HUMAN CYTOMEGALOVIRUS INFECTION

[0001] This application claims priority benefit to U.S. provisional application no. 62/636,219, filed February 28, 2018, which is incorporated by reference herein in its entirety.

INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0002] This application contains, as a separate part of the disclosure, a Sequence Listing in computer-readable form which is incorporated by reference in its entirety and identified as follows: Filename: 53968_Seqlisting.txt; Size: 3,733 bytes; Created: February 28, 2019.

FIELD

[0003] The present disclosure relates to peptides for treating human cytomegalovirus infections. The present disclosure also relates to methods of treating human cytomegalovirus infections using the peptides disclosed herein.

BACKGROUND

[0004] Human Cytomegalovirus (HCMV) is a major cause of morbidity and mortality in newborns and adults, with congenital HCVM infection affecting 10-20,000 births and costing an estimated $2 billion toll on the US and UK healthcare system annually. HCVM infects 60-100% of adults depending on geographical location (Mocarski et al., 2007). Currently there is no vaccine or cure and once infected, individuals harbor lifelong latent reservoirs of HCMV that periodically reactivate. Current pharmaceutical treatments help to manage infection, but toxicity and bioavailability issues limit their clinical application Although innocuous to most healthy individuals, HCMV can cause life-threatening complications in immunosuppressed individuals including organ transplant donors, pregnant mothers, and AIDS patients. In pregnant mothers, HCMV can cross the placenta with devastating effects. Every year in the US alone, HCMV induces hundreds of cases of perinatal mortality and leaves thousands with serious physical and developmental defects, yet awareness of this is alarmingly low (Manicklal et al., 2013).

[0005] There is a need for novel therapeutics for treating HCMV infection in both human newborn children and adults. SUMMARY

[0006] HCMV replicates slowly and extensively uses the host's cell systems over the course of infection. The disclosure provides experimental data demonstrating that HCMV actively upregulates the expression of microtubule accessory factor End Binding protein (EB)3, which in turn, mediates host cell remodeling of Golgi into a unique structure called the assembly compartment (AC) that accompanies the formation and maturation of HCMV particles.

Depletion of EB3 blocks the formation and release of new virus particles and is non-toxic Therefore, EB3 is a novel druggable target to suppress HCMV infection.

[0007] Provided are 16-mer (HEBTRON; Myr-RSMKRSLIPRWIGNKR; SEQ ID NO: 1), 8-mer (HEBTRON short; Myr-KRSLIPRF-NH2; SEQ ID NO: 2) and 12-mer (HEBTRON-ASLIP;

RSMKRRWIGNKR (SEQ ID NO: 3) peptides that targets EB3 and exhibits antiviral activity in primary human fibroblasts (NHDFs). These peptides are effective against HCMV but not against other viruses tested (Herpes Simplex Virus Type 1 (HSV-1) or Vaccinia Virus (VacV)). Mechanistically, both peptides modulate microtubule dynamics and interfere with the formation and maturation of the HCMV assembly compartment. As a result, cells treated with the peptides do not shed new virus efficiently. Hence these peptides provide novel and effective anti-viral therapy against HCMV.

[0008] The disclosure provides for isolated peptides comprising the amino acid sequence of RSMKRSLIPRWIGNKR (SEQ ID NO: 1), KRSLIPRF (SEQ ID NO: 2), RSMKRRWIGNKR (SEQ ID NO: 3) or a fragment or variant thereof. In addition, the disclosure provides for isolated peptides consisting of the amino acid sequence of RSMKRSLIPRWIGNKR or KRSLIPRF or RSMKRRWIGNKR (SEQ ID NO: 3) or a fragment or variant thereof.

[0009] The provided variant peptides comprise a conservative substitution or a deletion of one or more amino acids. The peptides may be conjugated to a fatty acid or linked to a myristoyl group, i.e. myristoylated. The peptides may be linked to a carrier peptide. The carrier peptide may be antennapedia peptide (AP), cell -penetrating peptides (CPPs) including

Penetratin petpide, TAT peptide, transportan or polyarginine peptides. The peptides may be modified from the amine- or the carboxy- termini. For example, the amine terminus of the peptide is myristolyated and/or the carboxy terminus of the peptide is aminated.

[0010] Provided are compositions comprising a pharmaceutically acceptable excipient and one or more of the disclosed isolated peptide. The provided compositions are used to treat human cytomegalovirus infection in newborn humans, infant humans and adult humans. For example, the provided pharmaceutical compositions are formulated for oral administration.

[0011] The disclosure also provides for method of treating human cytomegalovirus infection comprising the step of administering to a subject in need thereof an isolated peptide comprising the amino acid sequence of RSMKRSLIPRWIGNKR (SEQ ID NO: 1), KRSLIPRF (SEQ ID NO: 2), RSMKRRWIGNKR (SEQ ID NO: 3) or a fragment or variant thereof.

[0012] The disclosure further provides for method of treating human cytomegalovirus infection comprising the step of administering to a subject in need thereof an isolated peptide consisting of the amino acid sequence of RSMKRSLIPRWIGNKR (SEQ ID NO: 1), KRSLIPRF (SEQ ID NO: 2), RSMKRRWIGNKR (SEQ ID NO: 3) or a fragment or variant thereof.

[0013] In certain embodiments, the peptides used in the provided methods are linked to a myristoyl group (or the peptide is myristoylated) or a carrier peptide. In some embodiments, the peptide or composition is administered orally.

[0014] The methods include administering a therapeutically effective amount of a disclosed peptide or disclosed composition, such as an amount effective to inhibit or suppress HCMV infection. In any of the provided methods, the subject is an adult human, a new born human or an infant human. In certain embodiments, the subject is infected with HIV, pregnant or immune-comprised.

[0015] The disclosure also provides for use of any of the provided peptides or compositions for the preparation of a medicament for treating human cytomegalovirus infection in a subject in need. The medicament comprises a therapeutically effective amount of a disclosed peptide or disclosed composition, such as an amount effective to inhibit or suppress HCMV infection. In some embodiments, the medicament is formulated for oral administration. The medicament may be administered to an adult human, a new born human or an infant human. In certain embodiments, the subject is infected with HIV, pregnant or immune-comprised.

[0016] The disclosure also provides for compositions for use in treating human

cytomegalovirus infection in a subject in need. These compositions comprise a therapeutically effective amount of a disclosed peptide, such as an amount effective to inhibit or suppress HCMV infection. In some embodiments, the composition is formulated for oral administration. The composition may be administered to an adult human, a new born human or an infant human. In certain embodiments, the subject is infected with HIV, pregnant or immune- comprised.

BRIEF DESCRIPTION OF DRAWINGS

[0017] Figures 1A-F demonstrate AC dynamics and nuclear rotation during HCMV infection. (A) NHDFs were infected with TB40/E-UL99-Egfp at MOI 0.5 for 4d. Fixed cells were stained for GFP, TGN46 and Gb. Nuclei were stained with Hoechst. Note, both Golgi structures in each cell stain for UL99-Egfp and Gb and appear to have weak connections. (B) Time lapse images of NHDFs infected with TB40E-UL99-Egfp at MOI 0.5 imaged 3-5d.p.i. illustrating AC merging. (C) Time lapse images of NHDFs co-infected with TB40/E-UL99-Egfp and TB40/E-UL32-mCherry at MOI 0.5 imaged 3-5d.p.i. UL99 labels the AC. UL32 domains form in the nucleus (ND) prior to the appearance of virus particles in the AC (acVPs) and then in the cytoplasm (Cvp). (D) Still showing virus particles in the AC and cytoplasm (cyto) co-labeled with UL99-Egfp and UL32- mCherry. (E) Distribution of fluorescent intensity for UL32-mCherry and UL99-Egfp particles in D. measured using line-scan analysis. N = 5 (64 particles). Both peaks are in the size range of HCMV particles (indicated) and drop rapidly outside this size-range. (F) NHDFs expressing NLS- mCherry mock infected or infected with TB40E-UL99-Egfp at MOI 0.5 and imaged 3-5d.p.i. Displacement of NLS-mCherry-labeled nuclei was measured. 2 representative examples per group are shown. (G) Time lapse images of NHDFs co-infected with TB40/E-UL99-Egfp and TB40/E-UL32-mCherry at MOI 0.5. Arrows indicate the direction of cell migration. Nuc=nucleus.

[0018] Figure 2A-H demonstrate that the HCMV AC is a Golgi-derived MTOC. (A-B) NHDFs were mock infected or infected with TB40/E at MOI 3. (A) Cells were fixed 5.d.p.i. and stained for g-tubulin, pericentrin and Gb. Nuclei were stained with Hoechst. (B) Cell lysates were prepared at the indicated times and analyzed by WB. Lower: Densitometry analysis of g-tubulin relative to oc-tubulin. N = B; unpaired two-tailed t-test, *p<0.05. (C-F) NHDFs were mock- infected or infected with AD169 at MOI 3 for 3d. Cells were treated with IOmM nocodazole for 8h before washout for the indicated time. (C) Samples were stained for tyrosinated tubulin, TGN46 and pericentrin. Red arrows indicate centrosomes, white arrows indicate Golgi fragments. Insets show non-centrosomal nucleation sites. (D) The number of new MTs at non- centrosomal sites 10 min post-washout was quantified. N = 3 (>65 cells), bars = s.e.m., unpaired two-tailed t-test, ****p = 0.0001. (E-F) Tyrosinated MTs at centrosomes 10 min post- nocodazole washout imaged using confocal microscopy. (E) Area occupied by tyrosinated MTs nucleated at centrosomes was measured. N = 3 (>45 cells), bars = s.e.m., unpaired two-tailed t- test, *p = 0.0240. (F) Representative examples of MTs at centrosomes, including a bright g- tubulin merge used to identify centrosomes. (G) NHDFs were infected with TB40/E at MOI 1 for 5d. Fixed cells were stained for acetylated tubulin and TGN46, along with Hoechst . Samples were imaged using confocal microscopy. Top and bottom Z-plane images of the AC are shown. Insets show acetylated MTs localized at TGN sites. (H) NHDFs were infected and treated with nocodazole as in C. Samples were stained for acetylated and tyrosinated (tyr) tubulin, along with TGN46. Red arrows indicate centrosomes, white arrows in insets indicate Golgi fragments.

[0019] Figure 3A-3F demonstrates that HCMV increases EB protein levels. (A) Growth- arrested NHDFs were mock-infected or infected with TB40/E at MOI 3 for the indicated times. Cell lysates were analyzed by WB. (B) Densitometry analysis of EB1, EB2 and EB3 relative to oc- tubulin. N = 3; bars = s.e.m.; *p<0.05, unpaired two-tailed t-test (C) Growth-arrested NHDFs were mock-infected or infected at MOI 3 for 4d. EB transcript levels were measured using Qrt- PCR. EB levels were normalized to uninfected controls (arbitrarily set to 1). N = 3; bars = s.e.m; *p<0.05, ***p<0.001, unpaired two-tailed t-test. (D) NHDFs were treated with control or I El/2 siRNA prior to infection with AD169 at MOI 3 for 3d. Cell lysates were analyzed by WB for the indicated proteins. (E) NHDFs were transduced with retroviruses encoding GFP or IE proteins. Samples were analyzed by WB. (F) NHDFs were infected with AD169 at MOI 3 in the presence of DMSO or CDK1 inhibitor (JNJ-770662), re-dosing daily, for the indicated times. Samples were analyzed by WB.

[0020] Figure 4A-4G demonstrate that EB1 and EBB play distinct roles in HCMV replication. (A) NHDFs were treated with siRNA 30h prior to infection (+) or with a second siRNA treatment at 3d.p.i. (++). Cultures were infected at MOI 3 for 5d. Lysates were analyzed by WB for the indicated proteins. Note, IE1/2 are expressed because early infection is not affected using this siRNA treatment strategy. (B-D) NHDFs were treated with siRNAs as in A. and infected with TB40/E-Egfp at MOI 0.001 for 14d. (B) Cells were lysed and analyzed by WB for the indicated proteins. Note, I El/2 are reduced because of reduced HCMV spread in EB1 or EB3 depleted cultures. (C) Phase and fluorescent images of plaques for TB40/E or AD169. (D) Plaque sizes in C for TB40/E were measured. N = 3 (>22 plaques); bars = s.e.m. ***p=0.0005, unpaired two-tailed t-test. (E) NHDFs were infected with TB40/E at MOI 3. Cell supernatants and cell-associated virus were harvested at 7d.p.i. and titrated on NHDFs. N = 3; bars = s.e.m; *p<0.05, **p<0.01, unpaired two-tailed t-test. (F) Still images of NHDFs expressing Egfp-CLIP170, treated with siRNAs as in A and infected with TB40/E-UL32-mCherry at MOI 1 for 5d. Red boxes highlight elongated Egfp-CLIP170 tracks in EBl-depleted cells. (G) Line-scan analysis of Egfp-CLIP170 intensity distribution from the microtubule plus-end in F. n = 10 (>150 MT linescans); bars = s.e.m.

[0021] Figure 5A-5F demonstrate that EB3 regulates acetylated MTs, nuclear rotation and AC structure. (A-D) NHDFs were treated with siRNAs and infected with TB40/E at MOI 1 for 5d. (A) Fixed samples were stained for acetylated tubulin and TGN46. Nuclei were stained with

Hoechst. (B) Percentage of cells containing low (as in EB3 siRNA panels in A.), medium (as in Ctrl siRNA panels) or high (as in EB1 siRNA panels) levels of acetylated MTs. N = as indicated. (C) Fixed samples were stained for EB1, EB3 and TGN46. Enlarged insets show EB1 and EB3 comets. (D) Line-scan analysis of EB1 or EB3 comet intensity and distribution in samples in C. Note, loss of one EB increases MT tip binding by the other. Top: Distributions of EB1 (red) or EB3 (green) in control siRNA (solid) or EB1 siRNA (dashed) samples. Bottom: Distributions of EB1 (red) or EB3 (green) in control siRNA (solid) or EB3 siRNA (dashed) samples. N = 5 (>125 MT linescans); bars = s.e.m. (E-F) NHDFs were treated with siRNAs and infected with TB40/E-UL99-Egfp at MOI 0.5. (E) Effects on nuclear rotation: Cells were imaged at 2 frames per hour between 3-5d.p.i. Time lapse images were used to measure nuclear rotation. Bottom: Examples of rotations including changes in direction (red and orange). (F) Effects on AC structure: Still images from faster frame rate analysis of UL99-Egfp showing different AC architectures in control versus EB1 or EB3-depleted cells. Insets use non-linear scaling to show details within the bright AC region and highlight cytoplasmic virions and MVBs.

[0022] Figure 6A-6J provide characterization of HEBTRON. (A) ITC of HEBTRON binding to purified EB3 C-terminus (200-281aa). KD, binding enthalpy, and stoichiometry were calculated from changes in heat upon binding of HEBTRON to the protein using the "one set of sites" binding model. (B) Thermal unfolding of full-length EB3 alone (blue) or with HEBTRON (red) using NanoDSF. The first derivative of the 350/330 nm (peak) defines transitions between folded (left) to unfolded (right) states. Magnified insets show 0.20C temperature shift (green lines) for the complex. This suggests HEBTRON stabilizes dimers. (C) FRET signal after mixing full-length EB3-CFP and EB3-YFP without (blue) or with HEBTRON (red). FRET indicates formation of YFP/CFP-EB3 dimers, blocked by HEBRTON at 1:1 molar ratio. (D) NHDFs were treated with IOmM Myr-FITC-conjugated HEBTRON. Time lapse images were taken and overlaid with DIC images at the indicated times. (E) % uptake of Myr-FITC-conjugated HEBTRON in NHDFs over time was determined by the normalized fluorescence intensity of the cell. N = 3; assaying 32 cells. Bars = s.e.m. (F) NHDFs treated with DMSO or 25mM HEBTRON were infected with TB40/E at MOI 1 for 5d. Fixed cells were stained for acetylated tubulin and Gb. (G) %

DMSO or HEBTRON-treated cells in F containing acetylated MTs. N = as indicated. (H) Sequence of HEBTRON, MutN or MutN-MutC. (I) NHDFs treated with DMSO or 25mM HEBTRON, Mut-N or MutN-MutC were infected with TB40/E-Egfp at MOI 0.001 for 12d. Representative phase and fluorescent images of plaques. (J) Cells were treated and infected with TB40/E or AD169 as in I. Plaque areas are shown. N = 3 (>40 and >50 plaques. Respectively); bars = s.e.m.; p*<0.05, **p<0.01, ***p<0.001, unpaired two-tailed t-test. See also Figure S3.

