BACKGROUND -- FIELD OF INVENTION This invention relates to hosts containing constructs with genes from the starch pathway. More specifically the present invention relates to bacterial hosts that form plant like starches. Additionally the present invention relates to plant hosts that have genes from the starch pathway. The invention further relates to the starches produced by said hosts.

BACKGROUND -- DESCRIPTION OF PRIOR ART The starch using industry includes diverse industries such as candy makers, makers of adhesives and paints, gravy makers, paper producers, etc. Since the demand for starch, (which is formed of amylose and amylopectin), has been dramatically increasing for specialized food and industrial uses, efforts have been undertaken to tailor the quantity and quality of starch for specific food and industrial uses.

This industry has overtime looked for a number of different starches having, high viscosity, lower viscosity, higher gelling strength and lower gelling strength, different boiling points etc. Each starch tailored for a number of uses. The industry has utilized mutant starches that have less amylopectin and mutant starches with more amylose for tailored specifications.

For example the increased amylose starch has been used in the gelled candy making area. And the industry has used the increased amylopectin starches formed by mutants such as wx and wx su2 containing little amylose and mostly amylopectin for thicken foods like pudding, pies, gravies, frozen foods and batters, stews, canned foods and baby food. Additionally the mutant starches of different types have usefulness as adhesives and as sizing.

The other method used to address the industry needs for tailored starch is the use of chemical modification of the starch. Chemical derivation of the starch are produced by chemically reacting the starch with the monofunctional reagents to introduce the substituents such as phosphate, acetate, succinate groups to stabilize the starch. Unfortunately, these types of starches can be subjected to government regulation and additionally have less acceptance generally due to the added cost of the starch.

Starch is the major form in which carbohydrates are stored in biological systems. Plant starch in chloroplasts is transitory and storage starch accumulates in storage organs of many plant. Starch can be found in all organs of most higher plants including leaves stems and roots and fruits and embryo and endosperm. In addition to higher plants starch, similar polysaccharide (glycogen) has been found in bacteria. Many bacteria produce a reserve polysaccharide similar to the glycogen found in animals.

Storage polysaccharide has been classified as being in two groups, group one has storage in the cytsol of the cell and the second group within the plastid. Escherichia coli produces a polysaccharide within the cytsol. Starch producing plants typically store starch in the plastids. Typical starch bearing plants include cassava, potato, corn, peas, rice, wheat, barley. The main starch storing tissue of corn, rice wheat and barley and oats, the cereal grains, is the endosperm.

Starches are also classified by the plant source, for example cereal starches are from cereal grains such as maize, rice, wheat, barley, oats and sorghum; tuber and root starch are from potatoes and yams and cassava.

The pathway of starch synthesis is not well understood. Generally, as noted above starch from plants, consists of two major components: amylose and amylopectin. These intertwine in the starch granule of the plants. Amylose is a linear polymer of alpha 1 -4 bonded anhydroglucose units while amylopectin is a branched polymer comprised of linear chains alpha 1-4 linked anhydroglucose units with branches resulting from alpha6 linkages between the linear chains. It has been known for sometime that mutant genes in starch bearing plants can be expressed and that the properties of the starch can be altered. The proportion of the two components and their structures in the mutant primarily determine the physical-chemical properties of the starch.

Thus the lack of a clear understanding of the starch synthesis pathway and the difficulty of employing mutants limited the industry to the use of existing and producible mutant starches (cereals containing mutant starch can show a tremendous yield penalty in field environments) or to the chemical modification that could be made to the starch. In the last decade the industry has been studying the effects of certain starch genes in plants and bacteria in an attempt to more clearly understand starch synthesis.. Since the late 80's it has been possible to transform plants and bacteria to contain isolated genes. In response to this the industry has transformed potatoes with a bacterial gene GS and with starch soluble synthase III gene in the antisense (forming a mutant). As part of these potato starch experiments bacteria has been transformed with certain potato starch genes. For example the SSSIII gene from potato was transformed into E.coli deficient in glgA gene. The effect of glgC and branching enzyme I and II in combination in a mutant E.coli has also been studied and glycogen like product was reported.

The starch industry that is commercial does not have a particular interest in the production of glycogen which is the polysaccharide produced by bacteria and animals (the health care industry may have some such interest). The industry has thus not yet been able to generate tailored starches at reasonable prices through plant gene transformation. There remains a need for the industry to find new starches that are useful due to their changed characteristics such as lower viscosity and new starches that are useful because of their higher viscosity and new methods of producing such starches.

Glycogen synthesis in E. coli and starch synthesis in higher plants have similar pathways involving ADPGlc pyrophosphorylase, starch synthase,(SS) or glycogen synthase (GS,) and branching enzyme (BE). It has been suggested that ADPGlc pyrophosphorylase plays a pivotal role in regulating the amount of starch synthesized, while starch synthase and starch branching enzyme primarily determine the starch structure. Multiple forms of SBE and SS have been identified in many plants including maize, rice, pea and potato. In addition to the waxy gene coding for granule bound starch synthase (GBSS), three genes coding for the other forms of SS have been isolated from maize endosperm. Maize is the only cereal crop from which the genes coding for the five forms of SS have been isolated. Clearly a number of these sequences are published and known to those of skill in the art. Genes coding for maize SBE have also been cloned and characterized. Previous reports have demonstrated that maize SBEI has a higher rate of branching amylose than SBEII and preferentially transfers longer chains, while SBEII shows a higher rate of branching amylopectin and preferentially transfers shorter chains. In comparison with SBE, less is known about the specificities and functions of multiple forms of SS. In Waxy maize, which lacks GBSS, only amylopectin is synthesized and amylose is missing. Therefore, it is generally accepted that GBSS, encoded by waxy gene, is primarily responsible for the synthesis of amylose. Study of waxy mutation in Chlamedomonas reinhardtii has suggested that GBSS is also involved in amylopectin synthesis. Although it has been reported that Chlamedomonas reinhardtii SSII controls the synthesis of intermediate size glucans of amylopectin in Chlamedomonas, direct evidence for the functions of SS in higher plants is still missing. Antisense technology has been used to study the functions of SS in potato, however, the results are inconclusive.

In an article written by Hanping Guan et al., entitled AMaize Branching Enzyme Catalyzes Synthesis of Glycogen-like Polysaccharide in glg B-deficient Escherichia co1i.

Published in Proc. Natl. Acad. Sci. USA, Vol. 92, pp. 964-967, February 1995 Plant Biology a specific glycogen like polysaccharide from a transformed E coli was reported. This article taught the transformation of an E coli bacteria with maize BEI and BEII. These enzymes were transformed into two E coli hosts. One of the bacterial hosts was a wild type and the other was a mutant. The mutation to the bacteria was the reduction of the activity of glycogen BE in the AC7l(glgB-) so that the mutant was essentially free of BE activity. The paper analyzed the debranched alpha-glucan isolated from the four different transformants. The first host was E. coli containing glgB and the second host was the AC71 without any transformed genes then AC71 transformed with maize BEII, and then AC71 with maize BEl , then AC71 with maize BEI and BEII. The resultant polysaccharide products were analyzed by HPLC, by chain length and relative peak area and by mole distribution of chains. The study led to the understanding that BEII could play a role in synthesis of the short chains of amylopectin and BEI could be involved with the longer chains of amylopectin. The paper also noted that the mutant host AC71 produced more chains with chain length of 6 then did the wild type E. Coli. The paper also noted that the maize BE and the GS of the host did not produce amylopectin like polysaccharides. The article suggested that the concerted action of GS with different BE=s could play an important role in determining the final structure of the polysaccharide synthesized. The article by Guan ends by suggesting that his study had established the basis for studying the concerted actions of BE and SS in a bacterial model system.

The expression of E coli GS (glycogen synthases) in potatoes showed a large incidence of highiy branched starch. This result was published in an article in Plant Physiol. 104,1159- 1166 by Shewaker et al. This potato does not appear to be of much commercial use at this time.

The industry still needs the option of producing plant like starches in a fermentation process from bacteria and thus without the necessity of breeding and growing environment sensitive plants; and, the option of producing plants that generate the specific tailored starch through a plant host. And the industry needs altered and new starches that are cereal like starches or root and tuber like starches in large quantities and inexpensively thus avoiding having to use chemical modification of starch. The industry needs a host that can be readily transformed to supply different starches tailored to the industry=s need. Specifically the industry needs a host that supplies various different starches including those not capable of being made in plants or bacteria presently.

OBJECTS AND ADVANTAGES Accordingly, several objects and advantages of the invention are to produce plant like starch through the process of fermentation.

Additional objects and advantages are the production of new starches in plants.

Still further objects and advantages will become apparent from a consideration of the ensuing description and accompanying drawings.

Another object of the present invention is the synthesis of polysaccharides including amylose, amylopectin in E. coli, and/or fungal and yeast by plant starch synthesizing enzymes including SS, SBE, bacterial branching enzyme, glycogen synthase and other enzymes in other living organism.

Yet another object of my invention is using each or combination of these enzymes or modified enzymes studied in this patent to produce or to improve polysaccharides in any living organism including starch synthesis in plants.

SUMMARY OF THE INVENTION The invention provides DNA constructs in a host that include most of the genes in the starch pathway of a plant such that the host produces a plant like polysaccharide. And in one embodiment produces maize starch including slightly different embodiments that make specific maize mutant like starch in a non plant host. This invention encompasses a bacterial host containing a combination of two or more of such genes 551, SSSIIa, SSIIb, SSSIII, GBSS, BEI and BEII when the combination does not form glycogen like material. This invention encompasses a plant host transformed with any of the following maize genes or a plant host having a combination of two or more of the following maize genes 551, SSIIa, 55IIb, SSSIII, GBSS, BEI and BEII in a hybrid or an inbred rice plant.

Additionally the present invention includes new'polysaccharide produced by a transformed host. The host having a wildtype, which does not produce the new polysaccharide, the transformed host expressing at least two exogenous starch synthesis genes, the genes are selected from a group consisting of starch synthesis genes such as SSI SSIIa, SSIIb, SSIII, GBSS and optionally including at least one of the BEI and BEII genes wherein the transformed host is capable of producing such new polysaccharide.

The invention also covers a new polysaccharide wherein the host also expresses the exogenous genes selected from the following group consisting of bacterial glycogen inducing genes are selected from the group glgA, glgB, glgC and any mutants thereof. Or wherein the host also expresses the exogenous genes selected from the following group consisting of plant granule bound enzymes. And the new polysaccharide wherein the starch synthesis genes are selected from the group consisting of BEI and BEII.

