The present invention relates to a class of substituted amines, pharmaceutical compositions and methods of treating neurological and neuropsychiatπc disorders

Synaptic transmission is a complex form of intercellular communication that involves a considerable array of specialized structures in both the pre- and post-synaptic neuron High- affinity neurotransmitter transporters are one such component, located on the pre-synaptic terminal and surrounding ghal cells (Kanner and Schuldiner, CRC Critical Reviews in Biochemistry. 22 1032 ( 1987)) Transporters sequester neurotransmitter from the synapse, thereby regulating the concentration of neurotransmitter m the synapse, as well as its duration therein, which together influence the magnitude of synaptic transmission Further, by preventing the spread of transmitter to neighboring synapses, transporters maintain the fidelity of synaptic transmission Last, by sequestering released transmitter into the presynaptic terminal, transporters allow for transmitter reutihzation

Neurotransmitter transport is dependent on extracellular sodium and the voltage difference across the membrane, under conditions of intense neuronal firing, as, for example, duπng a seizure, transporters can function in reverse, releasing neurotransmitter in a calcium-independent non-exocytotic manner (Attwell et al , Neuron. 11. 401-407 (1993)) Pharmacologic modulation of neurotransmitter transporters thus provides a means for modifying synaptic activity which provides useful therapy for the treatment of neurological and psychiatric disturbances

The ammo acid glycine is a major neurotransmitter in the mammalian central nervous system, functioning at both inhibitory and excitatory synapses By nervous system, both the central and penpheral portions of the nervous system are intended These distinct functions of glycine are mediated by two different types of receptor, each of which is associated with a different class of glycine transporter The inhibitory actions of glycine are mediated by glycme receptors that are sensitive to the convulsant alkaloid strychnine, and are thus referred to as "strychnine-sensitive " Such receptors contain an intrinsic chloride channel that is opened upon binding of glycine to the receptor, by increasing chloride conductance, the threshold for firing of an action potential is increased Strychnine-sensitive glycine receptors are found predominantly in the spinal cord and bramstem, and pharmacological agents that enhance the activation of such receptors will thus increase inhibitory neurotransmission m these regions

Glycine functions m excitatory transmission by modulating the actions of glutamate, the major excitatory neurotransmitter in the central nervous system See Johnson and Ascher. Nature.

325. 529-531 (1987), Fletcher et al , Glycine Transmission. (Otterson and Storm-Mathisen. eds . 1990), pp 193-219 Specifically, glycme is an obligator, co-agonist at the class of glutamate receptor termed N-methyl-D-aspartate (NMDA) receptor Activation of NMDA receptors increases sodium and calcium conductance, which depolarizes the neuron, thereby increasing the likelihood that it will fire an action potential NMDA receptors are widely distributed throughout the brain, with a particularly high density in the cerebral cortex and hrppocampal formation Molecular cloning has revealed the existence in mammalian brains of two classes of glycine transporters, termed GlyT-1 and GlyT-2 GlyT-1 is found predominantly in the forebram. and its distribution corresponds to that of glutamatergic pathways and NMDA receptors (Smith, et al , Neuron, 8, 927-935 ( ^] 992)) Molecular cloning has further revealed the existence of three variants of GlyT- 1, termed GlyT-la, GlyT- lb and GlyT-lc (Kim, et al , Molecular Pharmacology. 45, 608-617 (1994)), each of which displays a unique distribution in the brain and peripheral tissues These vaπants arise by differential splicing and exon usage, and differ in their N-terminal regions GlyT-2. m contrast, is found predominantly in the brain stem and spinal cord, and its distribution corresponds closely to that of strychnine-sensitive glycine receptors (Liu et al , J_ Biological Chemistry. 268, 22802-22808 (1993), Jursky and Nelson, J Neurochemistrv. 64, 1026- 1033 ( 1995 )) These data are consistent with the view that, by regulating the synaptic levels of glycine, GlyT-1 and GlyT-2 selectively influence the activity of NMDA receptors and strychnine-sensitive glycine receptors, respectively Compounds that inhibit or activate glycine transporters would thus be expected to alter receptor function, and provide therapeutic benefits in a variety of disease states For example, inhibition of GlyT-2 can be used to diminish the activity of neurons having strychnine-sensitive glycine receptors via increasing synaptic levels of glycine. thus diminishing the transmission of pain-related (l e , nociceptive) information in the spinal cord, which has been shown to be mediated by these receptors Yaksh, Pain, 37, 1 1 1-123 (1989) Additionally, enhancing inhibitory glycinergic transmission through strychnine-sensitive glycine receptors in the spinal cord can be used to decrease muscle hyperactivity, which is useful in treating diseases or conditions associated with increased muscle contraction, such as spasticity, myoclonus, and epilepsy (Truong et al , Movement Disorders. 3, 77-87 (1988), Becker, FASEB J . 4. 2767-2774 (1990)) Spasticity that can be treated via modulation of glycine receptors is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury, dystonia, and other conditions of illness and injury of the nervous system

NMDA receptors are critically involved in memory and learning (Rison and Stanton, Neurosci Biobehav Rev . 19. 533-552 (1995), Danysz et al Behavioral Pharmacol 6. 455-474

(1995)), and. furthermore, decreased function of NMDA-mediated neurotransmission appears to underlie, or contπbute to. the symptoms of schizophrenia (Obey and Farber Archives General Psychiatry. 52, 998-1007 (1996) Thus, agents that inhibit GlyT-1 and thereby increase glycine activation of NMDA receptors can be used as novel antipsychotics and anti-dementia agents, and to treat other diseases in which cognitive processes are impaired, such as attention deficit disorders and organic brain syndromes Conversely, over-activation of NMDA receptors has been implicated in a number of disease states, in particular the neuronal death associated with stroke and possibly neurodegenerative diseases, such as Alzheimer's disease multi-mfarct dementia, AIDS dementia, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis or other conditions in which neuronal cell death occurs, such as stroke or head trauma Covle &

Puttfarcken, Science. 262, 689-695 (1993), Lipton and Rosenberg, New Engl J of Medicine. 330 613-622 (1993), Choi, Neuron. I, 623-634 (1988) Thus, pharmacological agents that increase the activity of GlyT- 1 will result in decreased glycme-activation of NMDA receptors, which activity can be used to treat these and related disease states Similarly, drugs that directly block the glycine site on the NMDA receptors can be used to treat these and related disease states SUMMARY OF THE INVENTION

By the present invention, a class of compounds has been identified that inhibit glycine transport via the GlyT-1 or GlyT-2 transporters, or are precursors, such as pro-drugs, to compounds that inhibit such transport, or are synthetic intermediates for prepaπng compounds that inhibit such transport Thus, the invention provides a class of compounds formula

or a pharmaceutically acceptable salt thereof, wherein

(1 ) X is nitrogen or carbon, and R^ is not present when X is nitrogen. (2) R ² (a) is hvdrogen, (C 1 -C6) alkyl, (C 1 -C6) alkoxy, cyano, (C2-C7) alkanoyl. aminocarbonyl, (C 1 -C6) alkylaminocarbonyl or dialkylaminocarbonyl wherein each alkyl is independently CI to C6, (b) compπses (where R^ is not aminoethylene -O-R ⁸ or -S-R ⁸ *)

hydroxy, fluoro. chloro. bromo or (C2-C7) alkanoyloxy. (c) forms a double bond with an adjacent carbon or nitrogen from one of either R\ R ^x " or R ^VD , or (d) is R ^2a linked by R ^2b to X.

(2') R ^x is R ^xa linked by R ^xb to X,

(2") RY is R ^va linked by Ry ^b to X, (2 ¹ ") R ^xa , Ry ^a and R ^2a , are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring having from 0 to 2 heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, wherein

(a) aryl is phenyl or naphthyl,

(b) heteroaryl compπses a five-membered ring, a six-membered ring, a six-membered πng fused to a five-membered ring, a five-membered πng fused to a six-membered nng. or a six-membered πng fused to a six-membered πng, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon,

(c) each of R ^xa , Ry ^a and R ^2a can be independently substituted with one of R ^Q , R ^r O- or R ^S S-, wherein each of R9, R ^r and R ^s are independently aryl. heteroaryl, adamantyl or a 5 to 7-membered non-aromatic πng as these πng structures are defined for R ^xa , and

(d) R ^xa . Ry ^a . R ^2a , RI, R ^r and R ^s can be additionally substituted with one or more substituents selected from the group consisting of fluoro, chloro. bromo. nitro, hydroxy. cyano. trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, adamantyl, (C1-C 12) alkyl, (C1 -C12) alkenyl, amino, (C1-C6) alkylamino, dialkylamino wherein each alkyl is independently C I to C6, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, trifiuoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be substituted for hydrogen with up to two independent

(C1-C6) alkyl, (C1-C6) alkyisulfonyl, amidino that can independently substituted with up to three (C 1 -C6) alkyl. or methylenedioxy or ethylenedioxy with the two oxygens bonded to adjacent positions on the aryl or heteroaryl nng structure, which methylenedioxy or ethylenedioxy can be substituted with up to two independent (C1-C6) alkyl. wherein

(ι ) the substitutions of R ^xa . Ry ^a and R ^2a can be combined to form a second bπdge between two of R ^xa , Ry ^a and R ^2a comprising (1) (C 1-C2) alkyl

or alkenyl. which can be independently substituted with one or more (C 1 - C6) alkyl, (2) sulfur, (3) oxygen (4) amino. which can be substituted for hydrogen with one (C1-C6) alkyl. (5) carbonyl, (6) -CH ₂ C(=0)-. which can be substituted for hydrogen with up to two independent (C 1 -C6) alkyl, (7) -C(=0)-0-, (8) -CH ₂ -0-. which can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (9) -C(=0) N(R ²⁴ ) , wherein R ²⁴ is hydrogen or (C1-C6) alkyl, (10) -CH ₂ -NH-, which can be substituted for hydrogen with up to three (C1-C6) alkyl. or (1 1) -CH=N-. which can be substituted for hydrogen with (C 1 -C6) alkyl. or wherein two of R ^xa , Ry ^a and R ^2a can be directly linked by a single bond.

(2' ^v ) R ^xb and R ² " are independently a single bond or (C 1-C2) alkylene,

(2 ^V ) R ^vb is a single bond, oxa, (C 1 -C2) alkylene, ethenylene or -CH= (where the double bond is with X), thia. methyleneoxy or methylenethio. or either -N(R^) or -CH ₂ -N(R6*)-. wherein R^ and R^ are hydrogen or (C1-C6) alkyl, wherein when X is nitrogen X is not bonded to another heteroatom,

(3) R* compπses a straight-chained (C2-C3) aliphatic group, where X is carbon.

=N-0-(ethylene), wherein the unmatched double bond is linked to X, (where X is carbon and Ry ^b does not include a heteroatom attached to X). -0-R ⁸ or -S-R ⁸ wherein R ⁸ or R ⁸ is a ethylene or ethenylene and O or S is bonded to X, (where X is carbon and Ry° docs not include a heteroatom attached to X). ammoethylene where the amino is bonded to X wherein R ' can be substituted with up to one hydroxy, up to one (C 1-C6) alkoxy or up to one (C2-C7) alkanoyloxy, with up to two independent (C1-C6) alkyl. with up to one oxo, up to one (C 1 -C6) alkylidene. with the proviso that the hydroxy. alkoxy. alkanoyloxy or oxo substituents are not bonded to a carbon that is bonded to a nitrogen or oxygen, wherein the alkyl or alkylidene substituents of R* can be linked to form a 3 to 7- membered non-aromatic πng. and wherein if X is nitrogen. X is linked to R' by a single bond and the terminal carbon of R^ that links R' to N IS saturated, (4) R3 (a) is hydrogen, (C1-C6) alkyl. or phenyl or phenylalkyl wherein the alkyl is C I to C6 and either such phenyl can be substituted with the same substituents defined above for the aryl or

heteroarvl of R ^xa . (b) is -R ¹² Z(R ^xx )(Ryy)(R ^{! l} ). wherein R ¹² is bonded to N. Z is independenth the same as X. R ^xx is independently the same as R ^x , Ry>' is independently the same as R ^% . R " is independently the same as R ² and R ¹² is independently the same as R'. or (c) forms, together with R ⁴ . a nng C. as follows

, wherein R4* IS hydrogen when ring C is present,

(5) n is 0 or 1 , and where if n is 1 , R ³ is either (C 1 -C6) alkyl (with the attached nitrogen having a positive charge) or oxygen (forming an N-oxide) and X is carbon,

(5') Q together with the illustrated πng nitrogen and ring carbon beanng R^ form πng C, wherein ring C is a 3 to 8-membered ring, a 3 to 8-membered πng substituted with a 3 to 6- membered spiro ring, or a 3 to 8-membered πng fused with a 5 to 6-membered nng. wherein the fused nng lacking the illustrated ring nitrogen can be aromatic or heteroaromatic, wherein for each component ring of nng C there are up to two heteroatoms selected from oxygen, sulfur or nitrogen. including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens other than the illustrated nitrogen, with the proviso that, in saturated rings. πng mtrogen atoms are separated from other πng heteroatoms by at least two intervening carbon atoms wherein the carbon and nitrogen πng atoms of πng C can be substituted with substituents selected from (C1-C6) alkyl. (C2-C6) alkenylene. cyano, nitro, tπfluoromethyl, (C2-C7) alkyloxycarbonyl, (C 1-C6) alkylidene, hydroxyl, (CI - C6) alkoxy, oxo, hydroxycarbonyl, aryl wherein the aryl is as defined for R ^xa or heteroaryl wherein the heteroaryl is as defined for R ^xa . with the proviso that ring atoms substituted with alkylidene, hydroxycarbonyl or oxo are carbon, with the further proviso that πng atoms substituted with hydroxyl or alkoxy are separated from other nng heteroatoms by at least two intervening carbon atoms,

(6) R ⁴ and R ⁴ * are independently hydrogen or (C 1 -C6) alkyl. or one of R ⁴ and R ⁴ can be

(C1-C6) hydroxyalkyl, and

(7) R ⁵ is (CO)NR ¹³ R ¹⁴ , (CO)OR ¹⁵ . (CO)SR ¹⁶ , (S0 ₂ )NR ¹⁷ R ^{1 8} , (PO)(OR ¹⁹ )(OR ²⁰ ).

(CR ²² )(OR ²³ )(OR ²⁴ ). CN or tetrazol-5-yl wherein R ¹³ , R ¹⁴ . R ¹⁵ , R ¹⁶ , R ^{1 7} , R ^{1 8} R ^{1 9} and R ² ° are independently hydrogen, (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of Rl-> or the sulfur of R'" has no more than secondary branching and , (C2-C6) hydroxyalkyl, aminoalkyl where the alkyl is C2 to C6 and the amino can be substituted with up to two independent (C1-C6) alkyls, arylalkyl wherein the alkyl is C1-C6. heteroarylalkyl wherein the alkyl is CI to C6. aryl or heteroaryl, R ²² is hydrogen or OR ² ^ and R ²³ . R ²⁴ and R ²⁵ are (C 1-C6) alkyl, phenyl. benzyl, acetyl or, where R ²² is hydrogen, the alkyls of R ²³ and R ²⁴ can be combined to mclude 1.3-dιoxolane or 1,3-dιoxane wherein the aryl is phenyl or naphthyl and the heteroaryl is a five-membered nng, a six- membcred πng, a six-membered ring fused to a five-membered ring, a five- membered ring fused to a six-membered πng, or a six-membered ring fused to a six-membered πng, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon, wherein the aryl, heteroaryl, aryl or arylalkyl or the heteroaryl of heteroarylalkyl can be substituted with [preferably up to three] substituents selected from the group consisting of fluoro, chloro. bromo, nitro. cyano. hydroxy, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C6) alkyl, (C2-C6) alkenyl, (C1-C6) alkylamine. dialkylamine wherein each alkyl is independently CI to C6, ammo, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy. tπfluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be N-substituted with up to two independent (C1-C6) alkyl, (C 1-C6) alkyisulfonyl, amidino that can substituted with up to three (C1-C6) alkyl, or methylenedioxy or ethylenedioxy with the two oxygens bonded to adjacent positions on the aryl or heteroaryl nng structure, which methylenedioxy or ethylenedioxy can be substituted with up to two independent (C 1-C6) alkyl, and wherein R' ³ and R* ⁴ together with the nitrogen can form a 5 to 7-membered nng that can contain one additional heteroatom selected from oxygen and sulfur

In a preferred embodiment, the ring Q is a 4 to 8-membered πng that includes the illustrated ring nitrogen, with the remaining ring atoms being carbon