[0023] Figure 7A-7G demonstrate that HEBTRON blocks recruitment of CDK5RAP2, nuclear rotation, and HCMV replication. (A-B) NHDFs treated with DMSO or 25mM HEBTRON or MutN- MutC were infected at MOI 1 for 5d. (A) Fixed cells were stained for TGN46 and CDK5RAP2. Example of measurements of CDK5RAP2-positive area (based on fluorescence above intensity threshold). (B) Area measurements of CDK5RAP2 at the AC above threshold intensity. N = 3 (>90 cells), bars = s.e.m; **p<0.01, unpaired two-tailed t-test. (C) HEBTRON does not affect CDK5RAP2 or EB3 abundance. NHDFs treated with DMSO or 25mM HEBTRON, MutN or MutN- MutC were infected with AD169 at MOI 3 for 5d. Lysates were analyzed by WB. (D-E) NHDFs treated with DMSO or 25mM HEBTRON were infected with TB40/E-UL99-Egfp at MOI 0.5. (D) Time lapse imaging was performed 3-5 d.p.i and nuclear displacement was measured.

Representative traces are shown. (E) Time lapse imaging of the AC at 5 d.p.i.. Still images show AC structure in DMSO or HEBTRON-treated cells. Insets and non-linear scaling show details within the bright AC. Arrows indicate virus particles and MVBs. (F-G) NHDFs treated with DMSO or 25 mM HEBTRON were infected with TB40/E at the indicated MOI. Infectious virus in culture supernatants was titrated. (F) Spreading assay infections at MOI 0.001 for 12d. n = 2; bars = s.e.m. (G) Single cycle infections at MOI 1 for 7d. n = 3; bars = s.e.m. *p<0.05, unpaired two- tailed t-test.

[0024] Figure 8A-8D provide AC dynamics and function as an MTOC. (A) UL99-eGFP labels TGN46-positive regions early in infection. NHDFs were infected with TB40/E-UL99-eGFP at M010.5. Cells were fixed at the indicated times and stained for GFP and TGN46. Nuclei were stained with Hoechst. The kinetics of Golgi remodeling into an AC and the localization pattern of UL99-eGFP with TGN46 are in line with prior fixed imaging studies, validating UL99-eGFP as a means to label the AC from its earliest stages of formation for live cell imaging. (B) Nucleating material localizes to Golgi-based sites throughout the AC (related to Figure 2A). NHDFs were infected with AD169 at M013 for 3d. Fixed cells were stained for pericentrin and TGN46. (C-D) HCMV induces the formation of a subpopulation of MTs containing acetylated tubulin. NHDFs were mock infected or infected with TB40/E at MOI 1 for 5d. (C) Cells were fixed and stained for detyrosinated (Glu) or acetylated tubulin, along with TGN46. Typical examples of detyrosinated and acetylated tubulin networks are shown. White arrows point to singular asters of acetylated tubulin emanating from centrosomes in uninfected cells. Note that uninfected or infected NHDFs do not contain significant levels of detyrosinated MTs. 293 cells served as a positive control for detection of detyrosinated MTs. (D) Cells were fixed and stained for acetylated tubulin and TGN46. Nuclei were stained with Hoechst. Examples of acetylated networks found in uninfected or infected cells are shown. White arrows point to singular asters of acetylated tubulin emanating from centrosomes in uninfected cells. Right: The number of cells containing acetylated MT networks was quantified. Acetylated MTs were categorized as low, medium or high. For examples of each category see left panels and Figure 5A-B. n = as indicated.

[0025] Figure 9A-9F demonstrate the effects of HCMV infection on the levels and localization of EB family members. (A) NHDFs were infected with laboratory (AD169) or clinical (FIX) strains of HCMV at MOI 3 for the indicated time in d.p.i. Cell lysates were analyzed by WB using the indicated antibodies. Although different HCMV strains have different kinetics of early gene expression and replication, in all three HCMV stains tested the increase in EB protein abundance coincided with the expression of 1E2, but not 1E1. (B) IE1/2 siRNAs do not indirectly affect EB protein levels in mock-infected cells. NHDFs were treated with control or I El/2 siRNA for 3d. Cell lysates were analyzed by WB using the indicated antibodies. (C-E) Localization of EB proteins in HCMV-infected cells. Blue arrows point to examples of EB1 or EB3 comets at MT plus-ends, and the weaker plus-end accumulation of EB2. NHDFs were mock infected or infected with TB40/E at MOI 3 for 5d. Samples were stained for EB1 (C), EB2 (D) or EB3 (E). In addition, depending on antibody compatibility with each EB, samples were co-stained with antibodies against either tyrosinated-tubulin or a-tubulin to detect MTs, and HCMV gB or TGN46 to label the AC. Nuclei were stained with Hoechst. Right Panels: Zoomed images showing the plus-end distribution of EB1 and EB3, and the MT lattice localization of EB2. (F) EB3 localizes at and around y-tubulin-positive regions of the AC. NHDFs were infected with TB40/E at MOI 3 for 5d. Fixed cells were stained for y-tubulin and EB3. Nuclei were stained with Hoechst. Samples were imaged using confocal microscopy. A representative maximum projection through the AC is shown.50

[0026] Figure 10A-10H provide the characterization of HEBTRON. (A) The DARTS method for drug target identification. Recombinant full-length human EB3 was incubated with or without the indicated peptides targeting EB1 or EB3 and digested with thermolysin. The products of digests were analyzed by WB for EB3. (B-C) Control experiments related to the results in Figure 6A. ITC of EBB C-terminus (200-281aa) alone (B) and HEBTRON alone (C). This data shows that changes in heat during formation of the EB3-HEBTRON complex were not the result of dilution of the protein or peptide alone. (D) The effects of HEBTRON compared with vehicle (DMSO) on eGFP-CLIP170 tracking behavior. NHDFs expressing eGFP- CLIP170 were treated with DMSO or 25pM HEBTRON followed by infection with TB40/E at MOI 0.5 for 5d. Different frames from time-lapse sequences were color-coded and overlaid to generate FireRainbow images of eGFP-CLIP170 movement. A FireRainbow map is provided beneath. Right: Line-scan analysis of eGFP-CLIP170 intensity and distribution in DMSO or HEBTRON-treated cells n = 5 (125 MT linescans per condition), bars = s.e.m. Note, HEBTRON does not affect MT dynamics or recruitment of CLIP170 to MT tips, similar to EB3 depletion in Figure 4F-G. (E-G) HEBTRON does not affect Vaccinia Virus replication or spread. NHDFs were treated with DMSO or 25pM HEBTRON, MutN or MutN-MutC, followed by infection with Vaccinia Virus expressing a GFP-tagged B5 protein (VacV-B5-GFP) at MOI 0.01 for 36h. (E) Phase and fluorescence images of plaques were acquired. 50-pixel background subtraction was performed using Fiji to reduce autofluorescence from plate. Representative images a re shown. (F) The sizes of VacV-B5-GFP plaques formed under each condition were measured using Fiji n = 3 biological replicates (>53 plaques), bars = s.e.m . ns= not significant. (G) Cu ltures were lysed and a na lyzed by WB using a pan-VacV a ntibody that detects vira l structural proteins. Asterisks highlight a non-specific host protein a lso detected in mock-infected samples. (H) HEBTRON does not affect EB3 localization to the AC. N HDFs were treated with DMSO or 25pM HEBTRON followed by infection with TB40/E at MOI 1 for 5d. Fixed sa mples were stained for EB3 and gB. Nuclei were stained with Hoechst. No difference in EB3 localization to the AC could be observed between DMSO or HEBTRON-treated cultures. Representative images are shown.

[0027] Figure 11A-D demonstrate displacement of SxIP-interacting proteins by HEBTRON and the role of EB3 in non-centrosomal MT formation in HCMV-infected cells. (A) NHDFs were treated with DMSO or 25pM HEBTRON and infected with AD169 at MOI 3 for 4d. Fixed samples were stained for EB1, tastin and Hoechst. Zooms show EB1 comets and trailing tastin on MT plus-ends. (B) Line-scan analysis of EB1 and tastin intensity and distribution in samples in A. Due to antibody incompatibility tastin and EBB could not be co-stained, and EB1 was used to demark MT plus-ends. The approximate location of EB3 peak intensity (based on separate EB1 and EB3 co-staining; see Figure 5D) corresponds to that of tastin, suggesting similar localizations of EB3 and tastin immediately behind EB1. tastin staining at MT plus-ends is reduced upon HEBTRON treatment. Distributions of EB1 (red) or tastin (green) in DMSO (solid) or HEBTRON (dashed) treated samples using MetaMorph. n = 5; bars = s.e.m. (C-D) NHDFs were treated with the indicated siRNAs for 30 h (C) or treated with DMSO or 25 pM HEBTRON (D) and then infected with AD169 at MOI 3 for 3 d. Cells were then treated with 10 pM nocodazole for 8h before washout for 0- or 10- min. Samples were stained for TGN46, a-tubulin and acetylated-MTs. White arrows point to examples of TGN46-positive sites that nucleate new acetylated MTs in control samples, or poorly nucleate new MTs in EB3 depleted or HEBTRON-tread cells. The number of new MTs at non- centrosomal sites 10 min post-washout was quantified using Fiji n = 3 biological replicates, bars = s.e.m., unpaired t-test, "p<0.01, unpaired t-test..

[0028] Figure 12 demonstrates that treatment with 25 mM of HEBTRON and HEBTRON short interferes with HCMV replication. NHDFs were infected with TB40/E at MOI 1. The cells were treated with HEBTRON and HEBTRIN-short every 2nd day for the duration of the experiment. Infectious virus in culture supernatant has being tittered at 120 hours post-infection.

[0029] Figure 13 demonstrates the treatment with HEBTRON and HEBTRON ASLIP inhibits HCMV spreading. HEBTRON suppresses HCMV spreading. Primary human fibroblasts were infected with clinical (TB40/E) HCMV strains expressing GFP reporters at low the multiplicity of infection (MOI) for 14 days in the presence of DMSO solvent (control), HEBTRON, HEBTRON- ASLIP or HEBTRON-mutN-mutC (negative control). The cells were treated with HEBTRON and HEBTRON-ASLIP or HEBTRON-mutN-mutC peptides every 2nd day for the duration of the experiment. Phase and fluorescence images show the suppression of HCMV spread by

HEBTRON and HEBTRON-ASLIP. DETAILED DESCRIPTION

[0030] Human Cytomegalovirus (HCMV), a leading cause of congenital birth defects, forms an unusual cytoplasmic virion maturation site termed the "Assembly Compartment" (AC). The experiments described herein demonstrate that the AC also acts as a microtubule-organizing center (MTOC) wherein centrosome activity is suppressed, and Golgi-based MT nucleation is enhanced. This involved viral manipulation of discrete functions of MT plus-end binding (EB) proteins. In particular, EBB, but not EB1 or EB2, was recruited to the AC and was required to nucleate MTs that were rapidly acetylated. EB3-regulated acetylated MTs were necessary for nuclear rotation prior to cell migration, maintenance of AC structure and for optimal virus replication. Independently, a myristoylated peptide that blocked EB3-mediated enrichment of MT regulatory proteins at Golgi regions of the AC also suppressed acetylated MT formation, nuclear rotation and infection. Thus, HCMV offers new insights into the regulation and functions of Golgi-derived MTs, and the therapeutic potential of targeting EB3.

[0031] The experiments described herein reveal the dynamic behavior of the HCMV AC and its ability to act as a Golgi-based MTOC by impairing centrosome activity and exploiting functions specific to EB3. Moreover, how HCMV remodels host MT organization at the AC adds to the broader understanding of non-centrosomal MTOCs.

Peptides

[0032] HEBTRON and its shorter forms provide a revolutionary strategy of treating HCMV infection by targeting the host protein EB3. The disclosed peptides are highly specific against HCMV but not against other tested herpesviruses (Herpes Simplex or Vaccinia Virus). Another advantage of HEBTRON is its low toxicity; and is less toxic than marketed drugs. Thus, the peptides are expected to be well tolerated by individuals and result in less adverse side effects. HEBTRON is likely to overcome the limitations of current antiviral therapies including virus evolution and drug resistance. Hence, HEBTRON would fulfill an unmet need in the marketplace for a novel therapeutic strategy in treating HCMV infection in both newborn children and adults. [0033] Peptide" or "polypeptide" as used herein, may refer to a linked sequence of amino acids and may be natural, synthetic, or a modification or combination of natural and synthetic.

[0034] "Fragment" as used herein may mean a portion of a reference peptide or polypeptide or nucleic acid sequence.

[0035] A " variant" means a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retains at least one biological activity. Variant may also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity. A conservative substitution of an amino acid, i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophilicity, degree and

distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes can be identified, in part, by considering the hydropathic index of amino acids, as understood in the art (Kyte et al., J. Mol. Biol. 157:105-132 (1982). The hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of .+-.2 are substituted. The hydrophilicity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophilicity of that peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity. U.S. Pat. No. 4,554,101, incorporated fully herein by reference. Substitution of amino acids having similar hydrophilicity values can result in peptides retaining biological activity, as is understood in the art. Substitutions may be performed with amino acids having hydrophilicity values within +-.2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity,

hydrophilicity, charge, size, and other properties. [0036] The peptide may comprise the amino acid sequence of RSMKRSLIPRWIGNKR (SEQ ID NO: 1; referred to HEBTRON), KRSLIPRF (SEQ ID NO: 2), RSMKRRWIGNKR (SEQ ID NO: S), a fragment thereof, or a variant thereof, wherein the peptide or a polypeptide comprising the peptide is 7 amino acid residues, 8 amino acid residues, 9, amino acid residues, 10, amino acid residues, 11, amino acid residues, 12 amino acid residues, 13 amino acid residues, 14 amino acid residues, 15 amino acid residues, 16 amino acid residues, 17 amino acid residues, 18 amino acid residues, 19, amino acid residues, 20 amino acid residues, 21 amino acid residues, 22 amino acid residues, 23 amino acid residues, 24 amino acid residues, 25 amino acid residues, 26 amino acid residues, 27 amino acid residues, 28 amino acid residues, 29 amino acid residues, 30 amino acid residues, 35 amino acid residues, 40 amino acid residues, 45 amino acid residues, 50 amino acid residues, 55 amino acid residues, 60 amino acid residues, 65 amino acid residues, 70 amino acid residues, 75 amino acid residues, 80 amino acid residues, 85 amino acid residues, 90 amino acid residues, 95 amino acid residues or 100 amino acid residues.

[0037] The peptide may be modified in that the amino acid sequence has one or more amino acid substitutions, amino acid insertions, amino acid deletions, carboxy terminal truncation, or an amino terminal truncation.

[0038] The peptides might also be glycosylated, phosphorylated, sulfated, glycosylated, animated, carboxylated, acetylated. For example, the C-terminal may be modified with amidation, addition of peptide alcohols and aldehydes, addition of esters, addition of p- nitroaniline and thioesters and multiple antigens peptides. The N-terminal and side chains may be modified by PEGylation, acetylation, formylation, addition of a fatty acid, addition of benzoyl, addition of bromoacetyl, addition of pyroglutamyl, succinylation, addition of tert- butoxycarbonyl and addition of 3-mercaptopropyl, acylations (e.g. lipopeptides), biotinylation, phosphorylation, sulfation, glycosylation, introduction of maleimido group, chelating moieties, chromophores and fluorophores.

[0039] The peptides may be conjugated to a fatty acid, e.g. the peptides are myristoylated. For example, a fatty acid may be conjugated to the N-terminus of the peptides, such fatty acids include caprylic acid (C8), capric acid (CIO), lauric acid (C12), myristic acid (C14), palmitic acid (C16) or stearic acid (C18) etc. Furthermore, cysteines in peptides can be palmitoylated. [0040] The peptides may be conjugated or linked to another peptide, such as a carrier peptide. The carrier peptide may facilitate cell-penetration, such as antennapedia peptide, penetratin peptide, TAT, transportan or polyarginine peptides.

[0041] The peptides may be cyclic or stapled. The peptides disclosed herein may be cyclized by adding a single or multiple disulfide bridges, adding a single or multiple amide bonds between the N- and C-terminus, heat to tail cyclization, side chain cyclization (e.g. lactam bridge, thioester), hydrocarbon-stabled peptides. The peptides disclosed herein may be stapled with a single, synthetic multiple, tandem braces ("staples") to enhance pharmacologic performance of the peptides.

