Field

[01] The present invention relates to a process for the biological production of methacrylic acid and derivatives thereof. In particularthe process relates to using particular enzymatic conversions to form methacrylic acid from isobutyryl-CoA via methacrylyl-CoA, and the polymers or copolymers produced therefrom.

Background

[02] Acrylic acids and their alkyl esters, in particular methacrylic acid (MAA) and its methyl ester, methyl methacrylate (MMA), are important monomers in the chemical industry. Their main application is in the production of plastics for various applications. The most significant polymerisation application is the casting, moulding or extrusion of polymethyl methacrylate (PMMA) to produce high optical clarity plastics. In addition, many copolymers are used; important copolymers are copolymers of methyl methacrylate and ethyl methacrylate with a-methyl styrene, ethyl acrylate and butyl acrylate. Furthermore, by a simple transesterification reaction, MMA may be converted to other esters such as butyl methacrylate, lauryl methacrylate etc.

[03] Currently, MMA (and MAA) is produced by a number of chemical procedures, one of which is the successful ‘Alpha process’ whereby MMA is obtained from the ester, methyl propionate, by anhydrous reaction with formaldehyde. In the Alpha process, the methyl propionate is produced by the carbonylation of ethylene. This ethylene feedstock is derived from fossil fuels. Recently, it has become desirable to also source sustainable biomass feedstocks for the chemical industry. Accordingly, an alternative biomass route to MMA instead of using the Alpha process would be advantageous.

[04] Therefore, it is one object of the present invention to address the aforementioned problem and to provide a biological or part biological process for the production of methacrylic acid.

[05] Surprisingly, the present inventors have found a way to apply a novel enzyme substrate combination not previously considered for the formation of methacrylic acid at an industrially applicable level, thereby providing a new and viable bio-based route to key monomers such as MMA.

[06] It is known that the oxidation of isobutyryl-CoA to methacrylyl-CoA occurs naturally in the valine degradation pathway, and enzymes carrying out this conversion have been observed in some cells. In these systems, the conversion typically uses an acyl-CoA dehydrogenase enzyme which requires a corresponding electron transport system to couple oxidation of the substrate with reduction of ubiquinone, which is then regenerated.

[07] WO201438216 describes a process of producing methacrylic acid from microbes and methacrylyl CoA conversion to the ester using alcohol acyl transferases. The document shows a small amount of conversion of 2-oxoisovaleric acid to isobutyryl CoA and isobutyryl CoA into methacrylyl CoA. It also discusses the theoretical production of methacrylic acid from methacrylyl- CoA in vivo but this is not successfully produced.

[08] However, in WO201438216, the only example of the in vivo production of methacrylic acid uses the Rhodococcus erythropolis derived acyl-CoA dehydrogenases recombinantly expressed in a host of the same genus; a Rhodococcus bacterium. Other examples attempting to heterologously express the similar acyl-CoA dehydrogenases discovered in Pseudomonas aeruginosa in a different host organism did not produce methacrylic acid. The up-regulation or expression of a heterologous acyl-CoA dehydrogenase in a host organism is difficult to achieve and has not yet been reported.

[09] Therefore, it is a further object of the present invention to provide an improved production of methacrylic acid.

[10] WO2016/185211 describes a process for the production of methacrylic acid from microorganisms. The document exemplifies the conversion of isobutyryl-CoA to methacrylyl-CoA by the action of ACX4 from Arabidopsis thaliana in recombinant E. coli. WO2016/185211 also exemplifies the subsequent conversion of methacrylyl-CoA to methacrylic acid by the action of 4- hydroxybenzoyl-CoA thioesterase (4HBT) from Arthrobacter sp. strain SU and, alternatively, the conversion of methacrylyl-CoA to butyl methacrylate by the action of apple alcohol acyl transferase (AAT) in the presence of butanol. However, WO2016/185211 does not exemplify the aforementioned conversions by any enzyme.

[11] Therefore, it is a further object of the present invention to provide an alternative viable enzymatic conversion of methacrylyl-CoA to methacrylic acid and/or the methacrylic acid esters thereof which can be used in an industrial process.

Summary

[12] According to a first aspect of the present invention there is provided a process of producing methacrylic acid and/or derivatives thereof comprising the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by the action of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) converting methacrylyl-CoA into methacrylic acid and/or derivatives thereof.

[13] Advantageously, the processes of the invention provide a further biological route to produce the key chemical methacrylic acid and its known derivatives reducing the industry reliance on fossil fuels and increasing sustainability.

[14] The process enables facile conversion of renewable feedstocks to isobutyryl-CoA by microbial fermentation, and co-expression of enzymes catalysing steps (a) and (b) will provide a direct microbial fermentation route to MAA.

[15] Still further, the processes use enzymes for step (a) not previously considered for the production of methacrylic acid and not found in naturally occurring valine pathways. The enzymes for step (a) act to convert isobutyryl CoA into methacrylyl CoA without requiring an associated electron transport system. The enzymes in step (a) may be used alone to improve partly chemical procedures to form methacrylic acid or to improve biological processes to form methacrylic acid. Alternatively, both enzymes of step (a) and (b) can be used together to form a stand-alone biological process for making methacrylic acid to an industrially applicable level, and which is functional in heterologous host organisms.

[16] According to a second aspect of the present invention there is provided a microorganism for use in producing methacrylic acid and/or derivatives thereof according to the process of the first aspect of the present invention.

[17] According to a third aspect of the present invention there is provided a recombinant microorganism adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid; wherein the recombinant microorganism is Escherichia coll.

[18] According to a fourth aspect of the present invention there is provided a microorganism modified by one or more heterologous nucleic acids to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid.

[19] According to a fifth aspect of the present invention there is provided a microorganism adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid and/or derivatives thereof.

[20] According to a sixth aspect of the present invention there is provided a microorganism adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into a C1 to C20 methacrylic acid ester, suitably a C1 to C12 methacrylic acid ester, such as a C1 to C4 or C4 to C12 methacrylic acid ester by expression of an alcohol acyl transferase.

[21] According to a seventh aspect of the present invention there is provided a process of production of methacrylic acid using a microorganism according to any of the second, third, fourth, fifth and/or sixth aspects of the present invention. [22] According to an eighth aspect of the present invention there is provided a process of fermentation comprising culturing one or more microorganism/s of any of claims according to any of the second, third, fourth, fifth and/or sixth aspects of the present invention in a fermentation medium to produce methacrylic acid and/or derivatives thereof.

[23] According to a ninth aspect of the present invention fermentation medium comprising one or more microorganism/s of any of the second, third, fourth, fifth and/or sixth aspects of the present invention.

[24] According to a tenth aspect of the present invention there is provided a bioreactor comprising one or more microorganism/s of any of the second, third, fourth, fifth and/or sixth aspects of the present invention and/or the fermentation medium according to the eighth aspect of the present invention.

[25] According to an eleventh aspect of the present invention there is provided a method of preparing polymers or copolymers of methacrylic acid or methacrylic acid esters, comprising the steps of:

(i) preparation of methacrylic acid and/or derivatives thereof in accordance with the first aspect of the present invention;

(ii) optional esterification of the methacrylic acid prepared in (i) to produce the methacrylic acid ester;

(iii) polymerisation of the methacrylic acid and/or derivatives thereof prepared in (i) and/or, if present, the ester prepared in (ii), optionally with one or more comonomers, to produce polymers or copolymers thereof.

[26] According to a twelfth aspect of the present invention there is provided polymethacrylic acid, polymethylmethacrylate (PMMA) and polybutylmethacrylate homopolymers or copolymers formed from the method according to the eleventh aspect of the present invention.

Detailed Description

Enzymes

[27] In the context of the present invention ‘biologically’ means using a biological catalyst. Preferably the biological catalysts are enzymes, but may include any catalytic structure derived from a biological source.

[28] In the context of the present invention ‘chemically’ means using chemical means other than using a biological catalyst such as an enzyme.

[29] In relation to the first aspect, step (b) may be conducted biologically or chemically, preferably step (b) may be carried out biologically.

[30] Preferably, step (a) and step (b) are conducted enzymatically using one or more enzymes wherein the enzymes are acting as biological catalysts.

[31 ] Step (a) is carried out by an acyl-CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii. [32] Preferably, step (a) may be carried out by an acyl-CoA oxidase from Spinacia oleracea and/or Populus alba, such as from Spinacia oleracea.

[33] Preferably, the acyl-CoA oxidase from Spinacia oleracea may have the GenBank ID No. XP_021855534.1 or KNA24566.1 , more preferably GenBank ID No. XP_021855534.1 or KNA24566.1.

[34] Preferably, the acyl-CoA oxidase from Populus alba may have the GenBank ID No. TKS13357.1.

[35] Preferably, the acyl-CoA oxidase from Trema orientale may have the GenBank ID No. PON92218.1.

[36] Preferably, the acyl-CoA oxidase from Arachis hypogaea may have the GenBank ID No. QHO54153.1.

[37] Preferably, the acyl-CoA oxidase from Parasponia andersonii may have the GenBank ID No. PON51135.1 .

[38] Preferably methacrylyl-CoA is converted to methacrylic acid by the action of a thioester hydrolase (also known as a thioesterase), suitably under EC group 3.1.2.X. Still more preferably the enzyme is an acyl CoA thioesterase, suitably under EC group 3.1 .2.20, a 3-hydroxyisobutyryl- CoA hydrolase, suitably under EC group 3.1.2.4, an ADP dependent acyl-CoA thioesterase, suitably under EC group 3.1 .2.18, a 4-hydroxybenzoyl-CoA thioesterase, suitably under EC group

3.1.2.23, or a thioesterase under EC group 3.1.2.-, such as, for example, a salicyloyl-CoA thioesterase. More preferably the thioesterase is selected from any of the following enzymes: 4HBT from Arthrobacter sp. strain SU, 4HBT from Arthrobacter globiformis, 4HBT from Pseudomonas sp. strain CBS-3, EntH from Escherichia coll (E. coli), YciA from E.coli, YciA from Haemophilus influenzae, TesA from E. coli or TesB from E. coli, FcoT from Mycobacterium tuberculosis. Still more preferably, the thioesterase is an acyl-CoA thioesterase. Still more preferably, the thioesterase is a 4-hydroxybenzoyl-CoA thioesterase, suitably under EC group

3.1 .2.23. Most preferably the acyl-CoA thioesterase is 4HBT from Arthrobacter sp. strain SU.

[39] Thus, in one embodiment, isobutyryl-CoA may be converted to methacrylyl-CoA by the action of an acyl-CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii and methacrylyl-CoA may be converted to methacrylic acid by the action of a 4-hydroxybenzoyl-CoA thioesterase, suitably under EC group 3.1.2.23, more preferably the acyl-CoA thioesterase 4HBT from Arthrobacter sp. strain SU.

[40] Alternatively, meth aery lyl-CoA may be converted to methacrylic acid by the action of one of the following enzymatic routes:

[41] In one embodiment, methacrylyl-CoA is converted to methacrylic acid by the action of a transferase, suitably under EC group number 2.X.X.X. Preferably the transferase is a transferase that transfers sulfur containing groups, suitably under EC group number 2.8.X.X. More preferably, the transferase is a CoA-transferase, suitably under EC group number 2.8.3.X. More preferably still, the transferase is an acetate-dependent acyl-CoA transferase or an acetoacetate-dependent butyric-CoA transferase, suitably under EC group numbers 2.8.3.8 and 2.8.3.9 respectively. Most preferably the transferase is selected from any of the following enzymes: butyryl- CoA:acetoacetate CoA transferase from Clostridium sp. SB4, butyryl-CoA:acetoacetate CoA transferase from Clostridium sticklandii, butyrate: acetoacetate CoA-transferase from Clostridium acetobutylicum ATCC824, acetate coenzyme A transferase ydiF from E. coll.

