OF OXIDASES

FIELD OF THE INVENTION

The present invention relates to the field of enzymatic production of a compound comprising a carbonyl group. The invention specifically relates to the oxidation of substrates comprising a hydroxyl group using yeast cells displaying immobilized enzyme, specifically oxidase.

BACKGROUND OF THE INVENTION

During the past decades, many enzymes have emerged to complement conventional chemical processes in various industries. Their utilization as highly specific and tunable biocatalysts has accelerated the expansion of novel biocatalytic processes and technology. There is an ever-increasing demand for improved catalytic properties of enzymes and enzymes which remain stable under process conditions.

Oxidases have been used for the oxidation of primary alcohols, but these enzymes are destabilized by the hydrogen peroxide formed by the reaction. Therefore, hydrogen peroxide must be constantly degraded during a process. This is done, if allowed, by adding catalase resulting in very high costs for production. Furthermore, catalase is on the list of substances prohibited in cosmetic products according to EU Regulation No. 1223/2009 and therefore must not be present in cosmetic products.

The addition of catalase is essential to prevent inhibition and deactivation of the oxidase by hydrogen peroxide (Nordkvist et al., 2007).

For example, US20070105200A1 describes enzymatic conversion of lactose to lactobionic acid using a carbohydrate oxidase, wherein catalase is added to the reaction to degrade hydrogen peroxide that is produced during the reaction. Addition of catalase converts the produced H2O2 to oxygen.

US8183030B2, for example, describes the production of gluconic acid using novel catalyst supports, such as e.g. yeast cells comprising immobilized avidin on their surface. Biotinylated glucose oxidase is added to the yeast cells to produce the gluconic acid. Catalase is added to the reaction to degrade the hydrogen peroxide produced during the reaction.

Gal et al. (2016) discloses two dehydrogenases, cellobiose dehydrogenase from Corynascus thermophilus and pyranose dehydrogenase from Agaricus meleagris, displayed on the surface of Saccharomyces cerevisiae using the yeast surface display system. The surface displayed dehydrogenases were used in a microbial fuel cell using lactose and xylose, respectively, as fuel.

Blazic et al. (2019) disclose directed evolution of cellobiose dehydrogenase on the surface of yeast cells to generate a CDH with higher activity for resazurin.

Kracher et al. (2019) describe the generation of an engineered cellobiose dehydrogenase (CDH) which is about 30 times more efficient in driving the lytic polysaccharide monooxygenase reaction due to its about 27 times increased production of hydrogen peroxide. The use of such enzyme for the production of oxidized substrates, such as lactobionic acid, would be interesting due to its increased enzymatic activity. However, its use is hindered by the increased production of hydrogen peroxide which would have to be degraded using an even bigger amount of catalase, making the process uneconomic.

Therefore, there is an unmet need in the field for an efficient, cheap and industrially scalable process for the production of oxidized compounds, that is driven by an enzymatic catalyst and wherein the enzymatic catalyst is regenerated with oxygen as electron acceptor.

SUMMARY OF THE INVENTION

It is the objective of the present invention to provide an improved process for the production of compounds comprising a carbonyl group, such as oxidized saccharides or alcohols.

The objective is solved by the subject matter of the present invention.

The present invention discloses a genetically modified yeast cell, which can be used as a whole cell biocatalyst for the production of oxidized compounds.

According to the invention there is provided a method for the production of a compound comprising a carbonyl group using yeast cells expressing a fusion protein comprising a cell surface anchor linked to an oxidase, which is displayed on the yeast cells’ surface, comprising the steps of: i. providing a substrate comprising a hydroxyl group; ii. providing the yeast cells; and iii. incubating the yeast cells with the substrate in an aqueous solution in the presence of O2 to produce at least 10g/L of the compound comprising the carbonyl group, wherein oxidation of the hydroxyl group of the substrate to the carbonyl group is catalyzed by the displayed oxidase using O2 as electron acceptor for the regeneration of the oxidase; and wherein the method is performed in the absence of heterologous catalase.

The method of the invention is performed without the addition of catalase to the reaction. By immobilizing the oxidase on the surface of yeast cells, the yeast cells are capable of degrading the unwanted side product hydrogen peroxide, without the addition of any extra catalase.

Specifically, the substrate comprising the hydroxyl group is provided in an aqueous solution, and the yeast cells are added to the aqueous solution comprising the substrate.

Specifically, the displayed oxidase is cellobiose dehydrogenase (cellobiose oxidase), carbohydrate oxidase, glucose oxidase, pyranose oxidase, galactose oxidase, aryl-alcohol oxidase, alcohol oxidase, or a functionally active variant thereof. Specifically, the functionally active variant includes a flavodehydrogenase domain (FAD domain) or a flavin adenine dinucleotide-binding domain (FAD-binding domain).

Specifically, the oxidase described herein can comprise the amino acid sequence of the homologous wild-type oxidase of several different species, or functionally active variants thereof.

Specifically, the yeast cells used in the methods described herein may display more than one oxidase. Specifically, the yeast cells described herein may display two or more oxidases, for example selected from the group consisting of cellobiose dehydrogenase, carbohydrate oxidase, glucose oxidase, pyranose oxidase, galactose oxidase, aryl-alcohol oxidase and alcohol oxidase.

For example, the fusion protein described herein may comprise cellobiose oxidase activity and glucose oxidase activity. Specifically, the fusion protein described herein may comprise cellobiose dehydrogenase, carbohydrate oxidase, glucose oxidase, pyranose oxidase, galactose oxidase, aryl-alcohol oxidase and/or alcohol oxidase activity.

Specifically, the yeast cells may express two or more different fusion proteins. For example, the yeast cells may express a fusion protein as described herein comprising cellobiose dehydrogenase activity and a fusion protein as described herein comprising glucose oxidase activity.

According to a specific embodiment, the displayed oxidase is a functional variant of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at the position 769 of the Myriococcum thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position functionally equivalent to 769 of SEQ ID NO:1.

Specifically, the amino acid substitution at position N769 of the Myriococcum thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position functionally equivalent to 769 of SEQ ID NO:1 increases the oxygen reactivity of the CDH, compared to a CDH not comprising said amino acid substitution. Specifically, said amino acid substitution increases the oxygen reactivity by at least about 10, 20, 30, 40, 50, 60, 70,

80, 90, or 100% or more, compared to a CDH comprising the same sequence but without said amino acid substitution. Specifically, the amino acid substitution at position 769 of SEQ ID NO:1, or at a position functionally equivalent to said position, is to a glycine (G, Gly).

According to further specific embodiment, the displayed oxidase is a functionally active variant of cellobiose dehydrogenase homologues from other species, such as Crassicarpon thermophilum, Phanerochaete chrysosporium, Neurospora crassa, or Trametes versicolor, comprising an amino acid substitution of the amino acid at the position functionally equivalent to the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1.

Specifically, the displayed oxidase is a functional variant of the CDH of M. thermophilum comprising at least 60% sequence identity to SEQ ID NO:1 , of Crassicarpon thermophilum comprising at least 60% sequence identity to SEQ ID NO:3, of Phanerochaete chrysosporium comprising at least 60% sequence identity to SEQ ID NO:5, of Neurospora crassa comprising at least 60% sequence identity to SEQ ID NO:7, or of Trametes versicolor comprising at least 60% sequence identity to SEQ ID NO:9, or its functional flavodehydrogenase domain.

Specifically, the functional variant of the CDH of M. thermophilum comprises at least about 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80,

81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:1. Preferably, the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:1.

Specifically, the displayed oxidase is the flavodehydrogenase domain of cellobiose dehydrogenase (CDH), or a functional variant thereof. Specifically, the displayed oxidase is the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) of M. thermophilum, Crassicarpon thermophilum, Phanerochaete chrysosporium, Neurospora crassa or Trametes versicolor, or a functional variant thereof. Specifically, the flavodehydrogenase domain displayed on the surface of the yeast cell by fusion to the cell surface anchor comprising SEQ ID NO:2, 4, 6, 8, or 10, or comprising at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:2, 4, 6, 8, or 10.

Specifically, the functional variant of the CDH of Crassicarpon thermophilum comprises at least about 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:3. Preferably, the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:3.

Specifically, the displayed oxidase is the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) of Crassicarpon thermophilum, or a functional variant thereof.

Specifically, the functional variant of the CDH of Phanerochaete chrysosporium comprises at least about 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:5. Preferably, the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:5.

Specifically, the displayed oxidase is the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) of Phanerochaete chrysosporium, or a functional variant thereof.

Specifically, the functional variant of the CDH of Neurospora crassa comprises at least about 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:7. Preferably, the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:7.

Specifically, the displayed oxidase is the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) of Neurospora crassa, or a functional variant thereof.

Specifically, the functional variant of the CDH of Trametes versicolor comprises at least about 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:9. Preferably, the functional variant of the CDH comprises at least about 70 or 80% sequence identity, and even more preferably 85 or 90% sequence identity to SEQ ID NO:9.

Specifically, the displayed oxidase is the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) of Trametes versicolor, or a functional variant thereof.

Specifically, the displayed oxidase is a functional variant of the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:2. Specifically, the functional variant of the displayed FAD domain of CDH comprises at least about 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:2.

Specifically, the displayed oxidase is glucose oxidase comprising SEQ ID NO:11, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:11. Specifically, the functional variant of the displayed glucose oxidase comprises at least about 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,

81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:11.

Specifically, the oxidase is aryl-alcohol oxidase comprising SEQ ID NO:12, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 12. Specifically, the functional variant of the displayed aryl-alcohol oxidase comprises at least about 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:12.

Specifically, the oxidase is carbohydrate oxidase comprising SEQ ID NO:13, ora functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 13. Specifically, the functional variant of the displayed carbohydrate oxidase comprises at least about 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:13.

Specifically, the oxidase is pyranose oxidase comprising SEQ ID NO:14, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 14. Specifically, the functional variant of the displayed pyranose oxidase comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80,

81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:14.

Specifically, the oxidase is galactose oxidase comprising SEQ ID NO:15, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 15. Specifically, the functional variant of the displayed galactose oxidase comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:15.

Specifically, the oxidase is alcohol oxidase comprising SEQ ID NO:16, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO: 16. Specifically, the functional variant of the displayed alcohol oxidase comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:16.

According to a specific embodiment, the substrate used in the method provided herein is a saccharide or an alcohol.

Specifically, the substrate is selected from the group consisting of saccharides, specifically cello-saccharides and lacto-saccharides, oligosaccharides, specifically cello- oligosaccharides and lacto-oligosaccharides, glucose, galactose, cellobiose, lactose, maltose, and alcohols, specifically primary alcohols and aryl alcohols.

According to a specific embodiment, the substrate is lactose and the aqueous solution is whey. In such embodiment, lactobionic acid is produced in whey using the surface-displayed oxidase as described herein. Optionally, the yeast cells may be extracted from the solution after production of the lactobionic acid. The whey enriched in lactobionic acid may be used in cosmetic preparations. Alternatively, the lactobionic acid may be isolated from the whey, and used in cosmetic preparations. The cosmetic preparation may be produced by formulating the whey enriched in lactobionic acid with a cosmetically acceptable carrier.