[0042] The peptides may be labeled with heavy isotope labeling, e.g. 15N, 13C, FITC, conjugation to a carrier protein, conjugation to imaging agent, FRET substrates with a fluorophore/quencher pair, peptide-DNA conjugation, peptide-RNA conjugation and peptide- enzyme labeling.

[0043] The peptides may be within a fusion protein such as fused to a polypeptide or peptide which promotes oligomerization, such as a leucine zipper domain; a polypeptide or peptide which increases stability or half-life, such as an immunoglobulin constant region, and a polypeptide which has a therapeutic activity different from disclosed peptides.

[0044] Fusions can be made either at the amine- or at the carboxy-termini of the

polypeptides. The fusion proteins may be direct with no linker or adapter molecule or indirect using a linker or adapter molecule. A linker or adapter molecule may be one or more amino acid residues, typically up to about 20 to about 50 amino acid residues. A linker or adapter molecule may also be designed with a cleavage site for a protease to allow for the separation of the fused moieties. For example, the peptide may be fused to one or more domains of an Fc region of human IgG to increase the half-life of the peptide or the addition of a Fab variable domain to shorten the half-life of the peptide.

HCMV Infection

[0045] HCMV is a b-herpesvirus with an unusually protracted replication cycle spanning several days (Mocarski et al., 2007). During this time, HCMV forms a unique yet poorly understood cytoplasmic Assembly Compartment (AC) (Alwine, 2012). Only recently has fixed cell imaging revealed that the AC is a restructured Golgi surrounded by several other host organelles (Das and Pellett, 2011; Das et al., 2007; Rebmann et al., 2016; Sanchez et al., 2000a). The AC forms intimate connections with the nucleus resulting in a pinched "kidney bean" shape characteristic of infection. This connectivity allows virus particles to bud from the nucleus into the AC to mature. Notably, microtubules (MTs) emanate from the AC and maintain its structure (Sanchez et al., 2000a), while the MT motor dynein recruits specific host and viral components to the AC (Clippinger and Alwine, 2012; Indran et al., 2010). However, it is unknown how the AC behaves in living cells, or its potential functions beyond serving as a site for virus maturation.

[0046] MTs form through the assembly of a/b-tubulin subunits into polarized filaments through minus-end seeding at MTOCs such as the centrosome (Petry and Vale, 2015). Central to MT nucleation are y-tubulin proteins, which assemble into higher-order g-Tubulin Ring

Complexes (g-TuRCs) that bind a-tubulin. While the centrosome is the primary MTOC in many cell types, several non-centrosomal nucleation sites exist. These include the Golgi that contribute to the broader complexity of MT networks in different cell types (Sanders and Kaverina, 2015). After nucleating, MT plus-ends undergo rapid phases of growth, pause and de polymerization, generating dynamic arrays that radiate from MTOCs. The dynamic behavior and function of MTs is regulated by specialized end-binding proteins (EBs), comprising three family members (Akhmanova and Steinmetz, 2015). EB1 and EBB are structurally similar and can form hetero- or homo-dimers, while the more divergent EB2 forms only homodimers (Komarova et al., 2009). EB dimers specifically recognize GTP-tubulin that is transiently present at growing MT plus-ends, and thereby track growing MT tips (Maurer et al., 2011; Morrison et al., 1998;

Rickard and Kreis, 1990). EBs influence MT behavior both through direct effects on

polymerization and by recruiting other plus-end tracking proteins (+TIPs) (Dixit et al., 2009; Komarova et al., 2009; Komarova et al., 2005; Tirnauer and Bierer, 2000; Vitre et al., 2008; Zhang et al., 2015). Although many +TIPS can bind MTs, they utilize CAP-Gly or SxlP motifs to bind EB proteins in order to accumulate at MT plus-ends where they influence MT dynamics or engagement with cellular structures (Akhmanova and Steinmetz, 2015; Honnappa et al., 2009). In response to signaling cues often at specific subcellular sites, +TI Ps can mediate the capture and stabilization of MTs. While dynamic MTs typically have half-lives lasting minutes, stable MTs persist for several hours allowing them to accumulate distinguishing post-translation modifications (PTMs) (Janke and Bulinski, 2011). This includes tubulin detyrosination on the outer filament surface, which does not impart stability but allows stable MTs to be recognized by specific motors. In contrast, tubulin acetylation in the inner lumen confers mechanical strength (Portran et al., 2017; Xu et al., 2017).

[0047] In the experiments described herein, live-cell imaging revealed the dynamic behavior of the HCMV AC and its ability to control host cell remodeling by acting as an MTOC whose nucleating activity is predominantly Golgi-based. Through transcriptional and

posttranscriptional control of different EBs, HCMV exploits different MT subsets for different purposes. In particular, EBB is recruited to the AC to form acetylated MTs that control both nuclear rotation and AC structure. siRNAs or myristoylated peptides targeting EB3 (HEBTRON) highlight its specific role in these events, revealing novel functions and regulatory mechanisms for the AC and Golgi-derived MTs, and identifying new targets to suppress infection.

Mechanism

[0048] There are several notable features to how MTs are generated at the Golgi in uninfected cells, and how these are coopted at the AC. Nucleation material such as g-tubulin is normally less concentrated at the Golgi than at the more dominant centrosome (Rios et al., 2004; Sanders and Kaverina, 2015; Wu et al., 2016; Yang et al., 2017). However, experimental depletion of centrosomes greatly enhances the nucleation activity of the Golgi (Yang et al., 2017), suggesting that centrosomes sequester much of the cells valuable nucleating material from other sites. In this regard, it is notable that HCMV impairs centrosome function and as others report (Hertel and Mocarski, 2004), appears to cause centrosome "splitting". HCMV blocks cell division but pushes the cell into a "pseudo-mitotic" state that promotes viral DNA replication (Hertel et al., 2007; Hertel and Mocarski, 2004). Deregulation of the cell cycle and centrosome organization may release nucleating factors such as g-tubulin, pericentrin and CDK5RAP2, and these factors enriched at Golgi regions during infection. The data provided herein also suggests that other processes beyond centrosome deregulation are involved. These include increased abundance and availability of proteins such as g-tubulin. It was also observed that the enrichment of CDK5RAP2 at Golgi sites is dependent on EBB and is therefore also an actively controlled process of redistribution of MT nucleating factors. CDK5RAP2 is known to bind and translocate with EB1 (Fong et al., 2009), but has >4-fold higher affinity for EB3 (Jiang et al., 2012). CDK5RAP2 is particularly noteworthy as it enhances the nucleating activity of g- TuRCs and may be particularly important at weaker, non-centrosomal sites (Choi et al., 2010; Wang et al., 2010; Wu et al., 2016; Yang et al., 2017). The data provided show that HCMV specifically exploits EB3 to enrich factors at Golgi regions.

[0049] It was notable that the enrichment of CDK5RAP2 and formation of acetylated MTs was blocked by EB3 inhibitory peptide HEBTRON, demonstrating this process involved SxlP- interacting proteins. Recent studies have shown that EB1 and EB3 are not only important for the polymerization of MT plus-ends, but also play a particularly important role in the attachment and organization of MT minus-ends at Golgi sites (Yang et al., 2017). This too involves SxIP-interacting proteins such as Myomegalin, a core component of the GM130- AKAP450 complex that regulates Golgi-based MT nucleation (Efimov et al., 2007; Rios et al., 2004; Rivero et al., 2009; Roubin et al., 2013; Wang et al., 2014; Wu et al., 2016; Yang et al., 2017). Moreover, in these studies it was found that both EB proteins and CDK5RAP2 were required for MT nucleation at the Golgi (Yang et al., 2017). The data provided suggests that at least in the context of the remodeled Golgi that becomes the AC, EB3 also uses SxIP-based interactions to mediate the redistribution of factors such as CDK5RAP2 to Golgi sites.

[0050] It is also notable that HCMV specifically exploited EB3, but not EB1 to generate acetylated MTs. This diverges from Golgi-based MT formation that utilizes both EB1 and EB3 (Yang et al., 2017), and potentially reflects differences in the behavior of the remodeled Golgi or CDK-dependent phosphorylation of EB3 during infection. Alternatively, the hyper-activate nature of Golgi-based MT nucleation during HCMV infection may make differences between the functions of EB1 and EB3 more readily detectable. Indeed, although structurally similar and often functionally interchangeable, examples of diversification amongst EB proteins have emerged. This involves differences in N-terminal domains and a limited number of specific binding partners for each family member (Akhmanova and Steinmetz, 2015; Geraldo et al., 2008; Hsieh et al., 2007). For example, EB1 regulates spindle orientation while EB3 is required for daughter cell reattachment during mitosis, when EBB stability is specifically increased (Ban et al., 2009; Ferreira et al., 2013). Here again, HCMV's induction of a pseudo-mitotic state may underlie how it specifically exploits EB3. EB3 also plays specific roles in Focal Adhesion and Adherens Junction formation, ciliogenesis, and myoblast and epithelial apico-basal elongation (Bazellieres et al., 2012; Geyer et al., 2015; Komarova et al., 2012; Schroder et al., 2011; Straube and Merdes, 2007). While in many systems these functional differences can be subtle, in HCMV-infected cells robust divergence is evident; EB1 and EB3 specifically regulate CLIP170 behavior and acetylated MTs, respectively, with each contributing differently to AC structure and the extent of HCMV replication.

[0051] The dynamic behavior of the AC, critical to efficient virus maturation, likely maintains its integrity during cellular reorganization and subsequent cell migration. However, there are also striking similarities to the dynamics of Golgi reorientation in migrating cells, which like the AC can traverse the nucleus as smaller fragments that reassemble on the side of the leading edge (Wu et al., 2016). This plays a key role in polarizing the cell for migration through re localization of vesicles and organelles, as well as control of cell adhesion (Maninova et al., 2013; Vinogradova et al., 2009; Wu et al., 2016). The data provided herein demonstrate that MTs formed at the AC also control nuclear rotation prior to cell migration. Nuclear movement, which involves elements of rotation and the distinct process of front-rear repositioning, helps generate cell polarity in migrating cells (Maninova et al., 2013; Zhu et al., 2017). MTs contribute to this by directly pushing the nucleus or by enabling force exertion by motors associated with the nuclear envelope (Daga et al., 2006; Hui et al., 2016; Levy and Holzbaur, 2008; Maninova et al., 2013; Szikora et al., 2013; Wu et al., 2011; Zhao et al., 2012). While much attention has focused on centrosomes, growing MTs push oocyte nuclei independently of centrosomes during establishment of the Drosophila dorsal-ventral axis (Zhao et al., 2012), hinting at potential roles for non-centrosomal MTs in at least some contexts. Indeed, nuclear rotation requires considerable force and recent work revealed that oc-tubulin acetylation confers mechanical strength to MTs (Portran et al., 2017; Xu et al., 2017). Given that Golgi-derived MTs are rapidly acetylated and may be the primary source of acetylated MT subsets in many cell types (Chabin-Brion et al., 2001; Rivero et al., 2009; Sanders and Kaverina, 2015), the data suggest Golgi-derived MTs may be underappreciated regulators of nuclear rotation.

[0052] Rotation of nuclei is a fundamental part of intracellular reorganization during polarization and migration (Gundersen and Worman, 2013; Maninova et al., 2013). Nuclear rotation may be central to how HCMV remodels its host cell to replicate and spread, in part through polarizing the cell for migration. ACs also exhibited structural abnormalities in EB3- depleted or HEBTRON-treated cells, suggesting that in order to maintain their structure ACs may need acetylated MTs to tether to the nucleus. This tight coupling to a dynamic AC may in turn cause nuclei to rotate. Rotation has also been suggested to contribute to chromosome organization during meiosis (Christophorou et al., 2015). Given the pseudo-mitotic state of infected cells it is also possible that the role of Golgi-derived MTs in nuclear rotation is specific to mitotic processes coopted by HCMV, rather than migration-related cell polarization discussed above. Notably, HCMV forms discrete nuclear replication compartments that may be organized, similar to chromosomes, by rotating the nucleus, or be positioned relative to sites of AC tethering to the nucleus for efficient virus budding into the AC. The findings described herein suggest this is a fundamental aspect of HCMV infection driven by EB3-regulated MTs. Targeting host proteins like EB3 with highly specialized functions is an attractive approach to avoid the emergence of drug-resistance commonly associated with therapeutics targeting evolutionarily adaptable viral proteins.

Methods of Treatment

[0053] Provided herein is a method of inhibiting, preventing or reducing human

cytomegalovirus infection in a subject. The subject may be a mammal, which may be a human. In certain embodiments, the subject is an adult human or child human.

[0054] In other embodiments, the subject is a newborn human, including children less than one week old, less than two weeks old, less than 3 weeks old, less than 4 weeks old, less than 5 weeks old, less than 6 weeks old. A "newborn" refers to a human that has an age between birth and about 2 months. [0055] In some embodiments, the subject is an infant human, including children that are about 2 months old, about 3 months old, about 4 months old, about 5 months old, about 6 months old, about 7 months old, about 8 months old, about 9 months old, about 10 months old, about 11 months old or about 12 months old. An "infant" refers to a human that has an age between about 2 months and about 1 year.

[0056] In any of the provided methods, the subject is infected with HMCV but may be asymptomatic. In addition, the subject may be at risk of being infected or developing symptoms associated with HCMV infection or a cytomegalovirus (CMV) related-condition. For example, the subject infected with HCMV may be an organ transplant recipient, a pregnant woman, a subject infected with HIV, a subject that has been significantly burned, or a subject that is immune compromised.

[0057] HMCV related-conditions include CMV hepatitis, cytomegalovirus retinitis,

cytomegalovirus colitis, CMV pneumonitis, CMV esophagitis, polyradiculopathy, transverse myelitis, subacute encephalitis, CMV mononucleosis, Gullain-Barre syndrome, type I diabetes and type 2 diabetes.

[0058] "Treating," "treatment," or "to treat" each may mean to alleviate, suppress, repress, eliminate, prevent or slow the appearance of symptoms, clinical signs, or underlying pathology of a condition or disorder on a temporary or permanent basis. Preventing a condition or disorder involves administering a peptide, agent or compound described herein to a subject prior to onset of the disease or prior to evidence of symptoms, for example in subjects infected with HCMV but are asymptomatic. Suppressing a condition or disorder involves administering a peptide, agent or compound described herein to a subject after induction of the condition or disorder but before its clinical appearance, for example "suppression" includes inhibiting or preventing clinical symptoms after HCMV infection. Repressing the condition or disorder involves administering a peptide, agent or compound described herein to a subject after clinical appearance of the disease, for example "repression" includes inhibiting or reducing the clinical symptoms after HCMV infection. Treating also includes reducing HCMV viral load and/or inhibiting the spread of the HCMV infection and/or inhibiting HCMV proliferation in the infected an infected subject. [0059] The term "therapeutically effective" depends on the condition of a subject and the specific peptide, agent or compound administered. The term refers to an amount effective to achieve a desired clinical effect. A therapeutically effective amount varies with the nature of the condition being treated, the length of time that activity is desired, and the age and the condition of the subject, and ultimately is determined by the health care provider.

[0060] Suitable methods of administering a physiologically-acceptable composition, such as a pharmaceutical composition comprising a peptide, agent or compounds described herein, are known in the art. Although more than one route can be used to administer a peptide, a particular route can provide a more immediate and more effective reaction than another route. Depending on the circumstances, a pharmaceutical composition comprising the peptide is applied or instilled into body cavities, absorbed through the skin or mucous membranes, ingested, inhaled and/or introduced into circulation. For example, in certain circumstances, it will be desirable to deliver the pharmaceutical composition orally; through injection or infusion by intravenous, intratumoral, intraperitoneal, intracerebral (intra-parenchymal),

intracerebroventricular, intramuscular, intra-ocular, intraarterial, intraportal, intralesional, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, urethral, vaginal, or rectal means; by controlled, delayed, sustained or otherwise modified release systems; or by implantation devices. In one aspect, drug exposure can be optimized by maintaining constant drug plasma concentrations over time. Such a steady-state is generally accomplished in clinical settings by continuous drug infusion at doses depending on the drug clearance and the plasma concentration to be sustained. If desired, the composition is administered regionally via intratumoral, administration, intrathecal administration, intracerebral (intra-parenchymal) administration, intracerebroventricular administration, or intraarterial or intravenous administration targeting the region of interest. Alternatively, the peptide is administered locally via implantation of a matrix, membrane, sponge, or another appropriate material onto which the desired compound has been absorbed or encapsulated. Where an implantation device is used, the device is, in one aspect, implanted into any suitable tissue or organ, and delivery of the desired compound is, for example, via diffusion, timed-release bolus, or continuous administration. [0061] Ocular administration of the peptides may be carried using intraocular implants, intravitreal injections, systemic administration, topical application, nanoparticles,

microparticles, eye drops, bioadhesive gels or fibrin sealant, polysaccharides to modulate the permeability of the epithelial cell barrier complex, peptide enhancing corneal drug delivery, mucosal administration such as administration using a biovector polymer, aqueous ophthalmic sprays and electrodynamic ocular spray treatment. In one particular embodiment, the peptide may be administered by intravitreal injection or topically such as in the form of an eye drop.