[42] As used herein, the terms ligase, synthetase, and synthase are used interchangeably as is understood in the art.

[43] In another embodiment, methacrylyl-CoA is converted to methacrylic acid by the action of a synthetase acting in the reverse direction, suitably under EC group number 6.X.X.X. Preferably the synthetase is a carbon-sulfur bond forming synthetase, suitably under EC group number 6.2.X.X. More preferably the synthetase is an acid-thiol ligase, suitably under EC group number 6.2.1.X. Most preferably, the synthetase is a reversible ADP or GDP forming acyl-CoA ligase, such as a GDP forming succinate-CoA synthetase , suitably under EC group 6.2.1.4, an ADP forming succinate-CoA synthetase, under EC group 6.2.1.5, an ADP forming glutarate-CoA synthetase , under EC 6.2.1 .6, an ADP forming malate-CoA synthetase, under EC 6.2.1 .9, a GDP forming carboxylic acid-CoA synthetase, under EC 6.2.1.10, an ADP forming acetate-CoA synthetase , under EC 6.2.1 .13 or an ADP forming citrate-CoA synthetase, under EC 6.2.1 .18.

[44] In another embodiment, methacrylyl-CoA is converted to methacrylic acid by the combined action of a phosphotransacylase akin to a phosphotransacetylase or a phosphotransbutyrylase under EC group number EC 2.X.X.X, more preferably EC group number EC 2.3.X.X, still more preferably EC 2.3.1 .X, most preferably under EC group number 2.3.1 .8 or 2.3.1 .19, and a short chain fatty acid kinase, under EC group number EC 2.X.X.X, preferably EC 2.7.X.X, more preferably EC 2.7.2.X, most preferably an acetate kinase under EC 2.7.2.1 , a formate kinase under EC 2.7.2.6, a butyrate kinase under EC 2.7.2.7, a branched chain fatty acid kinase under EC 2.7.2.14 or a propionate kinase under EC 2.7.2.15. Preferably the phosphotransacylase is a methacrylyl-CoA phosphotransacylase. Preferably the short chain fatty acid kinase is a reversible methacrylic acid kinase. Most preferably the phosphotransacylase is selected from any of the following enzymes: Phosphotransbutyrylase from Clostridium acetobutylicum ATCC824. Most preferably the short chain fatty acid kinase is selected from any of the following enzymes: branched chain fatty acid kinase from Spirochete MA-2, butyrate kinase from Thermotoga maritima, butyrate kinase form Clostridium butyricum.

[45] In the context of the present invention, the term ‘derivatives thereof’ means any chemical directly related to or comprising either methacrylyl CoA or methacrylic acid, such as the esters thereof, the acyl halides thereof, the anhydrides thereof, the amides thereof, the nitriles thereof, the lactones thereof, the salts thereof, the complexes thereof, the isomers of, the oligomers or polymers thereof and further any substituted versions of these, more preferably, it means the esters or the salts thereof.

[46] Preferably the derivatives thereof of methacrylic acid are methacrylic acid esters. Preferably the methacrylic acid esters are alkyl methacrylates, more preferably lower alkyl (C1- C20) methacrylates, still more preferably, C1-C12 alkyl methacrylates, especially the C1-C4 alkyl esters, such as the methyl, ethyl or butyl methacrylates, or C4-C12 alkyl esters. Most preferably, the methacrylic acid esters are butyl methacrylates, for example n-butylmethacrylate.

[47] The methacrylic acid esters may be formed biologically from the methacrylyl-CoA, preferably by the action of a transferase enzyme under EC group number EC2.X.X.X, more preferably an acyl transferase under EC group number 2.3.X.X, still more preferably an alcohol acyltransferase under EC group number EC2.3.1 .84.

[48] Preferably, the methacrylic esters may be formed biologically from the methacrylyl-CoA by the action of an alcohol acyltransferase, suitably under EC group number EC2.3.1 .84.

[49] Suitably the alcohol acyltransferase acts in the presence of an alcohol or phenol, preferably a linear or branched C1-20 unsubstituted alcohol, aralkyl alcohol or phenol, and particularly preferably a C1-8 or C1-4 alkyl alcohol such as methanol, ethanol, n-propanol, isopropanol, n- butanol, isobutanol, sec-butanol, tert-butanol, n-pentylalcohol, isopentyl alcohol, tert-pentyl alcohol, n-hexyl alcohol, isohexyl alcohol, 2-hexyl alcohol, dimethylbutyl alcohol, ethylbutyl alcohol, heptyl alcohol, octyl alcohol, 2-ethylhexyl alcohol; a benzyl alcohol or a phenol. Preferably, the alcohol acyltransferase acts in the presence of an alcohol, more preferably a CI CI 2 alcohol, more preferably a C1 to C4 or C4-C12 alcohol, still more preferably in the presence of butanol, such as n-butanol, isobutanol, sec-butanol or tert-butanol. Most preferably, the alcohol acyltransferase acts in the presence of n-butanol.

[50] By the term alcohol herein is meant a species having a hydroxyl group (-OH group) and which is capable of forming an ester group with the methacrylate. Preferably, the alcohol may be a C1 to C20 alkanol, more preferably a C1 to C12 alkanol, still more preferably a C1 to C4 alkanol or a C4 to C12 alkanol, most preferably a C4 alkanol (i.e. butanol, such as n-butanol, isobutanol, sec-butanol or tert-butanol).

[51] Preferably the alcohol acyltransferase is derived from a plant origin, more preferably the plant belongs to any order selected from the group consisting of Zingiberales, Rosales, Ericales, Cucurbitales, Brassicales and Laurales; still more preferably the plant belongs to any family selected from the group consisting of Musaceae, Rosaceae, Ericaceae, Actinidiaceae, Cucurbitaceae, Caricaceae and Lauraceae; still more preferably the plant belongs to any genus selected from the group consisting of Musa, Fragaria, Malus, Prunus, Pyrus, Vaccinium, Actinidia, Cucumis, Carica and Persea; still more preferably the plant is any one selected from the group consisting of banana, strawberry, apple, Prunus mume, Pyrus communis, blueberry, kiwi, melon, papaya and avocado. Most preferably, the alcohol acyltransferase is derived from a fruit origin such as apple, melon or tomato origin, suitably apple origin.

[52] The biological tissue or processed product thereof may be used e.g., fruit, leaves, petals, stem, seed, fruit skin, sarcocarp, etc in which the alcohol acyltransferase is present. Alternatively, the crude enzyme liquid extracted from these biological tissues, purified enzyme, or the like may be used. Alternatively, the gene for the alcohol acyltransferase may be isolated, and introduced into a host microorganism for expression therein. [53] The use of an alcohol acyltransferase to convert methacrylyl CoA into methacrylic acid esters is fully described in WO2014/038214, the disclosure of which is incorporated herein by reference, in particular the alcohol acyltransferase genes and sequences thereof, and the vector plasmids comprising said sequences.

Further process steps

[54] Optionally the process of the present invention may further comprise step (c) of converting any methacrylic acid formed in step (b) into a methacrylic acid ester.

[55] Preferably the methacrylic acid esters are alkyl methacrylates, more preferably lower alkyl (C1-C20) methacrylates, more preferably C1-C12 alkyl methacrylates, still more preferably C1- C4 or C4-C12 alkyl methacrylates. Most preferably, the methacrylic acid esters are butyl methacrylate.

[56] The methacrylic acid esters formed in step (c) may be formed biologically or chemically, preferably they are formed biologically.

[57] Optionally, step (c) may be conducted chemically by an esterification reaction with a suitable alcohol. The reaction conditions under which esterification is effected, can be varied considerably. The reaction proceeds very slowly at room temperature, but quite rapidly at elevated temperatures. Typically one of the reactants is used in stoichiometric excess in order to drive the reaction. The other reactant is then called the limiting reagent. About 99% of the limiting reagent, e.g., acids, alcohols or polyols, can be converted to an esterwithin a few hours. Limiting reagents are typically reagents which are not present in stoichiometric excess, e.g., limiting reagents used to make polyol esters are polyols.

[58] Because the esterification of an alcohol and an organic acid is a reversible reaction, the esterification reaction normally does not go to completion. However, conversions of over 99% can be achieved by removing at least one of the esterification products, typically water. If one of the products is boiling at a lower temperature than the other one, and than the reagents, this removal is typically achieved by distillation. A variety of distillation techniques are known in the art to remove the produced water from the reaction zone. One method of water removal includes carrying out the reaction in a liquid medium which may form an azeotrope having a boiling point that is lower than that of either or each component of the reaction. If the reagents and the resulting ester have boiling points above 100°C at atmospheric pressure, then the reaction temperature can simply be adjusted to remove water and no liquid medium capable of forming an azeotrope with water is required. Additionally, an entrainer may be used to aid in the distillation of the water from the reaction mixture. Inert materials such as cyclohexane, hexane, benzene, toluene, or xylene may be used as an entrainer in the production of esters. In addition, the reactant having the lower boiling point may also be employed as the entrainer. In this latter case, the reactant used as the entrainer is typically charged into the reaction mixture in excess over the stoichiometric quantities required for the reaction. Esterification processes, including those employing water removal, may be conducted in a batch or continuous mode of operation. Various esterification processes are disclosed in Volume 9 of the Kirk-Othmer Encyclopaedia of Chemical Technology, Fourth Edition (1994), pp. 762-768, the entirety of which is hereby incorporated by reference.

[59] A conventional batch esterification procedure includes charging all of the reactants into the reactor at the beginning of the reaction cycle. In catalytic esterification processes, the catalyst is typically added to the reaction mixture after the batch reaches a target temperature. The reaction mixture may then be heated further. The temperature of the reaction mixture rises until the boiling point ofthe reaction mixture is achieved, at which point the entrainer, if used, and water by-product boil out of the reaction mixture. Typically, the overhead vapours are condensed, the water separated from the entrainer, and the entrainer recycled to the reactor vessel. The reaction temperature, and therefore the rate of reaction, is limited by the boiling point of the reaction mixture. When the reactant with the lower boiling point is also used as the entrainer, its concentration is gradually reduced as the reaction proceeds. Also the concentrations of the reactants decrease during the reaction, which negatively affects the reaction rate. Thus the reaction temperature, and, therefore, the rate constant for the reaction, increases as the reaction proceeds, irrespective whether an entrainer is used or not, particularly if heat input is continued during the course of the reaction.

[60] Preferably step (c) is conducted biologically by the action of an esterase or hydrolase enzyme acting in relation to an ester bond under EC group number EC 3.1 ,x.x., more preferably, the enzymes are under.EC 3.1.1 .X and are the enzymes of the hydrolase class involved in catalysis of cleavage and formation of ester bonds. A recent review of microbial esterases is as follows : Int.J.Curr.Microbiol.App.Sci (2013) 2(7): 135-146.

[61 ] Preferably the process further comprises one or more further step/s of producing isobutyryl- CoA, more preferably producing isobutyryl-CoA from 2-ketoisovaleric acid, and/or from isobutyric acid.

[62] In one embodiment, the process further comprises the one or more further step/s of producing isobutyryl-CoA from 2-ketoisovaleric acid, the one or more further step/s being any of the following:

[63] Preferably the process further comprises a step of converting 2-ketoisovaleric acid into isobutyryl-CoA. More preferably 2-ketoisovaleric acid is converted to isobutyryl-CoA by a branched chain keto acid dehydrogenase enzyme complex, consisting of the alpha subunit component, the lipoamide acyltransferase component and the lipoamide dehydrogenase component. Most preferably, the dehydrogenase is selected from any of the following enzymes: branched chain keto acid dehydrogenase (BCKD) from P. putida, BCKD from Bacillus subtilis, BCKD from P. aeruginosa, BCKD from A. thaliana, BCKD from Streptomyces coelicolor and BCKD from Thermus thermophilus.