Preferably, (A) at least one of R ^xa . R ^Va and R ^2a is substituted with fluoro. chloro, bromo. hydroxy. trifluoromethyl, tπfluoromethoxy, nitro, cyano, (C3-C8) alkyl, R ^Q . R ^r O-, R ^S S- (B) R ³ is hydrogen, (C 1 -C6) alkyl, or phenyl or phenylalkyl wherein the alkyl is C 1 to C6 and either such phenyl can be substituted with the same substituents defined for the aryl or heteroaryl of R ^xa or (C) the ring stuctures of R ^xa , Ry ^a and R ^2a , including substituents thereto, otherwise include at least two aromatic ring structures that together include from 15 to 20 ring atoms Examples of preferred structures under clause (C) include A45, A53. A56, A57. A60-5. A73-74. A78-81, A86-89, A93-96, A99, AlOO, A102, A105-106. A108-109. Al 16, A122-123 and A176

Preferably, at least one of R ^λa , Ry ^a and R ^2a is substituted with fluoro, tπfluoromethyl, tπfluoromethoxy, nitro. cyano, or (C3-C8) alkyl Preferably. R ^xa , R> ^a and R ^2a is substituted with RI. R ^r O-, or R ^S S- Preferably, an aryl or heteroaryl of at least one of R ^xa . Ry ^a and R ^2a is phenyl Preferably, Ry ^b is oxa, methyleneoxy, thia. methylenethia Preferably. Ry° is oxa or thia Preferably. R ⁵ is (CO)NR ¹³ R ¹⁴ , (CO)OR ¹⁵ or (CO)SR ¹⁶

In one embodiment, R'* is (C2-C6) alkyl, (C2-C4) hydroxyalkyl. phenyl. phenylalkyl wherein the alkyl is C1-C3, or aminoalkyl where the alkyl is C2-C6 and the amino can be substituted with up to two independent (C1-C3) alkyls, wherein the phenyl or the phenyl of phenylalkyl can be substituted as recited above Preferably, n is zero Preferabh . Rl5 is hydrogen Preferably, R ⁴ is hydrogen, methyl or hydroxymethyl and R ⁴ is hydrogen

Preferably, at least one of R ^xa , Ry ^a and R ^2a is a heteroaryl compnsing diazolyl. tπazolyl, tetrazolyl, thiazolyl. isothiazolyl, oxazolyl, isoxazolyl, thiolyl, diazinyl. tπazinyl. benzoazolyl, benzodiazolyl, benzothiazolyl, benzoxazolyl, benzoxolyl. benzothiolyl, qumolyl. isoquinolyl, benzodiazinyl, benzotnazinyl, pyridyl, thienyl, furanyl, pyπolyl, indolyl. isomdoyl or pyπmidyl Preferably, R ¹ is -0-R ⁸ or -S-R ⁸ * Preferably, the second bridge between two of R* ³ . Ry ^a and

R ^2a (of Section (2 ^n, )(d)(ι )) is L, and satisfies the following formula

. wherein A and B are aryl or heteroaryl groups of R ^xa and R ^va . respectiveh Preferably. Rxa. _R xb._ Rya. _R yb. _{and x} f _orm

wherein Y is a carbon bonded to R' by a single or double bond or a nitrogen that is bonded to R' and wherein R ² ' either (i.) completes a single bond linking two aryl or heteroaryl nngs of R ^x and Ry. (ii.) is (C 1-C2) alkylene or alkenylene, (iii.) is sulfur or (iv.) is oxygen, and wherein R ^x and Ry can be substituted as set forth above Preferably, R ²¹ is CH ₂ CH ₂ or CH=CH Preferably, the alkylenedioxy substitution of R ^xa , Ry ^a . R ^2a , RI, R ^r or R ^s is as follows

wherein the alkylenedioxy can be substituted with up to two independent (C 1 -C3) alkyl

In one preferred embodiment, R ^xa and Ry ^a together can be substituted with up to six substituents, R ^2a . RI, R ^r and R ^s can each be substituted with up to 3 substituents. and wherein the presence of each of R ^Q . R ^r or R ^s is considered a substitution to the respective ring structure of Rxa Rya ^j R2a Preferably, a phenyl of R ³ is substituted with up to three substituents Preferably, the compound is an optically pure enantiomer (l e , at least about 80% ee. preferably at least about 90% ee. more preferably at least about 95% ee) Preferably, the compound is part of a pharmaceutical composition comprising a pharmaceutically acceptable excipient Preferably, the compound of the composition is present in an effective amount for

( 1 ) treating or preventing schizophrenia,

(2) enhancing treating or preventing dementia,

(3) treating or preventing epilepsy,

(4) treating or preventing spasticity,

(5) treating or preventing muscle spasm,

(6) treating or preventing pain,

(7) preventing neural cell death after stroke,

(8) preventing neural cell death in an animal suffering from a neurodegenerative disease

(9) treating or preventing mood disorders such as depression, (10) enhancing memory or learning, or

(1 1) treating or preventing learning disorders In another embodiment, the invention provides a method (1) of treating or preventing schizophrenia compnsmg administering a schizophrenia treating or preventing effective amount of a compound, (2) of treating or preventing dementia comprising administenng a dementia treating or preventing effective amount of a compound, (3) of treating or preventing epilepsy comprising administering an epilepsy treating or preventing effective amount of a compound, (4) of treatmg or preventing spasticity comprising administering a spasticity treating or preventing effective amount of a compound, (5) of treating or preventing muscle spasm comprising administenng a muscle spasm treating or preventing effective amount of a compound, (6) of treating or preventing pain comprising administering a pain treating or preventing effective amount of a compound, (7) of preventing neural cell death after stroke comprising administering a neural cell death preventing effective amount of a compound, (8) of preventing neural cell death in an animal suffeπng from a neurodegenerative disease, (9) treating or preventing mood disorders such as depression, ( 10) enhancing memory or learning, or ( 1 1 ) treating or preventing learning disorders, comprising administering an amount effective for said treating, preventing or enhancing of a compound of formula XI or a pharmaceutically acceptable salt thereof wherein the substituents are as defined above, except that R ²³ differs from R' in that it can be a straight-chained C4 aliphatic group Preferably, the spasticity treated or prevented is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury or dystonia Preferably, the neurodegenerative disease treated or prevented is Alzheimer's disease, multi-infarct dementia, AIDS dementia. Parkinson's disease. Huntington's disease, amyotrophic lateral sclerosis or stroke or head trauma (such as can result m neuronal cell death)

In another embodiment, the invention provides a method of synthesizing a compound of the invention compπsing A) reacting a compound of one of the following formulas

1)

^R 1

R* ^X 1 ^ ^L

/ R ^y

, wherein L* is a nucleophilic substitution leaving group, with a compound of the formula

2)

or B) reacting a compound of the formula

1)

. with a compound of the formula

2)

. wherein L ² is a nucleophilic substitution leaving group In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising

A) reductively alkylating a compound of the formula

1)

with a compound of the formula

2)

R\

\ /

X -0

/ R ^y

. where R^ differs from R' in that it lacks the carbon that is part of the illustrated aldehyde carbonyl, OR B) reductively alkylating a compound of the formula

1)

with a compound of the formula

2)

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising reductively alkylating R^NH ₂ with a compound of the formula

. wherein R" and R ^c are independently the same as defined for R ^x , and wherein R ² ' has the same definition as R' except that it does not include a nitrogen, oxygen or sulfur and does not include any double bonds conjugated with the above-illustrated carbonyl

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising reacting R ^f OH or R^SH with a compound of the formula

to form an ether or a thioether. respectively, wherein Rf and Rf" are independently the same as defined for R ^x . wherein R ² ' has the same definition as R' except that it does not include a

nitrogen, oxygen or sulfur and does not include any double bonds at the atom bonded to the above- illustrated L ⁵ -substιtuted carbon and wherein L ^* is a nucleophilic substitution leaving group

The method of claim 28. further comprising synthesizing the compound of formula

by replacing the hydroxyl of formula

with another nucleophilic substitution leaving group Preferably, the method comprises reacting a compound of formula

with an azodicarboxylate in the presence of a phosphine compound

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising reacting R ^e M with a compound of the formula

to form a compound of the formula

. wherein R ^e is independently the same as defined for R\ wherein M is a metal -containing substituent such that R ^e M is a organometalhc reagent

In another embodiment, the invention provides a method of synthesizing a compound of the invention compnsing dehydrating a compound of the formula

to form a compound of the formula

wherein C (the tertiary carbon marked with an adjacent "*") has a double bond with an ad _j acent carbon, R ²⁸ and R ²⁸ have the same definition as R^ except that R2 ⁸ * and R ²⁸ do not include a heteroatom

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising reducing a compound of the formula

wherein C has a double bond with an adjacent carbon and R ^c is independently the same as defined for R ^x , to form a compound of the formula

In another embodiment, the invention provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing the compound of formula

with a compound of formula

with a compound of formula

, wherein L ³ is a nucleophilic substitution leaving group

In another embodiment, the invention provides a method of synthesizing of a compound of the invention, the method comprising reacting a compound of formula

with Ar-Q wherein Ar is aryl which is substituted with an electron-withdrawing group or heteroaryl which is substituted with an electron-withdrawing group, and wherein Q is hahde (preferably fluoro or chloro), to form

In another embodiment, the invention provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing a compound of formula X

_R d S0 ₂ Ar

X

b\ reacting a compound of formula

with R ^d NHS0 ₂ Ar The method can further comprise converting the compound of formula X to

In another embodiment, the invention provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising reacting a compound of formula

with a compound of formula

to form a compound of formula

In another embodiment, the invention provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing the compound of formula

said synthesis comprising reducing the ketone of a compound of formula

BRIEF DESCRIPTION OF THE DRAWING

Figure 1 depicts several reactions that can be employed in the synthesis of the compounds of the invention

Figure 2 depicts representative syntheses utilized in making compounds of the invention Figure 3 shows additional representative syntheses utilized in making compounds of the invention

Figure 4 shows additional representative syntheses utilized in making compounds of the invention DEFINITIONS

The following terms shall have the meaning set forth below ♦ excipient

Excipients are pharmaceutically acceptable organic or inorganic carrier substances suitable for parenteral, enteral (e g . oral or inhalation) or topical application that do not deleteπously react with the active compositions Suitable pharmaceutically acceptable earners include but are not limited to water, salt solutions, alcohols, gum arable, benzyl alcohols, gelatine, carbohydrates such as lactose, amylose or starch, magnesium stearate. talc, silicic acid, hydroxymethylcellulose, polyvinylpyrrohdone, and the like ♦ effective amount

The meaning of "effective amount" will be recognized by clinicians but includes amount effective to (1) reduce, ameliorate or eliminate one or more symptoms of the disease sought to be treated, (2) induce a pharmacological change relevant to treating the disease sought to be treated, or (3) prevent or lessen the frequency of occurrence of a disease

♦ neuronal cell death prevention

Neuronal cell death is "prevented" if there is a reduction in the amount of cell death that would have been expected to have occurred but for the administration of a compound of the invention ♦ oxo substitution

References to oxo as a "substituent" refer to "=0" substitutions DETAILED DESCRIPTION

The compounds of the invention are generally prepared according to one of the following synthetic schemes, although alternative schemes will be recognized by those of ordinary skill Reaction 1

Reaction 2

In Reaction 1 or Reaction 2, L ' and L ² are good nucleophilic substitution leaving groups such as a hahde, especially a bromide, a tosylate. a brosylate (p-bromobenzenesulfonate). and the like The reaction is preferably conducted in the presence of a base such as potassium carbonate or a tertiary amme such as diisopropylethylamine Where the leaving group is a hahde. the reaction is preferably conducted m the presence of an iodide salt such as potassium iodide Suitable organic solvents include, for example, methanol. dioxane. acetonitπle or dimethyformamide Reaction 1 is

favorably conducted at a temperature range of about 50°C to about 100°C Reaction 2 is favorably conducted at a temperature range of about 15°C to about 40°C Avoiding more elevated temperatures helps decrease the formation of additional alkylation products Those of ordinary skill will recognize that reaction 2 should be conducted with compounds that lack ring C Reaction 3

Reaction 4

In Reaction 3, R' satisfies the definition of R' except for the absence of the carbon that is part of an aldehyde group in the starting mateπal The reductive alkylation of Reaction 3 or Reaction 4 can be effected by several known methods (see. for example. "Reductive Alkylation," W S Emerson m Organic Reactions. Vol 4, John Wiley & Sons, 1948, p 174 et seq ) including reaction with hydrogen in the presence of a catalyst such as palladium on carbon, reaction with sodium cyanoborohydride or reaction with sodium triacetoxyborohydride when groups labile to catalytic hydrogenation are present It will be recognized that an intermediate Schiff s base is formed in the reaction, which Schiff s base is reduced to form the linkage The intermediate Schiffs base can be isolated and then reduced m a separate reaction Solvent selection will vary with such factors as the solubility of the starting materials, the degree to which the solvent favors the dehydration reaction forming the Schiffs base, and the suitability of the solvent in the reduction process Suitable solvents using catalytic hydrogenation to reduce the Schiffs base include ethanol Suitable solvents using a borohydπde to reduce the Schiffs base include alcoholic solvents such as methanol or ethanol ln some cases, a drying process can be employed during the

reaction to promote the dehydration reaction that forms the Schiffs base that is reduced Such drying processes include refluxing under conditions selected to remove water as an azeotrope or the use of molecular sieves or other drying reagents Suitable reaction temperatures include the range from about 20°C to the reflux temperature of the solvent employed In Reaction 5, shown in Figure 1 , R ^c is independently the same as defined for R ^x The starting material I can be synthesized, for instance, using the chemistry of Reaction 13 (similar to Reaction 1). as follows

Reaction 13:

, wherein R ² ' has the same definition as R* except that it does not include a nitrogen, oxygen or sulfur and does not include any double bonds conjugated with the above-illustrated carbonyl. and wherein L ³ is a good nucleophilic substitution leaving group such as a hahde, especially a bromide, a tosylate, a brosylate (p-bromobenzenesulfonate), and the like In Reaction 5 shown in

Figure 1, R ^d -NH ₂ is reacted with I to give II under conditions that effect a reductive alkylation, as descnbed for Reaction 3 and Reaction 4 R" is independently the same as defined for R ^x

Alternatively, II can be synthesized via Reaction 18 by reacting R ^d -NH ₂ with VIII under the conditions descnbed for Reaction 1

In Reaction 6, shown in Figure 1. R ^e is independently the same as defined for R ^x In Reaction 6, I is reacted with a organometallic reagent such as an aryllithium or an aryl or arylalkyl Gngnard reagent to form III, as described, for instance, m Section 5 1 2 of Cary and Sundberg. Advanced Organic Chemistry, Part 2. Plenum. New York. 1977, pp 170 -180. and references cited therein This reaction is described below in more detail for the synthesis of compound A32

(step 2 of Example 5A) Those of ordinary skill will be aware that in some cases where R^ includes an ester, the organometallic reagent may react with the ester group, in those such cases where the yield of the desired product is too low, the solvent, the organometallic reagent or the ester substitution can be varied In Reaction 7, shown in Figure 1, III is subjected to conditions suitable for dehydration to form the double bond of IV Such conditions are, for instance, those described m H Weiland, Ber 45 484 et seq (1912). wherein III is refluxed with acetic anhydride In the illustration, the double bond forms with the adjacent carbon atom of R ² ^ The double bond will typically form with this orientation where R ^c and R ^e are aryl or heteroaryl and the adjacent carbon of R ² ^ is saturated and not fully substituted, but other orientations are possible depending on the composition of R ^c , R ^e and R ² '

In Reaction 8, shown in Figure 1, IV is reduced to form V, for instance using any of a number of known methods for reducing carbon-carbon double bonds, such as catalytic hydrogenation in the presence of an appropnate hydrogenation catalyst An example of this process is described below for compound A4 (Example 10)

In Reaction 9, shown in Figure 1, III is acylated, for instance with acetic anhydπde in the presence of an acylation catalyst such as 4-dιmethylamιnopyndιne In this context. R ³ should not be hydrogen, though a hydrogen substituent can be restored to this position after Reaction 9 by using a suitable protecting group to mask the nitrogen In Reaction 10, shown in Figure 1 , the ketone moiety of I is reduced, for instance by any of a number of known methods for selectively reducing ketones. such as reaction with lithium tπ-terf-butoxyaluminohydnde An example of this process is described below for the preparation of compound A31 (step 1 of Example 8A)

For Reaction 11, shown m Figure 1. the hydroxyl of VII is replaced by a leaving group L ³ . wherein the leaving group is, for instance, chloro or bromo. by reacting VII with, for instance, thiom 1 chloride or thionyl bromide An example of this process is descnbed below for the preparation of compound A31 (step 2 of Example 8A)