[0062] The provided peptide, agent or compound may be administered as a monotherapy or simultaneously or metronomically with other treatments. The term "simultaneous" or

"simultaneously" as used herein, means that the peptide and other treatment be administered within 48 hours, preferably 24 hours, more preferably 12 hours, yet more preferably 6 hours, and most preferably 3 hours or less, of each other. The term "metronomically" as used herein means the administration of the peptide at times different from the other treatment and at a certain frequency relative to repeat administration. For example, the provided peptide is administered with one or more anti-viral agents, hyperimmune globulin enhanced for CMV or with an anti-HMCV vaccine.

[0063] For example, the provided peptide, agent or compound may be administered simultaneously or metronomically with ganciclovir (Cytovene), valganciclovir (Valcyte), foscarnet (Foscavir), and cidofovir (Vistide), hexadecyloxypropyl-cidofovir, leflunomide (Avara), letermovir (Prevymis), and/or Maribavir. Alternatively, the provided peptide, agent or compound may be administered to a subject that is infected with HCMV that is resistant to one or more of with ganciclovir (Cytovene), valganciclovir (Valcyte), foscarnet (Foscavir), and cidofovir (Vistide), hexadecyloxypropyl-cidofovir, leflunomide (Avara), letermovir (Prevymis), and/or Maribavir.

[0064] The peptide may be administered at any point prior to another treatment including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50 hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 hr, 34 hr, 32 hr, 30 hr, 28 hr, 26 hr, 24 hr, 22 hr, 20 hr, 18 hr, 16 hr, 14 hr, 12 hr, 10 hr, 8 hr, 6 hr, 4 hr, 3 hr, 2 hr, 1 hr, 55 mins., 50 mins., 45 mins., 40 mins., 35 mins., 30 mins., 25 mins., 20 mins., 15 mins, 10 mins, 9 mins, 8 mins, 7 mins., 6 mins., 5 mins., 4 mins., 3 mins, 2 mins, and 1 mins. The peptide may be administered at any point prior to a second treatment of the peptide including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr,

102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50 hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 hr, 34 hr, 32 hr, 30 hr, 28 hr, 26 hr, 24 hr, 22 hr, 20 hr, 18 hr, 16 hr, 14 hr, 12 hr, 10 hr, 8 hr, 6 hr, 4 hr, 3 hr, 2 hr, 1 hr, 55 mins., 50 mins., 45 mins., 40 mins., 35 mins., 30 mins., 25 mins., 20 mins., 15 mins., 10 mins., 9 mins., 8 mins., 7 mins., 6 mins., 5 mins., 4 mins., 3 mins, 2 mins, and 1 mins.

[0065] The peptide may be administered at any point after another treatment including about 1 min, 2 mins., 3 mins., 4 mins., 5 mins., 6 mins., 7 mins., 8 mins., 9 mins., 10 mins., 15 mins., 20 mins., 25 mins., 30 mins., 35 mins., 40 mins., 45 mins., 50 mins., 55 mins., 1 hr, 2 hr, 3 hr, 4 hr, 6 hr, 8 hr, 10 hr, 12 hr, 14 hr, 16 hr, 18 hr, 20 hr, 22 hr, 24 hr, 26 hr, 28 hr, 30 hr, 32 hr, 34 hr, 36 hr, 38 hr, 40 hr, 42 hr, 44 hr, 46 hr, 48 hr, 50 hr, 52 hr, 54 hr, 56 hr, 58 hr, 60 hr, 62 hr,

64 hr, 66 hr, 68 hr, 70 hr, 72 hr, 74 hr, 76 hr, 78 hr, 80 hr, 82 hr, 84 hr, 86 hr, 88 hr. 90 hr, 92 hr.

94 hr, 96 hr, 98 hr, 100 hr, 102 hr, 104 hr, 106 hr, 108 hr, 110 hr, 112 hr, 114 hr, 116 hr, 118 hr, and 120 hr. The peptide may be administered at any point prior after a second treatment of the peptide including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr. 106 hr, 104 hr,

102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr. 76 hr. 74 hr. 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50 hr, 48 hr, 46 hr, 44 hr. 42 hr, 40 hr, 38 hr, 36 hr, 34 hr, 32 hr, 30 hr, 28 hr, 26 hr, 24 hr, 22 hr, 20 hr, 18 hr. 16 hr. 14 hr, 12 hr, 10 hr, 8 hr, 6 hr, 4 hr. 3 hr, 2 hr, 1 hr, 55 mins., 50 mins., 45 mins., 40 mins.. 35 mins., 30 mins., 25 mins.. 20 mins., 15 mins., 10 mins., 9 mins., 8 mins., 7 mins., 6 mins., 5 mins., 4 mins., 3 mins, 2 mins, and 1 mins.

Formulation

[0066] The method may comprise administering one or more of the peptides, agents or compounds disclosed herein. The peptides, agents or compounds provided herein may be in the form of tablets or lozenges formulated in a conventional manner. For example, tablets and capsules for oral administration may contain conventional excipients may be binding agents, fillers, lubricants, disintegrants and wetting agents. Binding agents include, but are not limited to, syrup, acacia, gelatin, sorbitol, tragacanth, mucilage of starch and polyvinylpyrrolidone. Fillers may be lactose, sugar, microcrystalline cellulose, maize starch, calcium phosphate, and sorbitol. Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica. Disintegrants may be potato starch and sodium starch glycollate. Wetting agents may be sodium lauryl sulfate. Tablets may be coated according to methods well known in the art.

[0067] The peptides, agents or compounds provided herein may also be liquid formulations such as aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs. The peptides may also be formulated as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain additives such as suspending agents, emulsifying agents, nonaqueous vehicles and preservatives. Suspending agent may be sorbitol syrup, methyl cellulose, glucose/sugar syrup, gelatin, hydroxyethylcellulose, carboxymethyl cellulose, aluminum stearate gel, and hydrogenated edible fats. Emulsifying agents may be lecithin, sorbitan monooleate, and acacia. Nonaqueous vehicles may be edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol. Preservatives may be methyl or propyl p-hydroxybenzoate and sorbic acid. In particular, the provided peptides may be in aqueous formulations for topical administration such as in the form of an eye drop.

[0068] The peptides, agents or compounds provided herein may also be formulated as suppositories which may contain suppository bases such as cocoa butter or glycerides. Peptides provided herein may also be formulated for inhalation, which may be in a form such as a solution, suspension, or emulsion that may be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifluoromethane or trichlorofluoromethane. Peptides provided herein may also be formulated as transdermal formulations comprising aqueous or nonaqueous vehicles such as creams, ointments, lotions, pastes, medicated plaster, patch, or membrane. Peptides provided herein may also be formulated for parenteral administration such as by injection, intratumor injection or continuous infusion. Formulations for injection may be in the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing, and dispersing agents. The peptide may also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free water.

[0069] The peptides, agents or compounds provided herein may also be formulated as a depot preparation, which may be administered by implantation or by intramuscular injection. The peptides may be formulated with suitable polymeric or hydrophobic materials (as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives (as a sparingly soluble salt, for example).

Dosage

[0070] The method may comprise administering a therapeutically effective amount of the peptides to a patient in need thereof. The therapeutically effective amount required for use in therapy varies with the nature of the condition being treated, the length of time desired to activate Toll-like receptors, and the age/condition of the patient. In general, however, doses employed for adult human treatment typically are in the range of 0.001 mg/kg to about 200 mg/kg per day. The dose may be about 0.05 mg to about 10 g per day. The desired dose may be conveniently administered in a single dose, or as multiple doses administered at appropriate intervals, for example as two, three, four or more sub-doses per day. Multiple doses may be desired or required.

[0071] The dosage may be at any dosage such as about 0.05 pg/kg. 0.06 pg/kg, 0.07 pg/kg, 0.08 pg/kg, 0.09 pg/kg, 0.1 pg/kg, 0.2 pg/kg, 0.3 pg/kg, 0.4 pg/kg, 0.5 pg/kg, 0.6 pg/kg, 0.7 pg/kg, 0.8 pg/kg, 0.9 pg/kg, 1 pg/kg, 1.5 pg/kg, 2 pg/kg, 3 pg/kg, 4 pg/kg, 5 pg/kg, 10 pg/kg, 15 pg/kg, 20 pg/kg, 25 pg/kg, 50 pg/kg, 75 pg/kg, 100 pg/kg, 125 pg/kg, 150 pg/kg, 175 pg/kg, 200 pg/kg, 225 pg/kg, 250 pg/kg, 275 pg/kg, 300 pg/kg, 325 pg/kg, 350 pg/kg, 375 pg/kg, 400 pg/kg, 425 pg/kg, 450 pg/kg, 475 pg/kg, 500 pg/kg, 525 pg/kg, 550 pg/kg, 575 pg/kg, 600 pg/kg, 625 pg/kg, 650 pg/kg, 675 pg/kg, 700 pg/kg, 725 pg/kg, 750 pg/kg, 775 pg/kg, 800 pg/kg, 825 pg/kg, 850 pg/kg, 875 pg/kg, 900 pg/kg, 925 pg/kg, 950 pg/kg, 975 pg/kg.

[0072] The dosage may be at any dosage such as about 0.05 mg/kg, 0.06 mg/kg, 0.07 mg/kg, 0.08 mg/kg, 0.09 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, 1 mg/kg, 25 mg/kg, 50 mg/kg, 75 mg/kg, 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg, 200 mg/kg, 225 mg/kg, 250 mg/kg, 275 mg/kg, BOO mg/kg, 325 mg/kg,

350 mg/kg, 375 mg/kg, 400 mg/kg, 425 mg/kg, 450 mg/kg, 475 mg/kg, 500 mg/kg, 525 mg/kg,

550 mg/kg, 575 mg/kg, 600 mg/kg, 625 mg/kg, 650 mg/kg, 675 mg/kg, 700 mg/kg, 725 mg/kg,

750 mg/kg, 775 mg/kg, 800 mg/kg, 825 mg/kg, 850 mg/kg, 875 mg/kg, 900 mg/kg, 925 mg/kg,

950 mg/kg, 975 mg/kg, 1 g/kg, 2 g/kg, 3 g/kg, 4 g/kg, 5 g/kg, 6 g/kg, 7 g/kg, 8 g/kg, 9 g/kg, or 10 g/kg.

Definitions

[0073] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the specification and the appended claims, the singular forms "a," "and" and "the" include plural references unless the context clearly dictates otherwise.

[0074] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9 and 7.0 are explicitly contemplated.

[0075] " Identical" or "identity" as used herein in the context of two or more polypeptides or nucleotide sequences, may mean that the sequences have a specified percentage of residues or nucleotides that are the same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the

denominator but not the numerator of the calculation. [0076] "Substantially identical," as used herein may mean that a first and second protein or nucleotide sequence are at least 50%-99% identical over a region of 6-100 or more amino acids nucleotides.

EXAMPLES

Example 1

Methods

Cells

[0077] Validated and certified primary Normal Human Dermal Fibroblasts (NHDFs) isolated from human male neonatal foreskin were purchased from Lonza (CC-2509). HEK-293-T, HEK- 293-A, VERO and BSC-40 cells were from Dr. Ian Mohr, NYU. Phoenix-Ampho cells were purchased from ATCC. All cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM; Fisher Scientific) supplemented with 5% Fetal Bovine Serum (FBS), 2 mM L-Glutamine and penicillin-streptomycin and maintained at 37°C, 5% C0 ₂ . Where indicated, confluent cultures of NHDFs were growth-arrested by washing three times in PBS before being maintained in DMEM supplemented with 0.2% Fetal Bovine Serum (FBS), 2 mM L-Glutamine and penicillin- streptomycin for 72 h.

Viruses and Cell Transduction

[0078] HCMV strain AD169 and bacterial artificial chromosome (BAC)-derived HCMV strains AD169, TB40/E and FIX expressing GFP reporters were grown on NHDFs until >90 cytopathic effect was observed. Cells and medium were collected and freeze-thawed to release virus. Cell debris was removed by centrifugation and virus was titrated by serial dilution on NHDFs and plaque counting. Generation of HCMV TB40/E expressing UL99-eGFP or UL32-mCherry, as well as viral expression vectors is described in Method Details. VacV-B5-GFP was grown on BSC-40 cells until >90% cypopathic effect was observed. Cells and medium were collected and freeze- thawed to release virus. Cell debris was removed by centrifugation and virus titrated on BSC-40 cells. [0079] HCMV BAC-derived strain TB40/E (clone 4) was used to generate either TB40/E expressing UL99-eGFP or UL32-mCherry using galK BAC recombineering protocols and transformation in SW105 E. coli. The galK ORF was inserted into UL99 or UL32 locus in BAC- TB40/E (clone 4) using the following primers:

[0080] UL99-GalK-5': 5'-CAA CGT CCA CCC ACC CCC GGG ACA AAA AAG CCC GCC GCC CCC

TTG TCC TTT CCT GTT GAC AAT TAA TCA TCG GCA-3' (SEQ ID NO: 5);

[0081] UL99-GalK-3': 5'-GTG TCC CAT TCC CGA CTC GCG AAT CGT ACG CGA GAC CTG AAA GTT

TAT GAG TCA GCA CTG TCC TGC TCC TT-3' (SEQ ID NO: 6)

[0082] UL32-Galk-5': 5'-CCG TGC AGA ACA TCC TCC AAA AGA TCG AGA AGA TTA AGA AAA

CGG AGG AAC CTG TTG ACA ATT AAT CAT CGG CA-3' (SEQ ID NO: 7)

[0083] UL32-Galk-3': 5'-CGT CAC TAT CCG ATG ATT TCA TTA AAA AGT ACG TCT GCG TGT GTG

TTT CTT CAG CAC TGT CCT GCT CCT T-3'. (SEQ ID NO: 8)

[0084] Positive clones were selected on GalK plates and further validated on McConkey plates. I nsertion of the cassette was confirmed by PCR. Positive clones were then selected and grown in LB-chloramphenicol at 32°C overnight. Cultures were then diluted and grown to an OD600 0.5-0.7. Competent bacteria were electroporated with PCR products generated as follows:

[0085] UL99-eGFP-5': 5'-CAACGTCCACCCACCCCCGGGACAAAAAAGCCCGCCGCCC

CCTTGTCCTTTGTGAGCAAGGGCGAGGAGCTGTTCACCG-3' (SEQ I D NO: 9) coupled with UL99- eGFP-3':5'-GTGTCCCATTCCCGACTCGCGAATCGTACGCGAGACCTGAAAGTTTATG AGTT

ACTTGTACAGCTCGTCCATGCCGAGAGT-3'(SEQ ID NO: 10) using eGFP as a template, or UL32- Rev-5': 5'-CCG TGC AGA ACA TCC TCC AAA AGA TCG AGA AGA TTA AGA AAA CGG AGG AAA TGG TGA GCA AGG GCG AGG AG-3' (SEQ ID NO: 11) coupled with UL32 Rev-3': 5'-CGT CAC TAT CCG ATG ATT TCA TTA AAA AGT ACG TCT GCG TGT GTG TTT CTT TAC TTG TAC AGC TCG TCC ATG CCG-3' (SEQ ID NO: 12) using mCherry as a template.

[0086] Recombinant clones were selected for loss of GalK expression by screening on 2- Deoxy galactose/Glycerol containing plates. Clones were further validated by PCR analysis and then analyzed by sequencing. Virus stocks were grown and titrated on NHDFs as described above.

