The invention relates to a recombinant baculovirus expressing the Coxsackievirus B-Adenovirus receptor (CAR), and to its use for increasing the efficiency of adenovirus mediated transduction.

Adenoviruses (Ads) are extensively used today to deliver genes into mammalian cells in vitro, ex vivo and in vivo for various purposes, including gene expression in cultured cells, preparation of recombinant viral vaccines, for gene therapy protocols, or for oncolytic virotherapy (For review see for instance RUSSELL, J. Gen. Virol., 81 , 2573-604., 2000; RUSSELL, J. Gen. Virol. , 90, 1-20., 2009; KELLY & RUSSELL, Mol Ther, 15, 651-9, 2007; DENT et al, Cancer Biol Ther. 7, 1335-40, 2008; ALEMANY, Methods Mol Biol., 542, 57-74, 2009; BACHTARZI et al, Expert Opin Drug Deliv., 5, 1231-40, 2008).

The adenoviral virions are nonenveloped icosahedral particles comprising a protein capsid surrounding core proteins and a double-stranded DNA genome. The principal components of the capsid are the 240 hexons, which form the virion shell, and the 12 pentons located at the vertices of the capsid. The pentons consist of penton bases extended by fibres that protrude from the virion, and comprise at their distal tips a globular knob domain. The penton base and the fibre are involved in the virus-cell interactions that allow cell attachment and entry of adenovirus.

Cell entry of human Ad type 5 (Ad5), the serotype which is the most widely jused as gene vector, occurs most efficiently by the receptor-mediated endocytosis pathway, via the Coxsackievirus B-Adenovirus receptor (CAR) (BERGELSON et al., Science, 275, 1320-23., 1997; TOMKO et al., Proc Natl Acad Sci U S A, 94, 3352-6, 1997) and ανβ3/ανβ5 integrins (WICKHAM et al., Cell, 73, 309-19, 1993; WICKHAM et al., J Cell Biol, 127, 257- 64, 1994), although alternative receptors have been described (DECHECCHI et al., J Virol, 75, 8772-80, 2001 ; GADEN et al., Am J Respir Cell Mol Biol, 27, 628-40, 2002; HONG et al., Embo J, 16, 2294-306, 1997). Initial binding of the virion occurs via direct binding of the fibre-knob domain to the CAR receptor. Following this binding, receptor-mediated endocytosis of the virion occurs via interaction of penton-base Arg-Gly Asp (RGD) motifs with cellular integrins.

CAR also serves as a receptor for attachment of other human Ads belonging to subgroups A, C, E, and F (ROELVINK et al., J. Virol., 72, 7909-15, 1998), and for several animal Ads (SOUDAIS et al., J Virol, 74, 10639-49, 2000; COHEN et al., J Gen Virol, 83, 151-55, 2002; TAN et al., J Gen Virol, 82, 1465-72, 2001).

Cell surface expression of CAR differs with different cell types, and this represents one of the major determinants of the efficiency of Ad5 -mediated transduction (LAW & DAVIDSON, Mol. Ther., 12, 599-609., 2005). The ubiquitous nature of CAR is responsible for transduction of nontarget tissues by Ad vectors. Paradoxically, many target cells such as dermal fibroblasts, synoviocytes, mesenchymal stem cells (MSCs), pheripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs), express none or very low levels of CAR at their surface and are relatively resistant to Ad-transduction (GADEN et al., Am J Respir Cell Mol Biol, 27, 628-40, 2002; HEMMI et al., Hum. Gene Ther., 9, 2363-73., 1998).

Much work has been done with different strategies to promote the entry of Ad5 into CAR-defective cells. These strategies include (i) the genetic modification of Ad capsid proteins to carry cell ligands (BELOUSOVA et al., J Virol, 82, 630-7, 2008) (GADEN et al., J Virol, 78, 7227-47, 2004; HENNING et al., Hum. Gene Ther., 13, 1427-39., 2002; HONG et al., Mol Ther, 7, 692-9, 2003; MAGNUSSON et al., J Virol, 75, 7280-9, 2001 ; MAGNUSSON et al., Cancer Gene Ther, 14, 468-79, 2007) (ii) pseudotyping Ad5 vectors with fibers from other serotypes (MIZUGUCHI & HAYAKAWA, Gene, 285, 69-77, 2002; TAKAYAMA et al., Virology, 309, 282-93, 2003; ZABNER et al., J Virol, 73, 8689-95, 1999); (iii) using bispecific adapters or peptides (HONG et al., Hum Gene Ther, 10, 2577-86, 1999; KOROKHOV et al., J Virol, 77, 12931-40, 2003)); (iv) chemical modification of Ad (CORJON et al., Mol. Ther., 16, 1813-24., 2008; REPPEL et al., Mol. Ther., 12, 107-17., 2005)); and (v) tethering on nanoparticles (CHORNY et al., Mol Ther, 14, 382-91 , 2006). The limitations to these strategies are that modifications of the Ad capsid are susceptible to negatively affect the virus growth or viability, due to an alteration of virion assembly, stability, viral uncoating process and/or intracellular trafficking (FRANQUEVILLE et al., PLoS ONE, 3, e2894, 2008; MAGNUSSON et al., J. Gene Med., 4, 356-70., 2002).