For Reaction 12, shown in Figure 1. Rf is independently the same as defined for R ^x VIII is reacted with R'OH in the presence of a base such as potassium carbonate or sodium hydride Alternatively, the thio-containmg analog of IX can be synthesized by reacting VIII with R%H An example of this process is descnbed below for the synthesis of compound A31 (step 3 of Example 8 A) The transformations of Reactions 1 1 and 12 can be conducted in a single pot, for

mstance by a Mitzunobu reaction such as described in Examples 8C. Step 1 and 8D. Step 2 Alternatively. VII can be directly reacted with an aryl hahde or chloride, preferably an aryl fluoride or chlonde, to form IX. such as is described in U S Patent Nos 5.166.437 and 5,362.886 It will be recognized that typically the aryl hahde used in this reaction will typically have an electron-withdrawing group that facilitates the reaction, such as a tnfluoromethyl or nitro group in the para position 1-fluoronaphthalene is also suitable for this reaction, since the ring fused to the fluoro-substituted nng is the electron withdrawing group

In reaction 19. VII is reacted with R ^d NHS0 ₂ Ar to yield X, as described for example in

Example 8C. Step 1 In reaction 20, X is coverted to II as described, for example, in Example 8C. Step 2

A number of other well-known synthetic approaches can be applied For instance, acids can be formed by the hydrolysis of the corresponding esters Amme derivatives can be formed by the alkylation of primary, secondary or tertiary amines A number of double bond containing compounds can be hydrogenated to form the corresponding single bond The N -oxide compounds of the invention are typically formed from the corresponding tertiary nitrogen by known methods

In some cases, the chemistries outlined above may have to be modified, for instance by use of protective groups, to prevent side reactions due to reactive groups, such as reactive groups incoφorated into heterocychc rings or attached as substituents

Compounds of the invention may also be prepared by adapting the classical solution chemistries outlined above into solid-phase synthetic techniques For example, R ' ³ , R' ^* , R' ",

R ¹⁷ and R ²⁰ can be residues other than hydrogen representing functionahzed resin or suitably selected linker attached to functionahzed resin The linker and the functional group represented by

R^ should be stable under the conditions employed for the above-descnbed reactions The compounds of the invention where R^ ³ , R'^. R^, R' ' is R ² ^ is hydrogen, are then cleaved from the resin or the linker leaving the remainder of the molecule intact For example, solid-phase synthesis of peptoids [ohgo(N -substituted glycines)] using robotic synthesizer was descnbed by Zuckermann et al . J Am Chem Soc . 114. 10646-10647, (1992) and Spellmeyer et al , WO 95/04072 Under analogous conditions, acylation reaction of Rink amide polystyrene resin with bromoacetic acid in the presence of N.N ^' -dusopropylcarbodumide followed by displacement of the bromine with N-substituted amine (Reaction 2) and cleavage can provide N-substituted glycmamides (R^ ³ and R^ ⁴ are hydrogen)

Using the reactions descnbed herein, including hydrolysis of esters, alkylation of amines, or hydrogenation reactions, the following compounds of the invention have been synthesized

- 38

Compound A12 is a bis-alkylation byproduct of the synthesis of A9 using reaction I The compounds of the invention that incorporate =N-0- can be prepared, for example, by alkylating an amine (such as sarcosme or glycme) with 0-(2-halogenethyl)alkanone oximes. which can be prepared bv condensing alkanones with hydroxylamme, followed by 0-alk\ lation (such as with 1.2-dιhaloethane)

It will be recognized that numerous salt forms of the compounds herein descnbed are available and suitable for use in the invention or during the synthesis of compounds of the invention The invention contemplates that in certain instances where stereoisomers are available that one such isomer can be more active than another, m such a case, it will be desirable to isolate the particular isomenc form The invention, of course, encompasses both the particular stereoisomers and racemic mixtures As descnbed herein, chemical approaches, starting with for example commercially available, optically pure starting materials (or made usmg enantioselective reactions), can also used to synthesize optically pure versions of the compounds of the invention It will be recognized that such optically pure compounds are within the invention Enantiomeπc excess ("ee") can be enhanced by punfication techniques such as crystallization or chromatography on chiral supports Enantiomeπc excess can be quantitated by a number of

anaiytic techniques including NMR, optical rotation measurements and appropriate chromatography

Additional, related compounds are described in two U S Patent Applications were filed concurrently with a parent hereof as U S Seπal No 08/655,912 (Docket No 317743- 106. Ognyanov et al ). U S Serial No 08/655,847 (Docket No 317743-107, Ognyanov et al ), U S Serial No 08/807.682 (PHARMACEUTICAL FOR TREATMENT OF NEUROPSYCHIATRIC AND NEUROLOGICAL DISORDERS, Docket No 317743-106A, Ognyanov et al ) and U S Seπal No 08/807.681 (PHARMACEUTICAL FOR TREATING OF NEUROLOGICAL AND NEUROPSYCHIATRIC DISORDERS, Docket No 317743-107A, Ognyanov et al In a preferred embodiment, at least one of the following applies if Rl5 IS hydrogen and R^ is propylene, then at least one [preferably at least two, more preferably at least three] of the following applies (1) both R ^x and R> are not /^-fluorophenyl, (2) one of R ^x and Ry includes a heteroaπl, (3) R ^v is arylalkyl, heteroarylalkyl, aryloxy. heteroaryloxy, arylmethoxy. heteroarylmethoxy, arylthio, heteroarylthio, arylmethylthio, heteroarylmethylthio, Ar-N(R ⁶ )- or Ar-CH ₂ -N(R ⁶ *)-, (4) R ² is R ^xa R ^xb -,

(5) R ² is not hydrogen, (6) R ³ is not hydrogen, (7) n is one, or (8) R ³ and

R ⁴ form πng Q, if R'- ⁵ is hydrogen and R' is ethylene or X-R^ is prop-1-enylene, then at least one [preferably at least two. more preferably at least three] of the following applies ( 1 ) an aryl of at least one of R ^x and R ^v is substituted with a radical different from hydrogen, (2) one of R ^x and Ry comprises a heteroaryl, (3) RV is arylalkyl. heteroarylalkyl, aryloxy. heteroaryloxy, arylmethoxy heteroarylmethoxy, arylthio, heteroarylthio, arylmethylthio, heteroarylmethylthio, Ar-N(R ⁶ )- or Ar-CH ₂ -N(R ⁶ *)-, (4) R ² is R ^xa R ^xb -.

(5) R ² is not hydrogen, (6) R ³ is not hydrogen, (7) n is one, or (8) R ³ and R ⁴ form ring Q. if R- ⁵ is C(0)NH ₂ . then at least one [preferably at least two, more preferably at least three] of the following applies ( 1 ) an aryl of at least one of R ^x and R> is substituted with a radical different from hydrogen, (2) one of R ^x and Ry comprises a heteroaryl, (3) Ry is arylalkyl. heteroarylalkyl. aryloxy.

heteroaryloxy. arylmethoxy. heteroarylmethoxy. arylthio. heteroarylthio. arylmethylthio, heteroarylmethylthio. Ar-N(R ⁶ )- or Ar-CH ₂ -N(R ⁶ *)-, (4) R ² is R ^xa R ^xb -, (5) R ² * is not hydrogen, (6) R ³ is not hydrogen, (7) n is one, (8) R' is not ethylene. or (9) R ³ and R ⁴ form ring Q, if R* ³ is hydrogen and R' ⁴ IS (3.4-dιhydro-2H-l-benzopyran-4-yl)methylene. then at least one [preferably at least two, more preferably at least three] of the following applies (1) an aryl of at least one of R ^x and Ry is substituted with a radical different from hydrogen, (2) one of R ^x and R compnses a heteroaryl,

(3) Ry is arylalkyl, heteroarylalkyl, aryloxy, heteroaryloxy, arylmethoxy, heteroarylmethoxy, arylthio, heteroarylthio, arylmethylthio, heteroarylmethylthio, Ar-N(R ⁶ )- or Ar-CH ₂ -N(R ⁶ *)-, (4) R ² is R ^xa R ^xb -,

(5) R ² is not hydrogen, (6) R ³ is not ethyl, (7) n is one, or (8) R ³ and R ⁴ if R ² is phenyl, /?-methylphenyl or /7-methoxyphenyl, then at least one [preferably at least two, more preferably at least three] of the following applies ( 1 ) the aryls of R ^x and Ry are not substituted with p-methylphenyl or /?-methoxyphenyl,

(2) an aryl of at least one of R ^x and R>' is substituted with a radical different from hydrogen, (3) one of R ^x and Ry compnses a heteroaryl, (4) Ry is arylalkyl, heteroarylalk} 1. aryloxy, heteroaryloxy. arylmethoxy. heteroarylmethoxy, arylthio. heteroarylthio, arylmethylthio, heteroarylmethylthio. Ar-N(R ⁶ )- or Ar-CH ₂ -N(R ⁶ *)-, (5) R ¹ is not aminoethylene, OR ⁸ or SR ⁸ , (6) n is one, or (7) R ³ and R ⁴ form nng Q In one preferred embodiment of the the methods, particularly treating or preventing epilepsy or spasticity or enhancing memory, the compound conforms with paragraph (f). above The glycme transporter genes and their respective gene products are responsible for the reuptake of glycine from the synaptic cleft into presynaptic nerve endings or glial cells, thus terminating the action of glycine Neurological disorders or conditions associated with improperly controlled glycine receptor activity, or which could be treated with therapeutic agents that modulate glycine receptor activity, include spasticity (Becker. FASEB Journal. 4, 2767-2774 (1990)) and pain realization (Yaksh, Pain. 37. 111-123 (1989)) Additionally, glycine mteracts at N-methyl-D-aspartate (NMDA) receptors, which have been implicated in learning and memory

disorders and certain clinical conditions such as epilepsy. Alzheimer's and other cognition-related diseases, and schizophrenia See Rison and Stanton. Neurosci Biobehav Rev . 19 533-552 (1995). Danysz et al . Behavioral Pharmacol . 6, 455-474 ( 1995)

Compounds that inhibit GlyT-1 mediated glycine transport will increase glycine concentrations at NMDA receptors, which receptors are located in the forebrain. among other locations This concentration increase elevates the activity of NMDA receptors, thereby alleviating schizophrenia and enhancing cognitive function Alternatively, compounds that interact directly with the glycme receptor component of the NMDA receptor can have the same or similar effects as increasing or decreasing the availability of extracellular glycine caused by inhibiting or enhancing GlyT-1 activity, respectively See, for example, Pitkanen et al , Eur J Pharmacol . 253, 125-129 (1994), Thiels et al , Neuroscience. 46, 501-509 (1992), and Kretschmer and Schmidt. J Neurosci . 16, 1561-1569 (1996) Compounds that inhibit GlyT-2 mediated glycine transport will increase glycine concentrations at receptors located pπmaπly in the brain stem and spinal cord, where glycine acts as an inhibitor of synaptic transmission These compounds are effective against epilepsy, pam and spasticity, myospasm and other such conditions See. for example. Becker, FASEB J . 4, 2767-2774 (1990) and Yaksh, Pain, 37, 11 1-123 (1989)

The compounds of the invention are, for instance, administered orally, subhngually, rectally. nasally, vagmally, topically (including the use of a patch or other transdermal delivery device), by pulmonary route by use of an aerosol, or parenterally, including, for example. intramuscularly, subcutaneously, intrapentoneally, mtraartenally, intravenously or mtrathecally Administration can be by means of a pump for periodic or continuous delivery The compounds of the invention are administered alone, or are combined with a pharmaceutically-acceptable carrier or excipient accordmg to standard pharmaceutical practice For the oral mode of administration, the compounds of the invention are used in the form of tablets, capsules, lozenges, chewing gum. troches, powders, syrups, elixirs, aqueous solutions and suspensions, and the like In the case of tablets, carriers that are used include lactose, sodium citrate and salts of phosphonc acid Various dismtegrants such as starch, and lubricating agents such as magnesium stearate and talc, are commonly used in tablets For oral administration in capsule form, useful diluents are lactose and high molecular weight polyethylene glycols If desired, certain sweetening and/or flavoπng agents are added For parenteral administration, sterile solutions of the compounds of the invention are usually prepared, and the pHs of the solutions are suitably adjusted and buffered For intravenous use. the total concentration of solutes should be controlled to render the preparation isotonic For ocular administration, ointments or droppable liquids may be delivered by ocular delivery systems known to the art such as applicators or eye droppers Such compositions can include

mucomimetics such as hyaluronic acid, chondroitin sulfate. hydroxypropyl methylcellulose or polyvinyl alcohol, preservatives such as sorbic acid. EDTA or benzylchroimum chloride, and the usual quantities of diluents and/or earners For pulmonary administration, diluents and/or earners will be selected to be appropriate to allow the formation of an aerosol Suppository forms of the compounds of the invention are useful for vaginal, urethral and rectal administrations Such suppositories will generally be constructed of a mixture of substances that is solid at room temperature but melts at body temperature The substances commonly used to create such vehicles include theobroma oil, glyceπnated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weight and fatty acid esters of polyethylene glycol See, Remington's Pharmaceutical Sciences, 16th Ed , Mack Publishing. Easton, PA, 1980, pp 1530-1533 for further discussion of suppository dosage forms Analogous gels or cremes can be used for vaginal, urethral and rectal administrations

Numerous administration vehicles will be apparent to those of ordinary skill in the art. including without limitation slow release formulations, hposomal formulations and polymeric matrices

Examples of pharmaceutically acceptable acid addition salts for use in the present invention include those denved from mineral acids, such as hydrochloric, hydrobromic, phosphoπc, metaphosphoπc, nitric and sulfuπc acids, and organic acids, such as tartaπc, acetic, citric, malic, lactic, fumaric, benzoic, glycohc, gluconic, succimc, p-toluenesulphonic and arylsulphonic acids, for example Examples of pharmaceutically acceptable base addition salts for use in the present invention include those denved from non-toxic metals such as sodium or potassium, ammonium salts and organoamino salts such as tπethylamine salts Numerous appropriate such salts will be known to those of ordinary skill

The physician or other health care profesional can select the appropriate dose and treatment regimen based on the subject's weight, age. and physical condition Dosages will generally be selected to maintain a serum level of compounds of the invention between about 0 01 μg/cc and about 1000 μg/cc, preferably between about 0 1 μg/cc and about 100 μg/cc For parenteral administration, an alternative measure of preferred amount is from about 0 001 mg/kg to about 10 mg/kg (alternatively, from about 0 01 mg/kg to about 10 mg/kg). more preferably from about 0 01 mg/kg to about 1 mg/kg (from about 0 1 mg/kg to about 1 mg/kg), will be administered For oral administrations, an alternative measure of preferred administration amount is from about 0 001 mg/kg to about 10 mg/kg (from about 0 1 mg/kg to about 10 mg/kg). more preferably from about 0 01 mg/kg to about 1 mg/kg (from about 0 1 mg/kg to about 1 mg/kg) For administrations in suppository form, an alternative measure of preferred administration

amount is from about 0 1 mg/kg to about 10 mg/kg. more preferably from about 0 1 mg/kg to about 1 mg/kg

For use in assaying for activity in inhibiting glycine transport, eukaryokic cells, preferably QT-6 cells derived from quail fibroblasts, have been transfected to express one of the three known vanants of human GlyT- 1 , namely GlyT- 1 a, GlyT- 1 b or GlyT- 1 c, or human GlyT-2 The sequences of these GlyT-1 transporters are described in Kim et al , Mυlec Pharm 45 608-617, 1994. excepting that the sequence encoding the extreme N-terminal of GlyT-la was merely inferred from the corresponding rat-derived sequence This N-terminal protein-encoding sequence has now been confirmed to correspond to that inferred by Kim et al The sequence of the human GlyT-2 is descnbed by Albert et al , U S Application No 08/700.013. filed August 20. 1996, which is incoφorated herein by reference in its entirety Suitable expression vectors include pRc/CMV (Invitrogen), Zap Express Vector (Stratagene Cloning Systems, LaJolla. CA. hereinafter "Stratagene"), pBk/CMV or pBk-RSV vectors (Stratagene). Bluescπpt II SK +/- Phagemid Vectors (Stratagene), LacSwitch (Stratagene), pMAM and pMAM neo (Clontech), among others A suitable expression vector is capable of fosteπng expression of the included

GlyT DNA in a suitable host cell, preferably a non-mammalian host cell, which can be eukaryotic, fungal, or prokaryotic Such preferred host cells include amphibian, avian, fungal, insect, and reptilian cells

As discussed above, the compounds of the invention have a number of pharmacological actions The relative effectiveness of the compounds can be assessed in a number of ways, including the following

♦ comparing the activity mediated through GlyT-1 and GlyT-2 transporters. This testing identifies compounds (a) that are more active against GlyT-1 transporters and thus more useful in treating or preventing schizophrenia, increasing cognition and enhancing memory or (b) that are more active against GlyT-2 transporters and thus more useful in treating or preventing epilepsy, pain, spasticity or myospasm