[0087] GFP-CLIP170, GFP, HCMV IE1 and HCMV IE2 retroviral expression vectors were produced by transfecting Phoenix-Ampho cells with pBABE-puro vectors described below. Cell culture medium was changed 24 h after transfection. Supernatant containing virus was then collected at 48 hours and 72 hours post-transfection and filtered through a 0.45 mM filter.

[0088] For stable expression of eGFP-CLIP170 or NLS-mCardinal sub-confluent NHDFs were transduced with a pBABE-puro-AA-GFP-CLIP170-derived or pBABE-puro-AA-NLS-mCardinal- derived retroviral vector in the presence of polybrene. Four hours after transduction, NHDFs were washed with PBS and fresh cell culture media was added. 24 hours after transduction, pools of stably expressing cells were generated by selecting with either 0.8 mg/ml puromycin (for eGFP-CLIP170 and NLS-mCardinal). Following selection, cells were maintained in growth medium containing either 160 ng/ml puromycin. For transient expression of GFP or IE1/2 NHDFs were transduced with retroviral vectors described above and processed at the indicated times.

RNA interference (RNAi) and inhibitors

[0089] siRNAs were obtained from Life Technologies (Thermo Fisher Scientific); See Key Resources Table for details. siRNAs were transfected as described previously (Jovasevic et al., 2015). To avoid effects on early HCMV infection, cells were transfected with 150 pmol/ml siRNA using RNAiMax (Invitrogen) and 30 h later infected with HCMV at the indicated MOI. When examining late stages of infection, 3 d.p.i. cells were transfected with siRNA for a second time to counter HCMV-induced increases in EB expression. In the case of spreading assays, this was done without changing cell culture medium. Infected cultures were then processed for imaging, western blot analysis or titration of virus production as described below. To suppress viral I El/2 expression, confluent NHDFs were treated with 300 pmol/ml siRNA. 1 day later, cells were infected with HCMV AD169 at MOI 3. Lysates were collected at 3 d.p.i. and analyzed by

Western blotting as described below. Aurora Kinase/CDK inhibitor JNJ-7706621 (Calbiochem) was dissolved in DMSO and used at a final concentration of 3 mM. Medium was replaced with fresh DMSO- or inhibitor-containing medium every 24h. HEBTRON and mutN-mutC, mutN controls were dissolved in DMSO and is described in detail below. To test effects of HEBTRON on infection, confluent NHDFs were pretreated for 1 h with DMSO control or 25 mM HEBTRON in culture medium without penicillin/streptomycin, followed by infection with HCMV TB40/E (GFP) at the indicated MOI. Cell culture media with DMSO or 25 mM HEBTRON was replaced every 48h. To avoid removing newly produced virus at later stages, at 6 d.p.i. a lOx stock of DMSO or HEBTRON was added directly to the cell culture medium such that the final concentration added was 25mM. At the indicated time-points infected cultures were then processed for imaging as described below.

Isothermal titration calorimetry

[0090] HEBTRON and EB3(200-281) were dialyzed into PBS. Titration experiments were performed using a VP-ITC Microcalorimeter (MicroCal LLC, Northampton, MA) at 25°C. For titration, 25-27 aliquots (5 mί each) of 60 mM EB3 (200-281) were injected into the ITC cell containing 1.4 mL of 4 mM HEBTRON. Each titration was preceded by a single 2pL injection to address diffusion artifacts. Two reference titrations were run. One of these titrations controlled for protein dilution effects and the other controlled for the peptide dilution effects. The reference data were subtracted from the protein titration data points. The integrated heat values were analyzed using the Origin 7.0'-software as well as the Scientist 3.0 software (Micromath Scientific Software). Data were fit using the 'One set of sites' model, to yield the dissociation constant (Kd), the stoichiometry, the enthalpic and entropic contributions to the Gibbs free energy of complex formation.

Analysis of EB3 Dimerization

[0091] FRET measurements were carried out using a PHERAstar FS (BMG LABTECH Inc., Cary, NC) microplate reader equipped with a FRET module for CFP and YFP pair (Komarova et al., 2012). (His6)-YFP-EB3 and (His6)-CFP-EB3 were mixed in equimolar concentration. In the experiments with HEBTRON, the protein and the peptide were mixed in 1:1 molar ratio. CFP and FRET fluorescence were recorded using simultaneous dual emission at l= 480 nm and 530 nm, respectively, and excitation at l= 420 nm. DARTS using purified full length (His6)EB3

[0092] 100 nM of recombinant (His6)-EB3 was incubated with 100 nM HEBTRON or the EB1- specific peptide for 2h at 4°C, followed by proteolysis with lpg of thermolysin at 37°C for 1 hr. To stop proteolysis, 0.5 M EDTA (pH 8.0) was added to each sample at a 1:10 ratio. The protein was detected using anti-EB3 antibody by Western blotting.

NanoDSF

[0093] Unfolding of EB3 alone or in presence of HEBTRON was measured by detecting the temperature-dependent change in tryptophan fluorescence at =330nm and 350nm using the Prometheus NT.Plex (NanoTemper). The temperature gradient was set in a range from 200C to 900C. Melting temperatures were calculated from the maximum of the first derivative of the fluorescence ratios (F350/F330). For this, an eighth order polynomial fit was calculated for the transition region and then the first derivative of the fit was formed. The peak position at melting temperature was determined from the first derivative.

HEBTRON Uptake Assays

[0094] NHDFs were grown on glass bottom dishes for 2 days at 37 °C and 5% C02. Cells were kept at 37 °C for the experiment. The 5'6-FAM (Fluorescein)-conjugated Myr-HEBTRON was added at a concentration of 10 mM directly to the media during imaging. Images were acquired every 10 seconds for 10 minutes in both the FITC and DIC channels (to mark cell boundaries) using a Zeiss LSM 880 confocal microscope equipped with a 63x 1.4 NA oil objective. The fluorescent intensity inside each cell for each time point was measured using ImageJ and normalized to the initial fluorescent background intensity inside the cell. The normalized fluorescent intensity was plotted over time. The half time to maximum uptake as well as the maximum uptake in the cells was found by fitting a Sigmoidal dose response curve to the data using GraphPad Prism 7.

Virus production and spreading assays

[0095] To determine effects on virus production, cells were treated with siRNAs or inhibitors and infected as indicated. Culture medium was then removed, centrifuged at 40C for 3 min at

3,000 rpm to remove cell debris and supernatants collected. To determine viral titers, a 1:10 dilution series was generated for each virus supernatant and used to infect NHDFs seeded on 12-well plates using four technical replicates for each dilution. At 14 d.p.i. GFP-positive plaques were counted at the appropriate dilution using a Leica DMI6000B-AFC microscope with a 370C InVivo environmental chamber. Phase imaging was also used to examine Cytopathic Effect (CPE) to ensure no infectious virus was present that did not retain GFP expression.

[0096] To determine effects of siRNAs on plaque sizes, NHDFs were treated and infected as outlined above before phase and fluorescent (GFP channel) images of plaques were acquired using a Leica DMI6000B-AFC microscope with a 370C InVivo environmental chamber, lOx objective, X-Cite XLED1 illumination, ORCA FLASH 4.0 cMOS camera and Metamorph software (Molecular devices) using the multi-dimensional acquisition function. Plaque areas were determined by using the threshold area function of the FIJI. To determine the effect of HEBTRON treatment on virus plaque sizes, NHDFs seeded in 12-well plates were pretreated with DMSO, 25 mM HEBTRON or 25 pM HEBTRON controls for 1 h. Cultures were then infected with either HCMV AD169-GFP or TB40/E-GFP, VACV-B5-GFP at MOI 0.001. For slower- replicating HCMV, cell culture media containing DMSO or 25 pM HEBTRON or controls was replaced every 48h. Images were acquired at the indicated times and analyzed as described above. 50 pixel rolling ball background subtraction was used to reduce autofluorescence from the cell culture vessel evident in VACV-B5-GFP plaque images using FIJI.

Western blotting (WB)

[0097] For Western blot analysis, cells were lysed in laemmli buffer (62.5 mM Tris-HCI at pH 6.8, 2% SDS, 10% glycerol, 0.7 M b-mercaptoethanol), followed by boiling for 3 min. Samples were resolved using reducing 10% polyacrylamide Tris-glycine SDS PAGE. Resolved proteins were transferred to a nitrocellulose membrane (GE Healthcare Life Sciences) at 57 V for 60 min (Mini Trans-Blot system, Bio-Rad), washed in Tris-Buffered Saline (TBS) containing 0.1% Tween (TBS-T) and blocked (5% non-fat milk TBS-T) before incubating with primary antibodies diluted in 3% BSA TBS-T overnight at 40C. Membranes were washed with TBS-T and incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (GE Healthcare Life Sciences) diluted 1:3,000 in TBS-T containing 5% non-fat milk for 1 h at room temperature. Membranes were then washed in TBS-T and incubated with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) before exposure to x-ray film. Densitometry was performed on scanned films using Gel Analyzer in FIJI.

Immunofluorescence and Live Cell Imaging

[0098] For immunofluorescence microscopy, confluent monolayers of NHDFs were grown on glass coverslips in a 12-well plate. Cells were treated with siRNAs or inhibitors and infected as indicated. Cells were then rinsed in PBS and fixed in ice-cold methanol for 7 min on ice. Samples were then rinsed in PBS and blocked in PBS containing 10% human serum and 0.25% (w/v) saponin for 1 h at 370C. Samples were incubated with primary antibody diluted in PBS containing 10% human serum and 0.025% (w/v) saponin overnight at 40C. The next day, samples were washed in PBS containing 0.025% (w/v) saponin, then incubated with appropriate Alexa Fluor-conjugated secondary antibodies diluted in PBS containing 10% human serum and 0.025% (w/v) saponin for 1 h at room temperature. Samples were stained with Hoechst 33342 where indicated, washed in PBS containing 0.025% (w/v) saponin, then washed with water, dried and mounted on a glass slide using FluroSave (Calbiochem). Wide-field images were acquired using a Leica DMI6000B-AFC microscope using a lOOx objective (HC PL APO

100x/1.44NA OIL), X-Cite XLED1 illumination, ORCA FLASH 4.0 CMOS camera and Metamorph software using the multi-dimensional acquisition function to ensure use of the same acquisition settings for all collected images. Confocal images were acquired using a motorized spinning-disc confocal microscope (Leica DMI 6000B), Yokogawa CSU-X1 A1 confocal head and MetaMorph software using the multi-dimensional acquisition function. Confocal z-stacks were acquired at 0.2 pm intervals. All images were analyzed using Metamorph and compiled using the FIJI. All images within a given dataset were processed equivalently.

[0099] For nocodazole wash-out assays, NHDFs were seeded onto glass coverslips and grown to confluence. Cultures were then mock infected or infected with HCMV strain AD169 at MOI 3. At 3 d.p.i. culture medium was changed to DMEM supplemented with 10 pM nocodazole for 8 h to completely depolymerize MTs. Cells were then washed with PBS and incubated in normal culture medium for 20 min. Cells were then fixed in ice cold methanol, stained with the indicated antibodies for immunofluorescence and imaged as described above. Areas of centrosomal tyrosinated tubulin staining after nocodazole washout were determined using the threshold area function on single confocal slices obtained at the centrosomal focal plain indicated by g-tubulin staining. Identical thresholds were used for all conditions. Non- centrosomal microtubules were quantified using the cell counter plugin for FIJI, centrosomal microtubules were excluded from analysis using pericentrin staining. CDK5RAP2 staining area was determined for infected cells with consistent gB staining using the threshold area function of the FIJI.

[0100] For live-cell imaging, immediately prior to imaging culture medium was changed Leibovitz's L-15 Medium without phenol red (Thermo Fisher Scientific) supplemented with 2 mM L-Glutamine and 5% Fetal Bovine Serum (FBS). Cultures then transferred to a Leica DMI6000B-AFC microscope with a 370C InVivo environmental chamber and allowed to equilibrate for 30 min. For single condition experiments, cells were seeded on 35 mm glass- bottom dishes (MatTek). Where multiple conditions were compared, cells were seeded on cell view four compartment 35 mm glass-bottom dish (Greiner Bio-One) to ensure the same experimental conditions between comparisons. For analysis of microtubule dynamics, NHDFs stably expressing eGFP-CLIP170 were imaged at 500 ms intervals for 1 min using a lOOx objective (HC PL APO 100x/1.44NA OIL), X-Cite XLED1 illumination and an ORCA FLASH 4.0 CMOS camera with Metamorph software.

[0101] CLIP-170-eGPF plus-end line-scan analysis was performed using the line-scan function of Metamorph on single frames from time lapse images of polymerizing microtubules only in TB40/E UL32-mCherry infected cells. EB1 and EB3 line-scan were obtained from fixed cells as above with intensities for EB1 and EB3 acquired simultaneously from individual microtubules in 2-channel stacks. All line-scans were first normalized and aligned before analysis using

Microsoft Excel. For live-cell imaging to determine AC maturation dynamics, a multi-position stage (was used to acquire images once every 30 mins from multiple infected cells and across multiple sections of compartmentalized dishes over the indicated imaging periods. For faster frame-rate imaging of virion trafficking and AC behavior, images were acquired at 500 ms intervals for 1 min. All live-cell image stacks were analyzed using Metamorph and compiled using the FIJI. UL32-mCherry/UL99-eGFP labelling of virus particles was analyzed

simultaneously using the line-scan function of Metamorph drawn across individual virus particles in 2-channel stacks generated from single frames of time lapse images of AC maturation of cells infected with both viruses. The maximum point of UL32-mCherry fluorescence were aligned for all virus particles before analysis using Microsoft Excel.

[0102] In all figures, representative examples are shown.

Tracking nuclear rotation

[0103] Two approaches to tracking nuclear rotation were used. In the first, nuclear reorientation was manually tracked using two fixed points on the nuclear membrane of infected cells using the Manual Tracking plugin of Fiji. The first point was the center of the unique nuclear "pinch" generated by HCMV (or the point most proximal to the AC if the pinch was yet to form). The second point was on the nuclear membrane directly opposite the first point. These coordinates were center corrected by deducting the coordinates of the first point from the second point to visualize rotation around a single, fixed point. Degrees of rotation were derived from the inverse tan trigonometric function using center corrected

coordinates. The second approach to tracking nuclear rotation involved labeling nuclei in NHDFs stably expressing mCardinal fused to a nuclear localization signal (NLS), which enabled the tracking of nuclear movement in both infected and uninfected cells. Nuclear movement was measured as described above, this time using far-red fluorescent nuclei. For uninfected cells, the two points used to track rotation were directly opposite each other at the center of the elongated side of the nuclear membrane.

RNA Isolation and RT-qPCR

[0104] To determine the relative expression of EB transcripts between mock and HCMV infected cells, growth-arrested NHDFs on 60mm dishes were either mock infected or infected with HCMV AD169 at MOI 3. Cells were collected in Trizol (Invitrogen) at 3 d.p.i. or 4 d.p.i. and RNA was isolated using RNeasy kit (Qiagen). cDNA was generated from 0.1 pg of RNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche). Real-Time quantitative PCR (RT-qPCR) was performed using a 7500 Fast Real-Time PCR System (Applied Biosystems) and FastStart

Universal SYBR Green Master (Rox). Quantification of RNA was performed using the

comparative Ct method using POLR2L as a stable endogenous control in HCMV infected cells. Fold changes were determined by average Ct comparison to mock infected cells. Data was generated from 3 independent biological replicates for each point.

Example 2

Generation and Characterization of HEBTRON Expression and purification of EB3

[0105] Preparation of (His6)-YFP-EB3, (His6)-CFP-EB3, (His6)-EB3 and EB3-C terminus (200- 281aa) was described previously (Geyer et al., 2015; Komarova et al., 2012). (His6)-tagged recombinant proteins were expressed in Escherichia coli strain BL21 (DE3) (Stratagene). The expression constructs for (His6)-EB3 and EB3-C terminus contained a tobacco etch virus (TEV) protease cleavage site immediately following the His6 tag for efficient removal. Bacteria were grown at 37°C in LB medium containing 50 pg/ml kanamycin. When the OD600 reached 0.6-0.7, protein synthesis was induced by addition of isopropyl l-thio- -D-galactopyranoside (IPTG) to a final concentration of 250 mM. After 4 h at 30°C, bacterial pellets were isolated and sonicated (4 x 1 min) in medium comprising 150 mM NaCI, 5 mM 2-mercaptoethanol, 2 mM CaCI2, 10 mM imidazole, 2 mM PMSF, 25 mM Tris, pH 7.4.