Other viruses which are gaining popularity as gene transfer vectors are the baculoviruses (BVs). Baculoviruses are a family of insect virus with a large double-stranded DNA genome packaged in a membrane-enveloped, rod-shaped protein capsid (SLACK & ARIF, Adv. Virus Res., 69, 99-165., 2007). This family includes two genera: nucleopolyhedrovirus (NPV) and granulovirus (GV). NPVs have further been separated into two major Groups, I and II (HERNIOU et al., J Virol, 75, 81 17-26, 2001). One of the major differences between these two groups is that Group I NPVs use the envelope glycoprotein gp64 to mediate entry in insect cells, while Group II NPVs lack gp64 and utilize a protein called F (PEARSON & ROHRMANN, J Virol, 76, 5301-4, 2002). Since the 1980s, baculovirus of the genus nucleopolyhedrovirus have been used for the expression of foreign genes in insect cells, the most commonly used being Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and also Bombyx mori nucleopolyhedrovirus (BmNPV). In the mid-1990s, it was shown that recombinant NPVs carrying reporter genes under cytomegalovirus (CMV) or retroviral RSV promoter efficiently expressed reporter genes in mammalian cells, and fish cells as well as in avian cells. These BVs have the capacity of entering a wide variety of cell types, including cells which are refractory to Ad5 infection, and to be internalized via a receptor mediated pathway involving the early endosomal compartment (HOFMANN et al., Proc Natl Acad Sci U S A, 92, 10099-103, 1995; BOYCE & BUCHER, Proc. Natl. Acad. Sci. USA, 93, 2348-52., 1996; SARKIS et al., Proc Natl Acad Sci U S A, 97, 14638-43, 2000; KOST & CONDREAY, Trends Biotechnol, 20, 173-80, 2002; LEHTOLAINEN et al., Gene Ther, 9, 1693-9, 2002; LEISY et al., J. Gen. Virol., 84, 1 173-78., 2003; STANBRIDGE et al., J Biomed Biotechnol, 2003, 79-91, 2003; KIM et al., J. Biotech., 125, 104-09., 2006; HU, Adv. Virus Res., 68, 287-320., 2006; SONGA et al, J. Virol. Methods, 135, 157-62., 2006; CHUANG et al., Gene Ther, 14, 1417-24, 2007; HU, Curr. Gene Ther., 8, 54-65., 2008).

As gene transfer vectors in vivo, BVs have a good biosafety profile due to their incapacity to replicate in mammalian cells. They have been found to be rapidly inactivated by human serum complement (HOFMAN & STRAUSS, Gene Ther., 5, 531-36 1998), but exposing decay accelerating factor (DAF) at the surface of BV by fusion with the baculoviral envelope glycoprotein gp64 can overcome this inactivation (HUSER et al., Nat. Biotech., 19, 451-55., 2001 ; GUIBINGA & FRIEDMANN, Mol Ther, 1 1, 645-51, 2005).

It has been shown that heterologous proteins or peptides of interest can be exposed on the baculoviral envelope, by fusing them to the envelope glycoprotein gp64: the heterologous polypeptide is inserted between the signal peptide and the mature domain of gp64, and the resulting fusion protein, after expression along with the native gp64, is translocated to the plasma membrane and incorporated into the baculoviral envelope. (BOUBLIK et al., Nat Biotech, 13, 1079-84, 1995). This technology has been used for instance to improve BV entry into different mammalian cell targets, including human cancer cells (KITAGAWA et al., J. Virol., 79, 3639-52., 2005) (MAKELA et al., J Gene Med, 10, 1019-31 , 2008; MAKELA et al., J Virol, 80, 6603-1 1, 2006), or for immunisation purposes (RAHMAN et al., Virology, 317, 36-49, 2003; YANG et al., Mol Ther, 15, 989-96, 2007). An alternative approach, less commonly used, does not involve a gp64-fusion construct but consists of the incorporation into the baculoviral envelope of a full-length protein normally exposed on a cell plasma membrane and foreign to the virus. This technology has been used for pseudotyping of BV by VSV-G (KITAGAWA et al., J. Virol., 79, 3639-52., 2005) or for expressing functional human beta 2-adrenergic receptors at the surface of extracellular baculovirus particles (LOISEL et al., Nat. Biotechnol., 15, 1300-04., 1997).

