Application Serial No. 08/777,405 filed November 25, 1996.

FIELD OF THE INVENTION The present invention relates generally to the identification and isolation of a novel lipid kinase and more particularly to the discovery of a novel catalytic subunit related to phosphatidylinositol 3-kinase, herein designated pl 106.

BACKGROUND OF THE INVENTION Phosphatidylinositol 3-kinase (PI 3-kinase) was originally identified as an activity associated with viral oncoproteins and growth factor receptor tyrosine kinases which phosphorylates phosphatidylinositol (PI) and phosphorylated derivatives of PI at the 3'-hydroxyl of the inositol ring [Panayotou et al., Trends in Cell Biol., 2:358-360 (1992)]. The initial purification and molecular cloning of PI 3-kinase revealed that it was a heterodimer consisting of p85 and pal 10 subunits [Otsu et al., Cell, 65:91-104 (1992); Hiles et al., Cell, 70:419-429 (1992)].

The p85 subunit acts to localize PI 3-kinase to the plasma membrane by the interaction of its SH2 domain with phosphorylated tyrosine residues (present in an appropriate sequence context) in target proteins [Rameh et al. Cell, 83:821-830 (1995)]. Two isoforms of p85 have been identified, p85a which is ubiquitously expressed, and p85P, which is primarily found in brain and lymphoid tissues [Volinia et al., Oncogene, 7:789-793 (1992)].

The p110 subunit contains the catalytic domain of PI 3-kinase and three isoforms (a, P and y) of p110 have thus far been identified. p110 a and P associate with p85 whereas pllOy which is activated by G protein Py subunits, does not [Stoyanov et al., Science, 269:690-693 (1995)]. The cloning

of p1 tOy revealed additional complexity within this family of enzymes. pl tOy is closely related to pl 10a and P (45-48 % identity in the catalytic domain), but does not make use of p85 as a targeting subunit, instead pllOy contains an additional domain termed a pleckstrin homology domain near its amino terminus. This domain allows interaction with the Py subunits of heterotrimeric G proteins and it appears that it is this interaction that regulates its activity [Stoyanov et al., 1995]. Thus PI 3-kinases are defined by their amino acid identity or their activity. Additional members of this growing gene family include more distantly related lipid and protein kinases including Vps34, TOR1 and TOR2 of Saccharnrnyces cerevisiae (and their mammalian homologous such as FRAP and mTOR), the ataxia telangiectasia gene product, and the catalytic subunit of DNA dependent protein kinase. [See, generally, the review of Hunter, Cell, 83:1-4 (1995).] The levels of phosphatidylinositol (3, 4, 5) triphosphate (PIP3), the primary product of PI 3-kinase activation, increase upon treatment of cells with a wide variety of agonists. PI 3-kinase activation is therefore believed to be involved in a range of cellular responses including cell growth, differentiation aI apoptosis [Parker et al., Current Biology, 5:577-579 (1995); Yao et al., Science, 267:2003-2005 (1995)]. The downstream targets of the phosphorylated lipids generated following PI 3-kinase activation have not been well characterized. In vitro, some isoforms of protein kinase C (PKC) are directly activated by PIP3 and the PKC related protein kinase PKB has been shown to be activated by PI 3-kinase through an as-yet-undetermined mechanism [Burgering and Coffer, Nature, 376:599-602 (1995)].

PI 3-kinase also appears to be involved in a number of aspects of leukocyte activation. A p85 associated PI 3-kinase activity has been shown to physically associate with the cytoplasmic domain of CD28, an important co- stimulatory molecule for the activation of T cells in response to antigen [Pages et al., Nature, 369:327-329 (1994); Rudd, Immunity, 4:527-534 (1996)].

Activation of T cells through CD28 lowers the threshold for activation by antigen and increases the magnitude and duration of the proliferative response.

These effects are linked to increases in the transcription of a number of genes including the T cell growth factor interleukin 2 (IL-2) [Fraser et al., Science, 251:313-316 (1992)]. Mutation of CD28 such that it can no longer interact with PI 3-kinase leads to a failure to initiate IL-2 production, suggesting a critical role for PI 3-kinase in T cell activation [Pages et al. 1994]. Based on studies using the PI 3-kinase inhibitor, wortmannin, there is evidence that PI 3-kinase(s) are also required for some aspects of leukocyte signalling through G protein-coupled receptors [Thelen et al., Proc. Natl. Acad. Sci. USA., 91:4960-4964 (1994)].

There thus continues to exist a need in the art for further insights into the nature, function and distribution of PI 3-kinase providing means for effecting beneficial modulation of PI 3-kinase effects.

SUMMARY OF THE INVENTION The present invention provides novel purified and isolated polynucleotides (i.e., DNA and RNA both sense and antisense strands) encoding a heretofore unknown catalytic member of the PI 3-kinase family, designated p1 105, which is expressed predominantly in leukocytes and thus likely plays a role in PI 3-Kinase mediated signaling in the immune system.

Preferred DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. The DNA sequence encoding p1105 that is set out in SEQ ID NO: 1 and DNA sequences which hybridize to the noncoding strand thereof under standard stringent conditions (or which would hybridize but for the redundancy of the genetic code) are contemplated by the invention. Exemplary stringent hybridization conditions are as follows: hybridization at 65"C in 3X SSC, 20mM NaPO4 pH 6.8 and washing at 65"C in 0.2X SSC. It is understood by

those of skill in the art that variation in these conditions occurs based on the length and GC nucleotide base content of the sequences to be hybridized.

Formulas standard in the art are appropriate for determining exact hybridization conditions. See Sambrook et al., 9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). DNA/DNA hybridization procedures carried out with DNA sequences of the invention under stringent conditions are expected to allow the isolation of DNAs encoding allelic variants of p1 105; non-human species enzymes homologous to pal 105; and other structurally related proteins sharing one or more of the enzymatic activities, or abilities to interact with members or regulators, of the cell pathways in which pal 106 participates.

Also contemplated by the invention are biological replicas (i. e., copies of isolated DNA sequences made in vivo or in vitro) of DNA sequences of the invention. Autonomously replicating recombinant constructions such as plasmid and viral DNA vectors incorporating p1 105 sequences and especially vectors wherein DNA encoding pl 10o is operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. The skilled worker will understand the various components of vectors [e.g. promoter(s), selectable marker(s), origin of replication(s), multiple cloning site(s), etc.], methods for manipulating vectors and the uses of vectors in transforming or transfecting host cells (prokaryotic and eukaryotic) and expressing pal 106 of the present invention.

According to another aspect of the invention, procaryotic or eukaryotic host cells are stably or transiently transformed with DNA sequences of the invention in a manner allowing the expression of p1 105. Host cells expressing p1 105 or pal 105 along with a binding partner thereof can serve a variety of useful purposes. Such cells constitute a valuable source of immunogen for the development of antibody substances specifically immunore- active with p1 105. Host cells of the invention are also useful in methods for

the large scale production of p1 105 wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification.

As described herein, p1 105 is a polypeptide which possess kinase catalytic activity.

In one aspect, the present invention provides pl 10o polypeptides.

The catalytic domain of p1 105 polypeptide (amino acid residues 723-1044 of SEQ ID NO: 2) exhibits greater than 72 % identity to the catalytic domain of pl 10 P. Preferably, the polypeptides of this invention exhibit identity to the catalytic domain of pllOP of 75% or greater. Even more preferably, the polypeptides comprise the amino acid residues according to SEQ ID NO: 2.

Yet another aspect of this invention provides polypeptide fragments or analogs of pal 105. The fragments of p1 105 are useful in modulating the binding of pal 106 and a binding partner (e.g., p85, Ras, and growth factor receptors). Analogs are polypeptides in which additions, substitutions, including conservative substitutions, or deletions of amino acid residues have been made in order to increase or decrease the binding affinity of the analog and a binding partner. These analogs of pllOQ may be useful for modulating (i. e., blocking, inhibiting, or stimulating) the interaction between p1106 and a binding partner.

The polypeptides of this invention may be modified to facilitate passage into the cell, such as by conjugation to a lipid soluble moiety. For example, p1 105 (or fragments or analogs thereof) may be conjugated to myristic acid. The peptides may be myristoylated by standard techniques as described in Eichholtz et al., J. Biol. Chem. 268:1982-1986 (1993), incorporated herein by reference. Alternatively, the peptides may be packaged in liposomes that may fuse with cell membranes and deliver the peptides into the cells. Encapsulation of the peptides in liposomes may also be performed by

standard techniques as generally described in U.S. Patent Nos. 4,766,046; 5,169,637; 5,180,713; 5,185,154; 5,204,112; and 5,252,263 and PCT Patent Application No. 92/02244, each of which is incorporated herein by reference.

Another aspect of this invention provides antibody substances (e.g., polyclonal and monoclonal antibodies, antibody fragments, single chain antibodies, chimeric antibodies, CDR-grafted antibodies, humanized antibodies and the like) specifically immunoreactive with p1 105. Antibody substances can be prepared by standard techniques using isolated naturally-occurring or recombinant p1 105. Specifically illustrating monoclonal antibodies of the present invention is the monoclonal antibody produced by hybridoma cell line 208F which was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852 on October 8, 1996 and was assigned Accession No. HB 12200. The antibody substances are useful in modulating (i.e., blocking, inhibiting, or stimulating) the binding between pllOS and its binding partner. Antibody substances are also useful for purification of pal 105 and are also useful for detecting and quantifying p1 105 in biological samples by known immunological procedures. In addition, cell lines (e.g., hybridomas) or cell lines transformed with recombinant expression constructs which produce antibody substances of the invention are contemplated.

In another aspect, methods of identifying a modulator that inhibits or activates the kinase activity of pllOb are contemplated. In a preferred method, kinase activity of p1 105 in the presence and absence of a potential modulator compound is determined and compared. A reduction in the kinase activity observed in the presence of the test compound indicates that the test compound is an inhibitor. An increase in the kinase activity observed in the presence of the test compound indicates that the test compound is an activator.