[0106] For affinity purification, (His6)-EB proteins were purified using Ni-NTA beads (Thermo Scientific) as previously described (Geyer et al., 2015). Ni-NTA beads (1 ml) in a 20 ml column (Bio-Rad) were equilibrated with 50 bed-volumes of binding buffer (25 mM Tris, pH 7.4, 300 mM NaCI, 5 mM 2-mercaptoethanol, 2 mM PMSF). Bacterial lysate (50 ml) was then added to the column, followed by washing (150 bed-volumes of wash buffer, ~75 ml). The protein-bound beads were washed with phosphate-bq ered saline (PBS) supplemented with 2 mM CaCI2 and protease inhibitor cocktail (Sigma) and stored in the same buffer.

[0107] For gel-filtration, after washing the Ni-NTA beads, recombinant His6-EB3 was eluted by addition of wash buffer containing 150 mM imidazole. Peak elution fractions were pooled, exchanged to imidazole-free buffer using PD-10 desalting columns (GE Life Sciences), and concentrated with an Amicon Ultra-15 with 10 kDa cut-off concentrator unit (Millipore, Inc.). The His6 tag was removed by addition of 1.5% (w/w) recombinant TEV protease and incubation at 0C for 16 hr. For further polishing, EB3 proteins were then subjected to gel filtration chromatography over tandem Superdex 200 HR 10/30 columns connected in series and controlled by an AKTA FPLC (GE Life Sciences). Peak fractions containing EB3 proteins were then pooled and concentrated as described above.

Peptide synthesis and purification

[0108] Peptides were synthesized using the stepwise solid-phase method by 9- fluorenylmethoxycarbonyl (Fmoc) chemistry on Wang resin (AnaSpec, Fremont, CA, USA) with a 12-channel multiplex peptide synthesizer (Protein Technologies, Tucson, AZ, USA) according to the manufacturer's procedures. Detachment of peptide from the resin and removal of the side chain protection groups were done by incubating the resin with a mixture of trifloroacetic acid (TFA):Thioanisole:Water:Phenol:l,2-ethanedithio (82.5:5:5:5:2.5 v/v) for 2 hours.

[0109] The crude peptide was purified on a preparative Kinetex reversed-phase C18 column, 150 x 21.1 mm (Phenomenex, Torrance, CA, USA) using a BioCad Sprint (Applied Biosystems, Foster City, CA, USA). A flow rate of 30 mL/min with solvent A (0.1% TFA in deionized water) and solvent B (0.1% TFA in acetonitrile) was used. The column is equilibrated with 5% solvent B before sample injection. Elution is performed with a linear gradient from 5% solvent B to 100% solvent B in 60 min. The absorbance of the column effluent is monitored at 214 nm, and peak fractions are pooled and lyophilized.

[0110] The pure peptide fraction is identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) or electrospray ionization mass

spectrometry (ESI-MS) and lyophilized.

Synthesis of N-myristoylated peptides

[0111] Chloroform (2.5 ml) was added to ~250 mg of Myr-anhydride and mixed until Myr- anhydride was dissolved. 2.5 ml of Dimethylformamide (DMF) is added following 50 pmole peptide on the resin. The mixture was kept at 60°C for 1 h and then filtered and washed with 50 ml hot chlorofornrDMF (1:1). Example 3

The AC is a dynamic structure that controls host cell behavior

[0112] To image the AC in living cells two HCMV proteins; UL99 and UL32, were fluorescently tagged. UL99 localizes to trans-Golgi vesicles and labels the AC, and also binds virus particles (Moorman et al., 2010; Sanchez et al., 2000a; Sanchez et al., 2000b). UL32 localizes to the nucleus very early (l-2d.p.i.) but becomes predominantly cytoplasmic thereafter, associating with clathrin-containing compartments recruited to the AC. At later stages (-5-6d.p.i.) UL32 is detected in the nucleus again, incorporating into new virus particles that then bud into the AC (Moorman et al., 2010; Sampaio et al., 2005; Sanchez et al., 2000a).

[0113] The HCMV clinical strain, TB40/E was engineered to express either UL99-eGFP or UL32-mCherry. To validate these viruses, primary normal human dermal fibroblasts (NHDFs) were infected with TB40/E-UL99-eGFP. Cultures were fixed at different days post-infection (d.p.i.) and stained for the trans-Golgi marker, TGN46. In line with fixed imaging of laboratory adapted strains (Moorman et al., 2010), UL99-eGFP labeled the Golgi that reorganized into an AC between 2-5 d.p.i.. Notably, 15% of infected cells imaged (65/431) contained two distinct or weakly inter-connected UL99-eGFP and TGN46-positive structures (Figure 1A). Staining for the viral glycoprotein gB confirmed that both structures contained other viral proteins and were likely nascent ACs. However, live cell imaging of UL99-eGFP-labeled structures revealed that in 100% of cases when two nascent ACs were present in a cell, they merged into one (Figure IB). As such, multiple ACs observed in a single cell in fixed images, here and evident in other studies (Buchkovich et al., 2010; Das et al., 2007), represent intermediate stages of merging. This seemed to ensure that only one AC resided in cells as infection progressed but also bore a striking resemblance to Golgi reorientation in migrating fibroblasts (Wu et al., 2016).

[0114] Next, NHDFs were co-infected with TB40/E-UL99-eGFP and TB40/E-UL32- mCherry followed by two-color live cell imaging. In line with fixed images (Sanchez et al., 2000a), between 3-5 d.p.i. UL32-mCherry labeled cytoplasmic structures that gradually accumulated around the UL99-eGFP-labeled Golgi (Figure 1C). As infection progressed, UL32-mCherry- positive domains also formed in the nucleus, followed by the appearance of small uniform structures in the AC and cytoplasm. These co-labeled with UL99-eGFP and their size was consistent with HCMV virions (Figure 1D-E). This order series of events occurred in all cells imaged and is in line with predictions from prior studies using fixed samples. This established UL99-eGFP as an appropriate marker of the AC from its earliest stages of formation. While imaging the AC, it was noted that infected cell nuclei rotated. To visualize nuclei, NHDFs stably expressing mCardinal fused to a Nuclear Localization Signal (mCardinal-NLS) were generated and either mock-infected or infected them with TB40/E-UL99-eGFP. Live cell imaging over 3-5 d.p.i. confirmed nuclear rotation in infected cells. Notably, mCherry-NLS signal in infected cells became progressively weaker over time. This did not occur in uninfected cells, suggesting it was not due to photobleaching but instead reflected increased nuclear porosity in HCMV-infected cells (Buchkovich et al., 2010). To measure the extent of nuclear rotation, nucleoli and the "nuclear pinch" were used as reference points. Results showed that ~80% (53/66) of infected cell nuclei exhibited persistent rotation >180° (Figure IF). This net range underestimates the extent of nuclear rotation, as often nuclei reversed directionality or rotated -720° (see below). By contrast, uninfected-cell nuclei exhibited no discernible rotation and translocated in the direction of cell motility. Nuclear rotation in infected cells ceased prior to cell migration (Figure 1G). Before migration, in 95% (57/60) cells imaged the AC was either already positioned at or moved toward the leading edge (between the nucleus and direction of migration) of cells. This demonstrated that the AC does not always remain at the nuclear "pinch" and suggested it might also regulate cell migration later in infection. In these later stages the AC continued to exhibit merging behaviors. If the AC lost integrity it rapidly "regrouped" while if two ACs encountered one another, presumably upon cell fusion, they merged. Although these later events arose from diverse, uncontrollable circumstances making them difficult to quantify, they illustrated the continued dynamic behavior of the AC throughout infection. Overall, AC merging, nuclear rotation and AC positioning at the leading edge all suggested the AC might function as an MTOC.

Example 4

The HCMV AC acts as a Golgi-derived MTOC

[0115] Although MTs emanate from the AC (Sanchez et al., 2000a), the true nature of their nucleation and function remains poorly understood. Fixed samples of mock or HCMV-infected NHDFs were stained for two key MT nucleation factors. Imaging detected bright g-tubulin and pericentrin puncta at centrosomes in uninfected cells and within ACs (Figure 2A). However, centrosomes in infected cells appeared "split" as shown in prior reports (Hertel and Mocarski, 2004). Moreover, g-tubulin and pericentrin were broadly distributed throughout the AC in regions positive for TGN46 (Figure 2A and Figure 8A-B). This was not observed in uninfected cells since the Golgi does not normally contain high levels of nucleating material (Sanders and Kaverina, 2015). Western Blot (WB) analysis of mock or infected cell lysates revealed that HCMV also increased g-tubulin abundance around the time of AC formation (Figure 2B). This suggested HCMV increased the availability of nucleating material to potentially form new MTOCs within the AC.

[0116] To test this directly, nocodazole washout assays were performed to identify sites of MT nucleation. Nocodazole disrupts the Golgi in uninfected cells and the AC in infected cells (Chabin-Brion et al., 2001; Sanchez et al., 2000a). While this prevented imaging of MT growth from an intact AC, this effect was advantageous as it spatially separated the centrosome from surrounding Golgi sites and avoided uncertainty over the origin of new MTs. Staining for TGN46, pericentrin and tyrosinated tubulin, which detects dynamic MTs, confirmed that nocodazole depolymerized MTs and dispersed Golgi and AC structures (Figure 2C). Quantitation revealed that new MTs almost exclusively originated from the centrosome in uninfected cells (Figure 2C-D). In infected cells, new MTs originated from Golgi-based sites distributed throughout the cell due to AC disruption. Notably, uninfected or infected NHDFs contained no detectable detyrosinated MTs beyond centrosome asters (Fig. 8C). As such, detyrosination does not affect the use of tyrosinated tubulin antibody to image MTs in NHDFs. Confocal imaging and quantification of new MTs further demonstrated that centrosomes in uninfected cells nucleated MTs more efficiently than in infected cells (Figure 2E-F). This suggested that HCMV overturned the normal dominance of the centrosome to favor Golgi-based nucleation.

[0117] A characteristic of Golgi-derived MTs is their rapid acetylation (Chabin-Brion et al., 2001; Efimov et al., 2007; Rios et al., 2004; Sanders and Kaverina, 2015). Uninfected or infected samples were stained for acetylated tubulin and TGN46. Imaging and quantification revealed that beyond singular asters, uninfected NHDFs contained very few acetylated MTs (Figure 8C- D). However, HCMV induced the formation of acetylated MTs that co-localized with TGN46- positive regions of the AC (Figure 2G), suggesting Golgi domains nucleated these MT subsets. To test this, nocodazole washout assays staining for acetylated tubulin and TGN46 were repeated. Although centrosomes stained brightly for acetylated tubulin, they were associated with relatively few acetylated filaments, while abundant arrays of acetylated MTs emanated from TGN46-positive structures dispersed throughout the cell (Figure 2H). Cumulatively, these findings demonstrated that Golgi regions of the AC nucleated new MTs that were quickly acetylated.

Example 5

Differential Regulation and Localization of EB Proteins during HCMV Infection

[0118] Formation of MTs at Golgi sites was recently shown to require EB proteins (Yang et al., 2017). To test whether HCMV influenced their abundance or localization, WB analysis over a time course of infection (Figure 3A-B) revealed that the abundance of EB1 and EB2 gradually declined in mock-infected NHDFs, likely as cells became quiescent, while levels of other proteins remained unchanged. However, in infected NHDFs all three EB proteins increased in abundance by 2-3 d.p.i. Similar increases in EB proteins were observed with independent HCMV strains, the timing of which correlated with differences in each strain's replication kinetics (Figure 9A). Alongside protein increases, qRT-PCR revealed that HCMV increased the transcript abundance of each EB relative to mock-infected cells (Figure 3C). The relative increases in transcript and protein levels for EB1 and EB2 largely corresponded but increases in EB3 protein were greater than those of its transcript. This suggested that EB3 might be additionally regulated at post-transcriptional levels.

[0119] Increases in EB levels coincided with expression of the viral transcriptional activator, Immediate Early protein 2 (IE2) in all three HCMV strains tested (Figure 3A and Figure 9A). To test if IE2 was involved in regulating EBs, IE2 expression was suppressed in infected cells using siRNAs. HCMV IE1 and IE2 proteins are encoded by alternatively spliced transcripts of the major immediate early (MIE) gene (Mocarski et al., 2007). NHDFs were treated with control non targeting or MIE (I El/2) siRNAs prior to infection with HCMV. WB analysis showed that I El/2 depletion prevented increases in EB1 and EB2 by HCMV (Figure 3D). I El/2 siRNAs did not reduce EB abundance in uninfected cells (Figure 9B), demonstrating that these changes were not off-target effects. Moreover, IE1/2 depletion did not block EB3 increases (Figure 3D), supporting the idea that EB3 was regulated at additional levels. To test if IE2 was sufficient to increase EB levels, NHDFs were transduced with lentiviruses encoding GFP control or IE proteins and found that IE2, but not I El, was sufficient to increase EB1 and EB2 abundance (Figure 3E). However, EB3 expression was not detectably affected. As such, independent siRNA and expression approaches supported the notion IE2 enhanced EB1 and EB2 accumulation, likely at the transcriptional level although changes in mRNA stability cannot be ruled out. Both approaches also suggested additional modes of regulation for EB3 were involved, beyond simply increasing EB3 transcript levels.

[0120] EB3 stability is controlled by Cyclin Dependent Kinase 1 (CDKl)-mediated

phosphorylation . To test the contribution of CDKs to EB3 accumulation, NHDFs were mock infected or infected in the presence of CDK1 inhibitor, JNJ-7706621. WB analysis of time- courses showed that in cells infected with AD169, where EB3 increases begin l-2d.p.i. (Figure 9A), JNJ-7706621 suppressed HCMV-induced CDK activation as determined by pan-CDKl substrate antibody and prevented increases in EB3 at 1 and 2 d.p.i. (Figure 3F). Although JNJ- 7706621 modestly affected IE2 expression, siRNA approaches above showed that reduced IE2 was not sufficient to affect EB3 increases. As such, JNJ-7706621 demonstrated that CDK, or the combined action of IE2 and CDK were required to increase EB3. However, by 3d.p.i. both CDK substrate phosphorylation and increases in EB3 abundance became insensitive to JNJ-7706621, despite daily inhibitor replenishment. Notably, HCMV encodes a CDK homolog, pUL97 that is resistant to host CDK inhibitors (Hertel et al., 2007). As such, our findings establish that CDK activity regulates EB3 abundance during infection, but that the viral CDK homolog likely takes over from host kinases once infection is established. Overall, these findings established that HCMV uses multiple strategies to increase the abundance of EB proteins.

[0121] The effect of HCMV on EB protein localization was tested. While EB1 and EB3 track MT plus-ends, the more divergent EB2 exhibits weaker plus-end-specific localization (Komarova et al., 2009). In line with this, EB1 and EB3 formed "comets" indicative of plus-end tracking on MTs in both uninfected and infected NHDFs, while EB2 was more broadly distributed along the MT lattice (Figure 9C-E). Notably, while EB1 comets localized throughout infected cells and near the AC, EBB comets intensely concentrated around g-tubulin-positive regions of the AC (Figure 9C-F). As such, EB1 and EB3 exhibited differences in both regulation and localization in infected cells, suggesting they might perform discrete functions.

Example 6

EB1 and DB3 Play Distinct Roles in HCMV Infection

[0122] The role of EB proteins in HCMV infection was examined. EB1 is required for some viruses to reach the nucleus and establish infection (Jovasevic et al., 2015; Sabo et al., 2013). Similar effects on early HCMV infection would confound our understanding of their roles in later processes. To avoid this, HCMV's protracted lifecycle was exploited by reducing siRNA pre treatment time such that the establishment of infection was unaffected. Using this approach, viral IE protein production was not affected despite efficient depletion of EBs, or by secondary dosing of siRNAs at 3 d.p.i. (Figure 4A). The fact this approach did not affect the establishment of infection was further evidenced by the formation of ACs and stable MTs, shown later. Using this approach, the effects of EB depletion on HCMV replication was assessed using independent siRNAs targeting EB1 or EB3. In cultures infected at low multiplicity of infection (MOI) for 12 days, WB analysis of viral protein accumulation (Figure 4B) or imaging and measurement of plaque sizes (Figure 4C-D) revealed that both EB1 and EB3 were required for efficient HCMV spread. The effects of EB1 or EB3 depletion on the production of virus in single round high MOI infections were also assayed. Titration of infectious virus produced at 7 d.p.i. revealed a 100- fold and 14-fold reduction in supernatant virus, and 10-fold and 4-fold reduction in cell- associated virus in EB1- or EB3-depleted cells, respectively (Figure 4E). These findings suggested EB1 and EB3 might regulate HCMV replication by distinct mechanisms.