The inventors have now had the idea to generate baculoviruses expressing at their surface the Coxsackievirus B- Adenovirus receptor. They found that said CAR receptor was functional, and that said baculoviruses (hereinafter designated as BV ^CAR ) were able to form a complex with Ad5 particles via CAR-fiber knob interaction, and that this complex was able to transduce efficiently cell lines which were poorly permissive to Ad5, including human cancer cells and primary cells.

An object of the present invention is therefore a recombinant baculovirus expressing a mammalian coxsackievirus and adenovirus receptor (CAR receptor) inserted in its envelope. Preferably said mammalian CAR receptor is a human CAR receptor (NCBI Reference Sequence: NP 001329).

According to a preferred embodiment of the invention, said CAR receptor is not fused to an envelope protein (such as the gp64 protein) of said baculovirus.

Recombinant baculovirus of the invention can be obtained by standard techniques, well-known in themselves. A classical technique involves the insertion of a polynucleotide of interest (in the present case a polynucleotide encoding a mammalian CAR receptor) in a transfer vector under control of a baculovirus promoter, such as the polyhedrin promoter or the plO promoter. The site of insertion of said polynucleotide is flanked by baculovirus sequences which are homologous with those of the portion of the viral genome where one desires to insert said polynucleotide (generally the polyhedrin or plO locus). Upon co-transfection of appropriate host cells with the loaded transfer vector and a baculovirus, site-specific recombination occurs between the viral DNA and the transfer vector, and results in the insertion of the polynucleotide of interest into the baculovirus genome. One can also use a bacmid expression system (LUCKOW et al., J Virol, 67, 4566-79, 1993), wherein a donor plasmid carrying an expression cassette containing the polynucleotide of interest under control of a baculovirus promoter, and flanked by transposon sequences, is introduced into an E. coli strain containing a large plasmid, called a bacmid, which comprises the baculovirus genome sequences as well sequences enabling replication in E. coli, and a target site for the transposon. The resulting recombinant bacmid is then transfected into insect host-cells, leading to the generation of recombinant baculovirus.

The recombinant baculovirus particles can be recovered from the culture supernatant of the infected cells by classical separation means such as centrifugation.

Baculoviruses belonging to the genus nucleopolyhedrovirus are more particularly suitable for preparing the recombinant baculoviruses of present invention. Preferred NPVs are those of Group I, which all possess a gp64 homolog. One can mention, by way of non-limitative examples, Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV), or Bombyx mori nucleopolyhedrovirus (BmNPV).

Suitable insect host cells, which are commercially available, include for instance Spodoptera frugiperda cell lines Sf9 and Sf21 , for AcMNPV and Bombyx mori BmN4 cell line for BmNPV. Various transfer vectors as well as bacmid systems for baculoviruses have been described in the literature, and a number of them are commercially available.

According to a particular embodiment of a recombinant baculovirus of the invention, it expresses a native envelope glycoprotein gp64.

According to another particular embodiment, said recombinant baculovirus expresses a chimeric envelope glycoprotein gp64 comprising one or more heterologous polypeptide(s) fused with gp64, as disclosed by BOUBLIK et al. (1995, cited above) GUIBINGA et al. (2005, cited above), KITAGAWA et al. (2005, cited above), or MAKELA et al. (2006, 2008, cited above). Said heterologous polypeptide can be for instance decay accelerating factor, and/or a cell -targeting ligand. Alternatively, said recombinant baculovirus may be a gp64-null baculovirus expressing instead of gp64, a foreign viral envelope protein, such as VSVG glycoprotein, as disclosed for instance by KITAGAWA et al. (2005, cited above).

According to still another particular embodiment, said recombinant baculovirus comprises one or more expression cassettes for expressing a polypeptide of interest under transcriptional control of a promoter functional in a mammalian cell.

Another object of the present invention is the use of a recombinant baculovirus of the invention to enhance the transduction of a mammalian cell by a CAR- dependent adenoviral vector.