The present invention broadly encompasses a host containing a transformed Glg C gene and at least one of the starch branching enzymes genes in a host in combination with at least one other transformed starch gene wherein the host produces a polysaccharide product. And a host containing transformed bacterial gene and at least one of the non starch branching enzymes selected from the group consisting of debranching enzymes and soluble starch synthase A method of producing polysaccharides which are non glycogen like in a host comprising transforming a host capable of being used in a fermentation process, with genes selected from the group which produce starch synthesizing enzymes, or glycogen synthesizing enzymes such that the host produces nonglycogen like starch, and employing the host in a fermentation process that produces polysaccharides. The host is bacteria, or a fungal or a yeast. Additionally the method of this invention includes the use of bacterial genes also such as the glycogen synthesizing genes including the glgC, glgA, glgB genes. A method wherein the genes which produce starch synthesizing enzymes include genes encoding for starch soluble synthases I, IIa, IIb and SS III (dull). A method wherein the genes which produce starch synthesizing enzymes include genes encoding for starch debranching enzyme and branching enzymes. The invention covers the modified starch synthesizing enzymes including the N-terminally truncated SS.

In other word the invention covers a host transformed to carry a gene active in glycogen production, and at least one nonstarch branching gene active in the production of at least one of the following polysaccharides amylopectin and amylose in its original host. The host can be a monocot or a dicot plant. The host can be a cereal bearing plant. Or the host can be a bacteria.

More specifically the invention includes a host wherein at least one nonstarch genes active in the production of at least one of the following polysaccharides, amylopectin and amylose in its original plant, is selected from the group consisting of starch soluble starch synthase I, Iia, IIb, III genes and debranching enzyme gene (sul), GBSS gene, sh2 gene and bt2 gene. A host including at least one of the starch branching enzyme genes such as BEl gene, BEII gene.

The present invention can also be described as a host transformed to carry a gene active in ADPG production, and at least one starch gene active in the production of at least one of the following polysaccharides amylopectin and amylose in its original host wherein the host produces polysaccharides that are plant like starch and not glycogen like.

Additionally the host can be transformed to carry a pyrophosphorylase gene, and glycogen synthase gene.

The scope of the present invention includes a host deficient in alpha 1,4 glucan synthesizing ability and alpha 1,4-1,6 branching enzyme capability transformed to express at least one a plant starch soluble synthesis gene. And the host can also include being transformed to express at least one gene encoding for debranching enzyme, and/or a gene encoding for starch soluble synthase I, starch soluble synthase enzyme Iia, IIb, starch soluble synthase enzyme III. This host can including being transformed to express at least one gene encoding for starch branching enzyme.

This invention also includes the production of a glycogen like material in plants.

Attached hereto are a number of plasmids described by the figures and by table one, that are part of the present invention and are claimed herein. One such example is the plasmid wherein the plasmid is in a carrier host and the plasmid contains the SSIIa gene with the n terminus GENVMNVIVV and wherein the gene is approximately 1561 base pairs in length. The invention includes mutant hosts such as mutant plants like waxy rice and potatoes and corn as example and wherein the host is a mutant E. Coli, or fungus.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows a graph which gives the relative peak area in percent and the chain length of glycogen and starch soluble synthase I (SSI), starch soluble synthase II (SSIIa), starch soluble synthase IIb (SSIIb). Thus this shows the specificities of Maize SS=s in chain elongation.

FIG. 2 shows plasmid pEXSC-MBEI with 7661 base pairs and promoter T7 and a Kanamycin gene and glgC and the maize starch branching enzyme I (MBEI).

FIG. 3 shows plasmid pEXSC3C with 7461 base pairs and promoter T7 and ampicillin gene and the maize starch soluble synthase gene Iia. pEXS3c is the 1082 bp Nde I-EcoRI fragment containing the N-terminus of MSSSIIa (from MSSIIa in pBSK) subcloned into the Nde I-EcoRI sites of pEXS3a, replacing the N-terminus of IIA-2 with the longer IIa N- terminus. MSSIIa is the mature maize SSIIa and is 2090 bp long. The following sites are not contained in the MSSIIc insert: Apa I, BglII, Eco V, Not, Spe I, and Xba I. The N-terminus of this plasmid is AEAEAGGKD.

FIG. 4 shows plasmid pEXSC-MBEI-MBEII with 9971 base pairs and promoter T7 and a Kanamycin gene and glgC and the maize starch branching enzyme I (MBEI) and the maize starch branching enzyme II (MBEII).

FIG. 5 shows plasmid pEXSC-MBEII with 7521 base pairs and promoter T7 and a Kanamycin gene and glgC and the maize starch branching enzyme II (MBEII).

FIG. 6 shows plasmid pEXSC-3a with 7990 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the maize N-terminally truncated starch synthase gene IIa (MSSIIa-2). The N-terminal sequence is GENVMNVI.

FIG. 7 shows plasmid pEXSC-8 with 7079 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the maize starch soluble synthase gene I and version I- 2.(MSSI-2), An N-terminally truncated 551.

FIG. 8 shows plasmid pEXSC-9 with 7551 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the maize starch soluble synthase gene IIb (SSIIb).

The N-terminal sequence is AAAPAGEE.

FIG. 9 shows plasmid pEXSC-10 with 7211 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the maize starch soluble synthase gene I, the full length 551. The N-terminal sequence is CVAELSREGPA FIG. 10 shows plasmid pEXSCA with 6738 base pairs and promoter T7 and a Kanamycin gene and the glgC gene and the glgA gene.

FIG. 11 shows plasmid pEXSC9a with 7240 base pairs and promoter T7 and ampicillin gene and the maize starch soluble synthase gene IIb-2 (Maize SS IIb-2), an N-terminally- truncated SSIIb. The N-terminal sequence is MNVVVVASECAP.

FIG. 12 shows plasmid pEXSWX with 6968 base pairs and promoter T7 and an ampicillin gene and the N-terminally-truncated maize WX (maize granular bound starch synthase). The N-terminal sequence for wx is ASAGMNVVFVGAEMA.

FIG. 13 shows plasmid pEXSWX2 with 6980 base pairs and promoter T7 and an ampicillin gene and the N-terminally-truncated maize WX termed as wx2. The N-terminus of wx2 is MNVVFVGAEMA.

FIG. 14 shows plasmid pEXSC9 with 7780 base pairs and promoter T7 and ampicillin gene and E. coli glgC gene and the maize starch soluble synthase geneIIb (Maize SS IIb).

FIG. 15 shows plasmid pEXSC I 0d with 7112 base pairs and promoter T7 and ampicillin gene, E. coli glgC gene and the N-terminally-truncated maize starch soluble synthase gene I termed as Maize SSI-3). The N-terminus of maize SSI-3 is MSIVFTGEASPYA.

FIG. 16 shows plasmid pEXS10 with 5300 base pairs and promoter T7 and ampicillin gene and the full length maize starch soluble synthase gene I termed as Maize SS I.

FIG. 17 shows plasmid pEXS8 with 7259 base pairs and promoter T7 and ampicillin gene and the N-terminally-truncated maize starch synthase gene I termed as 551-2. The N- terminal sequence is CVAELSRDLGLEPEG.

FIG. 18 shows plasmid pEXSCA1 with 5128 base pairs and promoter T7 and ampicillin gene and the glgA. pESCA1 is a 1551 bp Spel-Sac I fragment containing glgA (from glgA in pBSK) subcloned into the Xba I- Sac I sites of p ET-23d which is commercially available from Novagen in Madision Wisconsin under catalog number 69748-1 and called ET- 23d(+) DNA.

FIG. 19 shows the spectrum of the iodine glucan complex of the product produced by the host containing the glgC and glgA, and the pEXSC9, pEXSC3, pEXSC8, pEXSCwx the X-axis is listing nm and the Y axis is reading absorbance.

FIG. 20 shows the spectrum of the iodine glucan complex of the product produced by the host transformed with plasmids containing the glgC, the BEI, the BEII genes and glgA; glgC, the BEI, the BEII genes and maize SSI, SSI-2 and glgC, the BEI, the BEII genes and maize SSIIb, and glgC, the BEI, the BEII genes and maize SSIIa-2, and glgC, the BEI, the BEII genes, the X-axis is listing nm and the Y axis is reading absorbance.

FIG. 21 shows the product produced by the host in small bottles including the product from the host containing glgC, the BEI, the BEII genes and maize SS=s genes. Encoded as (C- I-II+8), glgC, the BEI, the BEII and maize SSI-2 genes and pEXSC10 encoded as (C-I-II+10), glgC, the BEI. the BEII and maize SSI genes and pEXSC9 encoded as (C-I-II+9),glgC, the BEI, the BEII and maize SSIIb genes and pEXSC3a encoded as (C-I-II+3a), glgC, the BEI, the BEII and maize SSIIa-2 genes and pEXSCWX encoded as (C-I-II+WX),glgC, the BEI, the BEII and maize waxy genes and pEXSCAl encoded as (C-I-II+A1), containing maize BEI, BEII and E.coli glgA genes. potato dextrin, waxy maize starch, corn amylopectin, rice starch, corn starch, pEXSC8.

FIG. 22 shows pExs-trc has 4178 base pairs with the trc promoter and the ampicillin gene. PEXS trc is pTrc99A-Ndel which has been mutagenixed. (Nco I site in multiple cloning site of p Trc99A-Ndel is mutagenixed to Nde I using primers EXS63 AND EXS64.) pEXS-trc contains only one Nde I site and no Nco I sites. The following sites are not contained in pEXS-trc; Bgl II, Cla I, Nco I, Not I, Sac II, SnaB I, Spe I, and Xho I.

FIG. 23 shows pEXS-trc3 has 4129 base pairs with the trc promoter and the ampicillin gene in partial and the Kanamycin gene. The pEXS-trc3 is pEXS-trcl cut with BglI (filled in)- Sca I and religated, deleting most of the Amp gene (304 nt from the 5" end remain). The following sites are Not contained in p EXS-trc3: Apa I, BgI II, Eco V, Nco I, Not I, SnaB I, and Spe I.

FIG. 24 shows the plasmid pEXS 102 having 7190 base pairs, adapted for plant transformation containing the maize 1 0KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the Waxy 2 gene and the nos terminator and the ampicillin gene.

