Field of the invention [1] The present invention relates to plants resistant to agricultural pests. In particular, it relates to nucleic acid molecules, constructs and other agents associated to manipulation of genes in plants for resistance to pests. The present invention also relates to plants that incorporate such elements, especially to plants that incorporate the constructs in which plants exhibit polypeptide of the invention in question.

Background of the invention

[2] The main characteristic of the biologic membranes is the double layer of lipids, restricting the passage of polar molecules and ions. The sphingolipids are structural components of cell membranes, involved in the growth and proliferation of cells. Besides, these molecules are important in regulating and differentiating cells, apoptosis and senescence.

[3] Sphingolipids compose a class of membrane lipids that have a polar head-group and two non-polar tails, formed by three basic structures: a long- chain amino-alcohol molecule along-chain fatty acid molecule and a polar group united either by a glycoside bond or by a phosphodiester bond. There are three subclasses of sphingolipids that are derived from ceramides, but contain different head-groups: sphingomyelin, neutral glycolipids and gangliosides. In the literature their role is related to regulation of the signaling pathways, controlling essential cellular processes, including differentiation, cell migration, apoptosis and response to inflammation.

[4] Sphingolipids are essential components of the plasma membrane of cells of mammals, but also membrane components of some groups of bacteria, particularly anaerobic and Gram-negative ones. [5] Sphingomyelinases (SMase) are a group of enzymes that catalyze the hydrolysis of sphingomyelin, releasing ceramide and phosphorylcoline. There are six types of SMases: acidic SMase, secreting SMase, magnesium- dependent neutral SMase, magnesium-independent neutral SMase, alkaline SMase and bacterial SMase. An important function of the sphingomyelinases is related to the properties that alter the membrane load, the fluidity and permeability thereof.

[6] Acidic sphingomyelinase was the first enzyme belonging to the sphingolipid class to be described. This enzyme is involved in cellular regulation through hydrolysis of sphingomyelin to form ceramide. The sphingomyelinase- ceramide system is associated to the response of the host for internalization of pathogenic agents, induction of apoptosis in infected cells and activation of intracellular signaling pathways.

[7] Various classes of peptides with activity against microorganism have been studied in the past few years. Cecropin B, a protein that affects the shape of the pores in the membranes of bacteria, is used in papers with different results. While in Jaynes, JM et al. Expression of a cecropin B lytic peptide analog in transgenic tobacco confers enhanced resistance to bacterial wilt caused by Pseudomonas solanacearum, Plant Science, 89:43-53 (1993) the resistance to Pseudomonas solanacearum is observed in transformed tobacco to express such a protein, the paper Hightower, R et al. The expression of cecropin peptide in transgenic tobacco does not confer resistance to Pseudomonas syhngae pv. tabaci, Plant Cell Reports, 13:295-299 (1994) did not identify the difference in response of plants that express Cecropin when compared with control plants. Besides, in Huang et. al. Expression of an engineered Cecropin gene cassette in transgenic tobacco plants confers disease resistance to Pseudomonas syringae pv. tabaci. Molecular Plant Pathology, 87(5): 494-499 (1997) it is reported that only with higher concentrations of inoculum of the bacteria did necrosis take place in the areas infiltrated in plats using a cecropina MB39, while such necrosis was clearly visible in untransformed plants. In Fukuta et al. Transgenic tobacco plants expressing antimicrobial peptide bovine lactoferricin show enhanced to phytopathogens. Plant biotechnology, 29:383-389, (2012), one reports the development of tobacco plants exhibiting high resistance to Pseudomonas syhngae when expressing an antimicrobial peptide {Lactoferhcina B) associated to a signal peptide aimed at the apoplast. On the other hand, Osusky et al. Transgenic plants expressing cationic peptide chimeras exhibit broad-spectrum resistance to phytopathogens. Nature biotechnology, 18: 1 162-1 166, (2000) describes a great increase in the resistance of potato plants to bacterial infection {Erwinia sp.) e -fungica {Fusahum, Phytophthora sp.) using a synthetic gene cecropin-melitina {MsrA 1) with an N-terminal modification.

[8] Another strategy for controlling bacterial diseases was that proposed by Ger, M et al. Constitutive expression of hrap gene in transgenic tobacco plant enhances resistance against virulent bacterial pathogens by induction of a hypersensitive response. Molecular Plant-Microbe Interactions. 15(8):764-773 (2002), which used the expression of proteins linked to the hypersensitivity reaction (HARP) against Pseudomonas syhngae pv. tabaci and Erwinia carotovora subs, carotovora, and in spite of observing that the hypersensitivity response does not take place in a constitutive manner, the authors suggested that the resistance presented by the transgenic plants are due to the hypersensitivity response in the infiltration areas.

[9] In addition, the antimicrobial action of elements found in fungi is the object of a number of papers encountered in the literature. In Leelavathi et al., Antimicrobial activity of Trichoderma harzianum against bacteria and fungi. Int. J. Curr. Microbiol. App. Sci. 2014.3(1 ): 96-103, the authors evaluate the activity of isolates of Trichoderma harzianum on different species of fungi and pathogenic bacteria, detecting antagonistic activity of the fungus on phytopathogen bacteria and Gram-negative bacteria. Such data is reinforced by the results presented in Sadykova et al., Antimicrobial activity of fungi strains of Trichoderma from Middle Siberia. Applied Biochemistry and Microbiology. 2015. 51 (3): 355-361 , which investigated antibiotic activity of isolates of the genus Trichoderma collected at different Siberian ecotypes on pathogens of medical importance.

