Field of the invention

The present invention relates to polymorphisms associated with increased capability of a fish to synthesize omega-3 fatty acids. In particular, the present invention provides methods for predicting increased capability of a fish to synthesize omega-3 fatty acids and methods for selecting a fish having increased capability to synthesize omega-3 fatty acids. The present invention further provides fish carrying at least one allele conferring increased capability to synthesize omega-3 fatty acids in their genome and use of a nucleic acid molecule for determining the presence of at least one allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele") within the genome of a fish.

Background of the invention

The omega-3 fatty acids are associated with beneficial health effects in human nutrition. Fatty fish, including salmonids, are good sources for essential omega-3 long-chain polyunsaturated fatty acids (LC-PUFA). Global human consumption of salmonids has increased substantially in the last decades, which has been made possible by extensive fish farming, where Atlantic salmon (Salmo salar) and rainbow trout {Oncorhynchus mykiss) are the dominant species.

Originally, salmonid feeds were mainly based on marine resources and therefore naturally rich in the omega-3 fatty acids. However, through the increase in global fish farming (including non-salmonid species) and increased direct human consumption of marine oils, the marine resources can no longer meet the demand of the fish farming industry. Composition of salmonid feeds has therefore shifted from being largely of marine origin to being largely of agricultural origin, marine oils being replaced by vegetable oils less rich in the omega-3 fatty acids. Coinciding with the shift in composition of salmonid feed a decrease in omega-3 content of farmed salmon has been observed.

The salmonid genome harbors all the enzymes required for synthesizing LC-PUFA, such as omega-3 fatty acids (Leaver et al. 2008), which involves enzymes such as fatty acyl desaturase (fadsd5 and fadsd6) and fatty acid elongase (elovl5 and elovll2). However, the capability of salmonids to synthesize omega-3 fatty acids is somewhat limited and varies between families and individuals.

There is therefore a need for improved methodologies for assessing the capability of fish to synthesize omega-3 fatty acids, particularly methodologies that allow the direct assaying and selection of individual's with increased capability to synthesize omega-3 fatty acids. Summary of the invention

The present inventors have solved this need by having identified polymorphisms within the genome of Atlantic salmon which are associated with increased capability of the fish to synthesize omega-3 fatty acids. Method for predicting

The present invention provides in a first aspect a method for predicting increased capability of a fish to synthesize omega-3 fatty acids, the method comprises:

determining the presence of at least one allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele") within the genome of said fish; wherein

- said fish belongs to the Salmonidae family;

- the at least one omega-3 allele is an allele of at least one polymorphism; and

- the at least one polymorphism is selected from the polymorphisms listed in Table 1. According to particular embodiments, the fish belongs to the genus Salmo.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphisms#l to polymorphism#54 listed in Table 1.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphisms#55 to polymorphism#90 listed in Table 1.

According to particular embodiments, the fish is Atlantic Salmon (Salmo salar). Method for selecting

The present invention provides in a second aspect a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises:

determining the presence of at least one allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele") within the genome of said fish; and selecting said fish as having increased capability to synthesize omega-3 fatty acids when the at least one omega-3 allele is present; wherein

- said fish belongs to the Salmonidae family;

- the at least one omega-3 allele is an allele of at least one polymorphism; and

- the at least one polymorphism is selected from the polymorphisms listed in

Table 1.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphisms#l to polymorphism#54 listed in Table 1.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphisms#55 to polymorphism#90 listed in Table 1.

According to particular embodiments, the fish belongs to the genus Salmo.

According to particular embodiments, the fish is Atlantic Salmon {Salmo salar). Fish The present invention provides in a third aspect a (isolated) fish, such as an isolated fish, selected by the method according to the second aspect of the present invention.

The present invention provides in a fourth aspect a (isolated) fish or progeny thereof, such as an isolated fish or progeny thereof, comprising within its genome at least one allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele"); wherein said fish belongs to the Salmonidae family.

According to particular embodiments, the at least one omega-3 allele is an allele of at least one polymorphism; and the at least one polymorphism is selected from the polymorphisms listed in Table 1.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphisms#l to polymorphism#54 listed in Table 1.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphisms#55 to polymorphism#90 listed in Table 1.

According to particular embodiments, the fish comprises within its genome at least one nucleotide sequence selected from the group consisting of a) a nucleotide sequence set forth in any one SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180, and b) a nucleotide sequence derived from any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide

substitution(s).

According to particular embodiments, the fish belongs to the genus Salmo.

According to particular embodiments, the fish is Atlantic Salmon {Salmo salar). Use

The present invention provides in a fifth aspect use of a nucleic acid molecule comprising at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NO: 55 to 108 or SEQ ID NOs: 145 to 180, b) nucleotide sequences derived from any one of SEQ ID NO: 55 to 108 or SEQ ID NOs: 145 to 180 by 1 to 5, such as 1 to 2, nucleotide substitutions and c) complements of a) and b), for determining the presence of at least one allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele") within the genome of a fish belonging to the Salmonidae family. According to particular embodiments, the fish belongs to the genus Salmo.

According to particular embodiments, the fish is Atlantic Salmon {Salmo salar).

Brief description of drawings

Figure 1. Significance levels of SNPs tested for their association to capability to synthesize DPA (example la-d). The SNPs have been ranked according to statistical significance, expressed as the negative of the base- 10 logarithm of the SNP's p- values. The two SNPs with the highest significance level, which are located on chromosome 19 and 23 respectively, are marked with circles.

Detailed description of the invention

Unless specifically defined herein, all technical and scientific terms used have the same meaning as commonly understood by a skilled artisan in the fields of genetics, biochemistry, and molecular biology.

All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will prevail.

Polymorphisms and omega-3 allele(s) of the invention

The present inventors have identified quantitative trait loci (QTL) responsible for a significant fraction of the genetic variation in capability to synthesize omega-3 fatty acids in Atlantic salmon. More specifically, the present inventors have identified polymorphisms within the genome, more particularly on chromosome 19 and 23, of Atlantic salmon which are associated with increased capability of the fish to synthesize omega-3 fatty acids. Specific details of polymorphisms of the invention are provided in Table 1 below. The respective nucleotide sequences, including the polymorphism at the polymorphic site, are shown in Table 2 below.

The polymorphisms of the invention can be present in either of two forms, i.e., the polymorphisms have two alleles. One allele can be characterized as being an allele conferring increased capability to synthesize omega-3 fatty acids. This means that a fish having such allele at the position of a polymorphism detailed herein shows increased capability to synthesize omega-3 fatty acids. This allele is herein denoted "omega-3 allele". The respective omega-3 allele for each of the polymorphisms of the invention is specified in Table 1 and table 2 below. An omega-3 allele according to the present invention may therefore be used to predict increased capability of a fish to synthesize omega-3 fatty acids. An omega-3 allele according to the present invention may also be used to select a fish having increased capability to synthesize omega-3 fatty acids. The other allele can be characterized as being an allele that does not confer increased capability to synthesize omega-3 fatty acids. Such allele is herein denoted "non-omega-3 allele".

Fish belonging to the Salmonidae family, and in particular fish belonging to the genus Salmo such as Atlantic salmon, are diploid, in some case triploid, organisms and thus possess at least two copies of the polymorphisms of the invention (one copy to be found on each copy of chromosome 19 and/or 23).

As demonstrated herein, if at least one allele of a polymorphism is the respective omega-3 allele then the fish has increased capability to synthesize omega-3 fatty acids compared to a fish wherein both alleles are non-omega-3 alleles (i.e. such fish being homozygous for the non-omega-3 allele). It would be expected that the capability to synthesize omega-3 fatty acids is even further increased if both alleles of a polymorphism are the respective omega-3 allele (such fish being homozygous for the omega-3 allele).

A polymorphism of the invention may be any of several polymorphisms associated with increased capability of a fish to synthesize omega-3 fatty acids. Particularly, a polymorphism of the invention is a polymorphism located on chromosome 19 and/or 23, i.e. a polymorphism found to be located on chromosome 19 and/or 23 on the basis of genetic linkage analysis, Fluorescence in situ Hybridization (FISH) or any other method that assigns DNA polymorphisms to their respective

chromosomes.

A polymorphism of the invention may be any polymorphism, including single nucleotide polymorphism, located within any of the genomic sequences listed in Table 1.

A polymorphism of the invention may be any polymorphism, including single nucleotide polymorphism, whose genetic distances from any one of the

polymorphisms listed in table 1 is smaller than or equal to 10 centi-Morgan. Here, the genetic distance is to be estimated on the basis of recombination event occurring in female fish, and not on recombination events occurring in male fish. A person who is skilled in the art will know how to estimate genetic map distances, as well as what data material is required for this estimation.

A polymorphism of the invention may be any polymorphism, including single nucleotide polymorphism, which is in strong linkage disequilibrium (LD) with any one of the polymorphisms listed in table 1. Here, two polymorphisms are defined to be in strong LD if the square of the correlation coefficient between the two loci (r2, the most commonly used measure of LD) is equal to or larger than 0.3, such as equal to or larger than 0.5, equal to or larger than 0.6, equal to or larger than 0.7, equal to or larger than 0.8 or equal to or larger than 0.85. A person who is skilled in the art will know how to estimate r2, as well as what data material is required for this estimation.

A polymorphism of the invention may be at least one of the polymorphisms listed in Table 1. Therefore, according to certain embodiments, the at least one

polymorphism of the invention is selected from the polymorphisms listed in Table 1. Each of the polymorphisms listed in Table 1 is contemplated as being disclosed individually as part of the present invention.

Table 1 : Polymorphisms associated with increased capability to synthesize omega-3 fatty acids. A= Adenine, G=Guanine, C=Cytosine, T=Thymine and "none" indicating that no nucleotide is present at the polymorphic site (XnY . Chrom# refers to the Atlantic

salmonchromosome to which the polymorphism is positioned. The column labeled "position" refers to the position of the DNA polymorphi within the DNA sequence of Atlantic Salmon chromosome 9 and chromosome 23 respectively (GenBank identifiers NC 027308.1 and NC 027322.1 for chromosome 9 and 23 respectively). dbID is the NCBI submission number of the polymorphism within the NCBI (Natio Center for Biotechnology Information) Polymorphism Database (the respective reference dbID numbers (ss#) can be retrieved from NCBI). Omega-3 allele refers to the polymorphism allele conferring increased capability to synthesize omega-3 fatty acids. Non-omega-3 allele re to the polymorphism allele not conferring increased capability to synthesize omega-3 fatty acids.

Polymorphisms SEQIDNO Chrom# Position dbID Omega-3 allele Non-omega-3 allele

1 1 ssal9 19895767 ssl 868137739 A G

2 2 ssal9 25376652 ssl 868378136 G A

3 3 ssal9 26780975 ssl 868124594 C T

4 4 ssal9 28210468 ssl 868442160 A C

5 5 ssal9 28755663 ssl 868161715 C A

6 6 ssal9 36869547 ssl 867977793 C T

7 7 ssal9 37561122 ssl 868080879 T G

8 8 ssal9 40839372 ssl 8681 14102 T C

9 9 ssal9 42653157 ssl 868049285 T G

10 10 ssal9 42660051 ssl 868670002 T C

11 11 ssal9 43082080 ssl 868149578 T C

12 12 ssal9 43112620 ssl 868332146 T C

13 13 ssal9 48388589 ssl 868159838 A G

14 14 ssal9 48593490 ssl 868626712 A G

15 15 ssal9 48863492 SS1868121121 A G

16 16 ssal9 49668348 ssl 868396098 A G

17 17 ssal9 50613128 ssl 868598678 A G

18 18 ssal9 50931487 ssl 868123695 T G

19 19 ssal9 51142623 ssl 867982908 C T

50 50 ssa23 44241630 ssl868348612 A G

51 51 ssa23 42811552 ssl868489256 G A

52 52 ssa23 43510086 ssl868208243 G A

53 53 ssa23 44934931 ssl868573197 C A

54 54 ssa23 44264938 ssl868787725 G T

55 109 ssa23 73285797 ss2137504177 C A

56 110 ssa23 73288360 SS2711319105 C G

57 111 ssa23 73288717 SS2711319106 T C

GTCAGGGCGATG

ssa23 GGAAAGTGCAAA

58 112 73289224 SS2711319107 none T

59 113 ssa23 73290400 SS2711319108 CAG AAT

60 114 ssa23 73290625 SS2711319109 T C

61 115 ssa23 73290681 SS2711319110 T c

62 116 ssa23 73292024 ss2711319111 C A

63 117 ssa23 73292367 SS2711319112 T C

64 118 ssa23 73293222 SS2711319113 A G

65 119 ssa23 73293369 SS2711319114 G A

66 120 ssa23 73295813 SS2711319115 A T

67 121 ssa23 73296004 SS2711319116 T A

68 122 ssa23 73297143 SS2711319117 none A

69 123 ssa23 73301151 SS2711319118 T C

70 124 ssa23 73301280 SS2711319119 T A

71 125 ssa23 73301523 SS2711319120 C A

72 126 ssa23 73305580 ss2711319121 G T

73 127 ssa23 73306850 ss2711319123 A C

74 128 ssa23 73310151 SS2711319124 A G

75 129 ssa23 73310296 SS2711319125 CC TT

76 130 ssa23 73310306 SS2711319126 A T

77 131 ssa23 73313073 SS2711319128 CA AC

78 132 ssa23 73313452 SS271 13 19129 A T

79 133 ssa23 73313605 SS271 13 19130 T G

80 134 ssa23 73313618 ss271 1319131 A G

81 135 ssa23 73313620 ss271 1319132 A C

82 136 ssa23 73314170 ss271 1319133 G A

83 137 ssa23 73314268 ss271 1319134 A G

84 138 ssa23 73314297 SS271 13 19135 G T

85 139 ssa23 73314377 ss271 1319136 G A

86 140 ssa23 73314587 ss271 1319137 A G

87 141 ssa23 73314884 ss271 13 19138 T C

88 142 ssa23 73315323 ss271 13 19139 T C

89 143 ssa23 73315499 SS271 13 19140 G T

90 144 ssa23 73315552 SS271 13 19141 T c

It is to be understood that the information provided in table 1 is a supplement to the information provided in table 2, i.e. polymorphism^ table 1 and polymorphism^ in table 2 refers to the same polymorphism.

Table 2: Nucleotide sequence containing polymorphism. The column in Table 2 labeled "Nucleotide sequence containing polymorphism" provides the sequence information for a reference nucleotide sequence for identification of the polymorphism within the genome of an Atlantic salmon. A=Adenine, G=Guanine; C=Cytosine, T=Thymine. [X/Y] indicates the polymorphic site, X represents one of the alternati forms of the polymorphism and Y represents the other alternative form. Omega-3 allele refers to the polymorphism allele conferring increa capability to synthesize omega-3 fatty acids. Non-omega-3 allele refers to the polymorphism allele not conferring increased capability to synthesize omega-3 fatty acids.

Polymorphisms SEQIDNO Nucleotide sequence containing polymorphism Omega-3 allele Non-omega-3 allele

1 1 GTACGTTAGATAGCTGTTGACCTGCAAACA[A/G]CACAGTA

GCCAGCCAACTTCTAGTAGAGTT A G

2 2 ATGTGCGGGGGCCTCGCATGCCAGTTGTCC[A/G]TCAAAAC

GCTGGTGTTGTGGTTGTCATGGC G A

3 3 TCTTCATCTCAATTCTTTAAATGTAGGCCA[C/T]GAATACGT

CCCTTTAATTTGAAAACATCAA C T

4 4 ATCTTTGTTTGAAAGATGAAGGGTGGTTCC[A/C]ACACAAA

AAGAGAGAGAACTTCAGAAATTA A C

5 5 ATGCATGAGAGAGAGCTTGAGACTTGTGTG[A/C]GCTCTTT

GTCTCAGAGCATAATAATTTCAC C A

6 6 ACAGGGAAACACATCAAGATTCAGAGAGAA[C/T]GTGGGA

GGGAGGGTGAATGACAGTGAGAGA C T

7 7 TTACATTAGATTAGCATATTTTTAAACAAG[G/T]GTACTCTC

CCTCCAACTGCTGTATGTTTGA T G

8 8 CGTAGAGAGTAATGCAGTTATCTTTCACAG[C/T]CACTTACC

AGGGAGTCCAGCTTTTGGTAGA T C

9 9 ACTCGAAATCCTGATCATCGTTAACAGTTG[G/T]AAAAATG

GCAGAGAAAGTCAAGCGACAGCA T G

10 10 TGGGGGAGTAGTTACATGGAGGCGTGTTGG[C/T]TTCAAAA

CAGCGCCTGTTGTCATCTAGTGT T C

1 1 1 1 GTTTTGGATGGTGCAGGGACGTTGCCTTAC[C/T]TACACCTG

CAGACAGATGTTTTCTGCTAGC T C

12 12 ACAGTCAGGGAACCCGACCAAGAACACAGA[C/T]GCAAAT

TGTCACTAACTTTATGAATATTTC T c

13 13 ATCCACATCTAAGTGCGTGTGTGTAACCTG[A/G]GCTAAGA

GTGGAGTGAGATATGAGAAAATG A G

14 14 ATTGGGATGACAAACAGCAGGAGATGATCA[A/G]GCTGGA

TTCAAGCCATGTGTTTTGTAATCG A G

15 15 CATTAACTTTGACCATCTGTGACGATGCAA[A/G]CTCTAAC

GACGAACTATCATTCTCCATTTT A G

16 16 AGGATAAACATTATCCATGGGCCAGAAAAG[A/G]TTGAATA

CATTGGCCATGCTGTCAATCCAG A G

17 17 GATTTAC ACC ATT AGTT AACAC ATTTT AGC [ A/G] TCTGGTAA

GGCATTCTGGATTATAGGCAAG A G

18 18 TATCTTAAC AT ACAACTGTTTTATATGAGA[G/T] AAAAATCT

TAAGATGGGCAGCTCAGTAGGC T G

19 19 CATTCATCACAGTTACTCCATAATTAGAGA[C/T]AAGGGAA

TGGAGGTGAGGCGCTGCATATGA C T

20 20 GATCAGACTGACCAAAAATGCCAAATTCTC[A/C]AAAAATG

CTTGAGGTAGCGTTTGCGTCCGC A C

21 21 ATTCTTAAATCCCAGAGTCCAGTCCTAAGG[A/C]CTTAGTCT

GGGCTGGTTGTAAGTTCTCCCC A C

22 22 GGGGCCTTGTGCCAGAATCACATCCATCCC[A/G]ACTGTAA

AGTACGTCCTAAATCTAAGGAGG A G

23 23 TGGGGGATGT AGAT AAAGCTTTC AGTTCGC [A/G] TTTCCT AT

GTCTGAGAGAGATTAAGTGTGC G A

24 24 TTTCTCGTCTCCAGGGATGCATTTGTGAAA[C/T]GCTGAATG

TCAGTTGAGATAACGGGTGGTA T C

25 25 ATTTCTTTAAATGAACAGTTCTGTTGAAAG[A/G]AGAGCAG

GTTGAAACACACTGTGGTCAAAA A G

26 26 TGCACAGAATTCTTAATACTCACAATATTA[G/T]AGCGAGT

ATAGGGAACAAGGAGATCTGATA T G

27 27 GAGAAAGCTCAGTGCCAAGCAGTGTGAGAA[A/G]ATGGAG

CGAGATGGCATTTGCCCGACATTC A G

28 28 AAGCCGGTGTGGCAGGAGACTGCTGCGGCC[A/G]TTGCTAA

CAGACTTTTTACCTCTCTCCCCT A G

29 29 TCACGTGATGAATTACTTGGGGGATATGAG[G/T]GGTCATT

TAGGCTCCTATAGATCATGCTCA T G

30 30 GGGCAGTGGTCATATTTATTGGATGGAATC[A/G] AGAAAAT

ATGCCACTACAAATACAATTTGA A G

31 31 GATCAGAACCAGAAGCACCGTCACCACCAT[A/G]ACTCATT

ACTGAAGAGTCGACGGACTCAAA G A

32 32 AGACTAAAGTTTTGGAAAATAGACCATGAG[A/G]CTAAAAT

CGAATAGAGCATGGCAGTCACAG G A

33 33 AGAACGTGGCTACAGCGGCCAAGGGCTAAA[A/C]GAGGCC

CTCCTCTCTCTCAGTTCCAGACCC A C

34 34 TCCAATTACCACACATGAAACCAACCTCCC[G/T]GAGTTAC

GAATTACCAGCCCACCCCCCCAG G T

35 35 AACATGCTTCAGCATTTTTATGAATTTTAC[A/G]ACAGCATT

GATCCAAACTGACTATGCATCG A G

36 36 TTCTACAACAGGTTTCCAAGTGGTACGCGA[A/C] ATAAAAT

GTTGCCTTTGTTTGATCCTAGGC A C

37 37 CAAGAAAATGCTTCTTCCAATCCTCCCAGC[G/T]TGCAGTAC

ATGGCGACTATTCCCCTGGGAG G T

38 38 GTGATGCACTGTAAAAACTAAGGAGGCTTG[A/C]TGGCAGC

AGAGCCAGATTACACCCGCGCTT A c

39 39 CCAGTTCCTGATAAACTTGCTCTCTAAACA[C/T]AGCTCCAA

TGAGCTTCCTCCCCTGTCCTCT T C

40 40 ACTGATATAACAGGAGATAGGAAGTACTTC[A/C]TGCCTGT

TCATGTTTGGTGACAGTGAGACC A C

41 41 CCAGTGAAATTTGTGGCTAATGGTGTCTTC[G/T]CCCTGGAT

ATTAGTGATCACTTTTCTATTG G T

42 42 AGTTTTATTTTAGAAGTAGTCAAATTATTT[C/T]CGAGGTAA

CTGTATTGCCTATTGCGGATTT C T

43 43 TGAAGGAGTAATAAGACTTTGAGACAAATG[C/T]TAACTTT

ATTAGGACGAATAAACATTTGTA C T

44 44 AATTAGTGTGTCAGATTAGTGGTAACATAG[C/T]GTATGAA

GTAGAGAGGGCCATATCATGTAT C T

45 45 GCACAACACAGATTTAGACTATTTATATAG[A/C]TAGAAAG

ATAATACTGTTATGATTATTAGT C A

46 46 AAGCCAAACATTGCTTTATTGAATATAGCC[CATGTGTACA

G/CG]TGTGTACTCATCAAAACTATCAGTCCAGAG CG CATGTGTACAG

47 47 TCTTACATAATATACTCCAAGTGTTCATTT[G/T]ATATGTTA

GTTCGTCTCTGCGATGGTAAAT G T

48 48 ACTCCTCTAACAGTGTTTTGTGGCGTGGTG[A/C] AGATTCAG

AGCTCCACTCACCTTGGGCTTT C A

49 49 TCATCACATATTAAAATCCTTTTCCTTTAC[A/G]TCCTCCTTC

AGATAATACGGTACCGAATAC A G

50 50 TGAGTGAGGCAGGAGATACCATTGTGTGGC[A/G]GGGCTTT

GGCATTTACTGTACTCATAGGTG A G

51 51 ATCGTCCTCGATAGTAAAGTAGTCCGTGGG[A/G]AAAGGTA

GACAAGACTGGAAGAGGAGAAGC G A

52 52 CGTGTTCGTAAGGCACCAATGGGGGGGGGG[A/G] ATGGATT

TACTTGATTTGACCAGTAAGAAA G A

53 53 TGCAATTGCTCGATTATAAATCACTATAAC[A/C]CAATACA

AGTGACAAGAGTCGATGGACTTG C A

54 54 AATTGATACTTAAAATGTACAACTGGTTTG[G/T]CATGTACA

GTATGCGTTTAAATGTATGCCA G T

55 109 TCAGCTGATGTACGAAGGGCTATATAAATA[A/C]ATTTGAT C A

TTGATTTGATTTTGATTTGATCT

56 110 GGTGGACAAGACCGTTTAAATGCAATAGTT[G/C]CGTTAGA C G

AGGAAGATACATCCGTTTAAGCC

57 111 CCGCAGTCCCTGTCGGTCATTTTAGCATCC[C/T]CCTACCGC T C

CCCTCCGCCCTGCATGTCTGTG

58 112 GTAAAAGCAAGGAATGTGCAACTGATGATG[GTCAGGGCG none GTCAGGGCGATG

ATGGGAAAGTGCAAAT/- GGAAAGTGCAAA

] TGC AAACTC AAT AGTT AGCTAC AT ATTTAT T

59 113 GGAAATCTGC AGTTGAAACAAT AAC AAAAC [AAT/C AG] CTC CAG AAT

CCCGCTACTGTTTCAGTAAAAAGCAGA

60 114 GCTGCTCTGGGCTATTAAGATGCACATAAG[C/T]CCCACAC T C

AAAAATTCTTCCTTTTCCTCCAA

61 115 TCCAATCCCAGCTAATCCTAAACTCTGGCC[C/T]TTCTGGCT T c

TGACCACCAATCTAGGTTTTTA

62 116 CAACAGGAAAATAATCCTGCAGCAACAGGA[A/C]ATGTGA C A

ATTATTATGTGGATTATAATTAAT

63 117 ATTGCTGGCTTTCTAACTAAGTAGCCAGCC[C/T]TGTATGTT T C

GGCCAATAGACCTAAGGGATAG

64 118 ACTGGCCCAATGCTCTTAACACGCTTAACC[G/A]CCAGGCT A G

ACCTGTCACCCTAATTTTGGCAA

65 119 AAAATATTTGATCCCCTGCTGATTTTGTAC[A/G]TTTGCCCA G A

CTGACAAAGAAATGATCAGTCT

66 120 TATTTTGTTAAATGGGCTCTATTGTGTGAT[T/A] AATGAGCT A T

CTATAATGTGATAAATGGGCTC

67 121 TTAATGGGCTCTGTAAGGTGATAAATGGGC[A/T]CTATAAT T A

GTGATTAATGGGCTCTATAATGT

68 122 GAAAATCATGAACAACATACTATACTGCTC[A/- none A

]AAAAAATAAAGGGAACACTTAAACAACACA

69 123 GGCATCTGTCTTAGTAACATCCTAGTTCTA[C/T] ACATCTTT T C

ATTAGTAACATCCTAGTTTTAT

70 124 ATTAGTAACATCCTAGTTTT AT ACATCTTT [A/T] TTAGTAAC T A

ATCCTAGTTTTATACATCTGTA

71 125 AAAGTGATGCTGACGCTTCGATAAATTATT[A/C] ATGTGAA C A

AAAATACATGATGCCTCAAAGTG

72 126 TGTGTTGTTTAAGTGTTCCCTTTATTTTTT[T/G]GAGCAGTGT G T

ATATATATGCAGTACCAGTAA

73 127 GTAGGCTGTCATTGTAAATAAGAATTTGTT[C/A]TTAACTAT A C

CTTGCCTAGTTAAATAAAAAGT

74 128 CAAGGGATCCACCCTCCCCCTCATGAGGCC[G/A]GCAGCAG A G

TGTCATCCCATCCCAGCAGGCCA

75 129 TTAAACTAGCCCAAACAACTTGAACATGTC[TT/CC]TGCTAC CC TT

ATGCAATTTGCAAAATATGTTTTA

76 130 CCCAAACAACTTGAACATGTCTTTGCTACA[T/A]GCAATTTG A T

CAAAATATGTTTTATTATTTTT

77 131 TCCGTTTTGGTCTTAATACAACAGAACATC[AC/CA]ATTTTC CA AC

CATTTAAAAAGAAGACGGGAACGA

78 132 CAGAACGACTGCACCGACTGACACTCGCTC [T/A] GCCAAAA A T

GTTCAGAAAAATTAGAGTTTTTG

79 133 AGTCGGAAGTTTACATACACTTAGGTTGGA[G/T]TCATTAA T G

AACTCGTTTTTCAACCACTCCAC

80 134 CAT AC ACTTAGGTTGGAGTC ATT AAAACTC [G/A] TTTTTC AA A G

CCACTCCACAAATTTCTTGTTA

81 135 AGGTTGGAGTCATTAAAACTCGTTTTTCAA[C/A]CACTCCAC A C

AAATTTCTTGTTAACAAACTAT

82 136 ATTCTGTCTCCTAGAAATGAATGTACTTTG[A/G]TGTGAAAA G A

GTGCAAATCAATCCCAGAACAA

83 137 TACAAAAGTATCTATATCCACAGTAAAACG[G/A]GTCCTAT A G

ATCGACATAACCTGAAAGGCCTC

84 138 GGGTCCT AT ATCGACATAACCTGAAAGGCC [T/G] CTC AGC A G T

AGGAAGAAGCCACTGCTCCAAAA

85 139 CTACGGTTTGCAACTGCACATGCTGACAAA[A/G]ATCATAC G A

TTTTTGGAGAAATGTCCTCTGGT

86 140 GGGACTGGTGCACTTCACAAAATAGATGGC[G/A]TCATGAG A G

GGAGGAAAATTATTGAAGAAATA

87 141 GTCAGGAGGAATGGGCCAAAATTCACCAAA[C/T]GTATTGT T C

TGGAAGCTTGTGGAAGGCTACCC

88 142 TAATGAGTCCAAATTTGAGATTTGTGGTTC[C/T]AACCGTCG T C

TGTCTTTGTGAGACGCAGAGTT

89 143 AAACATTTAATCCATTTTAGAAGAAGGCTG[T/G]AACGTAA G T

CAAATTGTAGAAAAAGTCAAGGG

90 144 GTCAAGGGATCTGAATACTTTCCGAATGCA[C/T]TGTACAT T c

ATTGCTCCTCTTATGTGCATTTA

It is to be understood that the information provided in table 2 is a supplement to the information provided in table 1 , i.e. polymorphism^ table 2 and polymorphism^ in table 1 refers to the same polymorphism.

The column in Table 2 labeled "Nucleotide sequence containing polymorphism" provides the sequence information necessary for identification of the polymorphism within the genome of an Atlantic salmon. The sequences SEQ ID NO: 1 to 90 are each polymorphic sequences including a polymorphic site. A "polymorphic sequence" is a nucleotide sequence including a polymorphic site at which a polymorphism occurs. All or only part of the polymorphic sequence flanking the polymorphic site can be used by the skilled practitioner to identify the polymorphim within the genome of an Atlantic salmon. The letter "n" in SEQ ID NO: 1 to 54 and SEQ ID NO: 109 to 144 is located at position 31 indicating the position of the polymorphic site.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

po lymorphism#54.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#55 to

polymorphism#90.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#54.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#49.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#49.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#50 to

polymorphism#54.

According to particular embodiments, the at least one polymorphism of the invention is polymorphism#46.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 54.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 109 to 144. According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 49.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 50 to 54.

According to certain embodiments, the at least one polymorphism of the invention is a polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46. The polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46 has two alternative alleles. The omega-3 allele is represented by the two nucleotides CG and the non-omega-3 allele is represented by the eleven nucleotides CATGTGTACAG.

It is understood that the foregoing disclosure regarding the polymorphisms of the invention, and in particular regarding omega-3 allele(s), is applicable to the following aspects. Method for predicting

The present invention provides in a first aspect a method for predicting increased capability of a fish to synthesize omega-3 fatty acids, the method comprises: determining the presence of at least one, such as at least two, allele(s) conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele") within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish;

wherein

- said fish belongs to the Salmonidae family;

- the at least one omega-3 allele is an allele of at least one polymorphism; and - the at least one polymorphism is selected from the polymorphisms listed in Table 1.

Each of the polymorphisms listed in Table 1 is contemplated as being disclosed individually as part of the present invention. According to certain embodiments, the at least one omega-3 allele is an allele of at least one single nucleotide polymorphism(s).

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism^ to polymorphism#54.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism#55 to polymorphism#90.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#49.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#50 to

polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is polymorphism#46.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 54 or SEQ ID NOs: 109 to 144.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 109 to 144. According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 49. According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 50 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is a polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46.

According to certain embodiments, said fish belongs to the genus Salmo.

According to certain embodiments, said fish is Atlantic Salmon {Salmo salar).

In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of Hexadecatrienoic acid (HTA), a-Linolenic acid (ALA), Stearidonic acid (SDA), Eicosatrienoic acid (ETE), Eicosatetraenoic acid (ETA), Eicosapentaenoic acid (EPA), Heneicosapentaenoic acid (HPA), Docosapentaenoic acid (DPA), Docosahexaenoic acid (DHA), Tetracosapentaenoic acid, Tetracosahexaenoic acid; or any combination thereof. In another embodiment according to the present invention, the term omega-3 fatty acids refer to long chain (LC) omega-3 fatty acids. Examples of LC omega-3 fatty acids are DPA, EPA and DHA. In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of DPA, EPA, DHA; or any combination thereof. In one embodiment according to the present invention, the term omega-3 fatty acids refers to Docosapentaenoic acid (DPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Eicosapentaenoic acid (EPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Docosahexaenoic acid (DHA).

According to certain embodiments, fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids. Examples of diets low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, are EWOS Opal 1 10/120, such as EWOS Opal 120 1000-30A, 10.0mm or EWOS Opal 120 2500-30A (see table 4 for further information about these commercially available feeds).

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, for at least 1 month, such as at least 2 months, at least 3 months, at least 4 months, at least 6 months or at least 8 months prior to measuring the omega-3 content in said fish.

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500, 9.0mm for the last 5 months prior to measuring the omega-3 content in said Atlantic salmon. The effect of this feeding scheme is further described in example la- Id.

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a substantially vegetable diet, such as a vegetable diet.

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet devoid of omega-3 fatty acids, in particular devoid of marine omega-3 fatty acids.

It is to be understood that an omega-3 allele may confer increased capability to synthesize omega-3 fatty acids through a number of different mechanisms. The increased capability to synthesize omega-3 fatty acids may e.g. be the result of: - a change in a regulatory sequence of a gene which e.g. may affect the level of transcription and/or translation; and/or - a change in amino acid sequence of a protein which e.g. may affect the activity of an enzyme.

Since the omega-3 allele may confer increased capability to synthesize omega-3 fatty acids through a number of different mechanisms, it is to be understood that presence of an omega-3 allele may be determined e.g. by a) identifying a change in a DNA sequence, b) identifying a change in a RNA sequence, such as a mRNA sequence, c) identifying a change in protein sequence, d) identifying a change in transcription level of a gene, e) identifying a change in translation level of a transcript and/or f) identifying a change in protein activity, such as enzymatic activity in case the protein in question is an enzyme.

Numerous techniques are known in the art for a) identifying a change in a DNA sequence, b) identifying a change in a RNA sequence, such as a mRNA sequence, c) identifying a change in protein sequence, d) identifying a change in transcription level of a gene, e) identifying a change in translation level of a transcript, and/or f) identifying a change in protein activity, and a person skilled in the art will easily know how to identify such changes.

According to certain embodiments, the present invention provides a method for predicting increased capability of a fish to synthesize omega-3 fatty acids, the method comprises: determining the identity of nucleotide(s) of at least one allele of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 54 or SEQ ID NOs: 109 to 144, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 54 or SEQ ID NOs: 109 to 144 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); wherein said fish belongs to the Salmonidae family.

In one embodiment according to the present invention, the nucleotide substitution(s) of the derived sequences is/ are located in the sequence(s) flanking the polymorphic site. The letter "n" in SEQ ID NO: 1 to 54 and SEQ ID NOs: 109 to 144 is located at position 31 indicating the position of the polymorphic site. Thus, the

polymorphism allele in question is not altered by said nucleotide substitution(s).

In one embodiment according to the present invention, the at least one

polymorphism is selected from the polymorphisms listed in Table 1.

The polymorphisms of the invention can be present in either of two forms, i.e., the polymorphisms have two alleles. The nucleotide(s) to be determined represents the nucleotide(s) constituting either of these two alleles, i.e. the nucleotide(s) to be determined represents the nucleotide(s) constituting either an omega-3 allele or a non-omega-3 allele. The respective omega-3 allele and non-omega-3 allele for each of the polymorphisms of the invention is specified in Table 1 and table 2. According to certain embodiments, the present invention provides a method for predicting increased capability of a fish to synthesize omega-3 fatty acids, the method comprises: determining the identity of a nucleotide of at least one allele of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); wherein said fish belongs to the Salmonidae family.

According to certain embodiments, the present invention provides a method for predicting increased capability of a fish to synthesize omega-3 fatty acids, the method comprises: determining the identity of nucleotide(s) of at least one allele of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 49, or at a position

corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 49 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); wherein said fish belongs to the Salmonidae family.

According to certain embodiments, the present invention provides a method for predicting increased capability of a fish to synthesize omega-3 fatty acids, the method comprises: determining the identity of a nucleotide of at least one allele of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); wherein said fish belongs to the Salmonidae family.

According to certain embodiments, the present invention provides a method for predicting increased capability of a fish to synthesize omega-3 fatty acids, the method comprises: determining the identity of a nucleotide of at least one allele of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 50 to 54, or at a position

corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 50 to 54 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); wherein said fish belongs to the Salmonidae family.

According to certain embodiments, the present invention provides a method for predicting increased capability of a fish to synthesize omega-3 fatty acids, the method comprises: determining the identity of the nucleotides of at least one allele of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in SEQ ID NOs: 46, or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NOs: 46 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); wherein said fish belongs to the Salmonidae family.

The nucleotide(s) to be determined is/are the nucleotide(s) constituting either of the two forms of the polymorphism allele, i.e. either the omega-3 allele or the non- omega-3 allele. In one embodiment according to the present invention, the nucleotide substitution(s) of the derived sequences is/ are located in the sequence(s) flanking the polymorphic site. The letter "n" in SEQ ID NO: 1 to 54 or SEQ ID NO: 109 to 144 is located at position 31 indicating the position of the polymorphic site. Thus, the polymorphism allele in question is not altered by said nucleotide substitution(s).

Numerous techniques are known in the art for determining the identity of nucleotide(s) of an allele present at a polymorphic site. For example, the determination may involve sequence analysis of the fish to be tested using, e.g., traditional sequence methodologies (e.g., the "dideoxy-mediated chain termination method, "also known as the "Sanger Method" (Sanger, F., et al., J. Molec. Biol. 94: 441 (1975); Prober et al. Science 238 : 336-340 (1987)) and the "chemical degradation method" also known as the "Max am- Gilbert method" (Maxam, A. M., et al., Proc. Natl. Acad. Sci. (U. S. A.) 74: 560 (1977). Alternatively, the

determination may involve single base extension of DNA oligonucleotides terminating at the polymorphic site (e.g. iPLEX assays from Sequenom (San Diego, USA) and Infinium assays from Illumina (San Diego, USA), allele-specific ligation assays (e.g. Axiom technology from Affymetrix (San Diego, USA), allele-specific PCR (e.g. SNPtype assays from Fluidigm (San Francisco) or KASP assays from LGC Genomics (Teddington, UK)), or competitive hybridisation of probes complementary to the different alleles (e.g. the TaqMan assay from Applied Biosystems (Foster City, USA)). Methods for the detection of allelic variation are also reviewed by Nollau et al., Clin. Chem. 43, 1 1 14-1 120, 1997; and in standard textbooks, for example

"Laboratory Protocols for Mutation Detection", Ed. by U. Landegren, Oxford University Press, 1996 and "PCR", 2nd Edition by Newton & Graham, BIOS Scientific Publishers Limited, 1997. For analyzing polymorphisms, it may for example be appropriate to use

oligonucleotides specific for alternative polymorphism alleles. Such

oligonucleotides which detect polymorphism variations, and in particular single nucleotide variations, in target sequences may be referred to by such terms as "allele-specific oligonucleotides", "allele-specific probes", or "allele-specific primers". The design and use of allele-specific probes for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al., Nature 324, 163-166 (1986);

Dattagupta, EP235726; and Saiki, WO 89/1 1548.

Method for selecting The present invention provides in a second aspect a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises: determining the presence of at least one, such as at least two, allele(s) conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele") within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish; selecting said fish as having increased capability to synthesize omega-3 fatty acids when the at least one, such as at least two, omega-3 allele(s) is present: wherein

- said fish belongs to the Salmonidae family;

- the at least one omega-3 allele is an allele of at least one polymorphism; and

- the at least one polymorphism is selected from the polymorphisms listed in Table 1.

Each of the polymorphisms listed in Table 1 is contemplated as being disclosed individually as part of the present invention.

According to certain embodiments, the at least one omega-3 allele is an allele of at least one single nucleotide polymorphism. According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism^ to polymorphism#54.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism#55 to polymorphism#90.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#49.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#50 to

polymorphism#54. Each and one of these polymorphism being a single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is polymorphism#46.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 54. According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 109 to 144.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 49.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 50 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is a polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46.

According to certain embodiments, said fish belongs to the genus Salmo. According to certain embodiments, said fish is Atlantic Salmon {Salmo salar).

In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of Hexadecatrienoic acid (HTA), a-Linolenic acid (ALA), Stearidonic acid (SDA), Eicosatrienoic acid (ETE), Eicosatetraenoic acid (ETA), Eicosapentaenoic acid (EPA), Heneicosapentaenoic acid (HPA), Docosapentaenoic acid (DPA), Docosahexaenoic acid (DHA), Tetracosapentaenoic acid, Tetracosahexaenoic acid; or any combination thereof.

In another embodiment according to the present invention, the term omega-3 fatty acids refer to long chain (LC) omega-3 fatty acids. Examples of LC omega-3 fatty acids are DPA, EPA and DHA. In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of DPA, EPA, DHA; or any combination thereof. In one embodiment according to the present invention, the term omega-3 fatty acids refers to Docosapentaenoic acid (DP A). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Eicosapentaenoic acid (EPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Docosahexaenoic acid (DHA).

According to certain embodiments, fish belonging to the Salmonidae family carrying at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids. Examples of diets low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, are EWOS Opal

1 10/120, such as EWOS Opal 120 1000-30A, 10.0mm or EWOS Opal 120 2500- 30A (see table 4 for further information about these commercially available feeds).

According to certain embodiments, the fish belonging to the Salmonidae family carrying at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, for at least 1 month, such as at least 2 months, at least 3 months, at least 4 months, at least 6 months or at least 8 months prior to measuring the omega-3 content in said fish.

According to certain embodiments, the fish belonging to the Salmonidae family carrying at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500, 9.0mm for the last 5 months prior to measuring the omega-3 content in said Atlantic salmon. The effect of this feeding scheme is further described in example la- Id.

According to certain embodiments, the fish belonging to the Salmonidae family carrying at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a substantially vegetable diet, such as a vegetable diet.

According to certain embodiments, the fish belonging to the Salmonidae family carrying at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet devoid of omega-3 fatty acids, in particular devoid of marine omega-3 fatty acids.

It is to be understood that an omega-3 allele may confer increased capability to synthesize omega-3 fatty acids through a number of different mechanisms. The increased capability to synthesize omega-3 fatty acids may e.g. be the result of:

- a change in a regulatory sequence of a gene which e.g. may affect the level of transcription and/or translation; and/or - a change in amino acid sequence of a protein which e.g. may affect the activity of an enzyme.

Since the omega-3 allele may confer increased capability to synthesize omega-3 fatty acids through a number of different mechanisms, it is to be understood that presence of an omega-3 allele may be determined e.g. by a) identifying a change in a DNA sequence, b) identifying a change in a RNA sequence, such as a mRNA sequence, c) identifying a change in protein sequence, d) identifying a change in transcription level of a gene, e) identifying a change in translation level of a transcript and/or f) identifying a change in protein activity, such as enzymatic activity in case the protein in question is an enzyme.

Numerous techniques are known in the art for a) identifying a change in a DNA sequence, b) identifying a change in a RNA sequence, such as a mRNA sequence, c) identifying a change in protein sequence, d) identifying a change in transcription level of a gene, e) identifying a change in translation level of a transcript, and/or f) identifying a change in protein activity, and a person skilled in the art will easily know how to identify such changes.

According to certain embodiments, the present invention provides a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises: determining the identity of nucleotide(s) of at least one allele, optionally of at least two alleles, of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 54 or SEQ ID NOs: 109 to 144, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 54 or SEQ ID NOs: 109 to 144 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); selecting said fish as having increased capability to synthesize omega-3 fatty acids when the nucleotide(s) of the at least one allele is nucleotide(s) corresponding to the omega-3 allele of the polymorphism;

wherein

- said fish belongs to the Salmonidae family; and

- the at least one polymorphism is selected from the polymorphisms listed in

Table 1. The polymorphisms of the invention can be present in either of two forms, i.e., the polymorphisms have two alleles. The nucleotide(s) to be determined represents the nucleotide(s) constituting either of these two alleles, i.e. the nucleotide(s) to be determined represents the nucleotide(s) constituting either an omega-3 allele or a non-omega-3 allele. The respective omega-3 allele and non-omega-3 allele for each of the polymorphisms of the invention is specified in Table 1

According to certain embodiments, the present invention provides a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises: determining the identity of a nucleotide of at least one allele, optionally of at least two alleles, of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); selecting said fish as having increased capability to synthesize omega-3 fatty acids when the nucleotide of the at least one allele is a nucleotide corresponding to the omega-3 allele of the polymorphism; wherein said fish belongs to the Salmonidae family.

According to certain embodiments, the present invention provides a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises: determining the identity of nucleotide(s) of at least one allele, optionally of at least two alleles, of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 49, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 49 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); selecting said fish as having increased capability to synthesize omega-3 fatty acids when the nucleotide(s) of the at least one allele is nucleotide(s) corresponding to the omega-3 allele of the polymorphism; wherein - said fish belongs to the Salmonidae family; and

- the at least one polymorphism is selected from the polymorphisms listed in Table 1.

According to certain embodiments, the present invention provides a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises: determining the identity of a nucleotide of at least one allele, optionally of at least two alleles, of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); selecting said fish as having increased capability to synthesize omega-3 fatty acids when the nucleotide of the at least one allele is a nucleotide corresponding to the omega-3 allele of the polymorphism;

wherein - said fish belongs to the Salmonidae family; and

- the at least one polymorphism is selected from the polymorphisms listed in Table 1.

According to certain embodiments, the present invention provides a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises: determining the identity of a nucleotide of at least one allele, optionally of at least two alleles, of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 50 to 54, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 50 to 54 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); selecting said fish as having increased capability to synthesize omega-3 fatty acids when the nucleotide of the at least one allele is a nucleotide corresponding to the omega-3 allele of the polymorphism; wherein - said fish belongs to the Salmonidae family; and

- the at least one polymorphism is selected from the polymorphisms listed in

Table 1.

According to certain embodiments, the present invention provides a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises:

determining the identity of nucleotides of at least one allele, optionally of at least two alleles, of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 46, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 46 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); selecting said fish as having increased capability to synthesize omega-3 fatty acids when the nucleotides of the at least one allele are nucleotides corresponding to the omega-3 allele of the polymorphism; wherein

- said fish belongs to the Salmonidae family; and

- the at least one polymorphism is selected from the polymorphisms listed in

Table 1.

In one embodiment according to the present invention, the nucleotide substitution(s) of the derived sequences is/ are located in the sequence(s) flanking the polymorphic site. The letter "n" in SEQ ID NO: 1 to 54 or SEQ ID NO: 109 to 144 is located at position 31 indicating the position of the polymorphic site. Thus, the polymorphism allele in question is not altered by said nucleotide substitution(s).

According to certain embodiments, the method is for selecting a fish having increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids. Examples of diets low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, are EWOS Opal 1 10/120, such as EWOS Opal 120 1000-30A, 10.0mm or EWOS Opal 120 2500-30A (see table 4 for further information about the feed).

According to certain embodiments, the method is for selecting a fish having increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, for at least 8 months prior to measuring the omega-3 content in said fish.

According to certain embodiments, the method is for selecting a fish having increased capability to synthesize omega-3 fatty acids when fed EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500, 9.0mm for the last 5 months prior to measuring the omega-3 content in said fish. The effect of this feeding scheme is further described in example l a- Id.

According to certain embodiments, the method is for selecting a fish having increased capability to synthesize omega-3 fatty acids when fed a vegetable diet.

According to certain embodiments, the method is for selecting a fish having increased capability to synthesize omega-3 fatty acids when fed a diet devoid of omega-3 fatty acids, in particular devoid of marine omega-3 fatty acids.

According to certain embodiments, the present invention provides a method for selecting a fish having increased capability to synthesize omega-3 fatty acids, the method comprises: determining the identity of nucleotide(s) of at least one allele, optionally of at least two alleles, of at least one polymorphism associated with (increased) capability to synthesize omega-3 fatty acids within the genome (e.g., on chromosome 19 and/or 23 of the genome) of said fish, said at least one polymorphism being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 54 or SEQ ID NO: 109 to 144, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 54 or SEQ ID NO: 109 to 144 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); selecting said fish as having increased capability to synthesize omega-3 fatty acids when

- an adenine is present at a position corresponding to position 31 of the nucleotide sequence set forth in SEQ ID NO: 1 , or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); - a guanine is present at a position corresponding to position 31 of SEQ ID NO: 2 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 2 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO: 3 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 3 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO: 4 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 4 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO: 5 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 5 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO: 6 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 6 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO: 7 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 7 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO: 8 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 8 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO: 9 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 9 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

10 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 10 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

1 1 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 1 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

12 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 12 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

13 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 13 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

14 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 14 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

15 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 15 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

16 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 16 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

17 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 17 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

18 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 18 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

19 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 19 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

20 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 20 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

21 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 21 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

22 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 22 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

23 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 23 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

24 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 24 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

25 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 25 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

26 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 26 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

27 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 27 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

28 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 28 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

29 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 29 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

30 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 30 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

31 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 31 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

32 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 32 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

33 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 33 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

34 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 34 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

35 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 35 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

36 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 36 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

37 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 37 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

38 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 38 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

39 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 39 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

40 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 40 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

41 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 41 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

42 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 42 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

43 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 43 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

44 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 44 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

45 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 45 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine-guanine (CG) is present at a position corresponding to position 31 of SEQ ID NO: 46 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 46 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO: 47 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 47 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

48 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 48 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

49 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 49 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a adenine is present at a position corresponding to position 31 of SEQ ID NO:

50 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 50 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

51 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 51 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

52 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 52 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

53 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 53 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

54 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 54 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

109 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 109 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cytosine is present at a position corresponding to position 31 of SEQ ID NO:

1 10 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 10 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO: 1 1 1 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 1 1 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or no nucleotide is present at a position corresponding to position 31 of SEQ ID NO: 1 12 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 12 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cystine-adenine-guanine is present at a position corresponding to position 31 of SEQ ID NO: 1 13 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 13 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

1 14 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 14 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

1 15 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 15 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cystine is present at a position corresponding to position 31 of SEQ ID NO:

1 16 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 16 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

1 17 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 17 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO:

1 18 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 18 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

1 19 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 1 19 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO:

120 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 120 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

121 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 121 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or no nucleotide is present at a position corresponding to position 31 of SEQ ID NO: 122 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 122 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

123 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 123 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

124 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 124 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cysteine is present at a position corresponding to position 31 of SEQ ID NO:

125 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 125 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

126 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 126 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO:

127 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 127 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO:

128 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 128 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cysteine-cysteine is present at a position corresponding to position 31 of SEQ ID NO: 129 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 129 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO: 130 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 130 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a cysteine-adenine is present at a position corresponding to position 31 of SEQ ID NO: 131 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 131 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO:

132 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 132 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a thymine is present at a position corresponding to position 31 of SEQ ID NO:

133 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 133 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO:

134 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 134 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO:

135 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 135 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or a guanine is present at a position corresponding to position 31 of SEQ ID NO:

136 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 136 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or an adenine is present at a position corresponding to position 31 of SEQ ID NO:

137 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 137 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or

- a guanine is present at a position corresponding to position 31 of SEQ ID NO:

138 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 138 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or

- an guanine is present at a position corresponding to position 31 of SEQ ID NO:

139 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 139 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or

- an adenine is present at a position corresponding to position 31 of SEQ ID NO:

140 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 140 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or - a thymine is present at a position corresponding to position 31 of SEQ ID NO:

141 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 141 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or

- an thymine is present at a position corresponding to position 31 of SEQ ID NO:

142 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 142 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or

- a guanine is present at a position corresponding to position 31 of SEQ ID NO:

143 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 143 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); and/or

- a thymine is present at a position corresponding to position 31 of SEQ ID NO:

144 or at a position corresponding to position 31 of a nucleotide sequence which is derived from SEQ ID NO: 144 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s); wherein said fish belongs to the Salmonidae family.

In one embodiment according to the present invention, the nucleotide substitution(s) of the derived sequences is/ are located in the sequence(s) flanking the polymorphic site. The letter "n" in SEQ ID NO: 1 to 54 or SEQ ID NO: 109 to 144 is located at position 31 indicating the position of the polymorphic site. Thus, the polymorphism allele in question is not altered by said nucleotide substitution(s). The methods for selecting a fish having increased capability to synthesize omega-3 fatty acids may involve determining the identity of nucleotides of at least one allele of more than one polymorphism, such as at least two, at least three or at least 4 polymorphisms. The selection may then be based on the presence of the omega-3 alleles for the polymorphisms analyzed. For example, one may genotype at least polymorphism^ and polymorphism#2. One may also genotype at least

polymorphism^ , polymorphism#2 and polymorphism#3.

Numerous techniques are known in the art for determining the identity of nucleotide(s) of an allele present at a polymorphic site. For example, the

determination may involve sequence analysis of the fish to be tested using, e.g., traditional sequence methodologies (e.g., the "dideoxy-mediated chain termination method, "also known as the "Sanger Method" (Sanger, F., et al., J. Molec. Biol. 94: 441 (1975); Prober et al. Science 238 : 336-340 (1987)) and the "chemical degradation method" also known as the "Max am- Gilbert method" (Maxam, A. M., et al., Proc. Natl. Acad. Sci. (U. S. A.) 74: 560 (1977). Alternatively, the

determination may involve single base extension of DNA oligonucleotides terminating at the polymorphic site (e.g. iPLEX assays from Sequenom (San Diego, USA) and Infinium assays from Illumina (San Diego, USA), allele-specific ligation assays (e.g. Axiom technology from Affymetrix (San Diego, USA), allele-specific PCR (e.g. SNPtype assays from Fluidigm (San Francisco) or KASP assays from LGC Genomics (Teddington, UK)), or competitive hybridisation of probes complementary to the different alleles (e.g. the TaqMan assay from Applied Biosystems (Foster City, USA)). Alternatively, the determination may be based upon so-called next-generation sequencing technology, such as the technologies implemented in the HiSeq2000 instrument or other commercially available sequencing instruments from Illumina (San Diego, USA).

Methods for the detection of allelic variation are also reviewed by Nollau et al., Clin. Chem. 43, 1 1 14-1 120, 1997; and in standard textbooks, for example

"Laboratory Protocols for Mutation Detection", Ed. by U. Landegren, Oxford University Press, 1996 and "PCR", 2nd Edition by Newton & Graham, BIOS Scientific Publishers Limited, 1997.

For analyzing polymorphisms, it may for example be appropriate to use

oligonucleotides specific for alternative polymorphism alleles. Such

oligonucleotides which detect polymorphism variations, and in particular single nucleotide variations, in target sequences may be referred to by such terms as "allele-specific oligonucleotides", "allele-specific probes", or "allele-specific primers". The design and use of allele-specific probes for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al., Nature 324, 163-166 (1986);

Dattagupta, EP235726; and Saiki, WO 89/1 1548. Fish

Individual fish

The present invention provides in a third aspect a (isolated) fish, such as an isolated fish, selected by the method according to the second aspect of the present invention.

The present invention provides in a fourth aspect a (isolated) fish or progeny thereof, such as an isolated fish or progeny thereof, comprising within its genome (e.g., on chromosome 19 and/or 23 of the genome) at least one, such as at least two, allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele"); wherein said fish belongs to the Salmonidae family.

According to certain embodiments, the at least one omega-3 allele is an allele of at least one polymorphism. According to certain embodiments, the at least one omega- 3 allele is an allele of at least one single nucleotide polymorphism(s).

According to certain embodiments, the at least one polymorphism is selected from the polymorphisms listed in Table 1. Each of the polymorphisms listed in Table 1 is contemplated as being disclosed individually as part of the present invention.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism^ to polymorphism#54.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism#55 to polymorphism#90.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#49.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#50 to

polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to particular embodiments, the at least one polymorphism of the invention is polymorphism#46.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 54.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 109 to 144.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 49.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 50 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is a polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46.

According to certain embodiments, said fish belongs to the genus Salmo. According to certain embodiments, said fish is Atlantic Salmon {Salmo salar).

In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of Hexadecatrienoic acid (HTA), a-Linolenic acid (ALA), Stearidonic acid (SDA), Eicosatrienoic acid (ETE), Eicosatetraenoic acid (ETA), Eicosapentaenoic acid (EPA), Heneicosapentaenoic acid (HPA), Docosapentaenoic acid (DPA), Docosahexaenoic acid (DHA), Tetracosapentaenoic acid, Tetracosahexaenoic acid; or any combination thereof. In another embodiment according to the present invention, the term omega-3 fatty acids refer to long chain (LC) omega-3 fatty acids. Examples of LC omega-3 fatty acids are DPA, EPA and DHA. In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of DPA, EPA, DHA; or any combination thereof. In one embodiment according to the present invention, the term omega-3 fatty acids refers to Docosapentaenoic acid (DPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Eicosapentaenoic acid (EPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Docosahexaenoic acid (DHA).

According to certain embodiments, fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids. Examples of diets low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, are EWOS Opal 1 10/120, such as EWOS Opal 120 1000-30A, 10.0mm or EWOS Opal 120 2500-30A (see table 4 for further information about these commercially available feeds).

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, for at least 1 month, such as at least 2 months, at least 3 months, at least 4 months, at least 6 months or at least 8 months prior to measuring the omega-3 content in said fish. According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500, 9.0mm for the last 5 months prior to measuring the omega-3 content in said Atlantic salmon. The effect of this feeding scheme is further described in example la- Id.

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a substantially vegetable diet, such as a vegetable diet. According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet devoid of omega-3 fatty acids, in particular devoid of marine omega-3 fatty acids. It is to be understood that an omega-3 allele may confer increased capability to synthesize omega-3 fatty acids through a number of different mechanisms. The increased capability to synthesize omega-3 fatty acids may e.g. be the result of:

- a change in a regulatory sequence of a gene which e.g. may affect the level of transcription and/or translation; and/or

- a change in amino acid sequence of a protein which e.g. may affect the activity of an enzyme.

Since the omega-3 allele may confer increased capability to synthesize omega-3 fatty acids through a number of different mechanisms, it is to be understood that presence of an omega-3 allele may be determined e.g. by a) identifying a change in a DNA sequence, b) identifying a change in a RNA sequence, such as a mRNA sequence, c) identifying a change in protein sequence, d) identifying a change in transcription level of a gene, e) identifying a change in translation level of a transcript and/or f) identifying a change in protein activity, such as enzymatic activity in case the protein in question is an enzyme.

Numerous techniques are known in the art for a) identifying a change in a DNA sequence, b) identifying a change in a RNA sequence, such as a mRNA sequence, c) identifying a change in protein sequence, d) identifying a change in transcription level of a gene, e) identifying a change in translation level of a transcript, and/or f) identifying a change in protein activity, and a person skilled in the art will easily know how to identify such changes.

According to certain embodiments, the (isolated) fish or progeny thereof, such as an isolated fish or progeny thereof, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide

sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at the polymorphic site.

According to certain embodiments, the (isolated) fish or progeny thereof, such as an isolated fish or progeny thereof, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide

sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108.

According to certain embodiments, the (isolated) fish or progeny thereof, such as an isolated fish or progeny thereof, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide

sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 103, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 103 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, the (isolated) fish or progeny thereof, such as an isolated fish or progeny thereof, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide

sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103.

According to certain embodiments, the (isolated) fish or progeny thereof, such as an isolated fish or progeny thereof, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide

sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 104 to 108, and b) nucleotide sequences derived from any one of SEQ ID NOs: 104 to 108 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s). In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 104 to 108.

According to certain embodiments, the (isolated) fish or progeny thereof, such as an isolated fish or progeny thereof, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide

sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 100, and b) nucleotide sequences derived from SEQ ID NOs: 100 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s). In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, the fish is a female.

According to certain other embodiments, the fish is a male. According to certain embodiments, the fish or progeny thereof is obtained by the method according to the second aspect of the present invention.

Population of fish

The present invention provides in a further aspect a (isolated) population of fish, such as an isolated population of fish, each individual within the population having increased capability to synthesize omega-3 fatty acids. Particularly, the present invention provides a population of fish, each individual within the population comprising within its genome (e.g., on chromosome 19 and/or 23 of the genome) at least one, such as at least two, allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele"); wherein each individual within the population belongs to the Salmonidae family.

According to certain embodiments, the at least one omega-3 allele is an allele of at least one polymorphism. According to certain embodiments, the at least one omega- 3 allele is an allele of at least one single nucleotide polymorphism(s).

According to certain embodiments, the at least one polymorphism is selected from the polymorphisms listed in Table 1. Each of the polymorphisms listed in Table 1 is contemplated as being disclosed individually as part of the present invention.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism^ to polymorphism#54.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism#55 to polymorphism#90. According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#49.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#50 to

polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is polymorphism#46.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 54.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 109 to 144.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 49.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 50 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to certain embodiments, the at least one polymorphism of the invention is a polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46.

According to certain embodiments, each individual within the population belongs to the genus Salmo. According to certain embodiments, each individual within the population is Atlantic Salmon (Salmo salar).

In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of Hexadecatrienoic acid (HTA), a-Linolenic acid (ALA), Stearidonic acid (SDA), Eicosatrienoic acid (ETE), Eicosatetraenoic acid (ETA), Eicosapentaenoic acid (EPA), Heneicosapentaenoic acid (HPA),

Docosapentaenoic acid (DPA), Docosahexaenoic acid (DHA), Tetracosapentaenoic acid, Tetracosahexaenoic acid; or any combination thereof.

In another embodiment according to the present invention, the term omega-3 fatty acids refer to long chain (LC) omega-3 fatty acids. Examples of LC omega-3 fatty acids are DPA, EPA and DHA. In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of DPA, EPA, DHA; or any combination thereof. In one embodiment according to the present invention, the term omega-3 fatty acids refers to Docosapentaenoic acid (DPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Eicosapentaenoic acid (EPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Docosahexaenoic acid (DHA).

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids. Examples of diets low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, are EWOS Opal 1 10/120, such as EWOS Opal 120 1000-30A, 10.0mm or EWOS Opal 120 2500-30A (see table 4 for further information about these commercially available feeds).

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, for at least 1 month, such as at least 2 months, at least 3 months, at least 4 months, at least 6 months or at least 8 months prior to measuring the omega-3 content in said fish.

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500,

9.0mm for the last 5 months prior to measuring the omega-3 content in said Atlantic salmon. The effect of this feeding scheme is further described in example la- I d.

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed a substantially vegetable diet, such as a vegetable diet.

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed a diet devoid of omega-3 fatty acids, in particular devoid of marine omega-3 fatty acids.

According to certain embodiments, the (isolated) population of fish, such as an isolated population of fish, is a population wherein each individual within the population comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at the polymorphic site.

According to certain embodiments, the (isolated) population of fish, such as an isolated population of fish, is a population wherein each individual within the population comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 108 and SEQ ID NOs: 101 to 108 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s). In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108.

According to certain embodiments, the (isolated) population of fish, such as an isolated population of fish, is a population wherein each individual within the population comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 103, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 103 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, the (isolated) population of fish, such as an isolated population of fish, is a population wherein each individual within the population comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103.

According to certain embodiments, the (isolated) population of fish, such as an isolated population of fish, is a population wherein each individual within the population comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 104 to 108, and b) nucleotide sequences derived from any one of SEQ ID NOs: 104 to 108 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 104 to 108. According to certain embodiments, the (isolated) population of fish, such as an isolated population of fish, is a population wherein each individual within the population comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 100, and b) nucleotide sequences derived from SEQ ID NOs: 100 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, the population of fish is a population of female fish.

According to certain embodiments, the population of fish is a population of male fish. According to certain embodiments, the population of fish is a population of male and female fish.

According to certain embodiments, each individual within the population is obtained by the method according to the second aspect of the present invention.

Individual fish cell

The present invention provides in a further aspect a (isolated) fish cell, such as an isolated fish cell, which comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as at least two, allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele"); wherein said fish cell has been isolated from a fish belonging to the Salmonidae family. According to certain embodiments, the at least one omega-3 allele is an allele of at least one polymorphism. According to certain embodiments, the at least one omega- 3 allele is an allele of at least one single nucleotide polymorphism(s).

According to certain embodiments, the at least one polymorphism is selected from the polymorphisms listed in Table 1. Each of the polymorphisms listed in Table 1 is contemplated as being disclosed individually as part of the present invention.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism^ to polymorphism#54.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism#55 to polymorphism#90. According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#49.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#50 to

polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is polymorphism#46.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 54.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 49.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the polymorphic sequences set forth in any one of SEQ ID NOs: 50 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is a polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46.

According to certain embodiments, said fish cell is derived from a fish belonging to the genus Salmo.

According to certain embodiments, said fish cell is derived from an Atlantic Salmon (Salmo salar). In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of Hexadecatrienoic acid (HTA), a-Linolenic acid (ALA), Stearidonic acid (SDA), Eicosatrienoic acid (ETE), Eicosatetraenoic acid (ETA), Eicosapentaenoic acid (EPA), Heneicosapentaenoic acid (HPA), Docosapentaenoic acid (DPA), Docosahexaenoic acid (DHA), Tetracosapentaenoic acid, Tetracosahexaenoic acid; or any combination thereof.

In another embodiment according to the present invention, the term omega-3 fatty acids refer to long chain (LC) omega-3 fatty acids. Examples of LC omega-3 fatty acids are DPA, EPA and DHA. In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of DPA, EPA, DHA; or any combination thereof. In one embodiment according to the present invention, the term omega-3 fatty acids refers to Docosapentaenoic acid (DPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Eicosapentaenoic acid (EPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Docosahexaenoic acid (DHA).

According to certain embodiments, the fish cell carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine- omega-3 fatty acids. Examples of diets low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, are EWOS Opal 1 10/120, such as EWOS Opal 120 1000-30A, 10.0mm or EWOS Opal 120 2500-30A (see table 4 for further information about these commercially available feeds).

According to certain embodiments, the fish cell carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine- omega-3 fatty acids, for at least 1 month, such as at least 2 months, at least 3 months, at least 4 months, at least 6 months or at least 8 months prior to measuring the omega-3 content in said fish cell.

According to certain embodiments, the fish cell carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500, 9.0mm for the last 5 months prior to measuring the omega- 3 content in said fish cell. The effect of this feeding scheme is further described in example la- I d.

According to certain embodiments, the fish cell carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a substantially vegetable diet, such as a vegetable diet.

According to certain embodiments, the fish cell carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet devoid of omega-3 fatty acids, in particular devoid of marine omega-3 fatty acids.

It is to be understood that an omega-3 allele may confer increased capability to synthesize omega-3 fatty acids through a number of different mechanisms. The increased capability to synthesize omega-3 fatty acids may e.g. be the result of:

- a change in a regulatory sequence of a gene which e.g. may affect the level of transcription and/or translation; and/or

- a change in amino acid sequence of a protein which e.g. may affect the activity of an enzyme.

Since the omega-3 allele may confer increased capability to synthesize omega-3 fatty acids through a number of different mechanisms, it is to be understood that presence of an omega-3 allele may be determined e.g. by a) identifying a change in a DNA sequence, b) identifying a change in a RNA sequence, such as a mRNA sequence, c) identifying a change in protein sequence, d) identifying a change in transcription level of a gene, e) identifying a change in translation level of a transcript and/or f) identifying a change in protein activity, such as enzymatic activity in case the protein in question is an enzyme.

Numerous techniques are known in the art for a) identifying a change in a DNA sequence, b) identifying a change in a RNA sequence, such as a mRNA sequence, c) identifying a change in protein sequence, d) identifying a change in transcription level of a gene, e) identifying a change in translation level of a transcript, and/or f) identifying a change in protein activity, and a person skilled in the art will easily know how to identify such changes. According to certain embodiments, the (isolated) fish cell, such as an isolated fish cell, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at the polymorphic site. According to certain embodiments, the (isolated) fish cell, such as an isolated fish cell, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 108 and SEQ ID NOs: 101 to 108 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108. According to certain embodiments, the (isolated) fish cell, such as an isolated fish cell, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome), comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 103, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 103 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, the (isolated) fish cell, such as an isolated fish cell, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103.

According to certain embodiments, the (isolated) fish cell, such as an isolated fish cell, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 104 to 108, and b) nucleotide sequences derived from any one of SEQ ID NOs: 104 to 108 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s). In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 104 to 108.

According to certain embodiments, the (isolated) fish cell, such as an isolated fish cell, comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 100, and b) nucleotide sequences derived from SEQ ID NOs: 100 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, the fish cell is a gamete. According to particular embodiments, the fish cell is an egg, such as an eyed egg. According to more particular embodiments, the egg is unfertilized. According to other more particular embodiments, the egg is fertilized.

According to particular embodiments, the fish cell is a sperm cell. According to certain other embodiments, the fish cell is a somatic cell. According to certain embodiments, the fish cell has been isolated from a fish belonging to the genus Salmo. In another embodiment, the fish cell has been isolated from an Atlantic Salmon {Salmo salar).

According to particular embodiments, the fish cell has been isolated from a female fish of the invention.

According to particular embodiments, the fish cell has been isolated from a male fish of the invention.

Population of fish cells

The present invention provides in a further aspect a (isolated) population of fish cells, such as an isolated population of fish cells, each individual cell within the population having increased capability to synthesize omega-3 fatty acids.

Particularly, the present invention provides a population of fish cells, each individual cell within the population of cells comprising within its genome (e.g., on chromosome 19 and/or 23 of the genome) at least one, such as at least two, allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele"); wherein each individual cell within the population of cells has been isolated from a fish belonging to the Salmonidae family.

According to certain embodiments, the at least one omega-3 allele is an allele of at least one polymorphism. According to certain embodiments, the at least one omega- 3 allele is an allele of at least one single nucleotide polymorphism(s).

According to certain embodiments, the at least one polymorphism is selected from the polymorphisms listed in Table 1. Each of the polymorphisms listed in Table 1 is contemplated as being disclosed individually as part of the present invention.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism^ to polymorphism#54.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism#55 to polymorphism#90.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#49. According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#50 to

polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is polymorphism#46.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 54.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 49.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 50 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is a polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46.

According to certain embodiments, each individual within the population has been isolated from a fish belonging to the genus Salmo. According to certain embodiments, each individual cell within the population of cells has been isolated from Atlantic Salmon (Salmo salar).

In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of Hexadecatrienoic acid (HTA), a-Linolenic acid (ALA), Stearidonic acid (SDA), Eicosatrienoic acid (ETE), Eicosatetraenoic acid (ETA), Eicosapentaenoic acid (EPA), Heneicosapentaenoic acid (HPA), Docosapentaenoic acid (DPA), Docosahexaenoic acid (DHA), Tetracosapentaenoic acid, Tetracosahexaenoic acid; or any combination thereof.

In another embodiment according to the present invention, the term omega-3 fatty acids refer to long chain (LC) omega-3 fatty acids. Examples of LC omega-3 fatty acids are DPA, EPA and DHA. In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of DPA, EPA, DHA; or any combination thereof. In one embodiment according to the present invention, the term omega-3 fatty acids refers to Docosapentaenoic acid (DPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Eicosapentaenoic acid (EPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Docosahexaenoic acid (DHA).

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids. Examples of diets low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, are EWOS Opal 1 10/120, such as EWOS Opal 120 1000-30A, 10.0mm or EWOS Opal 120 2500-30A (see table 4 for further information about these commercially available feeds).

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, for at least 1 month, such as at least 2 months, at least 3 months, at least 4 months, at least 6 months or at least 8 months prior to measuring the omega-3 content in said population of fish cells.

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500, 9.0mm for the last 5 months prior to measuring the omega-3 content in said population of fish cells. The effect of this feeding scheme is further described in example la- I d. According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed a substantially vegetable diet, such as a vegetable diet.

According to certain embodiments, each individual within the population show increased capability to synthesize omega-3 fatty acids when fed a diet devoid of omega-3 fatty acids, in particular devoid of marine omega-3 fatty acids.

According to certain embodiments, the (isolated) population of fish cells, such as an isolated population of fish cells, is a population wherein each individual cell within the population of cells comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s). In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at the polymorphic site.

According to certain embodiments, the (isolated) population of fish cells, such as an isolated population of fish cells, is a population wherein each individual cell within the population of cells comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 108 and SEQ ID NOs: 101 to 108 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s). In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108.

According to certain embodiments, the (isolated) population of fish cells, such as an isolated population of fish cells, is a population wherein each individual cell within the population of cells comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 103, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 103 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, the (isolated) population of fish cells, such as an isolated population of fish cells, is a population wherein each individual cell within the population of cells comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103, and b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103.

According to certain embodiments, the (isolated) population of fish cells, such as an isolated population of fish cells, is a population wherein each individual cell within the population of cells comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 104 to 108, and b) nucleotide sequences derived from any one of SEQ ID NOs: 104 to 108 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 104 to 108.

According to certain embodiments, the (isolated) population of fish cells, such as an isolated population of fish cells, is a population wherein each individual cell within the population of cells comprises within its genome (e.g., on chromosome 19 and/or 23 of its genome) at least one, such as two or three, nucleotide sequence(s) selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 100, and b) nucleotide sequences derived from SEQ ID NOs: 100 by 1 to 5, such as 1 to 2 or 1 to 3, nucleotide substitution(s). In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, each individual within the population of fish cells is a gamete.

According to certain embodiments, each individual within the population of fish cells is an egg, such as an eyed egg.

According to more particular embodiments, the egg is unfertilized.

According to other more particular embodiments, the egg is fertilized. According to certain embodiments, each individual within the population of fish cells is a sperm cell.

According to certain embodiments, each individual within the population of fish cells is a somatic cell.

According to certain embodiments, each individual within the population of fish cells has been isolated from a fish belonging to the genus Salmo. In another embodiment, each individual within the population of fish cells has been isolated from Atlantic Salmon {Salmo salar).

According to certain embodiments, each individual within the population of fish cells has been isolated from a female fish of the invention. According to certain embodiments, each individual within the population of fish cells has been isolated from a male fish of the invention.

Use

The present invention provides in a fifth aspect use of a nucleic acid molecule, such as an isolated nucleic acid molecule. More particularly, the present invention provides use of a nucleic acid molecule, such as an isolated nucleic acid molecule, comprising at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NO: 55 to 108 or SEQ ID NOs: 145 to 180, b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 108 or SEQ ID NOs: 145 to 180 by 1 to 5, such as 1 to 2, nucleotide substitutions and c) complements of a) and b), e.g. as a primer or a probe, for determining the presence of at least one, such as at least two, allele conferring increased capability to synthesize omega-3 fatty acids ("omega-3 allele") within the genome (e.g., on chromosome 19 and/or 23 of the genome) of a fish belonging to the Salmonidae family. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at the polymorphic site.

According to certain embodiments, said fish belongs to the genus Salmo.

According to certain embodiments, said fish is Atlantic Salmon {Salmo salar). According to certain embodiments, the at least one omega-3 allele is an allele of at least one polymorphism. According to certain embodiments, the at least one omega- 3 allele is an allele of at least one single nucleotide polymorphism(s).

According to certain embodiments, the at least one polymorphism is selected from the polymorphisms listed in Table 1. Each of the polymorphisms listed in Table 1 is contemplated as being disclosed individually as part of the present invention.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism^ to polymorphism#54.

According to particular embodiments, the at least one polymorphism is selected from the group consisting of polymorphism#55 to polymorphism#90.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#49.

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism^ to

polymorphism#45 and polymorphism#47 to polymorphism#49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to particular embodiments, the at least one polymorphism of the invention is selected from the group consisting of polymorphism#50 to

polymorphism#54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP). According to particular embodiments, the at least one polymorphism of the invention is polymorphism#46.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 54.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 109 to 144.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 49.

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 1 to 45 and SEQ ID NOs: 47 to 49. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is selected from the polymorphisms corresponding to position 31 of the

polymorphic sequences set forth in any one of SEQ ID NOs: 50 to 54. Each and one of these polymorphisms being single nucleotide polymorphism (SNP).

According to certain embodiments, the at least one polymorphism of the invention is a polymorphism corresponding to position 31 of the polymorphic sequence set forth in SEQ ID NO: 46.

It is to be understood that if the at least one polymorphism of the invention is polymorphism^ , the nucleic acid molecule to be used comprises at least a nucleotide sequence set forth in SEQ ID NO: 55. Similarly, if the at least one polymorphism of the invention is polymorphism#2, the nucleic acid molecule to be used comprises at least a nucleotide sequence set forth in SEQ ID NO: 56.

Similarly, if the at least one polymorphism of the invention is polymorphism#3, the nucleic acid molecule to be used comprises at least a nucleotide sequence set forth in SEQ ID NO: 57. In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of Hexadecatrienoic acid (HTA), a-Linolenic acid (ALA), Stearidonic acid (SDA), Eicosatrienoic acid (ETE), Eicosatetraenoic acid (ETA), Eicosapentaenoic acid (EPA), Heneicosapentaenoic acid (HPA), Docosapentaenoic acid (DPA), Docosahexaenoic acid (DHA), Tetracosapentaenoic acid, Tetracosahexaenoic acid; or any combination thereof.

In another embodiment according to the present invention, the term omega-3 fatty acids refer to long chain (LC) omega-3 fatty acids. Examples of LC omega-3 fatty acids are DPA, EPA and DHA. In one embodiment according to the present invention, omega-3 fatty acids are selected from the group consisting of DPA, EPA, DHA; or any combination thereof. In one embodiment according to the present invention, the term omega-3 fatty acids refers to Docosapentaenoic acid (DPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Eicosapentaenoic acid (EPA). In another embodiment according to the present invention, the term omega-3 fatty acids refers to Docosahexaenoic acid (DHA).

According to certain embodiments, fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids. Examples of diets low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, are EWOS Opal 1 10/120, such as EWOS Opal 120 1000-30A, 10.0mm or EWOS Opal 120 2500-30A (see table 4 for further information about these commercially available feeds). According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet low in omega-3 fatty acids, in particular low in marine-omega-3 fatty acids, for at least 1 month, such as at least 2 months, at least 3 months, at least 4 months, at least 6 months or at least 8 months prior to measuring the omega-3 content in said fish.

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500, 9.0mm for the last 5 months prior to measuring the omega-3 content in said Atlantic salmon. The effect of this feeding scheme is further described in example la- Id.

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a substantially vegetable diet, such as a vegetable diet.

According to certain embodiments, the fish belonging to the Salmonidae family carrying the at least one omega-3 allele within their genome show increased capability to synthesize omega-3 fatty acids when fed a diet devoid of omega-3 fatty acids, in particular devoid of marine omega-3 fatty acids.

According to certain embodiments, the nucleic acid molecule comprises at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108, b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108 by 1 to 5, such as 1 to 2, nucleotide substitutions and c) complements of a) and b).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 108.

According to certain embodiments, the nucleic acid molecule comprises at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 103, b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 103 by 1 to 5, such as 1 to 2, nucleotide substitutions and c) complements of a) and b).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103. In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

According to certain embodiments, the nucleic acid molecule comprises at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103, b) nucleotide sequences derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103 by 1 to 5, such as 1 to 2, nucleotide substitutions and c) complements of a) and b).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 55 to 99 and SEQ ID NOs: 101 to 103. According to certain embodiments, the nucleic acid molecule comprises at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in any one of SEQ ID NOs: 104-108, b) nucleotide sequences derived from any one of SEQ ID NOs: 104-108 by 1 to 5, such as 1 to 2, nucleotide substitutions and c) complements of a) and b).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 of the nucleotide sequence derived from any one of SEQ ID NOs: 104 to 108.

According to certain embodiments, the nucleic acid molecule comprises at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NO: 100, b) nucleotide sequences derived from SEQ ID NOs: 100 by 1 to 5, such as 1 to 2, nucleotide substitutions and c) complements of a) and b).

In one embodiment according to the present invention, the nucleotide substitution(s) is/are not at position 31 or 32 of the nucleotide sequence derived from SEQ ID NO: 100.

In one embodiment according to the present invention, said use is in-vitro use. According to certain embodiments, the nucleic acid molecule or complement thereof is a primer, such as a PCR primer.

According to certain embodiments, the nucleic acid molecule or complement thereof is a probe, such as a hybridization probe.

A probe or primer according to the present invention may have attached to it a detectable label or reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enyzmes. Methods for labelling and guidance in the choice of labels appropriate for various purposes are discussed, for example, in Sambrook et al. (In Molecular Cloning, A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York,

1998). As a particular example, a probe or primer may include one fluorophor, such as an acceptor fluorophore or donor fluorophor. Such fluorophore may be attached at the 5 '- or 3 ' end of the probe/primer.

Definitions As used herein, "increased capability" to synthesize omega-3 fatty acids means that an individual having increased capability has a higher probability of synthesizing higher amounts of omega-3 fatty acids than a random individual (under the same conditions) with whom it is comparable. Two individuals are comparable if they are, with regards to all discriminating factors except the genotype at the SNP which is used for predicting increased capability to synthesize omega-3 fatty acids, random representatives of one and the same population of fish. As used herein, "increased amount of omega-3 fatty acids" means that an individual having increased amount of omega-3 fatty acids has a higher probability of higher amounts of omega-3 fatty acids than a random individual (under the same conditions) with whom it is comparable. Two individuals are comparable if they are, with regards to all discriminating factors except the genotype at the

polymorphism which is used for predicting increased amount of omega-3 fatty acids in fish, random representatives of one and the same population of fish.

As used herein, an "omega-3 allele" is an allele conferring increased capability to synthesize omega-3 fatty acids. This means that a fish having such allele at the position of a polymorphism detailed herein shows increased capability to synthesize omega-3 fatty acids. The "omega-3 allele" may identify a single nucleotide polymorphism that can be used to detect or determine the degree of capability to synthesize omega-3 fatty acids.

As used herein, a "polymorphism" is a variation in a genomic sequence. In particular, a polymorphism is an allelic variant that is generally found between individuals of a population or between individuals from different populations. The polymorphism may be a single nucleotide difference present at a locus, or may be an insertion or deletion of one or a few nucleotides at a position of a gene.

As used herein, a "single nucleotide polymorphism" or "SNP" refers to a single base (nucleotide) polymorphism in a DNA sequence among individuals in a population. As such, a single nucleotide polymorphism is characterized by the presence in a population of one or two, three or four nucleotides (i.e. adenine, cytosine, guanine or thymine), typically less than all four nucleotides, at a particular locus in a genome, such as the genome of a fish, e.g. an Atlantic salmon. As used herein, "polymorphic sequence" refers to a nucleotide sequence including a polymorphic site at which a polymorphism occurs.

As used herein, a "polymorphic site" is the locus or position within a given sequence at which divergence occurs. Preferred polymorphic sites have at least two alleles, each occurring at frequency greater than 1%, and more preferably greater than 10%. Those skilled in the art will recognize that nucleic acid molecules may be double-stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand. In defining a polymorphic site or allele reference to an adenine, a thymine, a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule also defines the thymine, adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid. As used herein, a "sample", such as a biological sample that includes nucleic acid molecules, is a sample obtained from an Atlantic salmon, including, but not limited to, cells, tissue, and bodily fluids.

As used herein, an "oligonucleotide" is a plurality of joined nucleotides joined by native phosphodiester bonds, typically from 8 to 300 nucleotides in length.

As used herein, "probes" and "primer" are typically isolated oligonucleotides of at least 8 nucleotides, such as at least 10 nucleotides, capable of hybridizing to a target nucleic acid.

As used herein, "isolated" means that an organism or a biological component, such as a cell, population of cells or a nucleic acid molecule, has been separated from its natural environment.

As used herein, "genetic linkage" refers to the tendency of polymorphisms that are located close to each other on a chromosome to be inherited together during meiosis. Thus, polymorphisms located close to each other on the same chromosome are said to be genetically linked. Alleles at two such genetically linked loci are co- inherited (from parents to offspring) more often than they are not. Assume, for example, two polymorphisms; polymorphism A having alleles Al and A2, and polymorphism B having alleles Bl and B2. Assume further that a given fish carries all of the alleles Al , A2, Bl , and B2 (in other words, this fish is heterozygous at both marker and marker B). If alleles Al and Bl are, in this particular fish, located on the same chromosome copy, then alleles Al and B l are co-inherited, to the offspring of the fish, more often than not.

As used herein, "genetic linkage analysis" refers to a statistical procedure where genotype data, coming from sets of animals comprising parents and their offspring, are investigated in order to test for the presence of genetic linkage between polymorphisms. Genetic linkage analysis can be used in order to assign

polymorphisms to chromosomes, provided that the analysis incorporates

polymorphisms that have already been assigned to chromosome using Fluorescence In Situ Hybridiation. As used herein "Fluorescence In Situ Hybridiation" or "FISH" refers to a technique that detect the presence or absence of specific DNA sequences on chromosomes. FISH can be used in order to assign known DNA polymorphisms to chromosomes.

"Centi-Morgen" is a unit of measurement, used to describe genetic distances, where genetic distance is a measure of the extent to which two polymorphisms are genetically linked.

Linkage disquilibrium (LD) or, more precisely, gametic phase linkage

disequilibrium is used in order to describe the co-inheritance of alleles at genetically linked polymorphisms, at the population level. Assume, for example, two polymorphisms located on the same chromosome; polymorphism A having alleles Al and A2, and polymorphism B having alleles B l and B2. All copies of the chromosome in question will harbour a combination of alleles at the two loci (i.e. a haplotype), and there are four possible haplotypes: Al-B l , A1-B2, A2-B 1 , and A2- B2. The two loci are in said to be LD with each other if the number of Al -B l and A2-B2 haplotypes within the population are significantly larger or significantly smaller than the number of A1-B2 and A2-B1 haplotypes.

Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and sub ranges within a numerical limit or range are specifically included as if explicitly written out.

Having generally described this invention, a further understanding can be obtained by reference to certain specific examples, which are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwise specified.

Examples

Example la: Amount of DPA (Docosapentaenoic acid)

The first study was performed on 769 Atlantic salmons (Salmo salar) taken in the salt water phase. All fish came from a single net cage containing 273 full-sib- families. 8 months prior to slaughtering, all animals were fed commercially available feeds low in marine omega-3 fatty acids (EWOS opal 120 1000-30A, 10.0mm for 3 months and then EWOS opal 120 2500 30A 500, 9.0mm for the last 5 months prior to slaughtering (table 4)).

Table 4: Salmon feed

EWOS opal 1 10/120

Extruded, complete grower feed for salmon

Composition g/kg feed:

1000 2500

Energy, MJ/kg

Raw materials:

vitamins,

Fatty acid content was recorded by sampling 0.5 g muscle tissue from each individual fish. Fatty acids were methylated and extracted using the methodology described by O'Fallon et al. (2007), and content (%) DPA was recorded using gas chromatography. The mean content of DPA in the samples was 1.34 % with a standard deviation of 0.09%. All fish where then subjected to genotyping (see example lb).

Example lb: Genotyping

All fish from example la were genotyped using a custom Axiom® SNP genotyping array from Affymetrix (San Diego, CA, USA), containing 56, 177 SNPs. Genotyping was done according to the Axiom 2.0 Assay Manual Workflow User Guide

(http://media.affymetrix.com/support/downloads/manuals/axiom _2_assay_manual_ workflow_prepguide.pdf). Genotype calling was done using the Affymetrix Power Tools programs

(http://www.affymetrix.com/estore/partners_programs/programs /developer/tools/po wertools.affx), according to "best practices" recommendations from Affymetrix (http://media.affymetrix om/support/downloads/manuals/axiom_best_practice_sup p lement us er guide . p df) .

The DNA oligonucleotides required for Axiom genotyping were constructed by Affymetrix, on the basis of DNA polymorphism sequences including SEQ ID NO: 1-45 and SEQ ID NO 47-54 presented in Table 2. The Axiom ® genotyping array used in the study is proprietary to AquaGen (the DNA polymorphisms on the array were identified by AquaGen on the basis of whole-genome sequencing of 29 AquaGen animals). However, for the purpose of reproducing the experiment, the DNA sequences provided in SEQ ID NO: 1-45 and SEQ ID NO 47-54 can be used for ordering a new custom Axiom genotyping array from Affymetrix, containing the DNA polymorphisms of the Invention.

The GenBank identifiers of the Atlantic salmon chromosome sequences

corresponding to the DNA polymorphisms of the Invention, and the positions of the DNA polymorphisms relative to these sequences, are provided in Table 1. Also, by using these details, and by accessing the GenBank sequences in question, the DNA sequences of Table 2 can be extended to any required length.

Initially, a mixed linear pedigree-based model was used for estimating additive genetic variance for content of DPA (see example lc) and then a genome-wide association study was performed (see example Id). Example lc: Pedigree-based analysis

A mixed linear pedigree-based model was used for estimating additive genetic variance for content of DPA, the model was: y = lfi + 2a + e

where y is a vector of DPA phenotypes (%)

μ is the overall mean a ¥ ftf¾¾ is a vector of random additive genetic effects

Z is a design matrix assigning animals to phenotypes

*«M ¾ 5 is a vector of random residuals a is the numerator relationship matrix (based on pedigree only) is the additive (polygenic) genetic variance

I is an identity matrix of appropriate size is the residual variance.

Table 5: Results of the pedigree-based analysis

Example Id: Genome-wide association study A genome-wide association study was performed, where all SNPs on the 56k SNP- chip (see example lb) were tested independently. For each SNP locus two statistical models were used to analyze the data:

Model I: F = J* + & + »

Model II : J = + ^& + %™C + · where Model I was the same model as described in example lc, Model II is the same model extended with a random allele substitution effect of SNP locus i while ¾ is a vector of genotypes at locus i. All models were analyzed using restricted maximum likelihood (REML) to estimate variance components (Gilmour et al. 1995). If an animal had missing genotype information for locus i, the phenotype for this animal was omitted from the analysis in both models, i.e., exactly the same phenotypes were used in both models for all SNP loci.

The hypotheses tested were:

HO: No allele substitution effect exists for DPA (Model I)

HI : There is an allele substitution effect at locus i with respect to DPA content (Model II)

The hypotheses were tested using a likelihood ratio tests statistic comparing the Models I and II. REML likelihoods are only comparable when the fixed part of the two models are identical, and the allele substitution effect was therefore taken as random _{w e} re the variance parameter ^ff ™ was estimated for each SNP locus separately (without including other loci in the analysis). The test statistic was:

Where and ^ ¹¹ are the REML likelihoods of model I and II, respectively, and % is a chi-square test statistic with degrees of freedom k =1. As 56k SNP loci were tested, the significance levels were adjusted for multiple testing using a

conservative Bonferroni correction:

α¾ = ¾ * » where is the estimated significance of SNP locus i and n is total number of SNP loci tested (56k). A Manhattan plot containing the 1000 most significant SNPs is shown in figure 1.

At any of the significant SNPs, Atlantic salmon having different SNP genotypes are expected to differ from each other in terms of capability to synthesize omega-3 fatty acids. Table 6: Most significant associations detected by the genome-wide association analyses. Trait refers to the fatty acid that is significantly associated to the SNP. DPA is Docosapentaenoic acid. Effect (%) is the effect of the SNP on the trait, i.e., the one-allele difference (allele substitution effect) in concentration of the fatty acid in question between the two alleles of the SNP (omega-3 allele and non-omega-3 allele respectively), measured as % by weight of total fat, i.e. the effect of replacing one allele with the other.

Polymorphisms SEQIDNO Trait p-value Effect (%}

1 1 DPA l,00E+00 l,08E-07

2 2 DPA l,00E+00 5,65E-08

3 3 DPA l,00E+00 5,47E-10

4 4 DPA l,00E+00 l,05E-07

5 5 DPA l,00E+00 8,83E-04

6 6 DPA l,00E+00 l,15E-07

7 7 DPA 5,70E-01 3,96E-03

8 8 DPA 8,70E-01 l ,31E-03

9 9 DPA 4,80E-01 4,87E-03

10 10 DPA 4,10E-01 5,91E-03

11 1 1 DPA 6,50E-01 3,19E-03

12 12 DPA 8,00E-01 l ,92E-03

13 13 DPA l,00E+00 4,52E-08

14 14 DPA l,00E+00 9,00E-08

15 15 DPA l,00E+00 l,07E-07 16 16 DPA l,00E+00 7,96E-10

17 17 DPA l,00E+00 9,70E-08

18 18 DPA l,00E+00 l,03E-07

19 19 DPA l,00E+00 l,05E-07

20 20 DPA 2,78E-05 2,32E-02

21 21 DPA l,53E-03 l,86E-02

22 22 DPA 2,12E-03 l,81E-02

23 23 DPA 2,16E-02 l,42E-02

24 24 DPA 5,34E-03 l,82E-02

25 25 DPA 2,95E-02 l,49E-02

26 26 DPA 5,50E-01 4,72E-03

27 27 DPA 5,40E-01 4,85E-03

28 28 DPA 8,90E-01 l,15E-03

29 29 DPA 8,90E-01 l,20E-03

30 30 DPA 8,40E-01 l,60E-03

31 31 DPA 6,50E-01 3,64E-03

32 32 DPA 5,30E-01 4,93E-03

33 33 DPA l,00E+00 2,92E-08

34 34 DPA l,46E-02 l,44E-02

35 35 DPA 6,90E-01 3,21E-03

36 36 DPA 4,60E-01 5,06E-03

37 37 DPA 4,24E-03 l,63E-02

38 38 DPA 4,53E-03 l,62E-02

39 39 DPA 6,20E-01 3,89E-03

40 40 DPA 4,60E-01 5,68E-03

41 41 DPA 6,03E-03 l,80E-02

42 42 DPA 4,94E-03 l,58E-02

43 43 DPA 2,21E-02 l,32E-02

44 44 DPA 4,09E-02 l,22E-02

45 45 DPA 2,67E-05 2,28E-02

47 47 DPA l,30E-04 2,14E-02

48 48 DPA 1,50E-01 8,99E-03

49 49 DPA l,74E-02 l,45E-02

50 50 DPA 3,31E-07 3,07E-02

51 51 DPA 2,12E-05 3,52E-02

52 52 DPA 4,29E-05 2,22E-02

53 53 DPA l,10E-04 2,83E-02

54 54 DPA 3,15E-04 2,12E-02

Example 2a: Amount of EPA, DPA and DHA (Eicosapentaenoic acid,

Docosapentaenoic acid and Docosahexaenoic acid respectively)

The second study was performed on an independent sample of 163 genotyped Atlantic salmons (142 full-sib families) taken in the freshwater phase (pre- smo Itification) of a different year class (2015) of the AquaGen population. The fish were fed a commercial diet with a normal level of marine oils. Samples were taken following the same procedure as for the initial study (example 1). The content of EPA, DPA and DHA were recorded using GC, using the method described in the previous study (example 1). All fish were genotyped using the same technology as described in example lb. The LC-PUFA: EPA, DPA and DHA were included in a trivariate statistical analysis (example 2b and 2c).

Example 2b: Pedigree-based analysis

First, a classical pedigree-based analysis was conducted using the following model:

y = XI» + 2a -t- 9

Wh riate

incidence matrices for fixed and random additive genetic effects, respectively, G _G is the additive genetic (co)variance matrix for the three fatty acids (assumed diagonal due to a lower number of phenotypes), and _n is a residual (co)variance matrix for the three fatty acids.

Table 7: Results of the pedigree-based analysis of multivariate LC-PUFA in fish

Example 2c: Genome-wide association study

Genome-wide association studies were performed for each dataset, where all SNPs on the 56k SNP-chip were tested independently one at a time. For each SNP locus i, two statistical models were used to analyze the data:

I. y = fc + Za -t- »

II. y = Sfr -t- Za + ¾BII + e where model I is the same model as described in example 2b, while in model II:

¾ = i, the

SNP and

ff^„ is the marker variance for SNP i in trait j.

The hypotheses tested were:

Ho: No allele substitution effect exists for any of the fatty acids (EPA, DP A and

DHA) at locus i (Model I)

Hi : Allele substitution effects exist for at least one of the fatty acids (EPA, DPA and/or DHA) at locus i (Model II)

Similar to what was done in example 1 , the hypotheses were tested using a likelihood ratio tests statistic comparing the Models I and II. REML likelihoods are only comparable when the fixed part of the two models are identical, and the allele substitution effect for a trait (fatty acid) j and locus i was therefore taken as random, where the variance parameters s^y _? were estimated jointly for all three traits for each SNP locus separately (without including other loci in the analysis). The test statistic was:

Where l _a and L _t are the REML likelihoods of model 0 and 1 , respectively, and χ ² is a chi-square test statistic with degrees of freedom k. If the SNP effect for a locus i is neglible for one of the traits (e.g., DHA), the associated SNP variance will not be estimated, but automatically fixed at value close to zero. The degrees of freedom for a locus-specific likelihood ratio test statistic was therefore set to k = 1 , 2 or 3, depending on the number of SNP variance components that were actually estimated for this locus. As 56k SNP loci were tested, the significance levels were adjusted for multiple testing using the conservative Bonferroni correction:

a?i = p, * n

where _t is the estimated significance of SNP locus i across all three traits (EPA; DPA and DHA) and n is total number of SNP loci tested (56k). Table 8: Most significant associations detected by the genome-wide association analyses. Trait refers to the fatty acid that is significantly associated to the SNP. DPA is Docosapentaenoic acid. . Effect (%) is the effect of the SNP on the trait, i.e., the one-allele difference (allele substitution effect) in concentration of the fatty acid in question between the two alleles of the SNP (omega-3 allele and non-omega-3 allele respectively), measured as % by weight of total fat, i.e. the effect of replacing one allele with the other.