FIG. 25 shows the plasmid pEXS 103 having 6607 base pairs, adapted for plant use containing the maize 1OKD zein promoter,the gene coding for the maize starch synthase I transit peptide and the Waxy 2 gene and the nos terminator and the ampicillin gene.

FIG. 26 shows the plasmid pEXS 101 having 6979 base pairs, adapted for plant use containing the maize 1 0KD zein promoter, the gene coding for the maize starch synthase I transit peptide and the glg B gene and the nos terminator and the ampicillin gene.

FIG. 27 shows the plasmid pEXS 100 having 7557 base pairs, adapted for plant use containing the maize 1 0KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the glg B gene and the nos terminator and the ampicillin gene.

FIG. 28 shows the plasmid pEXS 101 having 6273 base pairs, adapted for plant use containing the maize 1OKD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the glg A gene and the nos terminator and the ampicillin gene.

FIG. 29 shows the plasmid pEXS 66 having 6001 base pairs, adapted for plant use containing the maize 1 0KD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the glg C3 gene and the nos terminator and the ampicillin gene.

FIG. 30 shows the plasmid pEXS 65 having 6373 base pairs, adapted for plant use containing the maize 1 0KD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the maize waxy gene and the nos terminator and the ampicillin gene.

FIG. 31 shows the plasmid pEXS 64 having 7073 base pairs, adapted for plant use containing the maize 1 0KD zein promoter,the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase IIa gene and the nos terminator and the ampicillin gene.

FIG. 32 shows the plasmid pEXS 63 having 6473 base pairs, adapted for plant use containing the maize 1 0KD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase IIa gene and the nos terminator and the ampicillin gene.

FIG. 33 shows the plasmid pEXS 62 having 6773 base pairs, adapted for plant use containing the maize 1OKD zein promoter,the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase I-2 gene and the nos terminator and the ampicillin gene FIG. 34 shows the plasmid pEXS 61 having 7013 base pairs, adapted for plant use containing the maize 1 0KD zein promoter, the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase IIb gene and the nos terminator and the ampicillin gene.

FIG. 35 shows the plasmid pEXS 59 having 6858 base pairs, adapted for plant use containing the maize IOKD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the E.coli glgA gene and the nos terminator and the ampicillin gene FIG. 36 shows the plasmid pEXS 58 having 7658 base pairs, adapted for plant use containing the maize 1 0KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the maize soluble starch synthase IIa gene and the nos terminator and the ampicillin gene.

FIG. 37 shows the plasmid pEXS 56 having 6586 base pairs, adapted for plant use containing the maize 1 0KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the glg C3 gene and the nos terminator and the ampicillin gene.

FIG. 38 shows the plasmid pEXS 54 having 7658 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the Maize SS IIa gene and the nos terminator and the ampicillin gene.

FIG. 39 shows the plasmid pEXS 53 having 7058 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and the maize starch soluble synthase IIa-2 gene and the nos terminator and the ampicillin gene.

FIG. 40 shows the plasmid pEXS 52 having 7358 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and maize starch soluble synthase I-2 gene and the nos terminator and the ampicillin gene.

FIG. 41 shows the plasmid pEXS 51 having 7398 base pairs, adapted for plant use containing the maize 10KD zein promoter, and maize adh I intron, the gene coding for the maize starch synthase I transit peptide, and maize starch soluble synthase IIb gene and the nos terminator and the ampicillin gene.

FIG. 42 shows photograph of eleven products of altered starch produced with the present invention. The titled are encoded C-I-II=the glgC gene and the BEI and the BEII genes the following number or alternatively designation means pEXS-and the number. Thus C-I- II=the glgC gene and the BEI and the BEII and EXS-10 plasmid that contains the gene 551, having the N-terminus shown in Table 1.

FIG. 43 shows the DNA sequence and the protein sequence for glgA having 1488 base pairs.

FIG. 44 shows the DNA sequence and the protein sequence for glgB having 2361 base pairs.

FIG. 45a shows the DNA sequence for Zea mays l0-kDa zein gene having 2562 base pairs.

FIG. 45b shows the DNA sequence for Zea mays 1 0-kDa zein portion of the gene used as the promoter in a number of the plasmids discussed herein.

FIG. 46 shows the DNA sequence and the protein sequence for glgC3 (glgC3) having 1328 base pairs containing two mutations P295D, K296E. This is a mutant of the wild type glgC gene.

FIG. 47 shows the DNA sequence and the protein sequence for glgC (glgC) having 1328 base pairs.

FIG. 48 shows the DNA sequence and the protein sequence for glgCwt (glgCwt) having 1328 base pairs. This is the glgC gene that is found in nature.

FIG. 49 shows the DNA sequence and the protein sequence for the maize waxy gene denoted wx herein.

FIG. 50 shows the DNA sequence and the protein sequence for the maize starch soluble synthase IIb encoding gene having 2423 base pairs.

FIG. 51 shows the DNA sequence and the protein sequence for the maize starch soluble synthase IIa.

FIG. 52 shows the DNA sequence and the protein sequence for the maize starch soluble synthase I-2 having 1749 base pairs.

FIG. 53 shows the DNA sequence and the protein sequence for the maize branching enzyme II.

FIG. 54 shows the DNA sequence and the protein sequence for the maize branching enzyme I.

FIG. 55 shows the DNA sequence and the protein sequence (153) for the transit peptide portion of the maize starch soluble synthase I.

FIG. 56, PCR analysis of transgenic rice plants. The genomic DNA isolated from rice plants were PCR amplified using specific primers for the inserted gene. The specific bands were identified on 1% agarose gel compared with non-transgenic rice plant.

FIG. 57. Activity staining of starch synthase on renaturing SDS-PAGE gel with Iodine solution: The positive staining of maize SSI-2 indicated the expression of maize SSI-2 in transgenic rice plants.

FIG. 58. SSI-I, SSI-2, and SSI-3 construct diagram. Three forms of SSI were constructed in the pET expression system (see Methods). pExsl0a encodes SSI-1, the full length maize SSI (583 amino acids). pExs8 encodes a truncated 551, SSI-2, with amino acids #8-52 deleted from the N-terminus of SSI-1. pExsld encodes the most truncated form of 551, SSI-3, with the first 93 amino acids deleted from SSI-1. A depiction of the waxy gene, encoding GBSS, is also included for comparison. The amino acid motif KS/TGGL, the putative binding site for ADPGlc, is indicated by the triangles. The KS/TGGL motif is located 18 amino acids from the N-terminus in GBSS, while the motif is 106 amino acids from the N- terminus in maize 551. Drawing not to scale.

FIG. 59. SSIIa-l and SSIIa-2 construct diagram. Two forms of SSIIa were constructed in the pET expression system. pExs3c encodes SSIIb-1, the putative full length maize SSIIb.

N-terminal sequencing of SSIIa-1 revealed that the polypeptide chain started at amino acid &num l, so the length of SSIIa-1 is 669 amino acids. pExs3a encodes a truncated form of SSIIa, SSIIa- 2, with the first 176 N-terminal amino acids deleted from SSIIa (493 amino acids total). A depiction of the waxy gene, encoding GBSS, is also included for comparison. The amino acid motif KTGGL, the putative binding site for ADPGlc, is indicated by the triangles. The KTGGL motif is located 18 amino acids from the N-terminus in GBSS, while the motif is 194 amino acids from the N-terminus in maize SSIIa.

FIG. 60. SSIIb-l and SSIIb-2 construct diagram. Two forms of SSIIb were constructed in the pET expression system (see Methods). pExs9 encodes SSIIb-1, the putative full length maize SSIIb. N-terminal sequencing of SSIIb-1 revealed that the polypeptide chain started at amino acid #1, so the length of SSIIb-1 is 637 amino acids. pExs9a encodes a truncated form of SSIIb, SSIIb-2, with the first 144 N-terminal amino acids deleted from SSIIb (492 amino acids total). A depiction of the waxy gene, encoding GBSS, is also included for comparison.

The amino acid motif KTGGL, the putative binding site for ADPGlc, is indicated by the triangles. The KTGGL motif is located 18 amino acids from the N-terminus in GBSS, while the motif is 158 amino acids from the N-terminus in maize SSIIb.

FIG. 61. Temperature Curves for SSI enzymes. All assay components, except enzyme and [U-'4C]-ADPGlc, were mixed and then preincubated at each temperature for 3 minutes before addition of enzyme and ADPGlc. For all assays, the final concentration of [U- '4C] ADPGlc was 3 mM, while amylopectin was 6 mg/ml. Each point is an average of three separate determinations.

FIG. 62. Temperature Optima of SSIIa-l and SSIIa-2. All assay components, except enzyme and [U-'4C]-ADPGlc, were mixed and then preincubated at each temperature for 3 minutes before addition of enzyme and ADPGlc. For assays in the presence of 0.5 M citrate, 5 mg/ml amylopectin was used as primer. For assays without citrate, 10 mg/ml amylopectin was used. For all assays, the concentration of [U-'4C]-ADPGlc was 3 mM. Each point is an average of three separate determinations.

FIG. 63. Temperature Optima of SSIIb-1 and SSIIb-2. All assay components, except enzyme and [U-'4C]ADPGlc, were mixed and then preincubated at each temperature for 3 minutes before addition of enzyme and ADPGlc. For all assays, the concentration of [U- '4C]ADPGlc was 3 mM and the concentration of glycogen was 40 mg/ml. Each point is an average of three separate determinations.

PREFERRED EMBODIMENT -- DESCRIPTION Gene shall mean the entire gene sequence or any mutations or varieties of the codon that produce the desired activity in the host or alternatively the section or sections of the gene sequence necessary to produce the desired activity in the host. For example glgC gene shall mean glgC,6, glgC3 and other mutants that produce the desired activity in the host. Starch synthase gene shall mean full length SS, N-terminally-truncated SS or mutated SS with starch synthase activity.

Glycogen like-shall mean polysaccharide material such as those produced as the main starch product by E.coli in its native state and by the hosts as taught in the above described paper by Hanping Guan.

Non Glycogen like- shall mean polysaccharide material which is plant like and is not produced as the main starch product by E.coli in its native state and by the hosts as taught in the above described paper by Hanping Guan.

Plant like starch- is non glycogen like.

Transformed gene-shall mean a gene that was somewhere in the lineage of the plant or bacteria introduced into the plant by means other than nature. Thus the progeny of a transformed host would continue to contain a transformed gene.