[64] Alternatively, the conversion of 2-ketoisovaleric acid to isobutyryl-CoA may be catalyzed by an oxidoreductase enzyme, suitably under EC group 1 .X.X.X, preferably an oxidoreductase acting on the aldehyde or oxo group of donors, suitably under EC group 1 .2.X.X, more preferably an oxidoreductase enzyme acting on the aldehyde or oxo group of donors, using an iron-sulfur protein as the electron acceptor, suitably under EC group 1.2.7.X, most preferably a 2- ketoisovalerate ferredoxin reductase (known also as ketovaline ferredoxin oxidoreductases), suitably under EC group number 1 .2.7.7, which is a tetramer consisting alpha, beta, gamma and delta subunits. Examples of such enzymes are 2-ketoisovalerate ferredoxin reductase from Pyrococcus furiosis; 2-ketoisovalerate ferredoxin reductase from Pyrococcus sp.; 2- ketoisovalerate ferredoxin reductase from Thermococcus sp; 2-ketoisovalerate ferredoxin reductase from Thermococcus litoralis; 2-ketoisovalerate ferredoxin reductase from Thermococcus profundus and 2-ketoisovalerate ferredoxin reductase from Methanobacterium thermoautotrophicum.

[65] In a second embodiment, the process further comprises the one or more further step/s of producing isobutyryl-CoA from isobutyric acid, the one or more further step/s being any of the following:

[66] Preferably the process further comprises a step of converting isobutyric acid into isobutyryl- CoA.

[67] Optionally, isobutyric acid is converted to isobutyryl-CoA by the action of a ligase enzyme, suitably under EC group number 6.X.X.X, preferably a carbon-sulfur bond forming ligase under EC group 6.2.X.X, more preferably an acid-thiol forming ligase under EC group 6.2.1 .X, more preferably a GDP-forming, an ADP forming or an AMP forming ligase, such as an AMP forming acetate-CoA ligase, suitably under EC group 6.2.1.1 , a butyrate-CoA ligase, suitably under EC group 6.2.1.2, a carboxylic acid-CoA ligase, suitably under EC group 6.2.1.10, an ADP forming acetate-CoA ligase, suitably under EC group 6.2.1 .13, a propionate-CoA ligase, suitably under EC group 6.2.1 .17 or an acid-thiol ligase in EC group 6.2.1 .-. Most preferably the ligase is selected from any of the following enzyme: AcsA from Pseudomonas chlororaphis, butyryl-CoA synthetase from Paecilomyces varioti, butyryl-CoA synthetase from bovine heart mitochondria.

[68] The process may further comprises one or more further step/s of producing isobutyryl-CoA from isobutyrate, the one or more further step/s being any of the following:

[69] Preferably the process further comprises the step of converting isobutyrate to isobutyrylphosphate, and the step of converting isobutyryl-phosphate to isobutyryl-CoA.

[70] Preferably the isobutyrate is converted to isobutyryl-phosphate by a kinase enzyme, suitably under EC group number EC 2.X.X.X, preferably under EC 2.7.X.X, more preferably under EC group number EC 2.7.2.X, most preferably an acetate kinase, suitably under EC group 2.7.2.1 , a formate kinase under EC 2.7.2.6, a butyrate kinase under EC 2.7.2.7, a branched chain fatty acid kinase under EC 2.7.2.14 or a propionate kinase under EC 2.7.2.15. Most preferably the kinase is selected from any of the following enzymes: branched chain fatty acid kinase from Spirochete MA-2, butyrate kinase from C. butyricum.

[71] Preferably the isobutyryl-phosphate is converted to isobutyryl-CoA by the action of a transferase enzyme, under EC group number 2.X.X.X, more preferably by the action of an acyltransferase under EC group number 2.3.X.X, still more preferably by the action of acyltransferase transferring groups other than amino-acyl groups under EC group number 2.3.1.X. Still more preferably a phosphate acetyltransferase or a phosphate butyryltransferase, under EC group numbers 2.3.1.8 and 2.3.1.19, respectively. More preferably the transferase is phosphate butyryltransferase from Clostridium acetobutylicum ATCC824 or phosphate acetyltransferase from Bacillus subtilis, Corynebacterium glutamicum ATCC13032, Thermotoga maritima and Clostridium kluyveri. Other sources of these enzymes include other anaerobic bacteria, especially Clostridium species such as Clostridium pasteurianum or Clostridium beijerinckii.

[72] Most preferably the process further comprises a step of producing isobutyryl-CoA from isobutyric acid by the action of the synthetase enzyme, preferably an isobutyryl-CoA synthetase, most preferably isobutyryl-CoA synthetase (AcsA) from P. chloraphis B23.

[73] Optionally, any of the further process steps as described hereinabove may be combined.

Microorganisms

[74] The enzymes of the above process may be contained within one or more microorganism/s, or present free of a microorganism, for example as a cell-free extract or purified enzyme in a reaction vessel, or held on a column.

[75] Preferably the biological conversions of the process are conducted in one or more host microorganism/s. More preferably the one or more enzymes for conducting the biological conversions are contained within one or more microorganism/s.

[76] Preferably the one or more microorganism/s express the one or more enzymes necessary to catalyse the relevant step/s. More preferably, the relevant step/s and any further enzymatic steps are conducted in vivo, within the one or more microorganism/s.

[77] The one or more microorganism/s may express the one or more enzymes naturally, or may be genetically engineered to express the one or more enzymes, or may express a combination of both wild type or genetically engineered enzymes. Such a genetically engineered organism may be described as a recombinant organism.

[78] The one or more microorganism/s may express the one or more enzymes endogenously or heterologously, or a combination of endogenous and heterologous enzymes.

[79] In the context of the present invention, the term ‘recombinant organism’ means a genetically modified or engineered organism comprising genetic material which has been artificially constructed and inserted into the organism. The genetic material may comprise endogenous or heterologous nucleic acids which may or may not have been further genetically modified.

[80] In the context of the present invention, the term ‘endogenous’ means deriving from the same species of organism.

[81] In the context of the present invention, the term ‘heterologous’ means deriving from a different species of organism. [82] In the context of the present invention, the term ‘adapted’, when used with respect to a microorganism, means a genetically modified or engineered organism, as defined above, or a mutant strain of an organism which, for example, has been selected on the basis that it expresses the one or more enzymes naturally.

[83] The microorgan ism/s for use in any of the above processes, genetically engineered or modified as described above, may be selected from naturally-occurring wild type or non-naturally occurring recombinant microorganism/s, for example, bacteria, archaea, yeast, fungus, algae or any of a variety of other microorganism/s applicable to fermentation processes.

[84] The microorganism/s may express at least the following enzymes:

(a) (i) an acyl-CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and/or

(b) (i) an acyl-CoA thioesterase suitably a 4-hydroxybenzoyl-CoA thioesterase (4HBT), more suitably a 4-hydroxybenzoyl-CoA thioesterase (4HBT) from Arthrobacter sp; and/or

(ii) an acyl-CoA transferase; and/or

(iii) acyl-CoA synthetase; and/or

(iv) a phosphotransacylase and a short chain fatty acid kinase; and optionally

(v) an alcohol acyltransferase.

[85] The microorganism/s may express at least the following enzymes:

(a) (i) an acyl-CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale,

Arachis hypogaea and/or Parasponia andersonii; and/or

[86] (b) (i) an acyl-CoA thioesterase suitably a 4-hydroxybenzoyl-CoA thioesterase

(4HBT), more suitably a 4-hydroxybenzoyl-CoA thioesterase (4HBT) from Arthrobacter sp.

[87] In some embodiments, the microorganism is adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase; and

(b) biologically converting methacrylyl-CoA into a C1 to C20 methacrylic acid ester, suitably a C1 to C12 methacrylic acid ester, such as a C1 to C4 or a C4 to C12 methacrylic acid ester by expression of an alcohol acyltransferase.

[88] Preferably, the methacrylic acid ester may be butyl methacrylate.

[89] The microorganism may be any suitable microorganism. The microorganism may be Escherichia coli. The microorganism may be a recombinant organism.

[90] The microorganism/s may express enzymes (a) and/or (b) as herein defined. Preferably the microorganism/s may express both of enzymes (a) and (b) as herein defined.

[91] Preferably the microorganism/s further express one or more of the following enzymes: a branched chain keto acid dehydrogenase enzyme or either an ADP forming, a GDP forming, or an AMP forming acyl-CoA synthetase/synthase/ligase; or a short chain fatty acid kinase and a phosphotransacylase. [92] More preferably the microorganism/s further express one or more of the following enzymes: 2-ketoisovalerate dehydrogenase, an isobutyrate-CoA ligase, an ADP forming, GDP forming or an AMP forming acyl-CoA synthetase/synthase/ligase, or a short chain fatty acid kinase and a phosphotransacylase.

[93] Most preferably, the microorganism/s further express an isobutyryl-CoA synthetase, in particular AcsA from Pseudomonas chloraphis, in particular Pseudomonas chloraphis B23

[94] The host microorganism/s may be any suitable microorganism. Preferably the host microorganism/s are bacteria, examples of suitable bacteria include: enterobacteria belonging to proteobacteria of the genus Escherichia, Enterobacter, Pantoea, Klebsiella, Serratia, Erwinia, Salmonella, Morganella, or the like, so-called coryneform bacteria belonging to the genus Brevibacterium, Corynebacterium or Microbacterium and bacteria belonging to the genus Alicyclobacillus, Bacillus, Hydrogenobacter, Methanococcus, Acetobacter, Acinetobacter, Agrobacterium, Axorhizobium, Azotobacter, Anaplasma, Bacteroides, Bartonella, Bordetella, Borrelia, Brucella, Burkholderia, Calymmatobacterium, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Coxiella, Ehrlichia, Enterococcus, Francisella, Fusobacterium, Gardnerella, Haemophilus, Helicobacter, Kelbsiella, Methanobacterium, Micrococcus, Moraxella, Mycobacterium, Mycoplasma, Neisseria, Pasteurella, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Rhizobium, Rickettsia, Rochalimaea, Rothia, Shigella, Staphylococcus, Stenotrophomonas, Streptococcus, Treponema, Vibrio, Wolbachia, Yersinia, or the like.

[95] Exemplary bacteria include species selected from Escherichia coll, Klebsiella oxytoca,

Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Mannheimia succiniciproducens, Rhizobium etli, Bacillus subtilis, Corynebacterium glutamicum, Gluconobacter oxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillus plantarum, Streptomyces coelicolor, Clostridium acetobutylicum, Pseudomonas fluorescens, Hydrogenobacter thermophilus, Methanococcus jannaschii and Pseudomonas putida.

[96] Preferably the bacterium is Escherichia coll.

[97] Exemplary yeasts or fungi include those belonging to the genera Saccharomyces, Schizosaccharomyces, Candida, Kluyveromyces, Aspergillus, Pichia, Crytpococcus, or the like. Exemplary yeast or fungi species include those selected from Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces marxianus, Aspergillus terreus, Aspergillus niger, Pichia pastoris, or the like.

[98] The one or more microorganism/s may be genetically modified to enhance or reduce the activity of the above natural or genetically engineered enzymes.

[99] Preferably the microorganism/s may be genetically engineered to enhance production of methacrylic acid and/or derivatives thereof.

[100] Enhancing the production of methacrylic acid and/or derivatives thereof may include making modifications to existing cellular metabolic processes, nucleic acids and/or proteins by the use of various genetic engineering techniques known in the art. Enhancing the production of methacrylic acid and/or derivatives thereof may also include modifying the microorgan ism/s to express one or more heterologous genes in the microorganism/s. These may include genes encoding enzymes of the desired pathway to methacrylic acid from carbon based feedstocks such as those set out herein, or may include other auxiliary genes which act to promote the functioning and expression of the enzymes in such pathways either directly or indirectly as discussed in detail below.