In another aspect, this invention provides methods of identifying

a modulator that affects the binding of p1 105 and a binding partner (e.g., p85, Ras and growth factor receptors) and thereby increases or decreases the effective specific subcellular concentration of p1 105. In this method, pl 10o and its binding partner are incubated in the presence and absence of a putative modulator under conditions suitable for binding. The observed binding in the presence and absence of the modulator compound is compared. A reduction in the observed binding indicates that the compound inhibits binding. An increase in the observed binding indicates that the compound increases binding. These modulators are useful in affecting localization of pl 10o to a specific subcellular location.

Modulators contemplated by the invention, for example, include polypeptides, polypeptide fragments of p1 105, and other organic and inorganic chemical compounds.

This invention further provides a method of detecting the presence of pl 10O in a biological sample. The method comprises exposing a pl 10o specific antibody to a biological sample to be tested. The binding of the pal 105 specific antibody to p1106 in the biological sample is detected by well- known means. For example, a second antibody conjugated to horseradish peroxidase (HRP) that specifically recognizes anti-pll0b antibody is used to detect anti-pll0b antibody. A positive color reaction catalyzed by HRP indicates that p1 105 is present in the biological sample.

Yet another aspect of this invention provides a diagnostic reagent for detecting the presence of polynucleotides that encode p1106 in biological samples. The diagnostic reagent is a detectably labeled polynucleotide encoding part or all of the amino acid residues of pl 10o set out in SEQ ID NO: 2. The presence of the polynucleotide in the biological sample is determined by hybridization of the diagnostic reagent to the polynucleotide encoding pllos.

Exemplary biological samples include chromosomes and chromosomal DNA.

The diagnostic reagent is detectably labeled with well-known labels, including

radioactive, enzymatic or other ligands, such as avidin/biotin, and fluorescent tags which are capable of providing a detectable signal.

The DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or "knockout" strategies [see e.g. Capecchi, Science 244: 1288-1292 (1989)] of mammals that fail to express a functional p1 105 or that express a variant analog of pal 105. The mammals of the present invention comprise a disrupted p1 105 gene or a disrupted homolog of the pal 105 gene. The general strategy utilized to produce the mammals of the present invention involves the preparation of a targeting construct comprising DNA sequences homologous to the endogenous gene to be disrupted. The targeting construct is then introduced into embryonic stem cells (ES cells) whereby it integrates into and disrupts the endogenous gene or homolog thereof. After selecting cells which include the desired disruption, the selected ES cells are implanted into an embryo at the blastocyst stage. Exemplary mammals include rabbits and rodent species.

Polynucleotides of the invention are also expected to be useful in chromosomal localization studies potentially useful in detection of inappropriate and/or over expression of p1106 in abnormal cell types.

Also made available by the invention are antisense polynucleotides relevant to regulating expression of p1 105 by those cells which ordinarily express the same.

Numerous additional aspects and advantages of the present invention will be apparent from the following detailed description of illustrative embodiments thereof.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 presents an alignment of the predicted catalytic domain of pl 105 with the corresponding domain of other members of the PI 3-kinase family. The alignment was performed using Geneworks (Intelligenetics, Inc.,

Mountain View, CA).

Figure 2 presents an alignment of the predicted Ras regulatory region of pl 10o with the corresponding region of other members of the PI 3- kinase family. The conserved lysine which is essential for interaction with Ras is indicated by the symbol # below the consensus line.

DETAILED DESCRIPTION OF THE INVENTION The present invention is illustrated by the following examples.

Example 1 describes the cloning and characterization of cDNA encoding p1 105. pllOS was obtained by combining three separate cDNA clones spanning the full length pal 105 cDNA. Example 2 describes the expression and kinase activity of recombinant p1 105. Example 3 describes the isolation of a mouse genomic p1 105 clone. Baculovirus expression of p1106 is described in Example 4. Example 5 assesses the ability of recombinant p1106 to associate with p85 in transfected mammalian cells. The expression of pal 105 in various human tissues is disclosed in Example 6. Example 7 provides monoclonal antibodies specific for pal 105. Example 8 describes experiments directed to chromosomal localization of pal 105. Example 9 describes experiments related to the association of pal 105 and growth factor receptors. Example 10 discusses the use of transgenic animals which are engineered to include a disruption in the pl 10o gene.

Example 1 Degenerate oligonucleotide primers were designed for use in a PCR reaction based on sequences conserved in the catalytic domain of known PI 3-kinases. The sense primer was GCACACGGATCCGGIGAYGAYHKIAGRCARGA (SEQ ID NO: 3) encoding the sequence GDDLRQD (SEQ ID NO: 4), and the anti-sense primer was GCAGACGAATTCRWRICCRAARTCIRYRTG (SEQ ID NO: 5) encoding the amino acid sequence HIDFGH (SEQ ID NO: 6). Bam HI and

Eco RI restriction sites are underlined. PCR reactions consisted of 100 ng of cDNA template [from human peripheral blood mononuclear cells (PBMC) activated for 18 hours with 10 ng/ml phorbol myristate and 250 ng/ml calcium ionophore (Sigma)], 10 ,ug/ml oligonucleotide primers, 50mM KC1, lOmM Tris HC1 (pH 8.4), 1.5mM MgCl2, 200mM dNTPs, and 1U of Taq polymerase in a final volume of 100 t£l. Reactions were performed using denaturation for 1 minute at 94"C, annealing at 60"C for 2 minutes and extension for at 72"C for 1 minutes for 3 cycles. The procedure was then repeated using 56"C annealing temperature for 3 cycles, 52"C annealing temperature for 3 cycles and 50"C annealing temperature for 30 cycles. Amplified products were gel purified, digested with Bam HI and Eco RI, and subcloned into the vector pBSSKII+ (Stratagene, La Jolla, CA) for sequencing. All DNA for sequencing was prepared using the Wizard Miniprep DNA Purification System (Promega, Madison, WI). Sequencing was performed on the Applied Biosystems Model 373 automated sequencer. Data bank searches were made using the BLAST program, and protein and DNA alignments were made using the Geneworks program antelligenetics Inc. Mountain View Ca.) One clone contained a 399 bp insert that encoded a 133 amino acid open reading frame showing similarity to p1 lop. This clone was a partial clone of a new catalytic subunit of PI 3- kinase designated p1 105.

To identify a cDNA encoding pl 105, specific oligonucleotide primers were designed based on the sequence of the 399 bp PCR product. The forward primer was CATGCTGACCCTGCAGATGAT (SEQ ID NO: 7) and the reverse primer was AACAGCTGCCCACTCTCTCGG (SEQ ID NO: 8). These primers were used to screen a cDNA library from human PBMC stimulated with PMA and ionomycin (as described above) in the mammalian expression vector pRc-CMV.

Successive rounds of PCR were performed initially on pools of 100,000 clones and subsequently on smaller pools until a single clone termed PBMC #249 was isolated by colony hybridization using the PCR product labelled by random

priming as a probe. This cDNA was not full length. Therefore to identify longer cDNA clones the same approach was used to screen a cDNA library from human macrophages (also in the vector pRcCMV). This led to the isolation of an additional cDNA clone (M#928) which extended the cDNA sequence by 1302 bp.

The remaining 5' end of the cDNA encoding p1 105 was obtained by 5' RACE PCR (Clonetech, Palo Alto, CA.) Two anti-sense gene-specific oligonucleotide primers were designed based on the 5' end of cDNA M#928 for RACE PCR reactions. The primary RACE primer was GGGCCACATGTAGAGGCAGCGTTCCC (SEQ ID NO: 9) and the nested RACE primer was GGCCCAGGCAATGGGGCAGTCCGCC (SEQ ID NO: 10). Marathon-Race reactions were set up using Marathon-ready cDNA template from Human Leukocytes and the Advantage Core PCR Reaction kit (Clonetech, Palo Alto, CA) following the manufacturer's protocol. Touchdown PCR cycling conditions were modified to improve the specificity of the Marathon-RACE PCR primary reaction as follows: denaturation at 94"C for 2 minutes, followed by 5 cycles of denaturation at 94"C for 30 seconds and annealing and extension at 72"C for 3 minutes; 5 cycles of denaturation at 94"C for 30 seconds and annealing and extension at 70"C for 3 minutes; and 25 cycles of denaturation at 94"C for 30 seconds and annealing and extension at 68"C for 3 minutes.

Amplified products were used as templates in a nested PCR reaction using the previously described cycling parameters. The reamplified products were then analyzed by Southern blotting using oligonucleotide probes specific for p1 105. Probes (lOOng each) were end-labelled with 32P-yATP, and hybridized and washed under standard conditions (Frisch and Sambrook). The sequences of the two probes were GATGCGGAACGGCTGCTCCAGGG (SEQ ID NO: 11) and CCAGGGACCACAGGGACACAGAG (SEQ ID NO: 12).

The specific 5' RACE PCR products identified in this manner were gel purified and subcloned into the TA vector PCRII (Invitrogen, San

Diego, CA) according to the manufacturer's instructions. Three independent clones were sequenced to ensure the veracity of the 5' sequence.

A full length cDNA for p1105 was assembled from clones #249, M#928 and the 5' RACE PCR products. The 5' RACE product was used as a template in PCR using the 5'primer <BR> <BR> <BR> AGTTACGGATCCGGCACCATG(GACTACAAGGACGACGATGACAAG)CCCCCTGGGGTGG A CTGCCC (SEQ ID NO: 13) and the 3 primer CCACATGTAOAGGCAGCGTTCC (SEQ ID NO: 14). The 5' primer includes a Bam HI site (underlined), and sequences that encode the FLAG peptide sequence DYKDDDDK (SEQ ID NO: 15) (shown in parenthesis) which is recognized by the M2 anti-FLAG monoclonal antibody (Kodak Scientific Imaging Systems, New Haven, CT). The resulting PCR product was digested with Bam HI and Afl II, and was ligated along with an Afl II/Pvu I fragment derived from the clone M#928 and a Pvu II/Xba I fragment derived from PBMC clone #249 into the Bam HI/Xba I sites of the mammalian expression vector pcDNA3 (Invitrogen, San Diego, CA). The vector containing the FLAG-tagged composite p1 105 cDNA is designated pCDNA3:p1 1O5FLAG. In the FLAG-tagged pl 10ô, the FLAG-tag is located immediately after the initiating methionine.

