FIELD OF INVENTION

The present invention relates to the field of poly(ether imine) (PETIM) dendrimers, methods of producing the dendrimers and their use as transfecting agents for therapeutic agent delivery in particular, for nucleic acid delivery.

BACKGROUND OF THE INVENTION

The process of gene therapy aims at generation of an optimal therapeutic outcome, either by production or inhibition of specific intracellular proteins, mediated by exogenously delivered DNA (Anderson, W. F. (1998) Human gene therapy. Nature 392, 25-30). Critical to the success of gene therapy is the requirement of a safe and efficient gene delivery system (Verma, I. M., and Somia, M. (1997) Gene therapy- promises, problems and prospects. Nature 389, 239-242). Viral and non-viral vectors are the general approaches to address gene delivery requirements. Whereas viral vectors are prominent, including in clinical gene therapies (Thomas, C. E., Ehrhardt, A., and Kay, M. A. (2003) Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358), development of non-viral vectors is being pursued actively in efforts to ameliorate undesirable effects of viral vectors. Non- viral vectors are considered attractive due to advantages associated with molecular level modifications suitable to optimize vector properties (Mintzer, A. M., and Simanek, E. E. (2009) Nonviral vectors for gene delivery. Chem. Rev. 109, 259-302; Fernandez, C. A., and Rice, K. G. (2009) Engineered nanoscaled polyplex gene delivery systems. Mol. Pharm. 6, 1277-1289; Bhattacharya, S., and Bajaj, A. (2009) Advances in gene delivery through molecular design of cationic lipids. Chem. Commun. 4632-4656; Zhang, S., Zhao, Y., Zhao, B., and Wang B. (2010) Hybrids of Nonviral Vectors for Gene Delivery. Bioconjugate Chem. 21, 1003-1009). Non-viral vectors based on cationic lipids, chitosan, poly-lactide-co-glycolide, gelatin, polyethylene imine and polymethyl methacrylate were studied extensively (Remy, J. S., Abdallah, B., Zanta, M. A., Boussif, O., Behr, J.-P., and Demeneix, B. (1998) Gene transfer with lipospermines and polyethylenimines. Adv. Drug Deliv. Rev. 30, 85-95; Torchilin, V. P. (2005) Block coploymer micelles as a solution for drug delivery problems. Expert Opin. Therapeutic Pat. 15, 63-75; Choi, J. S., Joo, D. K., Kim, C. H., Kim, K., and Park, J. S. (2000) Synthesis of a Barbell-like triblock coploymer, poly (L-lysine) dendrimer-2>/oc£-poly (ethylene glycol)-Woc£-poly (L-lysine) dendrimer, and its self-assembly with plasmid DNA. J. Am. Chem. Soc. 122, 474-480; Luo, D., and Saltzman, W. M. (2000) Synthetic DNA delivery systems. Nat. Biotechnol. 18, 33-37; Martin, B., Sainlos, M., Aissaoui, A., Oudhiri, N., Hauchecorne, M, Vigneron, J.-P., Lehn, J. -M, and Lehn, P. (2005) The design of cationic lipids for gene delivery. Curr. Pharm. Design 11, 375-394; Takae, S., Miyata, K., Oba, M., Ishii, T., Nishiyama, N., Itaka, K., Yamasaki, Y., Koyama, H., and Kataoka, K. (2008) PEG-detachable polyplex micelles based on disulfide-linked block catiomers as bioresponsive nonviral gene vectors. J. Am. Chem. Soc. 130, 6001-6009; Prata, C. A. H., Zhang, X.-X., Luo, D., Mcintosh, T. J., Barthelemy, P., and Grinstaff, M. W. (2008) Lipophilic peptides for gene delivery. Bioconjugate Chem. 19, 418-420; Zugates, G. T., Tedford, N. C, Zumbuehl, A., Jhunjhunwala, S., Kang, C. S., Griffith, L. G., Lauffenburger, D. A., Langer, R., and Anderson, D. G. (2007) Gene delivery properties of end-modified poly(P-amino ester)s. Bioconjugate Chem. 18, 1887-1896; Liu, Y., Wenning, L., Lynch, M., and Reineke, T. M. (2004) New poly(glucaramidoamine)s induce DNA nanoparticle formation and efficient gene delivery into mammalian cells. J. Am. Chem. Soc. 126, 7422-7423). Synthetic dendrimer macromolecules have also been explored in gene delivery, accompanied with many attributes of dendrimers suitable to the functions of a vector (Shah, D. S., Sakthivel, T., Toth, I., Florence, A. T., and Wilderspin, A. F. (2000) DNA transfection and transfected cell viability using amphipathic asymmetric dendrimers. Int. J. Pharm. 208, 41-48; Brown, M. D., Schatzlein, A. G., and Uchegbu, I. F. (2001) Gene delivery with synthetic (non viral) carriers. Int. J. Pharm. 229, 1-21 ; Weber, N., Ortega, P., Clemente, M. I., Shcharbin, D., Bryszewska, M., de la Mata, F. J., Gomez, R., and Munoz-Fernandez, M. A. (2008) Characterization of carbosilane dendrimers as effective carriers of siRNA to HIV-infected lymphocytes. J Control. Release. 132, 55-64; Guillot-Nieckowski, M, Joester, D., Stohr, M., Losson, M., Adrian, M., Wagner, B., Kansy, M., Heinzelmann, H., Pugin, R., Diederich, F., and Gallani, J.-P. (2007) Self-assembly, DNA complexation, and pH response of amphiphilic dendrimers for gene transfection. Langmuir 23, 737-746). Higher generation poly(amido amine) series of dendrimers are by far the most studied dendrimers for gene delivery studies among dendrimers (Haensler, J., and Szoka, F. C, Jr. (1993) Polyamidoamine cascade polymers mediate efficient transfection of cells in culture. Bioconjugate Chem. 4, 372-379; Kukowska-Latallo, J. F., Bielinska, A. U., Johnson, J., Spindler, R., Tomalia, D. A., and Baker, J. R., Jr. (1996) Efficient transfer of genetic material into mammalian cells using starburst polyamidoamine dendrimers. Proc. Natl. Acad. Set USA 93, 4897-4902; Bielinska, A. U., Kukowska-Latallo, J. F., and Baker, J. R. Jr. (1997) The interaction of plasmid DNA with polyamidoamine dendrimers: mechanism of complex formation and analysis of alterations induced in nuclease sensitivity and transcriptional activity of the complexed DNA. Biochim. Biophys. Acta, 1353, 180-190; Braun, C. S., Vetro, J. A., Tomalia, D. A., Koe, G. S., Koe, J. G., and Middaugh, C. S. (2005) Structure/function relationships of polyamidoamine/DNA dendrimers as gene delivery vehicles. J. Pharm. Sci. 94, 423- 436; Radu, D. R., Lai, C.-Y., Jeftinija, K., Rowe, E. W., Jeftinija, S., and Lin, V. S.-Y. (2004) A polyamidoamine dendrimer-capped mesoporous silica nanosphere-based gene transfection reagent. J Am. Chem. Soc. 126, 13216-13217; Nam, H. Y., Hahn, H. J., Nam, K., Choi, W.-H., Jeong, Y., Kim, D.-E., and Park, J.-S. (2008) Evaluation of generations 2, 3 and 4 arginine modified PAMAM dendrimers for gene delivery. Int. J. Pharm. 363, 199-205).

Primary requirements of gene carriers are their buffering capacities, DNA condensation abilities, and reduced toxicities. Poly(ethylene imines) and poly(amido amines) fulfill the requirements, although impediments relating to low gene expression levels and toxicities are a concern, for which, modifications of generic structures provide a clue (Lin, C, and Engbersen, J. F. J. (2008) Effect of chemical functionalities in poly(amido amine)s for non- viral gene transfection. J. Control. Release 132, 267-272; Wang, R., Zhou, L., Zhou, Y., Li, G., Zhu, X., Gu, H., Jiang, X., Li, H., Wu, J., He, L., Guo, X., Zhu, B., and Yan, D. (2010) Synthesis and gene delivery of poly(amido amine)s with different branched architecture. Biomacromolecules 11, 489-495).