Transformed host- shall mean any organism containing one or more of the novel plasmids and/or a novel combination of starch synthetic genes discussed herein.

Within this application a number of different protocols have been employed to designate the same gene or synthase. MSS&num =maize soluble starch synthase, SS#will likewise mean starch synthase though not necessarily maize. STS#will also designate soluble starch synthase.

GBSS=granule bound starch synthase. SBE#=starch branching enzyme, MBE= maize starch branching enzyme, MSBE#=maize starch branching enzyme, and BE#=starch branching enzyme.

The present invention broadly encompasses transforming hosts such as bacteria or plants with plant starch synthetic genes that produce a non glycogen like material (a bacteria containing BEI and BEII from maize produces a glycogen like material). Starch bearing plants and organisms hereinafter are referred to as the host. One of the primary aspects of this invention is the generation of plant like starch from a bacterial host and the production of altered starch in a plant host. The present invention has been exemplified in both bacteria and in transformed rice plants. The host can contain though it is not a limitation, an unlimited supply of ADPG from the addition of the glgC gene (the bacterial gene) to the plant.

Additionally the present invention encompasses plasmids that contain the maize genes and/or the bacterial genes in a construct adapted for use in a bacteria and constructs adapted for use in a plant. The plasmids in the plant construct preferably containing an active promoter recognized by the plant, a transit peptide, and the cleavage site that permits the protein to cleave from the transit peptide when crossing into the amyloplast in the plant. The plasmids used in the rice transformation specifically encompassed the maize 10 kd zein promoter, and the transit peptide from the maize SSI gene in the constructs adapted for plant use. The present invention also encompasses the plant producing the altered starch in the starch storage section of the plant or within the host cell and the altered starch itself. Additionally the present invention encompasses the combination of a number of starch genes in combination being active in a host such that the host produces differing non glycogen polysaccharides. Still further the present invention encompasses a method of making plant like starch in a bacterial host and the method of making altered plant like starch (altered in relationship to the type or amount of starch that the host makes without the constructs containing the genes), in a plant.

Yet another object of the present invention is the addition of a gene that encodes for the substrate ADPG used to form starch.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in a plant and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase I or its mutant form. The present invention also encompasses the combination of a promoter adapted for use in a plant and optionally a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase I or its mutant form and at least one gene encoding for branching enzyme transformed into a plant host.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in a plant and a gene encoding for ADPGlc pyrophosphorylase, preferably a bacterial gene, and a gene encoding for starch synthase Iia or its mutant form. The present invention also encompasses the combination of a promoter adapted for use in a plant and optionally a gene encoding for ADPGlc pyrophosphorylase, and a gene encoding for starch synthase Iia or its mutant form, and at least one gene encoding for branching enzyme transformed in to a plant host.

The present invention encompasses a plasmid having a promoter adapted for use in a plant and a gene encoding for ADPGlc pyrophosphorylase, preferably a bacterial gene. and a gene encoding for starch synthase IIb and its mutant form. The present invention also encompasses the combination for a promoter adapted of use in a plant and an optional gene encoding for ADPGlc pyrophosphorylase, and a gene encoding for starch synthase IIb or its mutant form and at least one gene encoding for branching enzyme transformed in to a plant host.

The present invention encompasses a plasmid having a promoter adapted for use in a plant and a gene encoding for Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa, starch synthase IIb, DU1. The present invention also encompasses the combination of a promoter adapted for use in a plant and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa, starch synthase Iib and DU1,, and at least one gene encoding for branching enzyme transformed in to a plant host.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in a plant and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa, IIb and starch synthase III (DU 1). The present invention also encompasses the combination of a promoter adapted for use in a plant and an optional gene encoding for ADPGlc pyrophosphorylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa, IIb starch synthase III(DU 1), and at least one gene encoding for branching enzyme, and at least one gene encoding for the debranching enzyme transformed in to a plant host.

The present invention encompasses a plasmid or combination of plasmids in the host having a promoter adapted for use in a bacteria or yeast and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase I.

The present invention also encompasses the combination of a promoter adapted for use in a bacteria or yeast and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase I, and at least one gene encoding for branching enzyme transformed in to a bacteria or yeast host.

The present invention encompasses a plasmid or combination of plasmids in the host having a promoter adapted for use in a bacteria or yeast and a gene encoding for Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase IIa.

The present invention also encompasses the combination of a promoter adapted for use in a bacteria or yeast and optionally a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase IIa, and at least one gene encoding for branching enzyme transformed in to a bacteria or yeast host.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in a bacteria or yeast, and a maize gene encoding for starch synthase III(DU1). The present invention also encompasses the combination of a promoter adapted for use in a bacteria or yeast and an optional gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and a gene encoding for starch synthase III, and at least one gene encoding for branching enzyme transformed in to a bacteria or yeast host.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in bacteria or in yeast and a gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa,IIb, starch synthase III(DU1). The present invention also encompasses the combination of a promoter adapted for use in bacteria or in yeast and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa,IIb, starch synthase III, and at least one gene encoding for branching enzyme transformed in to bacteria or into yeast hosts.

The present invention encompasses a plasmid or combination of plasmids in the same host having a promoter adapted for use in bacteria or in yeast and a gene encoding for ADPGlc Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa,IIb, starch synthase III The present invention also encompasses the combination of a promoter adapted for use in bacteria or in yeast and a gene encoding for Pyrophosphoroylase, preferably a bacterial gene, and genes encoding for at least one of the following genes starch synthase I, starch synthase IIa,IIb, starch synthase III(DU1), and at least one gene encoding for branching enzyme, and at least one gene encoding for the debranching enzyme transformed in to a bacteria or into a yeast host.

The present invention encompasses the truncated versions of the SSI and the SSII and the SSIII genes that still provide protein that is sufficient to make the polysaccharide.

By transforming different combinations of SS and SBE into E. coli HPG204(DE3) or G6MD3 defective in GS and GBE, we obtained the first evidence that maize 551, SSII and SSIII have different specificities in the size of glucans synthesized see fig one.. Herein, we present the model system to produce differing polysaccharides from hosts with SS and SBE in E.coli by metabolic engineering. We also demonstrated that the truncated forms of SS had different Vmax, temperature stability and kinetic properties (Table, Fig).

We also demonstrated that transformation of starch synthase and/or branching enzyme in E coli resulted in production of polysaccharides differing in size and structure. These polysaccharides can be used in food and nonfood industries to replace and/or complement starch functionalities. A large amount of these polysaccharides can be produced with fermentation technology.

Starch biosynthesis in higher plants and glycogen biosynthesis in E. coli have similar reactions which use adenosine diphosphate glucose (ADPGlc) as a substrate. This similarity allows us to use plant starch synthase (SS) and starch branching enzyme (SBE) to complement the functions of glycogen synthase (GS) and glycogen branching enzyme (GBE) in E. coli G6MD3, which is deficient in GS and GBE. Transformation of E.coli glgC gene and maize starch synthase gene in E.coli G6MD3 produced linear a 1,4 glucan similar to amylose. coexpression of the glgC, maize starch synthase and maize branching enzyme produced branched polysaccharides. However, distinct properties of plant starch branching enzyme and starch synthase make it possible to synthesize different polysaccharides in E.coli. While maize SSI preferentially synthesis short chains (dp 6 - 15), SSII and SSIII preferentially transferred long chains (dp > 24) and intermediate chains (dp 16 - 24) respectively. Transformation of different maize starch synthases, E. coli glycogen synthase (glgA) and/or maize branching enzymes into E.coli HPG96 or E. coli G6MD3 resulted in the synthesis of different sizes of polysaccharide with DP 500-4000.These polysaccharides synthesized in E coli by maize SS have different physical-chemical properties than polysaccharides synthesized in natural organisms including starch from plant sources and glycogen from animals. The polysaccharide can be used in food and nonfood industries to replace and/ or complement starch functionalities. A large amount of these polysaccharide can be produced by fermentation technology. The following materials were employed in the construction of the present invention some of the starting material are commercially available from Novagen in Madision Wisconsin ET-23d(+) DNA under catalog number 69748-1 and BL21(DE3) under catalog number 69387-1; ET-21a(+) DNA under catalog number 697401.

Plant Hosts The following plasmids have been transformed into rice plants Transgenic 1, MSTSIA(pExs52) and glgC3 (pExs66), MSTSIIa and glgC3 (pExs53 and pExs56). The second group of rice transformatns contain MSTSIIc and glgC3 (pExs54 and pExs56).The third group of transformation: transgenic 5 MSTSIII and glgC3 (pExs 61 and pExs 66); transgenic 6 Mwx glgC3 p'Exs65 and pExs66). Generally see figures 25-41 for plasmid maps and figure 43-55 for sequences used in the plasmid. Additionally, glgA and glgB and glgC were combined and transformed into rice. This is combining the rice plants starch pathway with the gene encoding for ADPG and the genes encoding for at least one of the following enzymes, 551, 5511, SSIII, Debranching enzymes, BEI, BEII, GBSS (wx).

These plasmids could have been transformed into other cereals such as corn, wheat, barley, oats, sorghum, milo in substantially the plasmid that is shown in the figures for the plant host. The promoter could be the waxy gene which is published, other additional zein promoters are known and could be used as the promoter. The promoter used herein is described in Figures 45aand 45b.

Additionally these plasmid with little additional work could be transformed into dicots such as potatoes, sweet potato, taro, yam, lotus cassava, peanuts, peas, soybean, beans, chickpeas. The promoter could be selected to target the starch storage area of the particular dicots (some are roots some are tubers). Various method of transforming monocots and dicots are known in the industry and the method of transforming the genes is not critical to the present invention. The plasmid can be introduced into Agrobacterium tumefaciens by the freeze-thaw method of An et al.(1988) Binary vectors. In Plant Molecular Biology Manual A3, S.B. Gelvin and R.A. Schilperoot,eds (Dordrecht, The Netherlands: Kluwer Academic Publishers), pp. 1- 19. Preparation of Agrobacteruim inoculum carrying the construct and inoculation of plant material , regeneration of shoots, and rooting of shoots are described in Edwards et al. (1995).

Biochemical and molecular characterization of a novel starch synthase from potatoes. Plant J.

8, 283-294. Additionally promoters for different dicots are known particularly 35sCaMV and Monsanto has also published a promoter that is useful in potatoes called a patatin promoter.