♦ testing for NMDA receptor binding. This test establishes whether there is sufficient binding at this site, whether antagonist or agonist activity, to warrant further examination of the pharmacological effect of such binding

♦ testing the activity of the compounds in enhancing or diminishing calcium fluxes in primary neuronal tissue culture. A test compound that increases calcium flux either (a) has little or no antagonist activity at the NMDA receptor and should not affect the potentiation of glycine activity

through GlyT-1 transporter inhibition or (b). if marked increases are observed over GlyT-1 inhibitors used for comparison and that have little direct interaction with NMDA receptors, then the compound is a receptor agonist In either of the above-described cases, the test confirms activity in treating or preventing schizophrenia, increasing cognition, or enhancing memory In contrast, a test compound that decreases calcium flux has a net effect wherein receptor antagonist activity predominates over an> activity the compound has in increasing glycine activity through inhibiting glycine transport In this case, the test confirms activity in limiting or preventing the cell damage and cell death arising after stroke or other ischemia-inducing conditions, or in limiting or preventing the cell damage associated with neurodegenerative diseases

All animal methods of treatment or prevention described herein are preferably applied to mammals, most preferably humans The following examples further illustrate the present invention, but of course, should not be construed as in any way limiting its scope

Example 1 - Synthesis of N-|(4.4-DiphenvI)but-3-enyllgIycine ethyl ester (Compound A26)

A mixture of 5 95 g (20 7 mmol) 4-bromo-l, l-dιphenyl-l-butene (prepared as described in F A Ah et al . J Med Chem . 28 653-660. 1985), 4 71 g (33 7 mmol) glycine ethyl ester hydrochloπde (Aldπch, Milwaukee, WI), 1 1 62 g (84 mmol) potassium carbonate and 1 06 g

(6 38 mmol) potassium iodide in 50 ml acetonrtπle was refluxed with stimng under argon for seven hours The reaction mixture was filtered, the solvent evaporated and the residue chromatographed on silica gel column with 20% ethyl acetate in hexanes to give 3 70 g (yield 58%) of N-[(4.4-dιphenyl)but-3-enyl]glycιne ethyl ester (compound A26) as an oil NMR spectra of the product showed 1H NMR (CDC1 ₃ , 300 MHz) 7 60-7 00 (m, 10 H), 6 09 (t, 1 H), 4 16

(q. 2 H), 3 35 (s. 2 H). 2 71 (t. 2 H), 2 32 (dt. 2 H). 1.25 (t, 3 H). ¹³ C NMR (CDCI3. 75 MHz)

172 29. 143 25. 142 37, 139 82, 129 72, 128 13, 128 04, 127 97, 127 13, 126 92. 126 88, 126 68. 60 56. 50 73. 49 32, 30 33, 14 14 Example 2 - Additional Syntheses According to Reaction 1

Additional compounds were synthesized using Reaction 1. as follows

Compound Reagent Amino acid or Solvent Yield prccusor

Al 1 B X 27%

A2 1 C X 35%

A7 7 E X 9%

A9 4 E X 47%

Al l 1 A X 70%

A12 4 E X 7%

A14 2 D X 15%

A18 6 E X 50%

A23 5 E X 26%

A24 3 D Y 20%

A43 8 F X 12%

A52 9 F X 28%

A57 10 F X 31%

A67 1 1 F X 10%

A71 12 E X 28%

A75 13 F X 73%

A77 14 F X 36%

A85 15 F X 86%

A87 16 F X 59%

A90 17 E X 16%

A95 17 F X 65%

A96 17 E X 50%

A104 15 E X 62%

A106 18 F X 65%

A121 19 E X 3%

A122 19 E X 40%

A123 19 F X 72%

A130 20 E X 6%

A132 21 F X 90%

A134 21 E X 67%

A170 6 F X 72%

A48 22 F X 87%

A50 23 F X 81%

A53 24 F X 76%

A59 25 F X 77%

A61 26 F X 91%

A63 27 F X 91%

A70 28 F X 89%

A73 29 F X 86%

A74 30 F X 76%

A78 31 F X 49%

A80 32 F X 66%

A82 33 F X 38%

A83 33 E X 25%

A88 34 F X 55%

A89 35 F X 75%

A99 36 F X 56%

AlOO 37 F X 67%

Al l l 38 F X 34%

A1 17 39 F X 58%

A1 18 40 F X 89%

A120 41 F X 62%

A 125 42 F X 46%

A126 43 E X 57%

A127 44 E X 5%

A128 44 E X 53%

A129 44 F X 66%

A138 45 F X 48%

A140 46 F X 69%

A141 47 F X 51%

A142 48 F X 67%

A143 49 F X 61%

A145 50 F X 98%

A155 51 F X 70%

A156 52 F X 65%

A158 53 F X 59%

A159 54 F X 85%

A160 55 F X 87%

A171 56 F X 88%

A173 57 F X 81%

A177 58 F X 84%

A178 58 F X 60%

A179 59 F X 68%

A180 24 G X 85%

Reagent

1) 4-bromo-l.1-dιphenyl-l-butene, (prepared as described in F A Ah et al . J Med Chem . 28 653-660, 1985), 2) l,l'-(4-chlorobutylιdene)bιs(4-fluorobenzene), (Acros Organics. Pittsburgh, PA), 3) benzhydryl 2-bromoethyl ether, (prepared as descnbed in M R Pavia et al , J Med Chem 35 4238-4248. 1992), 4) 9-fluorenylethanol /Holuenesulfate, [prepared by L1AIH4 reduction of 9-fluoreneacetιc acid methyl ester (Aldrich) to 2-(9-fluorenyl)ethanol. followed by tosylation], 5) 4-bromo-2,2-dφhenyl butyronitπle (Aldrich), 6) 3-bιs(4-fluorophenyl)propanol /j-toluenesulfate [prepared by alkylation of diethyl malonate (Aldrich) with chlorobιs(4- fluorophenyljmethane (Aldrich) followed by hydrolysis and decarboxylation, L1AIH4 reduction of the monocarboxylic acid, and tosylation of the formed alcohol], 7) 10-(3-bromo-2- hydroxypropyl)phenothιazme [prepared essentially as described in British Patent 800.635], 8) 3-tπs(4-fluorophenyl)propanol jθ-toluenesulfonate [prepared by alkylation of diethyl malonate

(Aldπch) with 4.4 ^" .4"-tπfluorotπtyl bromide (TCI America. Portland. OR) followed by hydrolysis and decarboxylation. L1AIH4 reduction of the monocarboxylic acid, and tosylation of the formed alcohol], 9) 3-cyclohexyl-3-phcnylpropanol /;-toluenesulfonate [prepared by Horner-Emmons reaction of the sodium yhde of tπethyl phosphonoacetate (Aldrich) with cyclohexyl phenyl ketone (Aldπch) followed by catalytic hydrogenation of the intermediate α,β-unsaturatcd ester. L1AIH4 reduction and tosylation of the formed alcohol]. 10)

3-tns(4-mcthoxyphenyl)propanol /?-toluenesulfonate [prepared by alkylation of diethyl malonate (Aldnch) with 4,4',4"-tnmethoxytπtyI chloride (Aldnch) followed by hydrolysis and decarboxylation. L1AIH4, reduction of the monocarboxylic acid, and tosylation of the formed alcohol], 11 ) 3-bιs(3-fluorophenyl)propanol /Moluenesulfonate [prepared by Horner-Emmons reaction of the sodium yhde of tπethyl phosphonoacetate (Aldπch) with 3.3'-dιfluorobenzophenone (Aldπch) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, L1AIH4 reduction and tosylation of the formed alcohol], 12) 3,5-dιphenylpentanol p-toluenesulfonate [prepared by Horner-Emmons reaction of the sodium yhde of tπethyl phosphonoacetate (Aldnch) with 3-phenylpropιophenone (Pfaltz & Bauer Chemicals Catalog. Waterbury, CT) followed by catalytic hydrogenation of the intermediate α,β -unsaturated ester, L1AIH4 reduction and tosylation of the formed alcohol], 13) 3-bιs(4-phenoxyphenyl)propanol /j-toluenesulfonate prepared by Horner-Emmons reaction of the sodium yhde of tπethyl phosphonoacetate (Aldrich) with 4,4'-dιphenoxybenzophenone (Lancaster, Windham. NH) followed by catalytic hydrogenation of the intermediate α.β-unsaturated ester, L1AIH4 reduction and tosylation of the formed alcohol],

14) 3-bιs(4-bιphenyl)propanol /?-toluenesulfonate [prepared by Horner-Emmons reaction of the sodium yhde of tnethyl phosphonoacetate (Aldrich) with 4-benzoylbιphenyl (Aldnch) followed by catalytic hydrogenation of the intermediate α,β -unsaturated ester. L1AIH4 reduction and tosylation of the formed alcohol], 15) 3-(4-ter/-butylphenyl-3-phenypropanol p-toluenesulfonate [prepared by Horner-Emmons reaction of the sodium ylide of tπethyl phosphonoacetate with

4-terf-butylbenzophenone (Aldπch) followed by catalytic hydrogenation of the intermediate α,β -unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 16)

3,3.3-tns(4-chlorophenyl)propanol/Moluenesulfonate [prepared by L1AIH4 reduction of

3.3.3-tπs(4-chloropropιonιc acid) (Aldnch) followed by tosylation of the formed alcohol], 17) 3-(2-naphthyl)-3-phenyl)propanol/>-toluenesulfonate [prepared by Horner-Emmons reaction of the sodium yhde of tnethyl phosphonoacetate with 2-benzoylnaphthalene (Aldrich) followed by catahtic hydrogenation of the intermediate α,β-unsaturated ester. L1AIH4 reduction and tosylation

of the formed alcohol], 18) 3,3.3-tπphenylpropanol p-toluenesulfonate [prepared b\ L1AIH4 reduction of 3,3.3 -tπphenylpropionic acid (Aldπch) followed by tosylation of the formed alcohol] 19) 3-(4-phenylphenyl)-3-phenylpropanol /Holuenesulfonate [prepared by Horner-Emmons reaction of the sodium yhde of tnethyl phosphonoacetate with 4-benzoylbιphenyl (Aldπch) followed by catalytic hydrogenation of the intermediate α,β -unsaturated ester, L1AIH4 reduction and tosylation of the formed alcohol], 20) 1.2-dιphenylbutan-l ,4-dιol /Holuenesulfonate [prepared by C-alkylation of deoxybenzom (Aldπch) with ethyl bromoacetate (Aldπch) followed by L1AIH4 reduction of the intermediate β-ketoester and tosylation of the formed diol]. 21)

3-phenyl-3-(4-tπfluoromethylphenyl)propanol /?-toluenesulfonate prepared by Horner-Emmons reaction of the sodium yhde of tnethyl phosphonoacetate with 4-(tπfluoromethyl)benzophenone (Aldrich) followed by catalytic hydrogenation of the intermediate α,β -unsaturated ester, L1AIH4 reduction and tosylation of the formed alcohol], 22) 3 -chloro- \-(4-tert -butylphenoxy)- l-(4-fluorophenyl)propane [prepared analogously to the method of U S Pat 5,281,624 by reduction of 3-chloro-4'-fluoropropιophenone (Aldπch) with 1 0 M borane- tetrahydrofuran complex ("BTC", Aldrich) followed by Mitzunobu reaction (diethyl azodicarboxylate ("DEAD"), Pl^P, see Example 8C, Step 1) of the resulting alcohol with

4-/e/7-butylphenol (Aldnch)], 23) 3-chloro-l-(2-methyl-5-pyndyloxy)-l-phenylpropane [prepared by reduction of 3-chloropropιophenone (Aldπch) with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with 5-hydroxy-2-methylpyπdιne (Aldnch)]. 24) 3-chloro-l -(4-phenylphenoxy)-l -(4-fluorophenyl)propane [prepared by reduction of

3-chιoro-4'-fluoropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Plv^P) of the resulting alcohol with 4-phenylphenol (Aldnch)], 25) 3-chloro-l-(4-/er/-octylphenoxy)- 1-phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with 4-te/"i ^, -butylphenol], 26) (R)-(+)-3 -chloro- l-(4-phenylphenoxy)-l-phenylpropane [prepared by Mitzunobu reaction (DEAD. PI13P) of (R)-(+)-3-chloro-l-phenyl-l-propanol (Aldnch) with 4-phenylphenol (Aldπch)(see, e g .

U S Pat 5.068.432) (Reaction illustrated in Fig 3, Reaction 27)], Compound A61 was prepared with [α] _D ²⁵ +54 9° (c 5 28. CHCI3), 27) (S)-(-)-3 -chloro- l-(4-phenylphenoxy)-l-phenylpropane

[prepared by Mitzunobu reaction (DEAD, Pl^P) of (S)-(-)-3-chIoro-l -phenyl- 1-propanol (Aldnch) with 4-phenylphenol (see U S Patent No 5,068.432). Compound A63 was prepared with [α]rj ² ->-54 6 (c 7 13. CHCI3), 28) 3 -chloro- l-(4-/£ ^, r/-butylphenoxy)-l-phenylpropane

[prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed bv Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with 4-/tτ/-butylphenoIj, 29)

3-chloro-l-{4-[4-(tπfluoromethyl)phenoxy]phenoxy}-l-phen ylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD. PI13P) of the resulting alcohol with 4-[4-tπfluoromethyl)phenoxy]phenol (Aldnch)], 30) 3-chloro-l -

|4-(phenoxy)phenoxy]-l -phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with

4-phenoxyphenol (Aldπch)|, 31) 3-chloro-l-[4-(4-bromophenyl)phenoxy]-l- (4-fluorophenyl)propane [prepared by reduction of 3-chloropropιophenonc with 1 0 M BTC followed by Mitzunobu reaction (DEAD, PI13P) of the resulting alcohol with

4-(4-bromophenyl)phenol (Aldπch)], 32) 3-chloro-l-[4-(4-cyanophenyl)phenoxy]-l- phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, PI13P) of the resulting alcohol with 4'-hydroxy-4-bιphenylcarbonιtπle

(Aldnch)], 33) 3-chloro-l-(3-tnfluoromethylphenoxy)-l-phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD. PI13P) of the resulting alcohol with 3-tπfluoromethylphenol (Aldnch)], 34) 3-chloro-l-(2-naphthyloxy)-l- phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with 2-naphthol (Aldπch)J, 35)

3-chloro-l-l-naphthyloxy)-l-phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, PI13P) of the resulting alcohol with

1-naphthol (Aldnch)]. 36) 3-chloro-l-(4-methylphenoxy)-l -phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD. PI13P) of the resulting alcohol with /?-cresol (Aldnch)], 37) 3 -chloro- 1 -(4-phenylphenoxy)- 1 -phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD. PI13P) of the resulting alcohol with 4-phenylphenol], 38) 3 -chloro- 1-

(4-amιdosulfonylphenoxy)-l -phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with

4-hydroxybenzenesulfonamιde, (TCI Ameπca. Portland. OR)]. 39) 3 -chloro- 1 -(4-nιtrophenoxy)- phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with 4-nιtrophenol (Aldπch)]. 40)

3-chloro-l-(4-nιtro-3-tπfluoromethylphenoxy)-l -phenylpropane [prepared by reduction of 3-chloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD. Pl^P) of the

resulting alcohol with 4-mtro-3-tπfluoromethylphenol (Aldπch)]. 41 ) 3-chloro-l- (4-cyanophenoxy)- 1 -phenylpropane [prepared by reduction of 3-chloropropiophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-cyanophenol

(Aldnch)], 42) 3 -chloro- 1-phenoxy-l -phenylpropane [prepared by reduction of 3-chloropropiophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD. PI13P) of the resulting alcohol with phenol ( Aldπch)], 43) 3 -chloro- l-(4-tπfluoromethylphenoxy)-

1 -phenylpropane [prepared by reduction of 3-chloropropiophenone with 1 0 M BTC followed by

Mitzunobu reaction (DEAD, PI13P) of the resulting alcohol with 4-tπfluoromethylphenol], 44)

3-chloro-l-[(4-tπfluoromethoxy)phenoxy]-l-phenylpropane [prepared by reducing 3-chloropropiophenone with 1 0 M BTC. and Mitzunobu reaction (DEAD, Ph3P) of resulting alcohol with 4-(tπfluoromethoxy)phenol (Aldπch)], 45) 3 -chloro- 1 -(4-tπfluoromethylphenoxy )- l-(2.4-dιmethoxy)phenylpropane [prepared by reduction of 3-chloro-

2',4'-dιmethoxypropιophenone (Maybπdge Chemical Co Ltd , Cornwall, UK) with 1 0 M BTC followed by Mitzunobu reaction (DEAD, PI13P) of the resulting alcohol with 4-tπfiuoromethylphenol], 46) 3-chloro-l-(3.4-methyIenedιoxyphenoxy)-

1 -(4-chlorophcnyl)propane [prepared by reduction of 3,4'-dιchloropropιophenone (Aldrich) with 1 0 M BTC followed by Mitzunobu reaction (DEAD. PI13P) of the resulting alcohol with sesamol

(Aldnch)], 47) 3-chloro-l-phenoxy-l-(4-bromophenyl)propane [prepared by reduction of 4-bromo-β-chloropropιophenone (Lancaster) with 1 0 M BTC followed by Mitzunobu reaction (DEAD, PI13P) of the resulting alcohol with phenol], 48) 3 -chloro- 1 -(4-tπfluoromethylphenoxy )- l-(4-bromophenyl)propane [prepared by reduction of 4-bromo-β-chloropropιophenone. with 1 0 M BTC followed by Mitzunobu reaction (DEAD, PI13P) of the resulting alcohol with

4-tπfluoromethylphenol] , 49) 3 -chloro- 1 -(4-methoxyphenoxy)- 1 -(4-chlorophenyl)propane [prepared by reduction of 3.4'-dιchloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD. PI13P) of the resulting alcohol with 4-methoxyphenol (Aldπch)], 50)

3-chloro-l-(4-cyanophenoxy)-l-(4-chlorophenyl)propane [prepared by reducing 3,4'-dιchloropropιophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD. PI13P) of the resulting alcohol with 4-cyanophenol]. 51) 3 -chloro- 1 -(4-chlorophenoxy)- 1 -(4-bromophenyl)propane [prepared by reduction of 4-bromo- β-chloropropiophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Plv P) of the resulting alcohol with

4-chlorophenol (Aldπch)], 52) 3 -chloro- l-phenoxy-l-(4-chlorophenyl)propane [prepared by reduction of 3.4'-dιchloropropιophenone with 1 0 M BTC followed by Mitzunobu reaction

(DEAD Ph3P) of the resulting alcohol with phenolj. 53) 3-chloro-l-(4-methoxyphenox\)-

1 -(4-fluorophenyl)propane [prepared by reducing 3-chloro-4'-fluoropropιophenone with 1 0 M BTC. and Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with 4-methoxvphenol].