A full-length composite cDNA encoding p1 105 is shown in SEQ ID NO: 1. The sequence of p1 105 includes an open reading frame of 3135 nucleotides which is predicted to encode a protein of approximately 114 KD.

In addition, there are 197 bp of 5' and 1894 bp of 3' untranslated sequence.

The sequence around the predicted initiating methionine is in good agreement with that required for optimal translational initiation [Kozak, M., J. Cell Biol., 115:887-992 (1991)] and the presence of stop codons in the 5' untranslated sequence is consistent with the isolation of the complete coding region of p1105.

Comparison of the deduced amino acid sequence of p1 105 (SEQ ID NO: 2) with other PI 3-kinases reveals that it is most closely related to

pllOP. Similar to pl lOP, the catalytic domain of pllOS is found in the C- terminus of the protein and is believed to be reside within amino acid residues 723-1044 of SEQ ID NO: 2. An alignment of the predicted carboxyl terminal catalytic domains of the PI 3-kinase family (including pal 105 residues 723 through 1044 of SEQ ID NO: 2) is shown in Figure 1. Table 1 shows the identity of pllOb to other members of the PI 3-kinase family. p1 105 is 72% identical to pl lOP in this region but is less closely related to pl lOa (49 %) and pllOy (45%). Table 1 also shows that pllOô shows low identity to cpk/pl70 and the yeast Vps 34 protein, 31 and 32% respectively.

TABLE 1 p110# p110 p110α p110γ cpk/p170 Vps34 p110# - 72 49 45 31 32 p110 - 49 48 37 31 pllOa - 45 39 29 pllOy - 39 31 cpk/pl 70 - 28 Vps34 Dendrogram analysis revealed that pl lOP and p1 105 form a distinct sub-branch of the PI 3-kinase family. The distantly related ATM gene and the catalytic subunit of DNA dependent protein kinase have been included for comparison.

It has been demonstrated that PI 3-kinase is an important intermediate in the Ras pathway [Hu et al. 1993; Rodriguez-Viciana et al., EMBO Journal, 15:2442-2451 (1996)]. A constitutively active form of PI 3-kinase has been shown to increase transcription of the c-fos gene, activate the protein kinase Raf, and stimulate oocyte maturation [Hu et al., 1995]. The

effects of PI 3-kinase in these systems can be blocked by co-expression of a dominant negative form of Ras indicating that PI 3-kinase acts upstream of Ras.

Additional studies have shown that Ras can physically interact with PI 3-kinase in vitro and stimulate its kinase activity [Rodriguez-Viciana et al., 1996]. Thus PI 3-kinase can either act as an effector of Ras-dependent signalling or be directly activated by interaction with Ras. A specific region at the amino terminus of the p110 subunits termed the Ras regulatory domain is responsible for this interaction [Rodriguez-Viciana et al. 1996]. Comparison of the sequence of p110S with other p110 subunits indicates that this region is also conserved in p110S including a lysine residue which has been shown to be essential for physical association with Ras (Rodriguez-Viciana et al., 1996).

Thus p1106 is also likely to interact with the Ras pathway. Figure 2 presents an alignment of the proposed Ras binding sites of four pal 10 subunits including p1106 residues 141 through 310 of SEQ ID NO: 2.

Example 2 The FLAG-tagged p1 105 was expressed by transfecting pCDNA3:pllOôFLAG into COS cells using DEAE dextran. Three days after transfection, expression of p1106 was determined by immunoprecipitations and western blotting using the M2 monoclonal antibody (Kodak Scientific Imaging Systems) according to the manufacturer's instructions. PI 3-kinase activity was determined as described [Hu et al., Mol. Cell. Biol., 13:7677-7688 (1993)].

To determine the PI 3-kinase activity of p1 105, 5,ul of immunoprecipitated p110# was mixed with 1y1 of PI/EGTA and incubated at room temperature for 10 minutes [PI/EGTA is 10mg/ml PI(Sigma) in CHCl3, which has been dried under a vacuum, resuspended in 20 mg/ml DMSO in the presence or absence of various concentrations of the PI3 kinase inhibitor wortmannin and diluted 1:10 in 5mM EGTA] and added to 1y1 10X HM buffer (200mM HEPES pH7.2, 50mM MnCl2), 0.5 ,ul y32PATP (lOmCi/ml-

300Ci/mmol), l,ul 100,uM ATP, and 1.5µl H20 and incubated at 30°C for 15 minutes. The reactions were terminated by addition of 100µl 1M HCl. Lipids were extracted with 200C11 CHCl3/MeOH (1:1) by vortexing for 1 minute followed by centrifugation at 16,000 x g for 2 minutes at room temperature.

The lipids were further extracted with 80,u1 1M HCl/MeOH (1:1) by vortexing for 1 minutes, followed by centrifugation at 16,000 x g for 2 minutes at room temperature. The lipids were dried under vacuum, resuspended in 10y1 CHCl3/MeOH (1:1) and spotted 2cm from the bottom of a dry Silica gel 60 chromatography plate (VWR) that had been pre-impregnated with 1 % K2C2O4 in H2O. 250yg of crude phosphoinositides (Sigma) were spotted as markers.

The products were resolved by chromatography for 2 hours in CHCl3/MeOH/4N NH4OH (9:7:2), allowed to dry and placed in an Iodine vapor tank for 5 minutes in order to visualize the crude standards. The position of the standards was marked with a pencil and the plate was autoradiographed.

Phosphorylated lipids were generated in the kinase assays. The major product was phosphatidyl inositol phosphate (PIP). Furthermore, the generation of these phosphorylated lipids was inhibited in a dose dependent manner by wortmannin (approximately 50 % of the activity was inhibited at 100 nM wortmannin) demonstrating that pllOb is a functional PI3 kinase.

Example 3 A mouse genomic clone encoding p1 105 was isolated as described below.

A mouse 129 SvEv lambda genomic library (Stratagene, La Jolla, Ca.) was screened using a fragment of the human cDNA clone for pal 105 (corresponding to amino acids 739 to 1044 of SEQ ID NO.: 2) labelled to high specific activity ( 1 x 109 dpm/ug DNA) by random priming using the Random Primed DNA labelling Kit (Boehringer Mannheim). Hybridization was performed for sixteen hours at 42°C in buffer containing 50% formamide, 5X SSC, 5 X Denhardts, 0.05M Na phosphate, and 100 ug/ml salmon sperm DNA. Filters were washed

in 0.2 XSSC/0.1 % SDS at 50"C. A single clone was isolated. Purified phage DNA was digested with Not I and inserts were subcloned into the vector pBSSKII+ (Stratagene, La Jolla, Ca.) for sequencing. This clone was approximately 16kb and included the entire catalytic region of p1 105.

Example 4 Recombinant p1 105 may be expressed in SF9 insect cells using a baculovirus expression system.

As discussed in Example 1, FLAG-tagged p1 105 encoding sequences are useful in expressing the kinases of this invention. Upon expression in insect cells, a monoclonal antibody that recognizes the FLAG tag (Eastman Kodak, Rochester, New York) is used to purify large quantities of the FLAG-PIK-related kinase fusion protein. Infected insect cells are incubated for 48 hours and lysed in lysis buffer (25mM 2-glycerolphosphate, 50mM sodium phosphate pH 7.2, 0.5% Triton-X 100, 2mM EDTA, 2mM EGTA, 25 mM sodium fluoride, 100,uM sodium vanadate, lmM PMSF, l,ug/ml leupeptin, l,ug/ml pepstatin, lmM benzamidine, and 2mM DTT). Expressed FLAG fusion proteins are purified over a column containing anti-FLAG antibody M2 affinity resin (Eastman Kodak). The column is washed with 20 column volumes of lysis buffer, then 5 column volumes of 0.5M lithium chloride, 50mM Tris pH 7.6, lmM DTT, and then eluted either with 0. 1M glycine pH 3.0 followed by immediate neutralization or by competitive elution with the FLAG peptide. For histidine tagged proteins, Ni-NTA agarose (Qiagen) is used for protein purification.

Plasmids for expression of p85 and p1 105 in the baculovirus expression sytstem were prepared as follows.

The plasmid pcDNA3:p85 DNA as described in Example 5 was digested with BamHI and EcoRI and the 2.5 kb FLAG-p85 band containing the entire p85 coding region with the FLAG tag was gel purified and inserted in

BamHI-EcoRI site of pFastbac Dual (Gibco BRL). The ligation mixture was transformed into E. coli XL-1 blue (Stratagene) and plated on ampicillin containing plate. A clone was purified that carries the pFastbac-Dual-p85 plasmid.

The pFastbac-Dual-p85 plasmid was transformed into E. coli DH 10 Bac cells and white colonies were selected on plates containing kanomycin, gentamycin, tetracyoline, X-gel and IPTG. One white colony was restreaked on a similar plate for repurification. Recombinant p85-bacmid DNA was purified from this clone.

The plasmid pcDNA3:p1 105 containing the entire pal 105 coding region with the FLAG tag was digested with BamHI and XbaI, gel purified and inserted into the BamHI-XbaI site of pFastbac HTb (Gibco BRL) such that the coding region of FLAG-tagged p1106 was in frame with the coding sequences of the histidine-tag present in the vector. The ligation mixture was then transformed into E. coli XL-1 blue (Stratagene). A clone carrying pFast-bac Htb p1 105 was isolated and the plasmid DNA was isolated and the plasmid DNA was purified. P11OQ-bacmid DNA was prepared by transforming E. coli DOH10 bac cells as described for p85-bacmid.

