Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
POLYPEPTIDE HAVING PHYTASE ACTIVITY AND INCREASED TEMPERATURE RESISTANCE OF THE ENZYME ACTIVITY, AND NUCLEOTIDE SEQUENCE CODING SAID POLYPEPTIDE
Document Type and Number:
WIPO Patent Application WO/2008/055625
Kind Code:
A3
Abstract:
The invention relates to a recombinant DNA molecule coding a polypeptide having phytase activity after being expressed in a prokaryotic or eukaryotic host cell. Said recombinant DNA molecule comprises a DNA sequence selected from among a) DNA sequences coding a polypeptide that has phytase activity and is obtained by varying the mature wild-type E. coli phytase sequence, the variation being selected from among i) the mutation lysine → aspartic acid in position 74 (K74D), and/or ii) a combination of the mutations asparagine → arginine in position 139 (N139R) and aspartic acid → glutamic acid in position 142 (D142E), and/or iii) a combination of the mutations leucine → isoleucine in position 145 (L145I) and leucine → isoleucine in position 198 (L198I), and/or iv) a mutation valine → proline in position 200 (V200P), and/or v) an N-terminal or C-terminal or an N-terminal and C-terminal addition of a sequence section of the acidic phosphatase of Aspergillus niger var. awamori or the phytase of Aspergillus niger, b) DNA sequences that are 70 to 100 percent homologous to the sequences listed under a), c) DNA sequences which are related to the sequences listed under a) and b) because of the degeneration of the genetic code. When expressed in a suitable host cell, the recombinant DNA molecule has increased temperature resistance as well as increased protease stability of the enzyme activity of the protein coded in said manner. Variations iii) and iv) are provided only in combination with a variation i), ii), and v). The invention also relates to the proteins coded thereby.

Inventors:
NGUYEN KHANH Q (DE)
WINTER BRUNO (DE)
Application Number:
PCT/EP2007/009522
Publication Date:
March 19, 2009
Filing Date:
November 02, 2007
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
AB ENZYMES GMBH (DE)
NGUYEN KHANH Q (DE)
WINTER BRUNO (DE)
International Classes:
C12N9/16; A23L29/00
Domestic Patent References:
WO2001090333A22001-11-29
WO2003102174A22003-12-11
WO2006037327A22006-04-13
WO2001036607A12001-05-25
WO2003066847A22003-08-14
Foreign References:
Other References:
GARRETT J B ET AL: "Enhancing the thermal tolerance and gastric performance of a microbial phytase for use as a phosphate-mobilizing monogastric-feed supplement", APPLIED AND ENVIRONMENTAL MICROBIOLOGY 200405 US, vol. 70, no. 5, May 2004 (2004-05-01), pages 3041 - 3046, XP002477018, ISSN: 0099-2240
RODRIGUEZ E ET AL: "Site-directed mutagenesis improves catalytic efficiency and thermostability of Escherichia coli pH 2.5 acid phosphatase/phytase expressed in Pichia pastoris", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, NEW YORK, US, US, vol. 382, no. 1, 1 October 2000 (2000-10-01), pages 105 - 112, XP002980498, ISSN: 0003-9861
Attorney, Agent or Firm:
HIEBL, Inge (Thomas-Wimmer-Ring 15, München, DE)
Download PDF:
Claims:
P A T E N T A N S P R U C H E

1. Rekombinantes DNA-Molekül, das nach Expression in einer prokaryoti- schen oder eukaryotischen Wirtszelle ein Polypeptid mit Phytaseaktivität codiert, wobei das rekombinante DNA-Molekül eine DNA-Sequenz, ausgewählt aus

a) DNA-Sequenzen, die ein Polypeptid mit Phytaseaktivität codieren, das durch Variation der reifen Wildtyp-E. co//-Phytasesequenz erhalten worden ist, wobei die Variation ausgewählt ist aus

i) der Mutation Lysin → Asparaginsäure an Position 74 (K74D), und/oder

ii) einer Kombination der Mutationen Asparagin → Arginin an Position 139 (N 139R) und Asparaginsäure → Glutaminsäure an Position 142 (D142E), und/oder

iii) einer Kombination der Mutationen Leucin -> Isoleucin an Position 145 (L145I) und Leucin → Isoleucin an Position 198 (L198I), und/oder

iv) einer Mutation Valin → Prolin an Position 200 (V200P), und/oder

v) einer N- oder C-terminalen oder einer N- und C-terminalen An- fügung eines Sequenzabschnitts der sauren Phosphatase von

Aspergillus niger var. awamori oder der Phytase von Aspergillus niger,

b) DNA-Sequenzen, die eine Homologie von 70% bis 100% zu den Sequenzen gemäß a) aufweisen,

c) DNA-Sequenzen, die aufgrund der Degeneriertheit des genetischen Codes mit den Sequenzen gemäß a) und b) verwandt sind,

umfasst, wobei das rekombinante DNA-Molekül bei Expression in einer geeigneten Wirtszelle mit einer erhöhten Temperatur- und Proteasestabili- tat der Enzymaktivität des so codierten Proteins einhergeht, wobei die Variationen iii) und iv) nur in Kombination mit einer Variation i), ii) und/oder v) vorliegen, oder gemeinsam mit einer Variation i), ii) und/oder v) vorliegen.

2. Rekombinantes DNA-Molekül nach Anspruch 1, dadurch ge ke n nze ich net , dass die DNA-Sequenz die Variation N139R und D142E des codierten Polypeptids umfasst.

3. Rekombinantes DNA-Molekül nach Anspruch 1 , dadurch geke n nze ich net , dass die DNA-Sequenz mindestens die Variation V200P des codierten Polypeptids umfasst.

4. Rekombinantes DNA-Molekül nach Anspruch 1, dadurch geke n n- ze ich net , dass die DNA-Sequenz die Variation K74D des codierten

Polypeptids umfasst.

5. Rekombinantes DNA-Molekül nach Anspruch 1, dadurch geke n nze ichnet , dass die DNA-Sequenz mindestens die Variation L145I und L198I des codierten Polypeptids umfasst.

6. Rekombinantes DNA-Molekül nach Anspruch 1, dadurch ge ke n nze i ch net, dass die DNA-Sequenz die Variation K74D, N139R, D142E, V200P des codierten Polypeptids umfasst.

7. Rekombinantes DNA-Molekül nach Anspruch 1, dadurch ge ke n nze ich net , dass die N-terminale Anfügung des codierten Polypeptids die Sequenz FSYGAAIPQS TQEKQFSQEF RDGYSILKHY GGNGPY-

SERV SYGIARDPPTS umfasst.

8. Rekombinantes DNA-Molekül nach Anspruch 1, dadurch gekennzeichnet, dass die C-terminale Anfügung des codierten Polypeptids die Sequenz LSFWWNYNTT TELNYRSSPI ACQEGDAMD umfasst.

9. Rekombinantes DNA-Molekül nach Anspruch 1, dadurch geken nzeichnet, dass die N-terminale Anfügung des codierten Polypeptids die Sequenz FSYGAAIPQS TQEKQFSQEF RDGYSILKHY GGNGPY- SERV SYGIARDPPTS und die C-terminale Anfügung des codierten Polypeptids die Sequenz LSFWWNYNTT TELNYRSSPI ACQEGDAMD umfasst.

10. Rekombinantes DNA-Molekül nach einem der Ansprüche 1 bis 8, dadurch gekennzeich net, dass es eine Sequenz ausgewählt aus den Sequenzen SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21 umfasst.

11. Polypeptid, das Phytaseaktivität besitzt und von einem rekombinanten DNA-Molekül nach einem der Ansprüche 1 bis 10 codiert wird oder durch Expression einer damit transformierten Wirtszelle erhalten wird.

12. Polypeptid nach Anspruch 11, dadurch geken nzeichnet, dass es eine Sequenz, ausgewählt aus SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22 umfasst.

13. DNA-Konstrukt mit der Fähigkeit, nach dem Einführen in eine geeignete Wirtszelle die Expression eines mutierten Phytasegens in einem Wirt zu steuern, dadurch geken nzeichnet, dass es gegebenenfalls ei- nen Promotor, gegebenenfalls Signal- und Markersequenzen, eine DNA-

Sequenz nach einem der Ansprüche 1 bis 10, einen Terminator und gegebenenfalls 5'- und 3'-flankierende Sequenzen enthält.

14. DNA-Konstrukt nach Anspruch 13, dadurch geken nze ich net, dass es sich bei dem Promotor um den Cellobiohydrolase-I-, den Cellobi- ohydrolase-ll-, den Amylase-, den Glucoamylase-, den Xylanase- oder den Enolase-Promotor handelt.

15. DNA-Konstrukt nach Anspruch 14, dadurch gekennze ich net, dass es sich bei der Signalsequenz und/oder den 5 1 - und 3'-flankierenden Sequenzen um gegebenenfalls modifizierte Phytase-Signalsequenzen aus Aspergillus niger handelt.

16. Vektor mit der Fähigkeit, eine Wirtszelle zu transformieren, dadurch g e - ke nnzeich net, dass der Vektor ein Konstrukt nach Anspruch 13 enthält.

17. Vektor nach Anspruch 16, dadurch geken nzeichnet, dass er ausgewählt ist aus dem Plasmid pET-PhyM2, hinterlegt unter der Hinterlegungsnummer DSM 18715, dem Plasmid pUC-PhyM3, hinterlegt unter der Hinterlegungsnummer DSM 18717, dem Plasmid pET-PhyM7, hinterlegt unter der Hinterlegungsnummer DSM 18716, dem Plasmid pUC-PhyM9, hinterlegt unter der Hinterlegungsnummer DSM 18718, dem Plasmid pUC- PhyMIO, hinterlegt unter der Hinterlegungsnummer DSM 18719, dem Plasmid pPhy2005, hinterlegt unter der Hinterlegungsnummer DSM 18720, dem Plasmid pPhy2006, hinterlegt unter der Hinterlegungsnummer DSM 18721.

18. Transformierte Wirtszelle, ausgewählt aus Pilz, Hefe, Bakterien und Säugerzellen, enthaltend ein rekombinantes DNA-Molekül nach einem der Ansprüche 1 bis 10 und ausgestattet mit der Fähigkeit, ein Polypeptid mit Phytaseaktivität zu exprimieren.

19. Transformierte Wirtszelle nach Anspruch 18, dadurch geken nze ich net, dass sie der Gattung Aspergillus, Rhizopus, Trichoderma, Neurospora, Mucor oder Penicillium angehört.

20. Verfahren zur Produktion von Phytase, dadurch gekennze ichnet, dass eine transformierte Wirtszelle nach Anspruch 18 oder 19 unter Bedingungen gezüchtet wird, die der Bildung von Phytase förderlich sind und die so produzierte Phytase isoliert wird.

5 21. Zusammensetzung, umfassend ein Polypeptid nach Anspruch 11 oder 12, gegebenenfalls zusammen mit weiteren Hilfs- und/oder Wirkstoffen.

22. Zusammensetzung nach Anspruch 21, dadurch geken nze ichnet, dass sie Magermilchpulver und/oder Calciumpropionat enthält.

23. Zusammensetzung nach Anspruch 21, dadurch geken nzeich- o n e t , dass die Zusammensetzung eine Nahrungsmittel- oder Futtermittelzusammensetzung ist.

24. Zusammensetzung nach Anspruch 21, 22 oder 23, dadurch gekennzeich net, dass die Zusammensetzung ein Backmittel ist.

25. Verwendung eines Polypeptids nach Anspruch 11 oder 12 zur Herstellung 5 eines Präparats zur Verbesserung der Phosphatverwertung aus der Nahrung bei Tieren und Menschen.

26. Verwendung eines Polypeptids nach Anspruch 11 oder 12 zur Verbesserung der rheologischen Eigenschaften von Teigen zur Herstellung von Backwaren.

o 27. Verwendung einer Variation der reifen Wildtyp-E. co//-Phytasesequenz, ausgewählt aus

i) der Mutation Lysin → Asparaginsäure an Position 74 (K74D), und/oder

ii) einer Kombination der Mutationen Asparagin -> Arginin an Position 5 139 (N 139R) und Asparaginsäure -> Glutaminsäure an Position 142

(D142E), und/oder

iii) einer Kombination der Mutationen Leucin → Isoleucin an Position 145 (L145I) und Leucin -> Isoleucin an Position 198 (L198I), und/oder

iv) einer Mutation Valin → Prolin an Position 200 (V200P), und/oder

v) einer N- oder C-terminalen oder einer N- und C-terminalen Anfügung eines Sequenzabschnitts der sauren Phosphatase von Aspergillus niger var. awamori oder der Phytase von Aspergillus niger

zur Herstellung eines rekombinanten DNA-Moleküls, das nach Expression in einer prokaryotischen oder eukaryotischen Wirtszelle ein Polypeptid mit Phytaseaktivität codiert, das eine erhöhte Temperatur- und Proteasestabi- lität besitzt.

28. Verwendung nach Anspruch 27, dadurch geken nzeichnet, dass die Variation K74D ist.

29. Verwendung nach Anspruch 27, dadurch geken nzeich net, dass die Variation N139R und D142E ist.

30. Verwendung nach Anspruch 27, dadurch geken nzeich net, dass die Variation L145I und L198I ist.

31. Verwendung nach Anspruch 27, dadurch gekennzeich net, dass die Variation V200P ist.

32. Verwendung nach Anspruch 27, dadurch geken nzeich net, dass die Variation K74D, N139R, D142E, V200P ist

33. Verwendung nach Anspruch 27, dadurch gekennzeichnet, dass die Variation die N-terminale Anfügung der Sequenz FSYGAAI PQS TQEKQFSQEF RDGYSILKHY GGNGPYSERV SYGIARDPPTS ist.

34. Verwendung nach Anspruch 27, dadurch ge ke n nzeich net , dass die Variation die C-terminale Anfügung die Sequenz LSFWWNYNTT TELNYRSSPI ACQEGDAMD ist.

35. Verwendung nach Anspruch 27, dadurch ge ke n nzeic h net , dass die Variation die N-terminale Anfügung der Sequenz FSYGAAIPQS TQEKQFSQEF RDGYSILKHY GGNGPYSERV SYGIARDPPTS und die C-terminale Anfügung die Sequenz LSFWWNYNTT TELNYRSSPI AC- QEGDAMD ist.

Description:

Polypeptid mit Phytaseaktivität und erhöhter Temperaturstabilität der Enzymaktivität sowie dieses codierende Nukleotidsequenz

Die Erfindung betrifft ein rekombinantes DNA-Molekül, das ein Polypeptid mit Phytaseaktivität und erhöhter Temperaturstabilität und erhöhter proteolytischer Stabilität der Enzymaktivität codiert sowie das codierte Polypeptid als solches. Insbesondere betrifft die Erfindung ein rekombinantes DNA-Molekül, das ein Polypeptid mit Phytaseaktivität und erhöhter Temperaturstabilität und erhöhter proteolytischer Stabilität der Enzymaktivität codiert, wobei die DNA-Sequenz durch eine Variation der reifen Wildtyp-E. co//-Phytase erhalten worden ist, wobei definierte Aminosäurepositionen im Vergleich zur Wildtypsequenz modifiziert sind bzw. N- und/oder C-terminale Extensionen vorhanden sind. Die Erfindung betrifft ferner ein Verfahren zur Expression der rekombinanten Phytase sowie deren Verwendung in der Lebensmittel- und Futtermitteltechnologie.

Phytinsäure oder Myoinositol-1 ,2,3,4,5,6-hexakisdihydrogenphosphat (abgekürzt Myoinositol-Hexakisphosphat) ist die Hauptquelle von Inositol und die primäre Speicherform von Phosphat in Pflanzensamen. In den Samen von Hülsenfrüchten liegt etwa 70% des Phosphatgehalts als ein gemischtes Kalium-, Magnesium- und Calciumsalz der Phytinsäure vor. Samen, Getreidekörner und Hülsenfrüchte sind wichtige Komponenten von Lebens- und Futtermittelzubereitungen, insbesondere von Tierfutterpräparaten; aber auch in der menschlichen Nahrung gewinnen Getreide- und Hülsenfrüchte zunehmend an Bedeutung.

Die Phosphateinheiten der Phytinsäure binden als Komplex zweiwertige und dreiwertige Kationen wie Metallionen, d.h. ernährungsphysiologisch wichtige Ionen wie Calcium, Eisen, Zink und Magnesium sowie die Spurenelemente Mangan, Kupfer und Molybdän. Daneben bindet Phytinsäure auch zu einem gewissen Ausmaß Proteine durch elektrostatische Wechselwirkung.

Phytinsäure und ihre Salze, die Phytate, werden oft nicht metabolisiert, da sie aus dem Magen-Darm-Trakt nicht absorbiert werden, d.h. weder der darin enthaltene Phosphor noch die chelatierten Metallionen, noch die gebundenen Proteine sind ernährungsphysiologisch verfügbar.

Da Phosphor ein wesentliches Element für das Wachstum aller Organismen ist, müssen Lebensmittel und Futtermittel mit anorganischem Phosphat supplemen- tiert werden. Sehr oft müssen auch die ernährungsphysiologisch essenziellen Ionen wie Eisen und Calcium supplementiert werden. Ferner wird der ernährungsphysiologische Wert jeder Diät vermindert, da Proteine durch Phytinsäure gebunden werden. Folglich wird Phytinsäure oft als Anti-Nährwertfaktor bezeichnet.