A "CAR-dependent adenoviral vector" is herein defined as an adenoviral vector which binds to a cell via the CAR receptor. This includes in particular vectors derived from human Ads belonging to subgroups A, C, E, and F, and more specifically from Ad2 and Ad5, this also include vectors derived from animal Ads, such as the canine CAV-2, the simian CV-68, as well as the avian adenovirus CELO, and porcine adenoviruses.

The invention also provides a method for preparing a complex between a recombinant baculovirus of the invention and a CAR-dependent adenoviral vector, wherein said method comprises contacting a recombinant baculovirus of the invention with a CAR- dependent adenoviral vector, in conditions allowing the binding of the fibre-knob domain of said CAR-dependent adenoviral vector to the CAR receptor expressed by said baculovirus.

The invention also encompasses a baculovirus-adenoviral vector complex between a recombinant baculovirus of the invention and a CAR-dependent adenoviral vector, obtainable by the above method.

A further object of the present invention is the use of a baculovirus- adenoviral vector complex of the invention for transducing mammalian cells.

More specifically, the invention provides a method for transducing a mammalian cell wherein said method comprises contacting a baculovirus/adenoviral vector complex of the invention with the cell to be transduced.

The present invention allows to enhance the transduction of mammalian cells by a CAR-dependent adenoviral vector. It is therefore particularly advantageous for transducing cells which are poorly permissive to Ads, such as some tumor cells or cells of the immune system.

Also, since the cell attachment of a baculovirus-adenoviral vector complex of the invention is mediated by the baculoviral envelope glycoprotein gp64, it is possible to direct this complex to desired target cells by using a recombinant baculovirus of the invention expressing a chimeric envelope glycoprotein gp64 comprising a cell-targeting ligand, as described above.

It is also possible, since both baculoviruses and adenoviruses are vectors of gene transfer, to use a complex of the invention comprising a recombinant baculovirus containing one or more expression cassettes under transcriptional control of a promoter functional in a mammalian cell, as described above, for expressing several transgenes within the same target cell, while limiting the risk of interference between transgenes and promoters carried by one single recombinant genome.

The present invention can be advantageously applied to various situations in vitro or ex vivo, e.g. for transducing Ad-refractory cells when Ad capsid modifications cannot be envisaged, when oncolytic Ads need to be delivered to tumors via nonpermissive cell carriers belonging to the immune system, or when the simultaneous delivery of two transgenes by two separate vectors might be beneficial in terms of timing and/or level of cellular expression of the transgene products.

The present invention will be understood more clearly from the further description which follows, which refers to non-limitative examples illustrating the preparation of a recombinant baculovirus expressing the human CAR glycoprotein, and its use for enhancing the transduction of various cells by an adenovirus.

LEGENDS OF THE DRAWINGS

Figure 1. Pseudotyping baculovirus with human CAR glycoproteins.

(a): Western blot analysis of control, parental (BV, lane 1) and CAR-pseudotyped baculovirions (BV ^CAR , lane 2).

(b-g): Immuno-EM analysis, (b, c), General views of immunogold stained BV ^CAR preparations; (d-g), Enlargement of anti-CAR gold-labeled BV ^CAR virions.

Figure 2. EM and immuno-EM of BVCAR.

(A) : Occurrence of BVCAR-BVCAR complexes. Spontaneously occurring pairwise (a-c) or multiple associations (d) of BV ^CAR virions.

(B) : Anti-gp64 immunogold labeling of CAR-pseudotyped baculovirions. Panels (a-c), BV ^CAR virions reacted with monoclonal antibody against peplomer gp64, followed by anti-mouse antibody tagged with 20-nm colloidal gold grains. Panel (d), same reaction as in (a-c) performed on BV ^CAR -Ad5GFP complexes deposited on grids.

Figure 3. Immunogold labeling of BVCAR.

(a): Comparison of the labeling efficiency of BVCAR samples using anti-gp64 or anti-CAR monoclonal antibodies.

(b): Topology of gp64 and CAR molecules on the baculoviral envelope, as determined by immunogold labeling. Figure 4. EM and immuno-EM of BVC AR-Ad5GFP complexes.

BV ^CAR -Ad5GFP complexes stained with uranyl acetate (panels a-c and g-i), or further incubated with anti-CAR monoclonal antibody and 20-nm colloidal gold-tagged anti-mouse

CAR. antibody (panels d-f). Ad5GFP virions are marked with asterisks. Panels a-d show BV virions associated with one single particle of Ad5GFP, whereas panels e-g show BV ^CAR virions associated with two Ad5GFP particles. Panels b and c are enlargements of BV ^CAR - Ad5GFP complexes. Panels h and i show Ad5GFP virions bridging two BV ^CAR virions.