[101] Accordingly, the microorganism/s may be modified to express the one or more genes for production of methacrylic acid and/or derivatives thereof and preferably, the microorganism/s are further modified to enhance production of methacrylic acid and/or derivatives thereof.

[102] The one or more gene/s which may be expressed within the microorganism/s such that it is modified to produce methacrylic acid and/or derivatives thereof include those encoding acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii and any of the following enzymes: 4-hydroxybenzoyl-CoA thioesterase from Arthrobacter sp, YciA from Escherichia coll, YciA from Haemophilus influenzae, TesA from Escherichia coli, TesB from Escherichia coli, 4HBT from Arthrobacter globiformis, 4HBT from Pseudomonas sp. Strain CBS-3, EntH from Escherichia coli, butyryl-CoA acetoacetate CoA transferase from Clostridium sp. SB4, butyryl-CoA acetoacetate CoA transferase from Clostridium sticklandii, butyrate-acetoacetate CoA-transferase from Clostridium acetobutylicum ATCC824, acetate coenzyme A transferase ydiF from Escherichia coli, phosphotransbutyrylase from Clostridium acetobutylicum ATCC824, branched chain fatty acid kinase from Spirochete MA-2, butyrate kinase from Thermotoga maritima, butyrate kinase from Clostridium butyricum, branched chain acyl-CoA dehydrogenase from Pseudomonas putida, isobutyryl-CoA dehydrogenase from Homo sapiens, isovaleryl-CoA dehydrogenase from Arabidopsis thaliana, electron transfer flavoprotein from H. sapiens, electron transfer flavoprotein from Sus scrofa, electron transfer flavoprotein from Arabidopsis thaliana, electron transfer flavoprotein from Pseudomonas putida, electron transfer flavoprotein from Paracoccus denitrificans, electron transfer flavoprotein ubiquinone oxidoreductase from H. sapiens, electron transfer flavoprotein ubiquinone oxidoreductase from Sus scrofa, electron transfer flavoprotein ubiquinone oxidoreductase from Pseudomonas putida, electron transfer flavoprotein ubiquinone oxidoreductase from Arabidopsis thaliana, electron transfer flavoprotein ubiquinone oxidoreductase from Rhodobacter sphaeroides, electron transfer flavoprotein ubiquinone oxidoreductase from Paracoccus denitrificans.

[103] The one or more gene/s which may be expressed within the microorganism/s such that it is modified to enhance production of methacrylic acid and/or derivatives thereof include those encoding any of the following enzymes: AcsA from Pseudomonas chlororaphis; bkdA1, bkdA2, bkdB and IpdV from Bacillus subtilis; bkdA1, bkdA2, bkdB and IpdV from Pseudomonas putida; alsS from Bacillus subtilis, ilvD from Escherichia coli, ilvC from Escherichia coli, ilvB from Escherichia coli, ilvN from Escherichia coli, ilvl from Escherichia coli, ilvG from Escherichia coli, ilvM from Escherichia coli, ilvH from Escherichia coli and ilvH from Escherichia coli with G14D and S17F mutations, ilvC from Corynebacterium glutamicum R harbouring S34G, L48E and R49F mutations, ilvB and ilvN from Corynebacterium R and ilvN from Corynebacterium R harbouring a G156E mutations well as homologues from other organisms, baring similar mutations as described above, to alleviate feedback inhibition of enzymes and to alter cofactor dependence, where appropriate..

[104] The microorgan ism/s of the present invention may further comprise modifications which decrease or eliminate the activity of an enzyme that catalyses synthesis of a compound other than methacrylic acid and/or derivatives thereof by competing for the same substrates and/or intermediates in the above mentioned biosynthesis pathways. Examples of such enzymes include YciA, TesA, TesB from Escherichia coli, and those encoded by fadB, ilvA, panB, leuA, ygaZ, ygaH, aceF, aceE, IpdA, tpiA, pfkA, pfkB, mdh, poxB, ilvE, IdhA and IldD, in Escherichia coli, as well as homologues in other host strains as described herein.

[105] The microorgan ism/s of the present invention may further comprise modifications that decrease or eliminate the activity of an enzyme which metabolises methacrylic acid and/or derivatives thereof or metabolises an intermediate in the above-mentioned biosynthesis pathways. Examples of such enzymes related to the metabolism are enzymes of the native valine degradation pathway in E. coli, or other thioesterases that may consume thioester intermediates of the engineered pathway.

[106] The microorgan ism/s of the present invention may also further comprise modifications which decrease or eliminate the activity of proteins involved in other cellular functions that remove intermediates in the above mentioned biosynthesis pathways. Examples of such cellular functions may include storage mechanisms such as vacuolar storage (e.g. in yeasts) or other intracellular bodies capable of storing metabolites (e.g. bacterial microcompartments), the bacterial periplasm or transport mechanisms such as transmembrane pumps or porins capable of exporting metabolites.

[107] Sources of nucleic acids for genes encoding the proteins, in particular the enzymes expressed in the microorganism/s according to the present invention can include, for example, any species where the encoded gene product is capable of catalyzing the referenced reaction. Such species include both prokaryotic and eukaryotic organisms including, but not limited to, bacteria, including archaea and eubacteria, and eukaryotes, including yeast, plant, insect, animal, and mammal, including human. Exemplary species for such sources include, for example, Escherichia coli, Homo sapiens, Propionibacterium fredenreichii, Methylobacterium extorquens, Shigella flexneri, Salmonella enterica, Yersinia frederiksenii, Propionibacterium acnes, Rattus norvegicus, Caenorhabditis elegans, Bacillus cereus, Acinetobacter calcoaceticus, Acinetobacter baylyi, Acinetobacter sp., Clostridium kluyveri, Pseudomonas sp., Thermus thermophilus, Pseudomonas aeruginosa, Pseudomonas putida, Oryctolagus cuniculus, Clostridium acetobutylicum, Leuconostoc mesenteroides, Eubacterium barker!, Bacteroides capillosus, Anaerotruncus colihominis, Natranaerobius thermophilus, Campylobacter jejuni, Arabidopsis thaliana, Corynebacterium glutamicum, Sus scrota, Bacillus subtilus, Pseudomonas fluorescens, Serratia marcescens, Streptomyces coelicolor, Methylibium petroleiphilum, Streptomyces cinnamonensis, Streptomyces avermitilis, Archaeoglobus fulgidus, Haloarcula marismortui, Pyrobaculum aerophilum, Saccharomyces cerevisiae, Clostridium cochlearium, Clostridium tetanomorphum, Clostridium tetani, Citrobacter amalonaticus, Ralstonia eutropha, Mus musculus, Bos taurus, Fusobacterium nucleatum, Morganella morganii, Clostridium pasteurianum, Rhodobacter sphaeroides, Xanthobacter autotrophicus, Clostridium propionicum, Megasphaera elsdenii, Aspergillus terreus, Candida, Sulfolobus tokodaii, Metallosphaera sedula, Chloroflexus aurantiacus, Clostridium saccharoperbutylacetonicum, Acidaminococcus fermentans, Helicobacter pylori, as well as other exemplary species disclosed herein or available as source organisms for corresponding genes.

[108] It should be noted that the one or more genes encoding enzymes which may be expressed in microorgan ism/s of the invention also comprise genes encoding variants of said enzymes, for example, variant enzymes which include substitutions, deletions, insertions or additions of one or several amino acids in the polypeptide sequence, and wherein said polypeptide retains the activity of the unmodified enzyme. Such variant enzymes also include variant enzymes which have a reduced enzymatic activity when compared to the unmodified enzyme and enzymes with modified allosteric control, for example ilvH from Escherichia coli with G14D and S17F mutations, ilvC from Corynebacterium glutamicum R harbouring S34G, L48E and R49F mutations, ilvB and ilvN from Corynebacterium R and ilvN from Corynebacterium R harbouring a G156E mutation.

[109] Methods for constructing and testing the expression of a protein in a non-naturally occurring methacrylic acid producing microorganism can be performed, for example, by recombinant techniques and detection methods well known in the art. Such methods can be found described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1999).

[1 10] Exogenous nucleic acid sequences involved in a pathway for production of methacrylic acid and/or derivatives thereof or an intermediate in the formation thereof can be introduced stably or transiently into a microorganism cell using techniques well known in the art including, but not limited to, conjugation, electroporation, chemical transformation, transduction, transfection, and ultrasound transformation.

[1 11] Examples of transformation methods can include treating recipient microorganism/s_cells with calcium chloride so to increase permeability of the DNA, and preparing competent cells from cells which are in the growth phase, followed by transformation with DNA. Alternatively, a method of making DNA-recipient cells into protoplasts or spheroplasts, which can easily take up recombinant DNA, followed by introducing the recombinant DNA into the cells, which is known to be applicable to Bacillus subtilis, actinomycetes and yeasts can also be employed. In addition, transformation of microorganisms can also be performed by electroporation. Such methods are well known in the art. [1 12] For exogenous expression in E. coli or other prokaryotic microorganism cells, some nucleic acid sequences in the genes or cDNAs of eukaryotic nucleic acids can encode targeting signals such as an N-terminal mitochondrial or other targeting signal, which can be removed before transformation into prokaryotic microorganism cells, if desired. For example, removal of a mitochondrial leader sequence led to increased expression in E. coli (Hoffmeister et al., J. Biol. Chem. 280:4329-4338 (2005). For exogenous expression in yeast or other eukaryotic microorganism cells, genes can be expressed in the cytosol without the addition of leader sequence, or can be targeted to mitochondria or other organelles, or targeted for secretion, by the addition of a suitable targeting sequence such as a mitochondrial targeting or secretion signal suitable for the target organelle. Thus, it is understood that appropriate modifications to a nucleic acid sequence to remove or include a targeting sequence can be incorporated into an exogenous nucleic acid sequence to impart desirable properties. Furthermore, genes can be subjected to codon optimization with techniques well known in the art to achieve optimized expression of the proteins within the microorganism/s.

[1 13] An expression vector or vectors can be constructed to include one or more biosynthetic pathway enzyme(s) encoding nucleic acids as exemplified herein operably linked to expression control sequences functional in the microorganism/s. Expression vectors applicable for use in the microorganism/s of the invention include, for example, plasmids, cosmids, phage vectors, viral vectors, episomes and artificial chromosomes, including vectors and selection sequences or markers operable for stable integration into a host chromosome.

[1 14] Additionally, the expression vectors can include one or more selectable marker genes and appropriate expression control sequences. Selectable marker genes also can be included that, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media. Expression control sequences can include constitutive, inducible or repressible promoters, transcription enhancers, transcription terminators, translation signals and the like which are well known in the art. When two or more exogenous encoding nucleic acid sequences are to be co-expressed, both nucleic acid sequences can be inserted, for example, into a single expression vector or in separate expression vectors. For single vector expression, the encoding nucleic acids can be operationally linked to one common expression control sequence or linked to different expression control sequences, such as inducible promoters and constitutive promoters. In some embodiments, the vector may have two or more promoters for the co-expression of multiple genes or operons. In some embodiments, the genes/operons may be expressed on one or more different vectors with one or more corresponding promoters.