Weiterhin wird aufgrund fehlender Metabolisierung von Phytinsäure der Phosphor des Phytats über den Magen-Darm-Trakt der Tiere ausgeschieden, was zu einer unerwünschten Phosphatverunreinigung der Umwelt führt, in deren Folge es beispielsweise zur Eutrophierung von Gewässern und zu exzessivem Algenwachstum kommen kann.

Phytinsäure oder Phytate (diese Ausdrücke werden im Folgenden synonym verwendet außer anders angegeben) können durch Phytasen abgebaut werden. Phytasen katalysieren die Hydrolyse von Phytat in Myo-Inositol und/oder Mono-, Di-, Tri-, Tetra- und/oder Pentaphosphate sowie anorganisches Phosphat. Man unterscheidet zwei verschiedene Arten von mikrobiellen Phytasen: 1) 3-Phytase/Myo-lnositolhexaphosphat-3-phosphohydrolase, EC 3.1.3.8; 2) 6- Phytase/Myo-lnositolhexaphosphat-6-phosphohydrolase, EC 3.1.3.26. Die 3- Phytase hydrolisiert bevorzugt zuerst die Esterbindung in der 3-Position, die 6-

Phytase bevorzugt zuerst die Esterbindung in der 6-Position. Phytinsäure enthaltende Pflanzensamen enthalten endogene Phytaseenzyme. Bei deren Aufnahme sind die Phytate in Lebensmitteln bzw. Futtermitteln theoretisch durch die endogenen Pflanzen-Phytasen, durch Phytasen aus der Darmflora und durch Phytasen aus der Darmschleimhaut hydrolisierbar. In der Praxis ist jedoch das Hydrolysepotenzial der endogenen Pflanzen-Phytasen und der im Darm vorkommenden Phytasen, sofern vorhanden, bei weitem nicht ausreichend, um signifikant die Bioverfügbarkeit des in den Phytaten gebundenen Phosphors zu gewährleisten. Daher werden Lebens- bzw. Futtermitteln häufig exogene Phytasen zugesetzt.

Phytasen können durch Pflanzen sowie durch Mikroorganismen produziert werden. Unter den Mikroorganismen sind Phytase produzierende Bakterien sowie Phytase produzierende Pilze und Hefen bekannt.

Die natürlich vorkommenden Phytase-Produzenten haben jedoch den Nachteil, dass Phytase nur in bestimmten Mengen und mit definierten Eigenschaften gebildet wird. Wie vorstehend dargelegt besteht jedoch ein erhöhter Bedarf an Phytase insbesondere für die Lebensmittel- und Futtermittelindustrie.

Obgleich in der Lebensmittel- und Futtermittelindustrie ein erhöhter Bedarf an Phytase besteht und die Verwendung von Phytase vorteilhaft sein kann, haben nur wenige der bekannten Phytasen eine breite Akzeptanz in der Lebensmittel- und Futtermittelindustrie gefunden. Typische Bedenken betreffen die relativ hohen Herstellungskosten und/oder schlechte Stabilität bzw. Aktivität des Enzyms in der gewünschten Anwendungsumgebung. Weiterhin muss ein derartiges Enzym eine Reihe von Kriterien erfüllen, um industriell einsetzbar zu sein. Diese umfassen eine hohe spezifische Gesamtaktivität, ein niedriges pH-Optimum, Resistenz gegenüber gastrointestinalen Proteasen sowie Temperaturstabilität bzw. Thermostabilität. Die Temperaturstabilität ist eine wichtige Voraussetzung für eine erfolgreiche industrielle Anwendung, da beispielsweise in Pelletierprozessen Enzyme Temperaturen zwischen 60 0 C und 95 0 C ausgesetzt werden.

AIIe bekannten mikrobiellen Phytasen entfalten sich bei Temperaturen zwischen 56 0 C und 78°C (Lehman et al., 2000), wodurch sie ihre Aktivität verlieren. Daher besteht insbesondere ein Bedarf an Phytasen, die auch bei erhöhten Temperaturen eine technologisch ausreichende Aktivität besitzen, bzw. nicht inakti- viert werden.

Der vorliegenden Erfindung liegt somit die Aufgabe zu Grunde, ein Polypeptid mit Phytaseaktivität bereit zu stellen, das eine erhöhte Thermostabilität aufweist bzw. bei erhöhten Temperaturen eine technologisch ausreichende Aktivität besitzt. Ferner soll das Polypeptid mit Phytaseaktivität auch eine erhöhte proteoly- tische Stabilität besitzen.

Das Polypeptid soll ökonomisch produziert werden können. Insbesondere soll die Phytase thermostabiler sein als das Wild-Typ-Enzym. Die Phytase soll ferner die wesentlichen Eigenschaften der natürlichen E. co//-Wildtyp-Phytase beibehalten, sich jedoch durch eine verbesserte Thermostabilität auszeichnen. Zu den wesentlichen Eigenschaften der natürlichen Wildtyp-Phytase zählen insbesondere die Fähigkeit, die Verfügbarkeit von Phosphat in-vivo und in-vitro zu verbessern durch seine Aktivität als Phytase wie auch als Phosphatase, sein pH-Optimum im sauren mit hoher Restaktivität im stark sauren, sowie die Eignung als Backhilfsmittel.

Der vorliegenden Erfindung liegt ferner die Aufgabe zu Grunde, ein Gen für ein Polypeptid mit Phytaseaktivität mit erhöhter Thermostabilität sowie erhöhter proteolytischen Stabilität bereit zu stellen. Das Polypeptid soll ökonomisch und kostengünstig zu produzieren sein. Insbesondere soll die Expression des Polypeptids in eukaryotischen Mikroorganismen zu einem Polypeptid mit erhöhter Thermostabilität verglichen mit der ähnlich hergestellten Wildtyp-Phytase führen. Bereitgestellt werden sollen ferner die das Polypeptid codierenden DNA- Sequenzen, entsprechende DNA-Konstrukte und Vektoren sowie eine Quelle für das rekombinante Enzym, die für die kommerzielle Verwendung für Nah-

rungs- und Futtermittel und in industriellen Prozessen geeignet ist und das erfindungsgemäße Enzym enthaltende Zusammensetzungen.

Es wurde nun überraschenderweise gefunden, dass Mutationen an bestimmten Positionen der E. co//-Wildtyp-Phytasesequenz zu einer intrinsischen Erhöhung der Thermostabilität bzw. Temperaturstabilität sowie zu einer Erhöhung der proteolytischen Stabilität des Proteins Phytase führen, ohne die sonstigen Wirkungen und wesentlichen Eigenschaften der Wildtyp-E. co//-Phytase nachteilig zu beeinflussen.

überraschenderweise wurde gefunden, dass eine Mutation bei Position 74 (K74D) der Aminosäurensequenz, und/oder eine Kombination von Mutationen bei den Positionen 139 (N139R) und 142 (D142E), und/oder eine Kombination von Mutationen bei den Positionen 145 (L145I) und 198 (L198I) und/oder eine Mutation bei Position 200 (V200P) der Wildtyp-Phytase von E. coli sowie Kombinationen dieser Mutationen zu einer verbesserten Thermostabilität des Prote- ins Phytase führen ohne die günstigen Wirkungen und wesentlichen Eigenschaften der Wildtyp-E. co//-Phytase zu beeinträchtigen. Weiterhin wurde gefunden, dass die Ergänzung der E. co//-Phytase durch Sequenzen der sauren Phosphatase aus Aspergillus niger var. awamori am N-terminalen oder C- terminalen Ende, bzw. an den N- und C-terminalen Enden, auch in Verbindung mit den vorhergenannten Mutationen, zu einer Verbesserung der Thermostabilität und der proteolytischen Stabilität des Enzyms führen.

Die Erfindung betrifft somit ein rekombinantes DNA-Molekül das nach Expression in einer prokaryotischen oder eukaryotischen Wirtszelle ein Polypeptid mit Phytaseaktivität codiert, wobei das rekombinante DNA-Molekül eine DNA- Sequenz, ausgewählt aus

a) DNA-Sequenzen, die ein Polypeptid mit Phytaseaktivität codieren, das durch Variation der reifen Wildtyp-E. co//-Phytasesequenz erhalten worden ist, wobei die Variation ausgewählt ist aus

i) der Mutation Lysin → Asparaginsäure an Position 74 (K74D), und/oder

ii) einer Kombination der Mutationen Asparagin → Arginin an Position 139 (N139R) und Asparaginsäure → Glutaminsäure an Position 142 (D142E), und/oder

iii) einer Kombination der Mutationen Leucin -> Isoleucin an Position 145 (L145I) und Leucin → Isoleucin an Position 198 (L198I), und/oder

iv) einer Mutation Valin → Prolin an Position 200 (V200P), und/oder

v) einer N-terminalen oder C-terminalen oder einer N- und C-terminalen Anfügung eines Sequenzabschnitts der sauren Phosphatase von

Aspergillus niger var. awamori, oder der Phytase von Aspergillus ni- ger,

b) DNA-Sequenzen, die eine Homologie von 70% bis 100% zu den Sequenzen gemäß a) aufweisen,

c) DNA-Sequenzen, die aufgrund der Degeneriertheit des genetischen Codes mit den Sequenzen gemäß a) und b) verwandt sind,

umfasst, wobei das rekombinante DNA-Molekül bei Expression in einer geeigneten Wirtszelle mit einer erhöhten Temperatur- und Proteasestabilität der Enzymaktivität des so codierten Proteins einhergeht, wobei die Variationen iii) und iv) nur in Kombination mit einer Variation i), ii) und v) vorliegt, sowie die von dieser DNA codierten Polypeptidsequenzen.

Mehrere Phytasen aus E. coli sind in der Literatur beschrieben, z. B. das für eine Phytase codierende appA-Gen aus E. coli K-12 (Dassa et al., J. Bacteriol. 172: 5497-5500 (1990)). Dieses Gen codiert für ein periplasmatisches Enzym, das sowohl saure Phosphataseaktivität als auch Phytaseaktivität aufweist (siehe Greiner et al., Arch. Biochim, Biophys. 303: 107-113 (1993)). Natürliche

Mutanten dieses Enzyms sind bekannt (vgl. z. B. Rodriguez et al., Biochem. Biophys. Res. Comm. 257: 117-123 (1999)). Genetisch modifizierte Mutanten der E. co//-Phytase wurden ebenfalls beschrieben, die zu einer erhöhten Temperaturstabilität und/oder höheren spezifischen Aktivität führten. Rodriguez et al. (Arch. Biochem. Biophys. 382: 105-112 (2000)) exprimierten Wildtyp-AppA und mehrere durch ortsspezifische Mutagenese erzeugte Mutanten in Pichia pastoris, um die Wirkung von N-Glycosylierung auf die Temperaturstabilität des AppA-Proteins zu untersuchen. Obwohl die Glycosylierung nicht verstärkt wurde, war eine Mutante bei pH 3,5 bis 5,5 aktiver und wies nach Hitzebehandlung mehr Aktivität auf als das in P. pastoris produzierte Wildtypprotein.

Die Patentfamilie basierend auf WO 03/057248 beinhaltet die Patentanmeldungen US 2003/0170293 A1 und US 2003/0157646 A1. Darin wird die mikrobielle Herstellung einer thermotoleranten Phytase für Tierfutter beschrieben. Die Mutante (Nov9X) der E. coli Stamm B Phytase (appA) wird in E. coli, Pichia pasto- ris, und Schizosaccharomyces pombe zur Expression gebracht. Die Mutante Nov9X enthält 8 Aminosäuremutationen gegenüber dem Wildtyp Enzym. Die Mutante hat in Flüssigkeit bei 7O 0 C gegenüber dem Wildtyp-Enzym eine verbesserte Thermostabilität. Der Wirt in dem das Enzym zur Produktion gebracht wird, hat auch einen Einfluss auf dessen Thermostabilität wie von der gleichen Arbeitsgruppe in der US Patentanmeldung US 2003/0157646 A1 impliziert wird. Die Aminosäurepositionszählweise ist-bei NOV9X um 2 Positionen höher als in der vorliegenden Erfindung (W48 NOV9X entspricht W46 in der vorliegenden Erfindung).

In den Patentanmeldungen WO 02/095003 und WO 2004/015084 sind eine Reihe von Punktmutationen der E. co//-Phytase beschrieben, die jedoch alle nicht zu einer Erhöhung der Thermostabilität führten. Die Nummerierung in WO 2004/015084 ist im Vergleich zur vorliegenden Erfindung um 30- Aminosäurepositionen höher.

Auch die Offenlegungsschrift DE 10 2004 050 410 beschreibt E. co//-Phytase- Mutanten, jedoch mit dem Zweck der Erhöhung der Sekretionseffizienz bei der Produktion in filamentösen Pilzen. Aussagen zur Erhöhung der Thermostabilität der Mutanten liegen in der genannten Druckschrift nicht vor.

Ferner beschreibt die Druckschrift Garrett et al.; Applied Environ. Microbiol., 2004, 70 (5), 3041-3046, Mutanten der E. co//-Phytase mit einer erhöhten thermischen und gastrointestinalen Stabilität.

Es ist praktisch nicht möglich, Vorhersagen über die Wirkung einer bzw. mehrerer Mutationen auf das Verhalten der Enzymaktivität unter Bedingungen erhöh- ter Temperatur zu treffen. Generell erfolgt bei höheren Temperaturen eine Denaturierung bzw. Entfaltung der Sekundär- und Tertiärstruktur des Proteins.

Die Temperaturstabilität bzw. Thermostabilität von Proteinen ist abhängig von einer Vielzahl an Wechselwirkungen. Die Konformation von Proteinen wird durch eine große Anzahl schwacher Wechselwirkungen aufrechterhalten. Die Stabilisierung kann alle Hierarchieebenen der Proteinstruktur umfassen: Lokale Packung der Polypeptidekette, Sekundär- und Supersekundärstrukturelemente, Domänen und Untereinheiten eines multimeren Proteins. Es gibt zahlreiche Gründe, die hinsichtlich der erhöhten Temperaturstabilität eines Proteins berichtet werden, wobei die häufigsten (a) die Zusammenlagerung von lonenpaaren innerhalb und/oder zwischen Untereinheiten; (b) verbesserte Packung des hydrophoben Kerns (van-der-Waals-Wechselwirkungen); (c) zusätzliche Netzwerke aus Wasserstoffbrücken; (d) verstärkte Neigung zur Sekundärstrukturbildung; (e) erhöhte Dipolstabilisierung innerhalb der Helix; (f) eine vergrößerte polare Oberfläche; (g) eine verringerte Anzahl und ein verringertes Gesamtvolumen von Kavitäten; (h) die Verringerung von konformationeller Spannung (Schleifenstabilisierung) und (i) Widerstandsfähigkeit gegenüber chemischer Modifikation (Oxidation von Methioninresten und/oder Desaminierung von Asparagin- und Glutaminresten), sind.

Im Stand der Technik sind keine Hinweise dahingehend bekannt, wie und in welcher Art die E. co//-Wildtyp-Phytasesequenz gezielt zu verändern ist, um eine Erhöhung der Thermostabilität zu erzielen. Der Stand der Technik enthält ferner keine Hinweise auf die vorstehend genannten Mutationen in der E. coli- Phytasesequenz.

Der Stand der Technik enthält insbesondere keine Hinweise dahingehend, dass eine Mutation bei Position 74 (K74D) der Aminosäuresequenz oder eine Kombination von Mutationen bei den Positionen 139 (N 139R) und 142 (D142E) oder eine Kombination von Mutationen bei den Positionen 145 (L145I) und 198 (L198I) oder eine Mutation bei Position 200 (V200P) der Wildtyp-Phytase von E. coli oder Kombinationen dieser Mutationen zu einer verbesserten Thermostabilität des Proteins Phytase führen ohne die günstigen Wirkungen und wesentlichen Eigenschaften der Wildtyp-E. co//-Phytase zu beeinträchtigen. Ferner enthält der Stand der Technik keine Hinweise darauf, dass die Ergänzung der E. co//-Phytasesequenz durch Sequenzen der sauren Phosphatase aus Aspergillus niger var. awamori am N-terminalen oder C-terminalen Ende, bzw. N- und C-terminalen Enden, auch in Verbindung mit den vorher genannten Mutationen, zu einer Verbesserung der Thermostabilität des Enzyms führt.

Bevorzugte erfindungsgemäße rekombinante DNA-Moleküle mit den erfin- dungsgemäßen Variationen der reifen Wildtyp-E. co//-Phytasesequenz sind die Konstrukte PhyM2, PhyM3, PhyM7, PhyM9 und PhyM10. Sie sind in der nachstehenden Tabelle 1 dargestellt. Die Konstruktion PhyM1 wurde als Vergleichsprodukt aufgenommen.

Tabelle 1 : Genotypen der Mutationen PhyM1 , PhyM2, PhyM3, PhyM7, Ph M9 und Ph MIO

Die folgenden Plasmide sind bei der Deutschen Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, 38124 Braunschweig am 18.10.2006 gemäß den Bedingungen des Budapester Vertrags hinterlegt worden.

Es war überraschend, dass Mutationen, die die hydrophobe Oberfläche des Proteins beeinflussen (PhyM3, PhyM7 und PhyM9), sowie Mutationen, die eine ionische Bindung in Helix D (PhyM2) einfügen, bzw. den Loop B4 über eine io- nische Brücke stabilisieren (PhyM7) signifikant zur Erhöhung der Thermostabili- tät der E. co//-Phytase beitragen.