Specifically, the substrates described herein are oxidized using the yeast cells displaying an oxidase as described herein, thereby producing a significant amount of a compound comprising a carbonyl group. Specifically, the significant amount is any of at least about 10, 15, 20, 25, 30, 35, 40, 45, or 50g/L, or 100g/L or more, and any ranges between these values.

According to a specific embodiment, the compound produced by the method provided herein is an oxidized saccharide, or an oxidized alcohol.

Specifically, said compound is selected from the group consisting of cello-oligonic acids, lacto-oligonic acids, cello-oligobionic acids, lacto-oligobionic acids, gluconic acid, galactonic acid, cellobionic acid, lactobionic acid, maltobionic acid, aldehydes, carboxylic acids, 2-oxo acids, keto aldoses or 1 ,6-dialdoses.

According to a specific embodiment, yeast cells displaying a fusion protein comprising an enzyme comprising cellobiose oxidase activity are used to produce at least 10g/L of cellobionic acid, preferably at least 20 or 30g/L, wherein oxidation of the hydroxyl group of glucose is catalyzed by the immobilized enzyme comprising cellobiose oxidase activity. Specifically, the hydroxyl group at the C1 position of glucose is oxidized by the immobilized oxidase.

According to a specific embodiment, yeast cells displaying a fusion protein comprising an enzyme comprising cellobiose oxidase activity are used to produce at least 10g/L of lactobionic acid, preferably at least 20 or 30g/L, wherein oxidation of the hydroxyl group of lactose is catalyzed by the immobilized enzyme comprising cellobiose oxidase activity.

According to a further specific embodiment, yeast cells displaying a fusion protein comprising an enzyme comprising glucose oxidase activity are used to produce at least 10g/L of gluconic acid, preferably at least 20 or 30 g/L, wherein oxidation of the hydroxyl group of glucose is catalyzed by the immobilized enzyme comprising glucose oxidase activity.

Specifically, the method provided herein provides for an industrially scalable process for the production of the compound comprising a carbonyl group as described herein. Specifically, the process includes culturing recombinant yeast host cells displaying the immobilized oxidase on their surface in defined culture media at a temperature suitable for growth of the recombinant yeast cells. The culture medium preferably has a pH ranging from 4 to 7.5 and temperature is preferably maintained between about 15°C to 30°C or 32°C. Specifically, the host cells are contacted with an aqueous solution comprising about 1% to 50%, preferably about 1% to 10% or about 5% to 20% of the substrate comprising the hydroxyl group. The final product, specifically the compound comprising the carbonyl group, is either harvested from the solution, or the product remains in the solution and the yeast cells are filtered from the solution.

Specifically, employing the method described herein, at least 40% of product is formed in less than 6 hours. Even more specifically, using the method described herein, up to 50% of product are formed in about 5 hours.

Specifically, the cell surface displayed oxidase is stable and retains more than 40%, preferably 50%, of its activity for up to 24 hours (hrs) during the oxidation process, when compared to native enzyme which is added to the substrate in free form without catalase.

According to a specific embodiment of the method provided herein, the yeast cells are removed from the solution, following cultivation with the substrate for a time sufficient to form the carbonyl compound. Specifically, the host cells are cultivated with the substrate for a time, which is sufficient for the production of a significant amount of said compound.

Specifically, the yeast host cells are cultivated in a cell culture, specifically in a bioreactor, under suitable conditions as further described herein to produce the carbonyl compound on an industrial scale.

According to a further specific embodiment of the method provided herein, the yeast cells are removed from the solution by filtration, preferably by microfiltration or ultrafiltration, or centrifugation.

According to another specific embodiment of the method provided herein, the method comprises the additional step of isolating the compound comprising the carbonyl group.

According to a specific embodiment, the cell surface anchor of the fusion protein is Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO:19. Specifically, the yeast cells used in the method provided herein are methylotrophic yeast cells selected from the group consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii, preferably the yeast cells are Saccharomyces cerevisiae or Pichia pastoris cells.

In another aspect, the invention provides for a fusion protein, which was constructed by fusing a cell surface anchor protein, such as the cell surface anchor protein Aga2 of S. cerevisiae, in-frame with the N- terminus of an oxidase, or a functionally active variant of an oxidase, such as the flavodehydrogenase domain of cellobiose dehydrogenase.

Thus, further provided herein is a fusion protein comprising the following structure from N- to C-terminus: i. Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO:19; ii. optionally, a linker; and iii. a functional variant of the flavodehydrogenase domain (FAD domain) of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.

In a preferred embodiment, the fusion protein is represented by SEQ ID NO:21. In another aspect, the present invention provides a modified expression cassette comprising a promoter, a modified open reading frame encoding for the flavodehydrogenase domain of cellobiose dehydrogenase fused to the C-terminus of an anchor protein and a terminator sequence. The promoter chosen may either be for constitutive expression or for inducible expression. The modified expression cassette can express a functionally active oxidase on the surface of a wide range of host organisms, such as, but not limited to Saccharomyces cerevisiae.

Specifically, the variant of the FAD domain of said fusion protein comprises a glycine at the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1. Specifically, the functional variant of the FAD domain comprises SEQ ID NO:2, or at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:2. Specifically, the functional variant of the FAD domain comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:2.

Specifically, the functional variant of the FAD domain comprises any one of SEQ ID NO:4, 6, 8, or 10, or at least 60%, preferably at least 70% at least 80%, more preferably at least 90% sequence identity to any one of SEQ ID NO:4, 6, 8, or 10. Specifically, the functional variant of the FAD domain comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to any one of SEQ ID NO:4, 6, 8, or 10.

Further provided herein is an isolated nucleotide sequence encoding the fusion protein described herein.

Further provided herein is an expression cassette comprising the isolated nucleotide sequence described herein operably linked to regulatory elements.

Further provided herein is a host cell or a host cell line expressing the fusion protein described herein, wherein the host cells are selected from the group consisting of yeast cells, bacterial cells, insect cells and mammalian cells.

Specifically, the host cells are yeast cells selected from the group of methylotrophic yeasts consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii.

Further provided herein is a yeast cell displaying an immobilized functional variant of the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.

Further provided herein is a yeast cell displaying the fusion protein described herein on its surface. Further provided herein is the use of the yeast cells displaying the fusion protein described herein on its surface for the production of a compound comprising a carbonyl group.

Further provided herein is a method for the production of a compound comprising a carbonyl group using yeast cells expressing a fusion protein comprising a cell surface anchor linked to a D-amino acid oxidase, which is displayed on the yeast cells’ surface, comprising the steps of: i. providing a substrate comprising an amino group; ii. providing the yeast cells; and iii. incubating the yeast cells with the substrate in an aqueous solution in the presence of O2 to produce the compound comprising the carbonyl group, wherein oxidation of the amino group of the substrate to the carbonyl group is catalyzed by the displayed D-amino acid oxidase using O2 as electron acceptor for the regeneration of the oxidase; wherein the method is performed in the absence of heterologous catalase.

Specifically, the substrate comprising an amino group is oxidized using the yeast cells displaying a D-amino acid oxidase as described herein, whereby a significant amount of a compound comprising a carbonyl group is produced. Specifically, the significant amount is any of at least about 10, 15, 20, 25, 30, 35, 40, 45, or 50g/L, or 100g/L or more, and any ranges between these values. Preferably, at least 20 g/L of the compound comprising the carbonyl group are produced using the yeast cells displaying a D-amino acid oxidase as described herein.

Specifically, the substrate comprising an amino group is a D-amino acid, preferably cephalosporin C. Specifically, the compound comprising a carbonyl group is a-Ketoadipyl-7 ACA.

Specifically, the oxidase is D-amino acid oxidase comprising SEQ ID NO:17 or 18, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:17 or 18. Specifically, the functional variant of the D-amino acid oxidase comprises at least about 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO:17 or 18.

According to a specific embodiment, the method using a D-amino acid oxidase comprises a further step of adding Glutaryl-7-ACA-Acylase (glutaryl acylase) to the reaction to produce 7-aminocephalosporanic acid from the carbonyl compound a- Ketoadipyl-7 ACA. Glutaryl acylase converts a-Ketoadipyl-7 ACA to 7- aminocephalosporanic acid (7-ACA). Glutaryl acylase may be added to the reaction in free form or may be immobilized on a carrier such as yeast cells.

According to a specific example, glutaryl acylase may be added as a fusion protein displayed on yeast cells’ surface, wherein glutaryl acylase ora functionally active variant thereof is linked to a yeast cell surface protein, such as but not limited to Aga2.

Specifically, the cell surface anchor of the fusion protein comprising a D-amino acid oxidase, or a functional variant thereof as described herein, is Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO: 19. Specifically, the functionally active variant of Aga2 comprises at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100% sequence identity to SEQ ID NO: 19. Specifically, the functionally active variant of Aga2 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 point mutations, amino acid substitutions, additions or deletions or the like. Specifically, a functional variant of Aga2 is functional to immobilize the fusion protein on the yeast sell surface.

According to a specific embodiment, the yeast cells are removed from the solution following incubation with the substrate for a sufficient time to form the compound comprising a carbonyl group, or after the final product, e.g. 7-aminocephalosporanic acid, has been formed. Specifically, the yeast cells are removed by filtration, preferably microfiltration or ultrafiltration, or centrifugation.

Specifically, the yeast cells used in the method using a D-amino acid oxidase as described herein, are methylotrophic yeast cells selected from the group consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii, preferably the yeast cells are Saccharomyces cerevisiae or Pichia pastoris cells.

FIGURES

Figure 1. Amino acid or nucleotide sequences referred to herein.

Figure 2. Enzyme activity of immobilised enzyme during the reaction. Figure 3. Conversion of lactose to lactobionic acid, lactose from whey to lactobionic acid, and cellobiose into cellobionic acid during the reaction.

Figure 4. Comparison of the residual enzyme activity of immobilised enzyme (“SD CDH”) and soluble enzyme (“free CDH with catalase”).

Figure 5. Comparison of the conversion of lactose to lactobionc acid in batches with immobilised enzyme (“SD CDH”) and soluble enzyme (“free CDH with catalase”).

DETAILED DESCRIPTION

Unless indicated or defined otherwise, all terms used herein have their usual meaning in the art, which will be clear to the skilled person. Reference is for example made to the standard handbooks, such as Sambrook et al, "Molecular Cloning: A Laboratory Manual" (4th Ed.), Vols. 1 -3, Cold Spring Harbor Laboratory Press (2012); Krebs et al., "Lewin ^' s Genes XI", Jones & Bartlett Learning, (2017), and Murphy & Weaver, "Janeway ^' s Immunobiology" (9th Ed., or more recent editions), Taylor & Francis Inc, 2017.

The subject matter of the claims specifically refers to artificial products or methods employing or producing such artificial products, which may be variants of native (wild- type) products. Though there can be a certain degree of sequence identity to the native structure, it is well understood that the materials, methods and uses of the invention, e.g., specifically referring to isolated nucleic acid sequences, amino acid sequences, fusion constructs, expression constructs, transformed host cells and modified proteins, are “man-made” or synthetic, and are therefore not considered as a result of “laws of nature”.