On the other hand, activation of adaptive immune responses by innate immune system has a potential in the development of safer and effective vaccines and adjuvants against pathogens. Several pattern recognition receptors (PRR), for example, toll-like receptors (TLR), NOD-like receptors and RIG-like receptors recognize pathogenic agents or their ligands, and activate intracellular signaling events, resulting in initiation of adaptive immune responses. The intermediary molecules involved in PRR-mediated signaling is a safer strategy than using TLR ligands which may evoke adverse effects following systemic administration (Wales, J., Andreakos, E., Feldmann, M., Foxwell, B. (2007) Targeting intracellular mediators of pattern-recognition receptor signaling to adjuvant vaccination. Biochem, Soc. Trans. 35, 1501-3).

Nanoparticulate formulations for gene delivery offer the advantages of specific cellular or subcellular targeting, improved bioavailability and facile synthesis (Bharali, D. J., Pradhan, V., Elkin, G., Qi, W., Hutson, A., Mousa, S. A. et al. (2008) Novel nanoparticles for the delivery of recombinant hepatitis B vaccine. Nanomedicine 4, 31 1- 7). For example, nanoparticulate formulations can increase the expression of co- stimulatory molecules (including CD40, CD80 and CD86 on dendritic cells), and soluble factors (TNF-a, IL-6, RANTES, MIP-la and IL-2) and MHC I, II and Toll-Like Receptors (Klippstein, R., Pozo, D. Nanotechnology-based manipulation of dendritic cells for enhanced immunotherapy strategies (2010) Nanomedicine: Nanotechnology, Biology and Medicine 6, 523-9).

BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS

Figure 1 shows (a) structure of fourth generation PETIM dendrimer, as an example of generic PETIM dendrimer series; (b) preparation of fourth generation PETIM dendrimer from a third generation PETIM dendrimer; (c) a cartoon representation of the electrostatic interaction of cationic PETIM dendrimer with anionic nucleotide Figure 2 shows

(a) Cell viability of PETIM dendrimer on BHK-21 cells, after 24 h. CC is cell control; bars represent standard error of mean (S.E.M.)

(b) TEM image pEGFP-Cl -PETIM complex at a charge ratio 5: 1

(c) Gel retardation assay on pEGFP-Cl -PETIM dendrimer. Lane 1 : Uncomplexed DNA (1 μg); lanes 2 to 7: pEGFPCl -PETIM complexes at charge ratios of 1 : 1, 1.5: 1 , 2: 1 ; 2.5: 1 ; 3:1 and 3.5:1, respectively

(d) Image of nuclease protection assay. Lane 1 : pEGFP-Cl(5 μg); lane 2: pEGFP-Cl complexed with PETIM at the end of 30 min.; lane 3: pEGFP-Cl treated with DNase I (1U) for 30 min.; lanes 4 to 6: intact DNA released from the complexes by SDS disruption, after treatment with DNase I for 30, 60, and 120 min., respectively.

Figure 3 shows electron micrographs of:

(a) normal BHK-21 cell

(b) pEGFPCl -PETIM complexes distributed within the cytoplasm

(c) complexes within the cytoplasm and thickening of rough endoplasmic reticulum membrane (thick arrow)

(d) PETIM-pEGFP-Cl complexes localized near the outer nuclear membrane and also within the nucleus (8 h post-transfection).

Figure 4 shows quantitative analysis of transfection efficiency of Turbofect (TF), a cationic lipid and PETIM-based transfection of pEGFP plasmid in BHK-21 cells. Mock represents un-transfected cells. Numerical ratios indicate the charge ratios of PETIM- pEGFPCl dendriplexes studied. Experiments were performed in 24 well-plates, in triplicate and data presented with standard error of mean (±S.E.M.).

Figure 5 shows transmission electron micrographs of dendriplex distribution within C2C12 cell (A & B) and P388D1 cells (C and D). Images showing (A, C) Mock- transfected (control) cells. (B,D) Cells Transfected with PETIM-pEGFP-C 1 complex (10:1 w/w ratio), 4 hours post-transfection. Arrows indicate dendriplexes seen within endosomes.

Table 1 provides list of primers used in this application.

Table 2 provides Fold changes in mRNA levels (calculated as 2 ^"AACt ) of TLR7 and associated genes induced by PETIM dendrimer, pEGFP-Cl and PETIM-pEGFP-Cl dendriplex.

DETAILED DESCRIPTION OF THE INVENTION

The terms "gene delivery system" and "nucleic acid delivery system" described herein are used interchangeably.

The subject matter of the present invention primarily concerns composition and methods of delivering foreign genetic material into cells. It is particularly useful for enhancement of the efficiency of genetic material with reduced toxicities. Although the object of the present invention is to deliver genetic material into cells, the inventors contemplate that any molecule of suitable size and configuration can be delivered into cells using the present invention. Thus other material for example protein and/or drugs can be delivered to targeted cells using the delivery system, techniques, and the composition disclosed in the present invention.

The gene delivery system or nucleic acid delivery system disclosed in the present invention can be used to deliver genes in-vitro or in-vivo to cells. The gene or nucleic acid delivery complex of the present invention comprises two parts, the genetic material; and a delivery vehicle/sy stem/vector.

The genetic material or the nucleic acid either DNA or RNA is carried by the delivery complex. One or more genes can be encoded on a strand of plasmid DNA, on double stranded DNA or RNA.

If the purpose of the gene transfer is to induce an immune response, then the genetic material must express on or more immunogenic protein such as different viral antigens and/or VLPs. Transduced cells will subsequently express enough of the immunogenic protein.

The present invention provides an entirely new class of dendrimer delivery systems. In particular the present invention provides poly(ether imine) (PETIM) dendrimer delivery system having the structure as set forth in Formula I. The dendrimer delivery system as disclosed in the present invention is capable of delivering negatively charged molecule such as nucleic acid molecule. The invention further provides a process of preparation of the dendrimer and process of delivering a nucleic acid molecule with poly(ether imine) (PETIM) dendrimer delivery system.

The PETIM dendrimers of the present invention are able to condense the DNA effectively, protect it from endosomal damage, and deliver to cell nucleus for effective gene expression. The Dendrimers as disclosed in the present invention are suitable agents for gene delivery roles.

Poly(ether imine) (PETIM) dendrimers, with primary amine peripheral groups, exhibit significantly reduced toxicities over a broad concentration range. The dendrimer complexes pDNA effectively, protects the DNA from endosomal damages and deliver it to cell nucleus. Gene transfection studies, involving a reporter plasmid, showed robust expression of the encoded protein. PETIM dendrimers are hither-to un-known novel gene delivery vectors, combining structural features of poly(ethylene imine) polymers and dendrimers, yet relatively non-toxic and structurally precise.

Non-viral vector based gene delivery approach is attractive due to advantages associated with molecular level modifications suitable to optimize vector properties. In a new class of non-viral gene delivery systems, we herein report the potential of poly(ether imine) (PETIM) dendrimers to mediate an effective gene delivery function. PETIM dendrimer, constituted with tertiary amine branch points, ^-propyl ether linkers and primary amines at their peripheries, exhibits significantly reduced toxicities, over a broad concentration range. The dendrimer complexes pDNA effectively, protects DNA from endosomal damages and delivers to cell nucleus. Gene transfection studies, utilizing a reporter plasmid pEGFP-Cl and upon complexation with dendrimer, showed a robust expression of the encoded protein. The study shows PETIM dendrimers are hither-to un-known novel gene delivery vectors, combining features of poly(ethylene imine)-based polymers and dendrimers, yet relatively non-toxic and structurally precise.

In accordance with the present invention in one of the embodiment there is provided a oly (ether imine) (PETIM) dendrimers having the structure as set forth in Formula I.

Formula I

wherein

Xi, X ₂ = H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo

J, k, 1, m, and n= numerical which corresponds to branch point multiplicity, which is the numerical value 2 i.e. J to n=2

Another embodiment of the present invention there is provided a polymer system to deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at least one negatively charged molecule.