Auch das Anfügen von Sequenzteilen der Aspergillus niger var. awamori sauren Phosphatase, die bei der sauren Phosphatase zu einer Di- und Tetramerbildung führen, hatte stabilisierende Effekte bei der E. co//-Phytase. Entsprechendes gilt für die Anfügung von Sequenzteilen der Phytase von Aspergillus niger.

Die erfindungsgemäßen Polypeptide mit Phytaseaktivität zeigen verglichen mit dem E. co//-Wildtyp-Enzym eine erhöhte Temperatur bzw. Thermostabilität ihrer Enzymaktivität. Diese Verbesserung der Thermostabilität kann in Flüssigkeit mittels Differential Scanning Calorimetry (DSC) gemessen werden. Insbeson- dere zeigt sich die Verbesserung der Thermostabilität an der stark erhöhten Restaktivität der Enzymmutanten gegenüber dem Wildtyp-Enzym, wenn sie der thermischen Belastung ausgesetzt werden, wie sie bei der Pelletierung von Tierfutter verwendet wird. Ferner besitzen die erfindungsgemäßen Polypeptide auch eine erhöhte Stabilität gegenüber proteolytischem Abbau wie er im spe- ziellen im Magen von Geflügel und Monogastriern auftritt. Da die Phytase bei der Tierernährung speziell während der Magenpassage das Phosphat aus Phy-

tinsäure und deren Abbauprodukten freisetzen muss, ist diese Stabilität von besonderem Interesse um die Dosage des Enzyms möglichst klein zu halten. Aufgrund der erhöhten Temperatur- und/oder proteolytischen Stabilität eignen sich die erfindungsgemäßen Phytasen insbesondere für Anwendungen, bei de- nen erhöhte Temperaturbedingungen auftreten bzw. bei denen mit einem erhöhten proteolytischen Abbau zu rechnen ist. Anwendungsbeispiele hierfür sind die Herstellung des Enzyms, bei der es vor Proteasen des Wirtsstammes geschützt werden muß, die Herstellung von pelletiertem Tierfutter, jedoch auch die Anwendung als Flüssigenzym bei der Post-pelleting Aufbringung auf das pelle- tierte Tierfutter. Eine erhöhte Temperaturstabilität erlaubt die frühere Aufbringung auf die noch nicht so weit abgekühlten Pellets, wodurch die Verdunstungszeit der aufgebrachten Flüssigkeit verkürzt wird. Auch mikrobiologisch bringt dies Vorteile, da dann der hohe Wassergehalt nur bei hohen Temperaturen kurzzeitig vorliegt, bei denen die meisten pathogenen Keime nicht wachsen können.

Die erfindungsgemäße eine Phytase codierende DNA-Sequenz umfasst mindestens eine der folgenden Mutationen bzw. Kombinationen von Mutationen und/oder sowie N- oder C- bzw. N- und C-terminalen Anfügungen des codierten Polypeptids:

i) die Mutation Lysin → Asparaginsäure an Position 74 (K74D), und/oder

ii) eine Kombination der Mutationen Asparagin -» Arginin an Position 139 (N139R) und Asparaginsäure -» Glutaminsäure an Position 142 (D142E), und/oder

iii) eine Kombination der Mutationen Leucin → Isoleucin an Position 145 (L145I) und Leucin → Isoleucin an Position 198 (L198I), und/oder

iv) eine Mutation Valin → Prolin an Position 200 (V200P), und/oder

v) eine N-terminale oder C-terminale oder eine N- und C-terminale Anfügung eines Sequenzabschnitts der sauren Phosphatase von Aspergillus niger var. awamoh oder der Phytase von Aspergillus niger.

Die erfindungsgemäße Phytasesequenz enthält dabei bevorzugt mindestens eine und besonders bevorzugt mindestens zwei der vorstehend genannten Variationen. Beliebige Kombinationen der oben genannten Mutationsvarianten sind möglich um die Thermostabilität der Phytase an die vorliegenden Gegebenheiten der speziellen Anwendung anzupassen. Eine bevorzugte Kombinationsmöglichkeit stellt die Kombination von i), ii) und iv) dar, die im Weiteren als Genotyp PhyMIO bezeichnet wird.

Ferner kann zusätzlich zu den oder anstelle der beschriebenen Mutationen bzw. Kombinationen von Mutationen eine N-terminale oder C-terminale oder eine N- und C-terminale Anfügung eines Sequenzabschnitts der sauren Phosphatase von Aspergillus niger var. awamori vorhanden sein. Auch das al- leinige Vorhandensein dieser Sequenzabschnitte führt bereits zu einer Erhöhung der Thermostabilität. Bei dem N-terminalen Abschnitt der sauren Phosphatase aus A. niger var. awamoh handelt es sich um die ersten 51 Aminosäuren des reifen Proteins (FSYGAAIPQS TQEKQFSQEF RDGYSILKHY GGNGPYSERV SYGIARDPPTS). Die letzten 4 Aminosäuren dieses Polypep- tids ersetzen dabei die ersten 4 Aminosäuren (QSEP) der reifen E. coli Phytase. Auch das Anfügen von Teilen dieses Abschnitts der sauren Phosphatase ist möglich. Alternativ kann auch der N-terminale Teil oder Teile davon, der ersten 40 Aminosäuren des reifen Proteins der Aspergillus niger Phytase verwendet werden (SCDTVDQGYQ CFSETSHLWG QYAPFFSLAN ESVISPEV- PA). Die Anfügung an die E. coli Phytase kann auch an anderen Stellen als an der beschriebenen Position 4 erfolgen, solange die Aktivität des Enzyms erhalten bleibt. Zur C-terminalen Verlängerung wurden die letzten 29 Aminosäuren (LSFWWNYNTT TELNYRSSPI ACQEGDAMD) der sauren Phosphatase aus A. niger var. awamori direkt an das C-terminale Ende der E. coli Phytase fusio- niert. Diese Fusion, bzw. Fusionen, können auch mit weiteren Mutationen in der

E. coli Phytase einhergehen und sind nicht beschränkt auf die in dieser Anmeldung aufgeführten weiteren Mutationen. Durch die Mutation Lys43Cys würde die Möglichkeit einer Disulphidbrückenbildung zwischen dem neuen C- terminalen Teil und dem E. coli Phytase Kern ermöglicht und damit eine ver- besserte Dimerisierung. Weitere Mutationen, die van der Waals, hydrophobe oder ionische intermolekulare Brücken begünstigen oder stabilisieren und damit die Thermostabilität erhöhen oder noch weiter verbessern können, sind möglich. Beispiele für die N- bzw. C-terminalen Sequenzverlängerungen sind die nachstehend beschriebenen Ausführungsformen Phy2005 und Phy2006.

Die Thermostabilität der erfindungsgemäßen Phytase kann in Handelsprodukten noch weiter erhöht werden, z. B. durch Zugabe von Stoffen in das Ultrafiltrationskonzentrat vor der Trocknung oder Granulation. Beispielsweise kann eine stabile Formulierung des erfindungsgemäßen Phytaseenzyms dadurch hergestellt werden, dass ein Gemisch aus einer flüssigen Enzymlösung auf ein Füll- mittel wie Maltodextrin gesprüht wird und dann das Gemisch getrocknet wird, oder der flüssigen Enzymlösung wird vor dem Trocknen 20% - 60% Magermilchpulver (w/w bezogen auf Gesamtprotein der Enzymlösung) und/oder 1% - 5% Calciumpropionat (w/w bezogen auf Gesamtprotein der Enzymlösung) zugesetzt und der pH-Wert auf einen definierten Wert eingestellt, insbesondere auf pH 5,2 ± 0,5. Die Verringerung der Feuchtigkeit und die Bindungswechselwirkungen der Phytase mit dem Füllmittel schützen das Enzym zusätzlich zu seiner in seiner Struktur definierten Stabilität vor Umwelteinflüssen wie Tempe- raturextrema, die während der Herstellung des Futtermittels auftreten können. Trockene und flüssige Formulierungen können weiter stabilisiert werden, wenn die Aktivität potenzieller proteolytischer Enzyme verringert wird, die als Nebenprodukte in dem Flüssigfermentationsgemisch vorhanden sein können, das zur Herstellung des erfindungsgemäßen Enzyms verwendet wird.

Die der erfindungsgemäß mutierten Phytasesequenz entsprechende DNA- Sequenz kann unter Verwendung beliebiger Codon usages realisiert werden. So kann beispielsweise die Codon usage des zur Expression verwendeten Mik-

roorganismus verwendet werden, es kann aber auch die E. co//-Codon-usage bzw. eine Variante davon verwendet werden. Ferner kann die erfindungsgemäße mutierte E. co//-Phytasesequenz weitere Sequenzvariationen enthalten. Dabei können beliebige Variationen zusätzlich zu den vorstehend beschriebenen Mutationen vorgenommen werden, solange die Eigenschaft der erhöhten Temperaturstabilität nicht nachteilig beeinträchtigt wird und solange die enzymati- sche Aktivität und weitere wesentliche Eigenschaften der E. co//-Wildtyp- Phytase beibehalten werden.

Entsprechende Variationen sind einem Fachmann auf dem Gebiet der Technik der rekombinanten DNA gut bekannt und umfassen die vorstehenden Mutationen sowie die nachstehend dargelegten beispielhaften Variationen.

Erfindungsgemäß können Additions- und/oder Deletionsmoleküle des erfindungsgemäß modifizierten Polypeptids verwendet werden. So kann das erfindungsgemäß modifizierte Polypeptid mit Phytaseaktivität durch Anfügen weite- rer Sequenzen am N-terminalen und/oder C-terminalen Ende verlängert werden. Dadurch können Hybridmoleküle hergestellt werden, die weitere vorteilhafte Eigenschaften besitzen. Beispielsweise können Fusionsproteine bzw. nativ in hohem Maße sekretierte Proteine angefügt werden, wodurch die Sekretionseffizienz verbessert wird. Bevorzugt wird dazu ein Teil des CBH2-Proteins aus Tri- choderma reesei, von Aminosäure Met 1 bis Ser 86, verwendet.

Erfindungsgemäß können auch Sequenzabschnitte des Polypeptids mit Phytaseaktivität deletiert werden, solange die Eigenschaft der erhöhten Temperaturstabilität unter Beibehaltung der Phytaseaktivität nicht beeinträchtigt wird.

Die Mutationen, Elongationen und Verkürzungen können in an sich bekannter Weise nach auf dem Fachgebiet gut bekannten Verfahren durchgeführt werden.

Die vorstehend in Betracht gezogenen Veränderungen des Polypeptids mit Phytaseaktivität entsprechen entsprechenden Mutationen bzw. Modifikationen des dazugehörigen DNA-Moleküls. Erfindungsgemäß werden dabei auch sol-

che Sequenzen in Betracht gezogen, die unter relaxierten oder stringenten Bedingungen mit den erfindungsgemäßen Sequenzen hybridisieren. Als stringente Bedingungen gelten: Hybridisierung bei 65 0 C 1 18 h in Dextransulfat-Lösung (GenescreenPlus, DuPont), danach waschen der Filter jeweils 30 min zuerst mit 6 x SSC, zweimal 2 x SSC, zweimal 2 x SSC mit 0,1% SDS und anschließend mit 0,2 x SSC bei 65°C (Membrane transfer and detection methods, Amers- ham).

Ferner betrifft die Erfindung auch solche Sequenzen, die mit der beanspruchten Nukleotidsequenz bzw. den beanspruchten Teilen davon eine Homologie von mindestens 70%, bevorzugter mindestens 80%, noch bevorzugter mindestens 90% und insbesondere mindestens 95% aufweisen, solange die jeweiligen Sequenzen zur Erhöhung der Temperaturstabilität des durch sie codierten Polypeptids mit Phytaseaktivität führen. Bevorzugt beträgt die Homologie 70 bis zu 100 Prozent. Die Homologie ist dabei als Grad der Identität definiert. Der Grad der Identität wird dabei bevorzugt so bestimmt, dass man die Anzahl der Reste der kürzeren Sequenz, die an dem Vergleich beteiligt ist und die ein „entsprechendes" Gegenstück in der anderen Sequenz besitzt, ermittelt. Für die Zwecke der vorliegenden Erfindung wird die Homologie dabei bevorzugt in üblicher Weise unter Verwendung der üblichen Algorithmen bestimmt. Erfindungsgemäß werden zum Vergleich nur die cDNAs der jeweiligen reifen Proteine herangezogen. Als homologe Sequenzen werden erfindungsgemäß ähnliche, bevorzugt identische, Sequenzgegenstücke mit Hilfe von bekannten Computerprogrammen ermittelt. Ein Beispiel für ein derartiges Programm ist das Programm Clone Manager Suite, das den Programmteil Align Plus enthält und von Scientific & Educational Software, Durham, NC, USA vertrieben wird. Dabei wird ein Vergleich zweier wie vorstehend definierter DNA-Sequenzen durchgeführt, unter der Option local alignment entweder nach der Methode FastScan — MaxScore oder nach der Methode Needleman-Wunsch unter Beibehaltung der Default- werte. Speziell wurde erfindungsgemäß zur Berechnung der Homologie die Programmversion „Clone Manager 7 Align Plus 5" mit den Funktionen „Compa- re Two Sequences/Local Fast Scan-Max Score/Compare DNA sequences" an-

gewendet. Dabei wurden die aus den folgenden Quellen zugänglichen Algorithmen verwendet: Hirschberg, D.S. (1975) A linear space algorithm for Computing longest common subsequences, Commun Assoc Comput Mach 18:341- 343; Myers, E.W. and W. Miller. (1988) Optimal alignments in linear space, CABIOS 4:1 , 11-17; Chao, K-M, W.R. Pearson and W. Miller. (1992) Aligning two sequences within a specified diagonal band, CABIOS 8:5, 481-487.

Die Erfindung betrifft ferner auch DNA-Sequenzen, die aufgrund der Degene- riertheit des genetischen Codes mit den erfindungsgemäßen Sequenzen verwandt sind sowie allelische Varianten davon. Die Degeneriertheit des geneti- sehen Codes kann sich dabei aufgrund natürlicher Degeneriertheit oder aufgrund eines speziell gewählten Codongebrauchs ergeben. Natürlich vorkommende allelische Varianten können unter Verwendung gut bekannter Techniken der Molekularbiologie wie z. B. der Polymerase-Kettenreaktion (PCR) und Hybridisierungstechniken identifiziert werden.

Eine DNA-Sequenz, die ein erfindungsgemäßes Polypeptid codiert, kann verwendet werden, um beliebige Wirtszellen wie beispielsweise Zellen von Pilzen, Hefen, Bakterien, Pflanzen oder Säugern zu transformieren. Derart transformierte Zellen zeichnen sich durch eine Produktion und ev. Sekretion an Phytase mit erhöhter Thermostabilität aus. Das so produzierte Phytaseenzym mit er- höhter Thermostabilität führt auch zu einer effizienten Phosphatfreisetzung aus Phytaten.

Die Ausdrücke Protein, Peptid und Polypeptid sollen austauschbar verwendet werden. Ein Polypeptid oder Enzym mit Phytaseaktivität oder eine Phytase soll jedes Enzym bezeichnen, das die Freisetzung von anorganischem Phosphat aus verschiedenen Myoinositol-Phosphaten bewirken kann. Beispiele für solche Myoinositol-Phosphat(Phytase)-Substrate sind Phytinsäure und beliebige Salze davon, beispielsweise Natriumphytat oder Kaliumphytat oder gemischte Salze. Auch beliebige Positionsisomere der Di-, Tri-, Tetra- oder Pentaphosphate von Myoinositol können als Phytasesubstrat dienen. Die Phytaseaktivität kann unter

Verwendung jedes beliebigen Assays, bei dem eines dieser Substrate verwendet wird, bestimmt werden. Eine erfindungsgemäße Phytase-Variante umfasst Polypeptidvarianten, die von einer spezieilen Phytase durch Deletion oder Addition einer oder mehrerer Aminosäuren an das N-terminale und/oder C-terminale Ende des nativen Proteins, Deletion oder Addition einer oder mehrerer Aminosäuren an einer oder mehreren Stellen in dem nativen Protein oder Substitution einer oder mehrerer Aminosäuren an einer oder mehreren Stellen in der Phytase abgeleitet sind. Die Erzeugung solcher Varianten ist allgemein auf dem Fachgebiet bekannt. Beispielsweise können Aminosäuresequenz-Varianten der Polypeptide durch Mutation in der DNA hergestellt werden. Verfahren zur Muta- genese und Nucleotidsequenz-Veränderung sind auf dem Fachgebiet gut bekannt (vgl. beispielsweise Kunkel, Proc. Natl. Acad. Sei. USA, 82:488 (1985), Kunkel et al., Methods in Enzymol., 154:367 (1987), US-Patentnr. 4,873,192, Walker und Gaastra, eds., Techniques in Molecular Biology, Mac Millan Pub- lishing Company, New York (1983)). Hinweise über geeignete Aminosäuresubstitutionen, die die biologische Aktivität des Proteins von Interesse nicht beeinträchtigen, finden sich in dem Model von Dayhoff et al., Atlas of Protein Se- quence and Structure, Natl. Biomed. Res. Found., Washington, D. C. (1978). Konservative Substitutionen wie der Austausch einer Aminosäure gegen eine andere mit ähnlichen Eigenschaften sind bevorzugt.