[0123] To determine whether EBs had different roles in infection, the effect of EB1 or EB3 depletion on MT behavior was investigated. NHDFs expressing CLIP170-eGFP, a +TIP widely used to visualize MT growth, were treated with control or EB-targeting siRNAs followed by infection with HCMV. Imaging at 4. d.p.i. revealed that while EB3 depletion had no detectable effect on the number or behavior of CLIP170-eGFP comets, EB1 depletion caused a re distribution of CLIP170 along the MT lattice (Figure 4F). Line-scan analysis of CLIP170-eGFP signal intensity and distribution further confirmed its broader distribution along MTs in EB1- depleted cells (Figure 4G), suggesting the accumulation of CLIP170 at growing MTs was specifically regulated by EB1.

[0124] EBs were required for the formation of acetylated MTs by HCMV was also tested. Staining showed that EB1 depletion increased acetylated MTs, while EBB depletion suppressed their formation compared to controls (Figure 5A). These effects were quantified scoring cells as 1) lacking acetylated MTs (none), 2) having acetylated MTs extending from the AC (medium), 3) having extensive acetylated arrays filling the cytoplasm (high). This quantification approach confirmed that EB1 depletion increased, while EB3 depletion decreased the extent of acetylated MT formation by HCMV (Figure 5B). EB1 and EB3 compete for binding to MT plus- ends (Komarova et al., 2009), which potentially explained their differential effects on the formation of acetylated MTs. In line with this, the staining intensity of EB3 comets at the AC increased in EBl-depleted cells compared with controls, while EB1 did not localize to the AC in EB3-depleted cells (Figure 5C). This suggested EB1 could not functionally substitute for EB3 in infected cells. Moreover, line-scan analysis showed that in controls, EB1 formed bright tracks ahead of EB3 (Figure 5D). EB3 formed longer and brighter comets upon EB1 depletion, while EB3 depletion resulted in brighter and longer EB1 tracks. This demonstrated that EB1 and EB3 compete for binding to MT plus-ends in HCMV-infected cells, and that EB1 depletion enhanced EB3 activity and localization the AC. The levels of acetylated MTs in each condition correlated with the extent of EB3 localization to the AC and MT plus-ends. Overall, this suggested that both EB1 and EB3 contributed to efficient infection but did so through effects on distinct MT subpopulations.

Example 7

Acetylated MTs Control Nuclear Rotation and AC Structure

[0125] The influence of EB1 or EB3 on nuclear rotation or AC formation was examined.

NHDFs were treated with control or EB-targeting siRNAs followed by infection with TB40/E- UL99-eGFP. Live cell imaging over 3-5 d.p.i together with nuclear displacement measurements revealed that in control or EB1 siRNA-treated samples -86% (37/43) nuclei rotated >180°

(Figure 5E). These involved cases of >360° unidirectional rotations or 180° rotations with reversed directionality. By contrast, other than limited general displacement similar to mock- infected cells, nuclear rotation could not be detected in EBB-depleted cells (Figure 5E). Using faster frame rate imaging, in control siRNA-treated cells UL99-eGFP-labeled ACs consisted of a dense core while smaller structures and uniform-sized particles, likely virions (Figure 5E), moved bi-directionally in the cytoplasm (Figure 5F). By contrast, in EBl-depleted cells the AC was diffuse and fewer motile organelles and particles could be detected in the cytoplasm. In EBB-depleted cells the AC also appeared disorganized, but the cytoplasm contained large structures that resembled multi-vesicular bodies (MVBs). These results demonstrated that depletion of EB1 or EB3 resulted in distinct alterations to AC structure, while EB3 was also required for HCMV-induced nuclear rotation.

Example 8

A Small Peptide Targeting EB3 Suppresses HCMV Replication

[0126] The foregoing experiments and data suggest that EB3 is a "druggable" target to suppress HCMV replication. Peptide aptamers containing SxlP motifs specifically bind EB1 or EB3 due to variations in their flanking amino acid sequence and displace their interacting +TI Ps (Lesniewska et al., 2014). Myristoylated peptide (Myr-RSMKRSLIPRWIGNKR, dubbed HEBTRON) to target EB3 and was first characterized it in vitro. Using Drug Affinity Responsive Target Stability (DARTS) assays wherein drug binding protects target proteins from proteolytic degradation by thermolysin, it was determined that HEBTRON protected purified recombinant EB3 (Figure 10A). This was specific to HEBTRON as an EBl-specific peptide did not prevent EB3 proteolysis (Figure 10A). Using isothermal titration calorimetry (ITC) to measure binding affinity further revealed an exothermic binding with the dissociation constant (KD) of 537 ± 94.7 nM and enthalpy (DH) of -2.138 ± 0.1592 cal/mol (Figure 6A and Figure 10B-C), indicating a strong and stable interaction of HEBTRON with EB3. The measured binding stoichiometry (N) of 0.47 ± 0.03 suggested formation of a 1:2 complex, in line with HEBTRON binding both EB3 subunits of dimers.

[0127] The effects of HEBTRON on EB3 dimer stability using nano Differential Scanning Fluorimetry (nanoDSF). In this assay, thermal unfolding of proteins is measured to identify melting temperature (Tm). Compared with EB3 alone, a 0.20C peak shift was detected with HEBTRON present (Figure 6B). This suggested HEBTRON increased EBB dimer stability. To independently test this, a FRET-based assay in which preassembled YFP-EB3 dimers were mixed with CFP-EB3 dimers was used. In solution, input homodimers dissociate and form mixed species of dimers over time, resulting in FRET signal when YFP/CFP tags are proximal within heterodimers (De Groot et al., 2010). In the absence of HEBTRON increasing FRET was observed over time with YFP/CFP-EB3 dimer formation (Figure 6C). However, HEBTRON blocked FRET signal indicating that it stabilized input EB3 dimers.

[0128] Uptake of myristoylated HEBTRON by cultured NHDFs was also determined. Confocal time lapse imaging showed that 5'6-fluorescein(FITC)-conjugated HEBTRON initially labeled the plasma membrane but was observed uniformly distributed throughout the cytosol within 7-8 minutes, with tl/2 uptake of 235.5 ± 1.4s (Figure 6D-E). It was tested whether HEBTRON affected MT behavior during infection. NHDFs expressing CLIP170-eGFP were treated with vehicle (DMSO) or 25mM HEBTRON followed by infection with HCMV. Time lapse imaging combined with line-scan analysis of CLIP170-eGFP intensity and distribution showed that HEBTRON had no detectable effect on CLIP170-eGFP behavior (Figure 10D). However, when fixed samples were stained for acetylated tubulin, imaging and quantification using approaches described above demonstrated that HEBTRON suppressed acetylated MT formation by HCMV (Figure 6F-G).

[0129] To understand how it functioned, the effects of HEBTRON and two HEBTRON mutants containing amino acid substitutions in either one (MutN) or both (MutN-MutC) SLIP-flanking regions (Figure 6H) was investigated. First, their effects on plaque formation by TB40/E-GFP or AD169-GFP were measured in low MOI spreading assays. Phase and fluorescence imaging at 12 d.p.i. along with plaque size measurements showed that HEBTRON suppressed HCMV spread compared with DMSO control, while both HEBTRON mutants had no effect (Figure 61-J). To further test its antiviral effects, NHDFs were treated with DMSO or 25mM HEBTRON before low MOI infection with an unrelated poxvirus, Vaccinia Virus (VacV). Imaging and measurements of plaque sizes formed by VacV expressing B5-GFP (Figure 10E-F) or WB analysis of VacV protein accumulation (Figure 10G) revealed HEBTRON had no significant effect on VacV spread. As such, HEBTRON exhibited specific antiviral effects toward HCMV that were dependent on guiding amino acids.

[0130] As published aptamers displace +TIPs from EB proteins (Lesniewska et al., 2014), it was tested whether HEBTRON affected the localization of representative proteins known to utilize an SxlP motif to bind EBB; Tastin and CDK5RAP2 (Jiang et al., 2012). IF imaging of infected cells showed that HEBTRON did not affect EB3 localization to the AC compared with DMSO controls (Figure 10H). However, staining DMSO-treated cells revealed that Tastin localized in the same area as EB3, behind EB1 on MT plus-ends, and that HEBTRON displaced Tastin from MT plus-ends (Figure 11A-B). Notably, the second SxIP-interacting protein, CDK5RAP2 not only binds EB proteins but also stimulates the nucleating activity of g-TuRC (Choi et al., 2010; Fong et al., 2009; Wang et al., 2010; Wu et al., 2016). CDK5RAP2 was present at centrosomes in uninfected NHDFs, but upon infection it localized throughout Golgi regions of the AC (Figure 7A). Imaging and measurements threshold brightness revealed that HEBTRON, but not the MutN-MutC form of HEBTRON, significantly reduced CDK5RAP2 recruitment to the AC (Figure 7B). HEBTRON did not decrease CDK5RAP2 or EB3 abundance (Figure 7C), demonstrating that HEBTRON specifically affected CDK5RAP2 enrichment in Golgi regions. Cumulatively, these data supported the notion that HEBTRON suppressed infection by interfering with EB3-mediated enrichment of factors such as CDK5RAP2 at non-centrosomal sites within the AC. This, combined with recent reports that EB proteins function in MT minus-end organization and nucleation at the Golgi (Yang et al., 2017), suggested that EB3 likely regulated the nucleation of MTs at the AC. To test this, nocodazole washout assays on EB3-depleted or HEBTRON-treated cells infected with HCMV were performed. Staining samples for oc-tubulin, acetylated tubulin and TGN46 revealed that in control siRNA or DMSO-treated cells new MTs formed at Golgi regions dispersed throughout the cytoplasm, and these MTs were acetylated (Figure 11C-D). By contrast, formation of new MTs at Golgi fragments was suppressed in either EB3 depleted or HEBTRON-treated cells.

[0131] To further determine how HEBTRON suppressed HCMV replication, the effect off HEBTRON on nuclear rotation or AC structure was investigated. NHDFs were treated with DMSO or 25mM HEBTRON followed by infection with TB40/E-UL99-eGFP. While time lapse imaging over 3-5 d.p.i. detected nuclear rotation >1800 in -71% (36/51) DMSO-treated cells, rotations could not be detected in cultures treated with HEBTRON (Figure 7D). Furthermore, consistent with our results in siRNA-treated cells (Figure 5F), imaging of UL99-labeled AC structures at 5 d.p.i. revealed that DMSO-treated cells contained a dense AC core while the cytoplasm was filled with UL99-positive structures, many of which were uniform in size and exhibited bi-directional motility suggestive of HCMV particles (Figure 7E). By contrast, HEBTRON treatment resulted in aberrant ACs and large structures resembling MVBs in the cytoplasm, similar to effects of EB3 depletion.

[0132] Finally, HEBTRON's effects on infectious virus production was measured. In low MOI spreading assays, 25mM HEBTRON suppressed the release of infectious HCMV approximately -100-fold compared with DMSO controls (Figure 7F). In single-round high MOI infections virus release was suppressed -13-fold (Figure 7G), similar to effects of EB3 depletion above. Overall, HEBTRON not only validated siRNA-based observations but provided additional insights into the underlying mechanism by which EB3 regulated MT formation at the AC to facilitate HCMV replication.

Example 9

In Vivo Efficacy Studies of HEBRON

[0133] In order to test in vivo efficacy of HEBTRON against CMV infection a mouse model of acute CMV infection (Hummel et al., J. Virol. 75 (10: 4814-22, 2001) was used. Although CMVs are highly species-specific, it is known that the AC plays a universal role in CMV's infection. Therefore, the studies in the natural host, murine CMVs (Smith strain of murine CMV), are practical in testing therapeutic benefits of HEBTRON in humans.

[0134] This study tests whether administration of HEBTRON prevents reactivation of the Smith strain of murine CMV from latency in vivo. This work tests whether targeting of host protein with a therapeutic peptide provides an effective strategy for inhibiting CMV replication and spreading in vivo. These experiments are based on the findings that HCMV upregulates the expression and function of EB3. HCMV transcription factors called IE1 and IE2 activate transcription of EB3, increasing its synthesis by host cells. Furthermore, perturbation of EB3 activity with genetic depletion or treatment with HEBTRON inhibits both formation of the HCMV virus assembly compartment and spreading of new HCMV virions in human fibroblasts (Figure 61 - J ) .

Example 10

Effect of HEBTRON Mutants on HCMV Infection

[0135] Various HEBTRON (16-mer) mutants were generated to test the effect on replication and spreading of clinical HCMV strain. These mutant peptides are denoted as HEBRON- ASLIP and HEBTRON-mutN-mutC, which are set out in Table 1.

Table 1

[0136] Primary human fibroblasts were infected with clinical (TB40/E) HCMV strains expressing GFP reporters at low the multiplicity of infection (MOI) for 12 days (MOI 1) in the presence of DMSO solvent (control), HEBTRON, HEBRON short , ASLIP and control (mutN-mut- C) mutants. The cells were treated with HEBTRON peptide every 2nd day for the duration of the experiment. Phase and fluorescence images show the suppression of HCMV spread by

HEBTRON. Figure 12 demonstrates that treatment with 25 mM of HEBTRON and HEBTRON short interferes with HCMV replication.

[0137] As shown in Fig. IB, the mutant harboring deletion of SLIP motif (RSMKRRWIGNKR) has similar inhibitory effect on HCMV replication whereas introduction of negatively changed amino acids in flanking region abolished the effect. Thus, HEBTRON and the SLIP deletion mutant suppressed HCMV spreading. The mutant harboring deletion of SLIP motif

(RSMKRRWIGNKR) has similar inhibitory effect on HCMV replication whereas introduction of negatively changed amino acids in flanking region abolished the effect. Example 11

Dose Dependent Effect of HEBTRON

[0138] To investigate the efficacy of HEBTRON in the murine model of CMV infection in vivo, a dose-dependent effect of HEBTRON on viral replication of the Smith strain of murine CMV after allogenic transplantation is established. To establish murine CMV latency, 3-to 4-week-old mice are injected intraperitoneally with 105 PFU of MCMV (Smith strain). The right donor kidney from latently infected mice is removed for use as a control, and the left donor kidney is transplanted into allogeneic C57BL/6 (H-2b) adult males and removed at 1, 2, 5, 8, or 15 days after transplant. Recipient mice are treated with 3 different doses of HEBTRON (5mM, 25mM and 50 mM per kg body weight, i.p.) daily for 5 days. All organs are frozen in liquid nitrogen immediately after removal. Viral replication is assessed in various organs by qPCR analysis of viral DNA copy number and by plaque forming assay.

REFERENCES

[0139] Akhmanova, A., and Steinmetz, M.O. (2015). Control of microtubule organization and dynamics: two ends in the limelight. Nat Rev Mol Cell Biol 16, 711-726.

[0140] Alwine, J.C. (2012). The human cytomegalovirus assembly compartment: a

masterpiece of viral manipulation of cellular processes that facilitates assembly and egress. PLoS Pathog 8, el002878.

[0141] Ban, R., Matsuzaki, H., Akashi, T., Sakashita, G., Taniguchi, H., Park, S.Y., Tanaka, H., Furukawa, K., and Urano, T. (2009). Mitotic regulation of the stability of microtubule plus-end tracking protein EBB by ubiquitin ligase SIAH-1 and Aurora mitotic kinases. J Biol Chem 284, 28367-28381.

[0142] Bazellieres, E., Massey-Harroche, D., Barthelemy-Requin, M., Richard, F., Arsanto, J.P., and Le Bivic, A. (2012). Apico-basal elongation requires a drebrin-E-EB3 complex in columnar human epithelial cells. J Cell Sci 125, 919-931. [0143] Buchkovich, N.J., Maguire, T.G., and Alwine, J.C. (2010). Role of the endoplasmic reticulum chaperone BiP, SUN domain proteins, and dynein in altering nuclear morphology during human cytomegalovirus infection. J Virol 84, 7005-7017.

[0144] Chabin-Brion, K., Marceiller, J., Perez, F., Settegrana, C, Drechou, A., Durand, G., and Pous, C. (2001). The Golgi complex is a microtubule-organizing organelle. Mol Biol Cell 12, 2047- 2060.