The terms “comprise”, “contain”, “have” and “include” as used herein can be used synonymously and shall be understood as an open definition, allowing further members or parts or elements. “Consisting” is considered as a closest definition without further elements of the consisting definition feature. Thus “comprising” is broader and contains the “consisting” definition.

The term “about” as used herein refers to the same value or a value differing by +/-5 % of the given value.

As used herein and in the claims, the singular form, for example “a”, “an” and “the” includes the plural, unless the context clearly dictates otherwise. As used herein, amino acids refer to twenty naturally occurring amino acids encoded by sixty-one triplet codons. These 20 amino acids can be split into those that have neutral charges, positive charges, and negative charges:

The “neutral” amino acids are shown below along with their respective three-letter and single-letter code and polarity:

Alanine: (Ala, A) nonpolar, neutral;

Asparagine: (Asn, N) polar, neutral;

Cysteine: (Cys, C) nonpolar, neutral;

Glutamine: (Gin, Q) polar, neutral;

Glycine: (Gly, G) nonpolar, neutral;

Isoleucine: (lie, I) nonpolar, neutral;

Leucine: (Leu, L) nonpolar, neutral;

Methionine: (Met, M) nonpolar, neutral;

Phenylalanine: (Phe, F) nonpolar, neutral;

Proline: (Pro, P) nonpolar, neutral;

Serine: (Ser, S) polar, neutral;

Threonine: (Thr, T) polar, neutral;

Tryptophan: (Trp, W) nonpolar, neutral;

Tyrosine: (Tyr, Y) polar, neutral;

Valine: (Val, V) nonpolar, neutral; and

Histidine: (His, H) polar, positive (10%) neutral (90%).

The “positively” charged amino acids are:

Arginine: (Arg, R) polar, positive; and Lysine: (Lys, K) polar, positive.

The “negatively” charged amino acids are:

Aspartic acid: (Asp, D) polar, negative; and Glutamic acid: (Glu, E) polar, negative.

The invention provides a multidimensional approach for achieving a high rate of bioconversion of a substrate comprising a hydroxyl group to a compound comprising a carbonyl group using a whole cell biocatalyst.

The present invention discloses novel whole cell biocatalysts for production of oxidized compounds, such as e.g. cellobionic acid and lactobionic acid, from substrates comprising a hydroxyl group, such as alcohols or sugars. Further, the invention also refers to nucleic acids which encode oxidase enzyme fused to a cell surface anchor protein, and to fusion proteins expressed from such nucleic acids.

Organic molecules are carbon-based and also may contain oxygen, hydrogen, nitrogen, sulfur, and/or phosphorus. Structurally, these molecules are composed of two main parts.

The first part is the carbon backbone, in which the carbon atoms are bonded together forming a carbon backbone.

The second part are the functional groups, which are small groups of atoms, such as hydrogen and oxygen, that are bonded to the carbon backbone. Functional groups are so named because they function as the chemically reactive area of the molecule.

The hydroxyl group (-OH) is one example of a functional group. As used herein, a “hydroxyl group” is a functional group composed of one hydrogen atom bonded to one oxygen atom. Its chemical formula is written as either -OH or HO-. The represents the carbon to which the hydroxyl group is bonded.

According to a specific embodiment of the method provided herein, the term “substrate” is used herein to refer to compounds comprising a hydroxyl group, specifically sugars and alcohols.

When hydroxyl groups are the primary functional group bonded to carbon backbones, the resulting molecules are alcohols. Examples of alcohols containing the hydroxyl group are methanol, isopropyl alcohol, and propanol.

Further substrates comprising hydroxyl groups are carbohydrate molecules, also called saccharides or sugars.

According to another specific embodiment of the invention, the term “substrate” is used herein to refer to a compound comprising an amino group.

The amino group is one of several nitrogen-containing functional groups found in organic molecules. What distinguishes the amino group is that the nitrogen atom is connected by single bonds to either hydrogen or carbon. A compound comprising an amino group is also referred to as “amine”. Amines are formally derivatives of ammonia, wherein one or more hydrogen atoms have been replaced by a substituent such as an alkyl or aryl group, which may respectively be called alkylamines and arylamines; amines in which both types of substituent are attached to one nitrogen atom may be called alkylarylamines. Specific examples of amines include amino acids, specifically D- amino acids, biogenic amines, trimethylamines, and aniline. In the method described herein, the whole cell biocatalyst described herein is used to convert the substrates described herein, i.e. a compound comprising a hydroxyl and/or an amino group, into a carbonyl compound.

As used herein, a “carbonyl group” is a functional group composed of a carbon atom double-bonded to an oxygen atom: C=0. It is common to several classes of organic compounds, as part of many larger functional groups. The “compound comprising a carbonyl group” as described herein is also referred to as a “carbonyl compound”.

The term "enzyme" in accordance with the invention means any substance composed wholly or largely of protein or polypeptides that catalyzes or promotes, more or less specifically, one or more chemical or biochemical reactions. Specifically, the term “enzyme” is used herein to refer to a protein or polypeptide comprising oxidase activity.

The term "activity” as used herein e.g., in the context of an enzyme activity, shall refer to a functionally active molecule. A functional enzyme is specifically characterized by a catalytic center recognizing the enzyme substrate and catalysing the conversion of the substrate to a conversion product. Enzyme variants are considered functional upon determining their enzymatic activity in a standard test system, e.g. wherein the enzymatic activity is at least 50% of the activity of the parent (not modified or wild-type enzyme), or at least any of 60%, 70%, 80%, 90%, 100%, or even more than 100%.

The term “oxidase” refers to an entity such as a protein or polypeptide having enzymatic activity, which is functional to catalyze the biochemical reaction forming an oxygenated or oxidized compound or product from the substrates described herein. Oxidases are enzymes that catalyze an oxidation reaction, by transferring hydrogen from a source or donor, specifically the substrates described herein, to oxygen, thereby forming hydrogen peroxide as a by-product. These enzymes belong to the group of oxidoreductases or redox enzymes, which also encompass oxygenases, hydrogenases or reductases, oxidases and peroxidases.

The term "oxidation reaction" means in general terms a biochemical reaction wherein an oxygenated or oxidized compound or product is formed. An oxidation reaction is typically accompanied by a reduction reaction (hence the term "redox" reaction, for oxidation and reduction). For example, glucose oxidase typically catalyzes the oxidation of a primary alcohol group to a lactone. The enzymatic conversion of sugar into acids involves an oxidation/reduction reaction, catalyzed by carbohydrate oxidases, in which oxygen serves as an electron acceptor. The oxygen is reduced to hydrogen peroxide (H2O2): sugar + O2 + H2O ® sugar acids + H2O2. The enzyme catalase in turn catalyzes the reaction: H2q2 ® H2O + ½ 02.

Previously, engineered CDH variants for use as biocatalyst, e.g. for lactobionic acid production, have been reported in the form of an immobilized CDH with higher activity (Blazic M., et al. 2019). In the course of the oxidation of lactose to lactobionic acid, electrons are transferred to CDH and thus CDH is reduced. In order to start a new reaction cycle for the oxidation of lactose, CDH has to be regenerated in the form of a reoxidation from the reduced state to the oxidized state. In Blazic M., et al. 2019, the regeneration was performed by using resazurin as electron acceptor. However, the addition of electron acceptors such as resazurin or DCIP to a biocatalytic production process does not only increase the production cost but also increases complexity in the process since such molecules need to be removed from the product and, depending on the nature of the electron acceptor, may be harmful or toxic.

The addition of oxygen as electron acceptor is cheap, does not require an additional purification step of the produced carbonyl group and is generally regarded as not harmful. However, when oxygen is used as electron acceptor, hydrogen peroxide is produced as a side product by the regeneration reaction of CDH.

It was commonly believed in the field, that, if the production of a sufficient amount of acids from substrates such as sugars or alcohols is desired, the addition of catalase is necessary in order to remove the unwanted side product hydrogen peroxide, which is an inhibitor of oxidases and hampers the production of high yields. The present inventors surprisingly discovered that, using the whole cell biocatalyst described herein, high yields of carbonyl compounds can be produced without adding catalase to the reaction.

The term “oxidase activity” as used herein describes the enzymatic activity of an enzyme to catalyze oxidation of a hydroxyl group to a carbonyl group. According to a specific example, oxidase activity describes the enzymatic activity of e.g. the glucose oxidase to catalyze oxidation of glucose to generate gluconolactone utilizing oxygen as an electron acceptor. The "activity" of an oxidase, such as the glucose oxidase, may be directed to a measure of its ability to catalyze the oxidation reaction D-glucose + O2 ® gluconolactone + H2O2 and may be expressed as the rate at which the product of the reaction is produced. For example, glucose oxidase activity can be represented as the amount of product (gluconolactone and/or H2O2) produced per unit of time, or per unit (e.g. concentration or weight) of glucose oxidase. The term “oxidase” as used herein, also comprises functional variants of wildtype oxidases known in the field as further described herein. Said functional variants comprise oxidase activity. Functional variants of the oxidases described herein may be full-length oxidases comprising one or multiple point mutations, or fragments of the full- length oxidase comprising catalytical activity, such as e.g. the flavodehydrogenase domain of cellobiose dehydrogenase.

Carbohydrate oxidases are oxidases that are capable of catalyzing the conversion of sugars or alcohols into acids. Any carbohydrate oxidase can be used in the method of the invention. Specific examples comprise cellobiose dehydrogenase, glucose oxidase, alcohol oxidase, aryl-alcohol oxidase, pyranose oxidase and galactose oxidase.

Cellobiose oxidase (EC 1.1.99.18) is a carbohydrate oxidase capable of oxidizing several saccharides including cellobiose, soluble cellooligosaccharides, lactose, xylobiose and maltose. Cellobiose dehydrogenase (CDH) was first discovered in 1974 in the extracellular enzyme system of Phanerochaete chrysosporium and later on in several other basidiomycetous fungi. A special characteristic of this enzyme is its composition: the combination of a catalytically active flavodehydrogenase domain (also called "flavin domain"), hosting a non-covalently bound FAD, and a haem domain, with a haem b as a cofactor. Both domains are connected by a linker. By its catalytic activity the natural substrate cellobiose is oxidised in a reaction which reduces the FAD of the flavin domain.

CDH or its flavodehydrogenase domain (also referred to as flavin domain) oxidises carbohydrates like its natural substrates cellobiose and cello-oligosaccharides and others like lactose and maltose. CDHs have been discovered and shown previously to be capable of converting glucose efficiently.

It is not necessary to use full-length CDH in the method or the fusion protein described herein. The flavin domain, even without the haem domain, is sufficient for catalytical activity. The domain is therefore referred to as "functional domain" as it has the function of oxidizing lactose with a suitable electron acceptor. The activity is exerted by either the whole enzyme cellobiose dehydrogenase or the catalytically active flavodehydrogenase domain.