[1 15] The vector used for transformation can be a vector autonomously replicable in a cell of the microorganism/s. Examples of vectors autonomously replicable in bacteria of the Enterobacteriaceae bacteria such as E.coli can include plasmid vectors pUC19, pUC18, pBR322, RSF1010, pHSG299, pHSG298, pHSG399, pHSG398, pSTV28, pSTV29, pET20b(+), pET28b(+) (pET vectors are available from Novagen), pLysS, (pHSG and pSTV vectors are available from Takara Bio Inc.), pMW119, pMW118, pMW219, pMW218 (pMW vectors are available from Nippon Gene Co., Ltd.) and so forth, and their derivatives. Furthermore, vectors for coryneform bacteria can include pAM330 (Japanese Patent Laid-open No. 58-67699), pHM1519 (Japanese Patent Laid-open No. 58-77895), pSFK6 (Japanese Patent Laid-open No. 2000-262288), pVK7 (USP2003-0175912A), pAJ655, pAJ611 , pAJ1844 (Japanese Patent Laid-open No. 58-192900), pCG1 (Japanese Patent Laid-open No. 57-134500), pCG2 (Japanese Patent Laid-open No. 58- 35197), pCG4, pCG11 (Japanese Patent Laid-open No. 57-183799), pHK4 (Japanese Patent Laid-open No. 5-7491) and so forth. Furthermore, vectors for yeast can include yeast plasmids, such as for example pD902 or pD905 for Pichia pastoris, or pD1201 , pD1204, pD1205, pD1207, pD1211 , pD1214 pD1215, pD1217, pD1218, pD1221 , pD1224, pD1225, pD1227, pD1231 , pD1234, pD1235, pD1237 for Saccharomyces cerevisiae. Genes can also be integrated into the host chromosome, using well known methods (e.g. Datensko and Wanner (Datsenko, K. A. and Wanner, B. L. 2000, Proc. Natl. Acad. Sci. USA, 97:6640-6645)).

[1 16] Enhancement of the activity of an enzyme can include enhancing expression of a target gene by replacing an expression regulatory sequence of the target gene such as a promoter on the genomic DNA or plasmid with a promoter which has an appropriate strength. For example, the thr promoter, lac promoter, trp promoter, trc promoter, pL promoter, tac promoter, etc., are known as frequently used promoters. Examples of promoters with high expression activity in microorganisms such as bacteria can include promoters of the elongation factor Tu (EF-Tu) gene, tuf, promoters of genes that encode co-chaperonin GroES/EL, thioredoxin reductase, phosphoglycerate mutase, glyceraldehyde-3-phosphate dehydrogenase, and the like (W02006/028063, EP1697525). Examples of strong promoters and methods for evaluating the strength of promoters are well known in the art.

[1 17] Moreover, it is also possible to substitute several nucleotides in a promoter region of a gene, so that the promoter has an appropriate strength, as disclosed in WO 2000/18935. Substitution of the expression regulatory sequence can be performed, for example, in the same manner as in gene substitution using a temperature sensitive plasmid. Examples of vectors having a temperature sensitive replication origin which can be used for Escherichia coli or Pantoea ananatis can include, for example, plasmid pMAN997 described in International Publication WO 1999/03988, its derivative, and so forth. Furthermore, substitution of an expression regulatory sequence can also be performed by methods which employ linear DNA, such as a method called "Red-driven integration" using Red recombinase of A-phage (Datsenko, K. A. and Wanner, B. L. 2000, Proc. Natl. Acad. Sci. USA, 97:6640-6645), a method combining the Red-driven integration method and the A-phage excisive system (Cho, E. H. et al. 2002. J. Bacteriol. 184:5200-5203) (W02005/010175), and so forth. The modification of an expression regulatory sequence can be combined with increasing the gene copy number.

[1 18] Furthermore, it is known that substitution of several nucleotides in a spacer between the ribosome binding site (RBS) and the start codon, and particularly, the sequences immediately upstream of the start codon profoundly affect the mRNA translatability. Translation can be enhanced by modifying these sequences.

[1 19] When a target gene is introduced into the aforementioned plasmid or chromosome, any promoter can be used for expression of the gene so long as a promoter that functions in the microorganism/s used is chosen. The promoter can be the native promoter of the gene, or a modified promoter. Expression of a gene can also be controlled by suitably choosing a promoter that potently functions in the chosen microorganism/s, or by approximating -35 and -10 regions of a promoter close to the consensus sequence.

[120] The transformation, transduction, conjugational or chromosomal insertion of exogenous nucleic acid sequences involved in a metabolic or synthetic pathway can be confirmed using methods well known in the art. Such methods include, for example, extraction of plasmid or chromosomal DNA followed by polymerase chain amplification of specific target sequences, or restriction mapping, further nucleic acid analysis such as Northern blots or polymerase chain reaction (PCR) amplification of mRNA, or polyacrylamide gel electrophoresis, or enzymatic activity measurements, or immunoblotting for expression of gene products, or other suitable analytical methods to test the expression of an introduced nucleic acid sequence or its corresponding gene product. It is understood by those skilled in the art that the exogenous nucleic acid is expressed in a sufficient amount to produce the desired gene product, and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art.

[121] Optionally, the one or more microorganism/s of the present invention may further be modified to reduce or eliminate the activity of an enzyme or protein partaking in a cellular function which:

(i) diverts material from methacrylic acid producing pathways; and/or

(ii) metabolises methacrylic acid and/or derivatives thereof.

[122] In order to reduce or eliminate the activities of the aforementioned enzymes or proteins, mutations for reducing or eliminating intracellular activities of the enzymes or proteins can be introduced into the genes of the aforementioned enzymes or proteins by conventional random or site directed mutagenesis or genetic engineering techniques. Examples of the mutagenesis can include, for example, X-ray or ultraviolet ray irradiation, treatment with a mutagen such as N- methyl-N'-nitro-N-nitrosoguanidine, in vitro site directed or random mutagenesis by high fidelity or error-prone polymerase chain reaction, respectively, and so forth. The site on the gene where the mutation is introduced can be in the coding region encoding the enzyme or protein or an expression control region such as a promoter. Examples of genetic engineering techniques can include genetic recombination, transduction, cell fusion, gene knockouts, and so forth.

[123] A decrease or elimination of the intracellular activity of the objective enzyme or protein and the degree of decrease can be confirmed by measuring the enzyme or protein activity in a cell extract or a purified fraction thereof obtained from a candidate strain, and comparing it with that of a wild-type strain, or by measuring formation of the target product by whole cells. [124] Examples of other methods for imparting or enhancing methacrylic acid and/or derivatives thereof producing ability and/or intermediates thereof can include imparting resistance to methacrylic acid or an organic acid analogue, respiratory inhibitor or the like and imparting sensitivity to a cell wall synthesis inhibitor. These methods can include, for example, selecting for resistant cells by growing with increasing concentrations of the toxic substance, imparting monofluoroacetic acid resistance, imparting adenine resistance or thymine resistance, attenuating urease, imparting malonic acid resistance, imparting resistance to benzopyrones or naphthoquinones, imparting HOQNO resistance, imparting alpha-ketomalonic acid resistance, imparting guanidine resistance, imparting sensitivity to penicillin, and so forth as is known in the art.

[125] Examples of such resistant bacteria can include the following strains: Brevibacterium flavum AJ3949 FERM BP-2632; Corynebacterium glutamicum AJ11628 FERM P-5736; Brevibacterium flavum AJ11355 FERM P-5007; Corynebacterium glutamicum AJ11368 FERM P- 5020; Brevibacterium flavum AJ11217 FERM P-4318; Corynebacterium glutamicum AJ11218 FERM P-4319; Brevibacterium flavum AJ11564 FERM P-5472; Brevibacterium flavum AJ11439 FERM P-5136; Corynebacterium glutamicum H7684 FERM BP-3004; Brevibacterium lactofermentum AJ11426 FERM P-5123; Corynebacterium glutamicum AJ11440 FERM P-5137; and Brevibacterium lactofermentum AJ11796 FERM P-6402.

[126] Further methods for imparting or enhancing methacrylic acid and/or derivatives thereof producing ability and/or intermediates thereof can include imparting resistance to down- regulators/inhibitors, imparting sensitivity to up-regulators/activators or alleviating the need for allosteric activation of enzymes by other compounds. For example, alleviation of the need for allosteric activation of branched chain keto acid dehydrogenase from Pseudomonas putida by valine, or alleviation of allosteric inhibition of acetolactate synthase from Escherichia coll.

Fermentation

[127] The process/es of the present invention may be conducted by culturing the microorgan ism/s of the present invention, suitably in a medium.

[128] Suitably, therefore, the process/es of the present invention may further comprise the step of culturing one or more microorganism/s to produce methacrylic acid and/or derivatives thereof such as methacrylic acid esters.

[129] Preferably said culturing takes place in a fermentation medium.

[130] The methacrylic acid and/or derivative thereof may be present in the fermentation medium or within the cells of the microorganism/s.

[131] Suitably, therefore, the process/es of the present invention may further comprise the step of collecting the methacrylic acid and/or an intermediate in the formation thereof and/or a derivative thereof such as a methacrylic acid ester from the fermentation medium or from the microorganism/s cells. [132] The methacrylic acid and/or a derivative thereof such as a methacrylic acid ester may be present in the fermentation medium by the microorganism/s secreting methacrylic acid and/or a derivative thereof such as a methacrylic acid ester as described hereinabove.

[133] The methacrylic acid and/or a derivative thereof such as a methacrylic acid ester may be present in the cells of the microorganism/s by the microorganism accumulating methacrylic acid and/or derivatives thereof such as a methacrylic acid ester as described hereinabove.

[134] Suitably therefore the cells are removed from the fermentation medium by any means known in the art, such as filtration, centrifugation, etc, and methacrylic acid or salt thereof and/or methacrylic acid ester is collected from the fermentation medium by any means known in the art, such as: distillation, liquid-liquid extraction, etc. Suitably therefore, the processes of the invention may comprise a further step of collecting the methacrylic acid and/or derivative thereof such as a methacrylic acid ester from the surrounding medium, this may be implemented by first removing the cells from the medium by filtration or centrifugation and then extracting the methacrylic acid and/or derivative thereof from the clarified medium by distillation or liquid-liquid extraction.

[135] Optionally, collecting the methacrylic acid and/or derivative thereof such as a methacrylic acid ester may further comprise a step of releasing the methacrylic acid and/or derivative thereof such as a methacrylic acid ester from the cell which may be performed by any means known in the art, preferably where the cell is lysed to release the desirable product, such as: by sonication, homogenization, enzymatic treatment, bead-milling, osmotic shock, freeze-thaw, acid/base treatment, phage lysis, etc. followed by a similar collection method from the fermentation medium as detailed above. Suitably therefore, the processes of the invention may comprise the further steps of collecting the methacrylic acid and/or derivative thereof such as a methacrylic acid ester from the cells, this may be implemented by lysing the cells, and subsequent filtration of cell debris followed by the extraction of methacrylic acid and/or derivative thereof such as a methacrylic acid ester.

[136] Suitably, culturing or cultivation of a microorganism requires a carbon based feedstock upon which the microorganism may derive energy and grow. Preferably, therefore, the microorganism/s are cultured on a carbon based feedstock, and the processes of the first or second aspects of the invention may further comprise the step of culturing the one or more microorganism/s which are able to produce methacrylic acid and/or derivatives thereof from a carbon based feedstock.

[137] Preferably the culturing or cultivation takes place in a fermentation medium, suitably a surrounding medium which surrounds the microorganism/s, preferably the carbon based feedstock is present in the medium, optionally dissolved or suspended in the medium, bubbled through the medium and/or mixed with the medium. Preferably therefore the medium comprises the microorganism/s and the carbon based feedstock together with any buffers and salts.

[138] Preferably the fermentation medium further comprises methacrylic acid and/or derivatives thereof such as methacrylic acid esters. [139] Preferably the microorganism/s produce methacrylic acid and/or derivatives thereof such as methacrylic acid esters at an increased rate above that of the basal rate as explained above, such that preferably the concentration of methacrylic acid and/or derivatives thereof such as methacrylic acid esters present in the medium, either from direct secretion or from lysing the cells, is at high titre.

[140] Preferably the titre of methacrylic acid and/or derivatives thereof such as methacrylic acid esters present in the fermentation medium is at least 5mg/L. For example, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95, 105, 115, 125, 135, 145, 155 mg/L, preferably at least greater than 130mg/L.