A number of monocots are also starch bearing plants but until about a decade ago monocots were difficult to develop transformants. The most prominent methods of transformation presently used in monocots is the gunning of micro projectiles into the plants or using Agrobacterium and subsequent regeneration of the plants from the transformed materials.

Various tissues and cells can now be transformed with plasmids into monocot hosts. In fact there are teaching from at least five ago on methods of transforming not only callus but also cotyledons. The methods of transforming plants and selecting for the transformants with either selectable or screen able markers are also well known. The use of the marker in the same plasmid and the use of the markers in a separate plasmid that is co transformed into the host are well known in the art by those of ordinary skill in the art. The biotechnology methods of forming plasmids and transforming plants are listed in the book entitled AShort Protocols In Molecular Biology@, 3rd ed. Published in 1995 by JOHN WILEY& Sons, Inc. Additionally, methods of transforming with the gun and with protoplasts are taught in a number of issued patents to Dekalb and Agracetus and Ciba.

PREFERRED EMBODIMENT - OPERATION EXAMPLE 1 Construction of the E. coli expression vector.

The expression vector pExs2 was derived from pET-23d (Novagen) and pGPl-2 (15).

The expression vectors pExs-trc and pExs-trc3 were derived from pTrc99a (Pharmacia) and pGPl-2. The BglII/PstI fragment (2192 bp) containing the pBR322 origin of replication was deleted from pET-23d and replaced with the BamHI/PstI fragment (3 kb) containing origin piSA and kanamycin resistance gene from pGPl-2. This process generated plasmid pEXS1 containing both ampicillin and kanamycin resistance genes. The ampicillin resistance gene was inactivated by deletion of the ScaI / BglI fragment (360 bp, BglI end was filled in and blunt- end ligated with ScaI end). Inactivation of the ampicillin resistance gene in pEXS 1 generated the expression plasmid pEXS2, containing the T7 promoter, T7 terminator, kanamycin resistance gene and pl 5A origin of replication. Plasmid pTrc99a was digested with Ndel, filled in with kelnow fragment and blunt-end ligated to remove NdeI site. A Ndel site was introduced at the NcoI site by mutagenesis to generate plasmid pExs-trc. The BglI and PvuII fragment(2.48 kb) in pExs-trc containing the pBR322 origin of replication was replaced by BglI/BamHI (filled in with Klenow fragment) fragment (3 kb) containing origin piSA and kanamycin resistance gene from pGPl-2 to generate pExs-trc2. The ampicillin resistance gene was inactivated by deletion of the ScaI / BglI fragment (360 bp, BglI end was filled in and blunt-end ligated with ScaI end). Inactivation of the ampicillin resistance gene in pExs-trc2 generated the expression plasmid pExs-trc3.

Construction of expression plasmids for maize SS. For expression of maize SS in E. coli, The PCR method was used to modify the N-terminus of maize SS using the following nucleiotides: primer Exs4 (5'-CAAGAATGCTGCGGGAGTC-3'), primer Exs23 (5'- AAGTCGACATATGTGCGTCGCGGAGCTGAGCAG-3'), primer Exs 57 (5'- GGGCCCCATATGAGCATTGTCTTTGTAACCGG-3'), primer Exs 1 (5'- CTCGGGCC CATATGGGGGAGAATGTTATGAA-3'), primer Exs2 (5'- GAGGCATCAATGAACACAAAGTCG-3'), Primer Exs33 (5'- GAAGGGCCCCATATGGCTGAGGCTGAGGCCGGGGGCAAG-3'), primer Exs 16 (5'- TTGGATCCATATGGGAGCTGCGGTTGCATTGGG-3') and primer Exs 17 (5'- CCTGCGGGCTCTGGCTTCACC), primer Exs 55 (5'- TTGGATCCATATGAACGTCGTC GTGGTGGCTTC-3'), primer 56 (5'- GCATACCATGGAACCTCAACAGC-3'), primer 53 (5'- GGTACCATATGAACGTCGTCTTCGGCG-3'), primer Exs 54 (5'- GACAGGCCCGTAGATCTTCTCC-3'), primer Exs -wx (5'- TTGGTACCATATGGCCAGCGCCGCCGGCATGAACG-3'). Primer Exs 4 paired respectively with primer Exs23 and Exs 57 was to modify the N-terminus of maize SSSI gene to generate pExs-10 and pExs-ld. Primer Exs2 paired individually with primer Exs33 and Exsl was to modify the N-terminus of maize SSSII to generate pExs3c and pExs3a. Primer Exs17 paired individually with primer Exsl 6 and Exs55 was to modify the N-terminus of maize SSSIII to generate pExs-9 and pExs-9a. Primer Exs54 paired individually with primer Exs-wx and Exs53 was used to modify the N-terminus of maize GBSS to generate pExs-wx and pExs- wx2. The modified N-terminus was recombined with the rest of the SS gene in pBluescript SK plasmid. The reconstructed of maize SS was subcloned from pBluescript SK to the NdeI/NotI sites of the expression vector pET-2la (Novagen) , pExs-trc, pExs-trc3 (maps are attached, Table I shows the N-terminal sequence of SSS).

EXAMPLE 2 Construction of expression plasmids for E. coli ADPGlc pyrophosphorylase, BE and maize SBE.

E. coli glgB gene was excised from plasmid pOP12 (16). The BstX1 (filled in) / HindII fragment containing the glgB ribosome binding site and the full length glgB gene was cloned at the SmaI site of pBluescriptSK- (Stratagene). The glgB gene in pBluscriptSK- was subsequently cloned into pEXS2 at the XbaI / SalI sites to generate plasmid pEXSB. Primer G (5'- GAAGATCTGGCAGGGACCTGCACAC-3') and primer H (5'- GGACTAGTGCATTATCGCTCCTGTTTAT-3') were used to PCR the E. coli glgC gene coding for ADPGlc pyrophosphorylase from plasmid pOP12. A BglII site and a SpeI site introduced by PCR to the N-terminal and C-terminal site respectively, were used to clone the PCR product into pBluscript SK- at the BamHI and SpeI sites. The glgC gene including its own ribosome binding site was subcloned into expression plasmid pEXS2 at the XbaI (filled in with Klenow fragment) and NotI site to generate plasmid pEXSc. The genes coding for mature maize SBEI and SBEII along with a ribosome binding site were subcloned from plasmids pET- 23d-SBEI and pET-23d-SBEII into the plasmid pEXSc at the SpeI site to form the plasmids pEXSc-SBEI and pEXSc-SBEII. The gene coding for mature maize SBEII including a ribosome binding site was cloned into pEXSc-SBEI at the XbaI/NotI sites to form plasmid pEXSc-SBEI-SBEII. E.coli glgc gene and genes encoding maize SBEI and SBEII were also cloned in plasmid pExs-trc and pExs-trc3 respectively and together as described for pExs2.

EXAMPLE 3 Isolation of E. coli HPG204 deficient in GBE and GS activities Homologous recombination was used for the strain construction. This was done according to the method described by Hamilton et al ( Journal of Bacteriology, 1989, 171:4617-4622.) A temperature-sensitive pSC101 replicon was used to facilitate the selection.

The gene coding for spectinomycin adenyltransferase was inserted at PvuII sites in plasmid pOP12 to form plasmid HPG9 which has spectinomycin resistance and has C-terminus of glgB gene and N-terminus of glgA gene deleted. The DNA fragment B=SA= with Spectinomycin resistant gene inserted between partial truncated glgB and glgA was subcloned into plasmid pMAK705 at XbaI site containing temperature sensitive replicon (Hamilton et al. Journal of Bacteriology, 1989, 171:4617-4622.) to form Plasmid pMak705B=SA=. Plasmid pMak705B=SA= was transformed into TG1 cell. After the transformed cell was cultured in 3 mL LB with 100 mg/mL Spectinomycin at room temperature overnight, the cells were plated on LB agar plate containing 100 mg/mL spectinomycin and incubated at 440C overnight.

Single colonies were inoculated on LB agar plate containing 100 mg/mL spectinomycin and 0.2% glucose and incubated at 440C and at 370C overnight. The colonies at 370C were stained with iodine. The colony with negative staining was selected and grown in 100 mL LB at 370C overnight. The cells were harvested and homogenized in an extraction buffer for assaying glycogen synthase and branching enzyme activities. The cell lacking glgA and glgB activities was named as HPG204 [F=traD36 Lacy4 D(glgBXCA) D(LacZ)M15proA+BVSupED (hsdM- <BR> <BR> mcrB)5(r, mk~ McrB~)thiD(lac-proAB),SpectinomycinR, ChloramphenicolR z ] The lDE3 lysogenization kit fromNovagen was used for site specific integration of lDE3 prophage into E. coli HPG204 to form E. coli HPG204(DE3)[ was DThe lysate was prepared with Plvir and its transduction into E. coli BL21 (DE3) [F=traD36 LacIq D(glgBXCA) <BR> <BR> <BR> D(LacZ)M 1 SproA+B+/SupED (hsdM-mcrB)5 (r m; McrB~)thiD(lac-proAB),SpectinomycinR, ChloramphenicolR ] EXAMPLE 4 Expression of maize SS and SBE in E. coli.

Plasmid pExs-2 and pExs-trc3 has kanamycin resistance and p1 5A origin of replication.

It is compatible with plasmid pET2la, pExs-trc, pTrc99A containing pBR322 origin.

Expression plasmids pExs-2 and pET-21a were used to express SS and SBE in E. coli HPG204(DE3). Expression plasmids pExs-trc and pExs-trc3 were used for expression in E. coli G6MD3. This made it possible to transform different combinations of maize SS and SBE in E. coli HPG204(DE3), or G6MD3 which is deficient in GS and GBE activity. An overnight culture of cells transformed with maize SS and SBE was diluted 1:20 (v/v) in fresh LB containing 0.2 % glucose, 100 mg/mL ampicillin and 50 mg/mL kanamycin. The cells were grown at 370C for about 2 h to A600nm =0.6 before the expression of maize SBE and/or SS was induced by adding isopropyl b-D-thiogalactoside to 0.5 mM. Following growth at 250C for 4 h, the cells were harvested in a refrigerated centrifuge.

EXAMPLE 5 Isolation of highly branched a-glucan from E. coli.