To prepare virus stocks, the p85-bacmid and the pl 10ô-bacmid DNAs were separately transfected into SF-9 cells according to the Gibco BRL suggested protocol. Forty-eight hours after transfection, the SF9 cell pellet and baculovirus produced by the transfected cells were harvested. The virus was stored at 4"C in Grace's Complete media containing 10% FBS, pennicillin- streptomycin, and gentamicin. This viral prep was used to make a high titer (P2) virus stock. The P2 virus stock was used to infect a 50 ml culture of SF9 cells. The cells were collected 48 hours after infection and centrifuged at low speed to pellet the cells without lysis. The cell pellet was stored at -20°C for 24 hours before lysis. The cells were lysed in 5 ml of lysis buffer (50 mM Tris, pH 8.0; 500 mM NaCl; 1% NP40; 100 i£m PMSF). Expression of p85

and pi 105 was confirmed by immunoblot using the M2 antibody anti-FLAG as a probe. The SF-9 transfected cells produced an approximately 85 kDa protein and a 110 kDa protein which were immunoreactive with anti-FLAG antibodies.

The P2 virus stock were also used to co-infect a 2 liter culture of SF9 cells. The cells were collected 48 hours after infection, centrifuged at low speed to pellet the cells without lysis and stored at -20°C. A cell pellet from 150 mls of this culture was lysed in 7.5 ml of lysis buffer (5OmM NaPO4 pH7.2; 0.5% NP-40; lOniM imidazole, 25mM NaF, 100M Na3VO4; 0.5mM AEBSF; 1 ,ug/ml leupeptin; l,ug/ml pepstatin A) and incubated on ice for 15 minutes. The lysate was then centrifuged for 30 minutes at 10,000 x g. The supernatant was removed and any DNA in the lysate resulting from broken nuclei was sheared by aspirating through an 20 gauge needle. Particulate matter was then removed by filtering through a 0.8 micron filter followed by a 0.2 micron filter. This cleared lysate was adjusted to contain 5 mM P- mercaptoethanol and 0.4 M NaCl. A 1 ml Ni-NTA-agarose column (Qiagen) was equilibrated in Buffer A (0.4 M NaCl; 5 mM P-mercaptoethanol; O. 1% Triton X-100; 50 mM NaPO4 10 mM imidazole; 25 mM NaF, 100 µM Na3VO4; 0.5 mM AEBSF; 1 ,ug/ml leupeptin; 1 yg/ml pepstatin A) prior to loading the cleared lysate. The sample was loaded at a flow rate of 0.25 ml/minute, washed 5 ml of Buffer A and then eluted in 10 ml of a gradient of 50 to 500 mM imidazole in Buffer A.

Example 5 The ability of pal 105 to associate with p85 was assessed by Western blot analysis. COS cells were transiently transfected with pit05 (see Example 2) and association with endogenous p85 was determined by coimmunoprecipitation. As controls, cells were also transfected with FLAG- tagged p85 DNA or empty vector. The cDNA encoding the p85 subunit was isolated from human leukocyte cDNA by Marathon-race PCR. The cDNA

sequence of p85 was described in Otsu, Cell, 65:91-104 (1992). The p85 cDNA was modified for expression as a FLAG-tagged protein (pcDNA3: p85) in a manner similar to the protocols described herein for p1 105.

COS cells were lysed in 3ml Buffer R (1 % Triton X-100, 150mM Nail, lOmM Tris pH7.5, lmM EGTA, 0.5% NP-40, 0.2mM Na3VO4, 0.2mM PMSF, 1X aprotinin, 1X leupeptin, 1X pepstatin A). After 10 minutes at 4°C, the lysates were sheared by passing through a 27G needle several times. The lysates were clarified by centrifugation at 16,000 x g for 10 minutes at 4°C, and immunoprecipitated for 2 hours at 4°C with either l,ug anti-pllO (Santa Cruz Laboratories, Santa Cruz, CA), lOyg anti-FLAG-M2 (Eastman Kodak), or tug anti-p85 (Santa Cruz Laboratories). Immune complexes were bound to 60y1 of Protein G-sepharose (Pharmacia) for 30 minutes at 4°C then washed 3 times in 300,u1 of Buffer R and resuspended in 25,u1 PAN (l00mM Nail, tOmM PIPES pH7.0, 208zg/ml Aprotinin). 5,u1 of each immunoprecipitate was resolved by 8% SDS-PAGE (Novex), transferred to Immobilon-P (Millipore), blocked one hour at room temperature in 5 % non- fat dried milk in TBS, and detected by Western blotting using either anti-p85 rabbit polyclonal antibodies (Santa Cruz Laboratories) at lyg/ml followed by goat anti-rabbit IgG HRP conjugated secondary antibody (Boehringer) or anti- FLAG-M2 monoclonal antibody at lOyg/ml followed by goat anti-mouse IgG HRP conjugated secondary antibody (Boehringer).

The Westerns showed that anti-FLAG-M2 antibody recognized immune complexes including FLAG-tagged p85 and FLAG-tagged pt 105.

Example 6 While the activation of PI 3-kinase in a wide range of biological systems has been extensively studied, less is known concerning the cell type specific expression of particular p110 isoforms. The expression of p110# in human heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas,

spleen, thymus, prostate, testis, uterus, small intestine, colon, and PBMC was determined by Northern blot analysis.

32P-labelled cDNA probes were prepared by PCR using lOng of plasmid DNA template encoding pal 105, as described previously [Godiska et al, J. Neuroimmun., 58:167-176 (1995)]. The forward primer was CTGCCATGTTGCTCTTGTTGA (SEQ ID NO: 16) and the reverse primer was GAGTTCGACATCAACATC (SEQ ID NO: 17). Reactions were heated for 4 minutes at 94"C, followed by 15 cycles of denaturation for 1 minutes at 94"C, annealing for 1 minutes at 55"C and extension for 2 minutes at 72"C.

Unincorporated nucleotides were removed by passing the reaction over a sephadex G50 column (Boehringer Mannheim Biochemicals).

A Multiple Tissue Northern blot (Clontech, Palo Alto, CA) was probed and washed under stringent conditions according to the manufacturer's recommen- dations. The autoradiograph was exposed for 1-4 days at -80°C with intensifying screens.

Northern blot analysis revealed a single transcript of approxi- mately 5.4 kb (consistent with the size of the composite cDNA). The highest levels of expression were seen in peripheral blood mononuclear cells (PBMC) and in spleen and thymus. On prolonged exposure of the autoradiograph, expression of pllOQ could also be detected in testes, uterus, colon, and small intestine, but not in other tissues examined including prostate, heart, brain, and liver. In contrast, pl lOP is expressed at high levels in brain, heart, kidney and liver, but cannot be readily detected in lymphoid tissues such as spleen. pt tOP is expressed at high levels in the transformed Jurkat T cell line (Hu et al.

1993). The expression of the p1 lOa isoform has not been well documented.

pl 10 isoforms have been shown to differ with respect to their preferred substrate specificities [Stephens et al., Current Biology, 4:203-214 (1994)]. In view of their potential for interaction with a common p85 adaptor

protein, it is likely that the nature of the phosphorylated lipids generated in response to a particular agonist may be regulated at least in part by the cell/tissue specific expression of the different isoforms of the kinase enzymatic activity. The abundant expression of p1105 in PBL and lymphoid tissues such as spleen and thymus suggests that this isoform may be involved in aspects of leukocyte activation.

Example 7 Monoclonal antibodies were generated against the carboxy terminal portion of p1105 (amino acids 740-1044 of SEQ ID NO: 2) expressed as a fusion protein with glutathione S transferase (GST) [Pharmacia, Alameda, CA]. Five Balb/c mice (Charles River Biotechnical Services, Inc., Wilming- ton, Massachusetts, IACUC #901103) were immunized subcutaneously with 30ug of antigen in complete Freund's adjuvant [CFA] (Sigma), a second immunization of 30ug of antigen in incomplete Freunds adjuvant (IFA) (Sigma) was administered on day 22. A third immunization with 30ug of antigen in IFA was administered on day 44. Immune serum was collected via retro-orbital bleeding on day 55 and tested by western blotting to determine reactivity to p1 105. All animals showed reactivity towards the immunogen and were immunized a fourth time on day 66 with 30ug of antigen in IFA. Immune serum was collected via retro-orbital bleeding on day 76 and tested by western blotting to determine its reactivity, animal #2321 showed the highest level of immunoreactivity and was chosen for fusion. On day 367 and 368 mouse #2321 was injected intraperitoneally with 50ug of antigen in PBS and a fusion was performed on day 371.

The spleen was removed sterilely and a single-cell suspension was formed by grinding the spleen between the frosted ends of two glass microscope slides submerged in serum free RPMI 1640, supplemented with 21nM L-glutamine, lmM sodium pyruvate, 100 units/ml penicillin, and 100

,ug/ml streptomycin (RPMI) (Gibco, Canada). The cell suspension was filtered through sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, New Jersey), and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 ml serum free RPMI. Thymocytes taken from 3 naive Balb/c mice were prepared in the same manner.

Two x 108 spleen cells were combined with 4 x 107 NS-1 cells (kept in log phase in RPMI with 11 % fetal bovine serum (FBS) for three days prior to fusion), centrifuged and the supernatant was aspirated. The cell pellet was dislodged by tapping the tube and 2 ml of 37"C PEG 1500 (50% in 75 mM Hepes, pH 8.0) (Boehringer Mannheim) was added with stirring over the course of 1 minute, followed by adding 14 ml of serum free RPMI over 7 minutes.