[141] Preferably, in an embodiment where the methacrylic acid and/or derivatives thereof such as methacrylic acid esters accumulate within the microorganism/s, the concentration of methacrylic acid and/or an intermediate thereof and/or derivatives thereof such as methacrylic acid esters present in the cell is at least 0.05mM, more preferably at least 0.1 mM, more preferably at least 1 mM, more preferably at least 2mM, more preferably at least 5mM, more preferably at least 10mM. Preferably the concentration of methacrylic acid or an intermediate thereof and/or derivatives thereof such as methacrylic acid esters in the cell ranges between 10mM to about 300mM, more preferably about 20mM to about 200mM, still more preferably about 30mM to about 100mM most preferably about 40mM to about 70mM.

[142] The microorganism/s of the invention may be cultivated or cultured as a batch, a repeated batch, a fed-batch, a repeated fed-batch or a continuous cultivation process.

[143] Suitably, the cultivation process takes place in a culture medium, otherwise known herein as the surrounding medium or fermentation medium. Preferably a fed-batch or repeated fed-batch process is applied, wherein the carbon source and/or the nitrogen source and/or additional compounds are fed to the cultivation process. More preferably, the carbon and/or nitrogen source are fed into the cultivation process.

[144] The fermentation medium in which the microorganism/s of the present invention are cultured may be any commercially available medium suitable for the needs of the organism in question, provided that the relevant nutrients required by said organism are limiting. The culture may be aerobic or anaerobic, however in the context of the invention where the oxidase enzyme is employed, the culture is preferably aerobic.

[145] The fermentation medium suitably contains a carbon based feedstock as described above, and a nitrogen source, as well as additional compounds required for growth of the microorganism/s and/or the formation of methacrylic acid and/or methacrylic acid ester.

[146] Examples of suitable carbon based feedstocks known in the art include glucose, maltose, maltodextrins, sucrose, hydrolysed starch, starch, lignin, aromatics, syngas or its components, methane, ethane, propane, butane, molasses and oils. Preferably the carbon based feedstock is derived from biomass. Mixtures may also be used, as well as wastes, such as municipal waste, food waste and lignocellulosic wastes from food processing, forestry or agriculture. [147] Examples of suitable nitrogen sources known in the art include soy bean meal, corn steep liquor, yeast extract, ammonia, ammonium salts, nitrate salts, urea, nitrogen gas or other nitrogenous sources.

[148] Examples of additional compounds required for growth of the microorganism/s include antibiotics, antifungals, anti-oxidants, buffers, phosphate, sulphate, magnesium salts, trace elements and/or vitamins.

[149] The total amount of carbon based feedstock and nitrogen source to be added to the medium may vary depending on the needs of the microorganism/s and/or the length of the cultivation process.

[150] The ratio between the carbon based feedstock and the nitrogen source in the culture medium may vary considerably.

[151] Additional compounds required for growth of the microorganism/s and/or for the production of methacrylic acid and/or derivatives thereof such as methacrylic acid esters, like phosphate, sulphate or trace elements, may be added in amounts that may vary between different classes of microorganisms, i.e. between fungi, yeasts and bacteria. In addition, the amount of additional compound to be added may be determined by whether methacrylic acid and/or derivatives thereof such as methacrylic acid esters are formed and what pathways are used to form them.

[152] Typically, the amount of each fermentation medium component necessary for growth of a microorganism is determined by measuring the growth yield on the nutrient and further assessed in relation to the amount of carbon based feedstock used in the culturing or cultivation process, since the amount of biomass formed will be primarily determined by the amount of carbon based feedstock used, and the nutrient limitations imposed during any feeding regime.

[153] The culturing or cultivation process according to the invention is preferably performed on an industrial scale. An industrial scale process is understood to encompass a culturing or cultivation process in one or more fermenters of a volume scale which is > 0.01 m ³ , preferably > 0.1 m ³ , preferably > 0.5 m ³ , preferably > 5 m ³ , preferably > 10 m ³ , more preferably > 25 m ³ , more preferably > 50 m ³ , more preferably > 100 m ³ , most preferably > 200 m ³ .

[154] Preferably, the culturing or cultivation of the microorganism/s of the invention is generally performed in a bioreactor. A ‘Bioreactor’ is generally understood to mean a container in which microorganisms are industrially cultured. Bioreactors can be of any size, number and form, and can include inlets for providing nutrients, additional compounds for growth, fresh medium, carbon based feedstocks, additives of gases, such as, but not limited to, air, nitrogen, oxygen or carbon dioxide. Bioreactors may also comprise outlets for removing volumes of the culture medium to collect the methacrylic acid and/or methacrylic acid ester either from the fermentation medium itself or from within the microorganism/s. The bioreactor preferably also has an outlet for sampling of the culture. The bioreactor can generally be configured to mix the fermentation medium, for example, by stirring, rocking, shaking, inverting, bubbling of gas through the culture etc. Alternatively, some continuous cultures do not require mixing, for example microreactor systems using a plug flow system. Bioreactors are common and well known in the art and examples may be found in standard texts, such as ‘Biotechnology: A Textbook of Industrial Microbiology, Second Edition’ (1989) Authors: Wulf Cruegar and Annelise Crueger, translated by Thomas D. Brock Sinauer Associates, Inc., Sunderland, MA.

Bioreactor

[155] Optionally, the bioreactor may comprise a plurality of different microorgan ism/s of the present invention.

[156] Preferably, the bioreactor comprises only microorganism/s capable of performing the process of the invention.

[157] More preferably the bioreactor comprises only microorganism/s of the same species such that the same culturing conditions can be used throughout.

Biomass Feedstock

[158] Preferably the biomass used comprises a high amount of carbohydrates, particularly preferable are carbohydrates which are sources of C5 or C6 sugars, carbon based gases, or aromatics, preferably C5 or C6 sugars, more preferably glucose, such as, but not limited to starch, lignin, cellulose, glycogen, arabinoxylan, chitin, or pectin.

[159] Alternatively, the biomass used comprises a high amount of fats, particularly preferable are fats or oils which are sources of glycerol and fatty acids, specifically triglycerides. Suitable triglycerides include any oil or fat which is readily available from a plant or animal source. Examples of such oils and fats include: palm oil, linseed oil, rapeseed oil, lard, butter, herring oil, coconut oil, vegetable oil, sunflower oil, castor oil, soybean oil, olive oil, cocoa butter, ghee, blubber etc.

[160] The biomass may be composed of one or more different biomass sources. Examples of suitable biomass sources are as follows; virgin wood, energy crops, agricultural residues, food waste, municipal waste and industrial waste or co-products.

[161] Virgin wood biomass sources may include but are not limited to; wood chips; bark; brash; logs; sawdust; wood pellets or briquettes.

[162] Energy crop biomass sources may include but are not limited to; short rotation coppices or forestry; non-woody grasses such as miscanthus, hemp switchgrass, reeds or rye; agricultural crops such as sugar, starch or oil crops; or aquatic plants such as micro or macroalgae and weeds.

[163] Agricultural residues may include but are not limited to; husks; straw; corn stover; flour; grains; poultry litter; manure; slurry; syngas; or silage.

[164] Food wastes may include but are not limited to; peel/skin; shells; husks; cores; pips/stones; inedible parts of animals or fish; pulp from juice and oil extraction; spent grains or hops from brewing; domestic kitchen waste; lard or oils or fats. [165] Industrial wastes may include but are not limited to; untreated wood including pallets, treated wood, shale gases, wood composites including MDF/OSD, wood laminates, paper pulp/shreddings/waste; textiles including fibre/yarn/effluent; or sewage sludge.

Further Products

[166] The production of other useful organic compounds, for example derivatives of methacrylic acid such as various esters thereof is also envisaged. Accordingly, the methacrylic acid product may be esterified to produce an ester thereof. Potential esters may be selected from C1-C20 alkyl or C2-C12 hydroxyalkyl, glycidyl, isobornyl, dimethylaminoethyl, tripropyleneglycol esters. Most preferably the alcohols or alkenes used for forming the esters may be derived from bio sources, e.g. biomethanol, bioethanol, biobutanol. Preferred esters are ethyl, n-butyl, i-butyl, hydroxymethyl, hydroxypropyl or methyl methacrylate, most preferably, methyl methacrylate or butyl methacrylate.

[167] Preferably methacrylic acid is converted to alkyl or hydroxyalkyl methacrylate by an esterification reaction. Suitable reaction conditions for such a conversion are well known in the art and are described in conjunction with the production of methacrylic acid in WO/2012/069813.

[168] According to the present invention there is provided a method of preparing polymers or copolymers of methacrylic acid or methacrylic acid esters, comprising the steps of:

(i) preparation of methacrylic acid and/or derivatives thereof in accordance with the process/es of the present invention (as herein defined);

(ii) optional esterification of the methacrylic acid prepared in (i) to produce the methacrylic acid ester; and

(iii) polymerisation of the methacrylic acid and/or derivatives thereof prepared in (i) and/or, if present, the ester prepared in (ii), optionally with one or more comonomers, to produce polymers or copolymers thereof.

[169] Preferably, the methacrylic acid ester of (ii) above is selected from C1-C20 alkyl or C2-C12 hydroxyalkyl, glycidyl, isobornyl, dimethylaminoethyl, tripropyleneglycol esters, more preferably, ethyl, n-butyl, i-butyl, hydroxymethyl, hydroxypropyl or methyl methacrylate, most preferably, methyl methacrylate, ethyl methacrylate, butyl methacrylate or butyl methacrylate.

[170] Thus, according to the present invention there is provided a method of preparing polymers or copolymers of methacrylic acid esters, comprising the steps of:

[171] Advantageously, such polymers will have an appreciable portion if not all of the monomer residues derived from a source other than fossil fuels.

[172] Preferred comonomers include for example, monoethylenically unsaturated carboxylic acids and dicarboxylic acids and their derivatives, such as esters, amides and anhydrides.

[173] Particularly preferred comonomers are acrylic acid, methyl acrylate, ethyl acrylate, propyl acrylate, n-butyl acrylate, iso-butyl acrylate, t-butyl acrylate, 2-ethylhexyl acrylate, hydroxyethyl acrylate, iso-bornyl acrylate, methacrylic acid, methyl methacrylate, ethyl methacrylate, propyl methacrylate, n-butyl methacrylate, iso-butyl methacrylate, t-butyl methacrylate, 2-ethylhexyl methacrylate, hydroxyethyl methacrylate, lauryl methacrylate, glycidyl methacrylate, hydroxypropyl methacrylate, iso-bornyl methacrylate, dimethylaminoethyl methacrylate, tripropyleneglycol diacrylate, styrene, a-methyl styrene, vinyl acetate, isocyanates including toluene diisocyanate and p,p'-methylene diphenyl diisocyanate, acrylonitrile, butadiene, butadiene and styrene (MBS) and ABS subject to any of the above comonomers not being the momomer selected from methacrylic acid or a methacrylic acid ester in (i) or (ii) above in any given copolymerisation of the said acid monomer or ester in (i) or a said ester monomer in (ii) with one or more of the comonomers.

[174] It is of course also possible to use mixtures of different comonomers. The comonomers themselves may or may not be prepared by the same process as the monomers from (i) or (ii) above.

[175] The invention is further defined in the following numbered embodiments:

[176] 1. A process of producing methacrylic acid and/or derivatives thereof comprising the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by the action of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii and

(b) converting methacrylyl-CoA into methacrylic acid and/or derivatives thereof.

[177] 2. A process according to embodiment 1 , wherein step (b) may be conducted biologically or chemically.

[178] 3. A process according to any of embodiments 1 or 2, wherein the derivatives thereof of methacrylic acid are methacrylic acid esters, more preferably, C1 to C20 alkyl esters, most preferably C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters.

[179] 4. A process according to embodiment 3, wherein the methacrylic acid esters are butyl methacrylates, for example n-butylmethacrylate.

[180] 5. A process according to embodiment 3 or 4, wherein the methacrylic acid esters are formed biologically by the action of a transferase.