Figure 5. Transduction of CAR-negative (CHO) or CAR-positive cells (CHO-CAR) by BVCAR-Ad5GFP complex.

(A): Fluorescent microscopy. CHO cells transduced by (a) Ad5GFP alone, (b) BV ^CAR GFP alone, or (c) BV ^CAR -Ad5GFP complex.

(B) : Flow cytometry. Bar graph representation of the efficiency of transduction of (a) CHO or (b) CHO-CAR by Ad5GFP alone (open bars), or BV ^CAR -Ad5GFP complex (solid bars).

(C) : Transduction efficiency of CHO cells by control vector BVCARGFP. Flow cytometry analysis of CHO cells (grey bars) or CHO-CAR cells (black bars) transduced by BV ^CAR GFP alone at increasing MOI, as indicated on the x-axis.

Symbols used in the figures were (*) for P<0.05, (**) for P<0.01 , and ns for no significant difference.

Figure 6. Transduction of CAR-negative human cell lines by BVCAR-Ad5GFP complex. (A): Nontumor cells. Fluorescent microscopy of MM39 cells transduced by (a) Ad5GFP alone, (b) BV ^CAR GFP alone, or (c) BV ^CAR -Ad5GFP complex.

(B): Tumor cells. Flow cytometry analysis of human cancer cell lines RD, SKOV3 and SKBR3 transduced by Ad5GFP alone, BV ^CAR GFP alone, or BV ^CAR -Ad5GFP complex.

Figure 7. Transduction of CAR-negative human primary cells by BVCAR-Ad5GFP complex.

Leftmost graphs: flow cytometry. Bar graph representation of the efficiency of gene transfer mediated by Ad5GFP alone versus BV ^CAR -Ad5GFP complex in different human primary cells, as indicated on top of each panel. Cells were transduced by Ad5GFP alone at increasing MOI, or by BV ^CAR -Ad5GFP complexes at constant MOI of BV ^CAR and increasing MOI of Ad5GFP, as indicated on the x-axis. Results, expressed as the percentage of GFP-positive cells, represent the mean of three separate experiments ± SEM. The black bars on the left-end side of the panels represent the value obtained with the control baculoviral vector BV ^CAR GFP alone, at MOI 500 vp/cell.

Rightmost three panels: fluorescent microscopy. Shown are cell samples transduced at the maximal infectivity of each separate vector or biviral complex, as indicated on top of each panel. Cells were transduced by Ad5GFP alone (left panel), BV ^CAR GFP alone (middle panel),

-Ad5GFP complex (right panel). Figure 8. Influence of BVCAR to Ad5GFP ratios on BVCAR-Ad5GFP-mediated transduction of human primary cells.

(a) : Dermal fibroblasts and synoviocytes transduced by BV ^CAR -Ad5GFP complex generated using constant MOI of BV ^CAR and various MOI of Ad5GFP, as indicated on the x-axis.

(b): Cells were transduced by BV ^CAR -Ad5GFP complex generated using constant MOI of Ad5GFP and various MOI of BV ^CAR , as indicated on the x-axis.

(c) : Cell transduction efficiency by BV ^CAR -Ad5GFP complex evaluated using a wide range of BV ^CAR to Ad5GFP ratios indicated on the x-axis..

Figure 9. Role of CAR and fiber knob in BVCAR-Ad5GFP-mediated cell transduction. (a): Requirement for the fiber knob domain in Ad5GFP vector. Human dermal fibroblasts were transduced by Ad5GFP-R7AKnob alone at increasing MOI, or a mixture of BV ^CAR at constant MOI and Ad5GFP-R7AKnob at increasing MOI, as indicated on the x-axis.

(b) : Requirement for CAR glycoprotein on the baculoviral membrane. Human dermal fibroblasts and synoviocytes transduced by a mixture of Ad5GFP and BV ^CAR , or a mixture of Ad5GFP and non-pseudotyped BV (parental AcMNPV empty vector), at constant MOI of Ad5GFP and various BV or BV ^CAR inputs indicated on the x-axis..

(c, d): Requirement for CAR-fiber interaction. Human dermal fibroblasts were transduced by a mixture of BV ^CAR and Ad5GFP, containing anti-CAR monoclonal antibody added at different dilutions (indicated on the x-axis).

Figure 10. Mechanism of cellular uptake of the BVCAR-Ad5GFP complex.