Another embodiment of the present invention provides a polymer system deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at least one negatively charged molecule, wherein structure of the (PETIM) dendrimers is as set forth in Formula I.

Formula I

wherein

Xi, X ₂ = H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo

J, k, 1, m, and n= numerical which corresponds to branch point multiplicity, which is the numerical value 2 i.e. J to n=2

Another embodiment of the present invention provides a polymer system deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at lest one negatively charged molecule, wherein the negatively charged molecule is selected from a group consisting of nucleic acid, oligomers of DNA and RNA, polynucleotides, DNAzymes, single and double stranded DNA, single and double stranded RNA, antisense RNA and DNA, hammerhead RNA, short interfering RNA, micro RNA, ribozymes, pharmaceutically active compound, a peptide, protein, a therapeutic molecule or combinations thereof.

Another embodiment of the present invention provides a deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at lest one negatively charged molecule, wherein molecular weight of the PETIM is in the range of about 500 to 75,000 Dalton.

Yet another embodiment of the present invention provides the polymer system for nucleic acid delivery as disclosed in present invention, wherein the nucleic acid sequence or polynucleotide is selected from a group consisting of green fluorescent protein gene, GUS-gene, luciferase gene, β-galactosidase gene, hygromycin resistance gene, neomycin resistance gene, and chloramphenicol acetyl transferase gene, genes encoding low density lipoprotein receptors and coagulation factors, gene suppressers of tumors, genes encoding major histocompatibility proteins, antioncogenes, pi 6, p53, genes encoding thymidine kinase, genes encoding IL2, genes encoding IL 4, genes encoding TNF, genes encoding an viral antigen, genes encoding lectin, genes encoding a mannose receptor, genes encoding asialoadhesin, and a genes encoding a retroviral transactiviating factor (TAT).

Yet another embodiment of the present invention provides the polymer system for nucleic acid delivery as disclosed in the present invention, wherein said nucleic acid or polynucleotide is operatively linked to a promoter.

The polymer system for DNA delivery as disclosed in the present invention, wherein the DNA is plasmid DNA.

Further embodiment of the present invention provides a composition for delivering a therapeutic molecule into cells, wherein the composition comprising a polymer system to deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at lest one negatively charged molecule.

Yet another embodiment of the present invention provides a composition for delivering a therapeutic molecule into cells, wherein the composition comprising a polymer system to deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further iunctionalizations, and at least one negatively charged molecule, wherein the composition further comprises a targeting moiety which is recognizable by a cell membrane receptor.

Yet another embodiment of the present invention provides a composition comprising the polymer system for nucleic acid delivery as disclosed in the present invention, wherein the composition upon administration initiates transcriptional activation of Toll- Like Receptor 7, proinflammatory and type I interferon genes in C2C12 (murine myoblast) and P388D1 (murine macrophage) cell lines.

Still another embodiment of the present invention provides a composition comprising the polymer system for Plasmid DNA such as, pEGFP-Cl delivery as disclosed in the present invention produce significant increases in the mRNA levels of genes, such as, TLR7 gene, proinflammatory genes NF-κΒ and TNFa and type I interferon genes (IFNa and IFNp).

The composition comprising the polymer system for nucleic acid delivery as disclosed in the present invention can be used as potential vaccine adjuvants against, for example, HIV, Neisseria meningitidis group B etc infectious diseases.

Further embodiment of the present invention provides a vaccine composition comprising the polymer system for nucleic acid delivery as disclosed in the present invention, wherein the nucleic acid is HIV, or Neisseria meningitidis group B.

The composition as disclosed in the present invention, wherein the targeting moiety is selected from a group consisting of carbohydrates, peptides, chemotactic factors, hormones, natural metabolites, biotin, tetrahydrofolate, folic acid, lactobionic acid, , phosphorylated and sulfated oligosaccharides, transferrin and asialoglycoprotein.

The composition as disclosed in the present invention is a pharmaceutical composition, a gene therapy composition, or a vaccine.

Further, the composition as disclosed in the present invention is in the form of nanoparticle or a microsphere. Another embodiment of the present invention provides use of the polymer system as of present invnetion for the preparation of composition useful for gene therapy.

Another embodiment of the present invention provides a method of delivering a nucleic acid sequence of interest into a selected cell, wherein the method comprising mixing an effective amount of a polynucleotide comprising the nucleic acid sequence of interest operatively linked to a promoter with an effective amount of poly(ether imine) (PETIM) dendrimers of present invention to result in a complex; and contacting the cell with the complex under conditions suitable to deliver the complex and maintain the viability of the cell.

Further embodiment of the present invention provides a method of transfecting cells, wherein the method comprising contacting said cells with the composition as disclosed in the present invention under conditions wherein said composition enters said cells, and the nucleic acid of said composition is released.

Still another embodiment of the present invention provides a poly (ether imine) (PETIM) dendrimers with primary amine peripheral groups having the structure as set forth in Formula I

Formula I

wherein

X], X ₂ = H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo J, k, 1, m, and n= numerical which corresponds to branch point multiplicity, which is the numerical value 2 i.e. J to n=2

In another embodiment of the present invention there is provided a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter.

Further embodiment of the present invention provides a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein molecular weight of the PETIM is in the range of about 500 to 75,000 Dalton.

Further embodiment of the present invention provides a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein structure of the (PETIM) dendrimers is as set forth in Formula I.

Formula I

wherein Χι, X ₂ = H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo

J, k, 1, m, and n= numerical which corresponds to branch point multiplicity, which is the numerical value 2 i.e. J to n=2

Still further embodiment of the present invention provides a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the nucleic acid sequence of interest is DNA or RNA sequence.

Still further embodiment of the present invention provides a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the nucleic acid sequence of interest is DNA or RNA sequence, wherein the RNA sequence is selected from the group consisting of an antisense RNA, miRNA, siRNA and a ribozyme.

In another embodiment of the present invention there is provided a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the nucleic acid sequence of interest is selected from a group consisting of green fluorescent protein gene, GUS-gene, luciferase gene, β- galactosidase gene, hygromycin resistance gene, neomycin resistance gene, and chloramphenicol acetyl transferase gene, genes encoding low density lipoprotein receptors and coagulation factors, gene suppressers of tumors, genes encoding major histocompatibility proteins, antioncogenes, pi 6, p53, genes encoding thymidine kinase, genes encoding IL2, genes encoding IL 4, genes encoding TNF, genes encoding an viral antigen, genes encoding lectin, genes encoding a mannose receptor, genes encoding asialoadhesin, and a genes encoding a retroviral transactiviating factor (TAT).

In another embodiment of the present invention there is provided a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the polynucleotide is a plasmid.

In another embodiment there is provided a composition for delivering nucleic acid into cells, wherein the composition comprising a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter.

In another embodiment there is provided a composition for delivering nucleic acid into cells, wherein the composition comprising a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the composition further comprises a targeting moiety which is recognizable by a cell membrane receptor.

In another embodiment there is provided a composition for delivering nucleic acid into cells, wherein the composition comprising a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the composition further comprises a targeting moiety which is recognizable by a cell membrane receptor, wherein the targeting moiety is selected from a group consisting of lactose, galactose, mannose, fructose, glucose, ribose, arabinose, xylose, rhamnose, peptides, chemotactic factors, hormones, natural metabolites, biotin, tetrahydrofolate, folic acid, lactobionic acid, asialo-oligosides, oligomannosides, phosphorylated oligomannosides, sulfated oligosaccharide of lactosamin, transferrin and asialoglycoprotein.

In a preferred embodiment of the present invention there is provided a Poly(ether imine) (PETIM) dendrimers comprising primary amine peripheral groups, wherein the formula of said dendrimer is as set forth in Formula I,

Formula I

wherein

Xi, X ₂ = H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo J, k, 1, m, and n= numerical which corresponds to branch point multiplicity, which is the numerical value 2 i.e. J to n=2

Another preferred embodiment of the present invention provides a Poly(ether imine) (PETIM) dendrimers having the formula as set of Formula I or having the structure as set forth in Structure I as disclosed in the present invnetion, wherein molecular weight of said poly(ether imine) (PETIM) dendrimers is in the range of about 500 to 75,000 Dalton.