[181] 6. A process according to embodiment 5, wherein the transferase is an alcohol acyltransferase, suitably under EC group number 2.3.1.84.

[182] 7. A process according to embodiment 6, wherein the alcohol acyltransferase is derived from a fruit origin such as apple, melon or tomato origin.

[183] 8. A process according to any of embodiments 6 or 7, wherein the alcohol acyltransferase acts in the presence of an alcohol, for example a C1 to C12 alcohol, such as a C1 to C4 alcohol or a C4 to C12 alcohol to form the corresponding alkyl ester.

[184] 9. A process according to embodiment 8, wherein the alcohol is butanol.

[185] 10. A process according to any of embodiments 1 or 2, wherein the process comprises a further step (c) of converting methacrylic acid formed in step (b) into a methacrylic acid ester. [186] 11 . A process according to embodiment 10, wherein step (c) may be conducted biologically or chemically.

[187] 12. A process according to embodiments 10 or 11 , wherein step (c) is conducted biologically by the action of an esterase or hydrolase.

[188] 13. A process according to any of embodiments 1 , 2 or 10-12, wherein methacrylyl-CoA is converted into methacrylic acid by the action of a thioesterase, transferase, synthetase, and/or a phosphotransacylase and a short chain fatty acid kinase.

[189] 14. A process according to embodiment 13, wherein methacrylyl-CoA is converted into methacrylic acid by the action of a thioesterase.

[190] 15. A process according to embodiment 13 or 14, wherein the thioesterase is a 4- hydroxybenzoyl-CoA thioesterase, suitably under EC group 3.1 .2.23.

[191] 16. A process according to embodiment 16 or 17, wherein the thioesterase is under EC group number 3.1 .2.X, the transferase is a CoA transferase under EC group number 2.8.3.X, the synthetase is an acid-thiol synthetase under EC group number 6.2.1 .X, the phosphotransacylase is under EC group number 2.3.1 .X, and the short chain fatty acid kinase is under EC group number 2.7.2.X.

[192] 17. A process according to any of embodiments 13-16 , wherein the thioesterase is selected from any of the following enzymes: acyl-CoA thioesterase 4HBT from Arthrobacter sp., acyl-CoA thioesterase 4HBT from Arthrobacter globiformis, 4HBT from Pseudomonas sp. strain CBS-3, EntH from Escherichia coli, YciA from Escherichia coli or Haemophilus influenzae, TesA or TesB from Escherichia coli and FcoT from Mycobacterium tuberculosis; the CoA transferase is selected from any of the following enzymes: butyryl-CoA:acetoacetate CoA transferase from Clostridium sp. SB4, butyryl-CoA:acetoacetate CoA transferase from Clostridium sticklandii, butyrate: acetoacetate CoA-transferase from Clostridium acetobutylicum ATCC824, and acetate coenzyme A transferase ydiF from Escherichia coll; the phosphotransacylase is selected from any of the following enzymes: Phosphotransbutyrylase from Clostridium acetobutylicum ATCC824; and the short chain fatty acid kinase is selected from any of the following enzymes: branched chain fatty acid kinase from Spirochete MA-2, butyrate kinase from Thermotoga maritima, and butyrate kinase from Clostridium butyricum.

[193] 18. A process according to any of embodiments 13 to 17, wherein methacrylyl-CoA is converted into methacrylic acid by the action of a thioesterase and the thioesterase is acyl-CoA thioesterase 4HBT from Arthrobacter sp. Strain SU.

[194] 19. A process according to any preceding embodiment, wherein the biological conversions of the process are conducted by enzymes in one or more host microorganism/s.

[195] 20. A microorganism for use in producing methacrylic acid and/or derivatives thereof according to the process of any of embodiments 1-19.

[196] 21 . A recombinant microorganism adapted to conduct the following steps: (a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid; wherein the recombinant microorganism is Escherichia coll.

[197] 22. A microorganism modified by one or more heterologous nucleic acids to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid.

[198] 23. A microorganism adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid and/or derivatives thereof.

[199] 24. A microorganism according to embodiment 20 or 23, wherein the derivatives thereof of methacrylic acid are methacrylic acid esters, more preferably C1 to C20 alkyl esters, most preferably, C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters.

[200] 25. The microorganism according to embodiments 20-24, wherein the microorganism expresses the following enzymes:

(a) (i) an acyl-CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and one or more of:

(b) (i) an acyl-CoA thioesterase;

(ii) a CoA transferase;

(iii) an acid-thiol synthetase;

(iv) a phosphotransacylase and a short chain fatty acid kinase;

(v) an alcohol acyltransferase.

[201] 26. The microorganism according to embodiment 25, wherein the microorganism expresses an acyl-CoA thioesterase, such as 4HBT.

[202] 27. The microorganism according to embodiment 26, wherein the microorganism expresses 4HBT, suitably from Arthrobacter sp.

[203] 28. The microorganism according to any of embodiments 20-27, wherein the microorganism expresses the one or more enzymes endogenously or the microorganism expresses the one or more enzymes heterologously, or the microorganism expresses a combination of endogenous and heterologous enzymes.

[204] 29. The microorganism according to any of embodiments 20-27, wherein the microorganism is selected from wild type or recombinant microorganism/s, for example, bacteria, archeae, yeast, fungus, algae or any of a variety of other microorgan ism/s applicable to fermentation processes.

[205] 30. The microorganism according to embodiment 29, wherein the microorganism is a bacterium selected from: enterobacteria belonging to proteobacteria of the genus Escherichia, Enterobacter, Pantoea, Klebsiella, Serratia, Erwinia, Salmonella, Morganella, or the like, so-called coryneform bacteria belonging to the genus Brevibacterium, Corynebacterium or Microbacterium and bacteria belonging to the genus Alicyclobacillus, Bacillus, Hydrogenobacter, Methanococcus, Acetobacter, Acinetobacter, Agrobacterium, Axorhizobium, Azotobacter, Anaplasma, Bacteroides, Bartonella, Bordetella, Borrelia, Brucella, Burkholderia, Calymmatobacterium, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Coxiella, Ehrlichia, Enterococcus, Francisella, Fusobacterium, Gardnerella, Haemophilus, Helicobacter, Kelbsiella, Methanobacterium, Micrococcus, Moraxella, Mycobacterium, Mycoplasma, Neisseria, Pasteurella, Peptostreptococcus, Porphyromonas, Prevotella, Pseudomonas, Rhizobium, Rickettsia, Rochalimaea, Rothia, Shigella, Staphylococcus, Stenotrophomonas, Streptococcus, Treponema, Vibrio, Wolbachia, Yersinia.

[206] 31 . A recombinant microorganism adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid by expression of a 4- hydroxybenzoyl-CoA thioesterase (4HBT); wherein the recombinant microorganism is Escherichia coll.

[207] 32. A microorganism modified by one or more heterologous nucleic acids to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid by expression of a 4- hydroxybenzoyl-CoA thioesterase (4HBT).

[208] 33. A microorganism adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into methacrylic acid by expression of a 4- hydroxybenzoyl-CoA thioesterase (4HBT).

[209] 34. A recombinant microorganism adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into meth aery lyl-CoA by expression of an acyl-

CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and (b) biologically converting methacrylyl-CoA into a methacrylic acid ester by expression of an alcohol acyl transferase; wherein the recombinant microorganism is Escherichia coli.

[210] 35. A microorganism modified by one or more heterologous nucleic acids to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into a methacrylic acid ester by expression of an alcohol acyl transferase.

[211] 36. A microorganism adapted to conduct the following steps:

(a) biologically converting isobutyryl-CoA into methacrylyl-CoA by expression of an acyl- CoA oxidase from Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii; and

(b) biologically converting methacrylyl-CoA into a methacrylic acid ester by expression of an alcohol acyl transferase.

[212] 37. A microorganism according to any of embodiments 32, 33, 35 or 36, wherein the microorganism is Escherichia coli.

[213] 38. A microorganism according to any of embodiments 34-37, wherein the alcohol acyl transferase is from a fruit origin such as apple, melon or tomato origin.

[214] 39. A microorganism according to any of embodiments 32, 33 or 35-38, wherein the microorganism is a recombinant microorganism.

[215] 40. The microorganism according to any of embodiments 20-39, wherein the microorganism is genetically modified to enhance production of methacrylic acid and/or derivatives thereof.

[216] 41. The microorganism according to any of embodiments 20-39, wherein the microorganism may be genetically modified by modifications which decrease or eliminate the activity of an enzyme that catalyses synthesis of a compound other than methacrylic acid and/or derivatives thereof by competing for the same substrates and/or intermediates, by modifications that decrease or eliminate the activity of an enzyme which metabolises methacrylic acid or metabolises an intermediate in the production of methacrylic acid, and/or by modifications which decrease or eliminate the activity of proteins involved in other cellular functions that remove intermediates in the production of methacrylic acid and/or derivatives thereof.

[217] 42. A microorganism according to any of embodiments 34-41 , wherein the methacrylic acid esters are C1 to C20 alkyl esters, most preferably, C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters.

[218] 43. A process of production of methacrylic acid using a microorganism according to any of embodiments 20-42. [219] 44. A process of fermentation comprising culturing one or more microorganism/s of any of embodiments 20-42 in a fermentation medium to produce methacrylic acid and/or derivatives thereof.

[220] 45. A process according to embodiment 44, wherein the derivatives thereof of methacrylic acid are methacrylic acid esters, more preferably, C1 to C20 alkyl esters, most preferably, C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters.

[221] 46. A fermentation medium comprising one or more microorganism/s of any of embodiments 20-42.

[222] 47. A fermentation medium according to embodiment 46, wherein the medium further comprises methacrylic acid and/or derivatives thereof.

[223] 48. A fermentation medium according to embodiment 47, wherein the derivatives thereof of methacrylic acid are methacrylic acid esters, more preferably, C1 to C20 alkyl esters, most preferably, C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters.

[224] 49. A bioreactor comprising one or more microorganism/s of any of embodiments 20-42 and/or the fermentation medium of any of embodiments 46-48.

[225] 50. A method of preparing polymers or copolymers of methacrylic acid or methacrylic acid esters, comprising the steps of:

(i) preparation of methacrylic acid and/or derivatives thereof in accordance with any of embodiments 1-19 or 43;

(ii) optional esterification of the methacrylic acid prepared in (i) to produce the methacrylic acid ester;

(iii) polymerisation of the methacrylic acid and/or derivatives thereof prepared in (i) and/or, if present, the ester prepared in (ii), optionally with one or more comonomers, to produce polymers or copolymers thereof.

[226] 51 . A method according to embodiment 50, wherein the derivatives thereof of methacrylic acid are methacrylic acid esters, more preferably, C1 to C20 alkyl esters, most preferably, C1 to C12 alkyl esters, especially C1 to C4 alkyl esters or C4 to C12 alkyl esters.

[227] 52. Polymethacrylic acid, polymethylmethacrylate (PMMA) and polybutylmethacrylate homopolymers or copolymers formed from the method of embodiments 50 or 51 .

Brief Description of Figures

[228] The invention will now be illustrated with reference to the following non-limiting examples and figures in which:-

[229] Figure 1 shows a reaction scheme for the conversion of 2-ketoisovalerate and 1-butnaol to butyl methacrylate, via sequential reaction steps catalysed by the enzymes branched chain keto acid dehydrogenase (BCKD), acyl-CoA oxidase (ACX) and alcohol acyl transferase (AAT).

[230] Figure 2 shows an illustration of plasmid pGGV4 carrying the bkdA1 , bkdA2, bkdB and IpdV genes encoding the Pseudomonas putida KT2440 BCKD complex. [231] Figure 3 shows an illustration of a recombinant plasmid for expression of BCKD, an ACX and apple AAT in recombinant E. coli.