An additional 16 ml RPMI was added and the cells were centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet was resuspended in 200 ml RPMI containing 15% FBS, 100 mM sodium hypoxanthine, 0.4 mM aminopterin, 16 mM thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and 1.5 x 106 thymocytes/ml. The suspension was dispensed into ten 96-well flat bottom tissue culture plates (Corning, United Kingdom) at 200 l/well. Cells were fed on days 2, 4, and 6 days post-fusion by aspirating 100 jul from each well with an 18 G needle (Becton Dickinson), and adding 100 ijI/well plating medium containing 10 U/ml IL-6 and lacking thymocytes.

When cell growth reached 60-80% confluence (day 8-10), culture supernatants were taken from each well and screened for reactivity to Pt105 by ELISA. Immulon 4 plates (Dynatech, Cambridge, Massachusetts) were coated at 4"C with 50 yl/well with loong/well of pl lOo:GST or GST in 50 mM carbonate buffer, pH 9.6. Plates were washed 3X with PBS with 0.05%, Tween 20 (PBST), blocked 30 minutes at 37"C with 0.5% Fish Skin Gelatin. Plates were washed as described above and 50 y1 culture supernatant was added. After incubation at 37"C for 30 minutes, 50 tcl of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch,

West Grove, PA) [diluted 1:10,000 in PBST] was added. Plates were incubated at 37"C for 30 minutes, washed 4X with PBST and 100 y1 of substrate, consisting of 1 mg/ml TMB (Sigma) and 0.15ml/ml 30% H202 in 100 mM Citrate, pH 4.5, was added. The color reaction was stopped in 3 minutes with the addition of 50 ml of 15% H2SO4. A4so was read on a plate reader (Dynatech).

Thirty-six wells showed preferential reactivity to pllO5 versus GST. Supernatants from these wells were then screened for reactivity to recombinant pllO5 by Western blotting. Ten wells (208A, 208B, 208C, 208D, 208E, 208F, 208G, 208H, 208I, and 208J) showed reactivity by Western blotting and were cloned twice by limiting dilution. Selected wells were tested by ELISA 7-10 days later. Activity was retained in all ten lines. Monoclonal antibodies produced by the cell lines were isotyped by ELISA assay. 208A, 208C, 208D, 208E, 208G, 208H, 208I were IgG2a, while 208J was IgG1 and 208B was IgG2b. An exemplary monoclonal antibody, produced by hybridoma cell line 208F (ATCC HB 12200), showed high reactivity with p1 105 and recognized a 110 kD protein in PBMC by Western analysis. The molecular weight of the 110 kD protein is consistent with the molecular weight of pllOb.

Example 8 Elevated levels of 3' phosphorylated phosphoinositides have been detected in cells transformed with viral oncoproteins. This observation suggests that PI 3-kinases may play a role in carcinogenesis. Chromosomal localization of p1 105 provides insights into the role of PI 3-kinase in carcinogenesis.

Chromosomal localization studies of pal 105 of cancerous cells may identify inappropriate and/or over expression of put 105.

For example, in 90-95 % of chronic myelogenous leukaemia there is a reciprocal chromosomal translocation which leads to the transfer of the

tyrosine kinase c-abl from chromosome 9 into the ber gene on chromosome 22.

The resultant inappropriate expression of c-abl tyrosine kinase activity is critical for cell transformation and tumorigenesis. Chromosomal localization of pllO6 is determined by fluorescence in situ hybridization (FISH) using the complete cDNA for p1106 as a probe. In this manner, the role of pllO5 in chromosomal translocations observed during tumorigenesis (e.g. leukemogenesis) is identified.

Example 9 PI 3-kinase activity has been reported to be associated with a number of growth factor receptors. In addition, it has been observed that PI 3-kinase activity increases following cell activation. The antibodies to ptlO5 disclosed in Example 5 are utilized to determine by Western blotting and immunoprecipitation the nature of the receptors with which pllO5 associates.

These antibodies are also useful in elucidating the regulation of PI 3-kinase enzymatic activity and cellular localization during cell activation. In view of the high levels of expression of p1105 in the immune system, it is likely that growth factor receptors involved in immune activation may associate with or be regulated by p1106. These receptors include T-cell receptors CD28 and CD2 and cytokine receptors such as IL-1 and IL-4, and tyrosine kinase coupled receptors such as CSF-1 R.

Example 10 To determine the functional role of pllOb in vivo, the p1 105 gene is inactivated in the germline of mammals by homologous recombination.

Animals in which an endogenous gene has been inactivated by homologous recombination are also known as "knockout" animals. Exemplary mammals include rabbits and rodent species such as mice. "Knockout" animals can be prepared by homologous recombination methods using the p1108 genomic

clone of Example 3.

These "knockout" animals allow for the determination of the role of p1 105 in immune and proliferative responses. The role of p1 105 in immune and proliferative response is determined by analysis of the development of the immune system in these animals (as determined by FACS analysis of cell populations at different stages of development), characterization of the effector function of the mature lymphoid populations of these animals both in vivo (as determined by antibody responses to injected antigens, cytotoxic T cell responses to viruses and or injected tumor cell lines, and the ability to reject allografts) and in vitro (as determined by proliferation of lymphocytes in response to allo-antigen, polyclonal activation by mitogens/superantigens, and the ability to elaborate cytokines).

While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the appended claims should be placed on the invention.

SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: Chantry, David Hoekstra, Merl F.

Holtzman, Douglas A (ii) TITLE OF INVENTION: Novel Lipid Kinase (iii) NUMBER OF SEQUENCES: 17 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: Marshall O'Toole Gerstein Murray & Borun (B) STREET: 6300 Sears Tower/233 South Wacker Drive (C) CITY: Chicago (D) STATE: Illinois (E) COUNTRY: USA (F) ZIP: 60606 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (viii) ATTORNEY/AGENT INFORMATION: (A) NAME: Noland, Greta E.

