RECOMBINANT AAV GENE THERAPY FOR NGYL1 DEFICIENCY

RELATED APPLICATION

This application claims the benefit of the filing date of U.S. Provisional Application No. 62/833,178, entitled“RECOMBINANT AAV GENE THERAPY FOR NGYL1 DEFICIENCY” filed on April 12, 2019, the entire contents of which are incorporated by reference herein in its entirety.

BACKGROUND OF INVENTION

NGLY1 (TV-glycanase 1, also known as peptide-A-asparagine amidase or PNGase) is a deglycosylating enzyme that removes A-gl yeans from glycoproteins. NGLY 1 deficiency, caused by loss-of-function mutations in the NGLY1 gene, is an ultra-rare genetic disorder. Patients suffer from developmental delay, low muscle tone, seizures, lack of tears, elevated liver transaminases in childhood, and movement disorder. There are currently no treatment options available other than supportive care.

SUMMARY OF INVENTION

Aspects of the disclosure relate to a gene replacement therapy to restore NGLY 1 function primarily in the central nervous system (CNS), which is useful for alleviating associated disease symptoms of NGLY1 deficiency. According to some aspects, the disclosure provides compositions and method for promoting expression of functional NGLY 1 protein in a subject. In some aspects, the disclosure provides methods of treating a subject having NGLY 1 deficiency.

In some embodiments, the methods involve administering to the subject an effective amount of an rAAV comprising a capsid containing a nucleic acid engineered to express NGLY1, e.g., in the central nervous system (CNS) of a subject. In some embodiments, the subject comprises at least one endogenous NGLY 1 allele having a loss-of-function mutation associated with NGLY 1 deficiency (OMIM: 610661). In some embodiments, the at least one endogenous NGLY1 allele comprises a frameshift mutation in exon 12. In some embodiments, the at least one endogenous NGLY 1 allele comprises a splice site mutation, a missense mutation, a truncation mutation or a nonsense mutation. In some embodiments, the subject has two NGLY1 alleles having the same loss-of-function mutations (homozygous state). In some embodiments, the subject has two NGLY1 alleles having different loss-of-function mutations (compound heterozygous state).

In some embodiments, the at least one endogenous NGLY 1 allele comprises a nonsense mutation in exon 8 resulting in an Arg401-to-Ter (e.g., stop codon) (R401X) substitution. In some embodiments, the at least one endogenous NGLY 1 allele comprises a frameshift mutation resulting from a 1-bp deletion (c.l891delC). In some embodiments, the at least one endogenous NGLY1 allele comprises a C.1201A-T transversion in exon 8 resulting in an Arg401-to-Ter (e.g., stop codon) (R401X) substitution. In some embodiments, the at least one endogenous NGLY1 allele comprises a 1-bp duplication (c.l370dupG) in exon 9, resulting in a frameshift and premature termination (Arg458fsTer). In some embodiments, the at least one endogenous NGLY1 allele comprises a 3-bp deletion (c.l205_1207delTTC), resulting in the deletion of 1 amino acid residue (402del). In some embodiments, the at least one endogenous NGLY1 allele comprises a C.1570C-T transition, resulting in an Arg542-to-Ter (e.g., stop codon) (R542X) substitution.

In some embodiments, administration of the rAAV is by systemic injection. In some embodiments, administration of the rAAV is by intrathecal or intravascular (e.g.. intravenous) injection.

In some embodiments, the rAAV comprises a capsid that is an AAV9 capsid or an AAVPHP.B capsid.

In some embodiments, the rAAV comprises a nucleic acid that is engineered to express a codon-optimized human NGLY1 gene. In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 1. In some embodiments, the nucleic acid comprises one or more ITRs, wherein each ITR is selected from the group consisting of AAV1 ITR, AAV2 ITR, AAV3 ITR, AAV4 ITR, AAV5 ITR, and AAV6 ITR. In some embodiments, the nucleic acid sequence encoding the NGLY 1 is flanked by AAV ITRs. In some embodiments, the nucleic acid is a self-complementary AAV vector.

Some aspects of the disclosure provide an rAAV comprising an AAV9 or AAVPHP.B capsid containing a nucleic acid engineered to express NGLY1, e.g., in the CNS of a subject. In some embodiments, the nucleic acid is engineered to express a codon-optimized human NGLY 1 gene. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 1. Some aspects of the disclosure provide a pharmaceutical composition comprising an rAAV comprising an AAV9 or AAVPHP.B capsid containing a nucleic acid engineered to express NGLY1.

Some aspects of the disclosure provide an isolated nucleic acid comprising the sequence set forth by SEQ ID NO: 1. In some embodiments, an isolated nucleic acid comprises a promoter operably linked to the sequence set forth by SEQ ID NO: In some embodiments, the promoter is a CB6 promoter. In some embodiments, the promoter is a JeT promoter.

Some aspects of the disclosure provide a host cell comprising an isolated nucleic acid construct as described herein ( e.g an isolated nucleic acid encoding an NGLY1 protein). In some embodiments, the cell is a eukaryotic cell. In some embodiments, the host cell further comprises an isolated nucleic acid encoding an AAV capsid protein. In some embodiments, the capsid protein is AAV9 or AAVPHP.B capsid protein.

BRIEF DESCRIPTION OF DRAWINGS

FIGs. 1A-1B. Constructs expressing NGLY1 and their expression in NGLYl-null mouse embryonic fibroblasts (MEFs). FIG. 1A depicts two constructs expressing the same codon- optimized human NGLY 1 cDNA, driven by the CMV/CB promoter or JeT promoter, respectively. FIG. IB shows a western blot and quantification showing NGFY1 expression following transfection in NFYGl-null MEFs with plasmids.

FIGs. 2A-2B. Quantification of in vivo gene delivery to CNS and peripheral tissues of wild-type mice by droplet digital PCR (ddPCR). FIG. 2A shows rAAV genome biodistribution. FIG. 2B shows transgene expression. Each dot represents the tissue from one animal (n=4).

FIGs. 3A-3B. Western blot showing NGFY1 expression in various tissues of rAAV- treated NGFY1 knockout mice. FIG. 3A shows peripheral tissues including liver, heart and tibialis anterior (TA) muscle. FIG. 3A shows central nervous system tissues including hippocampus, cortex, thalamus, and spinal cord.

FIG. 4. Fiver function test. Wild-type mice were treated by tail vein injection with rAAV vectors expressing codon-optimized human NGFY1. Alanine aminotransferase (AFT) and aspartate aminotransferase (AST) expression levels in the serum were measured at 1, 2, and 3 weeks post- injection. Untreated mice serve as controls. rAAV vector treatment is associated with mild and transient elevation of transaminases. FIGs. 5A-5C. Transgene expression in mouse tissues following rAAV delivery validated by RNAScope. Wild-type mice were treated by tail vein injection with rAAV vectors expressing codon-optimized human NGLY1. Four weeks later, the mice were euthanized and the tissues were subjected to RNAScope analysis to detect the codon-optimized human NGLY 1 mRNA (darkened signals) in the liver (FIG. 5A), thalamus (FIG. 5B), and cerebellum (FIG. 5C).

FIG. 6. Western blot showing NGLY1 expression and quantification of NGLY1 activity. NGLY 1 protein expression and activity were restored in the liver of mice having a NGLY 1 knockout (-/-) following treatment with an rAAV expressing codon-optimized human NGLY1.

DETAILED DESCRIPTION OF INVENTION

According to some aspects, nucleic acid constructs are provided that express a codon- optimized human NGLY1 cDNA. Recombinant AAVs were developed ( e.g ., using AAV9 or AAVPHP.B capsids) that contain the nucleic acid constructs for the treatment of NGLY 1 deficiency. In some embodiments, the nucleic acid constructs were configured as self complementary AAV vectors. In some embodiments, the rAAVs were configured to achieve delivery to CNS and/or peripheral tissues, e.g., via intravascular injection.

Isolated nucleic acids

In some aspects, the disclosure provides a nucleic acid comprising at least one transgene operably linked to a promoter, wherein the transgene encodes NGLY 1 (N-glycanase 1; GENE ID: 55768). The NGLY1 gene encodes N-glycanase (EC 3.5.1.52), a highly conserved enzyme that catalyzes deglycosylation of misfolded N-linked glycoproteins by cleaving the glycan chain before the proteins are degraded by the proteasome. NGLY 1 is a cytoplasmic component of the endoplasmic reticulum- associated degradation (ERAD) pathway that identifies and degrades misfolded glycoproteins.