[10] In the present invention, one presents plants expressing the gene of acidic sphingomyelinase, the nucleotide sequence of which was engineered to optimize the expression in plants. From what one infers from the researched literature, no documents were found to anticipate the teachings of the present invention, so that the solution proposed herein exhibits novelty and inventive activity over the prior art.

Summary of the invention [11] The invention relates to the modified sequence of the gene of sphingomyelinase in the transformation of plants aiming at the resistance to phitopathogens. In this context, the invention makes reference to a nucleic acid molecule characterized by comprising a sequence with at least 90% similarity with the sequence described in SEQ ID No1 . Additionally, the invention relates to a polypeptide molecule whose amino acid sequence exhibits at least 90% similarity with the sequence described in SEQ ID No2.

[12] The present invention also relates to a chimeric gene, characterized by comprising: a) a polynucleotide with at least 90, 95 or 99% similarity with SEQ ID n ^Q 1 ; and b) an active promoter operatively linked to the polynucleotide defined in (a).

[13] The invention further relates to a vector containing the chimeric gene of the invention. [14] One also mentions transformed cells and plants containing polynucleotide molecule with at least 90, 95 or 99% similarity with SEQ ID n ^Q 1 .

[15] The invention also foresees a method of producing a pest-resistant plant, which comprises the following steps: a) Transforming foliar explants with polynucleotides in which said nucleic acid sequence comprises sequence that encodes the protein sphingomyelinase to obtain a first line of transgene plant TO; b) Regenerating the foliar explants transformed; c) Transferring plants of the lineage TO to soil and grow said plants in greenhouse to obtain seeds of the lineage T1 .

[16] In this context, one also foresees a plant produced by a method defined in the invention, as well as parts of this plant, including its seeds and additionally plants of its progeny.

Brief description of the figures

[17] Figure 1 : Schematic representation of the vector pC3300GCHI.Sphingo containing the promoter CaMV35S directed to the expression of the gene of sphingomyelinase with terminator TNOS, the resistance gene for plant bar, and the gene nptl which imparts resistance to kanamycin.

[18] Figure 2: agarose gel (1 %) showing the digestion of the vector pC3300GCHI-Sphingo with the enzymes Nco I/Sac I and EcoR I. Weill : molecular mass marker 1 kb Ladder (Invitrogen); Well 2: negative clone 1 of E. coli digested with enzymes Nco I/Sac I; Well 3: positive clone 2 of E. coli digested with enzymes Nco I/Sac I; Well 4: positive clone 3 of E. coli digested with enzymes Nco I/Sac I; Well 5: clone 4 of E. coli digested with enzymes Nco I/Sac I; Well 6: clone of E. coli digested with enzymes Nco I/Sac I; Well 8: negative clone 1 of E. co// digested with enzyme EcoR I; Well 9: positive clone 2 of E. coli digested with enzyme EcoR I; Well 10: positive clone 3 of E. coli digested with enzyme EcoRI.

[19] Figure 3: Regeneration of foliar explants of tobacco after transformation by Agrobacterium tumefaciens. (A) Explants one month after co-culture with beginning of adventitious buds; (B) multiplication of adventitious buds; (C) elongation of sprouts in the presence of a selective agent GA 5 mg/L; (D) isolated sprout in elongation in the presence of herbicide GA; (E) elongated sprouts transferred to routing medium and (F) Tobacco plantule three months after genetic transformation.

[20] Figure 4: Lateral flow chromatography test carried out with extract of regenerated tobacco leaves in the presence of the herbicide GA for detection of the protein PAT. (1 ) Transgenic plant, the bottom lineage denotes the presence of the protein PAT; (2) Negative control, non-transformed tobacco leaf, only the negative control lineage was observed.

[21] Figure 5: Test with application of the herbicide glyphosate for selection of transgenic progenies T1 , wherein: (5. A) Plants resistant to the herbicide did not exhibit lesions, whereas in (5.B) we can observe symptoms of necrosis in the plant susceptible to herbicide.

[22] Figure 6: Agarose gel (2%) of the PCR of five plants (numbers 1 to 5) of the 15 tested plants T1 of each tobacco lineage, transformed with the vector pC3300GCHI.Sphingo, used ion the bioassays, wherein Sph = Sphingo, followed by the line number. MM 100 pb: molecular mass marker 100 bp Ladder (Invitrogen); Sph.1 to Sph.12: Line (1 ), wherein the numbers 1 to 5 refer to the DNA extracted from 5 progenies of each lineage. H ₂ 0: Water, C-: Untransformed plant, C+1 : Clone of E. coli with vector Pc3300. Sphingo, C+.2: vector Pc3300. Sphingo.

[23] Figure 7: Bioassay with the bacterium Pseudomonas pv. tabaci. Response of detached leaves to infiltration of the bacterial suspension after 7 and 14 days from infiltration. 1 ) Leaf from the non-transgenic event Sphingo 1 ; C -) Leaves of the negative control; 2-12 Leaves of the transgenic events after 7 and 14 days from infiltration.

[24] Figure 8: Affected area of the liens shown in the experimental repetitions. Equal letters show that the lineages are equal according to the non-parametric test of (Kruskal-Wallis =13.1 1 , p-value < 0.21 ).

[25] Figure 9: Distribution of the lineages into groups in the decreasing order of the means/Equal colors show that the repetitions are equal according to the test ScottKnott at 5% significance. [26] Figure 10: Graph of the injured areas in the two repetitions after inoculation of detached leaves with the bacterium P. syringae. A,B: Curve of progress of the disease, obtained from the mean of the progenies. C:D: Bar graph with the average values of infiltrated area, obtained for each lineage.