(B) REGISTRATION NUMBER: 35,302 (C) REFERENCE/DOCKET NUMBER: 27866/33441 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (312) 474-6300 (B) TELEFAX: (312) 474-0448 (C) TELEX: 25-3856 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5220 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 196.3327 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CAGTCGCTCC GAGCGGCCGC GAGCAGAGCC GCCCAGCCCT GTCAGCTGCG CCGGGACGAT 60 AAGGAGTCAG GCCAGGGCGG GATGACACTC ATTGATTCTA AAGCATCTTT AATCTGCCAG 120 GCGGAGGGGG CTTTGCTGGT CTTTCTTGGA CTATTCCAGA GAGGACAACT GTCATCTGGG 180 AAGTAACAAC GCAGG ATG CCC CCT GGG GTG GAC TGC CCC ATG GAA TTC TGG 231 Met Pro Pro Gly Val Asp Cys Pro Met Glu Phe Trp 1 5 10 ACC AAG GAG GAG AAT CAG AGC GTT GTG GTT GAC TTC CTG CTG CCC ACA 279 Thr Lys Glu Glu Asn Gln Ser Val Val Val Asp Phe Leu Leu Pro Thr 15 20 25 GGG GTC TAC CTG AAC TTC CCT GTG TCC CGC AAT GCC AAC CTC AGC ACC 327 Gly Val Tyr Leu Asn Phe Pro Val Ser Arg Asn Ala Asn Leu Ser Thr 30 35 40 ATC AAG CAG CTG CTG TGG CAC CGC GCC CAG TAT GAG CCG CTC TTC CAC 375 Ile Lys Gln Leu Leu Trp His Arg Ala Gln Tyr Glu Pro Leu Phe His 45 50 55 60 ATG CTC AGT GGC CCC GAG GCC TAT GTG TTC ACC TGC ATC AAC CAG ACA 423 Met Leu Ser Gly Pro Glu Ala Tyr Val Phe Thr Cys Ile Asn Gln Thr 65 70 75 GCG GAG CAG CAA GAG CTG GAG GAC GAG CAA CGG CGT CTG TGT GAC GTG 471 Ala Glu Gln Gln Glu Leu Glu Asp Glu Gln Arg Arg Leu Cys Asp Val 80 85 90 CAG CCC TTC CTG CCC GTC CTG CGC CTG GTG GCC CGT GAG GGC GAC CGC 519 Gln Pro Phe Leu Pro Val Leu Arg Leu Val Ala Arg Glu Gly Asp Arg 95 100 105 GTG AAG AAG CTC ATC AAC TCA CAG ATC AGC CTC CTC ATC GGC AAA GGC 567 Val Lys Lys Leu Ile Asn Ser Gln Ile Ser Leu Leu Ile Gly Lys Gly 110 115 120 CTC CAC GAG TTT GAC TCC TTG TGC GAC CCA GAA GTG AAC GAC TTT CGC 615 Leu His Glu Phe Asp Ser Leu Cys Asp Pro Glu Val Asn Asp Phe Arg 125 130 135 140 GCC AAG ATG TGC CAA TTC TGC GAG GAG GCG GCC GCC CGC CGG CAG CAG 663 Ala Lys Met Cys Gln Phe Cys Glu Glu Ala Ala Ala Arg Arg Gln Gln 145 150 155 CTG GGC TGG GAG GCC TGG CTG CAG TAC AGT TTC CCC CTG CAG CTG GAG 711 Leu Gly Trp Glu Ala Trp Leu Gln Tyr Ser Phe Pro Leu Gln Leu Glu 160 165 170 CCC TCG GCT CAA ACC TGG GGG CCT GGT ACC CTG CGG CTC CCG AAC CGG 759 Pro Ser Ala Gln Thr Trp Gly Pro Gly Thr Leu Arg Leu Pro Asn Arg 175 180 185 GCC CTT CTG GTC AAC GTT AAG TTT GAG GGC AGC GAG GAG AGC TTC ACC 807 Ala Leu Leu Val Asn Val Lys Phe Glu Gly Ser Glu Glu Ser Phe Thr 190 195 200 TTC CAG GTG TCC ACC AAG GAC GTG CCG CTG GCG CTG ATG GCC TGT GCC 855 Phe Gln Val Ser Thr Lys Asp Val Pro Leu Ala Leu Met Ala Cys Ala 205 210 215 220 CTG CGG AAG AAG GCC ACA GTG TTC CGG CAG CCG CTG GTG GAG CAG CCG 903 Leu Arg Lys Lys Ala Thr Val Phe Arg Gln Pro Leu Val Glu Gln Pro 225 230 235 GAA GAC TAC ACG CTG CAG GTG AAC GGC AGG CAT GAG TAC CTG TAT GGC 951 Glu Asp Tyr Thr Leu Gln Val Asn Gly Arg His Glu Tyr Leu Tyr Gly 240 245 250 AAC TAC CCG CTC TGC CAG TTC CAG TAC ATC TGC AGC TGC CTG CAC AGT 999 Asn Tyr Pro Leu Cys Gln Phe Gln Tyr Ile Cys Ser Cys Leu His Ser 255 260 265 GGG TTG ACC CCT CAC CTG ACC ATG GTC CAT TCC TCC TCC ATC CTC GCC 1047 Gly Leu Thr Pro His Leu Thr Met Val His Ser Ser Ser Ile Leu Ala 270 275 280 ATG CGG GAT GAG CAG AGC AAC CCT GCC CCC CAG GTC CAG AAA CCG CGT 1095 Met Arg Asp Glu Gln Ser Asn Pro Ala Pro Gln Val Gln Lys Pro Arg 285 290 295 300 GCC AAA CCA CCT CCC ATT CCT GCG AAG AAG CCT TCC TCT GTG TCC CTG 1143 Ala Lys Pro Pro Pro Ile Pro Ala Lys Lys Pro Ser Ser Val Ser Leu 305 310 315 TGG TCC CTG GAG CAG CCG TTC CGC ATC GAG CTC ATC CAG GGC AGC AAA 1191 Trp Ser Leu Glu Gln Pro Phe Arg Ile Glu Leu Ile Gln Gly Ser Lys 320 325 330 GTG AAC GCC GAC GAG CGG ATG AAG CTG GTG GTG CAG GCC GGG CTT TTC 1239 Val Asn Ala Asp Glu Arg Met Lys Leu Val Val Gln Ala Gly Leu Phe 335 340 345 CAC GGC AAC GAG ATG CTG TGC AAG ACG GTG TCC AGC TCG GAG GTG AGC 1287 His Gly Asn Glu Met Leu Cys Lys Thr Val Ser Ser Ser Glu Val Ser 350 355 360 GTG TGC TCG GAG CCC GTG TGG AAG CAG CGG CTG GAG TTC GAC ATC AAC 1335 Val Cys Ser Glu Pro Val Trp Lys Gln Arg Leu Glu Phe Asp Ile Asn 365 370 375 380 ATC TGC GAC CTG CCC CGC ATG GCC CGT CTC TGC TTT GCG CTG TAC GCC 1383 Ile Cys Asp Leu Pro Arg Met Ala Arg Leu Cys Phe Ala Leu Tyr Ala 385 390 395 GTG ATC GAG AAA GCC AAG AAG GCT CGC TCC ACC AAG AAG AAG TCC AAG 1431 Val Ile Glu Lys Ala Lys Lys Ala Arg Ser Thr Lys Lys Lys Ser Lys 400 405 410 AAG GCG GAC TGC CCC ATT GCC TGG GCC AAC CTC ATG CTG TTT GAC TAC 1479 Lys Ala Asp Cys Pro Ile Ala Trp Ala Asn Leu Met Leu Phe Asp Tyr 415 420 425 AAG GAC CAG CTT AAG ACC GGG GAA CGC TGC CTC TAC ATG TGG CCC TCC 1527 Lys Asp Gln Leu Lys Thr Gly Glu Arg Cys Leu Tyr Met Trp Pro Ser 430 435 440 GTC CCA GAT GAG AAG GGC GAG CTG CTG AAC CCC ACG GGC ACT GTG CGC 1575 Val Pro Asp Glu Lys Gly Glu Leu Leu Asn Pro Thr Gly Thr Val Arg 445 450 455 460 AGT AAC CCC AAC ACG GAT AGC GCC GCT GCC CTG CTC ATC TGC CTG CCC 1623 Ser Asn Pro Asn Thr Asp Ser Ala Ala Ala Leu Leu Ile Cys Leu Pro 465 470 475 GAG GTG GCC CCG CAC CCC GTG TAC TAC CCC GCC CTG GAG AAG ATC TTG 1671 Glu Val Ala Pro His Pro Val Tyr Tyr Pro Ala Leu Glu Lys Ile Leu 480 485 490 GAG CTG GGG CGA CAC AGC GAG TGT GTG CAT GTC ACC GAG GAG GAG CAG 1719 Glu Leu Gly Arg His Ser Glu Cys Val His Val Thr Glu Glu Glu Gln 495 500 505 CTG CAG CTG CGG GAA ATC CTG GAG CGG CGG GGG TCT GGG GAG CTG TAT 1767 Leu Gln Leu Arg Glu Ile Leu Glu Arg Arg Gly Ser Gly Glu Leu Tyr 510 515 520 GAG CAC GAG AAG GAC CTG GTG TGG AAG CTG CGG CAT GAA GTC CAG GAG 1815 Glu His Glu Lys Asp Leu Val Trp Lys Leu Arg His Glu Val Gln Glu 525 530 535 540 CAC TTC CCG GAG GCG CTA GCC CGG CTG CTG CTG GTC ACC AAG TGG AAC 1863 His Phe Pro Glu Ala Leu Ala Arg Leu Leu Leu Val Thr Lys Trp Asn 545 550 555 AAG CAT GAG GAT GTG GCC CAG ATG CTC TAC CTG CTG TGC TCC TGG CCG 1911 Lys His Glu Asp Val Ala Gln Met Leu Tyr Leu Leu Cys Ser Trp Pro 560 565 570 GAG CTG CCC GTC CTG AGC GCC CTG GAG CTG CTA GAC TTC AGC TTC CCC 1959 Glu Leu Pro Val Leu Ser Ala Leu Glu Leu Leu Asp Phe Ser Phe Pro 575 580 585 GAT TGC CAC GTA GGC TCC TTC GCC ATC AAG TCG CTG CGG AAA CTG ACG 2007 Asp Cys His Val Gly Ser Phe Ala Ile Lys Ser Leu Arg Lys Leu Thr 590 595 600 GAC GAT GAG CTG TTC CAG TAC CTG CTG CAG CTG GTG CAG GTG CTC AAG 2055 Asp Asp Glu Leu Phe Gln Tyr Leu Leu Gln Leu Val Gln Val Leu Lys 605 610 615 620 TAC GAG TCC TAC CTG GAC TGC GAG CTG ACC AAA TTC CTG CTG GAC CGG 2103 Tyr Glu Ser Tyr Leu Asp Cys Glu Leu Thr Lys Phe Leu Leu Asp Arg 625 630 635 GCC CTG GCC AAC CGC AAG ATC GGC CAC TTC CTT TTC TGG CAC CTC CGC 2151 Ala Leu Ala Asn Arg Lys Ile Gly His Phe Leu Phe Trp His Leu Arg 640 645 650 TCC GAG ATG CAC GTG CCG TCG GTG GCC CTG CGC TTC GGC CTC ATC CTG 2199 Ser Glu Met His Val Pro Ser Val Ala Leu Arg Phe Gly Leu Ile Leu 655 660 665 GAG GCC TAC TGC AGG GGC AGC ACC CAC CAC ATG AAG GTG CTG ATG AAG 2247 Glu Ala Tyr Cys Arg Gly Ser Thr His His Met Lys Val Leu Met Lys 670 675 680 CAG GGG GAA GCA CTG AGC AAA CTG AAG GCC CTG AAT GAC