The NGLY 1 gene may encode an mRNA having the nucleotide sequence of

NM_001145293.1, NM_001145294.1, NM_001145295.1, or NM_018297.4. The NGLY1 gene may encode a protein having the amino acid sequence NP_001138765.1, NP_001138766.1, NP_001138767.1 or NP_060767.2. In some embodiments, the NGLY 1 gene is codon-optimized (e.g., codon-optimized for expression in mammalian, such as human, cells). Sequences corresponding to all GenBank accession numbers described in the disclosure are incorporated herein by reference in their entirety. In some embodiments, an isolated nucleic acid encoding NGLY1 comprises the sequence as follows:

ATGGCCGCTGCTGCCCTGGGATCATCAAGTGGGTCCGCTTCACCTGCCGTCGCCGAA

CTGTGCCAGAACACCCCCGAAACCTTCCTGGAGGCCTCCAAGCTGCTGCTGACCTAC

GCCGACAACATCCTGCGCAATCCAAACGATGAGAAGTATCGCTCCATCAGGATCGG

CAATACCGCCTTCTCTACAAGGCTGCTGCCCGTGAGGGGAGCAGTGGAGTGCCTGT

TCGAGATGGGCTTTGAGGAGGGCGAGACACACCTGATCTTTCCCAAGAAGGCCAGC

GTGGAGCAGCTGCAGAAGATCAGGGACCTGATCGCCATCGAGAGAAGCTCCCGGCT

GGATGGCTCTAACAAGAGCCACAAGGTGAAGTCTAGCCAGCAGCCTGCAGCAAGC

ACACAGCTGCCTACCACACCATCCTCTAATCCATCCGGCCTGAACCAGCACACCAG

GAATAGACAGGGACAGAGCTCCGACCCACCTAGCGCCTCCACAGTGGCAGCCGATT

CTGCCATCCTGGAGGTGCTGCAGAGCAACATCCAGCACGTGCTGGTGTACGAGAAT

CCAGCCCTGCAGGAGAAGGCCCTGGCATGCATCCCAGTGCAGGAGCTGAAGCGGA

AGAGCCAGGAGAAGCTGTCCAGGGCAAGGAAGCTGGACAAGGGCATCAATATCAG

CGACGAGGATTTCCTGCTGCTGGAGCTGCTGCACTGGTTTAAGGAGGAGTTCTTTCA

CTGGGTGAACAATGTGCTGTGCTCCAAGTGTGGCGGCCAGACCAGGAGCAGAGATC

GGTCCCTGCTGCCTTCTGACGATGAGCTGAAGTGGGGCGCCAAGGAGGTGGAGGAC

CACTACTGCGATGCCTGTCAGTTCTCCAACCGCTTTCCCAGGTATAACAATCCTGAG

AAGCTGCTGGAGACAAGATGCGGCCGGTGTGGCGAGTGGGCCAATTGTTTCACACT

GTGCTGTAGAGCCGTGGGCTTTGAGGCCAGATACGTGTGGGACTATACCGATCACG

TGTGGACAGAGGTGTACTCTCCCAGCCAGCAGAGATGGCTGCACTGCGACGCCTGT

GAGGACGTGTGCGATAAGCCTCTGCTGTACGAGATCGGCTGGGGCAAGAAGCTGTC

TTATGTGATCGCCTTCAGCAAGGACGAGGTGGTGGATGTGACCTGGCGGTATAGCT

GTAAGCACGAGGAAGTGATCGCCAGGAGAACCAAGGTGAAGGAGGCCCTGCTGCG

CGACACAATCAATGGCCTGAACAAGCAGAGGCAGCTGTTCCTGTCCGAGAACCGGC

GCAAGGAGCTGCTGCAGAGGATCATCGTGGAGCTGGTGGAGTTTATCTCTCCTAAG

ACCCCAAAGCCAGGAGAGCTGGGAGGAAGGATCTCCGGCTCTGTGGCCTGGCGCGT

GGCCAGGGGCGAGATGGGCCTGCAGAGGAAGGAGACACTGTTCATCCCATGCGAG

AACGAGAAGATCTCTAAGCAGCTGCACCTGTGCTACAATATCGTGAAGGACAGATA

TGTGCGGGTGTCCAACAATAACCAGACCATCTCTGGCTGGGAGAACGGCGTGTGGA

AGATGGAGAGCATCTTTAGAAAGGTGGAGACAGATTGGCACATGGTGTACCTGGCC

CGGAAGGAGGGCTCTAGCTTCGCCTATATCAGCTGGAAGTTTGAGTGTGGCTCCGT GGGCCTGAAGGTGGACAGCATCTCCATCAGAACCTCCTCTCAGACATTCCAGACCG

GCACAGTGGAGTGGAAGCTGCGGTCCGATACCGCCCAGGTGGAGCTGACAGGCGA

CAATTCCCTGCACTCTTACGCCGATTTCTCTGGCGCCACCGAAGTGATCCTGGAGGC

AGAGCTGAGCAGGGGCGACGGCGATGTGGCCTGGCAGCACACACAGCTGTTTAGGC

AGAGCCTGAACGACCACGAGGAGAATTGCCTGGAGATTATTATCAAGTTTTCCGAC

CTGTGA (SEQ ID NO: 1).

In some embodiments, the nucleic acid sequence encoding NGLY1 comprises at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence encoding NGLY 1 gene comprises up to 20 nucleotides that are different from the NGLY 1 gene set forth in SEQ ID NO: 1. In some embodiments, the NGLY1 gene comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides that are different from the NGLY1 gene set forth in SEQ ID NO: 1. In some embodiments, the nucleic acid sequence encoding NGLY 1 gene comprises more than 20 nucleotides that are different from the NGLY 1 gene set forth in SEQ ID NO: 1.

In some embodiments, the nucleic acid sequence encoding NGLY1 comprises insertions relative to SEQ ID NO: 1. In some embodiments, the nucleic acid sequences encoding NGLY1 comprises insertions relative to SEQ ID NO: 1 that do not introduce a frameshift mutation. In some embodiments, an insertion in the nucleic acid sequence relative to SEQ ID NO: 1 involves the insertion of multiples of 3 nucleotides ( e.g ., 3, 6, 9, 12, 15, 18, etc.). In some embodiments, an insertion in the nucleic acid sequence relative to SEQ ID NO: 1 leads to an increase in the total number of amino acid residues in the resultant NGLY 1 protein (e.g., an increase of 1-3, 1- 5, 3-10, 5-10, 5-15, or 10-20 amino acid residues).

In some embodiments, the nucleic acid sequence encoding NGLY1 comprises deletions relative to SEQ ID NO: 1. In some embodiments, the nucleic acid sequences encoding NGLY1 comprises deletions relative to SEQ ID NO: 1 that do not introduce a frameshift mutation. In some embodiments, an deletion in the nucleic acid sequence relative to SEQ ID NO: 1 involves the deletion of multiples of 3 nucleotides (e.g., 3, 6, 9, 12, 15, 18, etc.). In some embodiments, a deletion in the nucleic acid sequence relative to SEQ ID NO: 1 leads to an decrease in the total number of amino acid residues in the resultant NGLY 1 protein (e.g., a decrease of 1-3, 1-5, 3- 10, 5-10, 5-15, or 10-20 amino acid residues). In some embodiments, the nucleic acid sequence encoding NGLY1 is a codon-optimized sequence ( e.g ., codon optimized for expression in mammalian cells). In some embodiments, a codon-optimized sequence encoding NGLY1 comprises reduced GC content relative to a wild- type sequence that has not been codon-optimized. In some embodiments, a codon-optimized sequence encoding NGLY1 comprises a 1-5%, 3-5%, 3-10%, 5-10%, 5-15%, 10-20%, 15-30%, 20-40%, 25-50%, or 30-60% reduction in GC content relative to a wild-type sequence that has not been codon-optimized. In some embodiments, a codon-optimized sequence encoding NGLY1 comprises fewer guanine and/or cytosine nucleobases relative to a wild-type sequence that has not been codon-optimized. In some embodiments, a codon-optimized sequence encoding NGLY1 comprises 1-5, 3-5, 3-10, 5-10, 5-15, 10-20, 15-30, 20-40, 25-50, or 30-60 fewer guanine and/or cytosine nucleobases relative to a wild-type sequence that has not been codon-optimized. In some embodiments, a codon-optimized sequence encoding NGLY1 comprises fewer CpG dinucleotide islands relative to a wild-type sequence that has not been codon-optimized. In some embodiments, a codon-optimized sequence encoding NGLY 1 comprises 1-3, 3-5, 3-10, 5-10, 5-15, 10-20, 15-30, 20-40, 25-50, or 30-60 fewer CpG dinucleotide islands relative to a wild-type sequence that has not been codon-optimized.