54) 3-chloro-l-phenoxy-l-(4-fluorophenyl)propane [prepared by reduction of 3-chloro-4'- fluoropropiophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, Pl^P) of the resulting alcohol with phenol], 55) 3 -chloro- l-(4-tπfluoromethylphenoxy)- l-(4-fluorophenyl)propane [prepared by reduction of 3-chloro-4'-fluoropropιophenone with 1 0 M BTC followed by Mitzunobu reaction (DEAD, PI13P) of the resulting alcohol with

4-tnfluoromethylphenol] . 56) (R)-(+)-3 -chloro- 1 -(4-mtrophenoxy)- 1 -phenylpropane [prepared (see, e g . U S Patent No 5,068,432) by Mitzunobu reaction (DEAD, Ph ₃ P) of (R)-

(+)-3-chloro-l -phenyl- 1-propanol (Aldrich) with 4-nιtrophenol], Compound A171 was prepared with [α] _D ²⁵ + 19 7° (c 5 18. CHCI3) 57) fS>(-)-3-chloro- 1 -(4-phenylphenoxy)- 1 -(4- flurophenyl)propane [prepared with [cφ ²⁵ -46 3° (c 2 49, CHCI3) analogously to U S pat 5,068,432 by reduction of 3-chloro-4 -fluoropropiophenone with (+) dusopinocampheylboron chloride (Aldπch) followed by Mitzunobu reaction (DEAD, Ph ₃ P) of the resulting (7iH+)-3-chloro-l -(4-fluorophenyl)- 1-propanol {[α] _D ²⁵ + 22 1 ° (c 8 07, CHC1 ₃ )} with 4-phenylphenol, (Aldπch)], Compound A173 was prepared with [α] _D ²⁵ -25 8° (c 3 03, CHC1 ₃ ), 58) (R)-(+)-3 -chloro- 1 -(4-phenylphenoxy)- 1 -(4- fluorophenyl)propane [prepared with [α]o ²⁵ +46 6° (c 2 73, CHCH) analogously to U S pat 5,068,432 by reduction of 3-chloro-4 -fluoropropiophenone with (-) dusopinocampheylboron chloride (Aldπch) followed by Mitzunobu reaction (DEAD, Ph ₃ P) of the resulting (S)-(-)-3 -chloro- 1 -(4-fluorophenyl)- 1-propanol {[α] _D ²⁵ -22 2° (c 2 37, CHCI3)} with 4-phenylphenol, (Aldπch)], Compound A177 was prepared with [α] _D ²⁵ +26 8° (c 3 10, CHC1 ₃ ), Compound A178 was prepared with [α] _D ²⁵ +20 0° (c 3 13, CHC1 ₃ ), 59) (R;-(+)-3-chloro-l-[4-(l-adamantyl)phenoxy]-l-(4- flurophenyl)propane [prepared with [α] _D ²⁵ +24 3° (c 2 19, CHC1 ₃ ) analogously to U S pat 5,068,432 by reduction of 3-chloro-4-fluoropropιophenone with (-) dusopinocampheylboron chloride (Aldnch) followed by Mitzunobu reaction (DEAD, Ph ₃ P) of the resulting (ϊ>(-)-3 -chloro- 1 -(4-fluorophenyl)- 1-propanol {[α] _D ²⁵ -22 2° (c 2 37, CHC1 ₃ )} with 4-(l -adamantyl)phenol, (Aldπch)], Compound Al 79 was prepared with [αJD ²⁵ +17 8° (c 2 98, CHC1 ₃ )

Amino acid or amino acid precursor

A) L-alanme methyl ester hydrochloride, (Fluka, Ronkonkoma, NY), B) D-alanme methyl ester hydrochloride (Aldπch). C) sarcosine methyl ester hydrochloride, (Lancaster. Windham. NH),

D) glycine methyl ester hydrochloπde (Aldrich). E) glycine ethyl ester hydrochlonde (Aldrich). F) sarcosine ethyl ester hydrochloride (Aldrich), and G) methylaminoacetaldehvde dimethyl acetal

(Aldrich)

Solvent X) acetomtπle, Y) methanol

For the synthesis of A61, the reaction is illustrated in Figure 3 (Reaction 28)

Example 3 - Synthesis of N-[(3,3-Diphenyl)propyllgrvcine ethyl ester (Compound A22)

2 132 g (10 1 mmol) 3.3-dιphenylpropylamιne (Aldrich. Milwaukee, WI) was added to a mixture of 0 853 g (5 11 mmol) ethyl bromoacetate (Aldnch) and 2 7 g (19 57 mmol) potassium carbonate in 14 ml acetonitπle at rom temperature The mixture was stirred under argon for 18 hours The reaction mixture was filtered, the solvent evaporated and the residue chromatographed on a silica gel column with 40% ethyl acetate in hexanes to give 1 05 g (yield 69%) N-[(3.3- dιphenyl)propyl]glycme ethyl ester (Compound A22) as an oil NMR spectra of the product showed 1H NMR (CDC1 ₃ , 300 MHz) 7 40 - 7 10 (m, 10 H), 4 14 (q, 2 H). 4 03 (t. 1 H), 3 33

(s,-2 H), 2 56 (t. 2 H), 2 24 (dt. 2 H), 1 22 (t, 3 H), ¹³ C NMR (CDCI3, 75 MHz) 172 44,

144 66, 128 43, 127 75. 126 15, 60 63, 50 93, 48 80, 47 92, 35 85, 14 17 0 019 g of A28 was also isolated from the silica gel column

Example 4 - Additional Syntheses Using Reaction 2

Additional compounds were synthesized using Reaction 2. as follows

Compound Starting amine Reagent Solvent Yield

A5 1 A X 27%

A6 7 B Y 89%

A10 9 B Y 77%

A13 8 B Y 95%

A15 6 B Y 96%

A17 3 B X 14%

A19 1 C X 69%

A20 2 E X 57%

A21 B X 55%

A30 H X 42%

A33 D X 20%

A34 G X 7%

A35 F X 18%

A36 5 B X 80%

A37 4 B X 77%

A38 1 E X 70%

A39 1 I X 10%

A40 1 J X 3%

A108 10 B X 9%

A150 2 K X 56%

A157 1 L X 30%

A162 1 K X 36%

A165 1 M X 59%

A166 1 N X 51%

A167 1 0 X 50%

A172 1 P X 46%

Starting amine 1) Fluoxetine [N-methyl-3 -(p-tnfluo romethylphenoxy] >-3-phenylpro] pylamine hydrochlonde], (Sigma, St Louis), 2) 3,3-dιphenylpropylamιne (Aldπch), 3) Nisoxetine hydrochloride [(±)-γ-(2-methoxyphenoxy)-N-methyl-benzencpropanamιne hydrochlonde], (RBI, Natick. MA), 4) 1.2-dιphenyl-3-methyl-4-(methylamιno)-2-butanol hydrochlonde. (Sigma- Aldnch Library of Rare Chemicals), 5) d-Norpropoxyphene (l,2-dιphenyl-3-methyl-4- methylamιno-2 -butyl propionate maleate salt), (Sigma), 6) Maprotyhne hydrochlonde [N-Methyl- 9,10-ethanoanthracene-9(10H)-propanarnιne hydrochlonde], (Sigma). 7) Nortπptyline hydrochlonde {3-( 10, 1 1 -dιhydro-5H-dιbenzo[a,d]cyclohepten-5-yhdene)-N-methyl- 1 -propanamme hydrochlonde} , (Sigma). 8) Desφiramine hydrochloride { 10, 1 l-dιhydro-N-methyl-5H- dιbenz[b,f]azepιnc-5-propanamme hydrochlonde}, (Sigma) 9) Protπptyhne hydrochlonde {N- Methyl-5H-dιbenzo[a,d]cycloheptene-5-propanamιne hydrochlonde} , (Sigma). 10) 3-(l-naphthyl)-3-phenylpropylamιne [prepared by Horner-Emmons reaction of the sodium yhde of diethyl cyanomethylphosphonate (Aldnch) with α-benzoylnaphthalene, (Pfaltz & Bauer, Waterbury, CT) followed by catalytic hydrogenation of the intermediate α,β-unsaturated nitrile] Reagent A) methyl bromoacetate (Aldnch), B) ethyl bromoacetate (Aldnch), C) propyl bromoacetate (Aldrich). D) phenyl bromoacetate (Aldπch). E) 2-bromoacetamιde (Aldπch), F) 2-chloro-N,N-dιethylacetamιde (Aldπch), G) N-ethylchloroacetamide (Lancaster). H) bromoacetomtπle (Aldπch), I) 4-(bromomethylsulfonyl)morpholιne, (Sigma - Aldrich Library of Rare Chemicals), J) diethyl chloromethylphosphonate (Aldπch), K) benzyl 2-bromoacetate, (Aldπch), L) p-nitrophenyl bromoacetate. (Lancaster), M) octyl chloroacetate. (Sigma-Aldπch Library of Rare Chemicals), N) isopropyl bromoacetate. (Aldnch), O) w-butyl bromoacetate, (Pfatz & Bauer), Waterbury, CT), P) tert-butyl bromoacetate, (Aldrich) Solvent X) acetonitπle, Y) ethanol

Example 5A - Synthesis of N-{|3-Hvdroxy-3-phenyl-3-(thien-2-vI)lpropyπ sarcosine ethyl ester (Compound A32)

Step 1 N-[(3-Oxo-3-phenyl)propyl]sarcosme ethyl ester A mixture of 3 37 g (20 mmol)

3-chloropropiophenone (Aldnch), (3 07 g, (20 mmol) sarcosine ethyl ester hydrochlonde. 3 32 g (20 mmol) potassium iodide and 2 5 g potassium carbonate in 140 ml acetonitπle was heated under reflux with stirring for 2 hours (see Reaction 13, Figure 2) The reaction mixture was filtered and the solvent evaporated The residue was dissolved m dichloromethane, washed with water and dned over sodium sulphate Evaporation of the solvent gave

N-[(3-oxo-3-phenyl)propyl]sarcosιne ethyl ester as a yellow oil which was used in step 2 without puπfication

Step 2 2-Thιenylhthιum [generated by adding 1 ml of butylhthium (2 5 M in tetrahydrofuran) to 0 21 g (2 5 mmol) thiophene m 10 ml tetrahydrofuran at -78°C] was added dropwise into a solution of 0 623 g (2 5 mmol) of N-[(3-oxo-3-phenyl)propyl]sarcosme ethyl ester (from step 1) in 30 ml of tetrahydrofuran at -78°C (see Reaction 14, Figure 2) After stirπng at -78°C for 1 h and at 20°C for 1 h, the reaction was quenched by adding 20 ml 10% ammonium hydroxide solution at 0°C The mixture was extracted with methylene chlonde, the solvent evaporated and the residue chromatographed on silica gel column with 16% ethyl acetate in hexanes to give 0 43 g (yield 52%) N-{[3-hydroxy-3-phenyl-3-(thιen-2-yl)]propyl}sarcosιne ethyl ester (compound A32) as a beige solid Example 5B - Synthesis of N-([3-Hvdroxy-3-phenyl-3-(furan-2-yl)lpropyl, sarcosine ethyl ester (Compound A161)

N-{[3-Hvdroxy-3-phenyl-3-(furan-2-yl)]propyl} sarcosine ethyl ester was synthesized essentially as described in Example 5A (replacing 2-thιenylhthιum with 2-furanylhthιum) (yield

14%) Example 6 - Synthesis of N-[3-Phenyl-3-(thien-2-vD-2-propenvHsarcosine ethyl ester (Compound A41)

N-{[3-Hydroxy-3-phenyl-3-(thιen-2-yl)]propyl}sarcosιne ethyl ester (Compound 32 from Example 5), 0 118g (0 354 mmol) was dissolved in 2 ml of formic acid The solution was heated at 110°C for 0 5 hour (see Reaction 19, Figure 2) The deep red reaction mixture was concentrated and the residue was partitioned between water and CH ₂ C1 ₂ The aqueous phase was extracted with CH ₂ C1 ₂ and the CH ₂ C1 ₂ solution was dried over Na ₂ Sθ4 After evaporating the solvent, the residue was punfied by preparative TLC with 1 3 ethyl acetate hexanes to give 0 091 g (82 %) N-[3-phenyl-3-(thιen-2-yl)-2-propenyl]sarcosme ethyl ester (Compound A41) as a deep red oil

Example 7 - Synthesis of N-[3-Phenyl-3-(thien-2-yl)propyl|sarcosine ethyl ester (Compound A42)

0 055 g (0 174 mmol) N-[3-Phenyl-3-(thιen-2-yl)-2-propenyl] sarcosine ethyl ester

(Compound 41 from Example 6) was hydrogenated over 0 055 g 10% Pd/C in 2 ml of EtOH The hydrogenation was conducted at 40 psi for 16 hours at room temperature (see Reaction 20,

Figure 2) After filtenng off the catalyst the solution was concentrated and the residue was purified by preparative TLC with 1 2 ethyl acetate hexanes to give 0 012 g (22 %)

N-[3-phenyl-3-(thιen-2-yl)propyl]sarcosme ethyl ester (Compound A42) as a yellow oil

Example 8A - Synthesis of IN-l(3-Phenyl-3-phenoxy)propylIsarcosine ethyl ester (compound A31)

Step 1 N-[(3-Hydroxy-3-phenyl)propyl]sarcosιne ethyl ester 2 40 ml of LιAl(t-BuO)3

[lithium tπ-/er/-butoxyalummohydπde (Aldrich) (1 M in THF)] was added into a solution of 0 593 g (2 38 mmol) N-[(3-oxo-3-phenyl)propyl]sarcosιne ethyl ester (step 1 of Example 5A) in 10 ml of tetrahydrofuran at -78°C (see Reaction 15 in Figure 2) After stimng at -78°C for 1 h and 1 h at room temperature, the reaction was quenched by adding 10 ml 10% ammonium chloride solution at 0°C and filtered through cehte The mixture was extracted with methylene chlonde and dned over sodium sulphate Evaporation of the solvent gave N-[(3-hydroxy-3-phenyl)propyl]sarcosιne ethyl ester as a yellow oil which was used in the next step without further purification

Step 2 N-[(3-Chloro-3-phenyl)propyl]sarcosιne ethyl ester The yellow oil of step 1 was dissolved in 20 ml of chloroform, 1 ml of SOCl ₂ was added and the mixture heated under reflux for 2 h (see Reaction 16 in Figure 2) After addition of crushed ice, the reaction mixture was neutralized with a saturated solution of potassium carbonate and extracted with methylene chloride The combined extracts were evaporated and the residue punfied by preparative silica gel TLC with 20% ethyl acetate in hexanes to give 0 165 g N-[(3-chloro-3-phenyl)propyl]sarcosιne ethyl ester (yield 26% in two steps)