(a, b): Cell binding kinetics. Ad5GFP alone (open symbols), BV ^CAR alone (open symbols) or BV ^CAR -Ad5GFP complex (filled symbols); (a), Ad5GFP genomes : Ad5GFP alone (y = 0.24 x, R2 = 0.993) ; BV ^CAR -Ad5GFP complex (y = 0.49 x, R2 = 0.977). (b), BV ^CAR genomes (y = 10.5 x, R2 = 0.91).

(c): Role of baculoviral gp64 in cell internalization of BV ^CAR -Ad5GFP complex.

(d) : Role of the Ad5GFP moiety in cell internalization of BVCAR- Ad5GFP complex. Human mesenchymal stem cells transduced with a mixture of nonpseudotyped, BV-GFP and Ad5Luc (unbound Ad; leftmost bars), or a mixture of CAR-pseudotyped, BV ^CAR -GFP with Ad5Luc (BV-bound Ad; rightmost bars).

Figure 11. Role of RGD-dependent integrins in BVCAR- Ad5GFP-mediated transduction.

(a) : Transduction efficiency of permissive cells by Ad5EGD-GFP mutant versus Ad 5 GFP.

(b) : Growth rate of Ad5EGD-GFP mutant versus Ad5GFP in permissive cells.

(c, d): Transduction efficiency by the BVCAR-Ad5EGD-GFP complex on dermal fibroblasts (c) and mesenchymatous stem cells (d). Figure 12. EM analysis of the early steps of virus-cell interaction between BVCAR- Ad5GFP complex and CAR-negative cells.

Panels (a-c) show the steps of attachment BV ^CAR -Ad5GFP at the plasma membrane and formation of clathrin-coated vesicles (CCV). Panels (d, e) show co-endocytosed virions of BV ^CAR and Ad5GFP (Ad) within intracytoplasmic vesicles. In (g), an adenovirion is seen in the process of vesicular escape. In (h), two adenovirions are free within the cyoplasm, and electron-dense particles reminiscent of adenoviral cores are seen at the nuclear pore complex (NPC). Panel (f) shows an intravesicular BV ^CAR nucleocapid released from the baculoviral envelope. N, nucleus ; PM, plasma membrane.

EXAMPLES

I - MATERIALS AND METHODS

Cells.

(i) Cell lines.

Spodoptera frugiperda (Sf9) cells were maintained as monolayers at 28°C in Grace's insect medium supplemented with 10% FBS and antibiotics (Invitrogen). Chinese hamster ovarian (CHO) cells, normal (CHO-K1), human embryonic kidney cells (HEK-293), human rhabdomyosarcoma cells (RD), human ovarian carcinoma cells (SKOV3), and human breast carcinoma cells (SKBR3) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and grown in Iscove's medium supplemented with 10% fetal bovine serum (FBS) and 50 mg/ml gentamicin (Invitrogen). CAR-expressing CHO cells (CHO-CAR) were obtained from Dr. J. Bergelson (BERGELSON et al., Science, 275, 1320- 23., 1997).

(ii) Primary cells.

Human synoviocytes were obtained from synovial tissue from rheumatoid arthritis patients undergoing joint surgery. Human dermal fibroblasts were obtained from the skin of a patient undergoing joint surgery for osteoarthritis. Both synoviocytes and dermal fibroblasts were isolated by enzyme digestion and cultured in DMEM supplemented with 10 % FBS and antibiotics (TOH et al., J Immunol, 175, 7687-98, 2005) and were used between passages 4 and 9. Human mesenchymal stem cell (MSC) cultures (established using the French National protocol of the SFGM-TC Society). Briefly, bone marrow aspirates were obtained from the posterior iliac crest of healthy donors after their consent, and bone marrow mononuclear cells were isolated by Ficoll density gradient centrifugation (Lymphoprep, Abcys, Veyrier-du-Lac, France). 2.5 x 10E5/ml mononuclear cells were seeded in a-MEM (Gibco BRL, Paisley, United Kingdom) supplemented with 10 % FBS, 2 mM L-glutamine and 100 U/ml penicillin-streptomycin. Cells were allowed to adhere for 48 h followed by the removal of non-adherent cells. Medium and non-adherent cells were removed every 3 days thereafter. When culture was confluent, adherent cells were detached using trypsin and reseeded into a new flask, for expansion. At the third passage, MSCs were identified by immunophenotypic criteria based on the expression of CD73, CD90, CD 105 and the absence of expression of CD45, CD34, CD 14, CD 19 and HLA-DR before use (LI et al., J. Immunol., 180, 1598-608., 2008). Monocyte-derived human DCs were obtained as follows. Immature dendritic cells were differentiated from primary monocytes obtained from peripheral blood mononuclear cells (PBMCs) of healthy donors upon incubation for 4 to 6 days with 100 ng/ml of interleukin 4 (IL4) and granulocyte-macrophage-colony stimulating factor (GM- CSF), as previously described (GOUJON et al., J. Virol., 77, 9295-304., 2003) Both IL4 and GM-CSF were from R&D. Cells were maintained in complete RPMI 1640 media supplemented with 10 % fetal calf serum (FCS, BioWest). All experiments using human primary cells were performed in accordance with ethical guidelines and regulations, and received approval from the Institutional Review board of the Laennec School of Medicine.