An isolated nucleic acid encoding a NGLY 1 protein is generally operably linked to a promoter. As used herein,“operably linked” refers to a promoter that is linked to and promotes expression of a downstream transgene. In some embodiments, the promoter is a constitutive promoter, for example a chicken beta-actin (CBA) promoter, a retroviral Rous sarcoma vims (RSV) LTR promoter (optionally with the RSV enhancer), a cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et ah, Cell, 41:521-530 (1985)], a SV40 promoter, a dihydrofolate reductase promoter, a b-actin promoter, a phosphoglycerol kinase (PGK) promoter, or an EFla promoter [Invitrogen] . In some embodiments, a promoter is an enhanced chicken b-actin promoter. In some embodiments, a promoter is a U6 promoter. In some embodiments, the promoter is a CB6 promoter. In some embodiments, the promoter is a JeT promoter.

In some embodiments, a promoter is an inducible promoter. Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex) -inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); the ecdysone insect promoter (No et ah, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.

In another embodiment, the native promoter for the transgene (e.g., NGLY 1) will be used. The native promoter may be preferred when it is desired that expression of the transgene should mimic the expression of a native wild-type NGLY 1 gene (e.g., a non-mutated NGLY 1 gene). The native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.

In some embodiments, the promoter drives transgene expression in neuronal tissues. In some embodiments, the disclosure provides a nucleic acid operably comprising a tissue-specific promoter operably linked to a transgene. As used herein,“tissue- specific promoter” refers to a promoter that preferentially regulates (e.g., drives or up-regulates) gene expression in a particular cell type relative to other cell types. A cell-type-specific promoter can be specific for any cell type, such as central nervous system (CNS) cells, liver cells (e.g., hepatocytes), heart cells, muscle cells, etc.

Lurther examples of tissue-specific promoters include but are not limited to a liver- specific thyroxin binding globulin (TBG) promoter, an insulin promoter, a creatine kinase (MCK) promoter, a a-myosin heavy chain (a-MHC) promoter, or a cardiac Troponin T (cTnT) promoter. Other exemplary promoters include Beta-actin promoter, hepatitis B virus core - Si - promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner.

Res., 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998), and the immunoglobulin heavy chain promoter, among others which will be apparent to the skilled artisan.

As used herein, the term“hybrid promoter” refers to a regulatory construct capable of driving transcription an RNA transcript (e.g., a transcript comprising encoded by a transgene) in which the construct comprises two or more regulatory elements artificially arranged. Typically, a hybrid promoter comprises at least one element that is a minimal promoter and at least one element having an enhancer sequence or an intronic, exonic, or UTR sequence comprising one or more transcriptional regulatory elements. In embodiments in which a hybrid promoter comprises an exonic, intronic, or UTR sequence, such sequence(s) may encode upstream portions of the RNA transcript while also containing regulatory elements that modulate (e.g., enhance) transcription of the transcript. In some embodiments, two or more elements of a hybrid promoter are from heterologous sources relative to one another. In some embodiments, a hybrid promoter comprises a first sequence from the chicken beta-actin promoter and a second sequence of the CMV enhancer. In some embodiments, a hybrid promoter comprises a first sequence from a chicken beta-actin promoter and a second sequence from an intron of a chicken-beta actin gene. In some embodiments, a hybrid promoter comprises a first sequence from the chicken beta-actin promoter fused to a CMV enhancer sequence and a sequence from an intron of the chicken-beta actin gene. In some embodiments, a hybrid promoter comprises a CB6 promoter. In some embodiments, a hybrid promoter comprises a JeT promoter.

In some aspects, the disclosure relates to isolated nucleic acids comprising a transgene (e.g., NGLY 1) operably linked to a promoter via a chimeric intron. In some embodiments, a chimeric intron comprises a nucleic acid sequence from a chicken beta-actin gene, for example a non-coding intronic sequence from intron 1 of the chicken beta-actin gene. In some

embodiments, the intronic sequence of the chicken beta-actin gene ranges from about 50 to about 150 nucleotides in length (e.g., any length between 50 and 150 nucleotides, inclusive). In some embodiments, the intronic sequence of the chicken beta-actin gene ranges from about 100 to 120 (e.g., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120) nucleotides in length. In some embodiments, a chimeric intron is adjacent to one or more untranslated sequences ( e.g ., an untranslated sequence located between the promoter sequence and the chimeric intron sequence and/or an untranslated sequence located between the chimeric intron and the first codon of the transgene sequence). In some

embodiments, each of the one or more untranslated sequences are non-coding sequences from a rabbit beta- globulin gene (e.g., untranslated sequence from rabbit beta- globulin exon 1, exon 2, etc.).

In some embodiments, the rAAV comprises a posttranscriptional response element. As used herein, the term“posttranscriptional response element” refers to a nucleic acid sequence that, when transcribed, adopts a tertiary structure that enhances expression of a gene. Examples of posttranscriptional regulatory elements include, but are not limited to, woodchuck hepatitis vims posttranscriptional regulatory element (WPRE), mouse RNA transport element (RTE), constitutive transport element (CTE) of the simian retrovirus type 1 (SRV-1), the CTE from the Mason-Pfizer monkey vims (MPMV), and the 5' untranslated region of the human heat shock protein 70 (Hsp70 5'UTR). In some embodiments, the rAAV vector comprises a woodchuck hepatitis vims posttranscriptional regulatory element (WPRE).

In some embodiments, the vector further comprises conventional control elements which are operably linked with elements of the transgene in a manner that permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the vims produced by the disclosure. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals;

sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A number of expression control sequences, including promoters which are native, constitutive, inducible and/or tissue-specific, are known in the art and may be utilized.

A polyadenylation sequence generally is inserted following the transgene sequences and optionally before a 3' AAV ITR sequence. A rAAV constmct useful in the disclosure may also contain an intron, desirably located between the promoter/enhancer sequence and the transgene. One possible intron sequence is derived from SV-40, and is referred to as the SV-40 T intron sequence. Another vector element that may be used is an internal ribosome entry site (IRES).

An IRES sequence is used to produce more than one polypeptide from a single gene transcript. An IRES sequence would be used to produce a protein that contain more than one polypeptide chains. Selection of these and other common vector elements are conventional and many such sequences are available [see, e.g., Sambrook et al., and references cited therein at, for example, pages 3.18 3.26 and 16.17 16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989].

Recombinant AA Vs

The isolated nucleic acids of the disclosure may be recombinant adeno-associated viruses (rAAVs) vectors. rAAV vectors of the disclosure are typically composed of, at a minimum, a transgene and its regulatory sequences, and 5' and 3' AAV inverted terminal repeats (ITRs). It is this recombinant AAV vector which is packaged into a capsid protein and delivered to a selected target cell. In some embodiments, the transgene is a nucleic acid sequence, heterologous to the vector sequences, which encodes a polypeptide, protein, functional RNA molecule or other gene product, of interest. The nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and/or expression in a cell of a target tissue.

In some embodiments, an isolated nucleic acid as described by the disclosure comprises a region (e.g., a first region) comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof and a second region comprising a transgene encoding NGLYE The isolated nucleic acid (e.g., the recombinant AAV vector) may be packaged into a capsid protein and administered to a subject and/or delivered to a selected target cell. The transgene may also comprise a region encoding, for example, a protein and/or an expression control sequence (e.g., a poly-A tail), as described elsewhere in the disclosure.

The instant disclosure provides a vector comprising a single, cis-acting wild-type ITR.

In some embodiments, the ITR is a 5’ ITR. In some embodiments, the ITR is a 3’ ITR

Generally, ITR sequences are about 145 bp in length. Preferably, substantially the entire sequences encoding the ITR(s) is used in the molecule, although some degree of minor modification of these sequences is permissible. In some embodiments, an ITR may be mutated at its terminal resolution site (TR), which inhibits replication at the vector terminus where the TR has been mutated and results in the formation of a self-complementary AAV. Another example of such a molecule employed in the present disclosure is a "cis-acting" plasmid containing the transgene, in which the selected transgene sequence and associated regulatory elements are flanked by the 5' AAV ITR sequence and a 3’ hairpin-forming RNA sequence. AAV ITR sequences may be obtained from any known AAV, including presently identified mammalian AAV types. In some embodiments, an ITR sequence is an AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, and/or AAVrhlO ITR sequence.

In some embodiments, a rAAV vector comprises a nucleic acid sequence encoding a NGLY 1 protein or a portion thereof.

In some embodiments, a rAAV vector is a self-complementary vector that comprises a nucleic acid sequence encoding a NGLY 1 protein or a portion thereof.

The isolated nucleic acids and/or rAAVs of the present disclosure may be modified and/or selected to enhance the targeting of the isolated nucleic acids and/or rAAVs to a target tissue (e.g., CNS). Non-limiting methods of modifications and/or selections include AAV capsid serotypes (e.g., AAV9), tissue-specific promoters, and/or targeting peptides. In some embodiments, the isolated nucleic acids and rAAVs of the present disclosure comprise AAV capsid serotypes with enhanced targeting to CNS tissues (e.g., AAV9). In some embodiments, the isolated nucleic acids and rAAVs of the present disclosure comprise tissue- specific promoters. In some embodiments, the isolated nucleic acids and rAAVs of the present disclosure comprise AAV capsid serotypes with enhanced targeting to CNS tissues and tissue- specific promoters.

In some aspects, the disclosure provides isolated AAVs. As used herein with respect to AAVs, the term“isolated” refers to an AAV that has been artificially obtained or produced. Isolated AAVs may be produced using recombinant methods. Such AAVs are referred to herein as“recombinant AAVs”. Recombinant AAVs (rAAVs) preferably have tissue- specific targeting capabilities, such that a transgene of the rAAV will be delivered specifically to one or more predetermined tissue(s). The AAV capsid is an important element in determining these tissue- specific targeting capabilities. Thus, an rAAV having a capsid appropriate for the tissue being targeted can be selected. In some embodiments, the rAAV comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, or AAV.PHPB capsid protein, or a protein having substantial homology thereto. In some embodiments, the rAAV comprises an AAV9 capsid protein. In some embodiments, the rAAV comprises an AAVPHP.B capsid protein In some embodiments, the rAAVs of the disclosure are pseudotyped rAAVs. Pseudotyping is the process of producing viruses or viral vectors in combination with foreign viral envelope proteins. The result is a pseudotyped virus particle. With this method, the foreign viral envelope proteins can be used to alter host tropism or an increased/decreased stability of the virus particles. In some aspects, a pseudotyped rAAV comprises nucleic acids from two or more different AAVs, wherein the nucleic acid from one AAV encodes a capsid protein and the nucleic acid of at least one other AAV encodes other viral proteins and/or the viral genome. In some embodiments, a pseudotyped rAAV refers to an AAV comprising an inverted terminal repeats (ITRs) of one AAV serotype and an capsid protein of a different AAV serotype. For example, a pseudotyped AAV vector containing the ITRs of serotype X encapsidated with the proteins of Y will be designated as AAVX/Y ( e.g AAV2/1 has the ITRs of AAV2 and the capsid of AAV1). In some embodiments, pseudotyped rAAVs may be useful for combining the tissue-specific targeting capabilities of a capsid protein from one AAV serotype with the viral DNA from another AAV serotype, thereby allowing targeted delivery of a transgene to a target tissue.

Methods for obtaining recombinant AAVs having a desired capsid protein are well known in the art. (See, for example, US Patent Application Publication Number US

2003/0138772, the contents of which are incorporated herein by reference in their entirety). Typically the methods involve culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein or fragment thereof; a functional rep gene; a recombinant AAV vector composed of, AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to permit packaging of the recombinant AAV vector into the AAV capsid proteins. Typically, capsid proteins are structural proteins encoded by the cap gene of an AAV. In some embodiments, AAVs comprise three capsid proteins, virion proteins 1 to 3 (named VP1, VP2 and VP3), all of which are transcribed from a single cap gene via alternative splicing. In some embodiments, the molecular weights of VP1, VP2 and VP3 are respectively about 87 kDa, about 72 kDa and about 62 kDa. In some embodiments, upon translation, capsid proteins form a spherical 60-mer protein shell around the viral genome. In some embodiments, capsid proteins protect a viral genome, deliver a genome and/or interact with a host cell. In some aspects, capsid proteins deliver the viral genome to a host in a tissue specific manner.

In some embodiments, the AAV capsid protein is of an AAV serotype selected from the group consisting of AAV3, AAV4, AAV5, AAV6, AAV8, AAVrh8 AAV9, AAV10 and AAVrhlO. In some embodiments, the AAV capsid protein is of an AAVrh8, AAVrhlO, or AAV.PHPB serotype. In some embodiments, the AAV capsid protein is of an AAVrh8 serotype. In some embodiments, the AAV capsid protein is of an AAV9 serotype. In some embodiments, the AAV capsid protein is of an AAV.PHPB serotype.

In certain embodiments, the disclosure relates to rAAV vectors comprising artificial transcription elements. As used here, the term“artificial transcription element” refers, in some embodiments, to a synthetic sequence enabling the controlled transcription of DNA by an RNA polymerase to produce an RNA transcript. Transcriptionally active elements of the present disclosure are generally smaller than 500 bp, preferably smaller than 200 bp, more preferably smaller than 100, most preferably smaller than 50 bp. In some embodiments, an artificial transcription element comprises two or more nucleic acid sequences from transcriptionally active elements. Transcriptionally active elements are generally recognized in the art and include, for example, promoter, enhancer sequence, TATA box, G/C box, CCAAT box, specificity protein 1 (Spl) binding site, Inr region, CRE (cAMP regulatory element), activating transcription factor 1 (ATF1) binding site, ATF1-CRE binding site, ARBb box, APBa box, CArG box, CCAC box and those disclosed by US Patent No. 6,346,415. Combinations of the foregoing transcriptionally active elements are also contemplated.

In addition to the major elements identified above for the recombinant AAV vector, the vector also includes conventional control elements necessary which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the plasmid vector or infected with the vims produced by the disclosure. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.

In some embodiments, components to be cultured in the host cell to package a rAAV vector in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components ( e.g ., recombinant AAV vector, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art. Most suitably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion of regulatory elements suitable for use with the transgene. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contain the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.

In some embodiments, the disclosure relates to a host cell containing a nucleic acid that comprises a coding sequence set forth in SEQ ID NO: 1 that is operably linked to a promoter. In some embodiments, the disclosure relates to a composition comprising the host cell described above. In some embodiments, the composition comprising the host cell above further comprises a cryopreservative.

The recombinant AAV vector, rep sequences, cap sequences, and helper functions useful for producing the rAAV of the disclosure may be delivered to the packaging host cell using any appropriate genetic element (vector). The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present disclosure. See, e.g., K. Fisher et al, J. Virol., 70:520-532 (1993) and U.S. Pat. No. 5,478,745.

In some embodiments, recombinant AAVs may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650). Typically, the recombinant AAVs are produced by transfecting a host cell with an recombinant AAV vector (comprising a transgene) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector. An AAV helper function vector encodes the "AAV helper function" sequences ( i.e ., rep and cap), which function in trans for productive AAV replication and encapsidation. Preferably, the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions {i.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use with the present disclosure include pHLP19, described in U.S. Pat. No. 6,001,650 and pRep6cap6 vector, described in U.S. Pat. No. 6,156,303, the entirety of both incorporated by reference herein. The accessory function vector encodes nucleotide sequences for non-AAV derived viral and/or cellular functions upon which AAV is dependent for replication ( i.e ., "accessory functions"). The accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus.

In some aspects, the disclosure provides transfected host cells. The term "transfection" is used to refer to the uptake of foreign DNA by a cell, and a cell has been "transfected" when exogenous DNA has been introduced through the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor

Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more exogenous nucleic acids, such as a nucleotide integration vector and other nucleic acid molecules, into suitable host cells.

A“host cell” refers to any cell that harbors, or is capable of harboring, a substance of interest. Often a host cell is a mammalian cell (e.g., a non-human primate, rodent, or human cell). In some embodiments, the host cell is a mammalian cell, a yeast cell, a bacterial cell, an insect cell, a plant cell, or a fungal cell. A host cell may be used as a recipient of an AAV helper construct, an AAV minigene plasmid, an accessory function vector, or other transfer DNA associated with the production of recombinant AAVs. The term includes the progeny of the original cell which has been transfected. Thus, a“host cell” as used herein may refer to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.

As used herein, the term "cell line" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.

As used herein, the term“recombinant cell” refers to a cell into which an exogenous DNA segment, such as DNA segment that leads to the transcription of a biologically-active polypeptide or production of a biologically active nucleic acid such as an RNA, has been introduced.

As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. In some embodiments, useful vectors are contemplated to be those vectors in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrases "operatively positioned," "under control" or "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. The term "expression vector or construct" means any type of genetic construct containing a nucleic acid in which part or all of the nucleic acid encoding sequence is capable of being transcribed. In some embodiments, expression includes transcription of the nucleic acid, for example, to generate a biologically- active polypeptide product or inhibitory RNA ( e.g ., shRNA, miRNA, miRNA inhibitor) from a transcribed gene.

The foregoing methods for packaging recombinant vectors in desired AAV capsids to produce the rAAVs of the disclosure are not meant to be limiting and other suitable methods will be apparent to the skilled artisan.

Recombinant AAV Vector: Transgene Coding Sequences

The composition of the transgene sequence of the rAAV vector will depend upon the use to which the resulting vector will be put. For example, one type of transgene sequence includes a reporter sequence, which upon expression produces a detectable signal. In another example, the transgene encodes a therapeutic protein. In another example, the transgene encodes a protein that is intended to be used for research purposes, e.g., to create a somatic transgenic animal model harboring the transgene, e.g., to study the function of the transgene product. In another example, the transgene encodes a protein that is intended to be used to create an animal model of disease.

In some embodiments, the disclosure provides an rAAV comprising a transgene encoding NGLY1. Also contemplated herein are methods of treating NGLY 1 Deficiency by delivering a transgene to a subject using the rAAVs described herein. In some embodiments, the disclosure relates to a method for treating a NGLY 1 Deficiency, the method comprising administering a rAAV to a subject. In some embodiments, the rAAV comprises a hybrid promoter. In some embodiments, the rAAV comprises a chimeric intron. In some

embodiments, the rAAV comprises an artificial transcription element. In some embodiments, the artificial transcription element comprises ATF1-CRE binding site, SP1 binding site and TATA box. In some embodiments, the promoter, chimeric intron or artificial transcription element is operably linked to a transgene. In some embodiments, the transgene encodes NGLY1.

Recombinant AAV Administration Methods

The rAAVs may be delivered to a subject in compositions according to any appropriate methods known in the art. The rAAV, preferably suspended in a physiologically compatible carrier ( i.e ., in a composition), may be administered to a subject, i. e. , host animal, such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or a non-human primate (e.g., Macaque). In some embodiments a host animal does not include a human.

Delivery of the rAAVs to a mammalian subject may be by, for example, intramuscular injection or by administration into the bloodstream of the mammalian subject. Administration into the bloodstream may be by injection into a vein, an artery, or any other vascular conduit. In some embodiments, the rAAVs are administered into the bloodstream by way of isolated limb perfusion, a technique well known in the surgical arts, the method essentially enabling the artisan to isolate a limb from the systemic circulation prior to administration of the rAAV virions. A variant of the isolated limb perfusion technique, described in U.S. Pat. No.

6,177,403, can also be employed by the skilled artisan to administer the virions into the vasculature of an isolated limb to potentially enhance transduction into muscle cells or tissue. A method for delivering a transgene to CNS tissue in a subject may comprise

administering a rAAV by a single route or by multiple routes. For example, delivering a transgene to CNS tissue in a subject may comprise administering to the subject, by intravenous administration, an effective amount of a rAAV that crosses the blood-brain-barrier. Delivering a transgene to CNS tissue in a subject may comprise administering to the subject an effective amount of a rAAV by intrathecal administration or intracerebral administration, e.g., by intraventricular injection. A method for delivering a transgene to CNS tissue in a subject may comprise co-administering of an effective amount of a rAAV by two different administration routes, e.g., by intrathecal administration and by intracerebral administration. Co-administration may be performed at approximately the same time, or different times.

The CNS tissue to be targeted may be selected from cortex, hippocampus, thalamus, hypothalamus, cerebellum, brain stem, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord, for example. The administration route for targeting CNS tissue typically depends on the AAV serotype. For example, in certain instances where the AAV serotype is selected from AAVPHP.B, AAV1, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh.lO, rh.39, rh.43 and CSp3, the administration route may be intravascular injection. In some instances, for example where the AAV serotype is selected from AAVPHP.B, AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh.lO, rh.39, rh.43 and CSp3, the administration route may be intrathecal and/or intracerebral injection.

Aspects of the disclosure relate to compositions comprising a recombinant AAV comprising at least one modified genetic regulatory sequence or element. In some

embodiments, the composition further comprises a pharmaceutically acceptable carrier.

The compositions of the disclosure may comprise an rAAV alone, or in combination with one or more other viruses (e.g., a second rAAV encoding having one or more different transgenes). In some embodiments, a composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs each having one or more different transgenes.

In some aspects, the disclosure relates to a composition (e.g., a pharmaceutical composition) comprising an rAAV comprising a nucleic acid encoding a NGLY1.

Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the rAAV is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present disclosure.

Optionally, the compositions of the disclosure may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and

parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

rAAVs are administered in sufficient amounts to transfect the cells of a desired tissue and to provide sufficient levels of gene transfer and expression without undue adverse effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the selected organ ( e.g ., injection into the liver, skeletal muscle), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parental routes of

administration. Routes of administration may be combined, if desired.

The dose of rAAV virions required to achieve a particular "therapeutic effect," e.g., the units of dose in genome copies/per kilogram of body weight (GC/kg), will vary based on several factors including, but not limited to: the route of rAAV virion administration, the level of gene or RNA expression required to achieve a therapeutic effect, the specific disease or disorder being treated, and the stability of the gene or RNA product. One of skill in the art can readily determine a rAAV virion dose range to treat a patient having a particular disease or disorder based on the aforementioned factors, as well as other factors that are well known in the art.

An effective amount of an rAAV is an amount sufficient to target infect an animal, target a desired tissue. The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. For example, an effective amount of the rAAV is generally in the range from about 1 ml to about 100 ml of solution containing from about 10 ⁶ to 10 ¹⁶ genome copies (e.g., from 1 x 10 ⁶ to 1 x 10 ¹⁶ , inclusive). In some cases, a dosage between about 10 ¹¹ to 10 ¹² rAAV genome copies is appropriate. In some embodiments, a dosage of between about 10 ¹¹ to 10 ¹³ rAAV genome copies is appropriate. In some embodiments, a dosage of between about 10 ¹¹ to 10 ¹⁴ rAAV genome copies is appropriate. In some embodiments, a dosage of between about 10 ¹¹ to 10 ¹⁵ rAAV genome copies is appropriate. In some embodiments, a dosage of 4.68 x 10 ⁷ is appropriate. In some embodiments, a dosage of 4.68 x 10 ⁸ genome copies is appropriate. In some embodiments, a dosage of 4.68 x 10 ⁹ genome copies is appropriate. In some embodiments, a dosage of 1.17 x 10 ¹⁰ genome copies is appropriate. In some embodiments, a dosage of 2.34 x 10 ¹⁰ genome copies is appropriate. In some embodiments, a dosage of 3.20 x 10 ¹¹ genome copies is appropriate. In some embodiments, a dosage of 1.2 x 10 ¹³ genome copies is appropriate. In some embodiments, a dosage of about 1 x 10 ¹⁴ vector genome (vg) copies is appropriate.

In some aspects, the disclosure relates to the recognition that one potential side-effect for administering an AAV to a subject is an immune response in the subject to the AAV, including inflammation. In some embodiments, a subject is immunosuppressed prior to administration of one or more rAAVs as described herein.

As used herein,“immunosuppressed” or“immunosuppression” refers to a decrease in the activation or efficacy of an immune response in a subject. Immunosuppression can be induced in a subject using one or more ( e.g ., multiple, such as 2, 3, 4, 5, or more) agents, including, but not limited to, rituximab, methylprednisolone, prednisolone, sirolimus, immunoglobulin injection, prednisone, methotrexate, and any combination thereof.

In some embodiments, methods described by disclosure further comprise the step inducing immunosuppression (e.g., administering one or more immunosuppressive agents) in a subject prior to the subject being administered an rAAV (e.g., an rAAV or pharmaceutical composition as described by the disclosure). In some embodiments, a subject is

immunosuppressed (e.g., immunosuppression is induced in the subject) between about 30 days and about 0 days (e.g., any time between 30 days until administration of the rAAV, inclusive) prior to administration of the rAAV to the subject. In some embodiments, the subject is pre treated with immune suppression (e.g., rituximab, sirolimus, and/or prednisone) for at least 7 days.

In some embodiments, immunosuppression of a subject maintained during and/or after administration of a rAAV or pharmaceutical composition. In some embodiments, a subject is immunosuppressed (e.g., administered one or more immunosuppressants) for between 1 day and 1 year after administration of the rAAV or pharmaceutical composition.

In some embodiments, rAAV compositions are formulated to reduce aggregation of AAV particles in the composition, particularly where high rAAV concentrations are present (e.g., ~10 ¹³ GC/ml or more). Methods for reducing aggregation of rAAVs are well known in the art and, include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference.)

Formulation of pharmaceutically-acceptable excipients and carrier solutions is well- known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens.

Typically, these formulations may contain at least about 0.1% of the active compound or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of active compound in each therapeutically- useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.

In certain circumstances it will be desirable to deliver the rAAV-based therapeutic constructs in suitably formulated pharmaceutical compositions disclosed herein either subcutaneously, intrapancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, the administration modalities as described in U.S. Pat. Nos. 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety) may be used to deliver rAAVs. In some embodiments, a preferred mode of administration is by portal vein injection.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

For administration of an injectable aqueous solution, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, a sterile aqueous medium that can be employed will be known to those of skill in the art. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example,

"Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.

Sterile injectable solutions are prepared by incorporating the active rAAV in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

The rAAV compositions disclosed herein may also be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.

As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase "pharmaceutically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.

Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, the rAAV vector delivered transgenes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.

Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids or the rAAV constructs disclosed herein. The formation and use of liposomes is generally known to those of skill in the art. Recently, liposomes were developed with improved serum stability and circulation half-times (U.S. Pat. No. 5,741,516). Further, various methods of liposome and liposome like preparations as potential drug carriers have been described (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).

Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of the DNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials examining the effectiveness of liposome-mediated drug delivery have been completed.

Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs). MLVs generally have diameters of from 25 nm to 4 mih. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 Angstroms, containing an aqueous solution in the core.

Alternatively, nanocapsule formulations of the rAAV may be used. Nanocapsules can generally entrap substances in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 pm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

In addition to the methods of delivery described above, the following techniques are also contemplated as alternative methods of delivering the rAAV compositions to a host.

Sonophoresis ( e.g ., ultrasound) has been used and described in U.S. Pat. No. 5,656,016 as a device for enhancing the rate and efficacy of drug permeation into and through the circulatory system. Other drug delivery alternatives contemplated are intraosseous injection (U.S. Pat. No. 5,779,708), microchip devices (U.S. Pat. No. 5,797,898), ophthalmic formulations (Bourlais et al., 1998), transdermal matrices (U.S. Pat. Nos. 5,770,219 and 5,783,208) and feedback- controlled delivery (U.S. Pat. No. 5,697,899).

In some embodiments, the disclosure relates to administration of one or more additional therapeutic agents to a subject who has been administered an rAAV or pharmaceutical composition as described herein.

Kits and Related Compositions

The agents described herein may, in some embodiments, be assembled into

pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. A kit may include one or more containers housing the components of the disclosure and instructions for use. Specifically, such kits may include one or more agents described herein, along with instructions describing the intended application and the proper use of these agents. In certain embodiments agents in a kit may be in a pharmaceutical formulation and dosage suitable for a particular application and for a method of administration of the agents. Kits for research purposes may contain the components in appropriate concentrations or quantities for running various experiments.

In some embodiments, the disclosure relates to a kit for producing a rAAV, the kit comprising a container housing an isolated nucleic acid encoding a NGLY 1 protein or a portion thereof. In some embodiments, the kit further comprises instructions for producing the rAAV.

In some embodiments, the kit further comprises at least one container housing a recombinant AAV vector, wherein the recombinant AAV vector comprises a transgene.

In some embodiments, the disclosure relates to a kit comprising a container housing a recombinant AAV as described supra. In some embodiments, the kit further comprises a container housing a pharmaceutically acceptable carrier. For example, a kit may comprise one container housing a rAAV and a second container housing a buffer suitable for injection of the rAAV into a subject. In some embodiments, the container is a syringe.

The kit may be designed to facilitate use of the methods described herein by researchers and can take many forms. Each of the compositions of the kit, where applicable, may be provided in liquid form ( e.g ., in solution), or in solid form, (e.g., a dry powder). In certain cases, some of the compositions may be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit. As used herein, “instructions” can define a component of instruction and/or promotion, and typically involve written instructions on or associated with packaging of the disclosure. Instructions also can include any oral or electronic instructions provided in any manner such that a user will clearly recognize that the instructions are to be associated with the kit, for example, audiovisual (e.g., videotape, DVD, etc.), Internet, and/or web-based communications, etc. The written

instructions may be in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions can also reflects approval by the agency of manufacture, use or sale for animal administration.

The kit may contain any one or more of the components described herein in one or more containers. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and/or isolating and mixing a sample and applying to a subject. The kit may include a container housing agents described herein. The agents may be in the form of a liquid, gel or solid (powder). The agents may be prepared sterilely, packaged in syringe and shipped refrigerated. Alternatively it may be housed in a vial or other container for storage. A second container may have other agents prepared sterilely. Alternatively the kit may include the active agents premixed and shipped in a syringe, vial, tube, or other container. The kit may have one or more or all of the components required to administer the agents to an animal, such as a syringe, topical application devices, or iv needle tubing and bag, particularly in the case of the kits for producing specific somatic animal models.

In some cases, the methods involve transfecting cells with total cellular DNAs isolated from the tissues that potentially harbor proviral AAV genomes at very low abundance and supplementing with helper virus function (e.g., adenovirus) to trigger and/or boost AAV rep and cap gene transcription in the transfected cell. In some cases, RNA from the transfected cells provides a template for RT-PCR amplification of cDNA and the detection of novel AAVs. In cases where cells are transfected with total cellular DNAs isolated from the tissues that potentially harbor proviral AAV genomes, it is often desirable to supplement the cells with factors that promote AAV gene transcription. For example, the cells may also be infected with a helper virus, such as an Adenovirus or a Herpes Vims. In a specific embodiment, the helper functions are provided by an adenovirus. The adenovirus may be a wild-type adenovirus, and may be of human or non-human origin, preferably non-human primate (NHP) origin. Similarly adenoviruses known to infect non-human animals (e.g., chimpanzees, mouse) may also be employed in the methods of the disclosure (See, e.g., U.S. Pat. No. 6,083,716). In addition to wild-type adenoviruses, recombinant viruses or non-viral vectors (e.g., plasmids, episomes, etc.) carrying the necessary helper functions may be utilized. Such recombinant viruses are known in the art and may be prepared according to published techniques. See, e.g., U.S. Pat. No.

5,871,982 and U.S. Pat. No. 6,251,677, which describe a hybrid Ad/ AAV vims. A variety of adenovims strains are available from the American Type Culture Collection, Manassas, Va., or available by request from a variety of commercial and institutional sources. Further, the sequences of many such strains are available from a variety of databases including, e.g., PubMed and GenBank.

Cells may also be transfected with a vector (e.g., helper vector) which provides helper functions to the AAV. The vector providing helper functions may provide adenovims functions, including, e.g., Ela, Elb, E2a, E40RF6. The sequences of adenovims gene providing these functions may be obtained from any known adenovims serotype, such as serotypes 2, 3, 4, 7, 12 and 40, and further including any of the presently identified human types known in the art.

Thus, in some embodiments, the methods involve transfecting the cell with a vector expressing one or more genes necessary for AAV replication, AAV gene transcription, and/or AAV packaging. In some cases, a novel isolated capsid gene can be used to construct and package recombinant AAV vectors, using methods well known in the art, to determine functional characteristics associated with the novel capsid protein encoded by the gene. For example, novel isolated capsid genes can be used to construct and package recombinant AAV (rAAV) vectors comprising a reporter gene ( e.g ., B-Galactosidase, GFP, Luciferase, etc.). The rAAV vector can then be delivered to an animal (e.g., mouse) and the tissue targeting properties of the novel isolated capsid gene can be determined by examining the expression of the reporter gene in various tissues (e.g., heart, liver, kidneys) of the animal. Other methods for characterizing the novel isolated capsid genes are disclosed herein and still others are well known in the art.

The kit may have a variety of forms, such as a blister pouch, a shrink wrapped pouch, a vacuum sealable pouch, a sealable thermoformed tray, or a similar pouch or tray form, with the accessories loosely packed within the pouch, one or more tubes, containers, a box or a bag. The kit may be sterilized after the accessories are added, thereby allowing the individual accessories in the container to be otherwise unwrapped. The kits can be sterilized using any appropriate sterilization techniques, such as radiation sterilization, heat sterilization, or other sterilization methods known in the art. The kit may also include other components, depending on the specific application, for example, containers, cell media, salts, buffers, reagents, syringes, needles, a fabric, such as gauze, for applying or removing a disinfecting agent, disposable gloves, a support for the agents prior to administration etc.

The instructions included within the kit may involve methods for detecting a latent AAV in a cell. In addition, kits of the disclosure may include, instructions, a negative and/or positive control, containers, diluents and buffers for the sample, sample preparation tubes and a printed or electronic table of reference AAV sequence for sequence comparisons.

Methods of treating NGLY1 Deficiency

Aspects of the present disclosure provide methods for treating NGLY 1 Deficiency. NGLY1 deficiency, which results from loss-of-function mutations in the NGLY1 gene is an ultra-rare genetic disorder, and patients suffer from developmental delay, seizures, lack of tears, elevated liver transaminases in childhood, and movement disorder. In some embodiments, gene replacement therapy is provided herein that is useful to restore NGLY 1 function, primarily in the central nervous system (CNS), which can alleviate the disease symptoms. Accordingly, in some embodiments, the disclosure provides isolated nucleic acids, rAAVs, compositions, and methods useful in treating NGLY1 Deficiency. In some

embodiments, the isolated nucleic acids, rAAVs, compositions, and methods are for the treatment of NGLY 1 Deficiency. Methods for treating NGLY 1 deficiency in a subject may comprise administering an isolated nucleic acid, rAAV, or composition of the present claims that comprises a transgene encoding NGLY1.

In some aspects, the disclosure provides a method of promoting expression of functional NGLY1 protein in a subject ( e.g ., in the central nervous system (CNS) of a subject) comprising administering the isolated nucleic acids, the rAAVs, or the compositions described herein to a subject having or suspected of having a disease of disorder associated with low levels of NGLY 1 expression (e.g., NGLY 1 Deficiency). As used herein, a disease of disorder associated with low levels of NGLY 1 expression is a disease or disorder in which a subject has at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% lower levels of NGLY 1 expression relative to a control subject (e.g., a healthy subject or an untreated subject).

In some embodiments, administering the isolated nucleic acids, the rAAVs, or the compositions described herein to a subject promotes expression of NGLY 1 by between 2-fold and 100-fold (e.g., 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 75-fold, 100-fold, etc.) compared to a control subject. In some embodiments, administering the isolated nucleic acids, the rAAVs, or the compositions described herein to a subject promotes expression of NGLY 1 in the CNS of a subject by between 2-fold and 100-fold (e.g., 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 75-fold, 100-fold, etc.) compared to a control subject. As used herein a“control” subject may refer to a subject that is not administered the isolated nucleic acids, the rAAVs, or the compositions described herein; or a healthy subject. In some embodiments, a control subject is the same subject that is administered the isolated nucleic acids, the rAAVs, or the compositions described herein (e.g., prior to the administration). In some embodiments, administering the isolated nucleic acids, the rAAVs, or the compositions described to a subject promotes expression of NGLY 1 by 2-fold compared to a control. In some embodiments, administering the isolated nucleic acids, the rAAVs, or the compositions described to a subject promotes expression of NGLY 1 by 100-fold compared to a control. In some embodiments, administering the isolated nucleic acids, the rAAVs, or the compositions described to a subject promotes expression of NGLY 1 by 5-fold compared to a control. In some embodiments, administering the isolated nucleic acids, the rAAVs, or the compositions described to a subject promotes expression of NGLY1 by 10-fold compared to a control. In some embodiments, administering the isolated nucleic acids, the rAAVs, or the compositions described to a subject promotes expression of NGLY1 by 5-fold to 100-fold compared to control (e.g., 5-fold to 10-fold, 10-fold to 15-fold, 10-fold to 20-fold, 15-fold to 25-fold, 20-fold to 30-fold, 25-fold to 35-fold, 30-fold to 40-fold, 35-fold to 45-fold, 40-fold to 60-fold, 50-fold to 75-fold, 60-fold to 80-fold, 75-fold to 100-fold compared to a control).

In some embodiments, administering the isolated nucleic acids, the rAAVs, or the compositions described herein to a subject promotes expression of NGLY 1 in a subject (e.g., promotes expression of NGLY 1 in the CNS of a subject) by between a 5% and 200% increase (e.g., 5-50%, 25-75%, 50-100%, 75-125%, 100-200%, or 100-150% etc.) compared to a control subject.

In some aspects, the disclosure provides a method of treating a subject having a disease of disorder associated with low levels of NGLY1 expression (e.g., NGLY1 Deficiency), the method comprising administering to the subject an effective amount of an rAAV comprising a capsid containing a nucleic acid engineered to express NGLY1 in the CNS of the subject.

As used herein, the term“treating” refers to the application or administration of a composition (e.g., an isolated nucleic acid or rAAV as described herein) to a subject who has a disease or disorder associated with low levels of NGLY1 expression (e.g., NGLY1 Deficiency), with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disorder, the symptom of the disease, or the predisposition toward a disease associated with prolonged oxidative stress.

Alleviating a disease associated with low levels of NGLY1 expression (e.g., NGLY1 Deficiency) includes delaying the development or progression of the disease, or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, "delaying" the development of a disease (such as a disease associated with inflammation (e.g., microgliosis), demyelination, and/or death of synaptic neurons) means to defer, hinder, slow, retard, stabilize, and/or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and/or individuals being treated. A method that "delays" or alleviates the development of a disease, or delays the onset of the disease, is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and/or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.

"Development" or "progression" of a disease means initial manifestations and/or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. "Development" includes

occurrence, recurrence, and onset. As used herein "onset" or "occurrence" of a disease associated with low levels of NGLY1 expression (e.g., NGLY1 Deficiency).

A subject may be a human, a mouse, a rat, a pig, a dog, a cat, or a non-human primate.

In some embodiments, a subject has or is suspected of having a disease or disorder associated with low levels of NGLY 1 expression (e.g., NGLY 1 Deficiency). In some embodiments, a subject having a disease or disorder associated with low levels of NGLY 1 expression (e.g., NGLY 1 Deficiency) comprises at least one NGLY 1 allele having a loss-of-function mutation (e.g., associated with NGLY1 deficiency). In some embodiments, a NGLY1 allele having a loss- of-function mutation (e.g., associated with NGLY 1 deficiency) comprises a frameshift mutation, a splice site mutation, a missense mutation, a truncation mutation or a nonsense mutation. A subject may have two NGLY1 alleles having the same loss-of-function mutations (homozygous state) or two NGLY 1 alleles having different loss-of-function mutations (compound

heterozygous state).

In some embodiments, a NGLY1 allele having a loss-of-function mutation comprises a frameshift mutation in exon 12. In some embodiments, a NGLY 1 allele having a loss-of- function mutation comprises a nonsense mutation in exon 8 resulting in an Arg401-to-Ter (e.g. a stop codon) (R401X) substitution. In some embodiments, a NGLY1 allele having a loss-of- function mutation comprises a frameshift mutation resulted from a 1-bp deletion (c.l891delC).

In some embodiments, a NGLY1 allele having a loss-of-function mutation comprises a

C.1201A-T transversion in exon 8 resulting in an Arg401-to-Ter (e.g., a stop codon) (R401X) substitution. In some embodiments, a NGLY1 allele having a loss-of-function mutation comprises a 1-bp duplication (c. l370dupG) in exon 9, resulting in a frameshift and premature termination (Arg458-to-Ter). In some embodiments, a NGLY1 allele having a loss-of-function mutation comprises a 3-bp deletion (c. l205_1207delTTC), resulting in the deletion of 1 residue (402del). In some embodiments, a NGLY1 allele having a loss-of-function mutation comprises a C.1570C-T transition, resulting in an Arg542-to-Ter (R542X) substitution.

The rAAVs are administered in sufficient amounts to transfect the cells of a desired tissue and to provide sufficient levels of gene transfer and expression without undue adverse effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the selected organ (e.g., to the central nervous system), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous,

intramuscular, subcutaneous, intradermal, intratumoral, and other parental routes of

administration. Routes of administration may be combined, if desired.

The dose of rAAV virions required to achieve a particular "therapeutic effect," e.g., the units of dose in genome copies/per kilogram of body weight (GC/kg), will vary based on several factors including, but not limited to: the route of rAAV virion administration, the level of gene or RNA expression required to achieve a therapeutic effect, the specific disease or disorder being treated, and the stability of the gene or RNA product. One of skill in the art can readily determine a rAAV virion dose range to treat a patient having a particular disease or disorder based on the aforementioned factors, as well as other factors that are well known in the art.

An effective amount of an rAAV is an amount sufficient to target infect a subject or target a desired tissue. In some embodiments, an effective amount of an rAAV is an amount sufficient to produce a stable somatic transgenic animal model. The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. For example, an effective amount of the rAAV is generally in the range of from about 1 ml to about 100 ml of solution containing from about 10 ⁹ to 10 ¹⁶ genome copies. In some embodiments, the rAAV transduces

hepatocytes. In certain embodiments, the effective amount of rAAV is 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ , or 10 ¹⁴ genome copies per kg. In certain embodiments, the effective amount of rAAV is 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , or 10 ¹⁵ genome copies per subject. In some cases, a dosage between about 10 ¹¹ to 10 ¹² rAAV genome copies is appropriate.

In some embodiments, rAAV compositions are formulated to reduce aggregation of AAV particles in the composition, particularly where high rAAV concentrations are present (e.g., ~10 ¹³ GC/ml or more). Methods for reducing aggregation of rAAVs are well known in the art and, include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference.)

Formulation of pharmaceutically-acceptable excipients and carrier solutions is well- known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens.

Typically, these formulations may contain at least about 0.1% of the active compound or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of active compound in each therapeutically- useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.

In certain circumstances it will be desirable to deliver the rAAV-based therapeutic constructs in suitably formulated pharmaceutical compositions disclosed herein either subcutaneously, intraopancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, the administration modalities as described in U.S. Pat. Nos. 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety) may be used to deliver rAAVs. In some embodiments, a preferred mode of administration is by portal vein injection.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

For administration of an injectable aqueous solution, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, a sterile aqueous medium that can be employed will be known to those of skill in the art. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example,

"Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.

Sterile injectable solutions are prepared by incorporating the active rAAV in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

The rAAV compositions disclosed herein may also be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.

As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase "pharmaceutically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.

Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, the rAAV vector delivered transgenes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.

EXAMPLES

Example 1. AAV-mediated gene replacement therapy for NGLY1 deficiency

Two constructs were generated expressing a codon-optimized human NGLY1 cDNA (SEQ ID NO: 1), driven by either the CB6 or the JeT promoter, respectively (FIG. 1A). The small size of the JeT promoter allowed packaging of JeT-NGLYl as a self-complementary (sc) rAAV genome, which in some embodiments is advantageous for in vivo gene delivery using rAAV. Using Ngly l -nu\\ mouse embryonic fibroblasts (MEFs) and plasmid transfection, it was found that the plasmid carrying CB6-NGLY 1 yielded 5-fold higher NGLY 1 expression than the one carrying JeT-NGLYl, as determined by western blot (FIG. IB). Both the AAV9 and AAVPHP.B capsids were evaluated due to their ability to broadly target CNS tissues following systemic delivery in C57BL/6 mice.

Age- and sex-controlled young C57BL/6 adult wild-type mice were treated with the same dose (lxlO ¹² vg total) of each vector by tail vein injections, and quantified rAAV genome biodistribution (gene delivery) and NGLY1 mRNA expression (transduction) in various tissues by droplet digital PCR (ddPCR) (FIG. 2). The scAAV9 JeT and ssAAV9.CB vectors performed comparably well with respect to gene delivery in all tissues examined. Similarly, in the CNS both vectors were comparable with respect to NGLY 1 transgene expression, suggesting that the sc genome configuration compensated for the weaker JeT promoter strength. However, the scAAV9.JeT vector was 10-fold less efficient than the ssAAV9.CB vector in driving NGLY1 expression in the heart and skeletal muscle. In addition, AAVPHP.B yielded 1-2 logs higher gene delivery and transduction than AAV9 in the CNS for ssAAVPHP.B.CB. In experiments using Nglyl-null mice, rAAV-borne NGLY1 protein expression was detected in peripheral tissues, but not in the CNS, likely due the dose used in this experiment (FIG. 3).

Example 2. AAV-mediated delivery of NGLY 1 in wild-type mice

The scAAV9.JeT and rAAV9.CB vectors described in Example 1 were used to treat wild-type mice. Mice were treated by tail vein injection with one of four treatments - (1) 3.0xl0 ¹² genome copies (GC) of the rAAV9.CB rAAV vector; (2) 1.5xl0 ¹² GC of the rAAV9.CB rAAV vector; (3) 1.5xl0 ¹² GC of the scAAV9.JeT vector; and (4) untreated control.

Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) expression levels in the serum were measured at 1, 2, and 3 weeks post-injection. Treatment with the rAAVs expressing NGLY1 provided mild and transient elevation of both transaminases (FIG. 4). These data indicate that these rAAV treatments are well tolerated in subjects and have a reasonable safety profile.

Four weeks after treatment, the mice were euthanized and tissues were subjected to RNAScope analysis to detect the codon-optimized human NGLY1 mRNA (darkened signals) in the liver (FIG. 5A), thalamus (FIG. 5B), and cerebellum (FIG. 5C). All three rAAV treatments provided elevated expression of NGLY 1 relative to the untreated control.

Example 3. AAV-mediated gene replacement therapy for NGLY1 deficient mice

The scAAV9.JeT, rAAV9.CB, and ssAAVPHP.B.CB vectors described in Example 1 were used to treat mice deficient in NGLY 1 (NGLY 1 -/-). Mice were treated by tail vein injection with one of four treatments - (1) the rAAV9.CB rAAV vector; (2) the

ssAAVPHP.B.CB rAAV vector; and (3) the scAAV9.JeT rAAV vector. Wild-type mice (NGLY 1 +/+) were used as a positive control. Untreated mice deficient in NGLY 1 (NGLY 1 -/-) were used as a negative control. After four weeks, the mice were euthanized and the liver was subjected to a NGLY 1 activity assay. All three rAAV treatments caused an increase in NGLY 1 activity, with at least 70% of the total activity of NGLY 1 in the wild-type mice for rAAV9.CB rAAV and scAAV9.JeT rAAV treatments (FIG. 6). The untreated NGLY1 -/- mice had less than 5% NGLY1 activity.

NGLY 1 protein expression was also determined by western blots. The NGLY 1 -/- mice treated with the rAAV9.CB and scAAV9.JeT rAAVs showed detectable levels of NGLY1 protein.

These data demonstrate that the rAAVs expressing codon-optimized NGLY 1 rescued NGLY 1 activity and protein expression in NGLY 1 deficient (-/-) subjects.

Example 4. AAV-mediated gene replacement therapy for NGEY1 knockout mice

An inducible NGLY 1 knock-out mouse model (iKO mice hereafter) has been shown to have disease-related phenotypes such as motor function defects.

iKO mice are treated by tail vein injection or systemic injection with one of four treatments - (1) the rAAV9.CB rAAV vector; (2) the ssAAVPHP.B.CB rAAV vector; and (3) the scAAV9.JeT rAAV vector - in order to deliver codon-optimized NGLY 1 (SEQ ID NO: 1).

At regular intervals ( e.g ., daily or weekly) following the injection, phenotypic markers and responses of the mice are tested. These phenotypic markers and responses include serum inflammatory markers, motor function (assessed by balance beam, rotarod, gait analysis, and/or hind-limb clasping), and kyphosis score.

After the conclusion of the study (e.g., after a set period of time or after a certain percentage of mice have died), total survival is assessed to determine the effectiveness of the treatments to rescue NGLY 1 expression. Splenomegaly, liver histology, total NGLY 1 RNA levels, total NGLY1 protein levels are determined.

iKO mice that are treated with AAVs expressing codon-optimized NGLY 1 are expected to live longer lives than control iKO mice that are untreated. Furthermore, iKO mice in the treatment groups are expected to have improved liver histology, higher levels of total NGLY 1 RNA, and higher levels of total NGLY 1 protein than control iKO mice that are untreated.

Example 5. Reversal of disease in knockout mice by AAV treatment iKO mice as described in Example 4 are treated with AAV constructs expressing codon- optimized NGLY1 to determine the ability of these AAVs to reverse disease states (e.g.,

NGLY 1 deficiency). iKO mice at a variety of appropriate age and at different stages of disease progression are subjected to this study to examine reversibility of disease and the therapeutic time window

iKO mice that are treated with AAVs expressing codon-optimized NGLY 1 are expected to have reversed disease states compared to control iKO mice that are untreated. Furthermore, iKO mice that are treated with AAVs are expected to live longer lives and have fewer disease phenotypes than control iKO mice that are untreated.

EQUIVALENTS

While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or

configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and/or methods, if such features, systems, articles, materials, and/or methods are not mutually inconsistent, is included within the scope of the present invention.

The indefinite articles“a” and“an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean“at least one.” The phrase“and/or,” as used herein in the specification and in the claims, should be understood to mean“either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the“and/or” clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to“A and/or B,” when used in conjunction with open-ended language such as“comprising” can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

As used herein in the specification and in the claims,“or” should be understood to have the same meaning as“and/or” as defined above. For example, when separating items in a list, “or” or“and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as“only one of’ or“exactly one of,” or, when used in the claims,“consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term“or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e.“one or the other but not both”) when preceded by terms of exclusivity, such as“either,”“one of,”“only one of,” or“exactly one of.”“Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

As used herein in the specification and in the claims, the phrase“at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase“at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example,“at least one of A and B” (or, equivalently,“at least one of A or B,” or, equivalently“at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

In the claims, as well as in the specification above, all transitional phrases such as

“comprising,”“including,”“carrying,”“having ,”“containing,”“involving,”“holding,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases“consisting of’ and“consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

Use of ordinal terms such as“first,”“second,”“third,” etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements.

The terms“about” and“substantially” preceding a numerical value represent ±10% of the recited numerical value.