Step 3 N-[(3-Phenyl-3-phenoxy)propyl]sarcosιne ethyl ester (compound A31) A solution of 0 075 g (0 278 mmol) N-[(3-chloro-3-phenyl)propyl]sarcosιne ethyl ester (from step 2) in 3 ml of anhydrous dimethylformamide was added into a solution of sodium phenoxide (generated by adding 0 022 g of 60% NaH in mineral oil to 0 054 g phenol in 2 ml dimethylformamide) at room temperature (see Reaction 17 m Figure 2) The reaction mixture was stirred at room temperature for 30 hours, the solvent was evaporated under vacuum and the residue punfied by preparative silica gel TLC with 35% ethyl acetate m hexanes to give 0 014 g (yield 15%) N- [(3 -phenyl-3-phenoxy)propyl] sarcosine ethyl ester (compound A31) as a yellow oil

Example 8B - Additional Syntheses Using the Procedure of Example 8A

Compound A 164 was prepared by alkylation of 4-methoxyphenol (Aldrich) with N-(3-chloro-3-phenylpropyl)sarcosιne ethyl ester as described above in Example 8 A (Step 3) - yield 5% Compound Al 19 was prepared by alkylation of thiophenol (Aldπch) with

N-(3-chloro-3-phenylpropyl)sarcosιnc ethyl ester as described above in Example 8A (Step 3) yield 62%

Compound Al 15 was prepared by alkylation of 4-(tπfluoromethyl)thιophenol (Lancaster) with N-(3-chloro-3-phenylpropyl)sarcosιne ethyl ester as described above in Example 8A (Step 3) - yield 93%

Compound A68 was prepared by alkylation of 4-?c/-/-butylthιophenol (Lancaster) with

N-(3-chloro-3-phenvlpropyl)sarcosme ethyl ester as described above in Example 8 A (Step 3) - yield 5%

Example 8C Synthesis of N- 13- Phenyl-3-(phenyIaminopropyl| sarcosine ethyl ester (Compound A47)

Step 1 N-[3-Phenyl-3-(/>toluenesulfonanιhdo)propyl]sarcosιne ethyl ester 0 465 g (2 67 mmol) diethyl azodicarboxylate ("DEAD", Aldπch) was added dropwise to a solution of 0 51 1 g

(2 03 mmol) N-(3-hydroxy-3-phenylpropyl)sarcosιne ethyl ester (from Example 8A, Step 1),

0 571 g (2 31 mmol)/j-toluenesulfonanιhde, (TCI America, Portland, OR) and 0 712 g (2 71 mmol) tnphenylphosphine in 2 ml anhydrous tetrahydrofuran with stirring under nitrogen and cooling with an ice bath The mixture was stirred at room temperature for 4 hours, the solvent evaporated and the residue chromatographed on silica gel with 25% ethyl acetate in hexanes to give 0 730 g (yield 74%) N-[3-phenyl-3-(p-toluenesulfonanιhdo)propyl]sarcosme ethyl ester

1H NMR (CDCI ₃ .300 MHz) 758 (d, 2 H).740-690 (m, 10 H), 662 (d, 2 H).555 (t.1 H), 414 (q, 2 H), 320 (s, 2 H), 260-220 (m, 2 H), 239 (s, 3 H), 233 (s.3 H), 220-180 (m.2 H),

1 12 (t. 3 H), ¹³ C NMR (CDCI3. 75 MHz) 170 74,142 90, 138 33, 138 08, 134 88. 132 78,

129 14. 128 60, 128 36, 128 28, 127 93. 127 79, 127 46, 60 51. 60 26, 58 57, 53 93. 42 16, 30 60. 21 36, 14 12

Step 2 N-[3-Phenyl-3-(phenylamιno)propyl]sarcosme ethyl ester (Compound A47) A solution of 0 284 g (0 6 mmol) N-[3-phenyl-3-(/?-toluenesulfonanιhdo)propyl]sarcosιne ethyl ester (from Step 1 ) in 3 ml anhydrous ethylene glycol dimethyl ether was added dropwise within 1 hour into solution of sodium naphthalenide [prepared from 0 545 g (5 04 mmol) naphthalene and 0 1 10 g (5 16 mmol) sodium) in 8 ml anhydrous ethylene glycol dimethyl ether with stirnng under nitrogen and cooling with an ice bath The mixture was stiπed at room temperature for 1 hour.

qucnched with ice and extracted with ethyl acetate The combined organic extracts were washed with brine, the solvent evaporated and the residue chromatographed on silica gel with 25% ethyl acetate in hexanes to give 0 092 g (yield 47%) N-[3-phenyl-3-(phenylamιno)propyl]sarcosιne ethyl ester (Compound A47) 1H NMR (CDC1 ₃ , 300 MHz) 7 50-7 00 (m. 7 H). 6 70-6 40 (m. 3 H), 5 75 (br s, 1 H), 4 47 (t, 1 H), 4 18 (q. 2 H). 3 24 (s. 2 H). 2 57 (t, 2 H), 2 37 (s. 3 H). 2 10-1 70 (m, 2 H), 1 18 (t, 3 H), ¹³ C NMR (CDCI3, 75 MHz) 170 73, 147 82, 143 89, 128 87. 128 43, 126 69, 126 26, 1 16 57, 1 13 17, 60 47, 58 53, 57 92, 54 47. 42 32, 35 19, 14 18

Example 8D Synthesis of rø?l-(+)-N-[3-Phenyl-3-(4-r ^g rf-butylphenoxy)propylsarcosine ethyl ester (Compound A55) llαlp ²⁵ +18.6" (c 7.84, CHChH

Step 1 [S]-(-)-N-(3-Hydroxy-3-phenylpropyl)sarcosιne ethyl ester {[α] _Q ² ^-35 ⁰ (c 4 88.

CHCI3)}, prepared by alkylation of sarcosine ethyl ester with

(R)-(+)-3 -chloro- 1 -phenyl- 1-propanol (Aldnch) under the conditions described in Example 1 - yield 72 % See Reaction 23, Figure 3 Step 2 [R]-(+)-N-[3-Phenyl-3-(4-/erNbutylphenoxy)propyl]sarcosme ethyl ester prepared by Mitzunobu reaction (analogously to Example 8C. Step 1) of [S\-(- )-N-(3-hydroxy-3-phenylpropyl)sarcosme ethyl ester (from step 1) with 4-/er?-butylphenol

(Aldπch) - yield 41 %. [α] _D ²⁵ + 18 6° (c 7 84. CHCI3) See Reaction 24, Figure 3

Example 8E - Synthesis of r/?l-(+)-N-|3-Phenyl-3-(4-phenylphenoxy)propyH sarcosine ethyl ester (Compound A61) (lαlp ²⁵ + 22.3° (c 8.1, CHCh).

Another synthesis of compound A61 with [α]r _j ²⁵ +54 9° (c 5 28, CHCI3) was already descnbed in Example 2

Step 1 [5]-(-)-N-(3-Hydroxy-3-phenylpropyl)sarcosme ethyl ester prepared analogously to the method of U S Pat 5.068,432 by reduction of N-[(3-oxo-3-phenyl)propyl]sarcosιne ethyl ester (from step 1 of Example 5 A) with (-) dusopinocampheylboron chloπde (Aldrich) - yield

12%. [α] _D ²⁵ -24 6° (c 3 63, CHCI3) (see Reaction 25. Figure 3) Another synthesis of [S]-(-

)-N-(3-hydroxy-3-phenylpropyl)sarcosιne ethyl ester with [α]rj ² ^-35° (c 4 88. CHCI3) was already described in Example 8D (Step 1) See Reaction 23. Figure 3 Step 2 [/?]-(+)-N-[3-Phenyl-3-(4-phenylphenoxy)propyl]sarcosιne ethyl ester (Compound

A61) prepared by Mitzunobu reaction (analogously to Example 8C, Step 1) of

[5]-(-)-N-(3-hydroxy-3-phenylpropyl)sarcosιne ethyl ester (from step 1) with 4-phenylphenol

(Aldnch) - yield 22%. [α] _D ²⁵ +22 3" (c 8 1. CHC1 ₃ ) Sec Reaction 26, Figure 3

Example 9A - Synthesis of N-l(4,4-DiphenvDbut-3-enyll-N-ethylgrycine ethyl ester (Compound A16) A mixture of 0 158 g (0 5 mmol) of N-[(4.4-dιphenyl)but-3-enyl]glycme ethyl ester

(Compound A26). 0 234 g (2 1 mmol) bromoethanc, 0 281 g (2 mmol) potassium carbonate and

0 068 g (0 4 mmol) potassium iodide was stirred under argon for 20 hours at room temperature

The reaction mixture was filtered, the solvent evaporated, and the residue chromatographed on a silica gel column with 20% ethyl acetate in hexanes to yield 0 1 12 g (66%) N-[(4.4-dιphenyl)but- 3-enyl]-N-ethylglycιne ethyl ester (Compound A 16) as an oil NMR spectra showed 1H NMR (CDCI3. 300 MHz) 7 60-7 00 (m, 10 H), 6 09 (t, 1 H), 4 13 (q 2 H). 3 27 (s, 2 H). 2 72 (t, 2

H). 2 61 (q, 2 H), 2 28 (dt, 2 H). 1 23 (t, 3 H), 1 01 (t, 3 H), ¹³ C NMR (CDCI3, 75 MHz)

171 77. 142 96, 142 86, 140 33, 130 09. 128 49, 128 35, 127 48, 127 27, 127 19, 60 58. 54 90.

53 98. 48 20, 28 19, 14 57, 12 70 Example 9B Additional Syntheses Using the Procedure of Example 9A

Compound A 147 was prepared by treatment of compound A150 with lodomethane under the conditions descnbed in Example 9 A - yield 30%

Example 10 - Synthesis of N-[(4,4-Diphenyl)butvIlgrycine ethyl ester (Compound A4) 0 072 g (0 23 mmol) of N-[(4,4-dιphenyl)but-3-enyl]glycιne ethyl ester (compound A26) was hydrogenated over 0 072 g 10% Pd/C in 5 ml ethanol under 40 psi for 3 hours at room temperature The mixture was filtered from the catalyst through cehte and the solvent evaporated to give 0 065 g (yield 90%) N-[(4,4-dιphenyl)butyl]glycιne ethyl ester (compound A4) as an oil NMR spectra of the product showed 1H NMR (CDCI3, 300 MHz) 7 40-7 10 (m. 10 H). 4 17 (q. 2 H). 3 89 (t, 1 H). 3 34 (s. 2 H), 2 61 (t, 2 H), 2 08 (dt, 2 H), 1 50-1 40 (m, 2 H). 1 25 (t, 3 H). ^{1 3} C NMR (CDCI3. 75 MHz) 172 47. 144 89, 148 36, 127 77, 126 05, 60 63. 51 17. 50 90, 49 44. 33 19, 28 50. 14.17 Example 11 - Additional Syntheses Using the Procedure of Example 10

Compound A25 was prepared by catalytic hydrogenation, using 10% palladium on carbon, of compound A2 - yield 90%

Compound A3 was prepared by catalytic hydrogenation. using 10% palladium on carbon, of compound A16 - yield 90%

Example 12 - Synthesis of N-|(4,4-Diphenyl)but-3-enyl|glycine hydrochloride (compound A27)

To a solution of 0 093 g (0 3 mmol) of N-[(4,4-dιphenyl)but-3-enyI|gl\cιne ethyl ester

(compound A26) in 2 ml methanol was added 3 4 ml IN sodium hydroxide and the mixture was heated under reflux for four hours The reaction mixture was concentrated to half volume. acidified with 4 N hydrochloric acid, and extracted 4 times with methylene chloride The combined extracts were dried and evaporated to give 0 100 g (yield 86%) of N-[(4.4-dιphenyl)but-

3-enyl]glycιne hydrochloride (compound A27) NMR spectra of the product showed 1H NMR (CD ₃ OD. 300 MHz) 7 40-7 00 (m. 10 H). 5 96 (t, 1 H), 3 81 (s. 1 H), 3 69 (s. 2 H). 3 04 (br s. 2 H). 2 42 (br s, 2 H). ^{1 3} C NMR (CD3OD, 75 MHz) 166 78. 145 86. 145 82. 141 73. 139 34.

129 42, 128 42. 127 96. 127 41. 127 35. 127 02. 121 97, 121 87. 52 28, 26 43 Example 13A - Additional Syntheses Using the Procedure of Example 12

The following N-modified amino acids were prepared by hydrolysis of the corresponding esters with 1 N sodium hydroxide in methanol, or with 1 N lithium hydroxide in ethanol at room temperature, followed by acidification with hydrochloric acid as described above in Example 12, where the parenthetical lists the starting ester, yield, and - where applicable, [α]r _j ²⁵

Example 13B Synthesis of N-Methyl-N-l(lH-tetrazol-5-vnmethyll-3,3- diphenylpropylamine hydrochloride (Compound A146)

Step 1 A mixture of 2 1 1 g ( 10 mmol) 3.3-dιphenylpropylamιne (Aldnch). (0 54 g. 4 54 mmol) bromoacetonitπle (Aldrich), and 2 5 g potassium carbonate m 5 ml acetonitπle was stirred at room temperature for 16 hours The reaction mixture was diluted with dichloromethane. washed with water, the solvent evaporated, and the residue chromatographed on silica gel column with

30% ethyl acetate in hexanes to give 1 24 g (yield 50%) N-cyanomethyl-3.3-dιphen\lprop>lamme as an oil which solidified on standing 1H NMR (CDC1 ₃ , 300 MHz) 7 45-7 10 (m. 10 H). 4 05 (t, 1 H). 3 50 (s, 2 H). 2 67 (t, 2 H), 2 23 (dt, 2H), ¹³ C NMR (CDCI3. 75 MHz) 144 25.

128 53. 127 68, 126 33, 117 72, 48 58, 47 13, 37 19, 35 14

Step 2 A mixture of 0 72 g (2 9 mmol) N-cyanomcthyI-3.3 -diphenylpropylamine (from step 1). 0 49g (3 4 mmol) lodomethane and 1 6 g potassium carbonate in 5 ml acetonitπle was stirred at room temperature for 16 hours The reaction mixture was diluted with dichloromethane, washed with water, the solvent evaporated, and the residue chromatographed on silica gel column with 20% ethyl acetate in hexanes to give 0 33 g (yield 43%) N-methyl-N-cyanomethyl-3,3- diphenylpropylaminc as an oil which solidified on standing Η NMR ((CDCI3, 300 MHz)

7 30-7 10 (m, 10 H). 4 02 (t, 1 H), 3 47 (s, 3 H). 2 38 (t, 2 H). 2 32 (s, 3H). 2 19 (dt. 2H). Step 3 A mixture of 0 132 g (0 5 mmol) N-methyl-N-cyanomethyl-3.3- diphenylpropylamine (from step 2) and 0 183 g (0 55 mmol) azidotπbutyltin (Aldnch) was stirred at 80°C under argon for 16 hours The reaction mixture was suspended with 1 M solution of hydrogen chloride in diethyl ether (Aldπch) and the precipitated yellow wax was punfied by preparative TLC with 10% methanol in ethyl acetate to give 0 06 g (yield 35%) N-methyl-N-[( lH-tetrazol-5-yl)methyl]-3.3-dιphenylpropylamιne hydrochlonde (Compound A146) as a white powder 1H NMR (DMSO-</ ₆ , 300 MHz) 7 30-7 16 (m. 10 H). 4 1 1 (s, 2 H),

3 97 (t, 1 H), 2 60 (br s, 2 H), 2 45 (s, 3H), 2 36 (br s, 2H)

Example 13C Additional Syntheses Using the Procedure of Example 13B:

Compound A133 was prepared by treatment of compound A30 with azidotπbutyltin as described above in Example 13B (Step 3) - yield 1 1%

Example 13D Synthesis of Dimethyl(ethoxycarbonylmethyl)|3-phenyl-3- (4-trifluoromethylphenoxylpropyll ammonium iodide (Compound A148)

A solution of 0 152 g (0 38 mmol) N-[3-phenyl-3-(4-tπfluoromethylphenoxy)propyll sarcosine ethyl ester (Compound A21) and 0 273 g (1 93 mmol) lodomethanc in 2 ml benzene was heated under reflux for 2 hours and the solvent evaporated The residue was washed three times with anhydrous diethyl ether and dried under vacuum to give 0 175g (yield 85%) dιmethyl(ethoxycarbonylmethyl)[3-phenyl-3-(4-tπfluoromethy lphenoxy)propyl]ammonιum iodide

(Compound A 148) as a pale yellow hygroscopic powder

Example 14 - Preparation of Cells Expressing GlyT-1 and GlvT-2 This example sets forth methods and materials used for growing and transfecting QT-6 cells