TTC GTC AAG 2295 Gln Gly Glu Ala Leu Ser Lys Leu Lys Ala Leu Asn Asp Phe Val Lys 685 690 695 700 CTG AGC TCT CAG AAG ACC CCC AAG CCC CAG ACC AAG GAG CTG ATG CAC 2343 Leu Ser Ser Gln Lys Thr Pro Lys Pro Gln Thr Lys Glu Leu Met His 705 710 715 TTG TGC ATG CGG CAG GAG GCC TAC CTA GAG GCC CTC TCC CAC CTG CAG 2391 Leu Cys Met Arg Gln Glu Ala Tyr Leu Glu Ala Leu Ser His Leu Gln 720 725 730 TCC CCA CTC GAC CCC AGC ACC CTG CTG GCT GAA GTC TGC GTG GAG CAG 2439 Ser Pro Leu Asp Pro Ser Thr Leu Leu Ala Glu Val Cys Val Glu Gln 735 740 745 TGC ACC TTC ATG GAC TCC AAG ATG AAG CCC CTG TGG ATC ATG TAC AGC 2487 Cys Thr Phe Met Asp Ser Lys Met Lys Pro Leu Trp Ile Met Tyr Ser 750 755 760 AAC GAG GAG GCA GGC AGC GGC GGC AGC GTG GGC ATC ATC TTT AAG AAC 2535 Asn Glu Glu Ala Gly Ser Gly Gly Ser Val Gly Ile Ile Phe Lys Asn 765 770 775 780 GGG GAT GAC CTC CGG CAG GAC ATG CTG ACC CTG CAG ATG ATC CAG CTC 2583 Gly Asp Asp Leu Arg Gln Asp Met Leu Thr Leu Gln Met Ile Gln Leu 785 790 795 ATG GAC GTC CTG TGG AAG CAG GAG GGG CTG GAC CTG AGG ATG ACC CCC 2631 Met Asp Val Leu Trp Lys Gln Glu Gly Leu Asp Leu Arg Met Thr Pro 800 805 810 TAT GGC TGC CTC CCC ACC GGG GAC CGC ACA GGC CTC ATT GAG GTG GTA 2679 Tyr Gly Cys Leu Pro Thr Gly Asp Arg Thr Gly Leu Ile Glu Val Val 815 820 825 CTC CGT TCA GAC ACC ATC GCC AAC ATC CAA CTC AAC AAG AGC AAC ATG 2727 Leu Arg Ser Asp Thr Ile Ala Asn Ile Gln Leu Asn Lys Ser Asn Met 830 835 840 GCA GCC ACA GCC GCC TTC AAC AAG GAT GCC CTG CTC AAC TGG CTG AAG 2775 Ala Ala Thr Ala Ala Phe Asn Lys Asp Ala Leu Leu Asn Trp Leu Lys 845 850 855 860 TCC AAG AAC CCG GGG GAG GCC CTG GAT CGA GCC ATT GAG GAG TTC ACC 2823 Ser Lys Asn Pro Gly Glu Ala Leu Asp Arg Ala Ile Glu Glu Phe Thr 865 870 875 CTC TCC TGT GCT GGC TAT TGT GTG GCC ACA TAT GTG CTG GGC ATT GGC 2871 Leu Ser Cys Ala Gly Tyr Cys Val Ala Thr Tyr Val Leu Gly Ile Gly 880 885 890 GAT CGG CAC AGC GAC AAC ATC ATG ATC CGA GAG AGT GGG CAG CTG TTC 2919 Asp Arg His Ser Asp Asn Ile Met Ile Arg Glu Ser Gly Gln Leu Phe 895 900 905 CAC ATT GAT TTT GGC CAC TTT CTG GGG AAT TTC AAG ACC AAG TTT GGA 2967 His Ile Asp Phe Gly His Phe Leu Gly Asn Phe Lys Thr Lys Phe Gly 910 915 920 ATC AAC CGC GAG CGT GTC CCA TTC ATC CTC ACC TAT GAC TTT GTC CAT 3015 Ile Asn Arg Glu Arg Val Pro Phe Ile Leu Thr Tyr Asp Phe Val His 925 930 935 940 GTG ATT CAG CAG GGG AAG ACT AAT AAT AGT GAG AAA TTT GAA CGG TTC 3063 Val Ile Gln Gln Gly Lys Thr Asn Asn Ser Glu Lys Phe Glu Arg Phe 945 950 955 CGG GGC TAC TGT GAA AGG GCC TAC ACC ATC CTG CGG CGC CAC GGG CTT 3111 Arg Gly Tyr Cys Glu Arg Ala Tyr Thr Ile Leu Arg Arg His Gly Leu 960 965 970 CTC TTC CTC CAC CTC TTT GCC CTG ATG CGG GCG GCA GGC CTG CCT GAG 3159 Leu Phe Leu His Leu Phe Ala Leu Met Arg Ala Ala Gly Leu Pro Glu 975 980 985 CTC AGC TGC TCC AAA GAC ATC CAG TAT CTC AAG GAC TCC CTG GCA CTG 3207 Leu Ser Cys Ser Lys Asp Ile Gln Tyr Leu Lys Asp Ser Leu Ala Leu 990 995 1000 GGG AAA ACA GAG GAG GAG GCA CTG AAG CAC TTC CGA GTG AAG TTT AAC 3255 Gly Lys Thr Glu Glu Glu Ala Leu Lys His Phe Arg Val Lys Phe Asn 1005 1010 1015 1020 GAA GCC CTC CGT GAG AGC TGG AAA ACC AAA GTG AAC TGG CTG GCC CAC 3303 Glu Ala Leu Arg Glu Ser Trp Lys Thr Lys Val Asn Trp Leu Ala His 1025 1030 1035 AAC GTG TCC AAA GAC AAC AGG CAG TAGTGGCTCC TCCCAGCCCT GGGCCCAAGA 3357 Asn Val Ser Lys Asp Asn Arg Gln 1040 GGAGGCGGCT GCGGGTCGTG GGGACCAAGC ACATTGGTCC TAAAGGGGCT GAAGAGCCTG 3417 AACTGCACCT AACGGGARAG AACCGACATG GCTGCCTTTT GTTTACACTG GTTATTTATT 3477 TATGACTTGA AATAGTTTAA GGAGCTAAAC AGCCATAAAC GGAAACGCCT CCTTCATTCA 3537 GCGGCGGTGC TGGGCCCCCC GAGGCTGCAC CTGGCTCTCG GCTGAGGATT GTCACCCCAA 3597 GTCTTCCAGC TGGTGGATCT GGGCCCAGCA AAGACTGTTC TCCTCCCGAG GGAACCTTCT 3657 TCCCAGGCCT CCCGCCAGAC TGCCTGGGTC CTGGCGCCTG GCGGTCACCT GGTGCCTACT 3717 GTCCGACAGG ATGCCTCGAT CCTCGTGCGA CCCACCCTGT GTATCCTCCC TAGACTGAGT 3777 TCTGGCAGCT CCCCGAGGCA GCCGGGGTAC CCTCTAGATT CAGGGATGCT TGCTCTCCAC 3837 TTTTCAAGTG GGTCTTGGGT ACGAGAATTC CCTCATCTTT CTCTACTGTA AAGTGATTTT 3897 GTTTGCAGGT AAGAAAATAA TAGATGACTC ACCACACCTC TACGGCTGGG GAGATCAGGC 3957 CCAGCCCCAT AAAGGAGAAT CTACGCTGGT CCTCAGGACG TGTTAAAGAG ATCTGGGCCT 4017 CATGTAGCTC ACCCCGGTCA CGCATGAAGG CAAAAGCAGG TCAGAAGCGA ATACTCTGCC 4077 ATTATCTCAA AAATCTTTTT TTTTTTTTTT TTGAGATGGG GTCTTCCTCT GTTGCCCAGG 4137 CTGGAGTGCA GTGGTGCAAT CTTGGCTCAC TGTAACCTCC GCCTCCCAGG TTCAAGTGAT 4197 TCTTCTTGCC TCAGCCTCCT GAGTAGCTGG GATTACAGGT GTGCACCACC CGTACCCAGC 4257 TAATTTTTGT ATTTTAGTAG AGACGGGGGT TTCACCATGT TGGCTGGGCT GGTCTCGAAC 4317 TCCTGACCTC AGGTGATCCA CCCGCCTGAG CCTCCCAAAG TGCTGGGATT ACAGGCATGA 4377 GCCACCACGC CCGGCCCACT CTGCCATTGT CTAAGCCACC TCTGAAAGCA GGTTTTAACA 4437 AAAGGATGAG GCCAGAACTC TTCCAGAACC ATCACCTTTG GGAACCTGCT GTGAGAGTGC 4497 TGAGGTACCA GAAGTGTGAG AACGAGGGGG CGTGCTGGGA TCTTTCTCTC TGACTATACT 4557 TAGTTTGAAA TGGTGCAGGC TTAGTCTTAA GCCTCCAAAG GCCTGGATTT GAGCAGCTTT 4617 AGAAATGCAG GTTCTAGGGC TTCTCCCAGC CTTCAGAAGC CAACTAACTC TGCAGATGGG 4677 GCTAGGACTG TGGGCTTTTA GCAGCCCACA GGTGATCCTA ACATATCAGG CCATGGACTC 4737 AGGACCTGCC CGGTGATGCT GTTGATTTCT CAAAGGTCTT CCAAAACTCA ACAGAGCCAG 4797 AAGTAGCCGC CCGCTCAGCG GCTCAGGTGC CAGCTCTGTT CTGATTCACC AGGGGTCCGT 4857 CAGTAGTCAT TGCCACCCGC GGGGCACCTC CCTGGCCACA CGCCTGTTCC CAGCAAGTGC 4917 TGAAACTCAC TAGACCGTCT GCCTGTTTCG AAATGGGGAA AGCCGTGCGT GCGCGTTATT 4977 TATTTAAGTG CGCCTGTGTG CGCGGGTGTG GGAGCACACT TTGCAAAGCC ACAGCGTTTC 5037 TGGTTTTGGG TGTACAGTCT TGTGTGCCTG GCGAGAAGAA TATTTTCTAT TTTTTTAAGT 5097 CATTTCATGT TTCTGTCTGG GGAAGGCAAG TTAGTTAAGT ATCACTGATG TGGGTTGAGA 5157 CCAGCACTCT GTGAAACCTT GAAATGAGAA GTAAAGGCAG ATGAAAAGAA AAAAAAAAAA 5217 AAA 5220 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1044 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Pro Pro Gly Val Asp Cys Pro Met Glu Phe Trp Thr Lys Glu Glu 1 5 10 15 Asn Gln Ser Val Val Val Asp Phe Leu Leu Pro Thr Gly Val Tyr Leu 20 25 30 Asn Phe Pro Val Ser Arg Asn Ala Asn Leu Ser Thr Ile Lys Gln Leu 35 40 45 Leu Trp His Arg Ala Gln Tyr Glu Pro Leu Phe His Met Leu Ser Gly 50 55 60 Pro Glu Ala Tyr Val Phe Thr Cys Ile Asn Gln Thr Ala Glu Gln Gln 65 70 75 80 Glu Leu Glu Asp Glu Gln Arg Arg Leu Cys Asp Val Gln Pro Phe Leu 85 90 95 Pro Val Leu Arg Leu Val Ala Arg Glu Gly Asp Arg Val Lys Lys Leu 100 105 110 Ile Asn Ser Gln Ile Ser Leu Leu Ile Gly Lys Gly Leu His Glu Phe 115 120 125 Asp Ser Leu Cys Asp Pro Glu Val Asn Asp Phe Arg Ala Lys Met Cys 130 135 140 Gln Phe Cys Glu Glu Ala Ala Ala Arg Arg Gln Gln Leu Gly Trp Glu 145 150 155 160 Ala Trp Leu Gln Tyr Ser Phe Pro Leu Gln Leu Glu Pro Ser Ala Gln 165 170 175 Thr Trp Gly Pro Gly Thr Leu Arg Leu Pro Asn Arg Ala Leu Leu Val 180 185 190 Asn Val Lys Phe Glu Gly Ser Glu Glu Ser Phe Thr Phe Gln Val Ser 195 200 205 Thr Lys Asp Val Pro Leu Ala Leu Met Ala Cys Ala Leu Arg Lys Lys 210 215 220 Ala Thr Val Phe Arg Gln Pro Leu Val Glu Gln Pro Glu Asp Tyr Thr 225 230 235 240 Leu Gln Val Asn Gly Arg His Glu Tyr Leu Tyr Gly Asn Tyr Pro Leu 245 250 255 Cys Gln Phe Gln Tyr Ile Cys Ser