Glucose oxidase (b-D-glucose!oxygen 1-oxidoreductase; EC 1.1. 3.4) catalyzes the oxidation of b-D-glucose to gluconic acid, by utilizing molecular oxygen as an electron acceptor with the simultaneous production of hydrogen peroxide. Microbial glucose oxidase is currently receiving much attention due to its diverse applications in the chemical, pharmaceutical, food, beverage, clinical chemistry, biotechnology and other industries. Glucose oxidase or "GOx" specifies a protein that catalyzes the oxidation of beta-D-glucose into D-glucono-1 , 5-lactone (D-glucose + 02® gluconolactone + H2O2), which then may hydrolyze to gluconic acid.

Hexose oxidase (EC 1.1.3.5) is a carbohydrate oxidase capable of oxidizing several saccharides including glucose, galactose, maltose, cellobiose and lactose.

Alcohol oxidase is an enzyme that catalyzes the following chemical reaction: a primary alcohol + O2 - an aldehyde + H2O2

The systematic name of this enzyme class is alcohol oxidoreductase. This enzyme is also called ethanol oxidase.

Aryl alcohol oxidase is an enzyme that catalyzes the following chemical reaction: an aromatic primary alcohol + O2 - an aromatic aldehyde + H2O2

The systematic name of this enzyme class is aryl- alcohol: oxygen oxidoreductase. Other names in common use include veratryl alcohol oxidase, and aromatic alcohol oxidase.

D-Amino acid oxidase is an enzyme capable of oxidizing several D-amino acid substrates, including cephalosporin C. 7-Aminocephalosporanic acid (7-ACA), the core of many semi-synthetic cephalosporins, is conventionally manufactured chemically from cephalosporin C. The chemical process uses chemical reagents that are highly toxic and heavily pollute the environment and the chemical process is low in conversion rate, as the process requires multiple steps of reactions. Bio-process offers an attractive alternative for the production of 7-ACA.

In prior art bioprocesses, the bioconversion of cephalosporin C to 7-ACA is conducted in two steps: (1) cephalosporin C is first oxidized by D-amino acid oxidase to a Ketoadipyl 7ACA and then non enzymatic with the produced H2O2 to glutaryl-7-ACA; (2) the glutaryl-7-ACA is then cleaved at the bond between the glutaryl moiety and the 7-ACA moiety by glutaryl-7ACA acylase to 7-ACA.

Glutaryl-7ACA acylase can process a Ketoadipyl 7ACA directly to 7-ACA, but only if the reaction mix is not contaminated with glutaryl-7-ACA which is produced by the side product H2O2. Using d-amino acid oxidase immobilized on yeast cells, the produced H2O2 is efficiently removed by the yeast cells from the reaction mix. This has the significant advantage that the glutaryl-7ACA acylase can process a Ketoadipyl 7ACA directly to 7-ACA, as the intermediate side product glutaryl-7-ACA is not produced by free H2O2. Also, no catalase has to be added to the process to remove H2O2 and isolation of the target compound is easier since the reaction mix is not contaminated by unwanted side products.

Glutaryl acylase, in immobilized or free form, may be added to the reaction mix together with the oxidase-displaying yeast cells to produce 7-aminocephalosporanic acid in a one-pot reaction. Alternatively, glutaryl acylase may be added in a separate second step, after the oxidase-displaying yeast cells had been incubated with the substrate cephalosporin C for a sufficient time to produce a sufficient amount of the carbonyl compound a Ketoadipyl-7-ACA, thereby producing 7-ACA in a two-step reaction.

Optionally, in a further step, 7-ACA or the yeast cells may be isolated from the reaction mix.

Rhodotorula gracilis and Trigonopsis variabilis are the two major sources of D- amino acid oxidase for industrial application.

The term "fusion protein" refers to a polypeptide which comprises protein domains from at least two different proteins. As used herein, the fusion protein is an oxidase, i.e. a protein or polypeptide comprising oxidase activity, linked to the C- terminus of a cell surface anchor protein. Linkage of the oxidase to the cell surface anchor may be via direct fusion or via a linker as described herein.

The terms "cell surface anchor", "anchor", or "anchor protein" refer, inter alia, to any molecular structure connected to or attached to the external surface of a eukaryotic cell, specifically a yeast cell. Said term comprises structures known to the skilled artisan but also structures being capable of anchorage to the surface not yet known.

In other words, the terms "cell surface anchor", "anchor", "anchor (poly)peptide" refer to a (poly)peptide moiety that, on expression in a host cell, becomes attached or otherwise associated with the outer surface of the host cell. An anchor (poly)peptide can be a transmembrane protein moiety, or can be a (poly)peptide moiety otherwise linked to the cell surface (e. g., via post-translational modification, such as by a phosphatidyl- inositol or disulfide bridge). The term encompasses proteins native to the host cell, or exogenous proteins introduced for the purpose of anchoring to the cell surface.

Preferably, the oxidases described herein are anchored to the surface of the host cell by covalent bonding to glycans containing phosphatidyl inositol. The structures to which the anchor protein or peptide is bonded are often referred to as glycosylphosphatidylinositol or GPIs. In all cells, anchor proteins covalently bonded to GPIs are found on the external face of the plasma membrane of cells or on the lumenal surface of secretory vesicles. According to a specific example of the fusion protein described herein, the anchor protein is a GPI anchor protein, Aga2 which is fused in frame to the N-terminus of a protein comprising oxidase activity.

Effective anchors include portions of a cell surface protein sufficient to provide a surface anchor when fused to another polypeptide, such as a protein comprising oxidase activity as described herein. The use of protein pairs that are separately encoded and expressed but associate at the surface of a cell by covalent (e.g., disulfide) or non- covalent bonds is also contemplated as a suitable anchor, and in this regard particular mention is made of the yeast a-agglutinin components, Agalp and Aga2p, which form a glycan-immobilized, disulfide-linked complex on the surface of yeast cells. Preferred examples of polypeptide anchors include FL01 (a protein associated with the flocculation phenotype in S. cerevisiae ), a-agglutinin, and a-agglutinin subunits (e.g., Agalp and Aga2p subunits), and functional fragments thereof.

Anchors further include any synthetic modification or truncation of a naturally occurring anchor, such as Aga2, that still retains the ability to be attached to the surface of a host cell. Preferred anchor protein moieties are contained in, for example, cell surface proteins of a eukaryotic cell.

The term "surface" in the term "surface of a eukaryotic host cell" refers to any structure surrounding the cellular body of any of the known eukaryotic host cells. The skilled artisan is aware of such structures, including, for example, a plasma membrane. The term "plasma membrane" in connection with the present invention is to be construed as comprising any eukaryotic membrane and specifically, the extracellular surface of any such membrane.

As used herein, the term “linker” or "linked" refers to a functional and structural connection between two or more elements, that does not interfere with the function of the elements. As used herein, the term “linker” typically refers to an operable connection between two or more polypeptide elements of the fusion protein described herein. The linkers may be used to engineer appropriate amounts of flexibility. Preferably, the linkers are short, e.g., 1-20 nucleotides or amino acids or even more and are typically flexible.

For example, a polypeptide can be directly linked to an anchor protein (e.g. via a peptide bond or via a peptide linker, amino acid linker), thus forming a fusion protein.

Amino acid linkers commonly used consist of a number of glycine, serine, and optionally alanine, in any order. Such linkers usually have a length of at least any one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 20 amino acids, as required. Preferably, the linker comprises 1 to 12 amino acid residues, preferably it is a short linker. Preferably the linker is a GS, GGSGG, GSAGSAAGSG, (GS)n, GSG or G4S linker or any combination thereof. In some embodiments, the linker comprises one or more units, repeats or copies of a motif, such as for example GS, GSG or G4S.

Similarly, the polynucleotides encoding the polypeptide and anchor protein can be linked such that the fusion protein is transcribed and translated as a unitary RNA message.

It is understood by persons of ordinary skill in the art that polynucleotides, which encode one or more elements of the fusion protein described herein for expression in the host cell display system, can be operably linked to a promoter (to facilitate transcription), or operably linked to a signal sequence or leader peptide (to facilitate cellular processing and transport to the surface). Such genetic control elements and functional linkages thereto are numerous and well known in the art, and the present invention is not limited by the use thereof. Preferred promoters, however, include inducible promoters. Particularly preferred promoters (for eukaryotic systems) include those useful in yeast vectors, such as pGAL1 , pGAL1-10, pGa1104, pGaMO, pPGK, pCYC1 , and pADH1. Particularly preferred signal sequences include the Aga2p signal sequence (for eukaryotic systems).

The term "host cell" as referred to herein is understood as any yeast cell type that is susceptible to transformation, transfection, transduction, or the like with nucleic acid constructs or expression vectors comprising polynucleotides encoding expression products described herein, or susceptible to otherwise introduce any or each of the components of the fusion protein described herein. Specifically, the host yeast cells are maintained under conditions allowing expression of the fusion protein and display of the fusion protein on the host cell’s surface. Host yeast cells can be haploid, diploid or polyploid cells.

Also described herein is also a “host cell line” or “production cell line”, which is commonly understood to be a yeast cell line ready-to-use for cultivation/culturing in a bioreactor to obtain the product of a production process, such as the compound comprising a carbonyl group as described herein. The yeast host or yeast cell line as described herein is particularly understood as a recombinant yeast organism, which may be cultivated/cultured to produce the desired compound. The term “cell culture” or “cultivation” (“culturing” is herein synonymously used), also termed “fermentation”, with respect to a host cell line is meant to be the maintenance of cells in an artificial, e.g., an in vitro environment, under conditions favoring growth, differentiation or continued viability, in an active or quiescent state, of the cells, specifically in a controlled bioreactor according to methods known in the industry. When cultivating, a cell culture is brought into contact with the cell culture media in a culture vessel or with substrate under conditions suitable to support cultivation of the cell culture. In certain embodiments, a culture medium as described herein is used to culture cells according to standard cell culture techniques that are well-known in the art for cultivating or growing yeast cells.

Cultivation of the yeast host cells may be in one or multiple phases.

According to a specific embodiment, the yeast cells are allowed to grow to a certain density in a first phase, before the carbonyl group is produced in a second or further phase. Cell density used for inoculating or starting the production phase may be OD600 of about 2 or more, specifically about 2.5, 3, 4, 5, 6 or more. The growth phase may be followed by an induction phase, wherein expression of the oxidase on the yeast cell surface is induced. The induction phase may also be included in the growth phase or the production phase.

According to another specific embodiment, cell growth and production of the carbonyl compound may be in a single phase. In this case, the medium used in the cultivation process comprises the respective substrate required for the production of the carbonyl compound from the beginning of the cultivation process.

Specifically, the media used in the present method, specifically in the production phase, do not comprise heterologous catalase.

Cell culture media provide the nutrients necessary to maintain and grow cells in a controlled, artificial and in vitro environment. Characteristics and compositions of the cell culture media vary depending on the particular cellular requirements. Important parameters include osmolality, pH, and nutrient formulations. Feeding of nutrients may be done in a continuous or discontinuous mode according to methods known in the art.