Examples

Bacterial strains

[232] Escherichia coli DH5a (ThermoFisher Scientific) was used as a general cloning host for transformation of DNA assembly reactions and routine propagation of plasmids.

[233] A derivative of f. coli BW25113 was used for whole cell biotransformation experiments (Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci USA. 97:6640-6645).

Growth media

[234] Lysogeny Broth (LB): LB-Miller medium comprised of peptone (10 g/L), yeast extract (5 g/L) and sodium chloride (10 g/L) was used for routine culture of E. coli strains. For solid medium, agar was added to a final concentration of 1.0% (w/v). Medium was sterilised by autoclaving. Where appropriate medium was supplemented with carbenicillin (50 pg/ml) and sucrose (10% w/v).

[235] LUND mediunr. The following were combined and made up to a final volume of 1 L with deionised water (dF ): 200 ml 5x LUND salts solution (10 g/L (NH4)SC>4, 73 g/L K2HPO4, 18 g/L NaH2PC>4.2H2O, 2.5 g/L (NFL)! I citrate), 40 ml glucose solution (25% w/v), 20 ml MgSC solution (1 M), 2 ml trace element solution (0.5 g/L CaCl2.2H2O, 10.03 g/L FeCh, 0.18 g/L ZnSC JF , 0.16 g/L CUSO4.5H ₂ O, 0.15 g/L MnSC>4.H2O, 0.18 g/L C0CI.6H2O, 22.3 g/L Na ₂ EDTA.2H ₂ O). Where appropriate, LUND medium was supplemented with carbenicillin (50 pg/ml) and butanol (5 mM).

[236] Biotransformation medium-. To prepare 1 L biotransformation (BT) medium, 200 mL 5x BT solution (73 g/L KH2PO4, 18 g/L NaH2PC>4.2H2O, 10 mL 1 M MgSC , 10 mL LUND trace element solution), 1.79 g sodium-2-ketoisovalerate (Sigma 198994), 1.11 g 1-butanol (Sigma 537993) and 10 mL glycerol (20% (w/v)) were made up to 900 mL with dF , and the pH adjusted to 7.0. dH2<D was added to a final volume of 1 L and the medium was filter sterilised (0.2 pm pore size) by vacuum filter funnel under aseptic conditions. Biotransformation medium was supplemented with carbenicillin (50 pg/ml).

Examples 1-6 and Control: Whole cell production of butyl methacrylate from 2-ketoisovalerate by recombinant Escherichia coli

[237] Nucleotide sequences encoding acyl-CoA oxidases from Spinacia oleracea (x2), Populus alba, Trema orientale, Arachis hypogaea and Parasponia andersonii and ACX4 from Arabidopsis thaliana as a control, were each codon optimised for expression in E. coli and synthesised by Twist Bioscience. The sequences were provided individually in pET-21 (+) plasmids (commercially available from Novagen). Each of the nucleotide sequences encoding the acyl-CoA oxidases were synthesised with the following 5’- and 3’-tails to facilitate one-pot DNA assembly: 5’ tail: tctagaaataattttgttcgtctcgaattcttaactttaagaaggagatatacc

3’ tail: taactcgagtaaactagtgagacggatccggc

[238] The GenBank IDs of the enzymes and the SEQ ID NOs of the nucleotide sequences as synthesised by Twist are shown in Table 1 and the list of sequences below.

[239] The nucleotide sequence encoding alcohol acyl transferase (AAT) from apple was codon optimised for expression in E. coli and synthesised by Twist Bioscience. The sequence was provided in a pET21 (+) plasmid (commercially available from Novagen). The nucleotide sequence encoding AAT from apple was synthesised with the following 5’- and 3’-tails to facilitate one-pot DNA assembly:

5’ tail: gagtaacgtctcactagttttgtttaactttaagaaggagatatacc

3’ tail: cttaaggagacggagcaaaa

Table 1 : GenBank IDs and List of Sequences

List of Sequences

[240] SEQ ID NO. 1 - codon optimised gene sequence for acyl-CoA oxidase (ACX4) from Spinacia oleracea for expression in Escherichia coli (including the 5’- and 3’-tails).

[241] SEQ ID NO. 2 - codon optimised gene sequence for acyl-CoA oxidase (ACXb) from Spinacia oleracea for expression in Escherichia coli (including the 5’- and 3’-tails).

[242] SEQ ID NO. 3 - codon optimised gene sequence for acyl-CoA oxidase from Populus alba for expression in Escherichia coli (including the 5’- and 3’-tails).

[243] SEQ ID NO. 4 - codon optimised gene sequence for acyl-CoA oxidase from Trema orientale for expression in Escherichia coli (including the 5’- and 3’-tails).

[244] SEQ ID NO. 5 - codon optimised gene sequence for acyl-CoA oxidase from Arachis hypogaea for expression in Escherichia coli (including the 5’- and 3’-tails).

[245] SEQ ID NO. 6 - codon optimised gene sequence for acyl-CoA oxidase from Parasponia andersonii for expression in Escherichia coli (including the 5’- and 3’-tails). [246] SEQ ID NO. 7 - codon optimised gene sequence for acyl-CoA oxidase from Arabidopsis thaliana for expression in Escherichia coli (including the 5’- and 3’-tails).

[247] SEQ ID NO. 8 - codon optimised gene encoding alcohol acyl transferase (AAT) from apple for expression in E. coli (including the 5’- and 3’-tails).

[248] SEQ ID NO 9 - sequence of the pGGV4 vector (as shown in Fig, 2).

One-pot DNA assemblies

[249] One-pot DNA assembly reactions were set up to construct plasmids expressing an individual acyl-CoA oxidase candidate in addition to P. putida BCKD and apple AAT.

[250] The recipient plasmid was pGGV4 (SEQ ID NO. 9) as shown in Figure 2. pGGV4 is an expression vector that contains the ‘ppBCKD’ polynucleotide sequence containing the four genes encoding the subunits of the Pseudomonas putida KT2440 branched chain keto acid dehydrogenase (bkdA1, bkdA2, bkdB and IpdV), the ampR gene (with promoter sequence), conferring resistance to ampicillin, and the sacB gene (with promoter sequence) flanked by EcoRI and Aflll restriction sites.

[251] The donor plasmids were the pET21 (+) plasmids containing the codon optimised nucleotide sequence of the candidate acyl-CoA oxidases and the plasmid containing the codon optimised nucleotide sequence of apple AAT. For each one-pot assembly, the recipient plasmid and two donor plasmids - one containing a candidate acyl-CoA sequence and one containing the apple AAT sequence - were added to the reaction mix.

[252] A quantity of 20 fmol recipient plasmid was mixed with 40 fmol of each of the donor plasmids. To this, 1 pl T4™ DNA ligase (New England Biolabs, M0202), 1 pl Esp3l (New England Biolabs, R0734) and 2 pl 10xT4™ DNA ligase buffer (New England Biolabs, M2622) were added, and the volume was made up to 20 pl with deionised H2O. The mix was then incubated in a thermocycler under the following conditions: 30 digestion-ligation cycles of 37°C for 5 mins then 16°C for 5 mins, followed by a final digestion step of 37°C for 5 mins, and heat inactivation at 65°C for 20 mins. The reaction was then held at 4°C before transformation into E. coli cells.

[253] The resultant plasmid constructs had the sacB gene, and promoter sequence, in the pGGV4 recipient plasmid (SEQ ID NO. 9) replaced by one of the candidate acyl-CoA oxidase sequences (SEQ ID NO.s 1-7) and the apple AAT sequence (SEQ ID NO. 8). Figure 3 illustrates an assembled plasmid construct containing a candidate acyl-CoA oxidase gene, in addition to sequences encoding the ppBCKD and apple AAT.

Transformation of plasmids into E. coli

[254] A volume of 2 pl of completed DNA assembly reactions or purified plasmids (1 ng each) were transformed into chemically competent E. coli cells (20 pl). The transformation mix was incubated on ice for 5 minutes before heat-shock at 42°C for 30 seconds. Cells were returned to ice for 2 minutes before the addition of 300 pl SOC medium (Novagen) and incubation at 37°C, 250 rpm for 60 min. Cells were subsequently plated onto medium with carbenicillin (50 pg/ml) and sucrose (10% w/v) and incubated at 37°C for 16 to 24 h to allow colonies to develop.

[255] Following transformation, E. coli DH5a cells harbouring the desired assembly constructs were selected on LB medium supplemented with carbenicillin (50 pg/ml) and sucrose (10% w/v). The resulting plasmids were confirmed by PCR and Sanger sequencing.

[256] Plasmids were propagated in E. coli DH5a cells and purified using the QIAprep Spin Miniprep Kit (Qiagen). Purified plasmids (1 ng) were then transformed separately into E. coli BW25113 ldhA for biotransformation experiments.

[257] Whole-cell biotransformation experiments were set up to test the activity of the acyl-CoA oxidase candidates on isobutyryl-CoA. Plasmid-containing E. coli BW25113 ldhA cells were cultured overnight at 37°C, 250 rpm, in LB medium supplemented with carbenicillin (50 pg/ml). Cells were then sub-cultured into LUND medium supplemented with yeast extract (2 g/L), carbenicillin (50 pg/ml) and butanol (5 mM). LUND cultures were inoculated to give an initial ODeoo of 0.1 and incubated at 37°C, 250 rpm until they reached an ODeoo of > 3. To set up the biotransformation reactions, cells were harvested by centrifugation, washed in biotransformation medium and resuspended in the same medium at an ODeoo of 10. Biotransformation reactions were incubated in sealed flasks at 37°C, 250 rpm, for 48 h. At the end of the experimental period, samples were analysed for butyl methacrylate by Gas Chromatography - Mass Spectrometry (GC-MS) (Agilent 7890A/5975C) as follows.

[258] Cells were removed from the medium by centrifugation and filtration and a 10 ml volume of supernatant was mixed with an equal volume of ethyl acetate for 1 min by vortexing. Once left to settle, two 1 mL samples were taken from the organic phase for analytical duplicates in GC-MS. 1 pL of each sample was injected with 10 split into the inlet, at 280 °C, 9.4 psi and 24.2 mL min- ¹ . The column (Agilent 19091 S-433), 30m x 20 pm x 0.25 pm, was heated to a maximum temperature of 300 °C for 5 minutes, ramping from 45 °C in 20 °C intervals. Oven temperature held at 300 °C for a further 10 minutes. Flow through the column was 1 .197 mL min ^-1 , at a velocity of 39.78 cm sec ¹ . Each sample cycle began and ended with four injections of pure ethanol to wash the column. The results are shown in Table 2 below.

[259] The biotransformations were performed in one of three separate runs, with ACX4 from Arabidopsis thaliana being run as the control in each case.

[260] At the start, each biotransformation reaction contained 13 mM 2-ketoisovalerate and 15 mM butanol. Conversion of 2-ketoisovalerate and butanol to butyl methacrylate (via a sequence of BCKD, acyl-CoA oxidase and AAT catalysed reactions) was only possible if the acyl-CoA oxidase candidate was able to catalyse the oxidation of isobutyryl-CoA to methacylyl-CoA (see Figure 1). The results clearly show that butyl methacrylate is formed in each biotransformation. As such, the results show that each of the acyl-CoA oxidases tested are able to convert isobutyryl- CoA to methacylyl-CoA. Table 2 - Results of whole cell biotransformation

[261 ] The results show that the acyl-CoA oxidases from each of Spinacia oleracea, Populus alba, Trema orientale, Arachis hypogaea and/or Parasponia andersonii are active in the conversion of isobutyryl-CoA to butyl methacrylate and may suitably be used as an alternative to ACX4 from Arabidopsis thaliana.

[262] Attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

[263] All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.

[264] Each feature disclosed in this specification (including any accompanying claims, abstract and drawings) may be replaced by alternative features serving the same, equivalent or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.

[265] The invention is not restricted to the details of the foregoing embodiment(s). The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.