Cell pellet (30 g) was resuspended and lysed by sonication in 150 mL 50 mM tris- acetate buffer (pH 7.5) containing 10 mM EDTA and 5 mM DTT. After a fraction of the homogenate was saved for assaying the STS and SBE activities, the homogenate was centrifuged at 20, 000g for 50 min at 40C. After collecting the supernatant, the pellet was resuspended in 150 mL water and boiled for 15 min with occasional stirring. The resuspension was centrifuged at 20, 000g for 30 at room temperature. After collecting the supernatant, the pellet was washed again with 100 mL water as above. 0.1 volumes of 50% Trichloric acid (TCA) were added to the pooled fractions. After storing on ice for 30 min, the precipitate was spun down at 15,000g for 20 min, then washed with 30 mL 5% TCA and centrifuged as above.

The supernatant and wash were pooled and one volume of absolute ethanol was added. After storing on ice for 30 min, the polysaccharide was collected by centrifuging at 15, 000g for 15 main. The polysaccharide was redissolved in water and precipitated with ethanol. This step was repeated twice. The pellet was washed with methanol twice, acetone twice and dried over silica gel at room temperature.

EXAMPLE 6 Isolation of linear a 1,4 polysaccharide from E. coli Resuspend 50 grams of cell pellet in 250 mL of 50 mM Tris acetate buffer, pH 7.5, containing 10 mM EDTA and 5 mM DTT. Sonicate for 3 minutes (45 seconds/time, output H 8, repeat 4 times with 30 seconds interval). The homogenate is centrifuged at 12,000 rpm (SAl 500) for 50 minutes. The supernatant is checked with iodine staining and discarded.

(Same 1 mL homogenate and 1 mL supernatant for enzyme assay. The pellet is resuspended & extracted in 100 mL DMSO. Extract the polysaccharide by heating and stirring in boiling water bath for 15 min. Let it cool down to below 40 OC and centrifuge at 12,000 rpm for 30 min at room temperature. The supernatant is pooled. The pellet is extracted two more times with 100 mL DMSO. Equal volume of absolute ethanol is added into the pooled supernatant, mixed and stored on ice for 30 minutes. Centrifuge at 12,000 rpm for 30 min at 4 OC . The pellet is redissolved in 20 mL DMSO by heating in boiling water bath. 80 mL water is added and mixed well. After adding 10 mL butanol to the solution, the solution is mixed and stored at 0 OC for one hr (mix once a while). Centrifuge at 12000 rpm for 30 min at 40C. Repeat the step once.

The pellet is redissolved in 90 mL hot water by heating in boiling water bath. Insoluble materials are immediately removed by centrifugation at room temperature. Add 10 mL butanol to the supernatant, stay at 0 OC for 1 hr and centrifuge at 12000 rpm for 30 min at 4 OC. Repeat the step once. The amylose precipitate is redissolved in 90 mL hot water by heating, and 10 mL butanol are added to the solution. After storing at 40 OC on ice for one hour, it is centrifuged at 4 OC for 30 min. Repeat the step once. The pellet is redissolved in 100 mL 10% butanol by heating. The amylose is stored at 0 OC and precipitated by centrifuging at 12000 rpm for 30 min at 4 OC The pellet is washed with 25 mL methanol 3 times and with acetone once. Dry over silica gel.

EXAMPLE 7 Enzyme assays 5 mL of supernatant were used to assay STS and SBE activities as previously described (Preiss) with minor modification. The reaction mixture for STS contained 100 mM Bicine buffer, 10 mg/mL glycogen, 0.5 mg/mL BSA, 0.5 M sodium citrate, 25 mM potassium acetate, 10 mM GSH, 3 mM [14C]ADPGlc (500 dpm/nmol) and enzyme in a final volume of 0.1 mL.

The reaction was carried out at 250C for 15 min and terminated by boiling for 2 min. The unincorporated [14C]ADPGlc was separated with Dowex anion exchange column (200-400 mesh, Sigma Chemical Co.). One unit of activity is defined as 1 nmol Glc incorporated into the a-glucan per min at 250C. SBE activity was determined by phosphorylase stimulation assay.

One unit of activity is defined as l mmol Glc incorporated into the a-glucan per min at 3 00C.

Example 8 Enzyme purification For the recombinant SS purification, the cell pellet was resuspended in sonication buffer (50 mM Tris-acetate, pH 7.5, 10 mM EDTA, and 5 mM DTT; 7 ml buffer per gram of cell mass), and cells were lysed using a Fisher 550 Sonic Dismembrator with 5 x 1 min. bursts with 30 sec. intervals. The homogenate was centrifuged at 9600g for 30 minutes. SSI in the supernatant was then precipitated by slowly adding neutralized saturated ammonium sulfate to 40% saturation. After stirring on ice for an additional 50 minutes, proteins were collected by centrifugation at 12700g for 45 minutes. The protein pellet was then redissolved in buffer A (50 mM Tris, pH 7.5, 1 mM EDTA, and 5 mM DTT) containing 0.1 M KC1 and dialyzed against the same buffer, with one change of buffer. After dialysis, the sample was centrifuged at 13000g for 20 minutes to remove insoluble materials. The resulting supernatant was loaded onto an amylose affinity column pre-equilibrated with dialysis buffer, and the flow through was collected. The column was washed with 10 column volumes of buffer A containing 0.1 M KCl, and then with buffer A containing 0.5 M KCl and 0.5 M maltose, collecting fractions during both washes. The active fractions were pooled and dialyzed overnight against buffer A, with one change of buffer. The next day, the amylose column sample was filtered and applied to a mono Q 5/5 FPLC column (Pharmacia). After washing with buffer A, a 20 ml 0-0.4 M KCl gradient was employed. The active fractions were electrophoresed on an 8% SDS-PAGE gel (31) to determine the purity of SSI in those fractions; the fractions which were apparently homogeneous were pooled and concentrated using a Centricon-30 spin column (Amicon).

Table 1. Expression of maize starch synthases in Escherichia coli BL21(DE3).

Plasmids Maize starch synthase N-terminus Protein Specific Activities* genes (mg/mL) (units/mg Protein) pET2la Native plasmid 1.8 0.009 pEXS-3a SSlla-2 GENVMNVIW 2.8 0.069 pEXS-3c SSlla AEAEAGGKD 2.8 0.28 pEXS-ld SS1-3 MSIVFVTGEA 3.0 0.23 pEXS-8 SSI-2 GDLGLEPEG 1.9 0.097 pExs-10SSI CVAELSREG 1.2 0.043 pEXS-9 SSllb GSVGAALRSY 1.8 0.515 pEXS-9a SSIIb-2 MNVVVVASEC 2.6 0.36 pEXS-wx GBSS (waxy) ASAGMNWFV 2 0.033 pEXS-wx2 GBSS(2) MNVVFVGAEM 2.2 0.32 *One unit activity is defined as one µmol glucose incorporated into a-1,4 glucan per ,imute at 25°C using 5 mg/mL glycogen as primer.

Table 2. Properties of polysaccharides synthesized in E.coli.<BR> <P> Plasmid Protein STS activity BE activity lmax DP CL Yield<BR> (Mg/mL) (u/mg protein) (u/mg protein) (nm) (mg dry wt/g wet cell)<BR> pExsCA 580 700 10.6 3.3<BR> pExsC-9 585 1007 35.8 4.1<BR> pExsC-3a 13.3 .0015 600 983 53 1.0<BR> pExsC-8 12.6 .0032 580 435 31.8 7.4<BR> pExsC-wx 15.2 0.002 600 836 15.6 9.1<BR> pExsC-I-II+pExs9 7.84 0.08 4.71 480 2333 19 30<BR> pExsC-I-II+pExs3a 13.61 0.011 1.56 530 3616 22 36<BR> pExsC-I-II+pExs8 11.95 0.042 3.33 525 1689 17.5 131<BR> pExsC-I-II+pExs10 8.9 .0094 3.65 500 3174 16.6 24.5<BR> pExsC-I-II+pExsA1 11 0.13 4.48 475 3940 14 28.9 Table 3. Properties listed by degree of DP of polysaccharides synthetized in E. coli.<BR> <P> Plasmid Protein STS activity BE activity lmax DP CL Yield<BR> (Mg/mL) (u/mg protein) (u/mg protein) (nm) (mg dry wt/g wet<BR> cell)<BR> pExsC-I-II+pExsA1 11 0.13 4.48 475 3940 14 28.9<BR> pExsC-I-II+pExs3a 13.61 0.011 1.56 530 3616 22 36<BR> pExsC-I-II+pExs108.9 .0094 3.65 500 3174 16.6 24.5<BR> pExsC-I-II+pExswx11.7 .007 5.4 450 2970 14.8 33.8<BR> pExsC-I-II+pExs9 7.84 0.08 4.71 480 2333 19 30<BR> pExsC-I-II+pExs8 11.95 0.042 3.33 525 1689 17.5 131<BR> pExsC-9 585 1007 35.8 4.1<BR> pExsC-wx 15.2 0.002 600 836 15.6 9.1<BR> pExsCA 580 700 10.6 3.3<BR> pExsC-8 12.6 .0032 580 435 31.8 7.4 Table 4. Properties listed by degree of #max of polysaccharides synthesized in E. coli.<BR> <P> Plasmid Protein STS activity BE activity #max DP CL Yield<BR> (Mg/mL) (u/mg protein) (u/mg protein) (nm) ( mg dry wt/g wet<BR> cell)<BR> pExsC-3a 13.3 .0015 600 983 53 1.0<BR> pExsC-wx 15.2 0.002 600 836 15.6 9.1<BR> pExsC-9 585 1007 35.8 4.1<BR> pExsCA 580 700 10.6 3.3<BR> pExsC-8 12.6 .0032 580 435 31.8 7.4<BR> pExsC-I-II+pExs3a 13.61 0.011 1.56 530 3616 22 36<BR> pExsC-I-II+pExs8 11.95 0.042 3.33 525 1689 17.5 131<BR> pExsC-I-II+pExs10 8.9 .0094 3.65 500 3174 16.6 24.5<BR> pExsC-I-II+pExs9 7.84 0.08 4.71 480 2333 19 30<BR> pExsC-I-II+pExsA1 11 0.13 4.48 475 3940 14 28.9<BR> pExsC-I-II+pExswx 11.7 .007 5.4 450 2970 14.8 33.8 Table 5. Properties listed by degree of CL of polysaccharides synthesized in E. coli.<BR> <P> Plasmid Protein STS activity BE activity #max DP CL Yield<BR> (Mg/mL) (u/mg protein) (u/mg protein) (nm) ( mg dry wt/g wet<BR> cell)<BR> pExsC-3a 13.3 .0015 600 983 53 1.0<BR> pExsC-9 585 1007 35.8 4.1<BR> pExsC-8 12.6 .0032 580 435 31.8 7.4<BR> pExsC-I-II+pExs3a 13.61 0.011 1.56 530 3616 22 36<BR> pExsC-I-II+pExs9 7.84 0.08 4.71 480 2333 19 30<BR> pExsC-I-II+pExs8 11.95 0.042 3.33 525 1689 17.5 131<BR> pExsC-I-II+pExs10 8.9 .0094 3.65 500 3174 16.6 24.5<BR> pExsC-wx 15.2 0.002 600 836 15.6 9.1<BR> pExsC-I-II+pExswx 11.7 .007 5.4 450 2970 14.8 33.8<BR> pExsC-I-II+pExsA1 11 0.13 4.48 475 3940 14 28.9<BR> pExsCA 580 700 10.6 3.3 Table 6. Purification Tables for SSI-1, SSI-2, andSSI-3.