Yet another preferred embodiment of the present invention provides a polymer system to deliver at least one negatively charged molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers having the formula as set forth in Formula I as disclosed in the present invention, and at least one negatively charged molecule with, wherein said primary amine peripheral groups are with or without further functionalizations.

Still another embodiment of the present invention provides a polymer system comprising a poly(ether imine) (PETIM) dendrimers having the formula as set forth in Formula I as disclosed in the present invention, wherein said negatively charged molecule is selected from a group consisting of nucleic acid, oligomers of DNA and PvNA, DNA, polynucleotides, DNAzymes, single and double stranded DNA, single and double stranded RNA, antisense PvNA and DNA, hammerhead RNA, short interfering RNA, micro RNA, ribozymes and combinations thereof.

Further embodiment of the present invention provides a composition for delivering a negatively charged therapeutic molecule into cells, wherein the composition comprising comprising a poly(ether imine) (PETIM) dendrimers having the formula as set forth in Formula I as disclosed in the present invention.

Further embodiment of the present invention provides a composition for delivering a negatively charged therapeutic molecule into cells, wherein the composition comprising comprising a poly(ether imine) (PETIM) dendrimers having the formula as set forth in Formula I as disclosed in the present invention, wherein said negatively charged molecule is selected from a group consisting of nucleic acid, oligomers of DNA and RNA, DNA, polynucleotides, DNAzymes, single and double stranded DNA, single and double stranded RNA, antisense RNA and DNA, hammerhead RNA, short interfering RNA, micro RNA, ribozymes and combinations thereof.

The present invention further provides a drug delivery composition comprising an effective amount of poly (ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and an effective amount of a negatively charged molecule. Another embodiment of the present invention provides a drug delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and an effective amount of a negatively charged molecule, wherein structure of the (PETIM) dendrimers is as set forth in Formula I.

Formula I

wherein

Xi, X ₂ = H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo

J, k, 1, m, and n= numerical which corresponds to branch point multiplicity, which is the numerical value 2 i.e. J to n=2

The present invention further provides a delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and an effective amount of a negatively charged molecule, wherein the negatively charged molecule is a peptide, protein, or a therapeutic molecule.

Another embodiment of the present invention provides a delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and an effective amount of a negatively charged molecule, wherein the negatively charged molecule is a therapeutic molecule selected from a group consisting of nucleic acid, oligomers of DNA and RNA, polynucleotides, DNAzymes, single and double stranded DNA, single and double stranded RNA, antisense RNA and DNA, hammerhead RNA, short interfering RNA, micro RNA, ribozymes, pharmaceutically active compound, or combinations thereof.

The present invention further provides a drug delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further iunctionalizations, and an effective amount of a negatively charged molecule, wherein the negatively charged molecule is a peptide, protein, or a therapeutic molecule, wherein the composition is in the form of nanoparticle or a microsphere.

A pharmaceutical composition comprising the a delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further iunctionalizations, and an effective amount of a negatively charged molecule, wherein the negatively charged molecule is a peptide, protein, or a therapeutic molecule.

Another embodiment of the present invention provides use of a nucleic acid delivery system for preparation of a composition useful for gene therapy, wherein the composition comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter.

Another embodiment of the present invention provides a method of delivering a nucleic acid sequence of interest into a selected cell, wherein the method comprising mixing an effective amount of a polynucleotide comprising the nucleic acid sequence of interest operatively linked to a promoter with an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, having structure as set forth in Formula I to result in a complex; and contacting the selected cell with the complex under conditions suitable to deliver the complex and maintain the viability of the cell.

Formula I

wherein

Xi, Χχ^ H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo

J, k, 1, m, and n= numerical which corresponds to branch point multiplicity, which is the numerical value 2 i.e. J to n=2

In another embodiment there is provided a method of transfecting cells, wherein the method comprising contacting said cells with a composition comprising a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the composition further comprises a targeting moiety which is recognizable by a cell membrane receptor under conditions, wherein said composition enters said cells, and the nucleic acid of said composition is released.

Yet another embodiment of the present invention provides a composition comprising the polymer system comprising the poly(ether imine) (PETIM) dendrimers having formula as set for the in Formula I and the siRNA or miRNA molecule to suppress or minimize the expression of a target gene, wherein the composition upon administration substantially reduces expression of the said gene.

As an example, PETIM dendrimer generation four, presenting 32 amine peripheral functionalities (Figure 1) was chosen. Synthesis of the dendrimer involved two alternate Michael addition reactions and two alternate functional group reductions, performed by a divergent growth methodology and amine functionalities were obtained upon reduction of nitrile groups present at the peripheries of dendrimer (Krishna, T. R., and Jayaraman, N. (2003) Synthesis of poly(propyl ether imine) dendrimers and evolution of their cytotoxic properties. J. Org. Chem. 68, 9694-9704; Jayamurugan, G., and Jayaraman, N. (2006) Synthesis of large generation poly(propyl ether imine) (PETIM) dendrimers. Tetrahedron 62, 9582-9588). Synthesis of dendrimer undertaken for the present study is given in the Supporting Information. There are 32 primary amine and 30 tertiary amine sites. The molecular structure also presented 61 oxygens in the form of ether functionalities. With pK _a of ~9, the amine sites are expected to be in the protonated form at physiological pH. The dendrimer generation in the neutral form is estimated to be -3.5 nm in diameter (Jana, C, Jayamurugan, G., Ganapathy, R., Maiti, P. K., Jayaraman, N., and Sood, A. K. (2006) Structure of poly(propyl ether imine) dendrimer from fully atomistic molecular dynamics simulation and by small angle x-ray scattering. J. Chem. Phys. 124, 204719-1-10).

Cytotoxicity of PETIM dendrimer was evaluated first in BHK-21 cell line by an MTT assay. A concentration-dependent cytotoxicity was observed, with cell viability reducing to ~ 50%, when dendrimer concentration was ~1 mg mL ^"1 (Figure 2a). Surprisingly, about 90% cell viability observed at 100 μg/ml of dendrimer concentration. Further it was observed that more than 70% viability was observe at 500 μg/ml of dendrimer concentration.

Gel retardation assay on agarose gel was performed subsequently on complexes formed with a pDNA, namely, pEGFP-Cl and PETIM dendrimer, prepared at varying charge (N/P) ratios, so as to identify the DNA-binding abilities of dendrimer. A gradual retardation of pDNA mobilities was observed, as evidenced by gradual disappearance of pDNA band, as a function of increasing dendrimer ratio (Figure 2c). At a charge ratio of 3.5:1, a complete and effective complexation of the added pDNA could be observed clearly. Upon observing complexation of dendrimer with DNA, assessing sizes and shapes of the complexes was undertaken by TEM technique, wherein the complex was observed to be in a toroidal shape with <100 nm size, formed as nanoclusters (Figure 2b). It is likely that large structures observed in the TEM images are aggregates, than complexes of individual plasmid DNA molecule with single dendrimer molecules. Such types of aggregates form (Shcharbin, D., Pedziwiatr, E., and Bryszweska, M. (2009) How to study dendriplexes I: Characterization. J. Control. Release 135, 186-197; Coles, D.J., Yang, S., Esposito, A., Mitchell, D., Minchin, R.F., and Toth, I. (2007). The synthesis and characterisation of a novel dendritic system for gene delivery. Tetrahedron 63, 12207-12214) when the dendriplex solution spotted onto foamvar- coated grids and allowed to dry, prior to analysis by TEM, leading to exhibit only the gross structural changes of the dendriplex in the solid-state. Above observations correlated with the structural property of the dendrimer, wherein protonated primary amine sites would be the major DNA condensing sites. The presence of ether moieties in PETIM dendrimers appears to compensate high toxicities that arise generally from amine moieties (Lin, C, and Engbersen, J. F. J. (2008) Effect of chemical functionalities in poly(amido amine)s for non-viral gene transfection. J. Control. Release 132, 267-272; Wang, R., Zhou, L., Zhou, Y., Li, G., Zhu, X., Gu, H., Jiang, X., Li, H., Wu, J., He, L., Guo, X., Zhu, B., and Yan, D. (2010) Synthesis and gene delivery of poly(amido amine)s with different branched architecture. Biomacromolecules 11, 489-495). Further, there was a complete protection from DNase I-mediated degradation, even after 2 h of incubation (Figure 2d). It was also observed that complexation with dendrimer did not produce a structural damage to the pDNA, as shown by the intactness of the DNA released upon treatment with SDS.