Cell culture may be a batch process or a fed-batch process. A batch process is a cultivation mode in which all the nutrients necessary for cultivation of the cells, and optionally including the substrates necessary for production of the carbonyl compounds described herein, are contained in the initial culture medium, without additional supply of further nutrients during fermentation. In a fed-batch process, a feeding phase takes place after the batch phase. In the feeding phase one or more nutrients, such as the substrate described herein, are supplied to the culture by feeding. In certain embodiments, the method described herein is a fed-batch process. Specifically, a host cell transformed with a nucleic acid construct encoding the fusion protein as described herein, is cultured in a growth phase medium and transitioned to an induction phase medium in order to produce the surface displayed oxidases described herein. Subsequently, the cells are transitioned to a reaction medium comprising the substrate described herein to produce a desired amount of the carbonyl compound described herein.

In another embodiment, host cells described herein are cultivated in continuous mode, e.g. a chemostat. A continuous fermentation process is characterized by a defined, constant and continuous rate of feeding of fresh culture medium into the bioreactor, whereby culture broth is at the same time removed from the bioreactor at the same defined, constant and continuous removal rate. By keeping culture medium, feeding rate and removal rate at the same constant level, the cultivation parameters and conditions in the bioreactor remain constant.

The host cell culture comprising the fusion protein described herein is particularly advantageous for methods on an industrial manufacturing scale, e.g. with respect to both the volume and the technical system, in combination with a cultivation mode that is based on feeding of nutrients, in particular a fed-batch or batch process, or a continuous or semi-continuous process (e.g. chemostat).

Expression products such as polypeptides, proteins or protein domains, or RNA molecules as described herein, including e.g., the fusion proteins, as described herein may be introduced into a host cell either by introducing the respective coding polynucleotide or nucleotide sequence for expressing the expression products within the host cell, or by introducing the respective expression products which are within an expression system or isolated.

Any of the known procedures for introducing expression cassettes, vectors or otherwise introducing (e.g., coding) nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, nucleofection, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well-known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al.). The invention specifically allows for the production process to be performed on a pilot or industrial scale. The industrial process scale would preferably employ volumes of at least 10 L, specifically at least 50 L, preferably at least 1 m ³ , preferably at least 10 m ³ , most preferably at least 100 m ³ .

Production conditions in industrial scale are preferred, which refer to e.g. fed batch cultivation in reactor volumes of 100 L to 10 m ³ or larger, employing typical process times of several days, or continuous processes in fermenter volumes of approximately 50 - 1000 L or larger.

The suitable cultivation techniques may encompass cultivation in a bioreactor starting with a batch phase, followed by a short exponential fed batch phase at high specific growth rate, further followed by a fed batch phase at a low specific growth rate. Another suitable cultivation technique may encompass a batch phase followed by a continuous cultivation phase at a low dilution rate.

It is preferred to cultivate the host cell line as described herein in a bioreactor under growth conditions to obtain a cell density of at least about 1 g/L, 5g/L or 10 g/L cell dry weight, more preferably at least 20 g/L cell dry weight, preferably at least 50 g/L cell dry weight. It is advantageous to provide for such yields of biomass production on a pilot or industrial scale.

A growth medium allowing the accumulation of biomass as described herein, specifically a basal growth medium, typically a carbon source, a nitrogen source, a source for sulphur and a source for phosphate. Typically, such a medium comprises furthermore trace elements and vitamins, and may further comprise amino acids, peptone or yeast extract.

Specifically, the medium used to produce the carbonyl compound according to the method provided herein comprises the substrate comprising the hydroxyl group which is oxidized by the displayed oxidase as described herein to produce the carbonyl compound as described herein. Specifically, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100g/L up to 200g/L, or more, of substrate are added to the cell culture, or comprised in the medium used in the production phase.

The fermentation preferably is carried out at a pH ranging from 3 to 7.5.

Typical fermentation times are about 24 to 120 hours with temperatures in the range of 20°C to 35°C, preferably 22-30°C.

Specifically, the cells are cultivated under conditions suitable to produce the carbonyl compound, which can be purified from the cells or culture medium. The carbonyl compound is preferably produced employing conditions yielding at least about 1 mg/L or 10 mg/L, preferably at least 100 mg/L, most preferred at least 1,

2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27,

28, 29,30, 31 , 32, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 g/L, or more, of the carbonyl compound, and any ranges between these values. More preferably, at least about 10 g/L to about 50 g/L are produced of the carbonyl compound using the method described herein.

The term “aqueous solution” refers to a liquid preparation that contains one or more chemical substances dissolved, i.e., molecularly dispersed, in a suitable solvent or mixture of mutually miscible solvents, wherein the predominant solvent is water. The aqueous solution used in the methods described herein may be any solution which is suitable for enzymatic oxidation reactions employing a whole cell biocatalyst as described herein. Specific examples of aqueous solutions are cell culture media as described herein. Even more specific examples of aqueous solutions include whey, wood hydrolysate, cellulose hydrolysate, plant hydrolysate, starch hydrolysate, fungal hydrolysate, chitin hydrolysate, and fungal fermentation broth.

The term “heterologous” as used herein with respect to a nucleotide sequence, construct such as an expression cassette, amino acid sequence or protein, refers to a compound which is either foreign to a given host cell, i.e. “exogenous”, such as not found in nature in said host cell; or that is naturally found in a given host cell, e.g., is “endogenous”, however, in the context of a heterologous construct or integrated in such heterologous construct, e.g., employing a heterologous nucleic acid fused or in conjunction with an endogenous nucleic acid, thereby rendering the construct heterologous.

The term “heterologous” as used herein with respect to catalase refers to a catalase compound which is foreign to the host cell used in the method described herein, i.e. it is exogenous to the host cell and not naturally produced by such host cell. Catalases disproportionate hydrogen peroxide to water and dioxygen (/ccat/Km 10 ⁶ -10 ⁷ M ¹ s ¹ ). Catalase is endogenously produced by yeast host cells at low levels to preserve the intracellular reducing environment by metabolizing hydrogen peroxide. In the method of the present invention no exogenous catalase is added to the cell culture, therefore, the method is performed in the absence of any additional catalase, except for the catalase that is endogenously produced by the host cells. The term “expression” as used herein regarding expressing a polynucleotide or nucleotide sequence, is meant to encompass at least one step selected from the group consisting of DNA transcription into mRNA, mRNA processing, non-coding mRNA maturation, mRNA export, translation, protein folding and/or protein transport. Nucleic acid molecules containing a desired nucleotide sequence may be used for producing an expression product encoded by such nucleotide sequence e.g., proteins or transcription products such as RNA molecules, in particular fusion proteins as described herein. To express a desired nucleotide sequence, an expression system is conveniently used, which can be an in vitro or in vivo expression system, as necessary to express a certain nucleotide sequence by a host cell or host cell line. Typically, host cells are transfected or transformed with an expression system comprising an expression cassette that comprises the desired nucleotide sequence and a promoter operably linked thereto optionally together with further expression control sequences or other regulatory sequences. Specific expression systems employ expression constructs such as vectors comprising one or more expression cassettes.

The term “expression construct” as used herein, means the vehicle, e.g. vectors or plasmids, by which a DNA sequence is introduced into a host cell so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. “Expression construct” as used herein includes both, autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences.

The terms "vector”, “DNA vector” and "expression vector” mean the vehicle by which a DNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vector” as used herein includes both, autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences, such as artificial chromosomes. Plasmids are preferred vectors of the invention.

In specific embodiments, an expression vector may contain more than one expression cassettes, each comprising at least one coding sequence and a promoter in operable linkage.

A "cassette” refers to a DNA coding sequence or segment of DNA that codes for an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame. An “expression cassette” as used herein refers to nucleic acid molecules containing a desired coding sequence and control sequences in operable linkage, so that an expression system can use such expression cassette to produce the respective expression products, including e.g., encoded proteins or other expression products. Certain expression systems employ host cells or host cell lines which are transformed or transfected with an expression cassette, which host cells are then capable of producing expression products in vivo. In order to effect transformation of host cells, an expression cassette may be conveniently included in a vector, which is introduced into a host cell; however, the relevant DNA may also be integrated into a host chromosome. A coding sequence is typically a coding DNA or coding DNA sequence which encodes a particular amino acid sequence of a particular polypeptide or protein, or which encodes any other expression product.

The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression. Vectors typically comprise DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences, i.e. of recombinant genes and the translation of their mRNA in a suitable host organism. A coding DNA sequence or segment of DNA molecule coding for an expression product can be conveniently inserted into a vector at defined restriction sites. To produce a vector, heterologous foreign DNA can be inserted at one or more restriction sites of a vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA. It is preferred that a vector comprises an expression system, e.g. one or more expression cassettes. Expression cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame.

To obtain expression, a sequence encoding a desired expression product, such as e.g. any of the polypeptides, proteins or protein domains described herein, is typically cloned into an expression vector that contains a promoter to direct transcription. Appropriate expression vectors typically comprise regulatory sequences suitable for expressing coding DNA. Examples of regulatory sequences include promoter, operators, enhancers, ribosomal binding sites, and sequences that control transcription and translation initiation and termination. The regulatory sequences are typically operably linked to the DNA sequence to be expressed.

A promoter is herein understood as a DNA sequence which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA. Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms. Recombinant cloning vectors often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g., antibiotic resistance, one or more nuclear localization signals (NLS) and one or more expression cassettes.

As used herein, the term "mutation" as used herein has its ordinary meaning in the art. A mutation may comprise a point mutation, or refer to areas of sequences, in particular changing contiguous or non-contiguous amino acid sequences. Specifically, a mutation is a point mutation, which is herein understood as a mutation to alter one or more (but only a few) contiguous amino acids, e.g. 1, or 2, or 3 amino acids are substituted, inserted or deleted at one position in an amino acid sequence. Amino acid substitutions may be conservative amino acid substitutions or non-conservative amino acid substitutions. Conservative substitutions, as opposed to non-conservative substitutions, comprise substitutions of amino acids belonging to the same set or sub set, such as hydrophobic, polar, etc.

The term “functional variant” or “functionally active variant” also includes naturally occurring allelic variants, as well as mutants or any other non-naturally occurring variants. As is known in the art, an allelic variant is an alternate form of a nucleic acid or peptide that is characterized as having a substitution, deletion, or addition of one or nucleotides or more amino acids that does essentially not alter the biological function of the nucleic acid or polypeptide.

Functional variants may be obtained by sequence alterations in the polypeptide or the nucleotide sequence, e.g. by one or more point mutations, wherein the sequence alterations retain or improve a function of the unaltered polypeptide or the nucleotide sequence, when used in combination of the invention. Such sequence alterations can include, but are not limited to, (conservative) substitutions, additions, deletions, mutations and insertions. Conservative substitutions are those that take place within a family of amino acids that are related in their side chains and chemical properties. Examples of such families are amino acids with basic side chains, with acidic side chains, with non-polar aliphatic side chains, with non-polar aromatic side chains, with uncharged polar side chains, with small side chains, with large side chains etc.