SSI-1 volume total mg activity total purification (ml) protein U/mg Units (fold) Homogenate 630 4347 0.018 76.2 1 Supernatant 570 2622 0.020 53.0 1.1 0-40% (NE4)2SO4 48 494 0.058 28.7 3.2 Amylose column 17 2.6 5.03 11.3 279 monoQ column 0.27 0.26 12.2 3.2 677 SSI-2 volume total mg activity total purification (ml) protein U/mg Units (fold) Homogenate 380 2797 0.0356 99.6 1 Supernatant 320 2118 0.0340 72.0 1 0-40%(NH4)2SO4 48 466 0.133 61.8 3.7 Amylose column 17.5 1.2 -- 22.6 26.5 634 monoQ column 1.0 0.325 17.2 5.6 483 SSI-3 volume total mg activity total purification (ml) protein U/mg Units (fold) Homogenate 1300 16770 0.23 3900 1 Supernatant 1100 9790 031 3080 1.3 0-40% (NH4)2SO4 237 2204 1.5 3294 6.5 Amylose column 63 30 22.4 668 97 monoQ column 3.6 3.1 30.5 93 132 Notes: Assays performed during the course of purification contained 10 mg/ml glycogen and 3 mM [U-14C]-ADPGlc. Assays were performed at room temperature in the presence of 0.5 M citrate. 1 Unit = 1 µmol [U-'4C]-glucose transferred per min.

Table 7. Primer Kinetics for SSI enzymes Amylopectin SSI-3 SSI-2 SSI-1 + citrate Wm 240 + 45 230 t 50 150 + 40 Vmax 26.3 + 0.5 33.4 + 2.1 22.5 + 0.6 -citrate Km 230 i60 68 + 3 120 + 20 Vmax 13.2 t 0.3 9.94 + 0.18 7.62 #0.99 Glycogen SSI-3 SSI-2 SSI-1 + citrate 1Vm2x 43.4 + 2.5 45.6 t 3.3 39.0 + 2.2 - citrate @Vmax 41.4 # 2.9 45.5 t 1.5 26.1 # 1.4 Notes: Assays were performed at 37°C as described in the Materials and Methods. Data are expressed as the average of three independent determinations along with the standard deviation. Km are expressed as µg/ml primer and Vmax are in pmol/min/mg protein. ADPGlc = 3 rnM in all assays. aBecause saturating glycogen concentrations could not be obtained, a standard 20 mg/ml glycogen was used to compare enzyme rates for that primer.

Table 8. ADPGlc Kinetics for STSI enzymes. Assays and data evaluation are as in Table U.

Km are expressed as mM ADPGlc and Van, are in µmol/min/mg protein. 5 mg/ml amylopectin was used as primer for all assays.

STSI-3 STSI-2 STSI-1 + citrate Km 0.33 + 0.07 0.32 # 0.02 0.18 # 0.02 Vm 26.4 + 1.4 32.6 # 0.8 18.0 i 0.5 - citrate Km 0.62 + 0.04 0.25 + 0.04 0.24 t 0.02 Vm 14.7 + 1.3 11.7 + 0.7 6.38 + 0.88 Table 9. Purification Tables for SSIIa enzymes. Assays for SSIIa-2 purification contained 10 mg/ml glycogen and 1.5 mM [UJ4C]-ADPGlc (both are at saturating concentrations). Assays for SSlla-1 purification contained 5 mglml amylopectin and 3 mM [U-l4C]-ADPGlc. Assays were performed at room temperature in the presence of 0.5 M citrate. 1 U =1 µmol [U-l4C]-glucose transferred per min.

SSIIa-2 volume total mg activity total purification (ml) (mi) protein U/mg Units (fold) Supernatant 300 1620 0.0216 34.8 1 0-40%(NH4)2SO4 53 419 0.0606 25.4 2.8 Amylose column 20 9.3 0.991 9.3 45.9 monoQ column 0.9 0.94 4.81 4.5 222 SSIIa-1 volume total mg activity total purification (ml) (ml) protein U/mg Units (fold) Supernatant 335 2613 0.28 737 1 0-40% (Nm)2SO4 47 427 0.96 409 3.4 Amylose column 25 11.5 8.04 92 28.7 monoQ column 1.0 4.8 9.10 44 32.5 Table 10. Primer kinetics for SSIIa enzymes. Assays were performed as described in the Materials and Methods. Data are expressed as the average of three independent determinations along with the standard deviation. Km are expressed in pg/ml and Vmax are in µmol/min/mg protein. ADPGlc = 3 mM in all assays. *NA = not applicable; enzyme cannot be saturated by primer under these conditions.

Amylopectin SSIIa-2 SSIIa-1 + citrate 27°C Km 153 + 22 182 + 38 Vmax 7.82 + 0.63 24.1 + 0.5 37°C Km 133 + 18 153 + 64 Vmax 15.4#0.6 41.1#0.2 - citrate 27°C Km 234 s 30 404 + 33 Vmax 4.31 + 0.32 10.5 i 0.3 37°C Km 1350#220 -NA Vmax 7.84 + 0.25 -NA Glycogen SSIIa-2 SSIIa-1 + citrate 27°C Km 50.7#3.8 162#17 Vmax 5.53 # 0.44 14.2 + 0.7 37°C Km 76.9 + 7.8 350 + 11 Vmax 11.3 + 0.7 31.6 + 0.8 Table 11. ADPGlc Kinetics for SSIIa enzymes. Assays and data evaluations are as in Table IL Concentration of primer in each case was saturating for each enzyme and was determined by the experiments detailed in Table II. Km are expressed as mM ADPGlc and Vmax are in µmol/min/mg protein. *NA = not applicable, as the enzyme cannot be saturated by primer under these conditions. with amylopectin as primer SSIIa-2 SSIIa-1 + citrate 27°C Km 0.17 t 0.04 0.48 + 0.09 Vmax 4.83#0.42 23.0#2.5 37°C Km 0.28 t 0.01 0.83 # 0.08 Vmax 11.4 + 0.6 49.1 + 2.6 - citrate 27°C Km 0.27 + 0.02 0.46 + 0.06 Vmax 4.87#0.25 12.1#0.8 37°C Km 0.28#0.005 -NA* Vmax 7.86 s 0.53 -NA* with glycogen as primer with glycogen SSIIa-2 SSIIa-1 + citrate 27°C Km 0.16 # 0.03 0.19 + 0.02 Vmax 4.41 + 0.21 17.1 + 0.7 37°C Km 0.15 i 0.03 0.37 + 0.04 Vmaz 7.60 # 0.94 40.1 + 1.7 Table 12. Purification Tables for SSIIb-2 and SSIIb-1. Assays performed during the course of purification contained 10 mg/ml glycogen and 3 mM [U-14C]ADPGlc. Assays were performed at room temperature in the presence of 0.5 M citrate. 1 U = 1 µmol 1U- 14Cjglucose transferred per min.

SSIIb-2 volume total mg activity total purification (ml) protein U/mg Units fold Supernatant 890 9256 0.48 4450 1 0-40% (NH4)2SO4 190 2660 1.24 3306 2.6 Amylose column 13 31.2 50.6 1573 105 monoQ column 6.6 16.3 56.8 939 118 SSIIb-1 volume total mg activity total purification (ml) protein U/mg Units fold Supernatant 365 2336 0.64 1533 1 0-40% (NH4)2SO4 56 436 2.35 1030 3.7 Amylose column 80 10.4 50.2 521 78 monoQ column 0.6 0.28 60.6 17.6 94 Table 13. Kinetics for SSIIb enzymes. Assays were performed at 37°C as described in the Materials and Methods. Data are expressed as the average of three independent determinations along with the standard deviation. For ADPGlc kinetics, K", are expressed in mM ADPGlc. For primer kinetics, K, are expressed as mg/ml primer, and 3 mM ADPGlc were used in the assays. V are in µmol min-1mg-1 protein.

ADPGlc Kinetics SSIIb-2 SSIIb-1 with glycogen Km 0.32 + 0.04 0.71 + 0.01 Vmax 130 + 6 76.8 + 3.2 with amylopectin Km 0.32 + 0.03 0.40 + 0.02 vmax 90.9 + 4.2 72.8 # 2.8 Primer Kinetics SSIIb-2 SSIIb-1 glycogen Km 0.36 + 0.02 0.43 + 0.02 Vmax 120#3 79.5#3.3 amylopectin Km 0.26 # 0.04 0.074 s 0.008 Vmax 84.5 + 2.4 67.9 + 1.7 Table 14. Comparison ofkinetic data for expressed SS's. Data for SSI and SSIIa are form Imparl-Radosevich et al., 1998; Imparl-Radosevich J>, Li P, McKean Al, Keeling PL, and Guan HP, submitted for publication. Km for amylopectin and glycogen are epxressed in mg/ml; Km for ADPGlc are in mM and were determined in the presence of amylopectin and 0.5 M citrate. Vma, are in µmol min-1mg-1. The Km for glycogen for SSI could not be determined as saturating concentrations of glycogen could not be reached for this enzyme.

Kinetic paramter SSI-3a SSI-1 SSIIa-2a SSIIa-1 SSIIb-2a SSIIb-1 Km foramylopectin 0.24 0.15 0.13 0.15 0.26 0.07 K- for glycogen - - 0.077 0.35 0.36 0.43 Km forADPGlc 0.33 0.18 0.28 0.83 0.32 0.40 Vmax (with amylopectin) 26.3 22.5 15.4 41.1 84.5 67.9 Vmax (with glycogen) 43.4 39.0 11.3 31.6 120 79.5 adenotes N-terminally truncated form of SS, while any SS with the designation SS-1 is the full length version ofthe SS.