Cys Leu His Ser Gly Leu Thr Pro 260 265 270 His Leu Thr Met Val His Ser Ser Ser Ile Leu Ala Met Arg Asp Glu 275 280 285 Gln Ser Asn Pro Ala Pro Gln Val Gln Lys Pro Arg Ala Lys Pro Pro 290 295 300 Pro Ile Pro Ala Lys Lys Pro Ser Ser Val Ser Leu Trp Ser Leu Glu 305 310 315 320 Gln Pro Phe Arg Ile Glu Leu Ile Gln Gly Ser Lys Val Asn Ala Asp 325 330 335 Glu Arg Met Lys Leu Val Val Gln Ala Gly Leu Phe His Gly Asn Glu 340 345 350 Met Leu Cys Lys Thr Val Ser Ser Ser Glu Val Ser Val Cys Ser Glu 355 360 365 Pro Val Trp Lys Gln Arg Leu Glu Phe Asp Ile Asn Ile Cys Asp Leu 370 375 380 Pro Arg Met Ala Arg Leu Cys Phe Ala Leu Tyr Ala Val Ile Glu Lys 385 390 395 400 Ala Lys Lys Ala Arg Ser Thr Lys Lys Lys Ser Lys Lys Ala Asp Cys 405 410 415 Pro Ile Ala Trp Ala Asn Leu Met Leu Phe Asp Tyr Lys Asp Gln Leu 420 425 430 Lys Thr Gly Glu Arg Cys Leu Tyr Met Trp Pro Ser Val Pro Asp Glu 435 440 445 Lys Gly Glu Leu Leu Asn Pro Thr Gly Thr Val Arg Ser Asn Pro Asn 450 455 460 Thr Asp Ser Ala Ala Ala Leu Leu Ile Cys Leu Pro Glu Val Ala Pro 465 470 475 480 His Pro Val Tyr Tyr Pro Ala Leu Glu Lys Ile Leu Glu Leu Gly Arg 485 490 495 His Ser Glu Cys Val His Val Thr Glu Glu Glu Gln Leu Gln Leu Arg 500 505 510 Glu Ile Leu Glu Arg Arg Gly Ser Gly Glu Leu Tyr Glu His Glu Lys 515 520 525 Asp Leu Val Trp Lys Leu Arg His Glu Val Gln Glu His Phe Pro Glu 530 535 540 Ala Leu Ala Arg Leu Leu Leu Val Thr Lys Trp Asn Lys His Glu Asp 545 550 555 560 Val Ala Gln Met Leu Tyr Leu Leu Cys Ser Trp Pro Glu Leu Pro Val 565 570 575 Leu Ser Ala Leu Glu Leu Leu Asp Phe Ser Phe Pro Asp Cys His Val 580 585 590 Gly Ser Phe Ala Ile Lys Ser Leu Arg Lys Leu Thr Asp Asp Glu Leu 595 600 605 Phe Gln Tyr Leu Leu Gln Leu Val Gln Val Leu Lys Tyr Glu Ser Tyr 610 615 620 Leu Asp Cys Glu Leu Thr Lys Phe Leu Leu Asp Arg Ala Leu Ala Asn 625 630 635 640 Arg Lys Ile Gly His Phe Leu Phe Trp His Leu Arg Ser Glu Met His 645 650 655 Val Pro Ser Val Ala Leu Arg Phe Gly Leu Ile Leu Glu Ala Tyr Cys 660 665 670 Arg Gly Ser Thr His His Met Lys Val Leu Met Lys Gln Gly Glu Ala 675 680 685 Leu Ser Lys Leu Lys Ala Leu Asn Asp Phe Val Lys Leu Ser Ser Gln 690 695 700 Lys Thr Pro Lys Pro Gln Thr Lys Glu Leu Met His Leu Cys Met Arg 705 710 715 720 Gln Glu Ala Tyr Leu Glu Ala Leu Ser His Leu Gln Ser Pro Leu Asp 725 730 735 Pro Ser Thr Leu Leu Ala Glu Val Cys Val Glu Gln Cys Thr Phe Met 740 745 750 Asp Ser Lys Met Lys Pro Leu Trp Ile Met Tyr Ser Asn Glu Glu Ala 755 760 765 Gly Ser Gly Gly Ser Val Gly Ile Ile Phe Lys Asn Gly Asp Asp Leu 770 775 780 Arg Gln Asp Met Leu Thr Leu Gln Met Ile Gln Leu Met Asp Val Leu 785 790 795 800 Trp Lys Gln Glu Gly Leu Asp Leu Arg Met Thr Pro Tyr Gly Cys Leu 805 810 815 Pro Thr Gly Asp Arg Thr Gly Leu Ile Glu Val Val Leu Arg Ser Asp 820 825 830 Thr Ile Ala Asn Ile Gln Leu Asn Lys Ser Asn Met Ala Ala Thr Ala 835 840 845 Ala Phe Asn Lys Asp Ala Leu Leu Asn Trp Leu Lys Ser Lys Asn Pro 850 855 860 Gly Glu Ala Leu Asp Arg Ala Ile Glu Glu Phe Thr Leu Ser Cys Ala 865 870 875 880 Gly Tyr Cys Val Ala Thr Tyr Val Leu Gly Ile Gly Asp Arg His Ser 885 890 895 Asp Asn Ile Met Ile Arg Glu Ser Gly Gln Leu Phe His Ile Asp Phe 900 905 910 Gly His Phe Leu Gly Asn Phe Lys Thr Lys Phe Gly Ile Asn Arg Glu 915 920 925 Arg Val Pro Phe Ile Leu Thr Tyr Asp Phe Val His Val Ile Gln Gln 930 935 940 Gly Lys Thr Asn Asn Ser Glu Lys Phe Glu Arg Phe Arg Gly Tyr Cys 945 950 955 960 Glu Arg Ala Tyr Thr Ile Leu Arg Arg His Gly Leu Leu Phe Leu His 965 970 975 Leu Phe Ala Leu Met Arg Ala Ala Gly Leu Pro Glu Leu Ser Cys Ser 980 985 990 Lys Asp Ile Gln Tyr Leu Lys Asp Ser Leu Ala Leu Gly Lys Thr Glu 995 1000 1005 Glu Glu Ala Leu Lys His Phe Arg Val Lys Phe Asn Glu Ala Leu Arg 1010 1015 1020 Glu Ser Trp Lys Thr Lys Val Asn Trp Leu Ala His Asn Val Ser Lys 1025 1030 1035 1040 Asp Asn Arg Gln (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE: (A) NAME/KEY: misc~feature (B) LOCATION: 15 (D) OTHER INFORMATION: /note= "n=inosine" (ix) FEATURE: (A) NAME/KEY: misc~feature (B) LOCATION: 24 (D) OTHER INFORMATION: /note= "n=inosine" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GCAGACGGAT CCGGNGAYGA YHKNAGRCAR GA 32 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: Gly Asp Asp Leu Arg Gln Asp 1 5 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (ix) FEATURE: (A) NAME/KEY: misc~feature (B) LOCATION: 16 (D) OTHER INFORMATION: /note= "n = inosine" (ix) FEATURE: (A) NAME/KEY: misc~feature (B) LOCATION: 25 (D) OTHER INFORMATION: /note= "n=inosine" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GCAGACGAAT TCRWRNCCRA ARTCNRYRTG 30 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: His Ile Asp Phe Gly His 1 5 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CATGCTGACC CTGCAGATGA T 21 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: AACAGCTGCC CACTCTCTCG G 21 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: GGGCCACATG TAGAGGCAGC GTTCCC 26 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GGCCCAGGCA ATGGGGCAGT CCGCC 25 (2) INFORMATION FOR SEQ ID NO:1l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: GATGCGGAAC GGCTGCTCCA GGG 23 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: CCAGGGACCA CAGGGACACA GAG 23 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 65 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: AGTTACGGAT CCGGCACCAT GGACTACAAG GACGACGATG ACAAGCCCCC TGGGGTGGAC 60 TGCCC 65 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: CCACATGTAG AGGCAGCGTT CC 22 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: CTGCCATGTT GCTCTTGTTG A 21 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: GAGTTCGACA TCAACATC 18 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM (PCT Rule 13bis) A. The indications made below relate to the microorganism referred to in the description on page 3 , line 16 ~~~~~~~~~~~~~~~~~ B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet El Name of depositary institution American Type Culture Collection Address of depositary institution (including postal code and country) 12301 Parklawn Drive Rockville, MD 20852 US Date of deposit Accession Number 7 November 1996 { HB 12233 and HB 12234 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet El "In respect of those designations in which a Europan patent is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28(4) EPC)."- D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (iSthe indications are not for all designated States EP E. SEPARATE FURNISIIING OF INDICATIONS (leave blank if not applicable) The indications listed below will be submitted to the International Bureau later (specifythegeneral narure of the gndicanonse.g. "accession Number of Deposit'7 For recelving Office use only I ' - For International Bureau use only This sheet was received with the intemationalgppl=Qn This sheet was received by the International Bureau on: Authorized officer ted officer iitem3tion Clivlb