In order to demonstrate the cellular uptake of PETIM-DNA complexes, a TEM evaluation was performed on pellets prepared from BHK-21 cells transfected with pEGFP-Cl -PETIM complex, at 8 h post-transfection (Figure 3). The complexes were found to be distributed in the cytoplasm primarily, indicating escape from endosomal vesicles. The complex was seen in varying sizes and shapes within the cell and the morphology was markedly different, when compared to the dendriplex deposited onto formvar-coated grids (Figure 2b). The complexes were also observed near outer membrane of the nucleus and also within the nucleolus, implying an effective traversal to the nucleus, from initial cytoplasmic locations. Further, thickening of rough endoplasmic reticulum membrane was also observed (Figure 3c). The TEM images clearly show the physical presence of the complexes within the cytoplasm, indicating their lysosomal escape and also near the outer nuclear membrane and within the nucleus. The images provide evidence to the ability of PETIM dendrimer as a nuclear delivery agent. Only few previous studies have attempted to provide information on the cellular uptake of dendriplexes by employing TEM (Nam, H. Y., Kwon, S. M., Chung, H., Lee, S.-Y., Kwon, S.-H., Jeon, H., Kim, Y., Park, J. H., Kim, J., Her, S., Oh, Y.-K., Kwon, I. C, Kim, K., and Jeong, S. Y. (2009) Cellular uptake mechanism and intracellular fate of hydrophobically modified glycol chitosan nanoparticles. J. Control. Release 735, 259-267).

Upon confirming nuclease protection and localization, gene expression studies were followed using pEGFP-Cl, a gene which encodes the green fluorescent protein (GFP). The ability of the complex to mediate gene expression was assessed through transient transfection experiments on BHK-21, Vero, HEK-293, and Neuro2a cell lines. Expressions were monitored initially through imaging and the transfection ability was evaluated both in the presence and absence of fetal calf serum. After 48 h of transfection, a robust expression of green fluorescent protein was observed in all four cell lines transfected with the complexes, images of gene expressions are given in the supporting figures.

The experiment on quantitation of transfection efficiency was performed on BHK-21, as a representative cell line. This cell line is hardy and easy to maintain, when compared to several other cell lines and thus further quantitative gene expression studies were performed on this cell line. The experiments on quantitation of transfection efficiency were performed in triplicate. The efficiency of transfection was observed to be better in the absence of serum. A quantitative analysis of transfection efficiency for BHK-21 cells with varying charge ratios are shown in Figure 4. A gradual increase in the number of EGFP-positive cells was observed with increase in the charge ratios of the complexes used. An expression level of 45% (±S.E.M.) was observed at a dendrimer to DNA charge ratio of 300:1, corresponding to a weight ratio of 26:1. In comparison, 32% (±S.E.M.) of cells showed EGFP specific fluorescence in the wells transfected with complexes of pEGFP with Turbofect reagent. Under the experimental conditions, the cell viability was found to be reduced above charge ratios of 300: 1, as observed through microscope.

From the series of studies described above, an efficient vector property of PETIM dendrimers for in vitro gene delivery is demonstrated. PETIM dendrimer employed in this study exhibits significantly reduced toxicities over a broad concentration range in the cationic form. The presence of ether moieties within the dendritic structure appear to compensate higher toxicities seen generally for polyamines. PETIM dendrimer complexes pDN A effectively, thereby protecting the DNA from endosomal damages and deliver to cell nucleus. Gene transfection studies, involving few cell lines in combination with a reporter plasmid, showed a robust expression of the encoded protein. The study shows PETIM dendrimers are hither-to un-known novel gene delivery vectors, combining the features of poly(ethylene imine) polymers and dendrimers, yet relatively non-toxic and structurally precise.

The PETIM dendrimers were found to efficiently complex the pEGFP-C 1 plasmid at a w/w ratio of 10:1, as evidenced by gel retardation assay. The cellular uptake of PETIM- pEGFP-Cl complexes in C2C12 and P388D1 cell lines was studied by transmission electron microscopy on the pellets obtained from transfected cells. The complexes were observed to be localized predominantly in the endosomes in both the cell lines, when examined 4 hours post-exposure. The endosomes containing the dendriplexes were seen distributed in the cytoplasm or positioned near the outer nuclear membrane (Figure 5), from which endosomal trafficking appeared to be mode of cellular uptake of dendrimers and dendriplexes. Although cationic dendrimers exhibit the proton sponge phenomenon, resulting in osmotic swelling, endosomal rupture and release of the complexed cargo into the cytosol, instances are also known wherein the cargo is retained within the endosomes, and facilitate antigenic presentation through MHC I and MHC II pathways sequentially (Walter, E., Dreher, D., Kok, M., Thiele, L., Kiama, S. G., Gehr, P. et al. Hydrophilic poly(DL-lactide-co-glycolide) microspheres for the delivery of DNA to human-derived macrophages and dendritic cells (2001) J. Control. Release 76, 149-68; Burgdorf, S., Kurts, C. Endocytosis mechanisms and the cell biology of antigen presentation (2008) Curr. Opin. Immunol. 20, 89-95.

It was observed further that exposure of the PETIM dendrimer or its dendriplex with the plasmid pEGFP-Cl produced significant increase in the mRNA levels of TLR7 gene, proinflammatory genes NF-κΒ and TNFa and type I interferon genes (IFNa and IFNP), as shown in Table 2. In comparison, treatment of the cells with the plasmid DNA alone did not produce any significant increase in mRNA levels of the genes assayed, except in the case of P388D1 cells in which it produced marginal increase in TLR7 and IFNa mRNA levels. Increase in mRNA levels of the proinflammatory mediator molecules NF-KB and TNFa observed indicated that the TLR7 stimulation induced by the dendrimer and the dendriplex indeed had functional consequences on the cells internalizing them. This was also supported by the observation of a significant increase in the mRNA levels of the type I interferon genes IFNa and IFNp in both the cell lines. Interestingly, the PETIM-pEGFP-Cl dendriplex was found to induce higher levels of TLR7, TNFa, and IFNa mRNA in C2C12 cell line, than the dendrimer alone. In comparison, the level of only IFNa mRNA showed an elevation subsequent to treatment with the dendriplex, in the macrophage cell line P388D1. Observations of dendriplex localization within cellular endosomes (the intracellular locus where TLR7 receptors are expressed) prompted the investigation into their probable influence on the endosomal TLR7 expression. The investigations were also based on the fact that TLR7 recognizes synthetic chemical compounds. It was observed that the fourth generation amine-terminated PETIM dendrimer or its DNA complexes induce transcriptional activation of TLR7 gene in cells internalizing them. PETIM derivatization by DNA complexation was found to induce a higher level of TLR7 mRNA level than the dendrimer alone, indicating a probable stimulatory effect by the high density of functional groups in the former, within the same surface area.

Exposure to the dendrimer or dendriplexes was also found to activate the NF-κΒ gene in both C2C12 and P388D1 cell lines. The NF-κΒ gene, when activated, triggers the expression of a number of proinflammatory, cytokine, and chemokine genes, and may have a significant effect on the ensuing adaptive immune responses, by influencing the polarization of T-cell responses into Thl or Th2 type.