A point mutation is particularly understood as the engineering of a poly-nucleotide that results in the expression of an amino acid sequence that differs from the non- engineered amino acid sequence in the substitution or exchange, deletion or insertion of one or more single (non-consecutive) or doublets of amino acids for different amino acids. The term “sequence identity” as used herein is understood as the relatedness between two amino acid sequences or between two nucleotide sequences and described by the degree of sequence identity or sequence complementarity. The sequence identity of a variant, homologue or orthologue as compared to a parent nucleotide or amino acid sequence indicates the degree of identity of two or more sequences. Two or more amino acid sequences may have the same or conserved amino acid residues at a corresponding position, to a certain degree, up to 100%. Two or more nucleotide sequences may have the same or conserved base pairs at a corresponding position, to a certain degree, up to 100%.

Sequence similarity searching is an effective and reliable strategy for identifying homologs with excess (e.g., at least 50%) sequence identity. Sequence similarity search tools frequently used are e.g., BLAST, FASTA, and HMMER.

Sequence similarity searches can identify such homologous proteins or polynucleotides by detecting excess similarity, and statistically significant similarity that reflects common ancestry. Homologues may encompass orthologues, which are herein understood as the same protein in different organisms, e.g., variants of such protein in different different organisms or species.

To determine the % complementarity of two complementary sequences, one of the two sequences needs to be converted to its complementary sequence before the % complementarity can then be calculated as the % identity between the first sequence and the second converted sequences using the above-mentioned algorithm.

“Percent (%) identity” with respect to an amino acid sequence, homologs and orthologues described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. In case of percentages determined for sequence identities, it is possible that arithmetical decimal places may result which are not possible with regard to full nucleotides or amino acids. In this case, the percentages shall be rounded up to whole nucleotides or amino acids. For purposes described herein, the sequence identity between two amino acid sequences is determined using the NCBI BLAST program version 2.2.29 (Jan-06-2014) with blastp set at the following exemplary parameters: Program: blastp, Word size: 6, Expect value: 10, Hitlist size: 100, Gapcosts: 11.1 , Matrix: BLOSUM62, Filter string: F, Genetic Code: 1 , Window Size: 40, Threshold: 21 , Composition-based stats: 2.

"Percent (%) identity" with respect to a nucleotide sequence e.g., of a nucleic acid molecule or a part thereof, in particular a coding DNA sequence, is defined as the percentage of nucleotides in a candidate DNA sequence that is identical with the nucleotides in the DNA sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at novocraft.com), ELAND (lllumina, San Diego, CA), SOAP (available at soap.genomies.org.cn), and Maq (available at maq.sourceforge.net).

The following items are particular embodiments described herein.

1. A method for the production of a compound comprising a carbonyl group using yeast cells expressing a fusion protein comprising a cell surface anchor linked to an oxidase, which is displayed on the yeast cells’ surface, comprising the steps of: i. providing a substrate comprising a hydroxyl group; ii. providing the yeast cells; and iii. incubating the yeast cells with the substrate in an aqueous solution in the presence of O2 to produce at least 10g/L of the compound comprising the carbonyl group, wherein oxidation of the hydroxyl group of the substrate to the carbonyl group is catalyzed by the displayed oxidase using O2 as electron acceptor for the regeneration of the oxidase; and wherein the method is performed in the absence of heterologous catalase.

2. The method of item 1 , wherein the oxidase is cellobiose dehydrogenase (cellobiose oxidase), carbohydrate oxidase, glucose oxidase, pyranose oxidase, galactose oxidase, aryl-alcohol oxidase, alcohol oxidase, or a functionally active variant thereof.

3. The method of item 1 or 2, wherein the oxidase is a functional variant of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at the position 769 of the Myriococum thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.

4. The method of item 3, wherein the oxidase is a functional variant of the CDH of M. thermophilum comprising at least 60% sequence identity to SEQ ID NO:1 , of Crassicarpon thermophilum comprising at least 60% sequence identity to SEQ ID NO:3, of Phanerochaete chrysosporium comprising at least 60% sequence identity to SEQ ID NO:5, of Neurospora crassa comprising at least 60% sequence identity to SEQ ID NO:7, or of Trametes versicolor comprising at least 60% sequence identity to SEQ ID NO:9, or its functional flavodehydrogenase domain.

5. The method of item 1 or 2, wherein the oxidase is a functional variant of the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:2.

6. The method of item 1 or 2, wherein the oxidase is glucose oxidase comprising SEQ ID NO:11 , or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:11.

7. The method of item 1 or 2, wherein the oxidase is aryl-alcohol oxidase comprising SEQ ID NO:12, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:12.

8. The method of item 1 or 2, wherein the oxidase is carbohydrate oxidase comprising SEQ ID NO:13, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:13.

9. The method of item 1 or 2, wherein the oxidase is pyranose oxidase comprising SEQ ID NO:14, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:14.

10. The method of item 1 or 2, wherein the oxidase is galactose oxidase comprising SEQ ID NO:15, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:15.

11. The method of item 1 or 2, wherein the oxidase is alcohol oxidase comprising SEQ ID NO:16, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:16.

12. The method of any one of items 1 to 11, wherein the substrate is a saccharide, or an alcohol.

13. The method of item 12, wherein the substrate is selected from the group consisting of oligosaccharides, cello-saccharides, lacto-saccharides, glucose, galactose, cellobiose, lactose, maltose, primary alcohols and aryl alcohols.

14. The method of any one of items 1 to 13, wherein the compound comprising a carbonyl group is an oxidized saccharide, or an oxidized alcohol.

15. The method of item 14, wherein the compound comprising a carbonyl group is selected from the group consisting of cello-oligonic acids, lacto-oligonic acids, gluconic acid, galactonic acid, cellobionic acid, lactobionic acid, maltobionic acid, aldehydes, carboxylic acids, 2-oxo acids, keto aldoses or 1,6-dialdoses. 16. The method of any one of items 1 to 15, wherein the yeast cells are removed from the solution following incubation with the substrate for a sufficient time to form the compound comprising a carbonyl group.

17. The method of item 16, wherein the yeast cells are removed by filtration, preferably microfiltration or ultrafiltration, or centrifugation.

18. The method of any one of items 1 to 17, further comprising the step of isolating the compound comprising a carbonyl group.

19. The method of any one of items 1 to 18, wherein the cell surface anchor of the fusion protein is Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO:19.

20. The method of any one of items 1 to 19, wherein the yeast cells are methylotrophic yeast cells selected from the group consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii, preferably the yeast cells are Saccharomyces cerevisiae or Pichia pastoris cells.

21. A fusion protein comprising the following structure from N- to C-terminus: i. Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO:19; ii. optionally, a linker; and iii. a functional variant of the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.

22. The fusion protein of item 21 , wherein the variant of the flavodehydrogenase domain comprises a glycine at the position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.

23. The fusion protein of item 21 or 22, wherein the functional variant of the flavodehydrogenase domain comprises SEQ ID NO:2, or at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:2. 24. The fusion protein of item 21 or 22, wherein the functional variant of the flavodehydrogenase domain comprises any one of SEQ ID NO:4, 6, 8, or 10, or at least 60%, preferably at least 70% at least 80%, more preferably at least 90% sequence identity to any one of SEQ ID NO:4, 6, 8 or 10.

25. An isolated nucleotide sequence encoding the fusion protein of any one of items 21 to 24.

26. An expression cassette comprising the isolated nucleotide sequence of item 25 operably linked to regulatory elements.

27. A host cell or a host cell line expressing the fusion protein of any one of items 21 to 24, wherein the host cells are selected from the group consisting of yeast cells, bacterial cells, insect cells and mammalian cells.

28. The host cell or host cell line of item 27, wherein the host cells are yeast cells selected from the group of methylotrophic yeasts consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii.

29. A yeast cell displaying an immobilized functional variant of the flavodehydrogenase domain of cellobiose dehydrogenase (CDH) comprising an amino acid substitution of the amino acid at position 769 of the M. thermophilum cellobiose dehydrogenase of SEQ ID NO:1 or at a position equivalent to 769 of SEQ ID NO:1.

30. A yeast cell displaying the fusion protein of any one of items 21 to 24 on its surface.

31. Use of the yeast cells of item 29 or 30 for the production of a compound comprising a carbonyl group.

32. A method for the production of a compound comprising a carbonyl group using yeast cells expressing a fusion protein comprising a cell surface anchor linked to a D-amino acid oxidase, which is displayed on the yeast cells’ surface, comprising the steps of: i. providing a substrate comprising an amino group; ii. providing the yeast cells; and iii. incubating the yeast cells with the substrate in an aqueous solution in the presence of O2 to produce the compound comprising the carbonyl group, wherein oxidation of the amino group of the substrate to the carbonyl group is catalyzed by the displayed d-amino acid oxidase using O2 as electron acceptor for the regeneration of the oxidase; wherein the method is performed in the absence of heterologous catalase.

33. The method of item 32, wherein at least 20 g/L of the compound comprising the carbonyl group are produced.

34. The method of item 32 or 33, wherein the substrate comprises a D-amino acid, preferably cephalosporin C.

35. The method of any one of items 32 to 34, wherein the compound comprising a carbonyl group is a-Ketoadipyl-7 ACA.

36. The method of item 35, further comprising the step of adding Glutaryl-7- ACA-Acylase (glutaryl acylase) to the reaction to produce 7-aminocephalosporanic acid from the carbonyl compound a-Ketoadipyl-7 ACA.

37. The method of any one of items 32 to 36, wherein the oxidase is D-amino acid oxidase comprising SEQ ID NO: 17 or 18, or a functionally active variant thereof comprising at least 60%, preferably at least 70%, at least 80%, more preferably at least 90% sequence identity to SEQ ID NO:17 or 18.

38. The method of any one of items 32 to 36, wherein the cell surface anchor of the fusion protein is Aga2, or a functionally active variant thereof comprising at least 80% sequence identity to SEQ ID NO:19.

39. The method of any one of items 32 to 37, wherein the yeast cells are methylotrophic yeast cells selected from the group consisting of Pichia pastoris, Hansenula polymorpha, Pichia minuta, Candida boidinii or yeast cells selected from the group of non-methylotrophic yeasts consisting of Saccharomyces cerevisiae, Klyveromyces lactis, Yarrowia lipolytica, Arxula adeninivorans, Zygosaccharomyces bailii, Pichia stipites, Klyveromyces marxianus, Saccharomyces occidentalis, Zygosaccharomyces rouxii, preferably the yeast cells are Saccharomyces cerevisiae or Pichia pastoris cells.

EXAMPLES

The examples described herein are illustrative of the present invention and are not intended to be limitations thereon. Many modifications and variations may be made to the techniques described and illustrated herein without departing from the spirit and scope of the invention. Accordingly, it should be understood that the examples are illustrative only and are not limiting upon the scope of the invention.