Table 15. The starch synthase activities of the chimerical enzymes.

Generation of chimerical enzymes of maize starch synthase: the recombination of N-terminal extensions with C-terminal catalytic domains of starch synthase The gene coding for N-terminal extensions of STSI, STSlla and STSllb were inserted, in the same (+) or reverse (-) orientation of original N-terminal DNA sequence, in front of the C-terminal catalytic domains of WX2, STSlla and STSllb, respectively. The chimerical enzymes were expressed in E.coli, and the activities were assayed. Wx2 STSIIa STSIIb C-catalytic domain C-catalytic domain C-catalytic domain STSI N1-WX2 N1-C2 N1-C3 N-extension (+) (-) (+) (-) (+) (-) NRA 9.0 6.6 39.7 89.2 STSlla N2-WX2 N2-C2 N2-C3 N-extension (+) (-) (+) (~) (+) (-) 9.2 11.2 213.8 8.7 232.5 NRA STSUb N3-WX2 N3-C2 N3-C3 N-extension (+) (-) (+) (-) (+) (-) NRA NRA 11.2 NRA 400.5 12.0 *N1: STSIN-terminal extension; N2: STSIIa N-terminal extension; N3: STSIIb N-terminal extension; WX2: WX2 C-terminal catalytic domain; C2: STSIIa C-terminal catalytic domain; C3: STSIIb C-terminal catalytic domain.

* (+): the N-terminal extensions were inserted in front of the C-terminal catalytic domains in same orientation; (-): the N-terminal extensions were inserted in front of the C-terminal catalytic domains in reverse orientation.

* Starch synthase enzyme activity: nmol/min mgprotein.

* The residue glycogen synthase activity ofBL2l(DE3) is 2.6nmol/min mg protein.

* NRA--No recombinant available.

The photographs listed in the figures 42 and 21 attempt to show the visual differences that are present into the starches as compared to those known in the art.

Description of the starch Corn starch is a milky , slightly thickened gel which is slightly if at all flowable.

Rice starch forms two levels the upper level is a thickened syrup like consistency more flowable then corn starch (less thick then corn starch) opaque milky color (more translucent then corn starch in this level) and a lower level which is a very white glob not transmitting much light through this bottom level of material. This lower level is formed in a very thick mass and does not appear flowable.

Corn amylonectin is slightly less white then the top level of rice starch and is a very slightly opaque milky color (more translucent then corn starch) slightly less flowable then the rice top level.

Potato dextrin is the most transparent almost appearing clear but is still opaque white and it is very flowable appearing only slightly less flowable then water.

Waxv Maize starch will flow very slowly and has the consistency of honey. The color is very opaque transmitting little light and the color is only slightly less light then corn starch.

SSI starch made from plasmid pExs-8 has two distinct levels. The top level appears clear and slightly thicker then the flowability of water. The bottom level appears as a precipitate. This sample resembles the ornaments that contain little figures and plastic flakes resembling snowflakes. Like those ornaments when turned upside down the sample appears to be falling snow. However the flakes in this sample appear to be slightly gummy and appear in the first moments of level mixing to form a opaque white liquid.

SSI starch made from a host containing the following two plasmids pExsC BEI BEII and pExs8 is not as clear as the top level of pExs-8 and appears slightly less thick then pExs-8.

It has even more flowability then does Potato Dextrin.

SSIIb starch made from a host containing the following two plasmids pExsC BEI BEII and pExs-9 is not as clear as the top level of pExs-8 and appears slightly less thick then pExs-8.

It has even more flowability then does Potato Dextrin.

WAXY starch made from a host containing the following two plasmids pExsC BEI BEII and pExs-wx is not as clear as the top level of pExs-8 but seems to have a few tiny thread like chains that settle to the bottom and when mixed give the material a slightly more white color and appears slightly less thick then pExs-8. It has even more flowability then does Potato Dextrin.

SSII starch made from a host containing the following two plasmids pExsC BEI BEII and pExs-3a is the color of corn starch and maybe slightly whiter but not as white as the bottom level of pExs8 and definitely transmitting more light through and has the flowability characteristic of pExs-8 when mixed. gl£TA starch appears to have a very slight precipitate and is comparable in color to corn amylose pectin and ExsC BEI BEII and pExs-wx. And the flowability is between corn amylose and pExsC BEI BEII pExs-wx.

The samples of polysaccharides listed above form groups generally according to color as follows: waxy maize starch and corn starch and pExsC BEI BEII pExs3a and pExsc8 are the whitest group. The flowability characteristics of this group are fairly diverse. With corn starch a lump and Waxy maize starch only slightly flowable and pExsC BEI BEII and pExs- 3a and pExsC-8 more like water then syrup. The second group contains corn amylopectin and pExsC BEI BEII pExs-wx and pExsC BEI BEII and pExs-Al which are less white and clearer.

The flowability of corn amylopectin is less then the other two members of this group but it is still similar. The last group is the least white and thus the clearest. This group includes pExsC BEI BEII and pExs-8, potato dextrin, pExsC BEI BEII and pExs-10, pExsC BEI BEII and pExs-9. The flowability of this group is also similar to each other.

Plant Hosts The following plasmids have been transformed into rice plants. The sequence for the mutant glgC gene is shown in Figure 46. The plasmids are made substantially in a similar manner as described above for the production of bacterial plasmid. Clearly the plasmid maps shown in figures 25-41 and this application and the listed short protocols allow the ordinarily skilled person in the art to make the present plasmids. The following combinations of plasmids have been transformed into rice plants. Additionally combinations of plasmids including the combination that includes all of the maize genes 551, 5511, 5511, BEI, BEII, and GBSS in one host or alternatively in two host that are then crossed to form a hybrid having the entire complement of up regulated starch genes are being developed. Clearly the ordinarily skilled person in the art could have placed the sequences in the antisense positions to down regulate these genes to the extent that maize genes will down regulate the partial homologous rice genes. The first group of transgenic are group, including rice transformants (transformed by microprojectile bombardment) containing MSTSI-2 (pExs52) and glgC3 (pExs66), M5TSIIa-2 and glgC3 (pExs53 and pExs56). The second group of rice transformants contains MSTSIIa and glgC3 (pExs54 and pExs56). The third group of transformation contain: transgenic 5 MSTSIIb and glgC3 (pExs 61 and pExs 66); transgenic 6 Maize wx and glgC3 pExs65 and pExs66). Additionally, glgA and glgB and glgC are combined and transformed into rice. This last transformant is combining the rice plants starch pathway with the gene encoding for ADPG pyrophosphorylase and the bacterial genes. The combination of the plasmids encoding for at least one of the following enzymes, 551, SSIIa, S5IIb, SSIII, Debranching enzymes, BEI, BEII, GBSS (wx)and some or all of the bacterial starch genes is also useful. There ae presently over 300 transformants in the greenhouse.The T1 transgenic rice plants have been screened and characterized (Figure 56, 57). 12 plants have successfully expressed maize SSI-2 in rice seeds.

21 plants have successfully expressed maize SSIIb in rice seeds. We are currently screening rice plants down regulated the rice SS expression by cosuppression and have 400 T2 plants in the greenhouse.

Maize Starch Synthase and its Mutant Forms.

In order to characterize the multiple forms of maize starch synthase, the genes coding for the full length SS and its N-terminally truncated forms were expressed in E. coli,. The recombinant enzymes were purified and kinetically characterized. We have demonstrated that different isoforms and its truncated forms all have distinct properties (Table 6-14, Figure 58- 63). The specific activities (Vmax) of the purified maize SSI- 1, 551-2, and SSI-3 were 22.5, 33.4 and 26.3 mol glc/min/mg of protein respectively, Our results have clearly indicated that the catalytic center of SSI is not located in its N-terminal extension. However, N-terminal truncation decreased the enzyme affinity for amylopectin, with the Km for amylopectin of the truncated SSI-3 being about 60%-90% higher than that of the full length SSI-1. The effects of N-terminal truncation of SSIIa depend upon the assay conditions used. For both SSIIa-1 and SSIIa-2, the Vmax of each enzyme increased 2-fold upon raising assay temperature from 27 NC to 37 NC (Tables II and III). However, the effect of temperature on ADPGlc affinity was different for SSIIa-1 and SSIIa-2. For the truncated 5SIIa-2, the Km for ADPGlc was not affected by raising temperature. In contrast, the Km of ADPGlc for the putative full length SSIIa-1 increased 2 fold upon raising the assay temperature from 27 NC to 37 NC (Table III).

Interestingly, the truncated SSIIa-2 exhibited a lower Km for ADPGlc than SSIIa-1 did in all assay conditions used in this study except that they showed similar Km values for ADPGlc when glycogen was used as a primer at 27EC. Although N-terminal truncation of SSIIa appears to lower the Km for ADPGlc under most assay conditions, it also must be noted that the maximal velocity of the truncated SSIIa-2 is decreased by about 2-4 fold when compared to 5SIIa-1. The truncated SSIIb-2 was found to be more temperature stable than the longer SSIIb- 1 in the presence of citrate, while little difference was observed in their pH activity profiles.

While the putative full length SSIIb-l showed a similar Vmay using amylopectin or glycogen as a primer, the N-terminally truncated SSIIb-2 showed a 40% increase in Vmay using glycogen compared with amylopectin as a primer. N-terminal truncation of SSIIb increased its Vmax by 25% with amylopectin as a primer. We also demonstrated that kimeric enzymes of maize starch synthase (combining the C-terminal domain of SS with different N-terminal sequences of SS or unrelated sequences would produce a functional enzyme with SS activity and altered properties) (Table 15).

Conclusions, Ramifications, and Scope Accordingly, it can be seen that, according to the invention, The starch genes can produce new and altered starch in either host, plant or bacteria. Additionally, polysaccalrrides very similar to corn starch can be produced in a bacterial host.

Although the description above contains many specificities, these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention. Various other embodiments and ramifications are possible within it's scope. For example, different combinations of the plasmids in either host for the production of useful plant and useful grain and useful polysaccahrides.

Thus the scope of the invention should be determined by the appended claims and their legal equivalents, rather than by the examples given. All references cited herein are incorporated herein in their entirety by reference.