Adenovirus vectors.

Replication-deficient Ad5 vectors (El -deleted) expressing the green fluorescent protein (Ad5GFP) under the cytomegalovirus (CMV) promoter were propagated in HEK-293 cells. The penton base mutant Ad5EGD-GFP, encoding GFP and carrying a RGD-to-EGD substitution at position 340 in the penton base coding sequence, has been described elsewhere (FRANQUEVILLE et al., PLoS ONE, 3, e2894, 2008; WASZAK et al., Mol. Ther., 15, 2008-16., 2007) The fiber mutant Ad5GFP-R7AKnob, carrying a short shafted fiber with seven repeats (R7) and complete deletion of the knob (AKnob) has been described in detail in previous studies (HENNING et al., Hum. Gene Ther., 13, 1427-39., 2002; HONG et al., Mol Ther, 7, 692-9, 2003; MAGNUSSON et al., J Virol, 75, 7280-9, 2001 ; MAGNUSSON et al., J. Gene Med., 4, 356-70., 2002). Ad5Luc, expressing the luciferase gene in the deleted E3 region of Ad5 genome under the control of the SV40 promoter, has been obtained from Pr. Frank Graham (University of Ontarion, Hamilton, Canada), and described in previous studies (MITTAL et al., Virus Res, 28, 67-90, 1993; HONG et al., Embo J, 16, 2294-306, 1997). Adenovirus stocks were purified by CsCl gradient ultracentrifugation by conventional methods (FRANQUEVILLE et al., PLoS ONE, 3, e2894, 2008).

Baculovirus vectors.

The recombinant AcMNPV expressing expressing the full-length human CAR glycoprotein under the control of the polyhedrin promoter (BV ^CAR ) was constructed by cloning the human full-length CAR gene DNA into the Nhe I and Kpn I cloning sites of pBlueBac (Invitrogen) downstream to the polyhedrin promoter. The CAR gene DNA was isolated by digestion of the pcDNA-hCARl plasmid (obtained from Dr. Kerstin Sollerbrant, arolinska Institutet, Stockolm, Sweden; (SOLLERBRANT et al., J. Biol. Chem. , 278, 7439- 44., 2003) ) with Nhe I and Kpn I. The recombinant BV expressing GFP under the CMV promoter (BV-GFP) was kindly provided by Pr. Norman Maitland (University of York at Heslington, York, UK).

BV ^CAR and BV-GFP were propagated by infection of Sf9 cells at MOI of 1 to 2. Concentrated stocks of recombinant BV were prepared as follows. Infected cell supernatants were harvested at 48-60 h post infection (pi), clarified by centrifugation at 2,400 rpm and 4°C for 10 min, and subjected to ultracentrifugation at 28,000 rpm for 1 h at 4° C through a 20 % sucrose cushion. The viral pellet was resuspended by gentle shaking in sterile phosphate buffered saline (PBS) overnight at 4°C, and further purified by isopycnic ultracentrifugation in linear sucrose-D ₂ 0 gradient (DAFONSECA et al., Antiviral Ther., 12, 1 185-203., 2007; HUVENT et al., J. Gen. Virol., 79, 1069-81., 1998). Gradients (10-ml total volume, 30-50 %, w:v) were generated from a 50 % sucrose solution made in D ₂ 0 buffered to pH 7.2 with NaOH, and a 30 % sucrose solution made in 10 mM Tris-HCl, pH 7.2, 150 mM NaCl, 5.7 mM Na ₂ EDTA. The gradients were centrifuged for 18 h at 28 krpm in a Beckman SW41 rotor. 0.5 ml-fractions were collected from the top, and proteins analyzed by SDS- PAGE and Western blotting with the required antibodies. Baculovirions pseudotyped with CAR were produced by single infection of Sf9 cells with BV ^CAR , and isolated from infected cell culture supernatant as above. Infectious titers of BV vector stocks were determined using the plaque assay on Sf9 cells.

Generation of BV ^CAR -Ad5 complex.