Example 1: Display of cellobiose dehydrogenase on the surface of S. cerevisiae

Materials & Methods

1. Generation of CDH-F variants:

Cellobiose dehydrogenase from Myriococcum thermophilum (Zamocky et al., 2008; Tan et al., 2015), UniProtKB A9XK88 was expressed in a display format using the established yeast surface display format for S. cerevisiae (Boder and Wittrup, 1997; Angelini et al., 2015). The gene sequence encoding the wild type flavin domain of cellobiose dehydrogenase (CDH-F, wild type FAD domain of CDH) and an engineered flavin domain with increased oxygen reactivity (CDH-F+, FAD domain of CDH comprising the amino acid substitution N769G) which was kindly provided by Prof. Roland Ludwig from BOKU University, Austria (Kracher et al., 2019). The genes were cloned in frame into the pCTCON2 display plasmid, omitting the sequence encoding the 247 N- terminal residues comprising the signal peptide, cytochrome domain and linker. The recombinant constructs CDH-F, CDH-F+ and an empty vector control (EVC) were transformed into competent S. cerevisiae EBY100 using the Frozen-EZ Yeast Transformation II Kit (Zymo Research, Germany). Vector and expression strain were kindly gifted by Dane Wittrup from 457 MIT, USA. Transformed cells were plated on SD- CAA selection plates and positive clones were expressed in SD-CAA liquid culture for 20 h at 30°C prior to media change and induction in SG(R)-CAA medium supplemented with 1% w/w raffinose at 20°C for 30 h (Angelini et al., 2015; Puri et al., 2013).

The amino acid sequence of the displayed Aga2-CDH-F fusion protein is shown in SEQ ID NO:22.

The amino acid sequence of the displayed Aga2-CDH-F+ fusion protein, comprising the N769G mutation, is shown in SEQ ID NO:21.

Results

M. thermophilum (synonymously Crassicarpon hotsonii) cellobiose dehydrogenase flavin domain wt (CDH-F) and the oxygen reactive variant N769G (CDH- F+) were efficiently displayed on the surface of S. cerevisiae cells as a fusion to Aga2. Display levels and enzyme activity were well-correlated and highest specific activities were obtained between 24 - 38 h induction at 20 °C. For CDH-F+ apparent oxidase activities of 1.7 - 2.8 mU OD ml_ ¹ were reached, where one mU ODmL ¹ is defined as the formation of 1 nmol of H2O2 per minute per ml_ of cell suspension of an Oϋboo 1.0. For CDH-F and the empty vector control (EVC), no peroxide formation above the background was detected. Both CDH variants are displayed on the cell surface at near identical levels.

Example 2: Production of Aldobionic acids catalyzed by cellobiose dehydrogenase displayed as fusion protein on the surface of S. cerevisiae

In this example cellobiose dehydrogenase immobilized on the cell surface of living Saccharomyces cerevisiae (SD CDH) is used to produce cellobionic acid from cellobiose and lactobionic acid from lactose and lactobionic acid from lactose in whey. The produced aldobionic acids can be separated from the reaction mixture and purified to produce the pure acids. Alternatively, only the cells can be removed producing a product enriched with aldobionic acid.

Materials & Methods

1. SD cell production

Grow medium:

For 1 L of grow medium 20 g casamino acid were dissolved in 600 ml water and autoclaved at 121°C for 15 min.

After cooling to room temperature, add sterile:

1 M PPB (pH 6) 200 ml

10 x YNB (132 g/l) 100 ml 30% Glycerin 100 ml

Biotin 500x (0.2 g/l): 2 ml

Induction medium:

For 1 L of induction medium II 20 g casamino acid were dissolved in 600 ml water and autoclaved at 121°C for 15 min.

After cooling to room temperature, add sterile:

1 M PPB (pH 6) 200 ml 10 x YNB 100 ml

20 % galactose: 100 ml Biotin 500x (0.2 g/l) 2 ml The yeast cells expressing CDH on the surface were produced in shaking flasks. One vial, containing 100 pl_ cell suspension, from the master cell bank were thawed and used to inoculate a 1000 ml Erlenmeyer flask containing 100 ml grow medium. After incubating the culture at 30°C and 120 rpm in a rotary shaker for 48 hours the cells were harvested by centrifugation (15 min, 6000 g). To induce protein expression the cell pellet was suspended in induction medium and diluted to an OD of 1 and incubated in a 1000 ml baffled flask. After four days the cells were harvested by centrifugation (15 min, 6000 g), washed once with PBS and stored as suspended in PBS at 4°C. One liter of induction medium produces 16 g wet cell mass with an activity of 10.2 U/g. That corresponds to a calculated yield of 164 U/l medium.

2. Enzyme (SD CDH):

The Mt CDH FAD fragment with the N769G mutation (SEQ ID NO:21), generated in Example 1 , was used in this experiment. It was expressed as surface display on the cell wall of Saccharomyces cerevisiae with an activity of 10.2 U/g wet biomass.

3. Transformation:

In this example it is shown that surface-display (SD) CDH can be used for converting pure lactose (or lactose in whey) to lactobionic acid and cellobiose to cellobionic acid. The reaction was performed in 50 ml Erlenmeyer flasks containing 10 ml 50 mM sodium phosphate buffer pH 7.0. To each of three flasks 50 mg of lactose or cellobiose or 71 mg of whey powder was added. 0.5 U SD CDH was added to the flasks containing lactose and whey powder and 1 U SD CDH was added to the flask with cellobiose. The reaction mixture was incubated at 30°C and 140 rpm and sealed with Parafilm. Samples are taken and enzyme activity, H2O2, and lactobionic acid and cellobionic acid concentration were measured. The pH of the conversion can be from 3.0 to 11.0. In this experiment pH 7.0 was used.

4. Analysis:

Enzyme activity was measured in 96 well plates with lactose as electron donor and DCIP as electron acceptor. 20 mI_ of sample suspension was used and the reaction started by adding 180 mI_ of reagent solution. The decline of the absorption of DCIP at 520 nm was measured and used to calculate the activity. One Unit of SD CDH was defined as the amount of enzyme necessary to oxidase one mM of lactose and therefore reducing one mM of DCIP in one minute under these conditions. The reagent solution contained 0.35 mM DCIP and 47 mM lactose in 50 mM sodium phosphate buffer at pH 7.0. 5. Determination of H2O2 concentration:

H2O2 concentration was measured in 96 well plates. Yeast cells were removed from the sample by centrifugation (2.5 min at 20000 g). To inactivate traces of enzyme the samples were incubated at 95°C for 5 min, cool on ice and centrifuge for 10 min at 20 000 g. 20 pl_ of the clear supernatant were taken, 180 mI_ reagent were added, the mixture was incubated at room temperature for 10 min and the absorbance was measured at 415. A standard curve with H2O2 concentration from 10 mM to 2 mM was made and treated the same way as the samples. The reagent solution contained 0.3 mM ABTS and 120 U/ml horse radish peroxidase in 50 mM sodium phosphate buffer at pH 7.0.

6. Substrate and product concentration:

Samples were prepared as described in the determination of H2O2 concentration. A Dionex IC-5000 system was used with a CarboPac PA100250x4 mm column. Detection was done with a PAD gold cell with a pH electrode as referenced. As mobile phase was 150 mM NaOH and 0.5 M sodium acetate/150 mM NaOH (gradient: 0% B to 36% B in 18 min).

Results

Lactobionic acid (LBA) was produced in the lactose and whey batch. The conversion was 37% in the lactose batch and 23% in the whey batch. In the cellobiose/CBA (cellobionic acid) batch, twice the enzyme concentration was used, resulting in a higher conversion rate. 69% of cellobiose was converted to CBA. No other product was seen in the HPLC chromatograms. The sum of substrate and product in the reaction did not decline over time, therefore no substrate was lost due to yeast metabolism (see Figures 2 and 3).

No H2O2 was detected in any sample. H2O2 concentrations as little as 0.02 mM are detectable with the used test. It seems H2O2 is efficiently destroyed by the cells. The enzyme activity was stable (lactose batch) or declined slightly (11% whey batch and 30% cellobiose batch).

The produced lactobionic acid can either stay in the reaction mixture or it can be purified by known methods, e.g. with ion exchange resins, and added to whey. The lactobionic acid enriched whey can be used as cosmetic ingredient since it does not contain catalase. Example 3: Production of lactobionic acid from lactose in 250 ml scale

In this example the conversion of lactose to lactobionic acid is performed under defined conditions in a 250 ml scale.

Materials & Methods

The reaction was performed in an Infors HT Multifors 400 ml flat bottom glass reactor with metal lid. The reactor was equipped with a heating mantle, a temperature probe for temperature measurement and control, a magnetic coupled stirrer with one Rushton 6-blade impeller for mixing, three steel baffles for better mixing, one pH electrode for measuring and controlling the pH (via addition of base), p02 electrode for measuring and controlling the oxygen concentration (via 02 flow), one gas inlet with ring sparger near the bottom of the reactor direct below the stirrer, a sampling tube connected to a 5 ml syringe (ending near the bottom of the reactor), one tube inlet connected to the base reservoir (ends above the liquid surface), an air outlet with water cooled condenser and one open port for filling the reactor (is closed during the reaction).

The reactor was operated under nonsterile conditions. Process parameter were controlled by the Infors HT Multifors control unit and recorded on a computer by the Iris V5 software.

The temperature was held constant at 30°C and the reactor was fed with pure oxygen via the ring sparger to a p02 of 21%. Stirring speed was 300 rpm. 1 M Na2C03 was added via a pump for neutralizing the formed lactobionic acid and keeping the pH at 7.0. The solution volume was 250ml_ (200 ml water and 50 ml cell suspension). 200 ml of water, 13.16 g of lactose, and 0.16 g sodium dihydrogen phosphate were added to the reactor. After the temperature had stabilized at 30°C and the pH at 7.0, the reaction was started by adding the 50 ml of cell suspension with an activity of 83 U CDH. The final concentration in the reactor were 146 mM lactose and 4.2 mM phosphate buffer. Samples were taken and enzyme activity, H2O2, lactose and lactobionic acid concentration were measured.

For comparison, a second reaction with CDH in soluble form, instead of immobilized SD CDH, was performed. 42 mg of the soluble FAD fragment of MtCDH with the mutations N721S N769G were used (SEQ ID NO:27). This corresponds to an enzyme activity of 83 U and was the same in both experiments. In addition, catalase from bovine liver (2800 U/ml) was added to destroy the produced H2O2. The rest of the reaction-setup was ident. Due to the added catalase, no H2O2 was found during the conversion. Results

The comparison of the enzyme activity overtime in both experiments can be seen in Figure 4. The soluble enzyme was a little bit more stable than the SD CDH with 75% residual activity after 24h. The residual activity of the SD CHD was 57%.

The comparison of the conversion of lactose to lactobionic acid is shown in Figure 5. There was a linear increase of LBA during the first hours. Lactose concentration decreased to the same amount. After 5h in the batch with SD CDH 49% of lactose was oxidized to LBA. This corresponds to a specific productivity (SP) of 20.7 g LBA/kU ^* h and is close to the theoretical maximum of 21.5 g LBA/kU ^* h under the used conditions. In the batch with soluble enzyme an almost identical conversion was found (49,5% instead of 49%) resulting in a specific productivity of 20.9 LBA/kU ^* h. The space-time-yield was calculated and was 5.23 g LBA/L ^* h for the SD CDH batch and 5.28 g LBA/L ^* h for the batch with soluble enzyme. The volume of added base over time was recorded for the SD CDH batch. After 5 h 9.1 ml of base was used equals a 51 .8% conversion. This fits nicely to the found LBA concentration in the batch after this time.