Transcriptional activation of the antiviral type I interferon genes IFN-a and IFN-β observed in the study reflect a novel attribute of PETIM dendrimer and dendriplexes. Earlier reports by several groups have indicated that activation of TLR7 in human plasmacytoid dendritic cells triggers production of co-stimulatory molecules, type I interferons and IL-12 (Jarossay, D., Napolitani, G., Colonna, M., Sallusto, F., Lanzavecchia, A. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells (2001) Eur. J. Immunol. 31, 3388-93; Kadowaki, N, Ho, S., Antonenko, S., Malefyt, R. W., Kastelein, R. A., Bazan, F. et al. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens (2001. J Exp. Med. 94, 863-9; Lore, K., Betts, M. R., Brenchley j. M., Kuruppu, J., Khojasteh, S., Perfetto, S., Roederer, M. et al. Toll-like receptor ligands modulate dendritic cells to augment cytomegalovirus- and HIV- 1 -specific T-cell responses (2003) J. Immunol. 171, 4320-8. Engagement of TLR7 in early endosomes results in production of type I intererons, whereas interaction in the late endosomes produces NF-KB-related cytokines, such as TNFa and IL-6 (Kagan, J. C, Su, T., Horng, T., Chow, A., Akira, S., Medzhitov, R. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta (2008) Nat. Immunol. 9, 361-8).

In the present invention it was found that upon transfection with PETIM dendrimers complex, mRNA levels of NF-κΒ, TNF-a and the type I interferon genes IFN-a and IFN-β were found to be elevated, though the fold changes in the interferon gene mRNAs were significantly higher, likely suggesting a greater interaction with the TLR7 in late endosomes.

TLR agonists find clinical utility, as exemplified by imiquimod, which is licensed for the treatment of cutaneous warts and superficial basal cell carcinomas. Studies have also indicated the potential utility of TLR7 ligands as vaccine adjuvants, in improving the magnitude and quality of experimental vaccines against HIV, Neisseria meningitidis group B etc. in animal models (for example, Wille-Reece, V., Flynn, B. J., Lore, K., Koup, R. A., Kedl, R. M., Mattappallil, J. J. et al. HIV Gag protein conjugated to a Toll-Like Receptor 7/8 agonist improves the magnitudeand quality of Thl and CD8+ T- cell responses in non-human primates (2005) Proc. Natl. Acad. Sci. USA 102, 15190-4. Findings of the present application suggest that amine-terminated PETIM dendrimers are less-toxic and efficient inducer of TLR7 activation and type I interferons. Applications in the field of vaccination against infectious diseases and immunotherapy are options in further developments involving these new types of macromolecular entities.

EXAMPLES

It should be understood that the following examples described herein are for illustrative purposes only and that various modifications or changes in light will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims.

Plasmid The plasmid DNA encoding green fluorescent protein (pEGFP-Cl) was obtained from Clontech. The plasmid was propagated in competent E. coli DH5a cells and amplified using standard protocols. The plasmid was purified using a modified alkaline lysis method and PEG-MgCl ₂ purification.

Chemicals

(3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2-yl-tetrazolium bromide) (MTT), dimethyl sulfoxide (DMSO), sodium dodecyl sulphate, and ethylenediamine tetra-acetic acid (EDTA) were purchased from Sigma-Aldrich. Deoxyribonuclease I enzyme and TurboFect in-vitro transfection reagent were obtained from Fermentas. All chemicals used in the study were of ACS/Molecular Biology grade.

Cell lines

BHK-21, Vero, and Neuro2a cells were obtained from National Centre for Cell Sciences, Pune, India, and maintained by serial passage. HEK293 cell line was a gift from Dr. Anjali Karande, Indian Institute of Science, Bangalore. The cell lines were maintained in Minimum Essential Medium (Sigma) supplemented with 10% Fetal Bovine Serum (Biological Industries, Israel) and ampicillin (lOOU/mL) and streptomycin (100 μg/mL) at 37°C, under C0 ₂ (5%). Plasticware for cell culture were obtained from CellStar, Greiner.

Example 1

Preparation of PETIM dendrimers

PETIM dendrimers were prepared according to the protocol described in: Synthesis of large generation poly(ether imine) (PETIM) dendrimers (2006) Jayamurugan, G.; Jayaraman, N. Tetrahedron 62, 9582-9588. Preparation and structure of the fourth generation PETIM dendrimer is depicted in Figure l(a, b). The structure of the PETIM dendrimers is as provided in structure I as follows.

Structure I

G4(C0 ₂ 'Bu) ₃₂ : The G3-nitrile (G3(CN)i ₆ ) (Krishna, T. R., and Jayaraman, N. (2003) Synthesis of poly(propyl ether imine) dendrimers and evolution of their cytotoxic properties. J. Org. Chem. 68, 9694-9704; Jayamurugan, G., and Jayaraman, N. (2006) Synthesis of large generation poly(propyl ether imine) (PETIM) dendrimers. Tetrahedron 62, 9582-9588) (1.5g) was transferred to a hydrogenation reactor vessel and mixed with Raney cobalt (4g) in water (1.2L). The mixture was hydrogenated (¾, 46 atm) at 70°C for 6 h. The reaction mixture was cooled, filtered through a celite pad and filtrate concentrated to afford G3(N¾) ₁₆ . A solution cof amine in MeOH (50 mL) was treated with tert-butyl acrylate (10 mL), stirred for 72 h at room temperature. Excess tert-butyl acrylate and MeOH were removed in vacuo to afford G4 (C0 ₂ 'Bu) ₃₂ , as a colorless oil (3.15 g, 93% for two steps). TLC (A1 ₂ 0 ₃ ) R/ 0.52 (CHCl ₃ /MeOH=9.7:0.3); FTIR (neat) v 1730, 1462, 1367, 1 157; 1H NMR (CDC1 ₃ , 300 ΜΗζ) δ 1.44 (s, 288 H), 1.64-1.71 (m, 1 16 H), 2.34 (t, J= 7.3 Hz, 64 H), 2.47 (t, J= 6.9 Hz, 1 16 H), 2.72 (t, J = 7.3 Hz, 64 H), 3.39 (t, J = 6.3 Hz, 1 16 H); ^l3 C NMR (CDC1 ₃ , 75.5 MHz) δ 27.4, 27.7, 28.1, 33.8, 47.4, 50.5, 50.8, 68.9, 69.2, 69.3, 80.1, 172.0. MALDI-TOF m/z 7454.927 [M+H] ⁺ calcd. for C ₃₉ 8H ₇₆₄ N ₃₀ O ₉₃ : 7454.605; Anal, calcd. for C ₃₉₈ H7 ₆₄ N ₃₀ O ₉ 3: C, 64.02; H, 10.25; N, 5.63. Found: C, 64.12; H, 9.92; N, 5.69. G4(OH) ₃₂ : To a suspension of LiAlH ₄ (1.34 g) in THF (50 mL), G4(C0 ₂ 'Bu) ₃₂ (4 g) in THF (150 mL) was added dropwise at 0°C and stirred for 4 h at room temperature. The reaction mixture was cooled to 0°C, quenched with ice, passed through celite and the filtrate concentrated in vacuo. The crude material was added with MeOH, filtered and filtrate concentrated, to afford G4(OH) ₃₂ , as a colorless gum (2.76 g, 98 %). FTIR (neat) v 3388, 1658, 1469, 1370, 1114, 1059. 1H NMR (CDC1 ₃ , 300 MHz) δ 1.64-1.71 (m, 180 H), 2.47-2.55 (m, 116 H), 2.60 (t, J = 6.6 Hz, 64 H), 3.38-3.43 (m, 1 16 H), 3.70 (t, J = 5.7 Hz, 64 H). ¹³ C NMR (CDC1 ₃ , 75.5 MHz) δ 26.9, 27.2, 28.7, 28.77, 50.7, 50.8, 50.9, 52.7, 62.3, 68.8, 69.1, 69.2. MALDI-TOF m/z 5217.12 [M+H] ⁺ calcd. for C ₂₇₀ H ₅₇₃ O ₆₁ N ₃₀ : 5213.26.