[0145] Choi, Y.K., Liu, P., Sze, S.K., Dai, C., and Qj, R.Z. (2010). CDK5RAP2 stimulates microtubule nucleation by the gamma-tubulin ring complex. J Cell Biol 191, 1089-1095.

[0146] Christophorou, N., Rubin, T., Bonnet, I., Piolot, T., Arnaud, M., and Huynh, J.R. (2015). Microtubule-driven nuclear rotations promote meiotic chromosome dynamics. Nat Cell Biol 17, 1388-1400.

[0147] Clippinger, A.J., and Alwine, J.C. (2012). Dynein mediates the localization and activation of mTOR in normal and human cytomegalovirus-infected cells. Genes Dev 26, 2015- 2026.

[0148] Daga, R.R., Yonetani, A., and Chang, F. (2006). Asymmetric microtubule pushing forces in nuclear centering. Curr Biol 16, 1544-1550.

[0149] Das, S., and Pellett, P.E. (2011). Spatial relationships between markers for secretory and endosomal machinery in human cytomegalovirus-infected cells versus those in uninfected cells. J Virol 85, 5864-5879.

[0150] Das, S., Vasanji, A., and Pellett, P.E. (2007). Three-dimensional structure of the human cytomegalovirus cytoplasmic virion assembly complex includes a reoriented secretory apparatus. J Virol 81, 11861-11869.

[0151] De Groot, C.O., Jelesarov, I., Damberger, F.F., Bjelic, S., Scharer, M.A., Bhavesh, N.S., Grigoriev, I., Buey, R.M., Wuthrich, K., Capitani, G., et al. (2010). Molecular insights into mammalian end-binding protein heterodimerization. J Biol Chem 285, 5802-5814.

[0152] Dixit, R., Barnett, B., Lazarus, J.E., Tokito, M., Goldman, Y.E., and Holzbaur, E.L. (2009). Microtubule plus-end tracking by CLIP-170 requires EB1. Proc Natl Acad Sci U S A 106, 492-497. [0153] Efimov, A., Kharitonov, A., Efimova, N., Loncarek, J., Miller, P.M., Andreyeva, N., Gleeson, P., Galjart, N., Maia, A.R., McLeod, I.X., et al. (2007). Asymmetric CLASP-dependent nucleation of noncentrosomal microtubules at the trans-Golgi network. Dev Cell 12, 917-930.

[0154] Ferreira, J.G., Pereira, A.J., Akhmanova, A., and Maiato, H. (2013). Aurora B spatially regulates EB3 phosphorylation to coordinate daughter cell adhesion with cytokinesis. J Cell Biol 201, 709-724.

[0155] Fong, K.W., Hau, S.Y., Kho, Y.S., Jia, Y., He, L., and Qi, R.Z. (2009). Interaction of CDK5RAP2 with EB1 to track growing microtubule tips and to regulate microtubule dynamics. Mol Biol Cell 20, 3660-3670.

[0156] Geraldo, S., Khanzada, U.K., Parsons, M., Chilton, J.K., and Gordon-Weeks, P.R. (2008). Targeting of the F-actin-binding protein drebrin by the microtubule plus-tip protein EB3 is required for neuritogenesis. Nat Cell Biol 10, 1181-1189.

[0157] Geyer, M., Huang, F., Sun, Y., Vogel, S.M., Malik, A.B., Taylor, C.W., and Komarova,

Y.A. (2015). Microtubule-Associated Protein EB3 Regulates IP3 Receptor Clustering and Ca(2+) Signaling in Endothelial Cells. Cell Rep 12, 79-89.

[0158] Gundersen, G.G., and Worman, H.J. (2013). Nuclear positioning. Cell 152, 1376-1389.

[0159] Hertel, L., Chou, S., and Mocarski, E.S. (2007). Viral and cell cycle-regulated kinases in cytomegalovirus-induced pseudomitosis and replication. PLoS Pathog 3, e6.

[0160] Hertel, L., and Mocarski, E.S. (2004). Global analysis of host cell gene expression late during cytomegalovirus infection reveals extensive dysregulation of cell cycle gene expression and induction of Pseudomitosis independent of US28 function. J Virol 78, 11988-12011.

[0161] Honnappa, S., Gouveia, S.M., Weisbrich, A., Damberger, F.F., Bhavesh, N.S., Jawhari, H., Grigoriev, I., van Rijssel, F.J., Buey, R.M., Lawera, A., et al. (2009). An EBl-binding motif acts as a microtubule tip localization signal. Cell 138, 366-376.

[0162] Hsieh, P.C., Chang, J.C., Sun, W.T., Hsieh, S.C., Wang, M.C., and Wang, F.F. (2007). p53 downstream target DDA3 is a novel microtubule-associated protein that interacts with end binding protein EB3 and activates beta-catenin pathway. Oncogene 26, 4928-4940. [0163] Hui, T.H., Zheng, F., Lin, Y., and Fu, C. (2016). The linear and rotational motions of the fission yeast nucleus are governed by the stochastic dynamics of spatially distributed microtubules. J Biomech 49, 1034-1041.

[0164] Indran, S.V., Ballestas, M.E., and Britt, W.J. (2010). Bicaudal Dl-dependent trafficking of human cytomegalovirus tegument protein ppl50 in virus-infected cells. J Virol 84, 3162- 3177.

[0165] Janke, C., and Bulinski, J.C. (2011). Post-translational regulation of the microtubule cytoskeleton: mechanisms and functions. Nat Rev Mol Cell Biol 12, 773-786.

[0166] Jiang, K., Toedt, G., Montenegro Gouveia, S., Davey, N.E., Hua, S., van der Vaart, B., Grigoriev, I., Larsen, J., Pedersen, L.B., Bezstarosti, K., et al. (2012). A Proteome-wide screen for mammalian SxlP motif-containing microtubule plus-end tracking proteins. Curr Biol 22, 1800- 1807.

[0167] Jovasevic, V., Naghavi, M.H., and Walsh, D. (2015). Microtubule plus end-associated CLIP-170 initiates HSV-1 retrograde transport in primary human cells. J Cell Biol 211, 323-337.

[0168] Komarova, Y., De Groot, C.O., Grigoriev, I., Gouveia, S.M., Munteanu, E.L., Schober, J.M., Honnappa, S., Buey, R.M., Hoogenraad, C.C., Dogterom, M., et al. (2009). Mammalian end binding proteins control persistent microtubule growth. J Cell Biol 184, 691-706.

[0169] Komarova, Y., Lansbergen, G., Galjart, N., Grosveld, F., Borisy, G.G., and Akhmanova, A. (2005). EB1 and EB3 control CLIP dissociation from the ends of growing microtubules. Mol Biol Cell 16, 5334-5345.

[0170] Komarova, Y.A., Huang, F., Geyer, M., Daneshjou, N., Garcia, A., Idalino, L., Kreutz, B., Mehta, D., and Malik, A.B. (2012). VE-cadherin signaling induces EB3 phosphorylation to suppress microtubule growth and assemble adherens junctions. Mol Cell 48, 914-925.

[0171] Lesniewska, K., Warbrick, E., and Ohkura, H. (2014). Peptide aptamers define distinct EB1- and EB3-binding motifs and interfere with microtubule dynamics. Mol Biol Cell 25, 1025-

1036. [0172] Levy, J.R., and Holzbaur, E.L. (2008). Dynein drives nuclear rotation during forward progression of motile fibroblasts. J Cell Sci 121, 3187-3195.

[0173] Manicklal, S., Emery, V.C., Lazzarotto, T., Boppana, S.B., and Gupta, R.K. (2013). The "silent" global burden of congenital cytomegalovirus. Clin Microbiol Rev 26, 86-102.

[0174] Maninova, M., Klimova, Z., Parsons, J.T., Weber, M.J., Iwanicki, M.P., and Vomastek, T. (2013). The reorientation of cell nucleus promotes the establishment of front-rear polarity in migrating fibroblasts. J Mol Biol 425, 2039-2055.

[0175] Maurer, S.P., Bieling, P., Cope, J., Hoenger, A., and Surrey, T. (2011). GTPgammaS microtubules mimic the growing microtubule end structure recognized by end-binding proteins (EBs). Proc Natl Acad Sci U S A 108, 3988-3993.

[0176] Mocarski, E.S., Shenk, T., and Pass, R.F. (2007). Cytomegaloviruses. In Fields Virology, D.M. Knipe, and P.M. Howley, eds. (Lippincott Williams & Wilkins), pp. 2701-2772.

[0177] Moorman, N.J., Sharon-Friling, R., Shenk, T., and Cristea, I.M. (2010). A targeted spatial-temporal proteomics approach implicates multiple cellular trafficking pathways in human cytomegalovirus virion maturation. Mol Cell Proteomics 9, 851-860.

[0178] Morrison, E.E., Wardleworth, B.N., Askham, J.M., Markham, A.F., and Meredith, D.M. (1998). EB1, a protein which interacts with the APC tumour suppressor, is associated with the microtubule cytoskeleton throughout the cell cycle. Oncogene 17, 3471-3477.

[0179] Petry, S., and Vale, R.D. (2015). Microtubule nucleation at the centrosome and beyond. Nat Cell Biol 17, 1089-1093.

[0180] Portran, D., Schaedel, L., Xu, Z., Thery, M., and Nachury, M.V. (2017). Tubulin acetylation protects long-lived microtubules against mechanical ageing. Nat Cell Biol 19, 391- 398.

[0181] Rebmann, G.M., Grabski, R., Sanchez, V., and Britt, W.J. (2016). Phosphorylation of Golgi Peripheral Membrane Protein Grasp65 Is an Integral Step in the Formation of the Human Cytomegalovirus Cytoplasmic Assembly Compartment. MBio 7. [0182] Rickard, J.E., and Kreis, T.E. (1990). Identification of a novel nucleotide-sensitive microtubule-binding protein in HeLa cells. J Cell Biol 110, 1623-1633.

[0183] Rios, R.M., Sanchis, A., Tassin, A.M., Fedriani, C, and Bornens, M. (2004). GMAP-210 recruits gamma-tubulin complexes to cis-Golgi membranes and is required for Golgi ribbon formation. Cell 118, 323-335.

[0184] Rivero, S., Cardenas, J., Bornens, M., and Rios, R.M. (2009). Microtubule nucleation at the cis-side of the Golgi apparatus requires AKAP450 and GM130. EMBO J 28, 1016-1028.

[0185] Roubin, R., Acquaviva, C., Chevrier, V., Sedjai, F., Zyss, D., Birnbaum, D., and Rosnet,

O. (2013). Myomegalin is necessary for the formation of centrosomal and Golgi-derived microtubules. Biol Open 2, 238-250.

[0186] Sabo, Y., Walsh, D., Barry, D.S., Tinaztepe, S., de Los Santos, K., Goff, S.P., Gundersen, G.G., and Naghavi, M.H. (2013). HIV-1 induces the formation of stable microtubules to enhance early infection. Cell Host Microbe 14, 535-546.

[0187] Sampaio, K.L., Cavignac, Y., Stierhof, Y.D., and Sinzger, C. (2005). Human

cytomegalovirus labeled with green fluorescent protein for live analysis of intracellular particle movements. J Virol 79, 2754-2767.

[0188] Sanchez, V., Greis, K.D., Sztul, E., and Britt, W.J. (2000a). Accumulation of virion tegument and envelope proteins in a stable cytoplasmic compartment during human cytomegalovirus replication: characterization of a potential site of virus assembly. J Virol 74, 975-986.

[0189] Sanchez, V., McElroy, A.K., and Spector, D.H. (2003). Mechanisms governing maintenance of Cdkl/cyclin B1 kinase activity in cells infected with human cytomegalovirus. J Virol 77, 13214-13224.

[0190] Sanchez, V., Sztul, E., and Britt, W.J. (2000b). Human cytomegalovirus pp28 (UL99) localizes to a cytoplasmic compartment which overlaps the endoplasmic reticulum-golgi- intermediate compartment. J Virol 74, 3842-3851. [0191] Sanders, A. A., and Kaverina, I. (2015). Nucleation and Dynamics of Golgi-derived Microtubules. Front Neurosci 9, 431.

[0192] Schroder, J.M., Larsen, J., Komarova, Y., Akhmanova, A., Thorsteinsson, R.I., Grigoriev, I., Manguso, R., Christensen, S.T., Pedersen, S.F., Geimer, S., et al. (2011). EB1 and EB3 promote cilia biogenesis by several centrosome-related mechanisms. J Cell Sci 124, 2539-2551.

[0193] Straube, A., and Merdes, A. (2007). EB3 regulates microtubule dynamics at the cell cortex and is required for myoblast elongation and fusion. Curr Biol 17, 1318-1325.

[0194] Szikora, S., Gaspar, I., and Szabad, J. (2013). 'Poking' microtubules bring about nuclear wriggling to position nuclei. J Cell Sci 126, 254-262.

[0195] Tirnauer, J.S., and Bierer, B.E. (2000). EB1 proteins regulate microtubule dynamics, cell polarity, and chromosome stability. J Cell Biol 149, 761-766.

[0196] Vinogradova, T., Miller, P.M., and Kaverina, I. (2009). Microtubule network asymmetry in motile cells: role of Golgi-derived array. Cell Cycle 8, 2168-2174.

[0197] Vitre, B., Coquelle, F.M., Heichette, C, Gamier, C, Chretien, D., and Arnal, I. (2008). EB1 regulates microtubule dynamics and tubulin sheet closure in vitro. Nat Cell Biol 10, 415- 421.

[0198] Wang, Z., Wu, T., Shi, L, Zhang, L, Zheng, W., Qu, J.Y., Niu, R., and Qi, R.Z. (2010). Conserved motif of CDK5RAP2 mediates its localization to centrosomes and the Golgi complex.

J Biol Chem 285, 22658-22665.

[0199] Wang, Z., Zhang, C., and Qi, R.Z. (2014). A newly identified myomegalin isoform functions in Golgi microtubule organization and ER-Golgi transport. Journal of Cell Science 127, 4904-4917.

[0200] Wu, J., de Heus, C., Liu, Q., Bouchet, B.P., Noordstra, L, Jiang, K., Hua, S., Martin, M., Yang, C., Grigoriev, L, et al. (2016). Molecular Pathway of Microtubule Organization at the Golgi Apparatus. Dev Cell 39, 44-60.

[0201] Wu, J., Lee, K.C., Dickinson, R.B., and Lele, T.P. (2011). How dynein and microtubules rotate the nucleus. J Cell Physiol 226, 2666-2674. [0202] Xu, Z., Schaedel, L, Portran, D., Aguilar, A., Gaillard, J., Marinkovich, M.P., Thery, M., and Nachury, M.V. (2017). Microtubules acquire resistance from mechanical breakage through intralumenal acetylation. Science 356, 328-332.

[0203] Yang, C, Wu, J., de Heus, C, Grigoriev, I., Liv, N., Yao, Y., Smal, I., Meijering, E., Klumperman, J., Qi, R.Z., et al. (2017). EB1 and EB3 regulate microtubule minus end

organization and Golgi morphology. J Cell Biol.

[0204] Zhang, R., Alushin, G.M., Brown, A., and Nogales, E. (2015). Mechanistic Origin of Microtubule Dynamic Instability and Its Modulation by EB Proteins. Cell 162, 849-859.

[0205] Zhao, T., Graham, O.S., Raposo, A., and St Johnston, D. (2012). Growing microtubules push the oocyte nucleus to polarize the Drosophila dorsal-ventral axis. Science 336, 999-1003.

[0206] Zhu, R., Antoku, S., and Gundersen, G.G. (2017). Centrifugal Displacement of Nuclei Reveals Multiple LINC Complex Mechanisms for Homeostatic Nuclear Positioning. Curr Biol 27, 3097-3110 e3095.

[0207] Pass, R.F., Congenital cytomegalovirus infection: impairment and immunization. J Infect Dis, 2007. 195(6): p. 767-9.

[0208] Procter, D.J., et al., The HCMV Assembly Compartment Is a Dynamic Golgi-Derived MTOC that Controls Nuclear Rotation and Virus Spread. Dev Cell, 2018. 45(1): p. 83-100 e7.

[0209] Hummel, M., et al., Allogeneic transplantation induces expression of cytomegalovirus immediate-early genes in vivo: a model for reactivation from latency. J Virol, 2001. 75(10): p.

4814-22