QT-6 cells were obtained from American Type Culture Collection (Accession No ATCC

CRL-1708) Complete QT-6 medium for growing QT-6 is Medium 199 (Sigma Chemical

Companj. St Louis, MO, hereinafter "Sigma") supplemented to be 10% tryptose phosphate, 5% fetal bovine serum (Sigma), 1% penicillin-streptomycin (Sigma), and 1% sterile dimethy Isulfoxide

(DMSO, Sigma) Other solutions required for growing or transfecting QT-6 cells included

DNA/DEAE Mix 450 μl TBS, 450 μl DEAE Dextran (Sigma), and 100 μl of DNA (4 μg) in TE, where the DNA includes GlyT-la, GlyT- lb , GlyT-lc, or GlyT-2, in a suitable expression vector The DNA used was as defined below PBS Standard phosphate buffered saline, pH 7 4 including 1 mM CaCl ₂ and 1 mM

MgCl ₂ sterilized through 0 2 μ filter

TBS One ml of Solution B, 10 ml of Solution A. brought to 100 ml with distilled H ₂ 0. filter-steπhzed and stored at 4°C

IE 0 01 M Tπs, 0 001 M EDTA, pH 8 0 DEAE dextran Sigma, #D-9885 A stock solution was prepared consisting of 0 1% (1 mg/ml) of the DEAE dextran in TBS The stock solution was filter sterilized and frozen in 1 ml aliquots

Chloroquine Sigma. #C-6628 A stock solution was prepared consisting of 100 mM chloroquine in H ₂ 0 The stock solution was filter-steπhzed and stored in 0 5 ml aliquots. frozen Solution A (IPX)

NaCI 8 00 g

KC1 0 38 g

Na ₂ HP0 ₄ 0 20 g

Tπs base 3 00 g

The solution was adjusted to pH 7 5 with HCI, brought to 100 0 ml with distilled H ₂ 0 and filter-sterilized and stored at room temperature Solution B (IOOX) CaCl ₂ 2H ₂ 0 1 5 g

MgCl ₂ -6H ₂ 0 1 0 g

The solution was brought to 100 ml with distilled H ₂ 0, and filter-sterilized, the solution was then stored at room temperature

HBSS 150 mM NaCI, 20 mM HEPES, 1 mM CaCl ₂ , 10 mM glucose. 5 mM KC1, 1 mM MgCl ₂ H ₂ 0, adjusted with NaOH to pH 7 4

Standard growth and passaging procedures used were as follows Cells were grown in 225 ml flasks For passaging, cells were washed twice with warm HBSS (5 ml each wash) Two ml of a 0 05% trypsin/EDTA solution was added, the culture was swirled, then the trypsin/EDTA solution was aspirated quickly The culture was then incubated about 2 minutes (until cells lift off), then 10 ml of QT-6 media was added and the cells were further dislodged by swirling the flask and tapping its bottom The cells were removed and transferred to a 15 ml conical tube, centrifuged at 1000 x g for 10 minutes, and resuspended in 10 ml of QT-6 medium A sample was removed for counting, the cells were then diluted further to a concentration of 1 x 10 ^* cells/ml using QT-6 medium, and 65 ml of the culture was added per 225 ml flask of passaged cells Transfection was accomplished using cDNA's prepared as follows

The rat GlyT-2 (rGlyT-2) clone used contains the entire sequence of rGlyT-2 cloned into pBluescript SK+( Stratagene) as an Eco RI - Hind III fragment, as described in Liu et al . J Biol Chem 268. 22802-22808 ( 1993) GlyT-2 was then subcloned into the pRc/RSV vector as follows A PCR fragment corresponding to nucleotides 208 to 702 of the rGlyT-2 sequence was amplified by PCR using the oligonucleotide 5'GGGGGAAGCTTATGGATTGCAGTGCTCC 3' as the 5' primer and the oligonucleotide

5' GGGGGGGTACCCAACACCACTGTGCTCTG 3' as the 3' pπmer This created a Hind III site immediately upstream of the translation start site This fragment, which contained a Kpn I site at the 3' end. along with a Kpn 1 - Pvu II fragment containing the remainder of the coding sequence of rGlyT-2. were cloned into pBluescript SK+ previously digested with Hind III and Sma I. in a three part hgation A Hind III - Xba 1 fragment from this clone was then subcloned into the pRc/RSV vector The resulting construct contains nucleotides 208 to 2720 of the rGlyT-2 nucleic acid in the pRc/RSV expression vector

The human GlyT-la (hGlyT-la) clone used contains the sequence of hGlvT-la from nucleotide position 183 to 2108 cloned into the pRc/CMV vector (Invitrogen. San Diego. CA) as a Hmd Ill-Xba 1 fragment as descnbed in Kim et al . Mol Pharmacol . 45 608-617, 1994 This cDNA encoding GlyT-la actually contained the first 17 nucleotides (corresponding to the first 6 amino acids) of the GlyT-la sequence from rat To determine whether the sequence of human GlyT-la was different in this region, the 5' region of hGlyT-la from nucleotide 1 to 212 was obtained by rapid amplification of cDNA end using the 5' RACE system supplied by Gibco BRL (Gaithersburg, MD) The gene specific pnmer 5' CCACATTGTAGTAGATGCCG 3' corresponding to nucleotides 558 to 539 of the hGlyT-la sequence, was used to pnme cDNA synthesis from human brain mRNA, and the gene specific primer 5'

GCAAACTGGCCGAAGGAGAGCTCC 3', corresponding to nucleotides 454 to 431 of the hGKT-la sequence, was used for PCR amplification Sequencing of this 5' region of GlyT-la confirmed that the first 17 nucleotides of coding sequence are identical in human and rat GlyT-la

The human GlyT- lb (hGlyT-lb) clone used contains the sequence of hGlyT-lb from nucleotide position 213 to 2274 cloned into the pRc/CMV vector as a Hind III - Xba I fragment as described in Kim et al , Mol Pharmacol . 45, 608-617, 1994

The human GlyT-lc (hGlyT-lc) clone used contains the sequence of hGlyT-lc from nucleotide position 213 to 2336 cloned into the pRc/CMV vector (Invitrogen) as a Hind III - Xba I fragment as described in Kim et al , Mol Pharmacol . 45, 608-617. 1994 The Hind III - Xba fragment of hGlyT-lc from this clone was then subcloned into the pRc/RSV vector Transfection expeπments were performed with GlyT-lc in both the pRc/RSV and pRc/CMV expression vectors

The following four day procedure for the tranfections was used

On day 1 , QT-6 cells were plated at a density of 1 x 10^ cells in 10 ml of complete QT-6 medium in 100 mm dishes

On day 2. the media was aspirated and the cells were washed with 10 ml of PBS followed by 10 ml of TBS The TBS was aspirated, and then 1 ml of the DEAE/DNA mix was added to the plate The plate was swirled m the hood every 5 minutes After 30 minutes. 8 ml of 80 μM chloroquine, in QT-6 medium was added and the culture was incubated for 2 5 hours at 37°C and 5% C0 ₂ The medium was then aspirated and the cells were washed two times with complete QT-

6 media, then 100 ml complete QT-6 media was added and the cells were returned to the incubator

On day 3. the cells were removed with trypsin/EDTA as described above, and plated into the wells of 96-well assay plates at approximately 2xl0 ³ cells/well On day 4. glycine transport was assayed (see Example 15) Example 15 - Assay of Transport Via GlyT-1 or GlyT-2 transporters This example illustrates a method for the measurement of glycine uptake by transfected cultured cells

Transient GlyT-transfected cells grown in accordance with Example 14 were washed three times with HEPES buffered saline (HBS) The cells were then incubated 10 minutes at 37°C, after which a solution was added containing 50 nM [ ³ Hjglycine (17 5 Ci/mmol) and either (a) no potential competitor, (b) 10 mM nonradioactive glycine or (c) a concentration of a candidate drug A range of concentrations of the candidate drug was used to generate data for calculating the concentration resulting in 50% of the effect (e g , the IC50S, which are the concentrations of drug inhibiting glycine uptake by 50%) The cells were then incubated another 10 minutes at 37°C, after which the cells were aspirated and washed three times with ice-cold HBS The cells were harvested, scintillant was added to the cells, the cells were shaken for 30 minutes, and the radioactivity m the cells was counted using a scintillation counter Data were compared between the same cells contacted or not contacted by a candidate agent, and between cells having GlyT-1 activity versus cells having GlyT-2 activity, depending on the assay being conducted Example 16 - Assay of Binding to NMDA Receptors This example illustrates binding assays to measure interaction of compounds with the glycine site on the NMDA receptor

Direct binding of [ ³ H]glycιne to the NMDA-glycine site was performed according to the method of Gπmwood et al . Molecular Pharmacology. 41. 923-930 (1992), Yoneda et al , J_ Neurochem. 62. 102-112 (1994) Preparation of membranes for the binding test required application of a series of standard methods Unless otherwise specified, tissues and homogenates were kept on ice and centnfugations were conducted at 4°C Homogenizations were conducted with an effort to minimize resulting πse in tissue/homogenate temperature The membrane preparation included the following steps A Sacπfice and decapitate four rats, remove cortices and hippocampi

B Homogenize tissue in twenty volumes of 0 32 M sucrose/5 mM Tns-Acetate

(pH 7 4) with 20 strokes of a glass/teflon homogemzer

C Centrifuge tissue at 1000 x g, 10 minutes Save supernatant Resuspend pellet in small volume of buffer and homogenize again Centrifuge the homogenized pellet and combine the supernatant with the previous supernatant D Centrifuge the combined supernatants at 40.000 \ g. for 30 minutes Discard the supernatant

E Resuspend the pellet in 20 volumes of 5 mM Tris-Acetate (pH 7 4) Stir the suspension on ice for one hour Centnfuge the suspension at 40.000 x g for 30 minutes Discard the supernatant and freeze the pellet for at least 24 hours F Resuspend the pellet from step 5 in Tπs Acetate buffer (5 mM, pH 7 4) containing 0 1% saponin (w/v, Sigma Chemical Co . St Louis) to a protein concentration of 1 mg/ml Leave on ice for 20 minutes Centnfuge the suspension at 40,000 x g for 30 minutes Resuspend the pellet in saponin-free buffer and centnfuge again Resuspend the pellet in Tπs -Acetate buffer at a concentration of 10 mg/ml and freeze in aliquots G On day three, remove an aliquot of membranes and thaw on ice Dilute the suspension into 10 ml Tπs-Acetate buffer and centrifuge at 40,000 \ g for 30 minutes Repeat the wash step twice more for a total of 3 washes Resuspend the final pellet at a concentration of 1 mg/ml in glycine-free Tris-Acetate buffer The binding test was performed in eppendorf tubes containing 150 μg of membrane protein and 50 nM [ ³ H]glycιne in a volume of 0 5 ml Non-specific binding was determined with 1 mM glycine Drugs were dissolved in assay buffer (50 mM Tπs-acetate. pH 7 4) or DMSO (final concentration of 0 1 %) Membranes were incubated on ice for 30 minutes and bound radioligand was separated from free radioligand by filtration on Whatman GF/B glass fiber filters or by centπfugation (18,000 x g, 20 min) Filters or pellet was washed three times quickly with ice-cold 5 mM Tπs-acetate buffer Filters were dried and placed m scintillation tubes and counted Pellets were dissolved in deoxycholate/NaOH (0 1 N) solution overnight, neutralized and radioactivity was determined by scintillation counting

A second binding test for the NMDA-glycmc site used [ ³ H]dιchlorokynurenιc acid (DCKA) and membranes prepared as above See. Yoneda et al , J Neurochem . 60.634-645 (1993) The binding assay was performed as described for [ ³ H]glycιne above except that

[ ³ H]DCKA was used to label the glycme site The final concentration of [ ³ H]DCKA was 10 nM. and the assay was performed for 10 minutes on ice

A third binding test used for the NMDA-glycine site used indirect assessment of affinity of ligands for the site bv measuring the binding of [ ³ H]MK-801 (dizocilpmc) See Palmer and Burns J Neurochem , 62 187-196 (1994) Preparation of membranes for the test was the same as abo\ e The binding assay allowed separate detection of antagonists and agonists The third binding test was operated to identify antagonists as follows 100 μg of membranes were added to wells of a 96-well plate, along with glutamate (10 μM) and ghcinc (200 nM) and various concentrations of the ligand to be tested The assay was started by the addition of 5 nM [ ³ H]MK-801 (23 9 Ci/mmol). which binds to the ion channel associated with NMDA receptors The final volume of the assay was 200 μl The assay was performed for 1 hour at room temperature Bound radioactivity was separated from free by filtration, using a TOMTEC harvester Antagonist activity was indicated by decreasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand

The third binding test was operated to identify agonists by performing the test as above, except that the concentration of glycine was 200 nM Agonist activity was indicated by increasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand Example 17 - Assay of Calcium Flux

This example illustrates a protocol for measuring calcium flux in pnmarv neuronal calls The calcium flux measurement is performed in primary neuronal cell cultures which are prepared from rat fetal cortices dissected from pregnant rats using standard procedures and techniques that require sterile dissecting equipment, a microscope and defined medium The protocol used was adapted from Lu et al , Proc Nat'l Acad Sci USA. 88, 6289-6292 (1991) is prepared in advance in accordance with the folio

Components Source (catalogue #) Final Concentration

D-glucose Sigma (G-7021) 0 6% transfernn Sigma (T-2252) 100 μg/ml insulin Sigma (1-5500) 25 μg/ml progesterone Sigma (P-6149) 20 nM putrescme Sigma (P-7505) 60 μM selenium Sigma (S-5261) 30 nM pen-strep "* ^• GIBCO (15070-014) 0 5 U-0 5 μg/ml

L-glutamme* GIBCO (25030-016) 146 mg/1

MEM° GIBCO (1 1095 or 1 1090) 500 ml/l

F-12 GIBCO ( 1 1765) 500 ml/l

* ^■ pen-strep 5 000 U/ml penicillin and 5,000 μg/ml steptomycin *add onl> when MEM without L-glutamine is used °wιth L-glutamine or without L-glutamme, respectively

Before starting the dissection, tissue culture plates were treated with polylysine (100 μg/ml for at least 30 minutes at 37°C) and washed with distilled water Also, a metal tray containing two sets of sterile crude dissecting equipment (scissors and tweezers) and several sets of finer dissecting tools was autoclaved A pair of scissors and tweezers were placed into a sterile beaker with 70% alcohol and brought to the dissecting table A petπ dish with cold phosphate buffered saline (PBS) was placed on ice next to the place of dissection

A pregnant rat (El 5 or 16 on arrival from Hilltop Lab Animals (Scottdale PA). El 7 or 18 at dissection) was placed in a C0 ₂ /dry ice chamber until it was unconscious The rat was removed, pinned to a backing, the area of dissection was swabbed with 70% alcohol, and skin was cut and removed from the area of interest A second pair of scissors was used to cut through and remove the prenatal pups in their sacs The string of sacs was placed into the cold PBS and transported to a sterile hood

The prenatal pups were removed from the sacs and decapitated The skulls were then removed and the brains were carefully dislodged and placed into a clean petri dish with cold PBS At this point, it was necessary to proceed with a dissecting microscope The brain was turned so that the cortices were contacting the plate and the tissue between the dissector and the cortex (stπatum and other brain parts) was scooped out The hippocampus and olfactory bulb were cut away from the cortex Then the tissue was turned over and the meninges were removed with tweezers The remaining tissue (cortex) was placed in a small petπ dish with defined media The tissue was chopped with a scalpel and then triturated with a glass pipet that had been fire polished The chopped, triturated tissue was then transfeπed to a stenle plastic tube and continued to be tnturated with a glass pipet with a finer opening Cells were counted in a suitable counting chamber Cells were plated at roughly 40,000 cells/well in 100 μl of defined medium for 96-well plates, 200.000 cells/well in 500 μl m 24-well plates, 400.000 cells/well m 1 ml in 12-well plates, 1 5 * 10 ⁸ cells/35 mm dish in 1 5 ml and 10 * 10 ⁸ cells/100 mm dish in 10 ml To inhibit gha growth, cultures were treated with 100 μM 5-flouro-2-deoxyuπdιne (FDUR. Sigma (F-0503)) or 50/μM undine (Sigma (U-3003)) and 50 μM FDUR

The cortical cultures for the standard calcium flux assay were grown in 24-well plates in the defined medium described above for 7 days and fed once with serum containing media ( 10% heat inactivated fetal calf serum, 0 6% glucose in MEM) by exchanging half of the medium Cultures were used after 12 days of incubation m vitro The cultures were rinsed three times with HCSS (I e HEPES-buffered control salt solution, containing 120 mM NaCI. 5 4 mM KC1

1 8 mM CaCl ₂ 25 mM HEPES, and 15 mM glucose, in HPLC water and adjusted to pH 7 4 by

NaOH which was also made in HPLC water) ln the third wash, the culture was incubated at 37°C for 20 to 30 minutes

Solutions containing ^^Ca ⁺⁺ (5000 dpm/ml) and drugs for testing or controls were prepared in HCSS Immediately before the above ^^Ca+ ⁺ solutions were added, cultures were washed twice with HCSS, and 250 μl of 45ca ⁺ + solution per well was added, one plate at a time

The cultures were incubated for 10 minutes at room temperature, rinsed three times with HCSS, and 1 ml scintillation liquid per well was added, followed by shaking for at least 15 minutes

Retained radioactivity was counted in a scintillation counter Example 18 - Synthesis of N-(3-Cvano-3,3-diphenyl)propyl-2-piperidinecarboxylic acid methyl ester (Compound B9)

A mixture of 0 3 g (1 mmol) of 4-bromo-2.2-dιphenyl butyronitπle (Aldrich, Milwaukee.