[27] Figure 1 1 : Mean of the injured areas, obtained with infiltration of Pseudomonas syringae in the two repetitions. The equal letters shown that the repetitions are equal according to the non-parametric test of Kruskal-Wallis = 2.978, p-valor= 0,084.

[28] Figure 12: Mean of the injured areas obtain with infiltration of Pseudomonas syringae for each lineage. The equal letters show that the repetitions are equal according to the non-parametric test of Kruskal-Wallis = 222,42 p-valor< 0,001 .

[29] Figure 13: Distribution into groups of the lineages sampled in the experimental repetitions. Equal colors show that the repetitions are equal according to the test ScottKnott at 5% significance.

[30] Figure 14: Losses o chlorophyll that take place naturally in the leaves of the lineages after 14 days from the essay.

[31] Figure 15: Graph of the percentages of losses of chlorophyll in the regions infiltrated with the bacterium P. syringae. A: Losses of chlorophyll of the lines in the first repetition of infiltration of P. syringae, B: A: Losses of chlorophyll of the lineages in the second repetition of infiltration of P. syringae.

[32] Figure 16: Semi-selective culture media MSP and SPA containing colonies of Pseudomonas syringae recovered from the leaves infiltrated with the bioassay. Detailed description of the invention

[33] The present invention describes a new and inventive method of producing a plant resistant to agricultural pests. In the context of this description, numberless terms will be used, and so they will be better detailed hereinafter. [34] The term "nucleic acid" refers to a molecule that may be a single-bond or a double-bond one, composed by monomers (nucleotides) containing a sugar, a phosphate and a purine or pyrimidine base. A "nucleic acid fragment" is a fraction of a given nucleic acid molecule. "Complementariness" refers to the specific pairing of purine and pyrimidine bases that consist of nucleic acids: pairs of adenine with thymine and pairs of guanine with cytosine. Then, the "complement" of a first nucleic acid fragment refers to the second nucleic acid fragment whose nucleotide sequence is complementary to the first nucleotide sequence.

[35] In more complex organism, the deoxyribonucleic acid (DNA) is a nucleic acid that contains the information of the genetic material of a given organism, while the ribonucleic acid (RNA) is a nucleic acid that is involved in the transfer of the information of the DNA in proteins. A "genome" is the whole main part fo the genetic material contained in each cell of an organism. The term "nucleotide sequence" refers to the nucleotide polymer sequences, forming a DNA or RNA strand, which may be a single strand or double strands, optionally synthetic, non-natural or with altered nucleotide bases capable of being incorporated into DNA or RNA polymers. The term "oligomer" refers to short nucleotide sequences, usually of up to 00 bases in length. The term "homolog" refers to the ancestral binding between the sequences of nucleotides of two nucleic acid molecules, or between the sequences of amino acids of two protein molecules. The estimate of such homology is provided by hybridizing DNA-DNA or RNA- RNA under stringency conditions, as defined in the prior art (as mentioned in document US20030074685, Hames and Higgins, Ed. (1985) Nucleic Acid Hybridization, IRL Press, Oxford, U.K); or by comparing similarity of sequence between two nucleic acid or molecules or protein molecules (as mentions in document US20030074685, Needleman et al., J. Mol. Biol. (1970) 48:443-453).

[36] "Gene" refers to the nucleotide fragment that expresses a specific protein, including regulatory sequences that precede (5' untranslated region) and that follow the (3' untranslated region) the encoded region. "Native gene" refers to an isolated gene with its own regulatory sequence found in nature. "Chimeric gene" refers to the gene that comprises encoded, regulatory and heterogeneous sequences that are not found in nature. The chimeric gene of the present invention comprises isolated nucleic acid molecules bonded operatively to active promoters. Gene constructs of the present invention may contain one or more chimeric genes chimeric genes and may or may not exhibit introns. "Endogenous gene" refers to the native gene usually found in its natural environment in the genome and is not isolated. An "exogenous gene" refers to a gene that is not usually found in the host organism, but that is introduced by genie transfer. "Pseudogene" refers to a nucleotide sequence that does not encode a functional enzyme.

[37] "Coded sequence" refers to the DNA sequence that encodes a specific protein and excludes the non-encoded sequence. An "interrupted coding sequence" means the sequence that acts as a separator (for instance, oen or more introns bonded by junctions). An "intron" is a nucleotide sequence that is transcribed and is present in the pre-mRNA, but is removed by cleavage and the-rebinding of the imRNA inside the cell generating a mature imRNA that may be translated to a protein. Examples of introns include, but are not limited to intron pdk, intron pdk2, intron catalase of castor plant, intron Delta 12 desaturase of cotton plant, Delta 12 desaturase of Arabidopsis thaliana, intron ubiquitin of maize, intron of SV40, introns of the gene of malate synthase.

[38] "RNA transcript" refers to the product resulting from the transcription catalyzed by the RNA polymerase of a DNA sequence. When the RNA transcript is a perfect copy of the DNA sequence, it is referred to with the primary transcript or it may be an RNA sequence derived from a post- transcriptional process of the primary transcript and is then referred to as a mature transcript. "Messenger RNA" (imRNA) refers to the RNA without introns.

[39] The term "vector" refers to a replicon, such as a plasmid, phage or virus, in which other genetic sequences or elements (be they of DNA or RNA) may be bonded. Thus, the genes may be replicated together with the vector. Such vectors can be obtained commercially, including those supplied by Clontech Laboratories, Inc (Palo Alto, Calif.), Stratagene (La Jolla, Calif), Invitrogen (Carlsbad, Calif.), New England Biolabs (Beverly, Mass.) and Promega (Madison, Wis.). A few examples of vectors, but not limited thereto, are the vectors pHANNIBAL (Wesley SV, Heliwell CA, Smith NA, Wang M, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green A G, Waterhouse PM (2001 ) Construct design for efficient, effective and highthroughput Gene silencing in plants. Plant J. 27:581590) pGLYP, pC3300, pAC321 , series pCambia (BioForge Co.), pBI121 (Chen, Po-Yen; Wang, Chen-Kuen; Soong, Shaw-Ching; To, Kin-Ying. Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants. Molecular Breeding vol. 1 1 issue 4 May 2003. p. 287-293), pBSK (Addgene Co.), pGEM-T easy (Promega Corporation), pET101 / D-TOPO (Invitrogen). Obtaining recombinant vectors comprising promoters bonded to nucleic acids is known from the prior art and can be found in Sambrook et al. (Sambrook, J., Russell, D. W., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press. 1989).

[40] "Promoter" refers to the DNA sequence in which a gene, usually located upstream of the coding sequence, which controls the expression of the coding sequence promoting the recognizance by the RNA polymerase and other factors required for the transcription itself.. Promoters may also contain DNA sequences that are involved in binding protein factors that control the effect of the beginning of the transcription in reply to physiologic or development conditions. "Constitutive promoters" refer to those that govern the gene expression in all the tissues of the organism and all the time. "Tissue-specific" promoters or "development-specific" promoters are those that govern the gene expression almost exclusively in specific tissues such as leaves, roots, stems, flowers, fruits or seeds, or in specific development states in a tissue, like the beginning or the end of the embryogenesis.

[41] The promoter may contain "enhancers". An enhancer is a DNA sequence that can stimulate the promoter activity. It may be an innate element of the promoter or a heterologous element inserted to enhance the level and/or the tissue-specificity of a promoter. [42] The term "expression" refers to the transcription of a given DNA sequence. More specifically^ in this invention, it refers to the transcription and stable accumulation of the dsRNA derived from the nucleic acid fragments of the invention.

[43] "Suitable regulatory sequences" refer to the nucleotide sequences in native or chimeric genes that are located above (5' untranslated region), within and /or below (3' untranslated region) the nucleic acid fragments of the invention, which control the expression of the nucleic acid fragments of the invention.

[44] "Transformation" refers to the transfer of the exogenous gene into the genome of a host organism and the consequent inclusion thereof into the genetically stable heritage.

[45] "Plants" refer to eukaryotic, autotrophic and photosynthetic organisms belonging to the reign Plantae.

[46] The term "promoter" refers to a DNA sequence that is capable of starting and/or controlling the transcription of a cell. This includes any promoter of plant origin or any promoter of non-plant origin that is capable of directing the expression in a plant cell, for instance promoters of viral or bacterial origin such as 35SCaMV (as mentioned in patent application US20030175783, Hapster et al, 1988 Mol. Gen. Genet. 212, 182-190) and promoters of the gene present in the T-DNA de Agrobacterium; tissue-specific promoters or organ-specific promoters, including, but not limited to seed-specific promoters (WO8903887), organ-primordia specific promoters (as mentioned in patent application US20030175783, An et al., 1996 The Plant Cell 8, 15-30), stem-specific promoters (as mentioned in patent application US20030175783, Keller et al., 1988 EMBO J. 7: 3625-3633), leaf-specific promoters (as mentioned in patent application US20030175783, Hudspeth et al., 1989 Plant Mol Biol 12:579-589), mesophyll-specific promoter, root-specific promoters (as mentioned in patent application US20030175783, KELLER et al. 1989 Genes Devel. 3:1639-1646), tuber-specific promoter (as mentioned in patent application US20030175783, Keil et al., 1989 EMBO J. 8: 1323:1330), vascular-tissue-specific promoters (as mentioned in patent application US20030175783, Peleman et al., 1989 Gene 84: 359-369), stamen-specific promoters (WO8910396, WO9213956), Dehiscence zone-specific promoters (WO9713865); and the like.

[47] The termination signal of the transcription and the polyadenylation region of the present invention includes, but is not limited to termination signal of adenylation of HSV TK, termination signal of the gene of nopalina synthase of Agrobactehum tumefasciens, termination signal of the gene RNA 35S do CaMV, termination signal of the virus that attacks Thfolium subterranean (SCSV), termination signal of the gene trpC of Aspergillus nidulans, and other similar ones.

[48] Gene constructs or chimeric gens can be introduced into the genome of a plant by a number of conventional techniques. For instance, the construct can be introduced directly into the plant tissue by using ballistic methods such as bombarding particles covered with DNA, as described in Rech EL, Vianna GR, Aragao FJL (2007) High transformation efficiency by biolistics of soybean, bean and cotton transgenic plants, Nature Protocols, 3 (3): 410-418. They can also be introduced directly into the gene DNA of the plant cell by using techniques such as electroporation and microinjection of protoplasts of plant cells. Another method of introducing the gene constructs is through transfection by the bacterium Agrobactehum tumefaciens.

[49] Transformed plant cells that are derived from any of the above-described transformation techniques can be cultivated to generate a whole plant that has the transformed genotype and, as a result, the expected phenotype. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue growth culture medium, typically containing a biocidal and/or herbicidal marker, which should be introduced together with the desired nucleotide sequence. Regeneration of plants from protoplast culture is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21 -73, CRC Press, Boca Raton, 1985 (as mentioned in patent application US20020152501 ). The regeneration can also be achieved through plant calli, explants, organs, or a part thereof. Such regeneration techniques are described generally in Klee et al., Ann. Ver. Of Plant Phys. 38:467-486, 1985 (as mentioned in patent application US20020152501 ).

[50] The invention relates to a nucleic acid molecule characterized by comprising a nucleic acid sequence with at least 90% similarity with the sequence described in SEQ ID No1 . In a preferred embodiment, the nucleic acid molecule exhibits at least 95% similarity with the sequence described in SEQ ID No1 . Preferably, the nucleic acid molecule exhibits at least 99% similarity with the sequence described in SEQ ID No1 . In a more preferred embodiment the nucleic acid molecule exhibits a nucleic acid sequence as described in SEQ ID No1 .

[51] In another embodiment, the nucleic acid molecule may comprise a substitution, deletion and/or insertion of nucleotide at one of more positions.

[52] The invention also foresees polypeptide molecule with at least 90% similarity with the sequence described in SEQ ID No2. In a preferred embodiment, the peptide molecule exhibits at least 95% similarity SEQ ID No2. More preferably, the polypeptide molecule exhibits at least 99% similarity with SEQ ID No2. In a still more preferred embodiment, the polypeptide molecule exhibits an amino acid sequence according to the sequence described in SEQ ID No2.

[53] The invention further relates to a chimeric gene comprising:

a) a polynucleotide with at least 90, 95 or 99% similarity with SEQ ID 1 ;

b) and an active promoter, operatively linked to the polynucleotide defined in (a).

[54] The above-cited chimeric gene can impart resistance to pest. Preferably, such a chimeric gene imparts resistance to bacterium. And still more preferably, the chimeric gene imparts resistance to bacteria of the genus Pseudomonas sp.

[55] Such a chimeric gene may be comprised in a vector. In a preferred embodiment, this vector is capable of promoting the expression of the molecule of interest or a fragment thereof. In another embodiment, such a vector comprises a fragment of nucleic acid. In another embodiment, such a vector comprises a fragment of nucleic acid with at least 90% similarity with the sequence described in SEQ ID No3. In a preferred embodiment, the vector comprises a nucleic acid sequence with at least 95% similarity with the sequence described in SEQ ID No3. On the other hand, in a more preferred embodiment, the vector has in its composition a nucleic acid sequence with at least 99% similarity with the sequence described in SEQ ID No3. In a still more preferred embodiment, the vector has in its composition a nucleic acid sequence as described in SEQ ID No3.

[56] The present invention also relates to a transformed cell comprising a nucleotide molecule with at least 90, 95 or 99% similarity with SEQ ID 1 . In a preferred embodiment, such a cell is a bacterial one. More preferably, the bacterial cell is a cell of Eschereha coli or of Agrobactehum tumefaciens. In another embodiment, the transformed cell is of plant origin.

[57] Another object of the present invention is a transformed plant comprising a nucleotide molecule with at least 90, 95 or 99% similarity with SEQ ID 1 . The invention further foresees a transformed plant containing a vector with a chimeric gene the comprises:

a) a polynucleotide with at least 90, 95 or 99% similarity with

SEQ ID 1 ;

b) and an active promoter, operatively linked to the polynucleotide defined in (a).

[58] In a preferred embodiment, such a transformed plant is a dicot. In a more preferred embodiment, the transformed plant is a soybean plant, tobacco plant, bean plant, tomato plant, cotton plant, orange plant, sun-flower plant, canola plant lettuce plant, caupi-bean plant, papaya plant, pineapple plant, grape plant, eucalyptus plant, manioc plant, coffee plant, banana plant.

[59] In a preferred embodiment, the transformed plant is a monocot. More preferably, the transformed plant is a maize plant, a rice plant, a sugar-cane plant, a sorghum plant, a wheat plant, a Brachiaria plant. [60] The invention also relates to a method of producing a pest-resistant plant comprising the following steps:

I. transforming foliar explants with polynucleotides in which said nucleic acid sequence comprises a sequence that encodes the protein sphingomylinase to obtain a first lineage of the transgene plant TO;

II. regenerating of the transformed foliar explants;

III. transferring plants of the lineage TO to soil and growing said plants in a greenhouse to obtain seeds of lineage T1 .

[61] After obtaining both plants TO in step I and seedsTI in step III, one identifies plants that exhibit at least one fragment corresponding to the polynucleotide used in step I. Preferably one identifies plants that exhibit at least one fragment corresponding to an internal region of the sequence presented in SEQ ID No3. Said identification of plants TO obtained in step I, as well as seeds T1 in step III, is made by subjecting a plurality of plants or seeds to at least one DNA analysis technique. Preferably, said DNA analysis technique is chosen from the following: PCR analysis, quantitative PCR analysis, Southern blot, Northern blot and nucleotide sequencing.

[62] Another objective of the invention is to obtain a plant produced by the method described in this invention, as well as its seed. In a preferred embodiment, the seed of the plant has in its genome a nucleic acid sequence with at least 90, 95 or 99% similarity with SEQ ID 1 .

[63] The invention also relates to a part of the plant produced by the method described in the invention. Preferably, the plant part would be pollen, a seed- bud, a meristem, a leaf, a stem, a rout, or a cell. Additionally, another objective of the invention is to obtain a plant that is progeny of the plant produced by the method described in the invention.

Experiments made and the results achieved:

[64] Plant material [65] Plants of Nicotiana tabacum cv. Xanthi, grown in vitro and kept with periodic transplantations in culture medium MS (Murashige, T. & Skoog, E.A. Revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiology Plant. 15: 473-497, 1962), photoperiod of 16 h at a temperature of 25 ± 2 ^< C.

[66] Construct of the vector containing the gene of sphingomyelinase

[67] The sphingomyelinase gene was synthesized chemically. The fragment of this sequence was cloned in the vector pC3300GCHI between the sites of Nco\ and Sad, under control of the promoter 35SCaMV. The vector further has the gene bar, which codes for the enzyme phosphinothicin acetyl transferase I (PAT), which imparts tolerance to the herbicide glufosinate ammonium, (GA), used for selecting the genetically modified plants.

[68] Transformation of Eschereria coil by electroporation and extraction of piasmidlai DNA (Miniprep)

[69] An Eppendorf tube containing competent cells was unfrozen in an ice- ban, and an aliquot of 2 μί DNA was added to the bacteria E. coii DH5a, and the tube was incubated in the ice for 2 minute. After this period, the mixture of cells and DNA was put in a previously cooled electroporation cuvette. The electroporation was carried out in a BioRad apparatus. Immediately after electroporation, 600 μί. LB medium was added, and the cells were suspended and transferred to an Eppendorf tube. The mixture was then incubated at 37 ⁸ C for 40 minutes. After this step, different volumes of the bacteria! culture were plated on a Petri dish containing 25 ml solid LB medium plus canamicyn 100 mg/L, after this procedure the dishes were incubated at 37 ^< C overnight.

[70] In order to carry out the miniprep, one collected 3 μί of the liquid bacterial culture generated from the transformed colony and incubated in 3 mL of liquid LB containing 100 mg/L canamicyn at 30 ^S C and 180 rpm. For extraction of the plasmidial DNA, one used the kit Wizard® Plus SV Miniprep (Promega, USA) according to the recommendations of the manufacturer.

[71] The cloning was confirmed by cleavage with restriction enzyme Eco Rl, at 37 ^< C for 2 hours, generating two fragments of 20 20 and 9235 bp. [72] Transformation of Agrobacterium tumefaciens by etecfroporation [73] The vector pC3300GCHI.Sphingo was transferred to the lineage of Agrobacterlum tumefaciens EHA 105 for electroporation as described by Lacorte, C. & Romano, E. Transferencia De Vetores Para Agrobacterium. In: Brasileiro, A. C. M, Carneiro, V. T. C. Manual de Transformagao Genetica de Plantas. Embrapa, Brasilia. 51 -64 (1998). After electroporation, one added 1 mL If LB medium, and the cells were suspended and transferred to an Eppendorf tube. The mixture was incubated at 28^0 f or 4 hours. After this step, different volumes of the bacterial culture was plated on a Petri dish containing 25 mL of solid LB medium plus rifampicin 100 mg/L and canamicyn 100 mg/L, after this procedure the dishes were incubated at 28 for 48h.

[74] Isolated colonies were collected individually with the aid of a sterilized pipette tip, inserted into 20 μί water and then boiled for 5 minutes. For PCT reaction, one used 2 μί of the bacterial solution a mold DNA, and the primers 35SCamvF (CCACTATCCTTCGCAAGAC) and TnosR

(ATCATCGCAAGACCGGCA), which amplify a sequence of 2220 pb, from the promoting region to the terminator, containing between them the coding region of the sphingomyelinase. After this in si!ico design of the cassette of expression of the sphingomyelinase, the vector pC3300GCHI-Sphingo was synthetized (Figure 1 ). After insertion into cells of E, co// stain XL1 Blue, its presence was confirmed through release of a fragment of 2020 pb corresponding to the coding region of the sphingomyelinase of the clones 3 and 4, which have the insert through digestion with Nco I and Sac I and of the 9 and 10 digested with Eco Rl (Figure 2).

[75] Generic transformation of tobacco plants

[76] A lineage of Agrobacterium tumefaciens EHA 105 containing the vector pC3300GCHI.Sphingo was inoculated in 10 mL of medium LB (MILLER, 1972) containing the antibiotics rifampicyn (100 mg/L) and canamicyn (100 mg/L). The culture grew for 16 h at 28 ^Q C under 100-rpm stirring until the exponential growth phase, with optical density (OD/D.O.) of 0.7 (A600nm). After the growth of the bacterial culture, one made the cutting of the young leaves of the plants of Nicotiana tabacum cv. Xanthi kept in vitro. The leaves were cut into 1 cm ² - squares with the aid of a sterile a scalpel on a Petri dish moistened with sterile deionized water to keep them hydrated. The foliar explants were transferred to the Petri dish containing the bacterial suspension (liquid co-culture), where they remained at room temperature for 10 minutes and with slight stirring, being the transferred to the Petri dish with the autoclaved filter paper, for the purpose of removing the excess of bacterial suspension. Then, they were inoculated in solid MS medium containing BAP (6-benzylminopurin) at 1 mg/L with the adaxial face in contact with the medium for 48 h at 25 ± 2 ^Q C in the dark. After two days' solid co-culture, the explants were transferred to an MS regeneration medium containing BAP 2 mg/L, cefotaxime 200 mg/L, timentin 100 mg/L and glufosinate-ammonium (GA) 5 mg/L. The dishes were kept in growth chamber under photoperiod of 16 h to 25 ± 2 ^Q C. A few explants developed auxiliary buds (Figure 3A) which then multiplied (Figure 3B) and formed sprouts (Figure 3C). The explants were cultivated for two weeks, and the calli obtained were separated and transferred to a new regeneration medium containing GA. Elongate sprouts were isolated (Figure 3D) and grown in the routing medium that consisted of MS medium containing ANA with 5 mg/L of GA to form the first routs (Figure 3E), giving rise to plantules (Figure 3F). The regenerated transgenic plantules were acclimatized in greenhouse until the production and harvest of the seeds. Twenty-seven plants regenerated in the presence of the herbicide glufosinate-ammonium were acclimatized in greenhouse, having been subjected to PCR molecular analyses and lateral flow chromatography test for the enzyme PAT (Phosphinotricin acetyl transferase).

Analysis of the regenerated plants

[77] Glufosinate-tolerant plants were subjected to tests for the presence of the transgene by PCR, the expression of the selection gene introduced by detection of the presence of phosphinothricyn acetyl transferase with the test Kit Trait LL (Strategic Diagnostic Inc.) and integration in the genome by Southern blot (Sambrook, J., Russel, D.W. Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 2001 ). [78] PCR for detection of the sphingomyelinase gene

The molecular analysis aimed at detection of the sphingomyelinase gene was carried out by using DNA extracted from foliar discs, according to the extraction protocol with CTAB ARAGAO, F. J. L; BRASILEIRO, A. C. M. Positive, negative and marker-free strategies for transgenic plant selection. Brazilian Journal of Plant Physiology, v. 14, n. 1 , p. 01 -10, jan. 2002. For each sample analyzed the DNA was added to the solution containing distilled water, dNTP, MgCI2, Taq polimerase and the primers Sphingo F: TGGACAAGATGGGTTGGAGC and Sphingo R: GCCATAACAGCATGAGAAGCA used will amplify a sequence of 412 pb contained in the coding region of the sphingomyelinase gene. The products PCR were subjected to electrophoresis in agarose gel 2%, using buffer TBE 0,5X.

[79] Test for detection of the protein PAT

[80] Test for the detection of the protein PAT

[81] A foliar disc of each tobacco plant was macerated with a glass rod in an Eppendorf tube, where it was added to the plant extract 200 μΙ_ of buffer PBS 1 X. Then a strep of the Test GMO TraitCheck (gene bar - PAT) was inserted into the Eppendorf tube with the indicating arrow facing downward. Among the plants tested, 27 were positive for the expression of the gene bar detected by the test GMO TraitCheck (Figure 4).

[82] Analysis of the segregation of the T1

[83] In order to select the positive plants for the bioassays, one used 15 plants of 10 events T1 . One applied to the adaxial face of the plantules a solution with the herbicide glufosinate-ammonium 200 img/imL. Table 1 shows the result of the application of the herbicide glufosinate-amonium to the leaves of 15 plants of each of the 10 transformed lineages Ti , which were used for selecting positive lineages for the bioassays and for analyzing the segregation of each progeny. The plants T1 resistant to the herbicide developed normally after foliar application of the GA (Figure 5A), whereas the susceptible and non- transgenic plants T1 exhibited necrosis in the brushed regions with the consequent death. On the basis of the response of tolerance and susceptibility to the herbicide of the progenies of each lineage, one observed the probability of segregation obtained by the X ² test.

[84] The PCR analysis of the progenies T1 detected the presence of the sphigomyelinase gene in nine (9) of the ten lineages analyzed (Figure 6). The lineage Sphingo.1 was not tolerant to the herbicide glufosinate-ammonium when the latter was applies to the leaves, and one did not detect the presence of the sphingomyelinase gene in any progeny of this lineage. Thus, this lineage was considered an escape and was kept as negative control of the transformed plants.

Table 1 : Analysis of the segregation of the genetically modified lineages through selection of the positive plants by applying the herbicide glufosinate- ammonium and by applying the X ² test with Yates correction, which calculates the probability of occurrence of one or two copies of the transgene in the genome: χ2: Chi-squared, P: Probability.

Lineages Positive Negative Segregation Segregation

plants plans 3:1 15:1

X2 P X2 P

1 0 15 43,08 0 21 1 ,28 0,0

2 13 2 1 ,48 0,3 0,51 0,25

2,1 13 2 1 ,48 0,3 0,51 0,25

5 9 6 1 ,48 0,17 24,40 0,0

6 12 3 0,42 0,65 3,07 0,02

7 9 6 1 ,48 0,17 24,40 0,0

8 13 2 1 ,48 0,3 0,51 0,25

10 13 2 1 ,48 0,3 0,51 0,25

1 1 13 2 1 ,48 0,3 0,51 0,25

12 10 5 0,42 0,45 15,01 0

Control 0 15 43,08 0,0 21 1 ,28 0,0

[85] Bioassays

[86] Tobacco transgenic plants expressing the sphingomyelinase gen were tested for resistance to the phytopathogenic fungus Fusahum sp. As described by DIAS, B. B. A.; CUNHA, W. G.; MORAIS, L. S.; VIANNA, G. R.; RECH, E. L; CAPDEVILLE, G.; AFtAGAO, F. J. L. Expression of an oxalate decarboxylase gene from Flammulina sp. in transgenic lettuce (Lactuca sativa ) plants and resistance to Sclerotinia sclerotiorum Plant Pathology: 55 , 187-193, 2006.