Derartige innerhalb einer Gruppe austauschbare Aminosäuren sind, ohne dadurch beschränkt zu werden, in der nachstehenden Tabelle beispielhaft angeführt.

Die Erfindung betrifft auch isolierte oder im Wesentlichen gereinigte Nucleinsäu- re- oder Proteinzusammensetzungen. Dabei bezeichnet ein isoliertes und gereinigtes Polynucleotid/Polypeptid bzw. Segment davon ein Polynucleotid bzw. Polypeptid bzw. Segment davon, das isoliert aus seiner nativen Umgebung vorliegt. Ein isoliertes Polynucleinsäuresegment oder Polypeptid kann in gereinigter Form vorliegen oder kann in einer nicht nativen Umgebung vorliegen, wie beispielsweise in einer transgenen Wirtszelle. Beispielsweise ist ein isoliertes oder gereinigtes Polynucleotidsegment oder -Protein oder ein biologisch aktiver Teil davon im Wesentlichen frei von weiterem zellulärem Material oder Kulturmedium bei Produktion nach rekombinanten Techniken oder im Wesentlichen frei von chemischen Vorläufern oder anderen chemischen Verbindungen. Bevorzugt ist ein isoliertes Polynucleotid frei von Sequenzen (bevorzugt Proteincodierenden Sequenzen), die natürlicherweise die Nucleinsäure (d.h. Sequen- zen, die an den 5'- und 3'-Enden der Nucleinsäure lokalisiert sind) in der genomischen DNA des Organismus, aus dem die Nucleinsäure stammt, flankieren. Beispielsweise kann gemäß verschiedenen Ausführungsformen das isolierte Nucleinsäuremolekül weniger als etwa 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0,5 kb oder 0,1 kb Nucleotidsequenzen enthalten, die natürlicherweise das Nucleotinsäu- remolekül in der genomischen DNA der Zelle, aus der die Nucleinsäure abgeleitet ist, flankieren. Ein Protein, das im Wesentlichen frei von zellulärem Material ist, umfasst Zusammensetzungen von Protein oder Polypeptid mit weniger als etwa 70%, 50%, 30%, 20%, 10%, 5% (bezogen auf das Trockengewicht) von verunreinigendem Protein. Wenn das erfindungsgemäße Protein oder ein biolo- gisch aktives Fragment davon rekombinant produziert wird, umfasst bevorzugt das Kulturmedium weniger als etwa 70%, 50%, 30%, 20%, 10% oder 5% (bezogen auf das Trockengewicht) der chemischen Vorläufer oder nicht- proteinartigen chemischen Substanzen. Fragmente und Varianten der erfindungsgemäßen Nucleotidsequenzen oder Proteine oder Proteinsegmente, die dadurch codiert werden, sind ebenfalls erfindungsgemäß umfasst. Fragment bezeichnet einen Teil der Nucleotidsequenz oder einen Teil der Aminosäurese-

quenz und daher einen Teil des Polypeptids oder Proteins, welches davon codiert wird.

Die Erfindung betrifft auch Expressionskassetten, die zur Einschleusung des eine erfindungsgemäße Phytase codierenden offenen Leserasters in eine Wirtszelle verwendet werden können. Sie umfassen bevorzugt eine Transkriptionsstartregion, die mit dem offenen Leseraster verknüpft ist. Eine derartige Expressionskassette kann eine Vielzahl von Restriktionsspaltstellen zur Insertion des offenen Leserasters und/oder anderer DNAs, z. B. einer Transkriptions- Regulator-Region und/oder selektierbare Markergene enthalten. Die Transkrip- tionskassette umfasst in der 5'->3'-Richtung der Transkription eine Transkriptions- und Translationsstartregion, die DNA-Sequenz von Interesse und eine Transkriptions- und Translationsstopregion, die in einer mikrobiellen Zelle funktionell ist. Die Terminationsregion kann bezüglich der Transkriptioninitiationsregion nativ sein, kann bezüglich der DNA-Sequenz von Interesse nativ sein oder kann von einer beliebigen anderen Quelle abgeleitet sein.

Der Ausdruck „offenes Leseraster" (ORF) bezeichnet die Aminosäure-Sequenz, die zwischen den Translationsstart- und -Stop-Codons einer codierenden Sequenz codiert wird. Die Ausdrücke „Start-Codon" und „Stop-Codon" bezeichnen eine Einheit aus drei benachbarten Nukleotiden (Codons) in einer codierenden Sequenz, die den Kettenstart und -stop der Proteinsynthese (mRNA- Translation) spezifizieren.

„Funktionelle Verknüpfung" bezeichnet im Zusammenhang mit einer Nukleinsäure eine Verbindung als Teil des gleichen Nukleinsäuremoleküls in geeigneter Positionierung und Orientierung zum Transkriptionsstart des Promotors. DNA in funktioneller Verknüpfung an einen Promotor befindet sich unter der Transkriptions-Initiations-Regulation des Promotors. Codierende Sequenzen können funktionell mit der Regulatorsequenz in Sense- oder Antisense- Orientierung verknüpft sein. Bei Bezugnahme auf Polypeptide bedeutet funktio-

nelle Verknüpfung die Verbindung als Teil desselben Polypeptids, d.h. über Peptidylbindungen.

Erfindungsgemäß können beliebige Promotoren verwendet werden. Promotor bezeichnet die Nukleotidsequenz üblicherweise stromaufwärts (5') bezüglich der codierenden Sequenz und kontrolliert die Expression der codierenden Sequenz, indem die Erkennung für die RNA-Polymerase und anderer Faktoren, die für die richtige Transkription erforderlich sind, bereit gestellt wird. Der erfindungsgemäß verwendete Promotor kann einen Minimalpromotor umfassen, d.h. eine kurze DNA-Sequenz aus einer TATA-Box und anderen Sequenzen, die die Transkriptionsstartstelle spezifizieren, an die Regulatorelemente zur Kontrolle der Expression angefügt sind.

Der erfindungsgemäße Promotor kann auch eine Nucleotidsequenz umfassen, die einen Minimalpromotor und Regulatorelemente umfasst, der die Expression einer codierenden Sequenz oder funktionellen RNA kontrollieren kann. Dieser Typ von Promotorsequenz besteht aus proximalen und distalen stromaufwärts gelegenen Elementen, wobei die zuletzt genannten Elemente oft als Enhancer bezeichnet werden. Folglich ist ein Enhancer eine DNA-Sequenz, die die Promotor-Aktivität stimulieren kann und kann ein dem Promotor innewohnendes Element oder ein insertiertes heterologes Element sein, um die Expressionshö- he oder Gewebspezifität eines Promotors zu verstärken. Er kann in beiden Orientierungen funktionieren und kann selbst bei stromaufwärtiger oder stromab- wärtiger Platzierung von dem Promotor funktionieren. Sowohl Enhancer als auch andere stromaufwärts gelegene Promotor-Elemente binden sequenzspezifisch DNA-bindende Proteine, die ihre Wirkungen vermitteln. Promotoren kön- nen in ihrer Gesamtheit von einem nativen Gen abgeleitet sein oder können aus verschiedenen Elementen zusammengesetzt sein, die von verschiedenen natürlich vorkommenden Promotoren abgeleitet sind oder können sogar aus synthetischen DNA-Segmenten zusammengesetzt sein. Ein Promotor kann auch DNA-Sequenzen enthalten, die an der Bindung von Proteinfaktoren beteiligt

sind, die die Effizienz der Transkriptionsinitiation als Antwort auf physiologische oder entwicklungsbedingte Bedingungen kontrollieren.

Promotorelemente, insbesondere TATA-Elemente, die inaktiv sind oder eine stark verminderte Promotor-Aktivität in Abwesenheit einer stromaufwärtigen Aktivierung besitzen, werden als Minimalpromotoren oder Kernpromotoren bezeichnet. In Gegenwart eines geeigneten Transkriptionfaktors bzw. geeigneter Transkriptionsfaktoren liegt die Funktion des Minimalpromotors in der Ermöglichung der Transkription. Ein Minimal- oder Kernpromotor besteht somit nur aus allen Grundelementen, die für die Transkriptionsinitiation notwendig sind, z. B. einer TATA-Box und/oder einem Initiator.

Die Erfindung betrifft auch die erfindungsgemäße DNA enthaltende Vektoren. Diese Vektoren umfassen beliebige Plasmide, Cosmide, Phagen und andere Vektoren in doppelsträngiger oder einzelsträngiger, linearer oder zirkulärer Form, die gegebenenfalls selbst transmittierbar oder mobilisierbar sein können und die einen prokaryotischen oder eukaryotischen Wirt entweder durch Integration in das zelluläre Genom transformieren können oder die extrachromosomal vorliegen (z. B. autonom replizierende Plasmide mit einem Replikationsori- gin).

Vektoren, Plasmide, Cosmide, künstliche Hefechromosomen (YACs), künstliche Bakterienchromosomen (BACs) und DNA-Segmente zur Verwendung zur Transformation von Zellen umfassen allgemein die erfindungsgemäße Phytase- codierende DNA sowie eine andere DNA, wie cDNA, ein Gen oder Gene, die in die Zellen eingeschleust werden sollen. Diese DNA-Konstrukte können weitere Strukturen wie Promotoren, Enhancer, Polylinker oder auch Regulatorgene, so weit erforderlich, umfassen. Eines der DNA-Segmente oder Gene, das bzw. die für die zelluläre Einschleusung ausgewählt wurde bzw. wurden, codiert/codieren zweckdienlicherweise ein Protein, das in den so erhaltenen transformierten (rekombinanten Zellen) exprimiert wird, was zu einem screenbaren oder selek-

tierbaren Merkmal führt und/oder der transformierten Zelle einen verbesserten Phenotyp verleiht.

Die Konstruktion von Vektoren, die erfindungsgemäß verwendet werden können, ist einem Fachmann auf dem Gebiet angesichts der vorstehenden Offen- barung bekannt (vgl. z. B. Sambrook et al., Molecular Cloning: A Laboratory Manual (2. Aufl., Coldspring Harbor Laboratory Press, Plainview, N.Y. (1989)). Die erfindungsgemäße Expressionskassette kann ein oder mehrere Restriktionsschnittstellen enthalten, um das die Phytase-codierende Nucleotid unter die Regulation einer Regulatorsequenz zu stellen. Die Expressionskassette kann auch ein Terminationssignal in funktioneller Verknüpfung mit dem Polynukleotid sowie Regulatorsequenzen, die für die ordnungsgemäße Translation des Polynukleotids benötigt werden, enthalten. Die Expressionskassette, die das erfindungsgemäße Polynukleotid enthält, kann chimer sein, d.h. mindestens eine ihrer Komponenten ist bezogen auf mindestens eine der anderen Komponenten heterolog. Die Expression des Polynukleotids in der Expressionskassette kann unter der Kontrolle eines konstitutiven Promotors, eines induzierbaren Promotors, eines regulierten Promotors, eines viralen Promotors oder eines synthetischen Promotors stehen.

Die Vektoren können bereits Regulatorelemente enthalten, z. B. Promotoren, oder die erfindungsgemäßen DNA-Sequenzen können so manipuliert werden, dass sie solche Elemente enthalten. Geeignete Promotorelemente, die verwendet werden können, sind auf dem Fachgebiet bekannt und sind beispielsweise für Tπchoderma reesei der cbh 1- oder der cbh-2-Promotor, für Aspergillus ory- zae der amy-Promotor, für Aspergillus niger der xyl-, glaA-, alcA-, aphA-, tpiA-, gpdA-, sucl- und der pkiA-Promotor. Geeignete Promotorelemente, die zur Expression in Hefe verwendet werden können, sind auf dem Fachgebiet bekannt und sind beispielsweise der pho5-Promotor oder der gap-Promotor zur Expression in Saccharomyces cerevisiae und für Pichia pastoris, z. B. aoxI-Promotor oder der fmd-Promotor oder der mox-Promotor für H. polymorpha.

DNA 1 die zur Einschleusung in Zellen geeignet ist, kann neben der erfindungsgemäßen DNA auch DNA, die aus einer beliebigen Quelle abgeleitet wurde o- der daraus isoliert ist, umfassen. Ein Beispiel für eine abgeleitete DNA ist eine DNA-Sequenz, die als nützliches Fragment in einem gegebenen Organismus identifiziert wurde und die dann in im Wesentlichen reiner Form chemisch synthetisiert wurde. Ein Beispiel für eine solche DNA ist eine geeignete DNA- Sequenz, die beispielsweise unter Verwendung von Restriktionsendonucleasen erhalten wurde, so dass sie weiter erfindungsgemäß manipuliert werden kann, beispielsweise amplifiziert werden kann. Eine derartige DNA wird üblicherweise als rekombinante DNA bezeichnet. Daher umfasst eine geeignete DNA vollständig synthetische DNA, semisynthetische DNA, aus biologischen Quellen isolierte DNA und von eingeschleuster RNA abgeleitete DNA. Im Allgemeinen ist die eingeschleuste DNA kein ursprünglicher Bestandteil des Genotyps der Empfänger-DNA, aber erfindungsgemäß kann auch ein Gen aus einem gege- benen Genotyp isoliert und eventuell verändert werden und anschließend können Mehrfachkopien des Gens in den gleichen Genotyp eingeschleust werden, z. B. um die Produktion eines gegebenen Genprodukts zu verstärken.

Die eingeschleuste DNA umfasst ohne Beschränkung DNA aus Genen, wie beispielsweise aus Bakterien, Hefen, Pilzen oder Viren. Die eingeschleuste DNA kann modifizierte oder synthetische Gene, Teile von Genen oder chimäre Gene einschließlich Genen aus dem gleichen oder einem unterschiedlichen Genotyp umfassen.

Die zur Transformation erfindungsgemäß verwendete DNA kann zirkulär oder linear, doppelsträngig oder einzelsträngig sein. Im Allgemeinen liegt die DNA in Form einer Chimären DNA wie eine Plasmid-DNA vor, die auch codierende Regionen, die von Regulatorsequenzen flankiert sind, die die Expression der in der transformierten Zelle vorhandenen rekombinanten DNA unterstützen, enthalten. Beispielsweise kann die DNA selbst einen Promotor enthalten oder daraus bestehen, der in einer Zelle aktiv ist, der von einer Quelle, die sich von der Zelle

unterscheidet, abgeleitet ist oder es kann ein Promotor verwendet werden, der bereits in der Zelle, d.h. der Transformationszielzelle, vorhanden ist.

Im Allgemeinen ist die eingeschleuste DNA relativ klein, weniger als etwa 30 kb, um die Empfindlichkeit gegenüber physikalischem, chemischem oder enzymati- schem Abbau zu minimieren, der mit der Größe der DNA zunimmt.

Die Selektion eines geeigneten Expressionsvektors hängt von den Wirtszellen ab. Hefe- oder Pilzexpressionsvektoren können einen Replikationsorigin, einen geeigneten Promotor und Enhancer umfassen, und auch beliebige notwendige Ribosomenbindungsstellen, Polyadenylierungsstellen, Splice-Donor und -Akzeptor-Stellen, Transkriptionsterminationssequenzen und nicht-transkribierte 5'-flankierende Sequenzen umfassen.

Beispiele für geeignete Wirtszellen sind: Pilzzellen der Gattung Aspergillus, Rhizopus, Trichoderma, Neurospora, Mucor, Penicillium, etc., wie beispielsweise Hefen der Gattungen Kluyveromyces, Saccharomyces, Schizosaccharomy- ces, Trichosporon, Schwanniomyces, Hansenula, Pichia und dergleichen. Geeignete Wirtssysteme sind beispielsweise Pilze wie Aspergilli, z. B. Aspergillus niger (ATCC 9142) oder Aspergillus ficuum (NRLL 3135) oder Trichoderma (z. B. Trichoderma reseei Q M6a) und Hefen wie Saccharomyces, z. B. Saccharomyces cerevisiae oder Pichia, wie z. B. Pichia pastoris oder Hansenula, z. B. H. polymorphe (DSMZ 70277). Derartige Mikroorganismen können von anerkannten Hinterlegungsstellen, z. B. der American Type Culture Collection (ATCC), dem Centraalbureau voor Schimmelcultures (CBS) oder der Deutschen Sammlung für Mikroorganismen und Zellkulturen GmbH (DSMZ) oder beliebigen anderen Hinterlegungsstellen erhalten werden.

Die Expressionskassette kann in der 5'-3'-Transkriptionsrichtung eine Transkriptions- und Translationstartregion des erfindungsgemäßen Polynucleotids und eine Transkriptions- und Terminationsregion, die in vivo oder in vitro funktionell ist, enthalten. Die Terminationsregion kann bezüglich der Transkriptions- initiationsregion nativ sein oder kann bezüglich des Polynucleotids nativ oder

anderer Herkunft sein. Die Regulatorsequenzen können stromaufwärts (5' nicht- codierende Sequenzen), innerhalb (Intron) oder stromabwärts (3 1 nicht- codierende Sequenzen) einer codierenden Sequenz lokalisiert sein und die Transkription, das RNA-Processing oder die Stabilität und/oder die Translation der assoziierten codierenden Sequenz beeinflussen. Regulatorsequenzen können ohne Beschränkung Enhancer, Promotoren, Repressorbindungsstellen, Translationsleadersequenzen, Introns oder Polyadenylierungsignalsequenzen umfassen. Sie können natürliche und synthetische Sequenzen sowie Sequenzen umfassen, die eine Kombination aus synthetischen und natürlichen Se- quenzen sind.

