transfected with pcDNA3-ZNF198-FGFR1. At low magnification, scattered overexpressing cells were stained brightly by anti-FGFRI, whereas such cells were absent when non-immune rabbit antibody is substituted for anti-FGFR1, or when anti-FGFRI is coincubated with immunogenic FGFR1 peptide. At high magnification, confocal sections showed diffuse cytoplasmic staining in overexpressing cells stained with anti-FGFR1.

Northern blot analysis using Clontech Human Immune System II (Fig. 3a) revealed ZNF198 transcripts in each of 14 tissues (Fig 3a-b) evaluated using Clontech Human Immune System II (Fig. 3a) and multiple tissue blots (Fig. 3b). Both blots were hybridized with pooled probes from ZNF198 cDNA 5'and 3'ends. All tissues express 4.5 kb ZNF198 transcripts and most tissues also express larger (7.5 and 1 Okb) transcripts. Fig. 3c illustrates that ZNF198-FGFR1 fusion transcripts were identified by RT-PCR. Identical ZNFl98-FGFRI fusion cDNAs (SEQ ID NO: 15) were found in each of four t (8: 13) SCLL-phenotype lymphomas (Figs. 3c and 4b) but not in three controls. The expected 152bp product is seen in each t (8; 13) case. By contrast, none of these lymphomas had detectable expression of the reciprocal (ZNFl98-FGFRI) fusion cDNA despite evaluation using 60 cycles of amplification including 30 cycles of nested PCR. Genomic PCR was performed using the same ZNF198 and FGFR1 oligonucleotide primers (FIZNF1981154 and R/FGFR1/1979) employed in the RT-PCR studies. Genomic fusion sequences of 2.0 and 2.5 kb were amplified from two frozen lymphomas (cases 1 and 2, Figs. 3d and 4c) but not from paraffin-embedded specimens (cases 3 and 4, Fig. 3d). Relative expression FGFR1,ZNF198, and ZNF198-FGFR1 was evaluated in two frozen t(8;13) lymphomas (cases 1 and 2) by competitive RT-PCT. All three transcripts were expressed at a similar level (Fig. 3e). The expected PCR products from ZNFl98. FGFRI, and ZNFl98-FGFRI are 1982bp, 1160bp and 1430bp, respectively. However, the normal ZNF198 and FGFRI transcripts detected in these studies might have been contributed, in part, by nonneoplastic cells within the lymphoma specimens.

The ZNF198-FGFR1 fusion protein contains the entire FGFR1 tyrosine kinase domain, including domain I (Gly-X-Gly-X,-Gly), whereas the FGFR1 immunoglobulin-like and

transmembrane domains are replaced by four intact ZNF198 zinc fingers (Fig. 4a). Fig. 4b illustrates the breakpoint and surrounding locus of the ZNFl98 gene (SEQ ID NO: 11) and corresponding ZNF198 protein (SEQ ID NO: 12). Also shown in Fig. 4b is the breakpoint and surrounding locus ofthe FGFR1 gene (SEQ ID NO: 13) and corresponding FGFR1 protein (SEQ ID NO: 14). The locus of the translocation fusion juncture of the ZNFl98/FGFRI gene (SEQ ID NO: 15) and corresponding protein (SEQ ID NO: 16) is also depicted in Fig. 4b. The different genomic translocation breakpoints from t (8; 13) lymphoma cases 1 and 2 is shown in Fig. 4c. The locus of the genomic ZNF198 breakpoint in case 1 (SEQ ID NO: 17) is different than the locus of the genomic ZNF198 breakpoint in case 2 (SEQ ID NO: 20). Similarly the locus of the genomic FGFRI breakpoint in case 1 (SEQ ID NO: 18) is different than the locus of the genomic FGFR1 breakpoint in case 2 (SEQ ID NO: 21). As a consequence, the case 1 genomic ZNFl98-FGFRI locus (SEQ ID NO: 19) is different than the case 2 genomic ZNF198-FGFRI locus (SEQ ID NO: 22). Immunohistochemical staining of paraffin-embedded sections with an antibody specific for the carboxy terminus of FGFR1 revealed extranuclear staining in t (8; 13) lymphoma cells (case 1).

It will be understood that various modifications may be made to the embodiments disclosed herein. Therefore, the above description should not be construed as limiting, but merely as exemplifications of preferred embodiments. Those skilled in the art will envision other modifications within the scope of the claims appended hereto.

What Is Claimed Is: