TECHNICAL FIELD

[0001] This disclosure generally relates to coated substrates having antimicrobial, including anti-viral, properties. In particular, this disclosure relates to rechargeable fabrics comprising polymers having at least one A'-lialamiiie precursor group and at least one cationic center and preparation methods thereof.

BACKGROUND

[0002] The COVID-19 pandemic continues to be a major threat to public health. Since the primary transmission pathway of SARS-CoV-2 is through the inhalation of airborne respiratory droplets, personal protective equipment (PPE) such as respirators and facemasks have become ubiquitous as a control measure for the transmission pathway of SARS-CoV-2. A variety of masks including N-95 respirators, surgical masks and cloth masks has been demonstrated to effectively reduce transmission of SARS-CoV-2.

[0003] However, the COVID-19 pandemic has brought to light several issues with currently available PPE. Since existing mask designs do not actively kill viruses such as SARS-CoV-2, there is a risk of contact transmission after touching contaminated PPE while handing the PPE during and after use. Additionally, the increased demand for disposable facemasks has stressed global supply-chains. The COVID-19 pandemic has caused shortages of supply for both the general public and healthcare workers and, in some cases, severe shortages have resulted in policies restricting the export of PPE and instances where healthcare workers are reusing single -use facemasks.

[0004] The SARS-CoV-2 virion is known to survive with variable success on different surfaces, such as: on the surface of an N-95 mask, the virus can persist up to 21 days (albeit with a rapid decline after 4 days and nearly undetectable levels at 21 days), with much lower stability on cotton.

[0005] The COVID-19 pandemic has spurred the development of a variety of antimicrobial fabric with antiviral properties. A wide range of strategies have been employed to endow surfaces with antimicrobial properties. Common strategies for developing antimicrobial fabric involve impregnating or coating the fabrics with an active agent such as copper nanoparticles, copper oxide particles, copper sulfide, benzalkonium chloride, polybiguanide, iodine complexed with N-vinylpyrrolidone, salt coating, licorice root extract, silver nanoparticles, titanium dioxide, aluminum and aluminum oxide, anionic photosensitizers (rose Bengal and sodium 2-anthraquinone sulfate), zinc oxide, or graphenebased nanomaterials such as graphene oxides, nanofibers, nanosheets, and nanoparticles to take advantage of graphene’s native antimicrobial activity, electrical properties, hydrophobicity.

[0006] However, such strategies that rely on impregnating surfaces with antimicrobial agents are subject to leaching of the active compound, posing health risks to the wearer as well as causing environmental contamination through laundering and fabric end-of-life disposal.

[0007] Furthermore, the consumption of single-use facemasks also poses a major environmental issue due to the rapid generation and mismanagement of associated waste. Further, work evaluating sterilization of contaminated single use masks for reuse has shown that not all “cleaning” methods are equally effective and there is a limited number of times the “cleaning” can occur effectively.

SUMMARY

[0008] A need exists for a reusable facemask that reduces or eliminates the risk of microbial transmission caused by handling the facemask during and after use. Some embodiments of the present disclosure relate to reusable facemask that is endowed with antimicrobial properties. In some embodiments of the present disclosure the antimicrobial properties are rechargeable properties. In some embodiments of the present disclosure, the reusable facemask has rechargeable antiviral properties. Without being bound by any particular theory, such reusable masks with rechargeable antiviral properties may offer a variety of benefits, including active killing of the virus during filtration, reducing the risk of contamination due to handling PPE during or after use, alleviating demand-driven pressure on PPE supply chains, and reducing waste due to the reusable nature of the mask.

[0009] Strategies involving covalent surface modification of fabrics or the PPE fabric with one or more precursors of anti-microbial compounds may prevent release into the environment of the compounds, thereby reducing risk of inhalation of components by the wearer and improve the safety of PPE, such as facemasks, made with such modified fabrics. [0010] Covalent modification of fabric surfaces can be achieved by a variety of methods, such as graft polymerization via chemical free radical initiators, click chemistry, or radiation-induced graft polymerization. Radiation-induced graft polymerization can be accomplished by UV, plasma, electron beam or gamma radiation for surface modification with polar monomers, and offers several inherent advantages such as efficient radical generation at the fabric surface, controlled grafting yield, and no residue from free chemical free radical initiators.

[0011] Chemical free radical initiators may also be used for graft polymerization of antimicrobial precursors onto fabric surfaces due to their affordability and compatibility with conventional fabric wet-finishing methods. Such methods of covalent surface modification can be used to endow surfaces with antimicrobial moieties such as /V-halamiiies. quaternary ammonium compounds, polyionenes, guanidines, N,N-dimethylaminoethyl methacrylate, N- vinylcaprolactam, acrylic acid, methacrylic acid, acrylamide, iodine complexed with N- vinylpyrrolidone, 1 -vinyl imidazole, triclosan, zwitterionic compounds, chitosan, and sulfopropylbetaine.

[0012] A'-lialamiiie precursors offer a safe and effective means for creating reusable, antiviral fabrics. These precursors can be covalently grafted to a fabric by free radical graft polymerization with potassium persulfate as a free radical initiator, endowing the surface with potential for chargeable and rechargeable antiviral activity.

[0013] The covalently grafted nontoxic /V-hal amine precursors can be converted to their “active” /V-halamine form by exposure to a source of a halogen, which allows the halogen to kill the microbe, including viruses. This bound oxidative halogen can transfer to viruses in direct contact with the fabric by transhalogenation for effective antiviral activity with minimal dissociation of free halogens. Depletion of active halogens from the surface as a result of the antiviral activity returns the grafted V-hal ami nes to their native amine or amide precursors. The active halogen concentration at the surface can easily be regenerated by the end-user of the fabric in a repeated fashion by immersing the fabric in dilute halogen solution, such as dilute sodium hypochlorite bleach in a conventional household laundering process.

[0014] Acyclic and cyclic /V-halamine precursors have been previously developed to endow surfaces with a potential for antimicrobial and antiviral activity with varying stability, including a /V-cliloramines featuring two quaternary ammonium groups within the structure to achieve the two-fold effect of improving the chlorination efficiency to endow the surface with higher bound oxidative chlorine under chlorination with low levels of free chlorine, as well as to improve antimicrobial efficacy due to interaction with the positive charges.

[0015] The present disclosure relates to antiviral fabrics for combatting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) based on the modification of cotton via graft polymerization of A'-lialamiiie precursors, to take advantage of the inherent benefits of A-halamine-based antiviral surfaces which include reusability and rechargeability of the antiviral potency.

[0016] The present disclosure relates to materials having antiviral and/or biocidal properties by way of one or more modifications. Such modifications arising by various techniques, such as grafting, covalent modification and the like. The present disclosure also relates to methods of preparing such modified materials. Fabrics, such as cotton, may be modified through free-radical graft polymerization to covalently bond proprietary quatemized /V-chloramiiie precursors to the surface, which may endow the cotton with antiviral capability. Furthermore, co-polymerization of quatemized /V-clilorami ne precursor(s) with N- chloramine precursor monomers may achieve enhanced durability to facilitate laundering and recharging with chlorine. The resulting /V-cliloramine grafted cotton may have rechargeable antiviral activity against SARS-CoV-2, is durable for home-laundering, has good stability to ultraviolet-visible (UV-vis) light, and may have minimal off-gassing of free chlorine from the surface under simulated breathing conditions. As will be appreciated by those skilled in the art, halogens other than chlorine are also contemplated herein.

[0017] A'-lial ami lies are a popular surface modification strategy to endow fabric substrates such as cotton with rechargeable antimicrobial activity. However, previously developed /V-lialamiiie precursors, such as /V-cliloramine precursors require high active chlorine concentrations in the dilute chlorination solution, also referred to herein as a charge solution, to achieve suitable conversion efficiency of N-H bond to N-CL The present disclosure relates to an A-halamine precursor that incorporates two cationic quaternary amine groups within the same molecule.

[0018] In particular, a quatemized /V-cliloramine (N1 -(3 -methacrylamidopropyl) -N1 ,N1 ,N10 ,N10 -tetramethyl-N 10 -(2,2,6,6-tetramethylpiperidin-4-yl) decane- 1,10-diaminium (abbreviated name: MAMP1P)) featuring two quaternary ammonium groups within the structure. This is to achieve a two-fold effect of improving the chlorination efficiency to endow the surface with higher concentrations of bound oxidative chlorine after chlorination with low levels of free chlorine, as well as improving the antiviral efficacy due to electrostatic attraction to the polycationic surface.

[0019] Many microorganisms are negatively charged at neutral pH: viral isoelectric points commonly fall within the range of 3.5-7, and bacteria often have isoelectric points <5. Although the SARS-CoV-2 virion carries a net positive charge, the structural proteins of SARS-CoV-2 have a varied total electric charge related to the amino acid content, with the surface spike protein S carrying a negative charge with an isoelectric point of 5.6. Since negative surface charge creates enhanced interaction with positively charged quaternary ammonium groups in the antimicrobial coating embodiments of the present disclosure, the material modification with polymers of MAMP1P disclosed herein would be effective against SARS-CoV-2 and has potential for enhanced antiviral and/or biocidal activity against a broad spectrum of microorganisms.

[0020] In the present disclosure, cotton is modified through free-radical graft polymerization to covalently bond the quatemized /V-chloramiiie precursor MAMP1P to the surface, endowing the cotton with antiviral capability. Furthermore, copolymerization of quatemized /V-chloramiiie precursor with two /V-cliloramine precursor monomers, acrylamide or methacrylamide to achieve enhanced durability to re-chlorination. The resulting N- chloramine grafted cotton is confirmed to have rechargeable antiviral activity against SARS- CoV-2, is durable to repeated cycles of re-chlorination, and shows good stability to UV-vis light and minimal off-gassing of free chlorine from the surface.

[0021] Some embodiments of the present disclosure relate to a substrate that comprises: a surface; an antimicrobial coating that is chemically grafted, covalently bonded, or physically coated on the surface. The antimicrobial coating comprises one or more N- halamine precursors selected from: acrylamide (AM), methacrylamide (MAM), and Nl-(3- methacrylamidopropyl)-N 1 ,N 1 ,N 10,N 10-tetramethyl-N 10-(2,2,6,6-tetramethylpiperidin-4- yl)decane-l,10-diaminium (MAMP1P). The one or more /V-cliloramine precursors are polymerized and covalently bonded to the surface substrate to provide a potential for an antimicrobial property to the substrate. [0022] In some embodiments of the present disclosure, the antimicrobial coating comprises AM. In some embodiments of the present disclosure, the antimicrobial coating comprises MAM. In some embodiments of the present disclosure, the antimicrobial coating comprises MAMP1P. In some embodiments of the present disclosure, the antimicrobial coating comprises a combination of AM and MAMP1P. In some embodiments of the present disclosure, the antimicrobial coating comprises a combination of MAM and MAMP1P. In some embodiments of the present disclosure, the antimicrobial coating further comprising one or more negatively charged, positively charged, or zwitterionic vinyl monomers, acrylate monomers or both. In some embodiments of the present disclosure, the antimicrobial coating comprises a combination of AM and MAM.

[0023] In some embodiments of the present disclosure, wherein exposing the antimicrobial coating to a halogen provides an antimicrobial property to the substrate. In some embodiments of the present disclosure, the antimicrobial property is rechargeable.

[0024] Some embodiments of the present disclosure relate to a method for chemically grafting a coating to a substrate surface to provide a potential for an antimicrobial property to the substrate. The method comprises the steps of contacting the substrate surface with the coating; covalently bonding one or more polymers of one or more /V-chlorami ne precursors to the substrate surface, the one or more A-chloramine precursors selected from acrylamide (AM), methacrylamide (MAM), and Nl-(3-methacrylamidopropyl)-Nl,Nl,N10,N10- tetramethyl-N10-(2,2,6,6-tetramethylpiperidin-4-yl)decane-l, 10-diaminium (MAMP1P).

[0025] In some embodiments of the present disclosure, the method further comprises a step of exposing the coated substrate to a source of a halogen. In some embodiments of the present disclosure, the halogen is one or more of fluorine, chlorine, bromine, and iodine. In some embodiments of the present disclosure, the source of a halogen is a bleach or a diluted sodium hypochlorite solution.

[0026] In some embodiments of the present disclosure, the substrate is a fabric, such as cotton. In some embodiments of the present disclosure, the substrate is a nanofibrous membrane. For example the nanofibrous membrane may comprise polyurethane, polyvinylpyrrolidone, or both.

[0027] Some embodiments of the present disclosure relate to a facemask with a potential for an antimicrobial property. The facemask comprises a surface that is chemically grafted, covalently bonded, or physically coated with an antimicrobial coating, wherein the antimicrobial coating comprises one or more /V-chloramiiie precursors selected from acrylamide (AM), methacrylamide (MAM), and Nl-(3-methacrylamidopropyl)- N 1 ,N 1 ,N 10,N 10-tetramethyl-N 10-(2,2,6,6-tetramethylpiperidin-4-yl)decane- 1 , 10-diaminium (MAMP1P). The one or more /V-chloramiiie precursors may be covalently bonded to the surface and are chargeable with exposure to a halogen source.

[0028] Some embodiments of the present disclosure relate to a method for preparing a fabric to provide a rechargeable antimicrobial property. The method comprises graft copolymerizing a negatively charged vinyl monomer, a positively charged vinyl monomer, a zwitterionic vinyl monomer, negatively charged acrylate monomer, a positively charged acrylate monomer, a zwitterionic acrylate monomer or any combination thereof with Nl-(3- methacrylamidopropyl)-N 1 ,N 1 ,N 10,N 10-tetramethyl-N 10-(2,2,6,6-tetramethylpiperidin-4- yl)decane- 1,10-diaminium (MAMP1P) onto the fabric. In some embodiments of the present disclosure, the fabric is cotton. In some embodiments of the present disclosure, the one or more negatively, positively charged or zwitterionic vinyl monomers, acrylate monomers, or both, comprise acrylamide or methacrylamide.

[0029] Some embodiments of the present disclosure relate to a facemask having a potential for a rechargeable antimicrobial property. The facemask comprises an inner layer comprising an unaltered cotton fabric; an outer layer comprising an anti-viral cotton fabric covalently bonded with an antimicrobial coating; and an intermediate layer comprising an anti-viral nanofibrous filtering membrane covalently bonded with an antimicrobial coating.

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] These and other features of this disclosure will become more apparent in the following detailed description in which reference is made to the appended drawings, wherein:

[0031] FIG. 1 shows data obtained from attenuated total reflectance-Fourier transform infrared (ATR-FT1R) spectra of untreated cotton and /V-cliloramine monomer precursors (MAMP1P, acryalamide and methacrylamide) (FIG. 1A), and ATR-FT1R spectra of N- chloramine grafted cottons: PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton (FIG. IB). [0032] FIG. 2 shows the durability of /V-cliloramine grafted cottons to rechlorination, according to some embodiments of the present disclosure.

[0033] FIG. 3 shows the ATR-FT1R spectra for MAMPIP-g-cotton after 0 wash cycles (FIG. 3A) and 50 wash cycles (FIG. 3B).

[0034] FIG. 4 shows the ATR-FT1R spectra for PAM-co-PETl-Ml-g-cotton (also called P(AM-co-MAMPlP)-g-cotton) after 0 wash cycles or 50 wash cycles (FIG. 4A) and for PMAM-co-PETl-Ml-g-cotton (also called P(MAM-co-MAMPlP)-g-cotton) after 0 wash cycles or 50 wash cycles (FIG. 4B).

[0035] FIG. 5 shows scanning electron microscopy (SEM) images of the N- chloramine grafted cottons (scale bar is 300 pm in all images), according to some embodiments of the present disclosure, that were collected after laundering for 0 wash cycles or 50 wash cycles with in situ re-chlorination every 5th cycle at 250 ppm.

[0036] FIG. 6 shows SEM images of the /V-cliloramine grafted cottons (scale bar is 20 pm in all images), according to some embodiments of the present disclosure, that were collected before and after a graft polymerization process that is according to the embodients of the present disclosure, at 2000x magnification: (FIG. 6A) negative control untreated cotton, (FIG. 6B) PMAMPIP-g-cotton, (FIG. 6C) P(AM-co-MAMPlP)-g-cotton, (FIG. 6D) P(MAM-co-MAMPlP)-g-cotton.

[0037] FIG. 7 shows the durability of /V-cliloramine grafted cottons to laundering, including losses of active chlorine for 50 cycles without rechlorination.

[0038] FIG. 8 shows the durability of A-chloramine grafted cotton to in situ rechlorination of A-chloramine grafted cottons through a conventional home laundering process with rechlorination every 5 cycles.

[0039] FIG. 9 shows the durability of A-chloramine grafted cotton to laundering, including nitrogen and carboxylic acid content throughout 50 cycles of laundering with in situ rechlorination every 5 cycles.

[0040] FIG. 10 shows the durability of A-chloramine grafted cotton to laundering with anionic surfactant including loss of active chlorine for 50 cycles without rechlorination. [0041] FIG. 11 shows the durability of /V-chloramine grafted cotton to in situ rechlorination of /V-chloramine grafted cottons through a conventional home laundering process with rechlorination every 5 cycles.

[0042] FIG. 12 shows the durability of /V-chloramine grafted cotton to laundering with anionic surfactant through a conventional home laundering process with rechlorination every 5 cycles.

[0043] FIG. 13 shows the durability of /V-chloraminc grafted cotton to laundering with non-ionic surfactant through a conventional home laundering process with rechlorination every 5 cycles.

[0044] FIG. 14 shows antiviral activity of /V-chloramine grafted cottons, according to some embodiments of the present disclosure.

[0045] FIG. 15 shows antiviral efficacy of /V-chloramine grafted cottons, according to some embodiments of the present disclosure, after 5 cycles of quenching and re-chlorination

[0046] FIG. 16 shows the stability of /V-chloramine grafted cottons, according to some embodiments of the present disclosure, to UV-visible light, including loss of active chlorine after exposure to UV-visible light (FIG. 16A) and samples of PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton, and P(MAM-co-MAMPlP)-g-cotton with recharged active chlorine concentration post-exposure to UV-light (FIG. 16B).

[0047] FIG. 17 shows the storage stability of active chlorine on /V-chloramine grafted cottons, according to some embodiments of the present disclosure.

[0048] FIG. 18 shows a reaction scheme for synthesizing 4-Dimethylamino-2, 2,6,6- tetramethylpiperidine (DMATMP).

[0049] FIG. 19 shows a reaction scheme for synthesizing Nl-(3- methacrylamidopropyl)-N 1 ,N 1 ,N 10,N 10-tetramethyl-N 10-(2,2,6,6-tetramethylpiperidin-4- yl)decane- 1 , 10-diaminium (MAMP1P).

[0050] FIG. 20 shows SEM images of 7% polyurethane (PU) that was pad-dry-cured with 0.35 M MAMP1P, 0.175 M KPS (FIG. 20A), 7% PU pad-dry-cured with 25% MAMP1P, 50% KPS (FIG. 20B), 7% PU, 3 heavy coats of water airbrushed, in replacement of MAMPIP (FIG. 20C), % PU pad-dry-cured with water, in replacement of MAMP1P (FIG. 20D), 7% PU pad-dry-cured, 25% MAMPIP, 50% KPS (FIG. 20E), and % PU airbrushed with 3 medium coats of MAMPIP (FIG. 20F).

[0051] FIG. 21 shows a reaction scheme for reversible chlorination of P(AM-co- MAMPlP)-g-cotton.

[0052] FIG. 22 shows the ' 1 l-NMR spectrum of MAMPIP in D2O.

[0053] FIG. 23 shows the FT1R spectra of PMAMPIP-g-cotton, P(AM-co-MAMPlP)- g-cotton and P(MAM-co-MAMPlP)-g-cotton after 0 or 5 cycles of rechlorination, 0- rechlorinated samples were chlorinated once (initial charging).

[0054] FIG. 24 shows the Zeta potential of A-chloramine grafted cotton from pH 3-10 after grafting (FIG. 24A), and after 5 cycles of re-chlorination (FIG. 24B).

DETAILED DESCRIPTION

[0055] Definitions

[0056] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0057] As used herein, the term “about” refers to an approximately +/-10% variation from a given value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.

[0058] As used herein, the term "activity" refers to antiviral activity and/or biocidal activity.

[0059] As used herein, the term “antimicrobial” may be used interchangeably with the term “biocide” to refer to a chemical compound, a chemical composition or a chemical formulation that can kill or render harmless one or more microbes.

[0060] As used herein, the term “antiviral”, refers to a chemical compound, a chemical composition or a chemical formulation that can kill or render harmless one or more viruses. [0061] As used herein, the term "coating formulation", refers to a chemical composition that can be used to coat a substrate, where the chemical composition made may be a mixture of different chemical components that undergo one or more chemical reactions to form a coating upon a substrate.

[0062] As used herein, the term "fabric” refers to a textile or cloth, woven or not, that can be used in making personal protection equipment, such as facemasks. Fabric may be made of a single layer or multiple layers, with each layer made of the same material, or not. In some non-limiting examples of the embodiments of the present disclosure, the fabric may be made from a natural material, such as cotton, a processed natural material, a synthetic material or any combinations thereof.

[0063] As used herein, the terms "halo" or "halogen" by themselves or as part of another substituent, have the same meaning as commonly understood by one of ordinary skill in the art, and preferably refer to one or more of fluorine, chlorine, bromine, and iodine.

[0064] As used herein, the terms “microbe” and “microbes” refer to one or more single celled, or multi-cellular, microorganisms exemplified by at least one of bacterium, archaea, yeast, fungi. For the purposes of the present disclosure, viruses and virions are also considered microbes.

[0065] The term "A-halamine" as used herein refers to a compound containing one or more nitrogen-halogen covalent bonds that is normally formed by the halogenation of imide, amide or amine groups of a compound. The presence of the halogen renders the compound biocidal. A-halamines, as referred to in the present disclosure, include both cyclic and acyclic A-halamine compounds.

[0066] As used herein, the terms 'W-halamine precursor" and “/V-lialamiiie precursor group” may be used synonymously and can be any N-H, preferably with the absence of an alpha hydrogen, as part of either a cyclic or acyclic organic structure. These functional groups may contain one or more nitrogen-hydrogen bonds that can be converted into a one or more nitrogen-halogen bonds normally formed by the halogenation of imide, amide or amine groups of the functional group. The presence of the halogen may convert an /V-lialamiiie precursor into an A-halamine, which may render the functional group biocidal. [0067] As used herein, the terms "quaternary ammonium cation", "quaternary ammonium compound", "quaternary ammonium salt", "QAC", and "quat" may be used interchangeably throughout the present disclosure to refer to ammonium compounds in which four organic groups are linked to a nitrogen atom that produces a positively charged ion (cation) of the structure NR4 ⁺ .

[0068] As used herein, the term “organic linker-group” includes at least the following functional groups phenyl, propane, butane, pentane, hexane, cyclic propane, cyclic butane, cyclic pentane or cyclic hexane.

[0069] As used herein, the term “virus” refers to a submicroscopic infectious agent that comprises a capsid-coated sequence of genetic material that can replicate inside living and infected cells. In the present disclosure, the term “virus” may be used interchangeably with the term “virion”. Virus includes (but not limited to) Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, vancomycin resistant enterococcus, Candida tropicalis, MS2 virus, Stachybotrys chartarum, and avian influeza virus.

[0070] Materials

[0071] Acrylamide (AM, >99%), methacrylamide (MAM, 98%), potassium persulfate

(KPS, >99%), sodium thiosulfate 0.1 N standard solution and glacial acetic acid (>99.7%) were purchased from Sigma Aldrich (St. Louis, MO, USA). Integra Miltex Standard biopsy punches, LB agar (Lennox), LB broth (Lennox) and iodine 0.1 N standard solution were purchased from Fisher Scientific (Nepean, ON, Canada).

[0072] A ¹ -(3-methacrylamidopropyl)-A ¹ ,A ¹ ,A ¹⁰ ,A ¹⁰ -tetramethyl-A ¹⁰ -(2,2,6,6- tetramethylpiperidin-4-yl)decane-l,10-diaminium (herein interchangeably referred to as “ET1-M1” or “MAMP1P”) was custom-synthesized by Alberta Research Chemicals Inc. (Edmonton, AB, CA) and synthesis of MAMP1P is discussed in details below.

[0073] Bleached desized cotton #400, AATCC HE Standard Reference Liquid Detergent and AATCC ballast dummy 1 100% cotton sheeting were purchased from TestFabrics Inc. (West Pittston, PA, USA).

[0074] AquaCleen® High Performing Nonionic Surfactant was purchased from Chemical Products Industries, Inc. (Oklahoma City, OK, USA). [0075] For the synthesis of DMATMP (FIG. 18), 2,2,6,6-tetramethylpiperidin-4- amine (70.0 g, 447.9 mmol) was solubilized in formic acid (84.5 mL, 2240 mmol) at 0 °C. Formaldehyde solution (37% in H2O, 70.0 mL, 940 mmol) was also added slowly in one portion at 0 °C. The solution was stirred, heated to 70 °C overnight, cooled to 0 °C the following day and 40 mL of concentrated HC1 added. All volatiles were removed in vacuo. Sodium hydroxide (=^ 130 g in 350 mL H2O) was added to the crude mixture with stirring and cooling. The top organic layer formed with stirring was collected using a separating funnel. The aqueous layer was extracted with ethyl acetate (100 mL x 3). The combined organic solution was dried and concentrated. Hexane (500 mL) was added to the mixture to precipitate a small amount of orange impurity, which was removed by filtration. Hexane was removed in vacuo, crude was purified by vacuum distillation (<1 torr, ^{; :;} 70 ° C). The distillations were repeated (at least 3 times) until NMR showed no impurity. The product was obtained as a clear liquid, yield, 71 g, 86%. 'H-NMR (CDC13, 400 MHz): d 2.70-2.62 (m, 1H), 2.28 (s, 6H), 1.78-1.73 (m, 2H), 1.20 (s, 6H), 1.14 (s, 6H), 1.30-0.70 (m, 2H).

[0076] For the synthesis ofMAMPIP (FIG. 19), 1,10-Dibromodecane (244.1 g, 0.813 mol) was dissolved in acetonitrile (1 L). /V-/3-(Dimetliylamiiio)propyl]metliacrylamide (138.5 g, 147.5 mL, 0.813 mol) was added in one portion. Residual N-[3- (Dimethylamino)propyl]methacrylamide in the container was rinsed with acetonitrile (30 mL x 3) and added to the reaction mixture as well. The reaction mixture was heated to reflux for 24 h. The completion of the reaction was monitored by NMR. After the reaction has completed, DMATMP (150 g, 0.814 mol) was added to the reaction mixture while it was hot and continued refluxing for 24 h. The completion of the reaction was confirmed by NMR. Then the reaction mixture was evaporated to dryness and dried under high vacuum for a prolonged period of time. The product was obtained as a pale yellow to colorless foam. Yield: 530 g. ‘H-NMR of MAMPIP (D2O, 300 MHz): 5 5.736 (s, 1H), 5.480 (s, 1H), 3.737 (t, 1H), 3.194-3.447 (m, 8H), 3.061 (s, 6H), 3.010 (s, 6H), 1.973-2.137 (m, 4H), 1.930 (s, 3H), 1.601-1.824 (m, 4H), 1.422-1.549 (m, 2H), 1.259-1.408 (m, 12H), 1.232 (s, 6H), 1.210 (s, 6H) (FIG. 22).

Statistical Analysis

[0077] For the characterization experiments in the following examples (including rechlorination durability, zeta potential, nitrogen content, UV-vis stability and storage stability), three technical replicates were performed for each measurement. Data are presented as mean ± standard deviation (SD). Data for re -chlorination durability, UV-vis stability and storage stability were analyzed using a mixed model AN OVA with time or number of cycles as a repeated measure (SAS Proc Mixed). Where significant interactions were observed among treatments and times, comparisons among treatments were made with Tukey's multiple range test (p < 0.05). For the experiment comparing re-charged chlorine content post-exposure to UV-visible light, data were analyzed using two-way ANOVA: where significant interactions were observed among fabric and UV-treatment condition, comparisons were made between the initial control and each UV-treatment condition using orthogonal contrasts (Protected LSD, < 0.05).

[0078] Assessments of antiviral efficacy were conducted over three independent experiments, each consisting of three biological replicates per sample at each time point. Results represent the means from all independent experiments (n = 3). To ensure no data skewing to indicate increased antiviral efficacies, outliers were not excluded. Data are presented as log-transformed means ± SD. Log-transformed antiviral data were analyzed by two-way ANOVA with Tukey's correction (p < 0.05). All statistical analyses were conducted using SAS software (Version 9.4, SAS Institute, Cary NC).

[0079] Example 1

[0080] (i) Graft polymerization

[0081] In this example, /V-cliloramine precursor monomers including AM,

MAM, and MAMP1P were covalently grafted onto cotton.

[0082] Bleach desized cotton such as pristine cotton #400 was treated using a conventional dip-padding process followed by radical graft polymerization. A chemical finishing bath was prepared by dissolving a desired monomer (AM, MAM or MAMP1P) in deionized (DI) water at a monomer concentration of 0.35 M with 0.175 M KPS as an initiator. The cotton was soaked in the finishing bath for 15 min at a charge solution ratio of 50:1 followed by dip-padding to a required wet-pickup of 130 ± 2%. The dip-pad process was repeated twice. The padded cottons were dried at 60°C for 10 min to remove excess water followed by curing at 120°C for 5 min. After curing, the cottons were washed thoroughly with DI water and line -dried at room temperature. The cottons grafted with AM, MAM, or MAMPIP were labelled as PAM-g-cotton, PMAM-g-cotton, and PMAMPIP-g-cotton (or PETl-Ml-g-cotton) respectively.

[0083] Cotton samples grafted with a copolymer of MAMPIP with either AM or MAM were prepared in a similar manner as described above, with the exception that the desired two monomers were dissolved in the finishing bath at equal molarity to reach a total monomer concentration of 0.35 M. The cotton grafted with MAMPIP copolymerized with AM was labeled as P(AM-co-MAMPlP)-g-cotton (or PAM-co-PETl-Ml-g-cotton). Similarly, cotton grafted with MAMPIP copolymerized with MAM was labeled as P(MAM- co-MAMP!P)-g-cotton (or PMAM-co-PETl-Ml-g-cotton).

[0084] MAMPIP or its copolymers with AM or MAM were grafted to cotton to endow the surface with rechargeable antiviral activity (as shown in FIG. 21). The positively charged quaternary amine groups in MAMPIP serve two functions. First, the positive charges allow for higher active chlorine loadings at lower concentrations of chlorine in the wash charge solution, which facilitates the recharging of the viricidal moiety by the end-user of the fabric through home laundering with chlorine bleach. This overcomes one issue with previously developed A-chloramine precursors which require high active chlorine concentrations in the chlorination charge solution to achieve a suitable conversion efficiency of N-H bond to N-CL Second, the positive surface charge can create an electrostatic attraction with the target virion to facilitate rapid action of the /V-chlorami ne groups.

[0085] (ii) Fabrication and characterization of V-chlorami ne grafted cottons

[0086] Grafting percentages (Table 1) varied with monomer formulation and ranged from 2.87 ± 0.07% for PAM-g-cotton to 5.91 ± 0.09% for PMAMPIP-g-cotton. The grafted molar repeating unit was lower for PMAMPIP-g-cotton (0.090 ± 0.002 mmol g-1 cotton) than the cotton grafted with noncationic acyclic /V-chlorami ne monomers AM or MAM (0.441 ± 0.009 mmol g-1 and 0.337 ± 0.009 mmol g-1 cotton respectively), potentially due to repulsion of the cationic quaternary amide groups during graft polymerization, which could lower grafting efficiency. Despite the lower molar amount of MAMPIP grafted to the cotton, PMAMPIP-g-cotton showed more than 5x greater active chlorine concentration compared to PAM-g-cotton and PMAM-g-cotton, demonstrating the contribution of the cationic charges to improved chlorination efficiency. [0087] The graft percentage (Table 1) was calculated as graft % = (W2 - W1)/W1 x 100, where W2 and W1 are the weights of grafted and pristine cotton respectively.

[0088] Table 1. Grafting percentages and active chlorine concentration on N- chloramine grafted cottons.

Data are expressed as mean ± standard deviation, n = 3. Concentration of KPS was 0.175 M for all chemical grafting baths.

[0089] The chemical structure of the monomer MAMP1P was confirmed by transmission Fourier transform infrared (transmission FT1R, Thermo Scientific, Nicolet is 10) and ¹ 11-nuclcar magnetic resonance ( ^r H NMR, Avance 300 MHz, Bruker, Karlsruhe, Germany). A-chloramine grafted cotton was analyzed by transmission FT1R (transmission FT1R, Thermo Scientific, Nicolet islO) after grinding in an electric mill.

[0090] Hydrophilicity of the cotton after modification by graft polymerization was evaluated using the sessile drop method for water contact angle measurement with a droplet size of 5 pL, measured in ImageJ. The contact angle was measured after Is or 20s contact as in Tang et al. Moisture regain of /V-cliloramine -modified cotton was tested according to ASTM Test Method D2654-22: Standard Test Methods for Moisture in Fabrics, Procedure 4.

[0091] Nitrogen content of A-chloramine grafted cotton was determined by CHN elemental analysis (PE 2400 Series II CHNS/O Analyzer, Perkin Elmer, Waltham, MA, USA). In preparation for elemental analysis, fabric samples were ground into pulpy fibers using an electric mill followed by drying at 105 °C for 18 h to remove moisture.

[0092] Zeta potential of mill-ground A-chloramine cotton samples was analyzed on the pH range of 3-10 using a SurPASS electrokinetic analyzer (Anton Paar, St. Laurent, Quebec, CA) with a cylindrical cell attachment for sample mounting. The measurement was conducted using acid titration by 0.05 M HC1 and base titration by 0.05 NaOH with 1 mM KC1 as a background electrolyte. The Fairbrother-Mastin model was automatically applied for the calculation of zeta potential.

[0093] The grafted cotton samples were characterized by attenuated total reflectance- Fourier transform infrared (ATR-FT1R, Nicolet islO, Thermo Scientific) (FIG. 1A and FIG. IB). Comparison of the spectra of the monomer MAMP1P versus pristine cotton shows that the MAMP1P C(O)-NH- amide 1 & 11 peaks at 1656 cm ¹ and 1619 cm ¹ are overlapped with the peak at 1641 cm ¹ corresponding to adsorbed water in virgin cotton (FIG. 1A). The MAMP1P monomer C-H alkene stretching peak at 3004.678 cm ¹ is absent in the structure of PMAMPIP-g-cotton but could be masked by the broad -OH stretching peak from cellulose at 3378 cm ¹ . Therefore, successful graft polymerization cannot be concluded based on the amide 1 & 11 peak and the corresponding disappearance of vinyl-associated peaks in the FT1R spectrum. However, a new peak at 1533 cm ¹ appears in the spectrum of PMAMPIP-g-cotton after graft polymerization (FIG. IB), which is attributed to N-H in-plane bending of MAMPIP's piperdine amine. Further, this peak does not appear in the spectrum of virgin cotton. Therefore, the presence of this characteristic peak of PMAMPIP-g-cotton confirms successful grafting. This peak unique to MAMP1P from piperidine N-H in -plane bending at 1533 cm ¹ is also present in the spectra of the copolymerized samples P(AM-co-MAMPlP)- g-cotton and P(MAM-co-MAMPlP)-g-cotton (FIG. IB). The rest of the characteristic peaks for the MAMP1P monomer amide or amine groups are convoluted with the peaks from virgin cotton: the -OH stretching peak from cellulose at 3378 cm ¹ covers the amide or amine N-H stretch in MAMP1P, and the peak at 1641 in the negative control cotton spectrum covers the amide C=O stretch in MAMP1P.

[0094] The ATR-FT1R spectra for the re-charged graft polymerized cottons were collected after 0 and 5 cycles of re -chlorination to detect amide hydrolysis after exposure to the alkaline conditions during re-chlorination (FIG. 23). After 5 cycles of re-chlorination, a new shoulder peak appeared in the spectrum of PAM-g-cotton (1718 cm '). PMAM-g-cotton (1713 cm ¹ ), P(AM-co-MAMPlP)-g-cotton (1709 cm ¹ ), and P(MAM-co-MAMPlP)-g- cotton (1714 cm '), which could indicate hydrolysis of the amide structures to carboxylic acid under the alkaline re-chlorination condition.

[0095] SEM micrographs of the grafted cottons were collected before and after graft polymerization to characterize changes to the surface texture of the fibers due to the coating process (FIG. 6, A-D on the left; FIG. 5, A-D on the left). Graft polymerization resulted in minor changes to the physical surface texture of the cotton fibers, such as increased roughness visible on the fibers of PMAMPIP-g-cotton and P(AM-co-MAMPlP)-g-cotton. The overall similar surface morphology prior to and after graft polymerization provides evidence for uniform distribution of the polymeric antiviral /V-cliloramine precursors at the fiber surface with a short polymer chain length.

[0096] Irregular dangling flakes visible in the SEM micrographs after graft polymerization, particularly for PMAMPIP-g-cotton and P(AM-co-MAMPlP)-g-cotton, are attributed to homopolymer which was not completely stripped from the surface after rinsing after graft polymerization (FIG. 6, B,C on the left). In a separate example, the grafted percentages were determined after 24 h of Soxhlet extraction with DI water. Whereas the initial rinsing method yielded grafting percentages of 5.91 ± 0.09%, 4.48 ± 0.06% and 4.41 ± 0.09% for PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g- cotton respectively; the grafted masses by Soxhlet extraction were slightly lower: 5.84 ± 0.01%, 4.46 ± 0.01% and 4.34 ± 0.01%. The difference in grafted percentages between the original rinsing method versus Soxhlet extraction was less than 0.07% (of grafted cotton), which confirms that the mass of homopolymer present in the rinsed samples after graft polymerization was low, and that the rinsing process was reasonably efficient for removing the highly hydrophilic homopolymers of PMAMP1P (or its copolymers with PAM or PMAM) from the samples. To evaluate the hydrophilicity of the graft-polymerized cotton, the water contact angle was measured after Is or 20s contact. The amphiphilic MAMP1P (and its copolymers with hydrophilic acrylamide or methacrylamide) resulted in hydrophilic surfaces after grafting on PMAMPIP-g-cotton, P(AM-co-MAMPlP)- g-cotton and P(MAM-co- MAMPlP)-g-cotton (Table 2).

[0097] Non-chlorinated PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton, P(MAM-co-MAMPlP)-g-cotton, and pristine cotton all had a contact angle of zero with complete wetting of the fabrics after Is. The hydrophilicity of the modified cotton after chlorination was also tested since the /V-cliloramine N-Cl bond is less polar compared to the precursor N-H bond. Each of the fabrics still exhibited high hydrophilicity after chlorination, but the time for complete wetting was extended. After 1 s contact time, the contact angle for chlorinated PMAMPIPg- cotton was 111% ± 6%, which indicates that chlorination of the substrate reduced the hydrophilicity. The chlorinated P(AM-co-MAMPlP)-g-cotton and chlorinated P(MAM-co-MAMPIP)-g-cotton both had nonzero but hydrophilic (<90°) contact angles at Is contact time with values of 52 ± 2% and 74 ± 6% respectively. The chlorinated PMAMPIP-g-cotton, P(AM-co-MAMPIP)-g-cotton, and P(MAM-co-MAMPIP)-g-cotton fabric samples all achieved a contact angle of 0° after the contact time was extended to 20s. For the application of antiviral fabrics, hydrophilicity is desirable to facilitate increased contact of the active grafted quaternized A-chloramines with the targeted virus.

[0098] Moisture regain was tested according to ASTM Test Method D2654-22: Standard Test Methods for Moisture in Fabrics, Procedure 4. The pristine unmodified cotton had moisture regain of 7.9 ± 0.2%. In comparison, the modified cottons had higher moisture regain: 11.7 ± 0.8% for PMAMPIP-g-cotton, 10.2 ± 0.4% for P(AM-co-MAMPIP)-g-cotton, and 9.7 ± 0.6% for P(MAM-co-MAMPIP)-g-cotton. The higher moisture regain of the modified cotton is a testament to the hygroscopic behavior of MAMPIP.

[0099] Table 2. Hydrophilicity and moisture regain of /V-cliloramine grafted cottons.

[00100] Example 2 - Chlorination and Redox Titration

[00101] In this example, cottons grafted with a coating formulation that comprised amide /V-chloramiiie precursors were chlorinated by immersion in 300 ppm bleach for 30 min with stirring at a charge solution ratio of 50:1, followed by rinsing thoroughly with DI water to remove unbound chlorine. [00102] Active chlorine concentrations on the fabrics (Table 1) were quantified by iodimetric titration. Triplicate samples with approximate mass of 0.25 g were cut into small pieces and immersed in 25 mL 0.001 N sodium thiosulfate for 30 min with shaking at 200 rpm. 2 mL of 5% acetic acid was added followed by titration with 0.001 N iodine solution. The active chlorine concentration was calculated as: active chlorine (ppm) = 35.45 (VI - V2) * N * 1000/(2 x w), where VI is the volume in mL of iodine solution consumed by titration of blank sodium thiosulfate, V2 is the volume in mL of iodine solution consumed by titration of sodium thiosulfate exposed to /V-chloramiiie cotton samples, N is the normality of the iodine solution and W is sample weight in grams.

[00103] Example 3 - Rechargeability, Durability, and Stability of A'-Chloramine Grafted Cottons

[00104] (i) Rechargeability and Durability

[00105] In this example, the rechargeability of the /V-cliloramine grafted cotton was assessed after five repeated chlorination and quenching cycles. Samples were chlorinated with 300 ppm bleach for 30 min, followed by quenching in excess of 0.001 N sodium thiosulfate (FIG. 2). The active chlorine concentration [C1+] and nitrogen content were evaluated after each re -chlorination by iodimetric titration and elemental analysis as previously described. The zeta potential of the recharged fabrics was measured after 0 and 5 re-chlorination cycles as previously described.

[00106] FIG. 2 shows the durability of /V-clilorami ne grafted cotton to re -chlorination. Data are expressed as mean ± standard deviation, n = 3. Means followed by the different letters (A,B,C) are significantly different at 5 cycles of rechlorination by repeated measures ANOVA with Tukey correction (p < 0.05).

[00107] The cotton grafted with acyclic amide /V-cliloramine precursors, PAM-g- cotton and PMAM-g-cotton, both exhibited stable active chlorine concentration throughout five re-chlorination cycles. In contrast, PMAMPIP-g-cotton showed a diminishing capacity for binding oxidative chlorine after multiple cycles of re-charging. After 5 cycles of rechlorination and quenching, the active chlorine concentration of PMAMPIP-g-cotton could only be charged to 38% of the original value. This poor durability to re-charging is likely attributed to the cationic quaternary nitrogen groups on PMAMPIP-g-cotton, which resulted in the electrostatic attraction of negatively charged hydroxide ions under the alkaline (pH 11) re-chlorination conditions, thereby increasing hydrolysis of the A-chloramine precursor and resulting in a permanent irreversible loss of capacity for binding oxidative chlorine.

[00108] Two new grafting formulations were prepared by copolymerizing MAMP1P with AM or MAM to improve the durability of the resulting copolymerized /V-chlorami lies to re-chlorination: P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton. It is hypothesized that hydrolysis of the acrylamide or methacrylamide amide groups during the alkaline chlorination process could reduce hydrolysis of MAMP1P by creating repulsion between the incoming hydroxide ions and the newly carboxylate anions hydrolyzed from acrylamide. Both copolymerized formulations showed enhanced durability to re-chlorination relative to PMAMPIP-g-cotton. The loss of active chlorine binding capacity was only 6.1% for P(AM-co-MAMPlP)-g-cotton and 2.9% for P(MAM-co-MAMPlP)-g-cotton after 5 cycles of re-chlorination, compared to 61.8% for PMAMPIP-g-cotton.

[00109] Elemental analysis was implemented to determine the nitrogen content for the /V-chloramiiie grafted cotton before and after 5 cycles of re-chlorination, and to monitor nitrogen loss which is indicative of hydrolysis of the precursor structures (Table 3). The copolymerized samples P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton retained a similar nitrogen content to the starting value after the first chlorination cycle, whereas PMAMPIP-g-cotton lost 17.4% of its initial nitrogen content after a single chlorination cycle. The significant loss of nitrogen in the PMAMPIP-g-cotton samples after the first chlorination cycle demonstrated that the loss in active chlorine content observed after five cycles of re -chlorination can be attributed to the irreversible loss of the nitrogen-bearing A-chloramine precursor structure due to alkaline hydrolysis. Overall, PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton exhibited nitrogen losses of 26.1%, 32.9% and 17.3% respectively after 5 re-chlorination cycles. PMAMPIP-g-cotton retained higher nitrogen content (0.68 ± 0.02%) compared to P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton (0.53 ± 0.03% and 0.62 ± 0.01% respectively) despite much lower active chlorine concentration after 5 cycles of re-chlorination, which is justified based on the higher nitrogen content per monomer unit of MAMP1P versus AM or MAM. [00110] Table 3. Nitrogen content of /V-cliloramine grafted cottons after rechlorination.

[00111] FIG. 24 shows the Zeta potential of /V-chloramiiie grafted cotton from pH 3- 10 after grafting (FIG. 24A), and after 5 cycles of re-chlorination (FIG. 24B). Data are expressed as mean ± standard deviation, n = 3.

[00112] The zeta potential of the /V-cliloramine grafted cotton after 5 re-chlorination cycles was analyzed on a pH range of 3-10 (FIG. 24). The zeta potential of the negative control cotton showed the characteristic shape associated with cotton: acidic behavior at low pH with an isoelectric point less than 3, as well as a plateau '=-30 mV at pH > 4 due to high hydrophilicity. In contrast to the negative zeta potential of virgin cotton, the /V-cliloramine grafted cotton all showed positive zeta potential on the tested range of pH 3-10 due to the positively charged quaternary ammonium groups in the structure of MAMPIP. Positive surface charge boosts the action of /V-cliloram ine-based antimicrobial materials.

[00113] Since many microorganisms bear a net negative surface charge at neutral pH, the electrostatic attraction to the positively charged antimicrobial coating can potentially enhance the antimicrobial activity of the grafted cotton. After 5 cycles of re -chlorination, P(AM-co-MAMPIP)-g-cotton and P(MAM-co-MAMPIP)-g-cotton both exhibited a higher zeta potential than PMAMPIP-g-cotton except when pH > 9. The lower zeta potential of PMAMPIP-g-cotton as well as a reduction in nitrogen content corroborate the hypothesis that PMAMPIP-g-cotton was subject to alkaline hydrolysis during the re-chlorination process, which resulted in the reduced capacity for recharging after multiple cycles of re -chlorination.

[00114] (ii) Durability to home-laundering

[00115] In this example, the durability of chlorinated or unchlorinated grafted cottons to home-laundering was evaluated according to AATCC TM188: Test Method for Colorfastness to Sodium Hypochlorite Bleach in Home Laundering using laundering protocol from AATCC LPl-2018e: Laboratory Procedure for Home Laundering: Machine Washing. Three wash conditions were examined: (i) washing anionic detergent without bleach for 50 wash cycles, (ii) anionic detergent with bleach added every fifth cycle for 50 wash cycles, and (iii) nonionic detergent with bleach added every fifth cycle for 50 wash cycles.

[00116] The anionic detergent was AATCC High Efficiency (HE) Standard Reference Liquid Detergent without optical brightener, and the non-ionic detergent was AquaCleen® High Performing Nonionic Surfactant. For each wash condition, triplicate samples of PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton were removed from the load after every cycle for titration of the remaining chlorine content on the grafted fabrics.

[00117] For each cycle, laundering was conducted as follows: PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton samples were washed with AATCC Ballast Type I (920 920 mm bleached cotton sheeting) to create a 1.8 ± 0.1 kg load. The load was washed with 50 ± 1 mL of detergent using AATCC standard washing conditions: 44 ± 8 L wash volume, 60 ± 5 strokes/min agitation speed, 1 rinse, 660 ± 20 final spin speed, 5-10 min final spin time, and warm wash temp (35 ± 4.2 °C). The load was washed for 14 ± 2 min followed by rinsing, draining, spinning, and line drying at room temperature. Water hardness was recorded.

[00118] For the experiments with added bleach, the laundering test was repeated according to the same procedure with 180 mL sodium hypochlorite bleach added to the load to at the specified cycles to regenerate the chlorine content on the fabrics. Triplicate 50g wash water samples were collected and titrated to determine available chlorine content in the charge solution. The available chlorine delivered by the charge solution dosage was 253 ± 8 ppm.

[00119] The concentration of active chlorine after laundering the A-chloramine grafted cottons was quantified by iodimetric titration. Briefly, cotton samples (~0.25g) were immersed in 25 mL of 0.001 N sodium thiosulfate solution for 30 min, followed by the addition of 2 mL 5% acetic acid. The samples were titrated with 0.001 N iodine solution. Active chlorine concentration was calculated as: active chlorine (ppm) = 35.45 x (Vi - V2) ^x N * 1000 / (2 x W) Where: VI = volume of iodine solution consumed by titration of blank sodium thiosulfate (mL), V2 = volume of iodine solution consumed by titration of sodium thiosulfate exposed to /V-chloramiiie cotton samples (mL), N = normality of the iodine solution and W = sample weight (g).

[00120] /V-chloramiiie grafted cottons were analyzed before and after laundering with attenuated total reflectance-Fourier transform infrared (ATR-FT1R, Nicolet islO, Thermo Scientific). Nitrogen content of /V-cliloramine grafted cottons (milled and dried at 105°C for 18h) was determined by CHN elemental using a PE 2400 Series 11 CHNS/O Analyzer (Perkin Elmer, Waltham, MA, USA).

[00121] The ATR-FT1R spectra for PMAMPIP-g-cotton after 0 cycles (FIG. 3A) and 50 cycles (FIG. 3B), P(AM-co-MAMPlP)-g-cotton after 0 cycle and 50 cycles (FIG. 4A) and P(MAM-co-MAMPlP)-g-cotton after 0 cycle and 50 cycles (FIG. 4B), and were collected to identify peaks in the carboxylic acid region (around 1710 cm ¹ ), which would be a sign of hydrolysis.

[00122] SEM images of the /V-cliloramine grafted cottons were collected after laundering for 0 cycles or 50 cycles with in situ re-chlorination every 5th cycle at 250 ppm (see FIG. 5 and FIG. 6). Expected damage to the cotton surface was clearly visible after 50 washing cycles, which indicates that mechanical abrasion could certainly contribute to the loss of active chlorine via the physical loss of antiviral coating from the fiber surface.

[00123] FIG. 5 provides SEM images of laundered cottons after 0 or 50 laundering cycles, 150X magnification: (A) negative control untreated cotton, (B) PMAMPIP-g-cotton, (C) P(AM-co-MAMPlP)-g-cotton, (D) P(MAM-co-MAMPlP)-g-cotton.

[00124] FIG. 6 provides SEM images of cottons before and after graft polymerization process, 2000x magnification: (A) negative control untreated cotton, (B) PMAMPIP-g- cotton, (C) P(AM-co-MAMPlP)-g-cotton, (D) P(MAM-co-MAMPlP)-g-cotton.

[00125] FIGs. 7-9 shows the durability of /V-cliloramine grafted cottons to laundering, including losses of active chlorine for 50 cycles without rechlorination (FIG. 7); in situ rechlorination of /V-cliloramine grafted cottons through a conventional home laundering process with rechlorination every 5 cycles (FIG. 8); and nitrogen and carboxylic acid content throughout 50 cycles of laundering with in situ rechlorination every 5 cycles (FIG. 9). [00126] (iii) Durability of quaternized A-chloramine-grafted cottons to laundering with anionic surfactant

[00127] A-chloramine grafted cotton samples (MAMPIP-g-cotton, P(AM-co- MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton) were laundered under standardized home laundering conditions with an anionic surfactant to analyze the stability of the coatings to home laundering (FIG. 10). Without recharging with bleach, the active chlorine concentration on the cotton samples was rapidly depleted and reached <110 ppm after 50 laundering cycles. In another experiment, the cotton samples were laundered with anionic surfactant and recharged in situ with 250 ppm bleach on every fifth laundering cycle to achieve a stable chlorine loading on the fabrics (FIG. 11). P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton both showed improved durability to in situ rechlorination compared to MAMPIP-g-cotton. The active chlorine concentration on P(AM-co-MAMPlP)- g-cotton fluctuated between 311±62 and 488±30 ppm between cycles 10-50, whereas MAMPIP-g-cotton fluctuated between 175±70 and 294±41 ppm over the same period. The nitrogen content of the samples after laundering was measured to verify the mechanism of the loss in active chlorine: either by reversion of the /V-lialamiiie bond to its N-H precursor form or permanent loss in active chlorine via hydrolysis of the monomer structure. The nitrogen content of MAMPIP-g-cotton decreased as the number of laundry cycles increased, which indicates that hydrolysis and subsequently the loss of the /V-cliloramine precursor results in the drop in active chlorine concentration (Table 4). In contrast, despite a lower starting concentration of nitrogen, P(AM-co-MAMPlP)-g-cotton maintained a relatively constant level of nitrogen throughout the laundering process. P(MAM-co-MAMPlP)-g-cotton showed better resistance to reduction in nitrogen content than PMAMPIP-g-cotton during the first 10 laundering cycles, but ultimately had a lower final nitrogen content than PMAMPIP-g-cotton at cycles 25 and 50. SEM images of the /V-cliloramine grafted cottons demonstrated surface wear due to mechanical abrasion during laundering after 50 cycles in each of the samples, which could also contribute to loss of the /V-cliloramine coating (FIG. 6).

[00128] Durability of /V-cliloramine grafted cottons to laundering with anionic surfactant including loss of active chlorine for 50 cycles without rechlorination is shown in FIG. 10 and in situ rechlorination of /V-cliloramine grafted cottons through a conventional home laundering process with rechlorination every 5 cycles is shown in FIG. 11. [00129] Table 4. Elemental analysis of /V-cliloramine grafted cottons laundered with anionic surfactant

Laundering

C (%) H (%) N (%)

Cycles theory 44.4 6.17

0 42.6 ±0.05 6.5 ±0.07 0.02 ± 0.02

Negative Control 10 42.4 ±0.02 6.43 ±0.01 -0.02 ±0

25 42.6 ±0.03 6.54 ±0.02 -0.03 ±0.01

50 42.7 ±0.28 6.47 ±0.06 -0.05 ±0.03 graft 44.82 ±0.06 6.86 ±0.03 0.92 ±0.01

0 44.4 ±0.13 7.06 ±0.06 0.87 ± 0.02

PMAMPIP-g-cotton 10 45.4 ±0.11 7.05 ±0.09 0.54 ± 0.02

25 45.2 ±0.11 7.01 ±0.09 0.46 ±0.01

50 44.9 ±0.36 6.9 ±0.11 0.35 ± 0.06 graft 44.43 ±0.06 6.7 ±0.01 0.79 ±0.01

0 43.2 ±0.04 6.61 ±0.07 0.46 ± 0.02

P(AM-co-MAMPIP)-g-cotton 10 44.4 ±0.14 6.89 ±0.05 0.49 ±0.01

25 43.9 ±0.32 6.59 ±0.25 0.39 ± 0.09

50 44.1 ±0.04 6.75 ±0.06 0.42 ±0.01 graft 44.51 ±0.12 6.71 ±0.05 0.75 ± 0.03

0 43.5 ±0.2 6.85 ±0.04 0.65 ±0.12

P(MAM-co-MAMPIP)-g-cotton 10 44.6 ±0.22 6.86 ±0.19 0.59 ± 0.07

25 43.5 ±0.01 6.64 ±0.04 0.28 ±0.01

50 43.3 ±0.03 6.58 ±0.05 0.22 ±0.01

[00130] (iv) Durability of quaternized V-chloramine-grafted cottons to laundering with non-ionic surfactant [00131] Given the incompatibility of anionic detergent with laundering quaternized N- chloramine grafted cottons, the laundering experiments are repeated with a non-ionic surfactant: AquaCleen® High Performing Non-ionic Surfactant (FIGs. 7F and 7G). The samples laundered with non-ionic detergent showed higher active chlorine concentration after laundering compared to washing with anionic detergent. For example, after 50 laundering cycles with non-ionic detergent, PMAMPIP-g-cotton retained a high active chlorine concentration of 776 ± 36 ppm, versus 255 ± 43 ppm with anionic surfactant (Table 10). When laundering the positively charged cotton surfaces with anionic detergent, the adsorption of anionic surfactant due to the cationic quaternary ammonium groups could interfere with further rechlorination of the surface after the initial laundering cycle, which would be mitigated by using the non-ionic surfactant. Furthermore, the improved durability can also be explained by differences in alkalinity of the charge solution - the pH of AquaCleen solution with bleach during laundering is pH 7.01 whereas the pH for laundering with the anionic surfactant from AATCC was more alkaline, at pH 9.2. Since MAMP1P is susceptible to hydrolysis under alkaline conditions which results in the permanent loss of active chlorine from the surface, the neutral pH of the non-ionic detergent charge solution would prevent this. This was verified by examining the nitrogen content of samples laundered with non-ionic detergent after 0, 25 and 50 cycles of laundering (Table 5). Indeed, the retained nitrogen content for PMAMPIP-g-cotton was higher when laundered with non-ionic surfactant (0.58 ± 0.16 %) compared to anionic surfactant (0.35 ± 0.06 %)). Interestingly, PMAMPIP-g-cotton demonstrated a greater loss in nitrogen content after 50 cycles of laundering compared to P(AM-co-MAMPlP)-g-cotton or P(MAM-co-MAMPlP)-g-cotton, which maintained relatively constant nitrogen composition throughout the laundering process. Therefore, the higher active chlorine concentration for PMAMPIP-g-cotton throughout 50 cycles of laundering with non-ionic surfactant can be attributed to the higher positive charge density of PMAMPIP-g-cotton due to the quaternary ammonium groups in MAMP1P which can boost the chlorination efficiency, as well as two potential sites of chlorination on MAMP1P compared to one for AM or MAM.

[00132] PMAMPIP-g-cotton showed better durability to laundering with non-ionic surfactant compared to P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton, whereas the opposite was the case when laundering with anionic surfactant. Due to the neutral pH of the non-ionic detergent solution, the reduced degree of alkaline hydrolysis would mitigate the benefits of P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g- cotton at resisting hydrolysis of MAMPIP due to the lower positive surface charge density. Therefore, when alkaline hydrolysis is not a dominating factor, the multiple chlorination sites of MAMPIP and higher positive charge density boost the chlorination efficiency without the negative side effect of alkaline hydrolysis. [00133] Table 5. Elemental analysis of A-chloramine cottons laundered with

Aquacleen non-ionic surfactant

Cycles C (%) H (%) N (%)

0 43.93 ± 0.03 6.37 ± 0.13 0.02 ± 0.1

NC 25 44 ± 0.07 6.39 ± 0.04 -0.13 ± 0.06

50 43.88 ± 0.27 6.43 ± 0.11 -0.05 ± 0.16 graft 44.82 ± 0.06 6.86 ± 0.03 0.92 ± 0.01

0 44.87 ± 0.39 6.91 ± 0.17 0.79 ± 0.18

MAMPIP-g-cotton e 25 45.31 ± 0.18 6.8 ± 0.07 0.62 ± 0.18

50 45.11 ± 0.25 6.81 ± 0.11 0.58 ± 0.16 graft 44.43 ± 0.06 6.7 ± 0.01 0.79 ± 0.01

P(AM-co-MAMPIP)-g- 0 44.46 ± 0.45 6.73 ± 0.04 0.42 ± 0.16 cotton 25 44.64 ± 0.1 6.74 ± 0.02 0.51 ± 0.19

50 44.57 ± 0.2 6.62 ± 0.05 0.48 ± 0.2 graft 44.51 ± 0.12 6.71 ± 0.05 0.75 ± 0.03

P(MAM-co-MAMPIP)-g- 0 44.56 ± 0.25 6.82 ± 0.2 0.71 ± 0.19 cotton 25 44.82 ± 0.23 6.77 ± 0.12 0.57 ± 0.19

50 44.9 ± 0.28 6.8 ± 0.06 0.74 ± 0.16

[00134] Durability of A-chloramine grafted cottons to laundering with anionic or nonionic surfactants through a conventional home laundering process with rechlorination every 5 cycles, including laundered with anionic surfactant (shown in FIG. 12) and laundered with non-ionic surfactant (FIG. 13).

[00135] (v) Durability of quaternized V-chloramine-grafted cottons to laundering

[00136] Nitrogen content (Table 6) of A-chloramine grafted cottons was determined by CHN elemental analysis (PE 2400 Series II CHNS/O Analyzer, Perkin Elmer, Waltham, MA, USA). [00137] Table 6. Nitrogen Content of A-chloramine grafted cottons

Laundering MAMPIP -g- P(AM-co-MAMPIP)- P(MAM-co- MAMPIP)

_ , Negative Control Cycles cotton g-cotton -g-cotton N (%) N (%) N (%)

0 0.02 ±0.02 0.87 ±0.02 0.46 ±0.02 0.65 ±0.12

10 -0.02 ±0.001 0.54 ±0.02 0.49 ±0.01 0.59 ±0.07

25 -0.03 ±0.01 0.46 ±0.01 0.39 ±0.09 0.28 ±0.01

50 -0.05 ±0.03 0.35 ±0.06 0.42 ±0.01 0.22 ±0.01

[00138] The nitrogen content of MAMPIP-g-cotton decreased as the number of laundry cycles increased, which supported the hypothesis that hydrolysis and subsequently the loss of the /V-cliloramine precursor results in the drop in active chlorine concentration (FIG.9). In contrast, despite a lower starting concentration of nitrogen, PAM-co- MAMPIP- g-cotton maintained a relatively constant level of nitrogen throughout the laundering process. PMAM-co- MAMPIP-g-cotton seemed to show better resistance to reduction in nitrogen content than MAMPIP-g-cotton during the first 10 laundering cycles, but ultimately had a lower final nitrogen content than MAMPIP-g-cotton at cycles 25 and 50. [00139] Elemental analysis of A-chloramine grafted cottons was performed and the results presented in Table 7.

[00140] Table 7. Elemental analysis of /V-chloramiiie grafted cottons.

Laundering

Cycles

Negative Control 0 42.6 ± 0.05 6.5 ± 0.07 0.02 ± 0.02

10 42.4 ±0.02 6.43 ±0.01 -0.02 ±0

25 42.6 ±0.03 6.54 ±0.02 -0.03 ±0.01

50 42.7 ±0.28 6.47 ±0.06 -0.05 ± 0.03

MAMPIP-g-cotton 0 44.4 ±0.13 7.06 ±0.06 0.87 ±0.02

10 45.4 ±0.11 7.05 ±0.09 0.54 ±0.02

25 45.2 ±0.11 7.01 ±0.09 0.46 ±0.01

50 44.9 ±0.36 6.9 ±0.11 0.35 ±0.06

P(AM-co-MAMPIP)-g-cotton 0 43.2 ±0.04 6.61 ±0.07 0.46 ±0.02

10 44.4 ±0.14 6.89 ±0.05 0.49 ±0.01 25 43.9 ± 0.32 6.59 ± 0.25 0.39 ± 0.09

50 44.1 ± 0.04 6.75 ± 0.06 0.42 ± 0.01

P(MAM-co-MAMPIP)-g-cotton 0 43.5 ± 0.2 6.85 ± 0.04 0.65 ± 0.12

10 44.6 ± 0.22 6.86 ± 0.19 0.59 ± 0.07

25 43.5 ± 0.01 6.64 ± 0.04 0.28 ± 0.01

50 43.3 ± 0.03 6.58 ± 0.05 0.22 ± 0.01

[00141] Example 4 - Antimicrobial activity

[00142] (i)(a) Cells and Virus Stocks

[00143] African green monkey Vero E6 cells (ATCC CRL-1586) were propagated in cell culture medium (CCM) (DMEM; HyClone SH302243.01) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% v/v penicillin-streptomycin (pen-strep; Gibco LS15140122)). One day prior to testing, cells were trypsinized (Gibco LS25200056) and seeded into 96 well plates to reach ~80% confluence the following day. On the day of testing, the CCM was removed and replaced with virus culture medium (VCM; DMEM+2%FBS+10 pL mL-1 pen/strep).

[00144] Virus stocks were prepared. Flasks containing 80% confluent Vero E6 cells were infected with seed stocks of SARS-CoV-2 (hCoV-19/Canada/ ON-VIDO-01/2020, GISA1D accession# EP1_1SL_425 177) at anMOI of 0.01. Once 80% of cell monolayer was lifted (3-5 days post infection), flask supernatant was removed and clarified using low-speed centrifugation (4500 x g) for 10 min. Supernatant was pooled, aliquoted, and quantified by end point. As SARS-CoV-2 is classified as a Risk Group 3 pathogen, all experimental procedures took place within a Class II B2 BSC in a high containment laboratory at the National Microbiology Laboratory in Winnipeg, Canada.

[00145] (i)(b) Antiviral Assessment

[00146] Samples of PMAMPIP-g-cotton, P(AM-co-MAMPIP)-g-cotton, P(MAM-co- MAMPIP)-g-cotton, and untreated cotton were collected after 0 or 5 cycles of in situ rechlorination for antiviral assessment to confirm the antiviral activity on the dressings against SARS-CoV-2. [00147] The negative controls used were pristine cotton and non-chlorinated samples of PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton, and P(MAM-co-MAMPlP)-g-cotton. Coupons of 1.0 cm diameter were cut from the chlorinated and nonchlorinated treated cotton fabrics, sterilized by soaking for 10 min in 70% EtOH, and air-dried overnight in a BSC prior to antiviral work. Each coupon was placed in a 12-well tissue culture plate with a sterile forceps and pinched to elevate the center to form a tent and prevent inoculum from wicking through to the bottom of the plate. Inoculum of SARS CoV-2 was added to the center of each tented coupon in 10 pL amounts and incubated for the set time points of 5, 10, and 30 min.

[00148] Following contact times, coupons were placed into sterile tubes with sterile 5 mm stainless steel beads and 1 mL of neutralizing medium (VCM with 0.1% sodium thiosulfate). The tubes were oscillated in a tissue homogenizer for 2 min at 1/30 Hz and clarified by centrifuging at 1500xg for 2 min. The clarified supernatant was ascertained for viable virus titers by using an end point dilution series.

[00149] Briefly, fabric supernatant was tenfold serially diluted in VCM and in replicates of five per dilution series, 50 uL was added to each well. Plates were incubated for 5 days and observed for cell monolayer cytopathic effects (CPE). A portion of the supernatant was further used to extract viral genome using the QiaAmp Viral RNA kit (Qiagen 52 906) following manufacturer protocols.

[00150] (i)(c) Real-Time RT-PCR

[00151] Real-time RT-PCR (qRT-PCR) was used to determine the elution efficiency of the virus from the various fabrics after incubating at the set times. Molecular viral load was determined by the QuantStudio 5, (Applied Biosytems, USA) platform using the Taq Path One-Step multiplex mix (Applied Biosystems A28522) with primers and probes targeting the SARS-CoV-2 envelope (E) protein (Table 8).

[00152] Thermal cycling conditions were 53 °C for 10 min for reverse transcription, followed by 95 °C for 2 min and then 40 cycles of 95 °C for 2 s, 60 °C for 30 s. A known standard of SARS-CoV-2 RNA was used to generate a standard curve in which the extracted treated samples cT was compared to obtain the log genome virus of eluted virus from fabrics.

[00153] Table 8. SARS-CoV-2 qRT-PCR primer and probe. Ol igonucleotide Sequence 5’ to 3’ Volu me

E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT 20 u M

E_Sarbeco_Pl ACACTAGCCATCCTTACTGCGCTTCG (FAM) 10 uM

E_Sarbeco_R ATATTGCAGCAGTACGCACACA 20 u M

[00154] (i)(d) Antiviral Activity of A'-Chloramine Grafted Cottons

[00155] In this example, the antiviral activity of chlorinated PMAMPIP-g-cotton, P(AM-co-MAMPIP)-g-cotton, P(MAM-co-MAMPIP)-g-cotton, and the nonchlorinated coupons of the /V-cliloramine grafted fabrics were evaluated over 3 assays each containing 3 biological replicates against SARS-CoV-2.

[00156] FIG. 14 shows the antiviral activity of /V-cliloramine -grafted samples against SARS-CoV-2. Non-chlorinated materials (black bars) or materials that were chlorinated once (grey bars) were incubated with SARS-CoV-2 for 5-30 min contact time and assessed for the residual viable virus. Bars indicate TCID50 units; lines indicate corresponding genome equivalents recovered. Results represent means +/- SD of three independent experiments (n = 3) of three biological replicates each. Means followed with no common letters (A,B,C) are significantly different, P-values were calculated by two-way ANOVA on log-transformed data with Tukey correction (p < 0.05).

[00157] It was found that contact with chlorinated PMAMPIP-g-cotton for 5 min showed a 4.59 log (99.997%) reduction in virus from initial with no surviving virus after 30 min (FIG. 14). Likewise, the chlorinated copolymerized formulations P(AM-co-MAMPIP)- g-cotton and P(MAM-co-MAMPIP)-g-cotton were also highly effective against SARS-CoV- 2, expressing 2.62 (99.76%) and 3.0 (99.9%) log reduction respectively after 5 min, and no surviving virus after 30 min.

[00158] The chlorinated PMAMPIP-g-cotton exhibited a larger log reduction of the virus than chlorinated P(AM-co- MAMPIP)-g-cotton and P(MAM-co-MAMPIP)-g-cotton. This is likely attributed to the higher active chlorine concentration (PMAMPIP-g-cotton: 1630 ± 49 ppm, P(AM-co-MAMPIP)-g-cotton: 1343 ± 47 ppm and P(MAM-co-MAMPIP)- g-cotton: 1433 ± 18 ppm, FIG. 2) and the higher positive zeta potential (at pH 7.4 ± 0.5, PMAMPIP-g-cotton: 22.2 ± 0.4 mV, P(AM-co- MAMPIP)-g-cotton: 18.7 ± 0.5 mV and P(MAM-co-MAMPIP)-g-cotton: 13.6 ± 0.4 mV, FIG. 24A). Higher surface zeta potential contributes to an increased contact with the virion, to facilitate the action of the oxidative chlorine.

[00159] Nonchlorinated samples had a minor antiviral effect against SARS-CoV-2 but were not substantially more effective than cotton alone. This indicates that the major mechanism of the rapid antiviral potency arises from the active chlorine rather than the inherent positive charge of the polymers.

[00160] Nevertheless, the positive surface charge of the grafted cotton samples acts in synergy with the /V-cliloramine to boost the antiviral activity of the fabric when active chlorine is present due to improved electrostatic attraction of negatively charged microbes.

[00161] The absence of an antiviral effect of the nonchlorinated grafted cotton is somewhat surprising since the antiviral effects of quaternary ammonium compounds against SARS-CoV-2 have previously been demonstrated via disruption of the viral envelope by the cationic quaternary ammonium groups. However, the 30 min contact time employed here may be too short to observe the native antiviral activity of the nonchlorinated grafted fabrics which could be attributable to the action of the polycationic QAC groups in the grafted polymers of MAMP1P. It is worth noting that even pristine cotton possesses an antiviral effect after extended periods of contact greater than 30 min. Limited stability of SARS-CoV- 2 on cotton with over 4-log viral reduction after 1 h of drying on the cotton surface was known.

[00162] Since this antiviral cotton is intended for applications in which frequent handling of the material poses a risk for contact transmission, the goal is fast contact killing, which justifies the choice of 30 min as the maximum tested time interval.

[00163] The antiviral efficacy of the fabrics was re-evaluated after 5 cycles of quenching and re-chlorination (FIG. 15).

[00164] FIG. 15 shows the antiviral activity of A-chloramine-grafted cotton against SARS-CoV-2 following single or multiple cycles of chlorination. Materials subjected to a single round of chlorination (lx, black bars) or 5 rounds of quenching and re -chlorination (5x, grey bars) were incubated with SARS-CoV-2 for 5-30 min contact time and assessed for the residual viable virus. Results represent means +/- SD of three independent experiments (n = 3) of three biological replicates each. Means followed with no common letters (A,B,C) are significantly different, P- values were calculated by two-way ANOVA on log-transformed data with Tukey correction (p < 0.05).

[00165] PMAMPIP-g-cotton experienced significant hydrolysis after 5 cycles of rechlorination, as evidenced by the loss in active chlorine from the surface, as well as lower nitrogen content and lower zeta potential (FIG. 2, FIG. 24, Table 3). Consequently, the PMAMPIP-g-cotton sample after 5 re -chlorination cycles was markedly less effective against SARS-CoV-2 when compared to the initial chlorinated sample (FIG. 15D).

[00166] The 5 -cycles re-chlorinated PMAMPIP-g-cotton was slightly more effective than untreated cotton at 5 min exposure, but had no major benefit over untreated cotton for longer exposure times. After 5 cycles of re-chlorination, P(AM-co-MAMPlP)- g-cotton and P(MAM-co-MAMPlP)-g-cotton retained a high level of antiviral potency, owing to the high level of active chlorine maintained on the fabrics due to the improved resistance to hydrolysis (1094 ± 16 ppm and 1284 ± 92 ppm respectively, compared to 665 ± 79 ppm for PMAMPIP- g-cotton).

[00167] The 5-cycles re -chlorinated P(AM-co-MAMPlP)-g-cotton and P(MAM-co- MAMPlP)-g-cotton achieved 2.86 (99.86%) and 2.55 (99.72%) log reduction of the virus respectively after 5 min contact time with no detectable virus present on the fabric surface after 30 min contact.

[00168] Supernatants containing the virus recovered from the fabric surface after the period of direct contact were analyzed using real-time RT-PCR to estimate the elution efficiency. Comparing the input virus genomic levels and the average of the time points from 5, 10, and 30 min in unchlorinated and chlorinated ungrafted cotton samples resulted in only a 0.1 log loss (FIG. 14A). This indicates the elution technique developed for this assay was very efficient at recovering the virus as nearly all of the inoculated virus was recovered, and furthermore, that the log reduction of the SARS-CoV-2 particle was directly tribute to the imbued properties of the fabric and not the physical nature of the fabric fixing the particle to the surface (i.e., physical adsorption).

[00169] However, as A-chloramine is incorporated into the system, there is a slight minor decrease in the recoverable genome in all chlorinated grafted cotton samples with the largest decrease in chlorinated PMAMPIP-g-cotton (FIG. 14D). [00170] Chlorinated PMAMPIP-g-cotton has the highest active chlorine and zeta potential compared to P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton. Chlorine itself is known and used as a surface cleaner to remove genome contamination of surfaces of PCR sensitive areas.

[00171] It is shown that chlorine in small quantities can have an effect on the quality of the genome leading to a reduction in signal. Furthermore, it is shown that chlorine transfer from A-chloramine grafted cotton samples to viral RNA does happen during the contact and might be the major reason for the effective kill of SARSCoV-2 virus.

[00172] (ii) Antibacterial Activity

[00173] The antibacterial performance of the fabrics was compared after washing the fabrics with an anionic or non-ionic surfactant: the anionic surfactant was AATCC High Efficiency (HE) Standard Reference Liquid Detergent and the non-ionic surfactant was AquaCleen® High Performing Nonionic Surfactant. Samples of PMAMPIP-g-cotton, P(AM- co-MAMP!P)-g-cotton and P(MAM-co-MAMPlP)-g-cotton or untreated cotton were collected after 0 and 50 wash cycles for antibacterial assessment.

[00174] E. coli (ATCC 25922), MRSA (ATCC 33592) or P. aeruginosa (ATCC 27853) were streaked on LB agar and incubated for 18h at 37°C. Subsequently, colonies of each bacteria were suspended in 0.01 M PBS to a turbidity of 0.5 MF and diluted by a factor of 100* prior to adding 15.0 LIL of the diluted suspension to 45.0 mL LB broth. The broth culture was incubated for 18 hours at 37°C with shaking at 140 rpm prior to use in experiments. For assessment of the antibacterial capabilities of the A-chloramine grafted cottons, 10 pL of the overnight bacteria suspension was dropped onto the surface of 1 cm x 1 cm square single-layer cotton coupons. After the desired time of contact, 1.0 mL LB broth containing 0.03% sodium thiosulfate to quench active chlorine was added to the coupon, and the bacteria were flushed from the surface by vigorous pipetting followed by 10 min vigorous shaking. The recovered bacteria suspension was serially diluted and drop-plated for quantification of bacteria concentration.

[00175] The antibacterial activity of chlorinated and non-chlorinated PMAMPIP-g- cotton, P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton was confirmed by direct contact testing with a 10 min exposure period (Table 9). The chlorinated A-chloramine grafted cottons (prior to laundering) demonstrated excellent antibacterial activity. PMAMPIP-g-cotton achieved 4.9 ± 1.5 log reduction of MRSA and 6.2 ± 0.5 log reduction of E. coli after the 10 min contact period. P(AM-co-MAMPlP)-g-cotton and P(MAM-co- MAMPlP)-g-cotton were less effective compared to PMAMPIP-g-cotton, which can be attributed to lower active chlorine content on the surface of the coupons. Non-chlorinated samples did not exhibit significant bacteria killing within the 10 min contact time, supporting the conclusion that the primary mode of antibacterial activity is via active chlorine killing rather than interaction with the positive surface charges associated with MAMP1P, except in the case of non-chlorinated PMAMP1P with MRSA. Non-chlorinated PMAMPIP-g-cotton achieved 1.8 ± 0.3 log reduction against MRSA vs only 0.8 ± 0.1 log reduction for E. coli, indicating that MRSA is more susceptible to neutralization by the cationic quaternary ammonium groups of MAMP1P compared to E. coli. A similar phenomenon was observed (known in the art) and attributed to structural differences between the gram positive and gram negative bacterial cell wall which can cause gram positive bacteria to be more susceptible to quaternary ammonium compounds compared to gram negative bacteria. In any case, antibacterial activity of the chlorinated A-halamine grafted fabrics was considerably greater compared to the non-chlorinated fabrics alone.

[00176] Table 9. Antibacterial activity of A-chloramine grafted cottons after 10 min contact.

Active Chlorine Log Reduction

(ppm) MRSA E. coli

Inoculum 6.7 ± 0.1 6.3 ± 0.2

PMAMPIP-C1 1630 ± 50 4.9 ± 1.5 6.2 ± 0.5

P(AM-co-MAMPIP)-Cl 1340 ± 47 1.4 ± 0.5 2.8 ± 0.7

P(MAM-co-MAMPIP)-Cl 1280 ± 42 2.5 ± 0.1 4.8 ± 0.3

PMAMPIP-no Cl 0 1.8 ± 0.3 0.8 ± 0.1

P(AM-co-MAMPIP)-no Cl 0 0.8 ± 0.1 0.61 ± 0.04

P(MAM-co-MAMPIP)-no Cl 0 0.7 ± 0.1 0.9 ± 0.3 [00177] Antibacterial activity of the /V-cliloramine grafted cottons was reassessed after laundering for 50 cycles (Table 10). Despite having active chlorine concentration between 200-400 ppm, the PMAMPIP-g-cotton, P(AM-co-MAMPIP)-g-cotton and P(MAM-co- MAMPIP)-g-cotton samples did not show significant antibacterial potency after 50 cycles of laundering. Whereas all three samples achieved >1 log reduction in 10 min contact prior to laundering (Table 9), the 50-cycles laundered PMAMPIP-g-cotton and P(AM-co-MAMPIP)- g-cotton samples showed negligible antibacterial activity after laundering while P(MAM-co- MAMPIP)-g-cotton had a small log reduction of 0.97 ± 0.04, despite extending the contact time to 30 min. Given the cationic quaternary ammonium groups in the structure of MAMPIP, it was hypothesized that adsorption of the anionic detergent to the surface of the positively charged cotton samples could result in an increase in the surface hydrophobicity which hindered the antimicrobial action of the A-chloramines. To verify this hypothesis, the zeta potential and contact angle of the cottons were measured before and after the laundering process.

[00178] The antibacterial efficacy of the A-chloramine grafted cottons was confirmed after 50 cycles of laundering with non-ionic detergent (Table 10). Compared to the samples laundered with anionic detergent which showed negligible antibacterial potency after 30 min contact time, the samples laundered with non-ionic detergent achieved 1.0 ± 0.1, 0.89 ± 0.08 and 0.9 ± 0.3 log reduction respectively for PMAMPIP-g-cotton, P(AM-co-MAMPIP)-g- cotton and P(MAM-co-MAMPIP)-g-cotton. The preserved antibacterial activity after 50 laundering cycles is promising for the application of quatemized A-chloramine coatings for rechargeable antimicrobial fabrics which can be recharged in situ through a conventional home laundering process by the end-user.

[00179] Table 10. Antibacterial activity of A-chloramine grafted cottons before and after laundering with anionic or non-ionic detergent after 30 min contact.

Cycles Sample Anionic Non-ionic

Active Active

Log Log

Chlorine Chlorine

Reduction Reduction

(PPm) (ppm)

Inoculum 4.4 ± 0.4 4.1 ± 0.3 0 PMAMPIP-g-cotton 1383 ± 91 3.9 ± 0.8 1406 ± 69 3.5 ± 0.8

P(AM-co-MAMPIP)-

956 ± 47 1.55 ± 0.04 732 ± 117 1.8 ± 0.4 g-cotton

P(MAM-co-

1044 ± 60 0.91 ± 0.02 1073 ± 93 1.6 ± 0.2

MAMPIP)-g-cotton

50 PMAMPIP-g-cotton 255 ± 43 -0.10 ± 0.03 776 ± 36 1.0 ± 0.1

P(AM-co-MAMPIP)-

399 ± 30 -0.26 ± 0.01 215 ± 142 0.89 ± 0.08 g-cotton

P(MAM-co-

363 ± 40 0.97 ± 0.04 281 ± 20 0.9 ± 0.3

MAMPIP)-g-cotton

[00180] Example 5 - Stability to UV and Visible Light

[00181] In this example, the stability of /V-cliloramine grafted cotton was evaluated after exposure to UV-visible light in the range of 300-800 nm with irradiance 765 W m-2 (FIG. 16).

[00182] The durability of the /V-cliloramine coatings to UV-visible light was evaluated according to adapted known methods. Rectangular 6 inch 2 inch samples of PAM-g-cotton, PMAM-g-cotton, PMAMPIP-g-cotton, P(AM-co-MAMPIP)-g-cotton and P(MAM-co- MAMPIP)-g-cotton were placed in an Accelerated Weathering Tester (SunTest XLS+, Atlas Material Testing Solutions, Mount Prospect, IL, USA) and exposed to simulated daylight conditions (ID65 emission standard spectrum ranging 300-800 nm, total irradiance 765 W/m2) by filtered light from a xenon lamp. Samples were removed periodically at 0, 1, 2, 3, 6, 12, 24, 48, 72, 96 and 120 h and titrated for chlorine content. Furthermore, the samples were re-chlorinated with 300 ppm bleach, pH 11 for 30 min to verify whether complete regeneration of the initial chlorine concentration could be attained after exposure to UV. The average temperature during the exposure period was 62°C BST, 45°C chamber temp.

[00183] FIG. 16 shows the stability of /V-cliloramine grafted cotton to UV-visible light. FIG. 16A shows the loss of active chlorine after exposure to UV-visible light. Data are expressed as mean ± standard deviation, n = 3. Means followed by different letters (A,B,C) are significantly different at 120 h of exposure by repeated measures ANOVA with Tukey correction (p < 0.05).

[00184] FIG. 16B shows samples of PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g- cotton, and P(MAM-co-MAMPlP)-g-cotton with recharged active chlorine concentration post-exposure to UV-light. Data are expressed as mean ± standard deviation, n = 3. Data were analyzed by two-way ANOVA. Since there was a significant interaction between fabric type and UV-treatment condition (p < 0.02), single degree of freedom orthogonal contrasts were used to compare differences between the initial condition versus post-UV conditions within each fabric sample type (* p < 0.05, ** p < 0.0001).

[00185] PAM-g-cotton, PMAMg-cotton, PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g- cotton and P(MAM-co-MAMPlP)-g-cotton showed similar lightfastness between 0-96 h, with negligible losses in active chlorine over the exposure period after the first 6 h. After 120 h of exposure to UV-visible light, the PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton, and P(MAM-co-MAMPlP)-g-cotton samples were re -chlorinated with 300 ppm bleach for 30 min.

[00186] The active chlorine on PMAMPIP-g-cotton was regenerated to 99 ± 10% of the original value, with no statistical difference between the initial chlorine concentration versus the chlorine concentration after light exposure and re-chlorination. Therefore, the active chlorine loss can be attributed to photolytic cleavage of the N-Cl bond rather than damage to the precursor structure. In contrast, photolytic decomposition of the copolymer was evident for P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton, since the active chlorine content on those samples could not be completely restored after UV-vis light exposure. The active chlorine contents for P(AM-co-MAMPlP)-g-cotton and P(MAM-co- MAMPlP)-g-cotton were restored to 77 ± 5% and 78 ± 5% of the initial value, respectively.

[00187] Example 6 - Storage Stability and chlorine off-gas

[00188] In this example, the storage stability of the /V-cliloramine grafted cotton was evaluated over a period of ~200 days (FIG. 17). PAM-g-cotton, PMAM-g-cotton, PMAMPIP-g-cotton, P(AM-co-MAMPlP)-g-cotton, and P(MAM-co-MAMPlP)-g-cotton samples were chlorinated as previously described, then stored at 21 °C, 65% RH for 200+ days. Triplicate samples were removed periodically to titrate active chlorine content. [00189] FIG. 17 shows the storage stability of active chlorine on /V-chloramiiie grafted cotton at 21 °C, 65% RH. Data are expressed as mean ± standard deviation, n = 3. Means followed with no common letters (A, B) are significantly different at 203 h of exposure by repeated measures ANOVA with Tukey correction (p < 0.05).

[00190] The active chlorine on acyclic A-chloramines PAM-g-cotton and PMAM-g- cotton was depleted after a period of 154 days, at which point measurements were terminated. In contrast, the quaternary A-chloramine fabrics PMAMPIP-g-cotton, P(AM-co-MAMPlP)- g-cotton, and P(MAM-co-MAMPlP)-g-cotton retained a high level of active chlorine, even after 203 days of storage at 21 °C, 65% RH.

[00191] After the initial rapid period of active chlorine loss for the first 28 days of storage, the loss of active chlorine was 2.8 ppm/day for PMAMPIP-g-cotton, 1.3 ppm per day for P(AM-co-MAMPlP)-g-cotton and 0.8 ppm per day for P(MAM-co-MAMPlP)-g-cotton. It has previously been demonstrated that amine A-chloramines have better bond stability relative to amide A-chloramines, and furthermore that cyclic /V-cli Io rami lies are more stable than acyclic A-chloramines since cyclic /V-cliloramines have electron-donating alkyl groups substituted in the position adjacent to the A-chloramine group on the heterocyclic ring, which hinder dehydrochlorination and release of free chlorine.

[00192] Therefore, it is surprising that the samples copolymerized with acyclic monomers AM and MAM had slower rates of chlorine loss compared to the sample with MAMP1P alone. The higher zeta potential of PMAMPIP-g-cotton and increased hygroscopic behavior could lead to higher rates of hydrolysis under the humid 65% RH storage conditions, which would explain the lower storage stability of PMAMPIP-g-cotton relative to P(AM-co-MAMPlP)-g-cotton and P(MAM-co-MAMPlP)-g-cotton.

[00193] Example 7 - Skin Irritation

[00194] In-vitro skin irritation was evaluated using an EpiDermTM reconstructed human epidermal skin model according to the manufacturer’s instructions for solid sample testing protocol. Cytotoxicity of the A-chloramine grafted fabrics toward the EpiDermTM skin tissues was evaluated after 60 min incubation in direct contact with double-layered circular 0.32 cm ² samples. Cytotoxicity of the A-chloramine grafted cottons towards the artificial skin model was evaluated by MTT assay. [00195] Example 8 - Fabrication of antiviral polyurethane nanofibrous membrane containing A'-chloramine

[00196] (i) Introduction and Objectives

[00197] Antiviral face masks have become a topic of great interest based on concerns of cross infections and contaminated PPE. In this example, various techniques of loading N- chloramine on polyurethane nanofibers were tested through graft polymerization with a paddry-cure method, airbrush techniques, and electrospinning.

[00198] The fabrication of nanofibrous membranes uses top-bottom electrospinning techniques, to form uniform and randomly oriented nanofibers. The mechanical strength of the prepared nanofibers can be improved with layering of spun bonded polypropylene nonwoven substrate (SPP) fabric. The greater the concentration of /V-cliloramine incorporated, the higher the chlorine concentration, and thus the greater the antibacterial effectiveness.

[00199] Graft polymerized pad-dry-cured PU membranes had chlorine concentration as high as 0.225%, while airbrushed PU membranes had an average of 0.145% chlorine present. Additionally, pad-dry-cured PU had greater reduction to the selected bacteria of Escherichia coli, with 3.37-log reduction after 1 h, compared to the airbrushed PU with 2.73- log reduction.

[00200] Selected membranes underwent air permeability testing, which displayed results of poor permeability, below 8 L/min.

[00201] A need exists to reduce waste generation of face masks, while addressing concerns of contact transmissions from contaminated PPE.

[00202] The present disclosure relates to a face mask with a nanofibrous membrane loaded with A-chloramine, which has rechargeable and antiviral properties. The goal of the experiments outlined below were to achieve nanofibrous membranes with antibacterial effectiveness, high air permeability, high chlorine concentration, and fiber morphology with small fiber diameter and high porosity, for use in the medical and PPE industry. Keywords: electrospinning, polyurethane (PU), antibacterial effectiveness, chlorine concentration, scanning electron microscopy, fiber morphology, nanofibers, air permeability. [00203] In some embodiments of the present disclosure, the face mask has multiple layers, such as an inner layer, an outer layer and an intermediate layer. The inner layer may comprise an unaltered cotton fabric that is configured to contact a wearer’s nose and mouth for comfort. The outer layer may comprises an anti-viral cotton fabric stitch laminated with a thin hydrophobic polypropylene (PP) fabric (about 1 mm in thickness). The intermediate layer may define a pocket and comprise of an anti-viral nanofibrous filtering membrane that can be inserted into the pocket. The pocket may be created by stitching together at least a portion of the edges of the inner and outer layers. The thin PP fabric is included there to provide the mask with water repellency, such as minimizing strike through from droplets. The outmost layer will minimize cross-contamination. The innermost layer of the mask is to be worn next to or against the face and therefore comprises a soft inert material for providing a soft non-irritating surface.

[00204] Electrospinning is considered a cost-effective method for manufacturing nanofibrous membranes. The quality and formation of the fibers regarding porosity, and diameter can be adjusted according to electrospinning parameters, as well as the properties of the solution used in electrospinning. The polymers selected for electrospinning vary based on the application. Common polymers for electrospinning include polyacrylonitrile (PAN), polylactic acid (PLA), polypropylene terephthalate (PET), polypropylene (PP), and polyurethane (PU) and polyvinylpyrrolidone (PVP).

[00205] A study on electrospinning methods described the importance of sufficiently high molecular weight. For example, the likelihood of bead generation increased with lower molecular weights, due to chain entanglement. Additionally, the volatility of solvents was considered in the electrospinning experiments. High volatility is not suitable for spinning as it may cause the jet to solidify too soon, however, if volatility is too low the fibers will remain wet when deposited on the collector. The solvents used for polymers during electrospinning have influence on the quality of the formed fibers. Various solvents for successful electrospinning, including acetone, alcohols, dimethyl sulfoxide (DMFO), and most notably, N, 7V-di methyl formamide (DMF) and tetrahydrofuran (THF). A 7% PU with 2:1 PU: PVP solution was prepared with 1:1 DMF: THF (v/v) as well as only DMF for comparison. However, based on further study with PVP, it was determined that 7% PU formed better fiber morphology, and successfully spun with 1 :1 DMF: THF (v/v) as the selected solvent. Additionally, 7% PU without the presence of PVP formed a more uniform solution for spinning with 1 : 1 DMF : THF, rather than only DMF as the solvent.

[00206] With the spread of CO VID-19, risks of cross infection and contamination have made antiviral face masks a topic of interest. Electrospinning is a common method of fabricating nanofibers, and as such incorporating antiviral properties into PPE is often considered with this technique. Previous studies have displayed success with blending N- halamines as antibacterial agents with commonly spun polymers like PAN, PU, and PMMA.

[00207] A'-lial ami lies are a group of compounds with one or more nitrogen-halogen covalent bonds, known for their strong antimicrobial efficiency. A'-lialamiiies display strong disinfectant properties, including easy regeneration as biocidal activity for short time periods and are considered safe regarding humans and the environment. The antibacterial effectiveness related to A'-lialamiiies involves dissociation of /V-lialogeii bonds which release halogen cations with strong oxidizing properties, which in turn will destroy the structure of the cell wall of microorganisms. Commonly used halogens include chlorine and bromine. N- halamines not only display strong antibacterial properties, but the ability to regenerate antimicrobial activity. Regeneration can be achieved with exposure to a halogen source, like household bleach or a diluted sodium hypochlorite. MAMP1P (2Vl-(3- methacrylamidopropyl)-7Vl, 2V1, MO, A10-tetramethyl-A10-(2,2,6,6-tetramethylpiperidin-4- yl) decane- 1,10-diaminium) has displayed strong antibacterial effectiveness in a study conducted by (Dr. S. Liu, Professor, Department of Biosystems Engineering E2- 376 E1TC, 75A Chancellor’s Circle, Winnipeg, MB, R3T 2N2).

[00208] In this example, a cotton fabric was grafted with poly (MAMP1P) displayed a reduction of 99.94% after 5 minutes, against SARS-CoV-2 virus. Although blending N- halamines with polymer solution for electrospinning is a commonly considered technique, graft polymerization is an additional method for fabrications of nanofibrous membranes. Active chlorine concentrations and biocidal activity can be controlled through the reaction time, the selected grafting monomer, as well as the concentration of the initiator.

[00209] (iii) Materials

[00210] Polyurethane (PU), Mw = 900,000 g/mol, was purchased from The Lubrizol Corporation (Wilmington, MA, USA). Polyvinylpyrrolidone (PVP), Mw = 360, 000 g/mol, Rhodamine B, AA-dimethylformamide (DMF) and Tetrahydro furan (THF), were purchased from Sigma Aldrich (St. Louis, MO, USA). DifcoTM Luria-Bertani (LB) broth, TSA agar, and lOx phosphate -buffered saline (PBS) were purchased from Thermo Fischer Scientific (Waltham, MA, USA).

[00211] Spun bonded polypropylene non-woven substrate fabric (SPP, 42 GSM) was purchased on Amazon. Escherichia coli (E. coli, gram negative, ATCC 25922) was purchased from American Type Culture Collection (ATCC). Clorox bleach was purchased from a local grocery store.

[00212] The selected monomer MAMP1P (Al -(3- methacrylamidopropyl)-Al, Al, A10, A10-tetramethyl-A10-(2,2,6,6-tetramethylpiperidin-4-yl) decane- 1,10-diaminium), was manufactured by Alberta Research Chemicals Inc. (Edmonton, AB, CA).

[00213] (iv) Polymer Solution

[00214] A concentration of 7% polyurethane (PU) was selected, with 1 :1 DMF: THF (v/v) as the solvent. This solution was magnetically stirred (Thermo Fischer Scientific, MA, USA) at a rate of 700 rpm, for 48 h at room temperature. Using similar methods, a control solution was also prepared, which was not graft polymerized with the selected monomer of MAMP1P.

[00215] An additional polymer solution was tested, with 6.5% PU with 2:1 PU: PVP, in 1 : 1 DMF : THF (v/v) as the solvent. This solution was prepared with similar methods to the PU solution, including preparation of a control solution which was not prepared with MAMP1P.

[00216] (v) Electrospinning

[00217] Bottom-top electrospinning was conducted with an NE-300 electrospinning machine (Inovenso, 1ST, TUR). Bottom-top electrospinning includes the spinneret at the bottom of the machine, which allows the polymer solution to form a Taylor cone at the tip of the nozzle and travel upwards to a collector based on an applied voltage. The selected collector was a drum, which was covered with aluminum foil, and set to rotate at 100 rpm. This drum collector ensured that the formed fibers were smooth and uniform.

[00218] The formed fibers’ morphology is influenced by electrospinning parameters of applied voltage, tip-to-collector distance, and flow rate. It was known that an increase in applied voltage yields smaller fiber diameter, as does lower concentration of the selected polymer. For the 7% PU solution, the applied voltage (alternating current) was set to 24.50 kV, the flow rate was 1.80 mL/h, and the bar-to-collector distance was 22.8 cm. The 2:1 PU: PVP electrospun with a slightly higher voltage of 26.60 kV, flow rate of 1.80 mL/h, and bar- to-collector distance of 22.8 cm. The polymer solutions were set to electrospin for 8 mL of solution. The spun membranes were placed in the vacuum at 25 kPa pressure for a minimum of 24 h to remove any residual contents on the membranes.

[00219] (vi) Incorporation of MAMPIP

[00220] Various methods of incorporating the selected monomer of MAMPIP were tested. The efficacy of each method was determined by testing antibacterial effectiveness, the quality of the formed fibers during scanning electron microscopy (SEM), and active chlorine concentration. The methods included: airbrushing MAMPIP on both electrospun PU membranes and 2:1 PU: PVP membranes, a pad-dry-cure process of MAMPIP on a similarly prepared PU membrane, and electrospinning a 7% PU membrane with chlorinated MAMPIP. After each of the processes were complete, antibacterial effectiveness, SEM, and redox titrations were performed to determine which method was most effective.

[00221] (a) Airbrush of MAMPIP on PU and 2:1 PU: PVP Membranes (Graft

Polymerization)

[00222] The prepared solution for airbrushing included the unchlorinated monomer of MAMPIP, as well as a free radical initiator of KPS. The concentration of MAMPIP was 0.35 M, and 0.175 M of KPS was used. The molecular weight of MAMPIP used was 654.52 g/mol, and molecular weight of 273.32 g/mol of KPS. Using the airbrush, various heights and angles were tested for optimum coverage of the membrane. It was determined that 3 medium coats were most effective. These airbrushed membranes were dried for ten minutes at 60 C and cured for five minutes at 120 C. Clorox bleach was diluted to a concentration of 300 ppm, before being used in the airbrush process. The diluted bleach was sprayed on the PU and 2:1 PU: PVP membranes, so the membranes became chlorinated. After this process was complete, the chlorinated membranes were hung to dry.

[00223] (b) Pad-dry-cure of MAMPIP on PU Membrane (Graft Polymerization) [00224] The pad-dry-cure process began with similar preparations to the airbrush method. The prepared solution for soaking the membranes included the unchlorinated monomer MAMP1P, as well as a free radical initiator of KPS. Various concentrations were tested, including 0.35 M MAMP1P with 0.175 M KPS, as well as 50% MAMP1P and 50% KPS, and 25% MAMP1P and 50% KPS. The membranes were soaked for 15 minutes, before being padded. After the padding process the wet pickup was calculated by measuring the mass of the membranes after the soaking process, compared to the initial mass. After the membranes had been treated, they were dried for 10 minutes at 60 C, and cured for 5 minutes at 120 C. The membranes were first washed in ultrapure water ten times, before being chlorinated with Clorox bleach, with a diluted concentration of 300 ppm. The membranes were again washed with ultrapure water ten times, before being hung to dry.

[00225] (c) Electrospinning of Chlorinated MAMPIP with PU Membrane

[00226] This process differed from the previous methods of incorporating the selected monomer. Rather than electrospinning 7% PU before incorporating MAMPIP, the selected monomer and polymer are electrospun simultaneously. The polymer solution of 7% PU was prepared as previously described. Following this process, chlorinated MAMPIP was added with a 10:1 mass ratio of polymer to monomer. This solution was magnetically stirred at 700 rpm at room temperature, until the monomer was considered fully combined. The same electrospinning parameters were used, with 1.80 mL/h flow rate, 24.50 kV applied voltage, and 22.8 cm bar-to-collector distance. This prepared membrane was placed in the vacuum at 25 kPa pressure for 24 h to remove any residual content.

[00227] (vii) Fiber Antibacterial Effectiveness

[00228] The antibacterial effectiveness was determined through antibacterial testing with Escherichia coli (E. coli, gram-negative). This process began with LB broth and LB and TS agar (TSA) prepared in ultrapure water, which were then autoclaved for a 30-minute liquid cycle at 121 C. The TSA plates were poured with approximately 3 mm thickness and were solidified and stored in the fridge. The E. coli were cultured on an LB agar plate at 37 C for 24 h. The bacterial colonies were transferred from the plate to tubes via an inoculation loop, until the suspension reached 0.5 McFarland density. Two serial dilutions of 10-x and 100-x were performed by adding 0.10 mL of the bacterial suspension to 0.90 mL of PBS. From the 100-x dilution, 7 LIL of the solution were added to the LB broth, and incubated for 18 h at 37 C.

[00229] The plate counting method was used to determine the antibacterial effectiveness of the prepared membranes. Three 1 x 1 cm samples were cut for each of the selected samples for testing, as well as the control samples which did not contain the selected monomer of MAMP1P. 10 pL of the prepared suspension of E. coli was dropped on the centre of each of the membranes. The selected treatment periods included 30 and 60 minutes.

[00230] After the treatment periods were completed, various elution methods were tested. These methods included a vortex, sonication, and a titer shaker. The titer shaker method involved quenching the membranes with 1 mL of 0.03% thiosulfate ten times, to ensure that no further bacterial reduction took place. The membranes were then placed on the titer shaker for 10 minutes, which was at a temperature of 37 C in the incubator.

[00231] The sonication method began with similar methods to quench the membranes. After the quenching process was complete, the membranes were transferred to tubes along with the 1 mL of 0.03% thiosulfate. An additional 1 mL of thiosulfate was added to the wells where the quenching process took place and was transferred to the same tube. This process ensured that no residual thiosulfate, or membrane was left in the wells. The tubes were briefly vortexed before being placed in the sonicator for 2 minutes. The vortex method had similar preparation methods for the tubes, before being placed on the vortex for 2 minutes.

[00232] The percentage of each method compared to the inoculation was calculated, to determine which elution method was most effective. The results for the titer shaker method were 50.272%, for the vortex were 94.823%, and for sonication were 101.226%. The sonication value being slightly over 100% implies lost solution during transfer, or pipetting errors. However, the value is significantly higher in percentage than the other methods, and therefore the sonication was the selected elution method for antibacterial testing.

[00233] Three serial dilutions were made from the original culture, such that four different dilutions could be plated in different quadrants. The dilutions were made by adding 30 LIL of the previous solution to 270 LIL PBS. Using the drop plating technique, 50 LIL of each of the dilutions was plated on the corresponding quadrant on TSA agar plates. After the plating process was complete, the plates were left in the incubator for 18 h, at a temperature of 37 C. The bacterial reduction was calculated by counting the bacterial colonies on each of the plates after the incubation period. The bacterial reduction values were calculated and expressed as log reduction values. The equation used was as follows:

Bacterial reduction [log] = log(a/b)

Where a = concentration of bacteria from the control (no MAMP1P) b = concentration of bacteria from membrane with MAMP1P

[00234] As previously described, the plate counting method was used to measure the antibacterial effectiveness of the selected membranes. For each agar plate, the bacteria colonies were counted in the quadrant with the highest countable number.

[00235] Table 11. Results of antibacterial effectiveness for airbrushed and pad-dry- cured PU after 30- and 60- minute treatment periods, as well as airbrushed PU with 2:1 PU: PVP.

[00236] The bacteria testing results displayed that the pad-dry-cured PU membranes with higher MAMP1P concentration had significantly higher antibacterial effectiveness. It was also determined that the airbrushed PU membrane had greater reduction than the 25%

MAMPIP (0.35 M) pad-dry-cured membrane. This is most likely due to the higher concentration of MAMPIP used in the airbrushing, which was 0.35 M MAMPIP and 0.175 KPS.

[00237] (viii) Scanning Electron Microscopy (SEM) [00238] The fiber morphology was determined with scanning electron microscopy (SEM, FE1 Talos F200X S/TEM, Thermo Fischer Scientific, MA, USA). With use of SEM, the fibers were analyzed regarding porosity, average fiber diameter, and the quality of the formed fibers. This process began with placing approximately 0.5 x 0.5 cm of the prepared membranes on SEM slide mounts, with carbon tape. After this process, the membranes were sputter coated in gold palladium, and were ready for SEM analysis.

[00239] (ix) lodimetric Thiosulfate Titration

[00240] lodimetric thiosulfate titrations were performed for quantification of the active chlorine concentrations of the PU membranes with MAMP1P. The selected titrant was iodine, with concentration of 0.0002 N. This process began by measuring the mass of the chlorinated PU membranes, with values of approximately 0.05 g. After the measurements, the membranes were cut into small pieces, and combined in 5 mL of sodium thiosulfate, in beakers. The beakers were placed on the titre shaker for 3 h and were covered with aluminum foil to address concerns with light sensitivity. 30 mL of ultrapure water and 2 mL of 5% acetic acid were added to the same beakers, such that the titration process could begin. This solution was titrated using a redox electrode (Orion 5 Star DO Benchtop, Thermo Fischer Scientific, MA, USA). To determine the completion of the titration, the increase in voltage was monitored throughout the titration. The volume of iodine solution needed for the titration was determined with similar methods, with 5 mL of sodium thiosulfate. The active chlorine concentration, expressed as a percentage was calculated with the following equation:

C7 (+) [%] = ((35.45/2) *(1000*(V2-Vl) *N)/W))/10000

Where N = 0.0002 N (normality of iodine solution) [N]

VI and V2 = volumes of iodine solutions consumed in titration with MAMP1P present, and without (the control) [L]

W = weight of membrane [g]

[00241] The active chlorine concentration was quantified based on titrations, with the thiosulfate method. The results displayed the active chlorine concentration was significantly higher for the pad-dry-cured PU membranes, with higher concentrations of MAMP1P. Attached below is a table with the results from the performed titrations, including the airbrushed and pad-dry-cured membranes, as well as the various concentrations of MAMP1P.

[00242] Table 12. Results of average active chlorine concentrations, for airbrushed and pad-dry-cured membranes, based on titrations.

[00243] The lower chlorine concentration in the 2:1 PU: PVP suggests that the MAMP1P leached out of the membrane, leading to not only lower chlorine content, but less antibacterial effectiveness. To evaluate this, the wet pickup percentage for this membrane was measured after two separate soaks in the prepared MAMP1P and KPS. After the first soak, the membrane measured a wet pickup percentage of 174%, and after the second was 144%. Based on this lower wet pickup, alongside the lower antibacterial effectiveness, and chlorine content, the 2: 1 PU: PVP was not considered for future experiments.

[00244] Both the airbrushed and pad-dry-cured PU membranes with higher MAMP1P concentrations displayed significantly higher chlorine concentration than the pad-dry-cured PU with 25% MAMP1P, 50% KPS. These titration results aligned with the antibacterial effectiveness testing. The greatest bacterial reduction was 0.35 M MAMP1P pad-dry-cured PU, while the lowest effectiveness was the 25% MAMP1P pad-dry-cured PU.

[00245] (x) Incorporation of Spun Bonded Polypropylene Non-Woven Substrate

(SPP) Fabric

[00246] Based on the limited mechanical strength of nanofibrous membranes, spun bonded polypropylene non-woven substrate (SPP) fabric was incorporated into the preparation of PU. A selected thickness of 42 GSM was used in electrospinning with 7% PU (1:1 DMF: THF). Various sources used SPP as a layering fabric, to improve the mechanical properties of nanofibers. [00247] The electrospinning process with 7% PU (1:1 DMF: THF) as the solution, used the same parameters when SPP was used as the collector, as a replacement for aluminum foil. The applied voltage was 24.50 kV, the bar-to-collector distance was 22.8 cm, and the flow rate was 1.80 mL/h. To monitor how the fibers collected, Rhodamine B was combined with the prepared PU solution.

[00248] The SEM results displayed that in general, airbrushed membranes had larger porosity, and smaller fiber diameter. The PU membranes airbrushed with fewer coats, as well as the pad-dry-cured membranes with lower concentrations of MAMP1P yielded stronger fiber morphology. The porosity was closely observed, based on the applications. Although the higher chlorine concentration, and higher antibacterial effectiveness is critical for actively killing the viral and bacterial particles, the breathability of the membrane should not be compromised. The nanofibrous membrane with stronger antibacterial properties was the 7% PU pad-dry-cured with the highest MAMP1P concentration, of 0.35 M, with 0.175 M KPS. However, this membrane displayed extremely low porosity, which is not effective for applications in face masks.

[00249] As seen by FIG. 20B compared to FIG. 20A, the fiber morphology improved with lower concentrations of MAMP1P. An additional sample was created, which was treated with water in replacement of MAMP1P, to determine if fiber swelling was based on the monomer. The water treated membranes had better porosity and smaller fiber diameter as shown in FIG. 20C and FIG. 20D, with a range of diameters between 755-942 nm. However, the porosity was larger for the membranes treated with water via airbrush, rather than the pad-dry-cure method. In comparison, the pad-dry-cured membranes as seen in FIGs. 14A and 14B had significantly larger diameter, of up to 2.500 pm. The pad-dry-cured membranes with lower concentrations of MAMP1P displayed better fiber diameter and porosity. However, the diameter was still large, with a range between 709.7 nm to 1.416 pm. Additionally, the lower chlorine concentration displayed lower antibacterial effectiveness, and the airbrushes method had better fiber morphology and antibacterial properties. Based on the SEM results, the deformation of the fibers can be attributed to the pad-dry-cure process associated with MAMP1P. See also FIG. 20E showing 7% PU pad-dry-cured, 25% MAMP1P, 50% KPS and FIG. 20F showing 7% PU airbrushed with 3 medium coats of MAMP1P. [00250] The airbrushed PU samples displayed smaller fiber diameters, and larger porosity compared to the pad-dry-cured PU. However, the overall porosity was too low for all the prepared membranes for biomedical applications such as medical face masks.

[00251] (xi) Air Permeability Testing

[00252] The air flow resistance of selected membranes and SPP were tested with a Frazier differential pressure air permeability tester (Frazier Precision Instrument Co. Inc. Hagerstown, MD. U.S.A). SPP of both 60 and 42 GSM was tested, as well as PU spun on SPP to analyze the influence of nanofibers on the air permeability. Additionally, the pad-dry- cured PU membrane with 25% MAMPIP and 50% KPS (0.35 M MAMPIP, 0.175 KPS) was tested. The readings were based on Meriam red oil, with each graduation being equivalent to 1/100 inches of water pressure.

[00253] The results displayed that the air permeability was extremely low for all samples involving spun PU. This included both SPP with PU spun directly on the fabric, as well as the pad-dry-cured PU membrane. As displayed in the SEM results, the prepared paddry-cured PU membrane was not entirely uniform, and the porosity was extremely low. These results aligned with the air permeability values for pad-dry-cured PU, with the highest permeability value being 0.985 cm ³ /cm2/s, and the lowest value being below 0.267 cm ³ /cm2/s. The SPP fabric displayed dramatically different permeability values with the spun PU, which confirmed the thickness of the collected fibers.

[00254] Table 13. Results of average rates of flow of air using Frazier differential pressure air permeability tester, for selected membranes and fabrics. [00255] Face masks for wear in medical applications and the public, should have air permeability greater than 8 L/min. Therefore, these prepared membranes are not considered acceptable based on air permeability.

[00256] This Example displays three methods of incorporating the selected N- chloramine MAMP1P on polyurethane membranes, through electrospinning techniques and graft polymerization. These membranes were measured according to active chlorine concentration, antibacterial effectiveness, air permeability, and fiber morphology. Testing included redox titrations with the thiosulfate method, bacteria testing with the plate counting method of selected bacterium E. coli, SEM analysis, and air permeability testing with a Frazier differential air pressure permeability tester. The results display that membranes prepared with greater MAMP1P concentrations had higher active chlorine content, and therefore stronger antibacterial activity. The pad-dry-cured PU with 0.35 M MAMP1P and 0.175 M KPS displayed the strongest antibacterial effectiveness, with 0.225% chlorine concentration and 3.37-log reduction after 1 h. When the concentration of MAMP1P was lowered to 25% MAMP1P, 50% KPS with this same method, the fiber morphology improved. However, this adjustment lowered the active chlorine concentration to 0.0733%, and the bacteria reduction was lowered to 1.64-log after 1 h. Air permeability testing confirmed results from SEM of poor porosity for the pad-dry-cured PU membrane, with air flow no higher than 0.985 cm ³ /cm2/s. The airbrushed PU displayed smaller fiber diameter and larger porosity under SEM analysis. The chlorine concentration for airbrushed PU was lower than pad-dry-cured methods of the same MAMP1P concentration, with 0.145% chlorine concentration and 2.73-log reduction after 1 h. Additionally, air permeability was significantly reduced on SPP fabrics with the inclusion of PU fibers. In summary, higher MAMP1P concentrations with pad-dry-cure methods compromised the fiber morphology, while using the same MAMP1P concentration with airbrush techniques displayed better antibacterial effectiveness and chlorine concentration, with smaller fiber diameter and higher porosity.