Der erfindungsgemäß verwendete Vektor kann auch geeignete Sequenzen zur Amplifikation der Expression umfassen.

Beispiele für Promotoren, die erfindungsgemäß verwendet werden können, sind Promotoren, von denen bekannt ist, dass sie die Expression in den eukaryoti- sehen Zellen kontrollieren. Beliebige Promotoren mit der Fähigkeit zur Expression in Fadenpilzen können verwendet werden. Beispiele sind ein Promotor, der stark durch Stärke oder Zellulose induziert wird, z. B. ein Promotor für Glucoa- mylase oder α-Amylase aus der Gattung Aspergillus oder Cellulase (Cellobio- hydrolase) aus der Gattung Trichoderma, ein Promotor für Enzyme im glykolyti- sehen Stoffwechselweg, wie beispielsweise Phosphoglyceratkinase (PGK) und Glycerinaldehyd-3-phosphat-dehydrogenase (GPD), etc. Bevorzugt ist der CeI- lobiohydrolase-l-, der Cellobiohydrolase-Il-, der Amylase-, der Glucoamylase-, der Xylanase- oder der Enolase-Promotor.

Zwei Hauptmethoden zur Kontrolle der Expression sind bekannt, d.h. überex- pression und Unterexpression. überexpression kann durch Insertion einer oder mehrerer Extra-Kopien des ausgewählten Gens erzielt werden. Für die Unterexpression gibt es zwei Hauptmethoden, die üblicherweise auf dem Fachgebiet als „Antisense Downregulation" und „Sense Downregulation" bezeichnet werden. Im Allgemeinen werden diese Verfahren als „Gene Silencing" bezeichnet.

Beide dieser Methoden führen zu einer Hemmung der Expression des Targetgens.

Zusätzlich zur Verwendung eines speziellen Promotors können andere Typen von Elementen die Expression von Transgenen beeinflussen. Insbesondere wurde gezeigt, dass Introns das Potenzial zur Verstärkung der Transgenexpression besitzen.

Die Expressionskassette kann noch weitere Elemente umfassen, beispielsweise solche, die durch endogene oder exogene Elemente wie Zinkfinger-Proteine, einschließlich natürlich vorkommender Zinkfinger-Proteine oder chimärer Zink- finger-Proteine, reguliert werden können.

Die erfindungsgemäß verwendete Expressionskassette kann ferner Enhancer- Elemente oder stromaufwärtige Promotor-Elemente enthalten.

Vektoren zur erfindungsgemäßen Verwendung können so konstruiert werden, dass sie ein Enhancer-Element enthalten. Die erfindungsgemäßen Konstrukte umfassen somit das Gen von Interesse zusammen mit einer 3'-DNA-Sequenz, die als Signal wirkt, um die Transkription zu terminieren und die Polyadenylie- rung der so erhaltenen mRNA zu erlauben. Es können beliebige Signalsequenzen verwendet werden, die die Sekretion aus dem gewählten Wirtsorganismus ermöglichen. .Bevorzugte Signalsequenz ist die Phytase-Signalsequenz aus Aspergillus niger oder daraus abgeleitete Signalsequenzen für die Sekretion aus filamentösen Pilzen.

Es kann auch eine spezielle Leadersequenz verwendet werden, da die DNA- Sequenz zwischen der Transkriptionsstartstelle und dem Start der codierenden Sequenz, d.h. der nicht-translatierten Leadersequenz die Genexpression beein- flussen kann. Bevorzugte Leadersequenzen umfassen Sequenzen, die die optimale Expression des angehefteten Gens steuern, d.h sie umfassen eine bevorzugte Consensus-Leader-Sequenz, die die mRNA-Stabilität erhöht oder er-

hält und eine ungeeignete Translationsinitiation verhindert. Die Wahl solcher Sequenzen ist einem Fachmann auf dem Gebiet gut bekannt.

Um die Möglichkeit, die Transformanten zu identifizieren, zu verbessern, kann ein selektierbares oder screenbares Markergen in die Expressionskassette auf- genommen werden. Derartige Markergene sind einem Fachmann auf dem Gebiet gut bekannt.

Die Expressionskassette oder ein Vektorkonstrukt, das die Expressionskassette enthält, wird in eine Wirtszelle eingeführt. Eine Vielzahl von Techniken sind verfügbar und einem Fachmann auf dem Gebiet zur Einschleusung von Konstruk- ten in eine Wirtszelle gut bekannt. Die Transformation mikrobieller Zellen kann unter Verwendung von Polyethylenglykol, Calciumchlorid, viraler Infektion, DEAE-Dextran, Phageninfektionen, Elektroporation und anderen auf dem Fachgebiet bekannten Methoden durchgeführt werden. Die Transformation von Pilzen kann nach Penttilä et al., Gene 61 :155-164, 1987 durchgeführt werden. Die Einschleusung eines rekombinanten Vektors in Hefen kann nach an sich bekannten Verfahren einschließlich Elektroporation, Verwendung von Sphero- plasten, Lithiumacetat und dergleichen durchgeführt werden.

Sobald die erfindungsgemäße Expressionskassette bzw. DNA-Sequenz erhalten ist, kann sie in Vektoren nach an sich bekannten Verfahren eingefügt wer- den, um das codierte Polypeptid in geeigneten Wirtssystemen zu überexprimie- ren. Jedoch können auch DNA-Sequenzen als solche verwendet werden, um geeignete Wirtssysteme der Erfindung zu transformieren, um eine überexpression des codierten Polypeptids zu erzielen.

Sobald eine erfindungsgemäße DNA-Sequenz in einer geeigneten Wirtszelle in einem geeigneten Medium exprimiert wurde, kann die codierte Phytase entweder aus dem Medium, falls die Phytase in das Medium sezerniert wird, oder aus dem Wirtsorganismus, falls die Phytase intrazellulär z. B. im periplasmatischen Raum vorhanden ist, nach an sich bekannten Verfahren aufkonzentriert und/oder isoliert werden. Bekannte Verfahren der Abtrennung der unlöslichen

Bestandteile des Kulturmediums und der Biomasse gefolgt von Verfahren zur Aufkonzentrierung der Phytase können zur Herstellung von konzentrierten Phy- taselösungen oder als Vorbereitung zur Trocknung der Phytase angewendet werden. Beispielsweise können Filtrationsverfahren oder Zentrifugationsverfah- ren zur Abtrennung der unlöslichen Bestandteile verwendet werden gefolgt von Ultrafiltrationsverfahren zur Aufkonzentration, oder es werden Cross-flow- Filtrationsverfahren angewendet. Die Trocknung kann durch Gefrier- und Sprühtrocknen, Granulationsverfahren, Extrudierung oder andere Verfahren erfolgen. Bekannte Verfahren der Proteinreinigung können verwendet werden, um die erfindungsgemäßen Phytasen zu isolieren. Beispielsweise können verschiedene chromatographische oder gelchromatographische Verfahren einzeln oder in Kombination verwendet werden. In Abhängigkeit von der verwendeten Wirtszelle bei einem rekombinanten Produktionsverfahren kann das erfindungsgemäße Enzym kovalent durch Glykosylierung modifiziert sein oder nicht. In eukaryotischen Zellen dient die Glykosylierung der sezemierten Proteine dazu, die Proteinfaltung, die Konformationsstabilität, die thermische Stabilität und die Resistenz gegenüber Proteolyse zu modulieren. Im Hinblick auf eine spezifische Anwendung der Phytase kann eine glykosylierte Variante des Enzyms gegenüber einer nicht-glykosilierten Variante bevorzugt sein. Beispielsweise dient die Verwendung einer glykosylierten Phytase in Tierfutter zum Schutz des Enzyms vor thermischer Denaturierung während der Futterpelletisierung und vor proteolytischer Inaktivierung bei der Passage durch den Magen des Tieres, wodurch die Verteilung des aktiven Enzyms im Darmtrakt und an die Wirkstelle gefördert wird. Für Anwendungen in der Nahrungsmittelverarbeitung, bei der die Enzymaktivität nur während der Verarbeitung und nicht im Endprodukt erwünscht ist, kann eine thermolabile, d.h. nicht-glykosylierte, und gegenüber pro- tolytischem Abbau empfindlichere Phytase bevorzugt sein.

Die Erfindung betrifft auch Phytasezusammensetzungen, die das erfindungsgemäße Polypeptid enthalten. Im Allgemeinen sind Phytasezusammensetzun- gen flüssig oder trocken. Flüssige Zusammensetzungen enthalten das Phyta- seenzym bevorzugt in einer gereinigten oder angereicherten Form. Jedoch

können auch Hilfsstoffe wie beispielsweise ein Stabilisator wie Glycerin, Sorbit oder Monopropylenglykol, Additive wie Salze, Zucker, Konservierungsstoffe, Mittel zur Einstellung des pH-Werts, Proteine und Phytat oder Salze von Myoi- nositolphosphaten (ein Phytasesubstrat) zugesetzt werden. Typische Flüssig- Zusammensetzungen sind wässrige oder ölige Aufschlämmungen. Die Flüssigzusammensetzungen können einem Nahrungsmittel oder Futtermittel vor oder nach einer möglichen Pelletierung bzw. Verarbeitungsschritt zugesetzt werden.

Trockenzusammensetzungen können gefriergetrocknete, sprühgetrocknete, granulierte oder extrudierte Zusammensetzungen sein, die ausschließlich das Enzym enthalten können. Vor dem Trocknen können aber auch Stoffe zugesetzt werden um den pH-Wert zu regulieren, sowie weitere Additive und Füllstoffe wie Maltodextrine, Lactose, Magermilchpulver, Salze zweiwertiger Kationen wie die von Mg, Ca, Zn, etc.. Trockenzusammensetzungen können Granulate sein, die leicht beispielsweise mit Nahrungsmitteln oder Futterkomponenten gemischt werden können oder bevorzugter eine Komponente eines Prämix bilden. Die Teilchengröße des Enzymgranulats ist bevorzugt mit der der anderen Komponenten des Gemisches kompatibel. Dies ermöglicht sichere und zweckdienliche Mittel, um Enzyme beispielsweise in prozessierte Nahrungsmittel, Prämixe oder Tierfutter einzuarbeiten.

Beispielsweise kann eine stabile Formulierung des erfindungsgemäßen Phyta- seenzyms dadurch hergestellt werden, dass ein Gemisch aus einer flüssigen Enzymlösung auf ein Füllmittel wie Maltodextrin gesprüht wird und dann das Gemisch getrocknet wird, oder der flüssigen Enzymlösung wird vor dem Trocknen 20%-60% Magermilchpulver (w/w bezogen auf Gesamtprotein der Enzym- lösung) und/oder 1%-5% Calciumpropionat (w/w bezogen auf Gesamtprotein der Enzymlösung) zugesetzt und der pH-Wert auf einen definierten Wert eingestellt, insbesondere auf pH 5,2 ± 0,5. Die Verringerung der Feuchtigkeit und die Bindungswechselwirkungen der Phytase mit dem Füllmittel schützen das Enzym zusätzlich zu seiner in seiner Struktur definierten Stabilität vor Umweltein- flüssen wie Temperaturextrema, die während der Herstellung des Futtermittels

auftreten können. Trockene und flüssige Formulierungen können weiter stabilisiert werden, wenn die Aktivität potenzieller proteolytischer Enzyme verringert wird, die als Nebenprodukte in dem Flüssigfermentationsgemisch vorhanden sein können, das zur Herstellung des erfindungsgemäßen Enzyms verwendet wird. Das so erhaltene Trockenenzym-Gemisch kann als Futterergänzungsmittel zur Verwendung in der Geflügel- und Schweinezucht verwendet werden. Ferner führt eine Verringerung der Phosphat-Supplementation zu einer Abnahme der Phosphat-Verunreinigung, die ihrerseits signifikant die Umweltbelastung durch intensive Tierzucht verringert.

Sobald ein Trockenenzym-Präparat erhalten ist, kann daraus in weiteren Schritten ein Agglomerations-Granulat hergestellt werden. Hierfür wird ein Mischer mit hohen Scherkräften verwendet, wodurch Füllmaterial und das Enzym co- agglomerieren und ein Granulat gebildet wird. Absorptionsgranulate werden hergestellt, indem Kerne aus einem Trägermaterial durch das erfindungsgemä- ße Enzym beschichtet werden. Typische Füllmaterialien sind Salze wie Dinatri- umsulfat. Andere Füllmaterialien umfassen Kaolin, Talk, Magnesiumaluminium- silicat und Cellulosefasern. Gegebenenfalls werden Bindemittel wie Dextrine auch in das Agglomerationsgranulat aufgenommen.

Typische Trägermaterialien umfassen Stärke, z. B. in Form von Cassava, Kar- toffel und Getreide, insbesondere Mais, Reis und Weizen, oder proteinhaltige Erzeugnisse wie z. B. Sojaprotein. Salze können auch verwendet werden. Das Granulat wird gegebenenfalls mit einem Beschichtungsgemisch umhüllt. Ein solches Gemisch umfasst Beschichtungsmittel, bevorzugt hydrophobe Be- schichtungsmittel, dehydriertes Palmöl und Talk und gegebenenfalls andere Additive wie Calciumcarbonat oder Kaolin um die Bioverfügbarkeit an der bestimmungsgemäßen Wirkstätte zu verbessern.

Zusätzlich können die Mischungen mit Phytase andere Stoffe wie farbgebende Mittel, Aromaverbindungen, Stabilisatoren, Vitamine, Mineralien, andere Nah-

rungsmittel- oder Futter-Enzyme und dergleichen enthalten. Dies trifft insbesondere für die sogenannten Prämixe zu.

Ein Nahrungsmittel- oder Futtermitteladditiv ist eine im Wesentlichen reine Verbindung oder eine Zusammensetzung aus mehreren Verbindungen, die dazu bestimmt oder geeignet ist, Nahrungsmitteln oder Futtermitteln zugesetzt zu werden. Insbesondere ist es eine Substanz, die gemäß ihrem Verwendungszweck eine Komponente eines Nahrungsmittels oder Futtermittels wird oder Eigenschaften eines Nahrungsmittel- oder Futtermittelprodukts beeinflusst. So soll ein Phytaseadditiv eine Phytase bezeichnen, die kein natürlicher Bestand- teil der hauptsächlich für Nahrungsmittel und Futtermittel verwendeten Substanzen ist oder in ihrer natürlichen Konzentration darin nicht vorhanden ist. Beispielsweise wird die Phytase dem Futtermittel separat von den Futtermittelsubstanzen allein oder in Kombination mit anderen Futtermitteladditiven zugesetzt. Ein typischer Prämix umfasst üblicherweise eine oder mehrere Verbin- düngen wie Vitamine, Mineralien oder Futter-verstärkende Enzyme und geeignete Träger und/oder Exzipienzien.

Ein gebrauchsfertiges Phytaseadditiv ist ein Additiv, das nicht in situ in Tierfutter oder in verarbeiteten Nahrungsmitteln produziert wird. Ein gebrauchsfertiges Phytaseadditiv kann Menschen oder Tieren direkt oder bevorzugt direkt nach dem Mischen mit anderen Bestandteilen des Futters oder der Nahrungsmittel verabreicht werden. Beispielsweise wird ein Futteradditiv gemäß diesem Aspekt der vorliegenden Erfindung mit anderen Futtermitteln und -additiven unter Erhalt eines Prämixes oder Ergänzungsfutters vereinigt. Solche anderen Futtermittelbestandteile umfassen eine oder mehrere andere (bevorzugt thermostabile) Enzymsupplemente, andere Futteradditive, mineralische Futtermittel und Aminosäuren. Die so erhaltenen (kombinierten) Futteradditive können mehrere verschiedene Verbindungstypen umfassen und können dann in ihrer geeigneten Menge mit den Futtermitteln wie Getreide- und Proteinträgern unter Bildung eines zusammengesetzten Tierfutters vermischt werden. Die Verarbeitung die- ser Komponenten zu einem Tierfutter kann nach dem Mischen mit an sich be-

kannten Verarbeitungsvorrichtungen wie einer Doppelpelletiermaschine, eines Dampfpelletierers, eines Expanders oder eines Extruders durchgeführt werden.

Auf ähnliche Weise kann ein Nahrungsmitteladditiv gemäß dieser Ausführungsform der vorliegenden Erfindung mit anderen Nahrungsmittelkomponenten ver- einigt werden, wodurch verarbeitete Nahrungsmittelprodukte erzeugt werden. Solche anderen Nahrungsmittelkomponenten umfassen ein oder mehrere Enzymsupplemente, Vitamine, Mineralien und Spurenelemente. Das so erhaltene kombinierte Nahrungsergänzungsmittel kann dann in einer geeigneten Menge mit anderen Nahrungsmittel-Komponenten wie Getreide und Pflanzenproteine vermischt werden, um ein verarbeitetes Nahrungsmittel zu ergeben. Die Verarbeitung dieser Komponenten zu einem verarbeiteten Nahrungsmittel kann unter Verwendung an sich bekannter Verarbeitungsvorrichtungen durchgeführt werden.

In einer bevorzugten Ausführungsform umfassen die erfindungsgemäßen Phy- tasezusammensetzungen zusätzlich eine wirksame Menge eines oder mehrerer Enzyme für Nahrungs- oder Futtermittel, bevorzugt ausgewählt aus alpha- Galactosidasen, beta-Galactosidasen, Laccasen, anderen Phytasen, Phosphatasen, Endoglucanasen, insbesondere endo-beta-1 ,4-Glucanasen, endo- beta-1 ,3(4)-Glucanasen, endo-1 ,2-beta-Glucanasen und endo-1 ,3-alpha-Glu- canasen, Cellulasen, Xylosidasen, Galactanasen, insbesondere Arabinogalac- tan-endo-1 ,4-beta-Galactosidasen und Arabinogalactan-endo-1 ,3-beta-Galacto- sidasen, Pectin-abbauenden Enzymen, insbesondere Pectinasen, Pectineste- rasen, Pectinlyasen, Polygalacturonasen, Arabananasen, Rhamnogalacturona- sen, Rhamnogalacturonanacetylesterasen, Rhamnogalacturonan-alpha- Rhamnosidasen, Pectatlyasen und alpha-Galacturonidasen, Mannanasen, be- ta-Mannosidasen, Mannanacetylesterasen, Xylanacetylesterasen, Proteasen, Xylanasen, Arabinoxylanasen und lipolytischen Enzymen wie Lipasen, Phospholipasen und Cutinasen.

Das erfindungsgemäße Tierfutteradditiv wird dem Tier vor oder gleichzeitig mit dem Futter verabreicht. Bevorzugt wird das erfindungsgemäße Tierfutteradditiv dem Tier gleichzeitig mit dem Futter verabreicht.

Eine effektive Menge an Phytase in Nahrungsmitteln oder Futtermitteln beträgt 5 etwa 10-20.000 PPU/kg, bevorzugt etwa 10-15.000 PPU/kg, bevorzugter etwa 10-10.000 PPU/kg, noch bevorzugter etwa 50-5.000 PPU/kg, insbesondere 50- 2.000 PPU/kg Futter oder Nahrungsmittel.

Die Erfindung betrifft auch die Verwendung von Phytase zur Verarbeitung und Herstellung von Nahrungsmitteln und Futtermitteln. Getreide und Mehle für o Nahrungsmittel können enzymatisch mit Phytase behandelt werden, um den Phytingehalt der Rohstoffe zu verringern. Verringerte Phytingehalte verbessern die Nahrungsmittelqualität, indem die Verfügbarkeit essenzieller Mineralien wie Eisen, Calcium und Zink erhöht wird. Zusätzlich zur Erhöhung der Qualität der Nahrungsmittel kann die Verwendung von Phytase während der Verarbeitung 5 die Gesamteffizienz der Nahrungsmittelherstellung verbessern. Beispielsweise kann die Zugabe von Phytase zu weißen Sojabohnenflocken während der Herstellung eines Sojaproteinisolats signifikant die Ausbeute und Qualität des extrahierbaren Proteins erhöhen. Dabei ist die Phytase nur während der Herstellung und Verarbeitung aktiv und ist in dem Endprodukt nicht mehr aktiv. o Dieser Aspekt ist insbesondere bei der Teigherstellung und beim Backen und der Produktion anderer verzehrfertiger Produkte auf Getreidebasis von Bedeutung. Auf ähnliche Weise können Tierfutterkomponenten wie getoastetes Sojabohnenmehl oder Canolamehl mit Phytase vor dem eigentlichen Herstellungs- prozess vorbehandelt werden. Die Entfernung von anti-nutritiven Faktoren in 5 Tierfutterkomponenten vor der Herstellung führt zu einer physiologisch höheren Qualität und zu wertvolleren Tierfutterinhaltsstoffen. Bei diesen Verarbeitungsverfahren ist die Phytase während der Herstellung aktiv und ist im Verdauungstrakt des Tiers nach Aufnahme des behandelten Futters in der Regel nicht mehr aktiv.

Zusätzlich zur Verwendung von Phytase als Futterverarbeitungshilfsmittel betrifft die vorliegende Erfindung die Verwendung der erfindungsgemäßen Phytase als Verdauungshilfe. Phytase in Tablettenform kann zusammen mit der Nahrungsaufnahme eingenommen werden, um das aktive Enzym im Magen-Darm- Trakt zu verteilen.

Die erfindungsgemäße Phytase kann ebenso in vorteilhafter Weise bei monogastrischen wie polygastrischen Tieren, insbesondere bei jungen Kälbern zum Einsatz kommen. Futter für Fische und Schalentiere kann ebenfalls mit Phytase supplementiert werden, um die Ausnutzung des Futters zu verbessern und den Gehalt an ausgeschiedenem Phosphor bei intensiver Tierzucht zu verringern. Das erfindungsgemäße Futtermittel kann auch Tieren wie Geflügel, z. B. Masthühnern, Truthühnern, Gänsen, Enten sowie Schweinen, Pferden, Rindern, Schafen, Ziegen, Hunden und Katzen sowie Fischen und Schalentieren verabreicht werden. Es ist jedoch besonders bevorzugt, dass das erfindungsgemäße Futtermittel Schweinen oder Geflügel verabreicht wird.

Erfindungsgemäße Phytaseformulierungen können auch mit anderen Inhaltsstoffen kombiniert werden, wodurch neue und besonders vorteilhafte Futterzusammensetzungen entstehen. Da, wie vorstehend ausgeführt, die Verfügbarkeit von pflanzlichem Phosphat in Sojabohnenmehl und Getreide in Folge der Bin- düng an Phytinsäure niedrig ist, wird anorganisches Phosphat dem Futter zugesetzt, um eine adäquate Phosphorversorgung der Tiere zu gewährleisten. Jedoch enthalten diese Futtermittel zu viel Gesamtphosphat und führen dadurch zu einer Verschmutzung der Umwelt mit Phosphat. Speziell umfasst das erfindungsgemäße Tierfuttermittel die Kombination einer erfindungsgemäßen Phytase mit Tierfutterinhaltsstoffen, um ein Futtermittel zu ergeben, das wesentlich erniedrigte Gehalte an zugesetztem anorganischem Phosphor enthält. In einer bevorzugten Ausführungsform umfasst das erfindungsgemäße Futtermittel typische Futterinhaltsstoffe, Mikronährstoffe, Spurenelemente, Vitamine, etc. sowie eine effektive Menge an Phytase und anorganischem Phosphor, wo- bei die Mengen der Phytase und des Phosphors zwischen 50 und 20.000 Ein-

heiten Phytase/kg Futtermittel und weniger als 0,45% anorganischem Phosphor, bevorzugt zwischen Gehalten von 100-10.000 Einheiten Phytase/kg Futtermittel und weniger als 0,225% anorganischem Phosphor, bevorzugter Gehalte von 150-10.000 Einheiten Phytase/kg Futtermittel und weniger als 0,15% anorganischem Phosphor, noch bevorzugter Gehalte von 200-20.000 Einheiten Phytase/kg Futtermittel und keinen zusätzlichen Zusatz an anorganischem Phosphor, betragen.

Die Erfindung betrifft auch Verfahren zur Verbesserung der Gewichtszunahme und des Futterverwertungsvermögens (Feed Conversion Ratio, FCR) in der Tierernährung sowie die Verwendung der erfindungsgemäßen Phytasen in diesen Verfahren. Eine erfindungsgemäße Phytase erlaubt verbesserte Gewichtszunahmen und ein verbessertes Futterverwertungsvermögen, insbesondere im Zusammenhang mit Futter, das wenig anorganisches Phosphat enthält. Gemäß den erfindungsgemäßen Verfahren kann der Gehalt an anorganischem Phos- phat in Futter unter Gehalte von 0,45%, bevorzugt unter 0,225%, gesenkt werden. Bevorzugt wird kein anorganisches Phosphat zugesetzt. Durch eine erhöhte Phosphat-Verfügbarkeit in Folge des Zusatzes des erfindungsgemäßen Enzyms kann die Knochenmineralisation der Tiere signifikant verbessert werden, was insbesondere bei rasch wachsenden Tieren von großer Bedeutung ist.

Gemäß einer noch weiteren Ausführungsform betrifft die Erfindung die Verwendung des erfindungsgemäßen Enzyms beim Backen, wodurch Entwicklung, Elastizität und/oder Stabilität des Teigs und/oder das Volumen, die Krumenstruktur und/oder der Widerstand des Backguts gegenüber dem Altbackenwerden verbessert wird. Obwohl das erfindungsgemäße Enzympräparat zur Her- Stellung von Teig oder gebackenen Produkten aus beliebigen Typen von Mehl, z. B. auf der Basis von Roggen, Gerste, Hafer oder Mais verwendet werden kann, erwies sich das erfindungsgemäße Enzympräparat als besonders nützlich bei der Herstellung von Teigen oder Backprodukten aus Weizen oder aus einem wesentlichen Weizenanteil. Die Backprodukte, die mit einem erfindungs- gemäßen Enzympräparat hergestellt werden können, umfassen Brot, Brötchen,

Baguette und dergleichen. Zum Backen kann das erfindungsgemäße Enzympräparat mit einer weiteren Enzymaktivität wie z. B. Xylanase, Lipase, Amylase, Oxidase oder Laccase neben der Phytase verwendet werden oder kann in Kombinationen mit weiteren Enzymen wie Lipase, Amylase, Oxidase (z. B. GIu- coseoxidase, Peroxidase), verwendet werden.

Die beigefügten Figuren erläutern die Erfindung näher:

Fig. 1 : Plasmidkarte von pET-PhyM2

Fig. 2: Plasmidkarte von pAB490-PhyM2

Fig. 3: Plasmidkarte von pUC-PhyM3

Fig. 4: Plasmidkarte von pAB489-PhyM3

Fig. 5: Plasmidkarte von pUC-PhyM10

Fig. 6: Plasmidkarte von pAB600-PhyM10

Fig. 7: Plasmidkarte von pPhy2005

Fig. 8: Plasmidkarte von pAB-Phy2005

Fig. 9: Plasmidkarte von pPhy2006

Fig. 10: Plasmidkarte von pAB-Phy2006

Fig. 11 : Sequenzvergleich einzelner erfindungsgemäßer Mutanten und Varianten auf Basis der Wild-Typ Sequenz (Dassa). Die Mutationen bzw. Variationen sind hervorgehoben.

Die nachstehenden Beispiele erläutern die Erfindung näher.

Beispiele

Beispiel 1 - Bestimmung der Phytaseaktivität

Die Phytaseaktivität wurde in einem Assay-Gemisch aus 0,5% Phytinsäure (etwa 5 mM), 20O mM Natriumeitrat, pH 5,0, gemessen. Nach 15-minütiger Inku- bation bei 37°C wurde die Reaktion durch Zugabe eines gleichen Volumens 15% Trichloressigsäure gestoppt. Die freigesetzten Phosphationen wurden durch Mischen von 100 μl des Assay-Gemisches mit 900 μl H 2 O und 1 ml 0,6 M H2SO 4 , 2% Ascorbinsäure und 0,5% Ammoniummolybdat nach Inkubation bei 50 c C und einer Dauer von 20 min, bei 820 nm quantitativ bestimmt. Kalium- phosphat-Standardlösungen wurden als Referenz verwendet.

Beispiel 2 - Konstruktion der Plasmide pET-PhyM2 und pAB490-PhvM2 (Genotyp PhvM2)

Die Konstruktion des Plasmids pAB490-PhyM2 erfolgte durch folgende Schritte: 1. Konstruktion von pET-PhyM2 Das Plasmid pET-PhyM2 enthält die modifizierte E. coli Phytase Sequenz (Dassa et al. 1990, Accession Nr. M58740 mit V200Y) unter Verwendung des Codon-Gebrauchs von T. reesei (http://www.kazusa.or.jp/codon) mit den zusätzlichen änderungen der Aminosäuren N139R und D142E.

Die DNA Sequenz, die mit dem CAG (Gln)-Codon in Position 1 ein offenes Le- seraster von 1230 bp umfasst und ein Enzym mit 410 Aminosäuren codiert, wurde unter Verwendung des Codon-Gebrauchs von T. reesei (http://www.kazusa.or.jp/codon) in das Plasmid pET26b(+) (Novagen, Deutschland, modifiziert durch Brain, Deutschland) eingefügt. Zur Realisierung der Mu- tagenesen wurde eine PCR-basierte Oligonucleotid-gerichtete Methode ange- wandt. Ausgehend von dem Plasmid, das das Gen kodierend für die Wϊldtyp- Dassa-Aminosäuresequenz enthält, wurden für jedes auszutauschende Triplet zwei komplementäre Primer mit den jeweiligen Mutationen synthetisiert, wobei die Mutation jeweils in der Mitte der Primer lokalisiert ist. Mithilfe der beiden

Primer wurde dann das gesamte Plasmid amplifiziert. Das erhaltene Plasmid mit den Mutationen für den Genotyp M2 hat die Bezeichnung pET-PhyM2.

Zur Konstruktion wurden die folgenden Primer benutzt.

a) Für die Mutationen an Position 139:

ccaactggataacgcccgggtgaccgacgccat (SEQ ID NO: 1)

atggcgtcggtcacccgggcgttatccagttgg (SEQ ID NO: 2)

b) Für die anschließend eingebaute zusätzliche Mutationen an Position 142:

gcccgggtgaccgaggccatcctcagc ( SEQ I D NO : 3 )

gctgaggatggcctcggtcacccgggc ( SEQ I D NO : 4 )

Das Plasmid ist in Fig. 1 dargestellt und wurde unter der Hinterlegungsnummer DSM 18715 am 18.10.2006 hinterlegt.

2. Konstruktion von pAB490-PhvM2

Zur Konstruktion des Plasmids pAB490-PhyM2 wurde das für E. co//-Phytase codierende Gen PhyM2 aus dem Plasmid pET-PhyM2 mittels PCR amplifiziert. Das PCR-Produkt wurde mit den Restriktionsenzymen Spei und Pacl geschnitten und in die Spei- und Pacl-Schnittstellen nach dem T. reesei cbhll- Genfragment in dem Plasmid pAB490 inseriert. Dadurch entstand ein offenes Leseraster, das die Fusion CBHII-Kexll-PhyM2 codiert.

Das entstandene Plasmid hat die Bezeichnung pAB490-PhyM2 (Fig. 2) und wurde durch Restriktionsendonucleasen kartiert. Die Phytasesequenz wurde durch Sequenzierung bestätigt.

Das Plasmid pAB490 basiert auf pUC18 und enthält das cbhll Genfragment (Nucleotide 1-307 entsprechen den Aminosäuren M1 bis S86, Teeri et al, 1987, Gene 51 : 43-52, Accession Nr. 16190) unter der Kontrolle des cbhl-Promotors und cbhl-Terminators aus dem Plasmid pALK487 (WO 94/28117). Ein glatten- diges 4,78 kb langen EcoRI/Spel-Fragment des Plasmids pALK424 (WO 93/24621), das den amdS Marker und die 3'-flankierenden cbhl-Sequenzen enthält, wurde in die Stul Schnittsstelle am 3 ' -Ende des cbhl Terminator eingebaut. Darüber hinaus wurden weitere Schnittstellen (Spei und Pacl) downstream des cbhll-Genfragments eingefügt. Diese Schnittstellen wurden für die direkte Klonierung der Phytasevarianten verwendet.

Die aus dem Plasmid pAB490-PhyM2 isolierte Expressionskassette enthält das folgende genetische Material:

cbhl (Cellobiohydrolase I) Promotor: Das 2,2 kb EcoRI/Sacll-Fragment, das den cbhl-Promotor enthält, stammt von Trichoderma reesei QM6a. Der Promotor- Bereich funktioniert auch als homologe DNA (zusammen mit dem cbhl 3'- Fragment; siehe nachstehend), um die Integration der transformierenden DNA in den cbhl Lokus zu steuern.

cbhll-Genfragment: Das 307-bp cbhll Genfragment mit seiner Signalsequenz steht unmittelbar unter der Kontrolle des cbhl-Promotors.

Die E. co//-Phytase Sequenz, die die Mutation der Aminosäuren N139R und D142E und V200Y enthält, ist mittels einer Kexll-Schnittstelle am 3'-Ende des cbhll-Genfragments fusioniert. Die Kex-Sequenz enthält folgende Aminosäuren: RTLVKR.

cbhl Terminator: Das 0,75 kb lange BamHI/Stul-Fragment, das den cbhl- Terminator enthält, wurde im Anschluss an die E. co//-Phytase hinzugefügt, um die Termination der Transkription zu gewährleisten.

amdS-Gen: Das Gen inkl. seines Promotors und seines Terminators wurde aus Aspergillus nidulans VH1-TRSX6 isoliert und codiert für Acetamidase (Hynes et

al., 1983, Mol. Cell. Biol. 3: 1430-1439; Kelly and Hynes, 1985, EMBO J. 4:475- 479). Acetamidase erlaubt dem Stamm unter Verwendung von Acetamid als alleiniger Stickstoffquelle zu wachsen und dieses Charakteristikum wurde zur Selektion der Transformanten verwendet.

cbhl 3' Fragment: Das Fragment (1 ,7 kb, BamHI/EcoRI, beginnend 1 ,4 kb nach dem Stopcodon des Gens) wurde aus T. reesei ALKO2466 isoliert. Der Stamm ALKO2466 stammt von dem Stamm ALKO233 (Harkki et al., 1991 , Enzyme Microb. Technol. 13: 227-233) ab. Das 3'-Fragment wird zusammen mit dem Promotorbereich verwendet, um die Phytase-Expressionskassette in den cbhl- Lokus durch homologe Rekombination zielgerecht zu integrieren.

Die Sequenz des Plasmids pAB490-PhyM2 wurde durch Kartierung mittels Restriktionsenzymen und Sequenzierung bestätigt.

Beispiel 3 - Konstruktion der Plasmide pET-PhvM7 und pAB490-PhvM7 (Genotyp PhvM7) Das Plasmid pET-PhyM7 enthält die modifizierte E. co//-Phytase (Dassa et al. 1990, Accession Nr. M58740 mit V200Y) Sequenz unter Verwendung des Co- don-Gebrauchs von T. reesei (http://www.kazusa.or.jp/codon) mit der zusätzlichen Mutation K74D. Die Konstruktion sowie die Klonierung des Plasmids pET- PhyM7 erfolgte analog zu der in Beispiel 2 beschriebenen Herstellung des Plasmids pET-PhyM2. Die zur Einfügung der Mutationen an Aminosäureposition 74 benutzten Primer sind:

cggactcctggctgacaagggatgcccgc ( SEQ I D NO : 5 ) gcgggcatcccttgtcagccaggagtccg ( SEQ I D NO : 6 )

Das Plasmid pET-PhyM7_ist unter der Hinterlegungsnummer DSM 18716 am 18.10.2006 hinterlegt worden.

Die Konstruktion sowie die Klonierung des Plasmids pAB490-PhyM7 erfolgte analog zu der in Beispiel 2 beschriebenen Herstellung des Plasmids pAB490- PhyM2. Die Sequenz des Plasmids pAB490-PhyM7 wurde durch Sequenzie-

rung bestätigt. Die aus dem Plasmid pAB490-PhyM7 isolierte Expressionskassette enthält daher mit Ausnahme der neuen spezifischen Phytasesequenz des Genotyps PhyM7 die gleichen Elemente wie in Beispiel 2 beschrieben.

Beispiel 4 - Konstruktion der Plasmide pUC-PhvM3 und pAB489-PhvM3 (Genotyp PhvM3)

Die Phytasevariante PhyM3 enthält die E. coli Phytase (Dassa et al. 1990, Accession Nr. M58740) Sequenz unter Verwendung des Codon-Gebrauchs von T. reesei (http://www.kazusa.or.jp/codon) mit der Mutation V200P. Die DNA- Sequenz mit dem CAG (Gln)-Codon in Position 1 umfasst ein offenes Leseras- ter von 1230 bp und codiert ein Enzym mit 410 Aminosäuren. Das 18 Aminosäuren lange Signalpeptid der Phytase von A. niger wurde verwendet, um die Phytasemutante von E. coli aus Trichoderma reesei zu sezernieren.

Ausgehend von dem Plasmid, das das Gen kodierend für die Wϊldtyp-Dassa- Aminosäuresequenz enthält, wurde die Mutation V200P mittels der PCR Me- thode analog dem Prinzip von Tomic et al. (1990, Nucleic Acids Research, 18 (6), 1656) und Vallette et al. (1989, Nucleic Acids Research, 17 (2), 723-733) durchgeführt. Das PCR Produkt wurde mit Avrll und Pacl geschnitten und in die Spei und Pacl Spaltstellen nach dem T. reesei cbh1 Promotor in dem Plasmid pAB489 inseriert. In dem neu entstandenen Plasmid pAB489-PhyM3 steht das Gen der E. coli Phytasevariante PhyM3 mit der modifizierten A. niger Phytase Signalsequenz -MGVSAI LLPLYLLSGVTS- (Mullaney et al., Appl Microbiol Bio- technol, 1991 , 35(5) , 611-614, Accession Nr. M94550) direkt unter der Kontrolle des cbh1 -Promotors. Das 18 Aminosäuren lange Signalpeptid der Phytase von A. niger wurde verwendet, um die Phytasemutante von E. coli aus Tricho- derma reesei zu sezernieren. Die 16 Basenpaare (CCGCGGACTGCGCATC atg) stromaufwärts des Startcodons, die zu dem T. reese/-Promotor (Shoema- ker et al. 1983, Bio/Technology 1 , 691-696) gehören, wurden nach dem Einbauen des Avrll-Pacl Phytase Fragments in die Spei und Pacl Spaltstellen in dem Plasmid pAB489 zu CCGCGGACTAGGCATC atg geändert.

Die Konstruktion pAB489-PhyM3 (Fig. 4) wurde durch Kartierung und Sequenzierung bestätigt.

Die Konstruktion des Plasmids pAB489 erfolgte durch folgende Schritte:

Aus dem Plasmid pALK487 (WO94/28117) wurde durch Einfügen weiterer Schnittstellen (Spei und Päd, CCGCGGACTAGTCCTTAATTAACCGCGG) in die Sacll-Stelle zwischen dem cbhl-Promotor und cbhl-Terminator das Plasmid pAB487 hergestellt. Die Spel-Pacl-Schnittstellen werden für die direkte Klonie- rung der Phytasevarianten verwendet. Ein glattendiges 4,78 kb langes Eco-

Rl/Spel-Fragment des Plasmids pALK424 (WO 93/24621), das den amdS- Marker und die 3'-flankierenden cbhl-Sequenzen enthielt, wurde in die Stul-

Spaltstelle von pAB487 inseriert, wodurch der Vektor pAB489 erhalten wurde.

Die aus dem pAB489-PhyM3 isolierte Expressionskassette enthält das folgende genetische Material:

Cbhl (Cellobiohydrolase I)-Promotor: Das 2,2 kb EcoRI/Sacll-Fragment, das den cbhl-Promotor enthält, stammt von Trichoderma reesei QM6a. Der Promotor-Bereich funktioniert auch als homologe DNA (zusammen mit dem cbhl-3'- Fragment; siehe nachstehend), um die Integration der transformierenden DNA in den cbhl-Lokus zu steuern.

Signalsequenz: Das modifizierte Signalpeptid der A. niger-Phytase wurde ver- wendet, um die E. co//-Phytase aus Trichoderma reesei zu sezernieren.

Die E. co//-Phytase mit der Mutation V200P Sequenz inkl. der A. π/ger-Phytase- Signalsequenz wurde zwischen den cbhl Promotor und den cbhl Terminator inseriert.

cbhl-Terminator: Das 0,75 kb lange BamHI/Stul-Fragment, das den cbhl- Terminator enthält, wurde im Anschluss an die E. co//-Phytase hinzugefügt, um die Termination der Transkription zu gewährleisten.

amdS-Gen: Das Gen inkl. seines Promotors und seines Terminators wurde aus Aspergillus nidulans VH1-TRSX6 isoliert und codiert für Acetamidase (Hynes et al., 1983, Mol. Cell. Biol. 3: 1430-1439; Kelly and Hynes, 1985, EMBO J. 4:475- 479). Acetamidase erlaubt dem Stamm unter Verwendung von Acetamid als alleiniger Stickstoffquelle zu wachsen und dieses Charakteristikum wurde zur Selektion der Transformanten verwendet.

cbhl 3' Fragment: Das Fragment (1 ,7 kb, BamHI/EcoRI, beginnend 1 ,4 kb nach dem Stopcodon des Gens) wurde aus T. reesei ALKO2466 isoliert. Der Stamm ALKO2466 stammt von dem Stamm ALKO233 (Harkki et al., 1991 , Enzyme Microb. Technol. 13: 227-233) ab. Das 3'-Fragment wurde zusammen mit dem Promotorbereich verwendet, um die Phytase-Expressionskassette in den cbhl- Lokus durch homologe Rekombination zielgerecht zu integrieren.

Das Phytasevariante PhyM3 Gen wurde in das Plasmid pAB2004 kloniert. Das erhaltene Plasmid hat die Bezeichnung pUC-PhyM3 (Fig. 3) und als DSM 18717 gemäß der vorstehenden Bedingungen hinterlegt.

Das Plasmid pAB2004 basiert auf dem Plasmid pUC18 und wurde durch Einfügen weitere Schnittstellen in die Hindlll-EcoRI Sites hergestellt.

Beispiel 5 - Konstruktion der Plasmide pUC-PhvM9 und pAB489-PhvM9 (Genotyp PhvM9)

Die Phytasevariante PhyM9 enthält die E. coli Phytase (Dassa et al. 1990, Accession Nr. M58740) Sequenz als synthetisches Gen unter Verwendung des Codon-Gebrauchs von T. reesei (http://www.kazusa.or.jp/codon) mit den Mutationen L145I und L198I. Die DNA-Sequenz mit dem CAG (Gln)-Codon in Position 1 umfasst ein offenes Leseraster von 1230 bp und codiert ein Enzym mit 410 Aminosäuren.

In dem Plasmid pAB489-PhyM9 steht das Gen kodierend für die E. coli Phytasevariante PhyM9 mit der A. niger Phytase Signalsequenz (MGVSAVLLPLYLLSGVTS) Mullaney et al., Appl Microbiol Biotechnol, 1991 ,

35(5) , 611-614, Accession Nr. M94550) direkt unter der Kontrolle des cbh1- Promotors. Das 18 Aminosäuren lange Signalpeptid der Phytase von A. niger wurde verwendet, um die Phytasemutante von E. coli aus Trichoderma reesei zu sezernieren.

Die Konstruktion von pAB489-PhyM9 und pUC-PhyM9 erfolgte analog zu Plasmid pAB489-PhyM3 und pUC-PhyM3 in Beispiel 4 und enthält damit mit Ausnahme der A. niger Signalsequenz und der spezifischen E. coli Phytasese- quenz die gleichen genetischen Elemente.

Das Plasmid pUC-PhyM9 ist unter der Hinterlegungsnummer DSM 18718 am 18.10.2006 hinterlegt worden.

Beispiel 6 - Konstruktion der Plasmide pl)C-PhvM10 und pABβOO- PhvMIO, die für multiple Mutanten codieren (Genotyp PhyMIO)

Das Plasmid pAB600-PhyM10 enthält die E. coli Phytase Sequenz mit den An- derungen der Aminosäuren K74D, N139R, D142E und V200P. Aus den Plasmiden pAB490-PhyM2, pAB490-PhyM7 und pAB489-PhyM3 wurde das Gen kodierend für die Phytasevariante PhyMIO mittels der PCR Methode analog dem Prinzip von Tomic et al. (1990, Nucleic Acids Research, 18 (6), 1656) und Vallette et al. (1989, Nucleic Acids Research, 17 (2), 723-733) hergestellt. Das PCR Produkt wurde mit Spei und Pacl geschnitten und in die Spei- und Pacl- Spaltstellen in dem Plasmid pAB600 inseriert.

Das entstandene Plasmid pAB600-PhyM10 (Fig. 6) wurde durch Kartierung und Sequenzierung bestätigt.

In dem Plasmid pAB600-PhyM10 wurde die E. coli Phytase Sequenz mittels einer Kexll-Schnittstelle am 3 ' Ende des CBHII-Genfragments fusioniert. Die Kex Sequenz enthält folgende Aminosäuren RTLVKR.

Die Konstruktion des Plasmids pAB600 erfolgte durch folgende Schritte:

Das Plasmid pAB1280 basiert auf pUC18 und enthält das cbhll-Genfragment (Nuc- leotide 1-307 entspricht Aminosäure M1 bis S86, Teeri et al, 1987, Gene 51 : 43- 52, Accession Nr. 16190) unter der Kontrolle des cbhl-Promotor und cbhl- Terminator aus dem Plasmid pALK487 (WO 94/28117). Darüber hinaus wurden weitere Schnittstellen (Spei und Pacl) downstream des cbhll-Genfragments eingefügt. Diese Schnittstellen werden für die direkte Klonierung der Phytasevariante verwendet.

Aus dem Plasmid p3SR2 (Hynes et al., 1983, Mol. Cell. Biol. 3, 1430-1439; Kelly and Hynes, 1985, EMBO J. 4, 475-479) wurde das Acetamidase (amdS)-Gen mittels der PCR-Methode als Ascl-Nrul-Fragment isoliert und in das mit Ascl/Stul geschnittene Plasmid pAB1280 inseriert.

Für die Amplifizierung des amdS-Gens wurden folgende Primer aus der Sequenzinformation des A. nidulans-Acetamidase-Gens abgeleitet:

AmdS-AscI aggcgcgccctagtcatcattggataggcagattactcag ( SEQ

I D NO : 7 )

AmdS-NruI ggaattctcgcgaaaggcaacaaccagctcacccctgag ( SEQ

I D NO : 8 )

Das erhaltene Plasmid hat die Bezeichnung pAB600 wurde durch Kartierung und Sequenzierung bestätigt.

Das Gen der Phytasevariante PhyMIO wurde in das Plasmid pAB2004 Moniert. Das Plasmid pUC-PhyM10 ist in Fig. 5 dargestellt und ist unter der Hinterlegungsnummer DSM 18719 am 18.10.2006 hinterlegt worden.

Beispiel 7 - Konstruktion der Plasmide pPhv2005 und pAB-Phv2005 (Genotyp Phv2005)

Die Konstruktion des Plasmids pAB-Phy2005 erfolgte durch folgende Schritte:

1. Konstruktion von pPhv2005

Das Plasmid pPhy2005 enthält die Fusion aus dem A. niger var. awamori- saure-Phosphatase (ap)-Gen (Piddington et al., 1993, Gene 133 (1), 55-62; Accession Nr. L02420) und dem E. co//-Phytase-Gen Gen unter Verwendung des Codon-Gebrauchs von T. reesei (http://www.kazusa.or.jp/codon) (Dassa et al. 1990, Accession Nr. M58740). Dadurch entsteht ein offenes Leseraster, das für eine Phytasevariante mit 457 Aminosäuren codiert, wobei die ersten vier (4) Aminosäuren des E. co//-Phytase-Gens durch die ersten einundfünfzig (51) A- minosäuren des sauren Phosphatase-Gens ersetzt sind. Zur Sekretion des Proteins bestehend aus der Fusion saure Phosphatase-E. co//-Phytase in T. reesei wurde die Signalsequenz der sauren Phosphatase verwendet.

Die Fusion aus der A. niger var. awamori sauren Phosphatase Sequenz und der unter Verwendung des Codon-Gebrauchs von T. reesei erzeugten E. coli Phytase Sequenz wurde synthetisiert und in das Plasmid pUC18 kloniert. Das erhaltene Plasmid pPhy2005 wurde durch Sequenzierung bestätigt.

Das Plasmid ist in Fig. 7 dargestellt und ist unter der Hinterlegungsnummer DSM 18720 am 18.10.2006 hinterlegt worden

2. Konstruktion von pAB-Phv2005

Zur Konstruktion des Plasmids pAB-Phy2005 wurde die Sequenz der Fusion Phosphatase-Phytase aus dem Plasmid pPhy2005 mit Avrll und Pacl geschnitten und in die Spei- und Pacl-Spaltstellen nach dem T. reese/-cbhl-Promotor in dem Plasmid pAB489 inseriert. Das entstandene Plasmid hat die Bezeichnung pAB-Phy2005 (Fig. 8) und wurde durch Restriktionsendonucleasen kartiert und die Phytasesequenz durch Sequenzierung bestätigt.

Die aus dem isolierten Expressionskassette pAB-Phy2005 enthält das folgende genetische Material:

cbhl (Cellobiohydrolase I) Promotor: Das 2,2 kb EcoRI/Sacll-Fragment, das den cbhl-Promotor enthält, stammt von Trichoderma reesei QM6a. Der Promotor- Bereich funktioniert auch als homologe DNA (zusammen mit dem cbhl 3'- Fragment; siehe nachstehend), um die Integration der transformierenden DNA in den cbhl Lokus zu steuern.

Saure Phosphatase-Genfragment: Das saure Phosphatase-Genfragment mit seiner Signalsequenz steht direkt unter der Kontrolle des cbhl Promotors. Die 16 Basenpaare (CCGCGGACTGCGCATC atg) stromaufwärts des Startcodons, die zu dem T. reese/ ' -Promotor (Shoemaker et al. 1983, Bio/Technology 1 , 691- 696) gehören, wurden nach dem Einbauen des Avrll-Pacl Fusion Phosphatase- Phytase Fragments zu CCGCGGACTAGGCATC atg geändert.

E. co//-Phytase-Gen: Das synthetische E. co//-Phytase-Gen ist direkt am 3'- Ende der sauren Phosphatase-Sequenz zu einem offenem Leseraster fusioniert.

cbhl-Terminator: Das 0,75 kb lange BamHI/Stul-Fragment, das den cbhl- Terminator enthält, wurde im Anschluss an die E. co//-Phytase hinzugefügt, um die Termination der Transkription zu gewährleisten.

amdS-Gen: Das Gen inkl. seines Promotors und seines Terminators wurde aus Aspergillus nidulans VH1-TRSX6 isoliert und codiert für Acetamidase (Hynes et al., 1983, Mol. Cell. Biol. 3: 1430-1439; Kelly and Hynes, 1985, EMBO J. 4:475- 479). Acetamidase erlaubt dem Stamm unter Verwendung von Acetamid als alleiniger Stickstoffquelle zu wachsen und dieses Charakteristikum wurde zur Selektion der Transformanten verwendet.

cbhl 3' Fragment: Das Fragment (1 ,7 kb, BamHI/EcoRI, beginnend 1 ,4 kb nach dem Stopcodon des Gens) wurde aus T. reesei ALKO2466 isoliert. Der Stamm ALKO2466 stammt von dem Stamm ALKO233 (Harkki et al., 1991 , Enzyme

Microb. Technol. 13: 227-233) ab. Das 3'-Fragment wird zusammen mit dem Promotorbereich verwendet, um die Phytase-Expressionskassette in den cbhl Lokus durch homologe Rekombination zielgerecht zu integrieren.

Beispiel 8 - Konstruktion der Plasmide pPhv2006 und pAB-Phv2006 (Ge- notyp Phv2006)

Die Konstruktion des Plasmids pAB-Phy2006 erfolgte durch folgende Schritte:

1. Konstruktion von pPhv2006

Zur Konstruktion des Plasmids pPhy2006 wurde das 87 bp lange ap- Genfragment, das für die zum C-Terminus des ap-Gens der sauren Phosphata- se aus A. niger var. awamori gehörenden 29 Aminosäuren codiert, direkt an die für die letzte Aminosäure (Leucin) der E. coli Phytase codierende DNA Sequenz in dem Plasmid pPhy2005 fusioniert. Dadurch entsteht ein offenes Leseraster von 486 Aminosäuren.

Die Fusion Phy2006 aus der A. niger var. awamori saure Phosphatase Se- quenz und der unter Verwendung des Codon-Gebrauchs von T. reesei erzeugten E. coli Phytase Sequenz wurde synthetisiert und in das Plasmid pUC18 klo- niert. Die in dem erhaltene Plasmid pPhy2006 enthaltene neue Sequenz wurde durch Sequenzierung bestätigt.

Das Plasmid ist in Fig. 9 dargestellt und ist unter der Hinterlegungsnummer DSM 18721 am 18.10.2006 hinterlegt worden.

2. Konstruktion von pAB-Phv2006

Die Konstruktion sowie die Klonierung des Plasmids pAB-Phy2006 ist identisch mit der in Beispiel 7 beschriebenen Herstellung des Plasmids pAB-Phy2005.

Die Sequenz der Phytasevariante pAB-Phy2006 (Fig. 10) wurde durch Sequen- zierung bestätigt.

Beispiel 9 - Transformation von T. reesei

T. reesei RH 378Od wurde mit den aus den Plasmiden pAB489-PhyM3, pAB490-PhyM2, pAB490-PhyM7, pAB489-PhyM9, pAB600-PhyM10, pAB- Phy2005 und pAB-Phy2006 isolierten linearisierten Expressionskassetten separat transformiert. Die zur Transformation und zur Handhabung von T. reesei verwendeten Techniken waren die gemäß Penttilä et al. (1987, Gene 61 : 155- 164). Die Transformanten wurden selektiert und zweimal durch Einzelsporenisolierung gereinigt. Von allen Transformanten wurden diejenigen mit der höchsten Sekretionsleistung ausgewählt und in Beispiel 10 zur Herstellung von Enzymmaterial weiterverwendet. Die verwendeten Transformanten sind in der folgenden Tabelle 2 aufgelistet.

Tabelle 2: Auflistung der Transformanten für weitere Versuche in den Beispielen 10 - 13.

Beispiel 10 - Produktion von Enzym mit den einzelnen Mutanten

A) Herstellung von Enzymlösunqen durch Fermentation in Schüttelkolben

Transformanten, die die Expressionskassetten aus den Beispielen 2 bis 8 tragen, bzw. die Transformanten mit dem Plasmid pKDa2 (M1) und pKDa4 (WiId- typ Aminosäuresequenz E. co//-Phytase nach Dassa) aus DE 10 2004 050 410, wurden in Schüttelkolben mit pH-Steuerung auf einer DASGIP-Anlage auf CeI- lulase-induzierendem Medium folgender Zusammensetzung gezüchtet: Lactose 10,5% (w/v), DSG 5,25% (w/v), (NH 4 J 2 SO 4 0,63% (w/v), Leitungswasser Rest, Einstellung des pH-Werts vor der Sterilisation auf 4,5. Nach Inokulation wurde in den Schüttelkolben eine pH-Rampe innerhalb von 5 h auf pH 3,3 gefahren. Die nach 6-tägiger Züchtung bei gesteuertem pH-Wert von pH 3,3 erhaltenen Kulturfiltrate wurden für die Bestimmung der Phytaseaktivität und für die Analyse der Thermostabilität mittels Differential-Scanning-Kalorimetrie (DSC) (Beispiel 11) verwendet.

B) Herstellung von Enzvmgranulaten durch Fermentation in 30-l-Bioreaktoren und Trocknung in einem ProCellδ

Die Transformanten aus Beispiel 10 A) wurden in dem Medium aus Beispiel 10 A) in 30-l-Bioreaktoren bei einem pH-Wert von pH 3,2 ± 0,2, 200 bis 400 upm und 0,5 wm Belüftungsrate gezüchtet. Am Ende der 6-tägigen Fermentation wurde die Biomasse durch Filtration abgetrennt und der klare Kulturüberstand mittels Ultrafiltration (30 kDa cut-off Membran) um den Faktor 6 eingeengt. Das Konzentrat wurde steril filtriert und dann für die nachfolgende Herstellung von Enzymgranulaten verwendet.

Die Granulate wurden aus den UF-Konzentraten durch Trocknung in einem Sprühgranulator vom Typ ProCellδ, Firma Glatt Systemtechnik GmbH, Dresden, Deutschland, hergestellt. Dazu wurde der pH-Wert der UF-Konzentrate auf pH 5,2 eingestellt und vor der Trocknung 50% (w/w) Magermilchpulver mit 30% Laktosegehalt und 9,2% (w/w) Ca-Propionat, beide Zugaben bezogen auf den

Gesamtproteingehalt des UF-Konzentrates, zugesetzt. Das Gemisch wurde durch eine 1 ,2 mm 0 Zweistoffdüse mit einem von 1 ,2 auf 2,2 bar ansteigenden Luftdruck bei 80°-90°C Zulufttemperatur getrocknet. Die Aktivitätsausbeuten bei der Trocknung lagen im Bereich 89 bis 99%. Die so hergestellten Granulate wurden für den Versuch in Beispiel 12 verwendet.

Beispiel 11 - Bestimmung der Temperaturstabilität mittels DSC

Die Proben aus Beispiel 10A) wurden mittels einer PD-10-Säule (Pharmacia) in 100 mM Natriumacetat Puffer, pH 5,2 umgepuffert. Dazu wurden 1 ,5 ml Probe aufgetragen und mit 3,5 ml Puffer nach Anleitung des Herstellers eluiert. Alle DSC-Versuche wurden auf einem VP-DSC-Gerät (MicroCal Inc., Northampton, MA, USA) durchgeführt und die Daten wurden auf einen PC übertragen um dort mit Hilfe der Software Origin V7.0383 (OriginLab Corp. Northampton, MA, USA) ausgewertet zu werden.

Die Proben wurden vor der Messung 20 min lang in einem ThermoVac2 (Mic- roCal Inc., Northampton, MA; USA) entgast und auf 25°C in einem Wasserbad temperiert.

Die Messungen erfolgten mit folgenden Parametern:

A) Konstante Geräteparameter:

Zellvolumen: 0,51231 ml

Referenz Heizwiderstand: 1009,1 ohms

Zeilheizwiderstand: 1002,7 ohms

Adiabatische Rate: 0,88181

Delta T read: 3,676

B) VP-DSC scan Parameter waren wie folgt:

Scanrate (aufwärts und abwärts): 1 0 C min '1

Temperatur vor dem Scanzyklus: 25°C

äquilibrierzeit vor dem Zyklus: 15 min

äquilibrierzeit nach dem Zyklus: 0 min

Filter: 10 s

Feedback: keines

Starttemperatur: 25°C

Endtemperatur: 105 0 C

Zelldruck: 26,1 bis 28,7 psi

Die nachstehende Tabelle 3 zeigt die Schmelztemperatur Tm (in Grad Celsius) und die Verschiebung der Schmelztemperatur δT (in Grad Celsius) der mutanten E. co//-Phytasen, die nach den oben stehenden Beispielen hergestellt wurden, im Vergleich zur Wildtyp-E. coli Phytase (Dassa et al., 1990) hergestellt mit dem gleichen Wirtssystem wie die mutanten E. coli Phytasevarianten und einer E. co//-Phytase mit einer nicht-erfindungsgemäßen Mutation (M 1) , ebenfalls hergestellt mit dem gleichen Wirtssystem wie die erfindungsgemäßen mutanten E. coli Phytase-Varianten.

Tab. 3: Schmelztemperatur Tm [°C] und Verschiebung der Schmelztemperatur δT [ 0 C] der E. coli Phytasemutanten im Vergleich zum dem Wild-Typ Protein, alle hergestellt in T. reesei nach Beispiel 10A.

Die Ergebnisse zeigen, dass bei allen erfindungsgemäßen Mutanten eine Erhöhung der Schmelztemperatur des Proteins eingetreten ist, was sich in einer positiven Verschiebung der Schmelzpunktstemperatur zeigt. Die Erhöhung der Schmelzpunkttemperatur ist gleichbedeutend mit einer Erhöhung der Temperaturstabilität. Die höchste Verbesserung der Thermostabilität zeigte dabei die Doppelmutation M2 mit δT = +1 ,11 0 C. Im Gegensatz dazu zeigte die in DE 10 2004 050 410 beschriebene Mutation zur Verbesserung der Sekretionshöhe (V200Y = M1) eine Verschlechterung der Thermostabilität (δT = -0,63 0 C).

Auch die Verlängerungen am N- oder N- und C-terminalen Ende zeigten Verbesserungen der Thermostabilität. Diese liegt in der Größenordnung wie die der Punktmutation bei M3.

Beispiel 12 - Messung der Thermostabilität im Pelletierverfahren

Enzymgranulate hergestellt gemäß Beispiel 10B) wurden mit Weizenmehl, Typ 550, vorgemischt, um 300 g einer enzymhaltigen Vormischung zu erhalten. Diese Vormischung wurde am Biotechnologischen Institut des Research Institutes

for Food and Molecular Biotechnology, Kolding, Dänemark, mit 15 kg Tierfutter vermischt um eine optimale Verdünnung für die Einmischung in 285 kg Tierfutter und eine gut bestimmbare Enzymaktivität in dem pelletierten Material zu gewährleisten. Die eingesetzte Menge an Enzymgranulat führte zu einer Phyta- seaktivität von ca. 3 bis 6 Enzymeinheiten pro Gramm Tierfutter in dem Gemisch vor dem Testprozess. Die 300 kg Tierfutter die in der Pilot-Pelletieranlage behandelt wurden, haben die Zusammensetzung von Tabelle 4.

Tabelle 4: Zusammensetzung des zu pelletierenden Tierfutters

* Enthält Phytase mit Genotyp wt, PhyM1 , PhyM2, PhyM3, PhyM7, PhyM9, Phy2005, oder Phy2006

Pelletierbedingungen:

Horizontalmischer mit 700 I Volumen, 48 upm. Die Menge, die gemischt wird, liegt im Bereich 80 bis 300 kg je h.

An den Mischer angeschlossen ist eine Horizontalförderschnecke zum Entleeren des Mischers, deren Fördergeschwindigkeit an den nachfolgenden Schritt angepasst ist.

Anschließend an die Mischung im Horizontalmischer erfolgt eine thermische Behandlung in einem Kahl Kaskadenmischer (Konditionierer) mit 130 cm Länge, 30 cm Durchmesser, 155 upm und 37 Kammern. Durchsatz 300 kg je h. Futtermittel und Enzyme haben ca. 30 s Kontakt mit Nassdampf und werden dabei auf eine Temperatur von 70° bis 95 0 C erwärmt. Der Dampf, der durch

einen Dan-Stoker-Hochdruckkessel bereitgestellt wird, strömt mit 2 bar überdruck durch ein Druckregulationsventil in den Kaskadenmischer. Das Ventil regelt die Menge Dampf, die in den Kaskadenmischer einströmt und dort zur Erwärmung des Futtermittels (einschl. des Enzyms) führt.

Das konditionierte Material wird durch eine Simon Heesen Presse pelletiert und anschließend in einer mit 1500 m 3 h "1 durchströmten perforierten Box durch Luft gekühlt. Die Pelletierpresse läuft mit 500 upm bei einer Leistungsaufnahme von 7,5 kW und erzeugt dabei Pellets von 3 x 20 mm.

Die Behandlung im Kaskadenmischer bewirkte eine thermische Belastung des im pelletierten Material enthaltenen Enzyms. Anschließend an die Herstellung der Pellets wurde die Wiederfindung der Phytaseaktivität im pelletierten Tierfutter bestimmt. In der nachstehenden Tabelle 5 ist die Wiederfindung der Phytaseaktivität im pelletierten Tierfutter in Abhängigkeit von der Temperatur bei der Behandlung angegeben.

Tab. 5: Wiederfindung der Phytaseaktivität im Tierfutter nach der Konditionierung bei 70° bis 95°C und anschließender Pelletierung. Alle Enzyme wurden rekombi- naπt mit T. reesei exprimiert.

Die Ergebnisse zeigen, dass die Veränderung der Thermostabilität, die bei den Messungen in Flüssigkeit mittels DSC gefunden wurde, auch in den „trockenen" Pelletierversuchen wiedergefunden wurde. Die Verbesserung der Thermostabilität gegenüber dem Wildtyp-Enzym ist dabei nicht bei allen Mutanten über den gesamten gemessenen Temperaturbereich konstant. M2 zeigte im DSC- Versuch die höchste Temperaturstabilität. Auch im Pelletierversuch wurde die beste Stabilisierung durch Mutation in einer isolierten Region durch die Doppelmutation M2 erzielt, die eine ionische Brücke in Helix D der E. coli Phytase einfügt. Die nicht erfinderische Mutante M1 zeigt wie im DSC Versuch eine Ver- schlechterung der Thermostabilität im Vergleich zum Wildtyp-Enzym exprimiert in Trichoderma reesei. Die ebenfalls für sich alleine nicht erfindungsgemäße Mutation M3 zeigt ähnliche Thermostabilitätseigenschaften wie das Wildtyp- Enyzm. Die Variante Phy2005, die nur die N-terminale Verlängerung durch den korrespondierenden Teil der sauren Phosphatase aus A. niger var. awamori trägt, ist nicht so stabil bei höheren Temperaturen wie Phy2006, die sowohl die N- wie auch die C-terminale Verlängerung enthält. Dies deutet darauf hin, dass diese Verlängerungen sehr wohl zu einer Zusammenlagerung von E. coli Phytase Molekülen analog zu der Dimerisierung der sauren Phosphatase unter normalen Bedingungen beitragen können und damit die Thermostabilität verbessern.

Beispiel 13 - Messung der proteolytischen Stabilität in einem in-vitro- Verfahren

Zur Bestimmung der proteolytischen in-vitro-Stabilität wurden Enzymproben aus Beispiel 10A) verwendet, d.h. Proben der Transformanten M1 (der nicht erfin- dungsgemäßen Mutation), M2, M3, M7, Phy2005 und Phy2006 hergestellt mit den Transformaten aus Tabelle 2.

20 ml einer Pepsin-Lösung (Merck 7190), die 20 Proteaseeinheiten pro ml in Glycin-HCI-Puffer (pH 2,5) enthält, wobei die Aktivität nach Angabe des Herstellers auf Hämoglobin, pH 1 ,6, 25°C bezogen ist, wurde bei 40 0 C temperiert.

10 ml einer Phytase-Lösung (1 :100 verdünnt) wurde zugegeben und die Lösung mit Puffer auf 50 ml aufgefüllt und anschließend bei 40 0 C 1 pH 2,5 für 30 min inkubiert. Die Reaktion wurde durch Eintauchen in ein Eis/Wasser-Bad gestoppt und der pH-Wert wurde sofort auf pH 5 mit Natronlauge angehoben und die Lösung dabei auf 100 ml verdünnt. Die Phytaseaktivität wurde dann nach Beispiel 1 gemessen.

10 ml der mit Pepsin behandelten Lösung wurde auf pH 7 eingestellt. 30 ml einer Pankreatin-Lösung (Merck 7130), die 30 Proteaseeinheiten (Casein, pH 8,0, 35°C), in 0,05 M Tris-HCI-Puffer (pH 7,0) enthält, wurde zugegeben, die Lösung mit Tris-HCI-Puffer, pH 7, auf 50 ml verdünnt und die Lösung in einem Wasserbad bei 40 0 C für 30 min inkubiert. Die Reaktion wurde durch Eintauchen in ein Eisλλ/asser-Bad gestoppt und der pH-Wert wurde sofort auf pH 5 mit HCl erniedrigt und die Lösung dabei auf 100 ml verdünnt. Die Phytaseaktivität wurde dann nach Beispiel 1 gemessen. Die Ergebnisse sind in Tabelle 6 dargestellt.

Tab. 6: Aktivitätswiederfindung nach Behandlung der Enzymmutanten mit Pepsin und anschließend Pankreatin

Die Ergebnisse zeigen für alle erfindungsgemäßen Mutanten eine sehr hohe proteolytische Stabilität in Gegenwart von Pepsin und Pankreatin, verglichen mit der Vergleichsmutante PhyM1 , unter in-vitro-Bedingungen, wie sie im Magen von Monogastriern, z. B. Schweinen, vorkommen. Die hier gezeigte hohe

proteolytische Stabilität verdeutlicht, dass diese Enzymmutanten für einen Einsatz im Tierfutterbereich besonders geeignet sind.