WI). 0 359 g (2 mmol) methyl pipecohnate hydrochlonde (Aldnch), 0 553 g (4 mmol) potassium carbonate and 0 166 g (1 mmol) potassium iodide in 5 ml acetonitπle was refluxed under argon for 20 hours The reaction mixture was filtered, the solvent evaporated and the residue chromatographed on silica gel column with 30% ethyl acetate m hexanes to give 0 173 g (yield

48%) of N-(3-cyano-3,3-dιphenyl)propyl-2-pιpeπdιnecarboxyhc acid methyl ester (compound B9) as an oil NMR spectra of the product showed 1H NMR (CDCI3, 300 MHz) 7 50 - 7 20 (m,

10 H). 3 58 (s 3 H), 3 10 - 3 00 (m, 2 H), 2 70 - 2 50 (m. 3 H), 2 50 - 2 35 (m, 1 H). 2 25 - 2 10 (m. 1 H), 1 90 - 1 50 (m, 4 H), 1 40 - 1 20 (m, 2 H), ¹³ C NMR (CDCI3, 75 MHz) 173 59,

140 00, 139 00, 128 71, 127 72, 126 58, 126 46, 121 73, 103 85, 65 09. 52 88, 51 47, 50 92,

49 70, 36 35, 29 27. 24 82, 22 27

Example 19 - Additional Syntheses Using Reaction 1

Additional compounds were synthesized using Reaction 1 as follows Compound Reagent Aminoacid Solvent Yield ii A i x 70%

B2 E 1 X 28%

B3 B 2 Y 13%

B4 B 1 X 57%

B6 C 3 Z 24%

B7 C 1 Z 48%

B8 D 1 X 77%

Bl l D 4 X 61%

B12 B 3 X 43%

B13 B 4 X 39%

B14 C 5 z 63%

B17 F 1 X 65%

Reagent A) 1,1' -(4-chlorobutyhdcne)bιs(4-fluorobenzene) (Acros Orgamcs, Pittsburgh,

PA) B) 4-bromo-l. 1-dιphenyl-l-butene [prepared as described in F A All i et al , J Med Chem .

28 653-660, 1985], C) benzhydryl 2-bromoethyl ether, [prepared as described m M R Pavia et al . J Med Chem . 35 4238-4248, 1992], D) 3,3-dιphenylpropyl tosylate [prepared bv L1AIH4 reduction of 3,3-dιphenylpropιonιc acid (Aldnch) to 3,3-dιphcnylpropanol, followed by tosylation], E) 9-fluorenylethyl tosylate [prepared by LιAlH4 reduction of 9-fluoreneacetιc acid methyl ester (Aldnch) to 2-(9-fluorenyl)ethanol, followed by tosylation], and F) 3.3-bιs(4-fluorophenyl)propyl tosylate [prepared by alkylation of diethyl malonate (Aldnch) with chlorobιs(4-fluorophenyl)methane (Aldnch), followed by hydrolysis and decarboxylation. L1AIH4 reduction of the monocarboxylic acid, and tosylation of the formed alcohol]

Ammo acid 1) methyl pipecohnate hydrochloride (Aldπch), 2) methyl (S-(-)-2-azetιdιnecarboxylate hydrochlonde [prepared by methylation of S-(-)-2- azetidmecarboxyhc acid (Aldnch) with chlorotnmethylsilane (Aldrich) in methanol according to the general procedure descnbed in M A Brook et al , Synthesis, p 201, 1983], 3) L-prohne methyl ester hydrochlonde (Aldπch), 4) methyl (±)-/røm-3-azabιcyclo[3 1 0]hexane-

2-carboxylate hydrochlonde [prepared by methylation of (±)-/røm-3-azabιcyclo[3 1 0]hexane-2- carboxyhc acid (Aldnch) with chlorotnmethylsilane (Aldnch) in methanol according to the general procedure descnbed in M A Brook et al . Synthesis. 201 , 1983], 5) ιndole-2 -carboxylic acid methyl ester hydrochlonde [prepared by methylation of ιndole-2-carboxyhc acid (Aldπch) with chlorotnmethylsilane (Aldπch) in methanol according to the general procedure described in M A Brook et al , Synthesis. 201. 1983]

Solvent X) acetonitnle. Y) dioxane, Z) methanol

Example 20A - Synthesis of N-I(3,3-DiphenyI-3-hvdroxy)propyl|pipecolic acid methyl ester (compound B18)

Step 1 N-[(3-Oxo-3-phenyl)propyl]pιpecohc acid methyl ester A mixture of 3 37 g (20 mmol) 3-chloropropiophenone (Aldrich), 3 59 g (20 mmol) methyl pipecohnate hydrochlonde (Aldnch), 3 32 g (20 mmol) potassium iodide and 2 5 g potassium carbonate in 140 ml of acetonitπle was heated under reflux with stirring for 2h (Reaction 29. Fig 4) The reaction mixture was filtered, the solvent evaporated and the residue dissolved m dichloromethane washed with water and dried over sodium sulphate Evaporation of the solvent gave N-[(3-oxo-3- phenyl)propyl]pιpecohc acid methyl ester as a yellow oil which was used in the next step without further purification

Step 2 0 21 ml of phenylhthium (1 8 M m cyclohexane-ether. Aldnch) was added dropwise into a solution of 0 101 g (0 367 mmol) of N-[(3-oxo-3-phenyl)propyl]pιpecohc acid methyl ester (from step 1) m 5 ml of tetrahydrofuran at -78°C (Reaction 30, Fig 4) After stirring at -78°C for 0 5 h and at 20°C for 0 5 h, the reaction was quenched by adding 5 ml 10% ammonium chloride solution at 0°C The mixture was extracted with methylene chlonde the solvent evaporated and the residue purified by preparative TLC with 40% ethyl acetate in hexanes to give 0 072 g (yield 56%) N-[(3,3-dιphenyl-3-hydroxy)propyl]pιpecohc acid methyl ester

(compound Bl 8) as a pale yellow oil

Example 20B - N-I3-(4-ChIorophenvn-3-(4-fluorophenvn-3- hvdroxypropyHpipecolic acid methyl ester (Compound B30)

Step 1 N-[3-(4-Fluorophenyl)-3-oxopropyl]pιpecohc acid methyl ester was prepared m

92% yield by alkylation of methyl pipecohnate with 3-chloro-4'-fluoropropιophenone (Aldrich) as described in Example 20A (Step 1)

Step 2 N-[3-(4-Chlorophenyl)-3-(4-fluorophenyl)-3-hydroxypropyl]pι pecohc acid methyl ester (Compound B30) 7ml (2 mmol) of 0 28 M solution of 4-chlorophenylmagnesιum iodide m diethyl ether [prepared from l-chloro-4-ιodobenzene (Aldrich) and magnesium] was added dropwise to an ice-cooled solution of 0 605 g (2 mmol) N-[3-(4-fluorophenyl)-3- oxopropyl]pιpecohc acid methyl ester (from Step 1) in 12 ml anhydrous diethyl ether with stirring under nitrogen The mixture was stirred at room temperature for 16 hours, poured onto crushed ice and extracted with dichloromethane The combined organic extracts were washed with bnne concentrated and the residue purified by preparative silica gel TLC with 25 % ethvl acetate in hexanes to give 0 037 g (yield 4 5%) N-[3-(4-chlorophenyl)-3-(4-fluorophenyl)-3- hydroxypropyl]pιpecohc acid methyl ester (Compound B30)

Compound B21 was prepared in 4% yield analogously to Step 2 by reaction of N-(3-oxo-

3-phenylpropyl)pιpecohc acid methyl ester [synthesized analogously to Step 1 of Example 20A from ethyl pipecohnate (Aldnch)] with 4-chlorophenylmagnesιum iodide

Example 20C - N-[3-(4-Chlorophenyl)-3-(4-fluorophenyl)prop-2-enyl|pipecoli c acid methyl ester (Compound B20)

A solution of 0 035 g (0 086 mmol) N-[3-(4-chlorophenyl)-3-(4 fluorophenyl )-3- hydroxypropyl]pιpecohc acid methyl ester (Compound B30) m 1 ml 99% formic acid was heated under reflux for 0 5 hours The mixture was concentrated under vacuum, the residue dissolved in ethyl acetate, washed with saturated sodium bicarbonate solution and brine, and the solvent evaporated The residue was punfied by preparative silica gel TLC with 5% diethyl ether in dichlorometane to give 0 018 g (yield 54%) N-[3-(4-chlorophenyl)-3-(4-fluorophenyl)prop-2- enyl]pιpecohc acid methyl ester (Compound B20)

Example 21 A - Synthesis of N-|3-Phenyl-3-(p-trifluoromethylphenoxy)propyl|pipecolic acid methyl ester (Compound B16) Step 1 0 70 ml of lithium tπ-tert-butoxyaluminohydπde (Aldnch) (1 M in THF) was added into a solution of 0 190 g, (0 69 mmol) N-[(3-oxo-3-phenyl)propyl]pιpecohc acid methyl ester (prepared in step 1 of Example 20A) in 10 ml of THF at -78°C (Reaction 31. Fig 4) After stirring at -78°C for 0 5 h and at room temperature for 20 h, the reaction was quenched b\ adding 10 ml 10% ammonium chloride solution at 0°C, filtered, and extracted with methylene chlonde After evaporation of the solvent, the residue was chromatographed on silica gel column with 30% ethyl acetate in hexanes to give 0 171 g (yield 89%) N-[(3-hydroxy-3-phenyl)propyl]pιpecohc acid meth\l ester as a pale yellow oil

Step 2 To an ice cooled solution of 2 27 g (8 2 mmol) of N-[(3-hydroxy-3- phenyl)propyl]pιpecohc acid methyl ester (from step 1) in 10 ml anhydrous methylene chloride was added dropwise 4 ml (51 mmol) thionyl chloride and the mixture heated under reflux for one hour (Reaction 32, Fig 4) After addition of crushed ice, the reaction mixture was neutralized with saturated solution of potassium carbonate and extracted with methylene chlonde The combined extracts were evaporated and the residue chomatographed on silica gel column with 20% diethyl ether m hexanes to give 1 45 g (yield 60%) N-[(3-chloro-3-phenyl)propyl]pιpecohc acid methyl ester as an oil

Step 3 A solution of 0 082 g (0 28 mmol) of N-[(3-chloro-3-phenyl)propyl]pιpecolιc acid methyl ester (from step 2) in 1 ml of anhydrous dimethylformamide was added into a solution of sodium 4-tπfluoromethylphenoxιde in 2ml anhydrous dimethylformamide at room temperature (Reaction 33, Fig 4) The sodium 4-tπfluoromethylphenoxιde was generated by adding 0 040 g

of 60%o sodium hydride in mineral oil to a solution of 0 165 g ( 1 mmol) of α.α,α-tπfluoro-p-cresol (Aldrich) in 2 ml of dimethylformamide The reaction mixture was stirred at room temperature for 30 h, the solvent evaporated under vacuo and the residue purified by preparative TLC with 30% ethyl acetate in hexanes to give 0 079 g (yield 68%) N-[3-phenyl-3-(p- tπfluoromethylphenoxy)propyl]pιpecohc acid methyl ester (Compound B 16) as a pale yellow oil

Example 21 B - additional Syntheses Using the Procedure of Example 21 A

Compound B23 was prepared by alkylation of 4-tπfluoromethylphenol (Aldnch) with N-

(3-chloro-3-phenylpropyl)pιpccohc acid ethyl ester as described above in Example 21A (Step 3) - yield 6 5% Compound B24 was prepared by alkylation of phenol (Aldnch) with N-(3-chloro-3- phenylpropyl)pιpecohc acid ethyl ester as descnbed above in Example 21A (Step 3) - yield 4% Compound B25 was prepared by alkylation of 4-methoxyphenol (Aldnch) with N-(3- chloro-3-phenylpropyl)pιpecohc acid ethyl ester as descnbed above in Example 21 A (Step 3) - yield 8% Compound B29 was prepared by alkylation of thiophenol (Aldrich) with N-(3-chloro-3- phenylpropyl)pιpecohc acid ethyl ester as descnbed above in Example 21 A (Step 3) - yield 12%

Example 21 C - Synthesis of N-[3-(4-chlorophenoxy)-3-phenylpropyl|pipecolic acid ethyl ester (Compound B22)

0 133g (0 76 mmol) diethyl azodicarboxylate (Aldrich) was added dropwise to a solution of 0 142 g (0 51 mmol) N-(3-hydroxy-3-phenylpropyl)pιpecohc acid methyl ester (from Example

21 A, Step 1), 0 083 g (0 64 mmol) p-chlorophenol (Aldπch) and 0 197 g (0 75 mmol) tnphenylphosphine in 5 ml anhydrous tetrahydrofuran with stimng under nitrogen and cooling with an ice bath The mixture was stirred at room temperature for 4 hours, the solvent evaporated and the residue punfied by preparative silica gel TLC with 30% ethyl acetate m hexanes to give 0 09 g (yield 46%) N-[3-(4-chlorophenoxy)-3-phenylpropyl]pιpecohc acid ethyl ester (Compound

B22) (See Reaction 34, Figure 4 )

Example 22 - Synthesis of N-(4,4-Diphenyl)butyl-2-piperidine carboxylic acid methyl ester (compound B10)

0 040 g (0 11 mmol) of N-[4,4-dιphenyl)but-3-enyl]-2-pιpeπdιne carboxylic acid methyl ester (compound B4) was hydrogenated over 0 030 g 10%Pd/C in 5 ml ethanol under 40 psi for 4 hours at room temperature The mixture was separated from the catalyst by filtration through cehte and the solvent evaporated to give 0 028 g (yield 70%) N-(4.4-dιphenyl)butyl-2-pιpendιne carboxylic acid methyl ester (compound B 10) as an oil NMR spectra of the product showed 1H NMR (CDC1 ₃ , 300 MHz) 7 40 - 7 10 (m. 10 H), 3 88 (t. 1 H). 3 65 (s. 3 H), 3 10 - 2 90 (m, 2

H) 2 60 - 2 45 (m. 1 H). 2 35 - 2 20 (m. 1 H) 2 10 - 1 90 (m 3 H) 1 85 - 1 10 (m 8 H) ¹³ C NMR (CDCI3, 75 MHz) 174 57, 145 36. 145 23. 128 66. 128 12, 128 10 126 34 126 33,

65 66 56 81, 51 78, 51 44, 50 78, 33 81. 29 88, 25 53. 25 39, 22 92

Example 23 - Synthesis of N-|(4,4-Diphenyl)but-3-enyll-L-2-azetidine carboxylic acid hydrochloride (compound B15)

To a solution of 0 050 g (0 3 mmol) of N-[(4,4-dιphenyl)but-3-enyl]-L-2-azetidιne carboxylic acid methyl ester (compound B3) in 2 4 ml ethanol was added 1 2 ml IN lithium hydroxide and the mixture was stirred at room temperature for 20 hours The reaction mixture was concentrated to half volume, acidified with 4 N hydrochloric acid, and extracted 4 times with methylene chlonde The combined extracts were dried and evaporated to give 0 041 g (yield 80%) of N-[(4,4-dιphenyl)but-3-enyl]-L-2-azetιdmc carboxylic acid hydrochlonde (compound B 15) 1H NMR (CD3OD, 300 MHz) 7 50 - 7 00 (m, 10 H), 6 08 (t 1 H), 4 62 (t. 1 H), 4 00 - 3 75 (m, 3

H). 3 30 - 3 20 (m, 1 H), 2 75 - 2 55 (m, 1 H), 2 50 - 2 30 (m, 3 H)

Compound B5 was prepared by hydrolysis of the corresponding ester, compound B14 Compound B19 was prepared by hydrolysis of the corresponding ester, compound B23

While this invention has been described with an emphasis upon preferred embodiments, it will be obvious to those of ordinary skill in the art that variations m the preferred devices and methods may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the claims that foliow