After 24 h no lactose was found in either batches with HPLC. The transformation of lactose to lactobionic acid was therefore complete.

The SD CDH enzyme was continuedly inactivated over time. After 26h, 57% of the enzyme is still active in the SD CDH batch. To recover the cells the reaction mixture was centrifuged at 6000 g for 15 min. The cell pellet was suspended in PBS and stored at 4°C. 28 U, or 33% of the starting activity, was recovered. The so recovered enzyme did not lose any activity after storing for one week at 4°C.

Example 4: Production of gluconic acid catalyzed by glucose oxidase displayed as fusion protein on the surface of S. cerevisiae

In this example, the native glucose oxidase from Aspergillus niger immobilized on the cell surface of living Saccharomyces cerevisiae (SD GOX) was used to produce gluconic acid from glucose (SEQ ID NO:25).

Materials & Methods

The cells were grown in SD-CAA medium containing 0.5% casamino acids, 1x YNB, 2% dextrose, and 100 mM potassium phosphate buffer pH 6.0. After incubating for 24 h at 30°C the cells were harvested by centrifugation (6000 g, 15 min) and suspended (OD =1) in induction medium (same as SD-CAA medium with 2% galactose instead of dextrose). After incubation at 20°C for 24h cells were harvested. Analysis:

Enzyme activity was measured in 96 well plates with glucose as electron donor and oxygen as electron acceptor. 20 pl_ of sample suspension was used and the reaction started by adding 180 mI_ of reagent solution. The increase of the absorption of the ABTS radical at 415 nm was measured and used to calculate the activity. One Unit of SD GOX was defined as the amount of enzyme necessary to oxidase one mM of glucose and therefore reducing one mM of oxygen to H2O2 in one minute under these conditions. The reagent solution contained 0.5 mM ABTS, 40 mM glucose, and 120 U/ml peroxidase from horse radish in 50 mM sodium citrate buffer pH 5.5.

Results

Active immobilized SD GOX was found with a yield of 14 U SD GOX per litre of induction medium. The specific conversion rate for the transformation of glucose to gluconic acid (GA) was 11.7 g GA/kU*h with a space-time-yield of 0.016 g GA/L*h.

Example 5: Display of D-Amino acid oxidase on the surface of S. cerevisiae

Materials & Methods

1. Preparation of S. cerevisiae catalysts:

The D-Amino acid oxidase from the yeast Trigonopsis variabilis (TvDAAO) can be expressed in a display format using the established yeast surface display format for S. cerevisiae (Boder and Wittrup, 1997; Angelini et al., 2015). Copy the 356-residue long protein sequence encoding the wild type TvDAAO (Gonzalez et al., 1997) as is available in the UniProtKB database (UniProtKB: Q99042, SEQ ID NO:18) and order a commercial gene synthesis service such as Twist Bioscience (adapter-free gene fragments) to reverse-translate into a nucleotide sequence whilst codon optimize for S. cerevisiae as an expression host. Additionally, add flanking sequences of 50 nucleotides reflecting the pCTCON2 cloning site to each side of the sequence to allow homologous recombination upon transformation in the S. cerevisiae host: 5’ GTGGAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGGCTAGC (SEQ ID NO:32)

3’ GGCGGAT CCGAACAAAAGCTTATTT CT GAAGAGGACTT GTAATAGCTCGA (SEQ ID NO:33)

The recombinant TvDAAO can be cloned into the pCTCON2 vector by transformation of 50 ng of vector backbone and 100 ng of synthesized TvDAAO gene during the transformation into competent S. cerevisiae EBY100 using the Frozen-EZ Yeast Transformation II Kit (Zymo Research, Germany). Vector and expression strain can be requested from the owner Prof. Dane Wittrup (457 MIT, USA) and found on plasmid repositories such as Addgene (https://www.addgene.org/41843/). Plate Transformed cells onto SD-CAA selection plates pick clones for expression in SD-CAA liquid culture for 20 h at 30°C prior to media change and induction in SG(R)-CAA medium supplemented with 1% w/w raffinose at 20°C for 30 h (Angelini et al., 2015; Puri et al., 2013).

The amino acid sequence of the displayed Aga2-TvDAAO fusion protein is shown in SEQ ID NO:31.

Example 6: Conversion of cephalosporin C to 7-aminocephalosporanic acid (7-ACA) in the absence of hydrogen peroxide catalyzed by D-Amino acid oxidase displayed as fusion protein on the surface of S. cerevisiae

In this protocol D-Amino acid oxidase immobilized on the cell surface of living S. cerevisiae is used for the production of a Ketoadipyl 7ACA, which is further converted to 7-Aminocephalosporanic acid by Glutaryl-7ACA acylase. The produced 7- Aminocephalosporanic acid can be separated from the reaction mixture and purified. Alternatively, only the cells can be removed producing a product enriched with 7- Aminocephalosporanic acid.

Materials & Methods

1. Surface Display Cells production

Grow medium:

For 1 L of grow medium 20 g casamino acid are dissolved in 600 ml water and autoclaved at 121°C for 15 min.

After cooling to room temperature, add sterile:

1 M PPB (pH 6) 200 ml

10 x YNB (132 g/l) 100 ml 30% Glycerin 100 ml

Biotin 500x (0.2 g/l): 2 ml

Induction medium:

For 1 L of induction medium 20 g casamino acid are dissolved in 600 ml water and autoclaved at 121°C for 15 min.

After cooling to room temperature, add sterile: 1 M PPB (pH 6) 200 ml 10 x YNB 100 ml

20 % galactose: 100 ml Biotin 500x (0.2 g/l) 2 ml

The S. cerevisiae cells expressing D-Amino acid oxidase on the surface (such as the cells from Example 5) are produced in shaking flasks. Use 100 pl_ cell suspension to inoculate a 1000 ml Erlenmeyer flask containing 100 ml grow medium. Incubate the culture at 30°C and 120 rpm in a rotary shaker for 48 hours. Harvest the cells by centrifugation (15 min, 6000 g). To induce protein expression, suspend the cell pellet in induction medium, dilute to an OD of 1 and incubate in a 1000 ml baffled flask. Harvest the cells after four days by centrifugation (15 min, 6000 g), wash once with PBS and store the cells suspended in PBS at 4°C. One liter of induction medium produces roughly 16 g wet cell mass.

2. Conversion:

Incubate 50 ml_ of 1% cephalosporin C (w/v) in potassium phosphate buffer (0.1 M, pH 7.5) with 3 ml_ of cell suspension with a D-Amino acid oxidase activity of 20 U and 20 U of Glutaryl-7ACA acylase in a stirred (120 rpm) reactor at 28°C. Maintain the pH at 7.5. Inject oxygen to the reaction mixture at a flow rate of 0.2 I min ¹ . More than 50% conversion can be reached within 1-2 hours. Filter cells or remove by centrifugation (2.5 min at 20 000 g). Cells may be reused for further conversions. Remove proteins by ultrafiltration. Assay product formation by high performance liquid chromatography (HPLC).

3. Analysis:

Determine D-Amino acid oxidase activity by measuring the formation of keto acid. Incubate the D-Amino acid oxidase displaying cells in 5 ml of 50 mM d-Ala-containing pyrophosphate buffer (pH 8.5) for 30 min at 37 °C. Terminate the reaction by adding 3 ml of trichloroacetic acid (10%). Dilute a total of 0.1 ml of the reaction mixture 10 times and add 0.4 ml of 2,4-dinitrophenylhydrazine saturated (0.2%) in 2 M HCI for 10 min. Add 1.5 ml of 3 M NaOH and measure the absorbance at 550 nm after 15 min. One unit of DAAO activity corresponds to the formation of 1 pmol min ¹ of pyruvate at 37°C (Yu et al. 2002)

4. Substrate and product concentration: Substrate and product concentrations can be measured by HPLC with a reverse phase XDB C-18 column (Zorbax, 4.6 9 150 mm). Prepare the eluent (25 mM sodium phosphate, pH 3.5, 8% acetonitrile, v/v) and et the flow rate to 1 ml_ min ¹ . Analytes can be detected at 254 nm. The retention times of the compounds are: 2.1 min for cephalosporin C, 3.2 min for a Ketoadipyl 7ACA, 8.7 min for Glutaryl-7ACA and 1.7 min for 7-ACA (Tan et al. 2010)

REFERENCES

Angelini A, Chen TF, de Picciotto S, Yang NJ, Tzeng A, Santos MS, et al. Protein Engineering and Selection Using Yeast Surface Display. In: Methods in Molecular Biology (Clifton, NJ) 2015, p. 3-36.

Blazic M. et al. ..Directed Evolution of Cellobiose Dehydrogenase on the Surface of Yeast Cells Using Resazurin-Based Fluorescent Assay”, Applied Sciences, 2019, Vol. 9(7), 1413.

Boder ET, Wittrup KD. Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 1997, 15(6):553-557.

Gal I et. al., “Yeast surface display of dehydrogenases in microbial fuel-cells.” Bioelectrochemistry, 2016, Vol. 112, pp. 53-60

Gonzalez, Francisco J., et al. "Molecular cloning of TvDAOI , a gene encoding ad-amino acid oxidase from Trigonopsis variabilis and its expression in Saccharomyces cerevisiae and Kluyveromyces lactis." Yeast 13.15 (1997): 1399-1408.

Kracher D, Forsberg Z, Bissaro B, Gangl S, Preims M, Sygmund C, et al. Polysaccharide oxidation by lytic polysaccharide monooxygenase is enhanced by engineered cellobiose dehydrogenase. FEBS J 2019;febs.15067.

Nordkvist M, Nielsen PM, Villadsen J et al. Oxidation of Lactose to Lactobionic Acid by a Microdochium nivale Carbohydrate Oxidase: Kinetics and Operational Stability. Biotechnology and Bioengineering 2007;97(4):694-707.

Puri V, Streaker E, Prabakaran P, Zhu Z, Dimitrov DS. Highly efficient selection of epitope specific antibody through competitive yeast display library sorting. MAbs 2013;5(4):533-539.

Tan T-C, Kracher D, Gandini R, Sygmund C, Kittl R, Haltrich D, et al. Structural basis for cellobiose dehydrogenase action during oxidative cellulose degradation. Nat Commun 2015;6(1):7542.

Tan Q, Zhang Y, Song Q, et al. Single-pot conversion of cephalosporin C to 7- aminocephalosporanic acid in the absence of hydrogen peroxide. World J Microbiol Biotechnol 2010;26:145.

Yu J, Li DY, Zhang YJ, Yang S, Li RB, Yuan ZY High expression of Trigonopsis variabilis D-amino acid oxidase in Pichia pastoris. J Mol Catal B Enzym 2002;18:291- 297 Zamocky M, Schiimann C, Sygmund C, O’Callaghan J, Dobson ADW, Ludwig R, et al. Cloning, sequence analysis and heterologous expression in Pichia pastoris of a gene encoding a thermostable cellobiose dehydrogenase from Myriococcum thermophilum. Protein Expr Purif. 2008;59(2):258-265.