[87] Infiltration with Pseudomonas syringae pv. tabaci

[88] The bacterial strain of Pseudomonas syringae pv. tabaci Emb 135 was used for the infiltration assays as described in Li, Q et al. The yeast polyadenylate-binding (PAB1 ) gene acts as disease lesion mimic gene when expressed in plants. Plant Molecular Biology, 42:335-344 (2000). The bacterial strain Emb 135 (IBSBF 766) was striated on the Petri dish containing the solid medium 523, developed according to Kado & Heskett, .G. Selective media for isolation of Agrobacterium, Corynebacterium, Erwinia, Pseudomonas and Xanthomonas. Phytopathology, 60: 969-976 (1970), and incubated at 28 . After 24 hours, the material of a colony was recovered and grew in medium 523 for 48 hours under 150-rpm stirring. After this incubation period, the culture was centrifuged and re-suspended in distilled water using the scale of Mc Farland in the dilution of 10-7. The infiltration in the leaves detected was carried out with a needle-less syringe at its abaxial part, after infiltration the leaves were kept on trays containing moistened paper and involved in plastic sacks to simulate a moisture chamber. The trays were kept in growth chamber under photoperiod of 16 h at 25 ± 2 ^Q C. Fife plants of each lineage were used in two repetitions with the bacterium P. syringae. For each leaf detached, 6 points were infiltrated with the bacterial suspension and one point was infiltrated with water. The evaluations were made with 7, 10 and 14 days (Figure 7). The leaves detached were photographed for calculation of the injured and were read with chlorophyll meter Opti-science CCM-200 and the program Image J for measurement of the area around the infiltration.

[89] The evaluation of the test with chlorophyll meter for the infiltrated leaves demonstrated that the control plants have twice as much chlorophyll in the infiltrated areas as the transgenic plants, and the reading of the infiltrated area demonstrated that there was difference between the genetically modified events and the control. [90] In the first assay, seven days after infiltration, it was already possible to verify the beginning of growth of the affected area, with the consequent loss of chlorophyll. One could observe, around the infiltration site, growth of the injured area with a difference of up to twice between the transgenic event and the control. With the progress of the disease after 14 days, one observed 1 : an increase in the injuries on the susceptible plants, which was not observed in the tolerant plants; 2: greater losses of chlorophyll around the infiltration area; 3: bacterial infiltration in the control plants taking virtually the whole leaf, whereas in the transformed plants one observed a hypersensitiveness reaction with cell death for control of the bacterial growth (Figure 8). In this experiment, the reading of the injured area (Figure 9A, 9C) indicated a great difference between the transformed plants with respect to the control, and still the analysis of the experiment with the aid of the chlorophyll meter demonstrated that the control plants had great losses in the infected areas.

[91] The analysis of the second bacterial infiltration assay by measuring the results achieved, the control plants had an injured area that was very superior to the transgenic events (Figure 9B, 9D).

[92] The statistical analysis using the test ANOVA for the non-parametric data demonstrates that at 5% of significance there was no difference between the affected areas in the two repetitions (Figure 10), further the comparison test between the averages indicates that the means are equal. The statistical analyses point out the transgenic lineage (2,1 ), differing from the other genetically modified lineages. The comparison tests of the averages indicates that the averages between the lineages are different from each other and in comparison with the controls (Figure 1 1 ), the distribution in groups by the test of Scott Knott (Figure 12) demonstrates that the transgenic lineages are distributed inferior to the controls (F10.649=7.17, p-value<0.001 ). Analyzing the isolated variation of the progenies in the two repetitions one points out 2.2; 5.1 ; 6.2; 6.3; 10.2 1 1 .1 and 1 1 .2 as the best progenies. Such plants exhibited an injured area of about 25 to 50 mm ² as compared to the control that varied from 150 to 615 mm ² . [93] The reading with the chlorophyll meter enabled one to quantify the losses of chlorophyll observed by the bacterial infection, comparing the areas of natural loss of chlorophyll (Figure 13) with the areas infiltrated in the assay, so as to observe the variation between the point of infiltration with water alone and the points infiltrated with the bacterial suspension. All the analyses took into consideration the values of one point without infiltration. The infiltrations with water enabled one to observe that in these areas there was no loss besides the natural one or due to the injury caused by the infiltration process.

[94] The analysis of loss of chlorophyll showed that the transgenic lineages had less infiltration than the control in the two repetitions. In the first repetition one observed significantly higher losses in the non-transformed plants. (Figure 14 A). However in the second repetition, one observed losses in the same proportion between the control and the transgenic plants (Figure 14 B). This occurred due to the methodology established for the reading that takes into consideration only three points around the halo of infection, without embracing the whole leaf. However, the (Figure 15) associated to the affected areas on the transgenic plants demonstrates the difference between the lineages analyzed.

[95] Recovery of P. syringae pv tabaci from the infiltrated regions

[96] Discs of 5 mm ² with symptoms of yellowing around the infection halo were disinfected through immersion into alcohol 70% for 1 minute, sodium hypochlorite 1 % for 1 minute, and then washed in distilled water, the discs were inserted into microcentrifuge tubes (1 .5 ml) containing distilled water to be centrifuged for 5 seconds at 13400 rpm. Then, 50 μΙ_ of the bacterial suspension were transferred to the semi-selective media SPA with Sacarose, 20 g/L Peptona 10g/L and Agar 12 g/L and 0.05% triphenyl tetrazolium chloride (Silveira et al. Ocorrencia das biovares 1 e 2 de Ralstonia solanacearum em lavouras de batata no estado do Rio Grande do Sul. Fitopatologia Brasileira, 27(5): 450-453, 2002); and for the medium MSP (Mohan & Schaad, Semi selective agar media forisolating Pseudomonas syringae pv. syringae and Pseudomonassyringae pv. phaseolicola from bean seed. Phytopathology, 77:1390-1395, 1987) composto por Sacarose 20g/L, peptona 5g/L, K2HPO4, MgSO4.7H2O 25 mg/L, Agar 20 g/L e bromotimol azul (15 mg/L).

[97] This experiment enabled one to prove that the symptoms observed were caused by the bacteria P. syhngae. In the medium SPA the colonies exhibited red center and white borders, and in the culture medium MSP yellowed young stains that became orange-color as they formed the colony (Figure 16).

[98] The experiments described in this document were carried out with financial support of the CNPq.