Polymorphisms SEQIDNO Trait p-value Effect (%)

1 1 EPA 3,13E-03 l,97E-02

DPA 2,66E-02

DHA 0,2034

2 2 EPA l,54E-02 3,52E-07

DPA l,36E-02

DHA 0,2754

3 3 EPA 9,54E-05 l,55E-06

DPA l,83E-02

DHA 0,3757

4 4 EPA l,36E-02 2,04E-02

DPA l,59E-02

DHA 0,2636

5 5 EPA 3,10E-03 l,49E-02

DPA l,74E-02

DHA 0,307

6 6 EPA l,03E-05 l,53E-06

DPA 2,49E-02

DHA 0,3982

7 7 EPA 8,69E-05 l, 17E-02

DPA 2,72E-02

DHA 0,3168

8 8 EPA 6,38E-06 l,39E-06

DPA 2,50E-02

DHA 0,4082

9 9 EPA 2,40E-05 l, 17E-07

DPA 2,53E-02

DHA 0,3831

10 10 EPA 6,30E-05 4,72E-07

DPA 2,06E-02

DHA 0,376

1 1 1 1 EPA 4,66E-05 3,99E-08

DPA 2,29E-02

DHA 0,3758

12 12 EPA 4,66E-05 3,99E-08

DPA 2,29E-02

DHA 0,3758 13 13 EPA 7,01E-05 l,30E-06

DPA 2,33E-02

DHA 0,3259

14 14 EPA 2,27E-04 8,32E-07

DPA 2,09E-02

DHA 0,3433

15 15 EPA 3,54E-05 l,33E-06

DPA 2,34E-02

DHA 0,3717

16 16 EPA 6,40E-04 8,40E-07

DPA l,33E-02

DHA 0,3816

17 17 EPA 3,05E-05 l,29E-06

DPA 2,40E-02

DHA 0,3685

18 1 8 EPA 3,20E-05 6,80E-07

DPA 2,32E-02

DHA 0,3699

19 19 EPA 3,05E-05 l,29E-06

DPA 2,40E-02

DHA 0,3685

20 20 EPA 5,34E-04 l,23E-06

DPA 2,35E-02

DHA 0,2858

21 21 EPA 3,84E-03 5,10E-02

DPA 2,37E-02

DHA 0,1962

22 22 EPA 3,03E-03 4,42E-02

DPA 2,25E-02

DHA 0,2189

23 23 EPA l,99E-04 8,07E-03

DPA 2,61E-02

DHA 0,3026

24 24 EPA l,38E-05 l,16E-02

DPA 2,95E-02

DHA 0,3482

25 25 EPA l,28E-05 l,19E-03

DPA 2,84E-02

DHA 0,3736

26 26 EPA 3,88E-05 l,96E-02

DPA 2,45E-02

DHA 0,3712

27 27 EPA l,23E-05 l,50E-06

DPA 2,61E-02

DHA 0,3717 28 28 EPA l,35E-05 l,51E-06

DPA 2,50E-02

DHA 0,3741

29 29 EPA 2,61E-05 l,57E-06

DPA 2,43E-02

DHA 0,3691

30 30 EPA l,62E-05 l,44E-06

DPA 2,21E-02

DHA 0,4078

3 1 3 1 EPA 5,53E-05 l,62E-06

DPA 2,31E-02

DHA 0,3748

32 32 EPA 3,30E-05 l,50E-06

DPA 2,09E-02

DHA 0,4114

33 33 EPA 7,81E-03 l,19E-05

DPA l,llE-02

DHA 0,3222

34 34 EPA 5,53E-04 6,05E-02

DPA l,96E-02

DHA 0,2581

35 35 EPA 8,94E-06 l,09E-06

DPA 2,53E-02

DHA 0,3817

36 36 EPA 5,96E-05 8,59E-08

DPA 2,29E-02

DHA 0,3549

37 37 EPA 2,50E-04 5,00E-02

DPA 2,59E-02

DHA 0,2819

38 38 EPA 2,84E-04 4,75E-02

DPA 2,55E-02

DHA 0,2806

39 39 EPA 2,86E-05 l,37E-06

DPA 2,40E-02

DHA 0,359

40 40 EPA 2,60E-05 l,70E-06

DPA 2,42E-02

DHA 0,3401

41 41 EPA 7,05E-06 l,59E-06

DPA 2,49E-02

DHA 0,3884

42 42 EPA 3,25E-04 l,59E-02

DPA 2,02E-02

DHA 0,36 43 43 EPA 7,87E-04 l,63E-02

DPA 2, 10E-02

DHA 0,3221

44 44 EPA 3,82E-04 4,82E-03

DPA 2,28E-02

DHA 0,3254

45 45 EPA 3,58E-06 7,20E-02

DPA 3,24E-02

DHA 0,2765

47 47 EPA 3,73E-04 l, HE-06

DPA 2,37E-02

DHA 0,2595

48 48 EPA l,82E-05 9,21E-03

DPA 2,35E-02

DHA 0,4276

49 49 EPA l,05E-04 8,79E-07

DPA 2,30E-02

DHA 0,3535

Example 3: Polymorphism#46 - Linkage Disequilibrium analysis

One polymorphism, polymorphism 46 in Table 2, corresponding to SEQ ID NO 46, was not genotyped using the genotyping array described in example lb. Rather, this polymorphism was found by sequencing the whole genomes of 99 Atlantic salmon individuals from the AquaGen breeding nucleus to lOx genome coverage (using standard paired-end sequencing on an Illumina HiSeq2000 machine), followed by alignment to the published genome sequence for Atlantic salmon (GenBank assembly accession: GCA 000233375.4) using Bowtie2 (Langmead and Salzberg, 2012) and identification of polymorphisms (plus calling of genotypes at the identified polymorphisms) using freebayes (http://arxiv.org/abs/1207.3907). The 'LD' function from the 'genetics' library (https://cran.r-project.org/web/packages/genetics/genetics.p df) of the R programming language was used in order to calculate the level of LD (quantified as r2, the square of the correlation coefficient of alleles at the two loci) between the polymorphisms corresponding to SEQ ID NO 46 and the polymorphism corresponding to SEQ ID NO 45; r2 was found to be 0.81. Two loci having an inter- loci r2 value of 0.81 are in very strong LD with each other; more precisely, 81 % of the variation at one locus can be predicted by the alleles observed at the other locus. Thus, as far as genetic prediction (including the ability to predict levels of omega_3 fatty acids) goes, the polymorphisms corresponding to SEQ ID NO 46 shares the attributes of the polymorphism corresponding to SEQIDNO 45.

Example 4: Polymorphism#55-90 In order to identify additional DNA polymorphisms capable of predicting increased capability of a fish to synthesize omega-3 fatty acids, and in particular DNA polymorphisms capable of performing such predictions even more precisely than DNA polymorphisms # 1 through 54, we used the following approach:

103 Atlantic salmon individuals from the AquaGen breeding nucleus, constituting a genetically diverse sample of the population, were whole-genome sequenced using Illumina technology (standard paired-end DNA sequencing, average genome coverage of 18x with range 8x to 32x). The reads were aligned to the reference sequence of chromosome 19 of Atlantic salmon (GenBank identifier = NC 027318.1) using BWA mem version 0.7.10-r789 (Li and Durbin 2009). SNPs and short indels were identified using Freebayes version 0.9.15-1 (Garrison and Marth 2012); to filter away low-quality variants, run-time parameters " -use-mapping-quality and -min-mapping-quality 1" were used, in addition to "vcffilter -f "QUAL > 20". The SNP-detection process additionally returned genotypes on the 103 whole-genome sequenced individuals, for all identified DNA polymorphisms. SNPs and short indels were annotated using snpEff version 4.0e (Cingolani et al. 2012). The snpEff annotation database was based on the CIGENE annotation version 2.0 (Lien et al. 2016). DNA polymorphism #45 (dbSNP ID ssl868585481, located at position 73,306,543 bp within chromosome 19) was chosen as "tag SNP". DNA polymorphisms in sufficiently strong LD with ss 1868585481 were identified by running the computer program PLINK vl .9 (Chang et al. 2015) (options— r2 -ld-snp rsl59406379 -chr-set 29 -no-xy -ld-window 999999999 -ld-window-kb 500), with the input data being SNPs and other DNA polymorphisms from chromosome 19, encoded in Plink format and derived from the 103 individuals as described above. A SNP or other DNA polymorphism "in strong LD with ss 1868585481" was defined as a SNP or other DNA polymorphisms having a squared correlation coefficient (r2) to ssl868585481 of 0.3 or more. Twenty-eight SNPs and other DNA polymorphisms were selected that had an r2 above 0.3 as well a location close to a candidate causative gene, hypothesised by the Inventors to be causal with regard to omega-3 content (five such genes were identified). More precisely, the SNPs were located within the range stretching from position 22,166,053 bp to 73,310,306 bp on Atlantic salmon chromosome 19 (GenBank identifier = NC_027318.1) (Figure 2). These SNPs were tested for association to omega-3 content, in the same manner as described above, using the 769 sea-water phase individuals described above. The most significant SNPs were found within the range stretching from 73,288,717 bp to 73,310,306 bp, wherein is located the gene encoding Elongation Of Very Long Chain Fatty Acids Protein 2, elovl2.

Table 9: DNA-polymorphisms found by the authors to be strongly associated to omega- 3 content, while being located within or close to the elovl2 gene. P-value is the p-value from a multi-trait test for association between omega-3 (EPA, DP A, and DHA) content and DNA polymorphism alleles, performed as described in Example 2a. Effect (%) is the effect of the SNP on the content of individual omega-3 fatty acids (EPA, DHA, or DP A), i.e. the one-allele difference (allele substitution effect) in concentration of the fatty acid in question between the two alleles of the SNP (omega-3 allele and non-omega-3 allele respectively), measured as % by weight of total fat, i.e. the effect of replacing one allele with the other. r2 = squared correlation coefficient between alleles at

rs 159406379 and at the DNA polymorphism in question.

Polymorphism* SEQIDNO Trait p-value Effect % r2

55 109 EPA 2.16E- 16 4.55E-07 1

DPA 4.04E-03

DHA 0.293255

56 1 10 EPA 2.62E- 16 4.43E-07 1

DPA 3.78E-03

DHA 0.291 151

57 1 1 1 EPA 4.06E- 16 4.94E-07 0.979

DPA 3.92E-03

DHA 0.294701

58 1 12 EPA 5.65E- 16 4.71E-07 0.919

DPA 4.01E-03

DHA 0.281978

59 1 13 EPA 7.55E- 16 4.77E-07 0.902

DPA 3.99E-03

DHA 0.29331 1

60 1 14 EPA 8.34E- 16 4.55E-07 0.94

DPA 4.04E-03

DHA 0.293255

61 1 15 EPA 1.50E- 13 4.55E-07 0.829

DPA 4.04E-03 DHA 0.293255

62 1 16 EPA 2.68E- 13 6.22E-07 0.979

DPA 3.85E-03

DHA 0.210012

63 1 17 EPA 2.44E- 12 4.40E-07 0.812

DPA 3.94E-03

DHA 0.25634

Table 10. DNA polymorphism, located within or close to the elovl2 gene, found to be strongly associated to omega-3 on basis of being in very strong LD with DNA polymorphism #45 (rsl59406379). r2 = squared correlation coefficient between alleles at rs 159406379 and at the DNA polymorphism in question.

Polymorphism* SEQIDNO r ²

64 118 0.879

65 119 0.939

66 120 0.88

67 121 0.849

68 122 0.959

69 123 0.939

70 124 0.979

71 125 0.959

72 126 0.863

73 128 0.979

74 129 0.899

75 130 0.898

76 131 0.829

77 133 0.792

78 134 0.795

79 135 0.789

80 136 0.744

81 137 0.789

82 138 0.748

83 139 0.75

84 140 0.748

85 141 0.806

86 142 0.792

87 143 0.759 88 144 0.756

89 145 0.829

90 146 0.808

Certain references cited in the application

Chang CC, Chow CC, Tellier LC, Vattikuti S, Purcell SM, Lee JJ (2015). Second- generation PLINK: rising to the challenge of larger and richer

datasets. GigaScience: 4:7.

Cingolani P, Platts A, Wang LL, Coon M, Nguyen T, Wang, Land SJ, Ruden DM, and Lu X (2012). A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila

melanogaster strain wi l l 8; iso-2; iso-3. Fly 6:2. Garrison E and Marth G (2012). Haplotype-based variant detection from short-read sequencing. arXiv: 1207.3907v2 [q-bio.GN]

Gilmour, A. R., R. Thompson and B. R. Cullis, 1995 Average information REML: An efficient algorithm for variance parameter estimation in linear mixed models. Biometrics 51 : 1440-1450. Langmead, B. and S. Salzberg, 2012 Fast gapped-read alignment with Bowtie 2. Nature Methods 9: 357-359.

Leaver, M. J., J. M. Bautista, B. T. Bjornsson, E. Jonsson, G. Krey et al., 2008 Towards Fish Lipid Nutrigenomics: Current State and Prospects for Fin-Fish Aquaculture. Reviews in Fisheries Science 16: 73-94.

Leaver, M. J., J. B. Taggart, L. Villeneuve, J. E. Bron, D. R. Guy et al., 201 1

Heritability and mechanisms of n-3 long chain polyunsaturated fatty acid deposition in the flesh of Atlantic salmon. Comp Biochem Physiol Part D Genomics

Proteomics 6: 62-69.

Li H and Durbin R (2009). Fast and accurate short read alignment with Burro ws- Wheeler Transform. Bioinformatics 25 : 1754-60

Lien S, Koop BF, Sandve S, Miller J, Kent MP et al. (2016). The Atlantic salmon genome provides insights into rediploidization. Nature 533 : 200-205.

O'Fallon, J. V., J. R. Busboom, M. L. Nelson and C. T. Gaskins, 2007 A direct method for fatty acid methyl ester synthesis: Application to wet meat tissues, oils, and feedstuffs. Journal of Animal Science 85 : 151 1-1521. Torrissen, O., R. E. Olsen, R. Toresen, G. I. Hemre, A. G. J. Tacon et al., 201 1 Atlantic Salmon (Salmo salar): The "Super-Chicken" of the Sea? Reviews in Fisheries Science 19: 257-278.

Zheng, X., D. R. Tocher, C. A. Dickson, J. G. Bell and A. J. Teale, 2005 Highly unsaturated fatty acid synthesis in vertebrates: new insights with the cloning and characterization of a delta6 desaturase of Atlantic salmon. Lipids 40: 13-24.