G4(CN) ₃₂ : A mixture of G4-(OH) ₃₂ (5 g), acrylonitrile (2.02 mL) and aq. NaOH (40%, 0.4 mL) was stirred for 15 h at room temperature. Acrylonitrile (2.02 mL) was added further, left to stir for 48 h, diluted with CHC1 ₃ , filtered through celite, filtrate concentrated in vacuo and purified by column chromatography (neutral A1 ₂ 0 ₃ ), to afford G4(CN) ₃₂ , as a colorless liquid (5.23 g, 93%). TLC (A1 ₂ 0 ₃ ): R 0.60 (CHCl ₃ /MeOH=9: l). FTIR (neat) v 2251, 1467, 1367, 1 1 17. Ή NMR (CDC1 ₃ , 300 MHz) δ: 1.64-1.71 (m, 180 H), 2.43-2.50 (m, 180 H), 2.60 (t, J= 6.0 Hz, 64 H), 3.41 (t, J = 6.0 Hz, 116 H), 3.52 (t, J = 6.3 Hz, 64 H), 3.63 (t, J = 6.3 Hz, 64 H). ¹³ C NMR (CDC1 ₃ , 75.5 MHz) δ: 18.9, 27.3, 27.4, 50.5, 50.8, 65.3, 69.1, 69.20, 69.24, 69.4, 118.0. MALDI-TOF m/z 6913.23 [M+H] ⁺ calcd. for C ₃₆₆ H ₆₆₉ 0 ₆₁ N ₆₂ : 6910.12.

G4(NH ₂ )3 ₂ : G4(CN) ₃₂ (1 g) was transferred to a hydrogenation reactor vessel, mixed with Raney Co (7g) in water (1.2L) and hydrogenated (H ₂ , 46 atm) at 70°C for 6 h. The reaction mixture was cooled, filtered through a celite pad and filtrate concentrated in vacuo to afford G4(NH ₂ ) ₃₂ , as a colorless gum (lg, 98 %). FTIR (neat) v 3375, 2939, 2857, 1575, 1467, 1369, 1113. 1H NMR (D ₂ 0, 300 MHz) δ 1.52-1.57 (m, 244 H), 2.36 (t, J= 6.3 Hz, 180 H), 2.53 (t, J= 6.0 Hz, 64 H), 3.31-3.39 (m, 244 H). ¹³ C NMR (D ₂ 0, 75.5 MHz) δ 27.4, 33.4, 39.6, 50.7, 50.8, 68.94, 69.01, 69.15. A standard solution of G4(NH ₂ ) ₃₂ in phosphate buffered saline (pH:7.4) buffer was prepared for the studies. Example 2

Preparation of nucleic acid- PETIM complex

Gel retardation assay

pEGFPCl -PETIM complexes were prepared at various charge (N/P) ratios by co- incubating defined amounts of PETIM dendrimer and 1 μg of pEGFP-Cl in Phosphate Buffered Saline (PBS) (pH 7.4), in a total volume of 50 μί,. The complexes were incubated at room temperature for 30 min.; mixed with gel loading buffer and loaded onto wells of a 0.8% agarose gel and electrophoresed for 45 min. at 100V in IX Tris- Acetate-EDTA buffer. The presence or absence of DNA bands were visualized and documented with the help of a Gel Documentation System (G-Box, Syngene).

Analysis of sizes and shapes of PETIM-pEGFP-Cl complexes

Transmission electron microscopy (TEM) was performed to identify the sizes and shapes of pEGFPCl -PETIM complexes. The complexes were prepared in a total volume of 30 μΐ., of PBS (pH 7.4) at a charge ratio of 5:1, 10:1 and 20: 1 and stained by Harris method (Harris JR. Negative staining of thinly spread biological samples. In: John K, editor. Electron Microscopy: Methods and protocols. 2nd ed. New Jersey:Humana Press, 2007). A droplet of sample was placed on to formvar-coated copper grids and incubated for 10-15 min. in a humid and dust-free environment. Later, the grids containing samples were stained with phosphotungstic acid (1%) for 1 minute, dried on a filter paper and examined under Tecnai G2 Bio-twin TEM, operating at an electron beam of 80 kV, equipped with Megaview III CCD camera.

Example 3

Evaluation of cytotoxicity of PETIM dendrimer

In vitro cytotoxicity of PETIM dendrimer was evaluated on BHK-21 cells by a standard MTT Assay (Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983, 65, 55- 63). Briefly, 5x10 cells, in 200 μΐ, growth medium, were seeded per well in a 96-well tissue culture plate (Cellstar, Greiner) and allowed to grow for 24 h at 37°C, under 5% C0 ₂ . Growth medium was replenished and 20 μΐ, of various concentrations of PETIM dendrimer were added to cells and incubation continued for 24 h. Then 20 μΐ, of MTT (5 mg/mL) solution was added to each well and the plate incubated in dark for 4 h. Resulting formazan crystals were dissolved in DMSO (200 μΕ), added to each well and absorbance at 570 nm was recorded. Cell controls un-treated with dendrimer were used as the reference. Each concentration of dendrimer was tested in quadruplicates and the whole experiment was repeated twice. Data represented as standard error of mean (S.E.M.).

Example 4

Nuclease protection assay

Deoxyribonuclease-mediated degradation of PETIM-DNA complex was studied by a DNase I protection assay. For this study, pEGFPCl -PETIM complex was prepared in PBS (pH 7.4), at a charge ratio of 10: 1 and complexation verified by agarose gel electrophoresis. The complex was then incubated with deoxyribonuclease I enzyme (1U) under appropriate buffer conditions. At 30, 60, or 120 min. of incubation, the enzyme action was stopped by addition of EDTA (25 raM) solution and the complexes disrupted by 5% SDS and centrifuged. The supernatants were subjected to agarose gel electrophoresis. The presence or absence of DNA bands was verified and documented. Example 5

Tracking of intracellular localization of PETIM-DNA dendriplexes

The uptake and intracellular localization of PETIM-DNA complexes were studied by TEM on negatively stained thin sections, prepared from transiently transfected BHK-21 cells. BHK-21 cells (lxlO ⁵ cells/well) were seeded in a 6-well plate with complete growth medium and incubated for 24 h at 37°C, under 5% C0 ₂ . pEGFPCl -PETIM complexes were prepared at a ratio of 10: 1 (w/w), in a total volume of 100 μί, of growth medium without serum. Three wells were identified as the test group and were transfected with the dendrimer-DNA complexes and the remaining wells were mock- transfected with 100 μΐ, of growth medium. Prior to transfection, the growth medium in the wells were replenished with medium without serum. The dendriplexes were added to the cells, rocked gently and the plate incubated at 37°C, under 5% C0 ₂ . After 4 h, the transfection mix was removed and complete growth medium replenished. At the end of 8 h, the cells in each well were gently scraped, using a sterile cell scraper, into 1 mL of growth medium. The scrapings from the test wells and the mock-transfected wells were pooled separately and centrifuged at 6000 rpm for 5 min. to obtain the cell pellets. The cell pellets were fixed in 4% glutaraldehyde solution and embedded into paraffin blocks. Thin sections of the blocks were cut using an ultramicrotome, appropriately stained and subjected to transmission electron microscopy.

Example 6

In vitro transfection experiments

PETIM-pEGFP-Cl

In vitro transfection ability of the PETIM-pEGFP-Cl complexes was evaluated four different cell lines, namely, BHK-21, Vero, HEK-293 and Neuro2a. In brief, 1 x 10 ⁵ cells of each cell line were seeded per well in separate 24-well tissue culture plates and grown at 37°C, under C0 _{2 (} 5%) for 24 h. pEGFPCl-PETIM complexes were prepared at various charge ratios, using 2 μg of the plasmid and appropriate amounts of PETIM. The growth medium in the wells was replaced with MEM without fetal bovine serum and the complexes added to each well. Transfection was allowed for 4 h at 37°C and thereafter, the contents of the wells were replaced with complete growth medium. A commercial in vitro transfection reagent TurboFect was used, as per manufacturer's guidelines, as a positive control for transfection. Cells mock-transfected with growth medium served as negative controls. The plates were re-incubated at 37°C for 48 h, at the end of which the growth medium was aspirated off from the wells and the cells gently rinsed in PBS, pH 7.4. The cells were fixed in 4% paraformaldehyde for 30 min. at room temperature, rinsed with PBS and the plates examined under an inverted fluorescent microscope (Nikon Eclipse TS120). The images were documented.

Quantitation of transfection efficiency was secured by flow cytometry performed on transfected BHK-21 cells, in 24-well plates. Upon reaching 70-80% cell growth confluency, the cells were transfected with pEGFPCl-PETIM complexes, prepared at various charge ratios, using 5 μg of the plasmid and appropriate amounts of PETIM dendrimer (4.3 μg, 10.7 μg, 21.5 μg, 32.4 μg, 43 μg, 64 μg, 86 μg, 107.5 μg and 129 μ relating to the charge ratios of 10:1, 25:1, 50:1, 75:1, 100: 1, 150: 1, 200:1, 250: 1 and 300:1, respectively). Un-transfected cells were used as negative controls, and cells transfected with a pEGFP complexed to TurboFect, were used as positive controls. The cells were incubated in serum-free medium for 4 h at 37°C in a 5% C0 ₂ incubator. Thereafter, the growth medium containing the complexes was aspirated off and complete growth medium was replenished. After 48 h of incubation, the cells from each well were trypsinized separately and pelleted by centrifugation at 6000 rpm for 5 min. The pellets were re-suspended in PBS and subjected to flow cytometric measurement on a FACSCalibur flow cytometer (Becton Dickinson). Fluorescence emission for EGFP was recorded per 10,000 cells in each sample, using FL1 channel and 530/30 band pass filter. Non-viable cells were gated out and % of EGFP positive cells was measured. The experiment was done in triplicate, and the data were analyzed using CellQuest Pro software.

Complexation of pEGFP-Cl with G4-PETIM

PETIM-pEGFP-Cl dendriplex was prepared at a weight/weight ratio of 10: 1 by coincubation of 10 μg of pEGFP-Cl and 100 μg of PETIM dendrimer in a total volume of 100 μΐ, of serum-free medium, at 37°C for 30 minutes. Complexation was verified by agarose gel electrophoresis.

Transfection of C2C 12 and P388D 1 cell lines C2C12 and P388D1 cells were grown to confluency in 25 cm ² non- vented tissue culture flasks. The cells were trypsinized (or resuspended without trypsinization in the case of P388D1) and resuspended in growth medium, and about 1 x 10 ⁵ cells were seeded alongwith 2 mL of complete growth medium per well in 6-well tissue culture plates. The plates were incubated till a confluency of 70-80% was reached. Prior to transfection, the growth medium in the wells were replaced with medium containing 1% FBS. Three wells of each plate received 100 μg of PETIM alone, and another three wells were exposed to PETIM-pEGFP-Cl complexes. A set of three wells were mock- transfected with 100 μΐ, of growth medium and a similar number of wells were exposed to pEGFP-Cl in an equivalent volume of growth medium. The dendrimer, DNA, or dendriplexes were added to the cells, with gentle rocking to facilitate mixing and the plate was incubated at 37°C, under 5% C0 ₂ . The contents of the well were aspirated off after 4 hours of incubation and fresh growth medium was replenished.

The experiment was set up in parallel in two sets of 6-well plates. At the end of 24 hours, the cells from one plate were gently scraped using a sterile cell scraper into 1 mL of growth medium. The scrapings were pooled separately and centrifuged at 6000 rpm for 5 min. to obtain the cell pellets, which were processed for Transmission Electron Microscopy. Total cellular RNA was extracted from the wells in the second plate, and processed for RT-PCR.

Example 7

Study of cellular uptake of dendriplexes by Transmission Electron Microscopy

The cell pellets were fixed in 0.5mL of 3% glutaraldehyde solution at 4°C for 24 hours, and later washed in several changes of 0.1 M phosphate buffer. The pellets were post- fixed in 1% osmium tetroxide for 1 hour at 4°C, washed with 0.1 M phosphate buffer and subjected to sequential dehydration with glass-distilled absolute ethanol (70% ethanol for 1 hour, 80% ethanol for 1 hour, 90% ethanol for 1 hour, followed by two changes in absolute ethanol for 30 min. each). The pellets were treated with 0.5 mL of propylene oxide (clearing agent), in two changes lasting 15 minutes each. The specimens were incubated overnight in a mixture of propylene oxide:araldite (1 : 1 proportion) on a rotator, at room temperature, followed by two changes in pure embedding medium, over a period of 6 hours, on the rotator, and finally embedded in flat embedding moulds or beam capsules. Polymerization of embedding medium was carried out by incubation in an oven at 60°C for 48 hours. After complete polymerization, the blocks were trimmed using a razor blade and thin sections cut using an ultramicrotome (Leica). For checking the quality, the sections were collected using a glass rod, and transferred onto a clean glass slide, and placed on a slide warmer at 80°C for drying. The slides were stained with 1% toluidine blue for 1 minute, washed in running water, dried and observed under a light microscope. The ultrathin sections, -400-500 A thick, were collected on copper grids, and stained using uranyl acetate and lead citrate. After drying, the grids were scanned under Tecnai G Transmission Electron Microscope and representative areas were photographed using MegaView III CCD Camera.

Example 8

Real time PCR experiments to study transcriptional activation of TLR7, NF-KB, TNFa, IFNa and IFNp genes

DNA sequences having following accession number were used in the present invention. Murine TLR7: NMJ33211.3; Murine NF-KB:EF043800.1 ; Murine TNFa: NM_013693.2; Murine IFNa: NM_010504.2; Murine IFNp: NM_010510.1 ; and Murine GAPDH: NM_008084

Total cellular RNA was extracted from each well of the 6-well plate using TRI reagent. Briefly, the cells from each well were lysed in 1 mL of TRI reagent, followed by phase separation using chloroform and RNA precipitation by addition of chilled isopropyl alcohol to the aqueous phase. After a brief wash in 70% ethanol, the pellets were air- dried and re-suspended in nuclease-free water.

Reverse transcription reactions were set up with about 1 μg of RNA using random primers, in a total volume of 50 μΐ,, using High Capacity cDNA synthesis kit (ABI) as per manufacturer instructions. The reaction was carried out in a thermal cycler (Veriti 96-well thermal cycler, Applied Biosystems) with cycling conditions as follows: 25°C for 10 minutes, followed by 42°C for 45 minutes. The cDNA thus produced was subjected to Real-time PCR using the primers listed in Table 1 (SEQ ID NO: 1 to SEQ ID NO: 12). The real time PCR was performed using SYBR Green PCR Master Mix (ABI) in an ABI PRISM ^® 7700 Sequence Detection System. Each reaction was set up in a total volume of 25 μί, with cycling conditions as follows: 50°C for 2 minutes, 95 °C for 10 minutes, followed by 42 cycles of sequential incubation at 95 °C for 15 minutes and 57°C for 1 minute, followed by analysis of dissociation curves to verify the specificity of the amplicons.

The mRNA expression in each sample was determined after normalization with the housekeeping gene GAPDH as internal control. The threshold cycle (Ct) of GAPDH was subtracted from gene-specific Ct values to obtain ACt values. ACt for experimental groups were subtracted from ACt of control group (normal, untreated cells) to obtain AACt. The fold change of each gene mRNA was expressed as 2 ^"AACt . Each measurement was performed in duplicate, and the experiment repeated thrice. The results are provided in Table 2.

Table 1 : List of primers used in this application

mGAPDH-F: SEQ ID NO: 11 AACTTTGGCATTGTGGAAGG

GAPDH

mGAPDH-R: SEQ ID NO: 12 GGATGCAGGGATGATGTTCT

Table 2: Changes in mRNA levels (calculated as 2 ^" ) of TLR7 and associated genes induced by PETIM dendrimer, pEGFP-Cl and PETIM-pEGFP-Cl dendriplex

5