The infectivity index, defined as the ratio of infectious virions (determined by the plaque assay method and expressed as plaque-forming units per ml ; pfu/ml) to the total number of physical virus particles per ml (vp/ml) ranged from 1 : 100 to 1 :500 for BVs (VOLKMAN et al., J. Virol., 19, 820-32., 1976), a value which was about 5- to 20-fold lower compared to that of Ad5, which was routinely about 1 :20 to 1 :30. The titer in physical virus particles (vp) of BV and Ad5 vectors was determined by adsorbance measurement at 260 nm ( 260) of 1-ml samples of SDS-denatured virions (0.1 % SDS for 1 min at 56°C) in 1-cm pathlength cuvette, using the respective formula : A260 of 1.0 = 1.1 x 10E12 vp/ml for Ad5 (genomic DNA = 36 kbp) ; and 260 of 1.0 = 0.3 x 10E12 vp/ml for BV (genomic DNA = 134 kbp). Infectious titers of concentrated stocks of BV ^CAR were usually 5 x 10E9 to 1 x 10E10 pfu/ml, and the corresponding physical particle titers ranged between 1 x 10E12 and 5 x 10E12 vp/ml. Ad5GFP particle titers ranged from 1 x 10E12 to 2 x 10E12 vp/ml, with infectious titers between 2 x 10E10 and 5 x 10E10 pfu/ml. To generate BV ^CAR -Ad5GFP complexes with different virus ratios, we only considered the respective titers in vp/ml. In standard experiments, samples of BV ^CAR and Ad5GFP virions in 50 mM Tris-HCl pH 8.0 buffer were mixed and adjusted to a total volume of 20-30 μΐ with the same buffer, then incubated for 1 h at 37°C. Antibodies and proteins.

Monoclonal anti-CAR antibody (clone El . l ; (HEMMI et al., Hum. Gene Ther., 9, 2363-73., 1998)) was obtained from Dr. Silvio Hemmi (University of Zurich, Ziirich, Switzerland). The monoclonal anti-gp64 antibody, clone Ac VI (Santa Cruz Biotechnology, Inc) was used at a working dilution of 1 :50 for immunoelectron microscopy. Mouse monoclonal antibody (mAb) 7A7 directed against the fiber knob domain has been characterized in a previous study (HONG et al., Embo J, 16, 2294-306, 1997) . Group- specific anti-hexon mAb 4C3 was provided by Pr. W.C. Russell (University of St Andrews, Scotland) (RUSSELL et al., J Gen Virol, 56, 393-408, 1981 ; MATTHEWS & RUSSELL, J Gen Virol, 75 ( Pt 12), 3365-74, 1994). Rabbit anti-Ad5 virion, anti-penton base and anti- fiber were all laboratory-made (NOVELLI & BOULANGER, Virology, 185, 365-76, 1991 ; KARAYAN et al., Virology, 202, 782-95, 1994; KARAYAN et al., J Virol, 71 , 8678-89, 1997; FRANQUEVILLE et al., PLoS ONE, 3, e2894, 2008). Human coagulation factor X (FX) was purchased from CRYOPREP (Montpellier, France), and used at the normal adult plasma concentration of 8 μg/ml. Adenoviral capsid proteins, hexon, fiber and penton (base + fiber) proteins were recovered from the pool of excess soluble Ad5 proteins present in Ad5- infected cell lysates used for vector stock preparations. Capsid proteins were purified to homogeneity according to a three-step procedure including ammonium sulfate precipitation and two chromatographic steps using high-performance liquid chromatography (BioLogic DuoFlow; BioRad), as described in detail in previous studies (BOULANGER & PUVION, Eur. J. Biochem., 39, 37-42., 1973; MOLINIER-FRENKEL et al., J. Virol., 76, 127-35., 2002).

Cell transduction assays.

Cells for transduction assays were prepared in 24-well plates containing 1 x 10E5 cells per well. Complexes of BV ^CAR and Ad5GFP virions (B V ^CAR - Ad5 GFP) were prepared by preincubating appropriate volumes of each virus in a total volume of 300 μΐ of DMEM for 1 h at 37°C. The complexes were then added to the cells and incubated for an additional hour at 37°C, after which 200 μΐ prewarmed media was added to each well. Cellular expression of GFP was observed at 36 h post-transduction, using an inverted microscope (Axiovert-135 ; Zeiss, Switzerland). Fluorescence images were taken using an AxioCam digital camera (Zeiss), and analyzed using an Axio Vision program and quantitated by flow cytometry analysis. For quantification, cells were fixed with 2 % paraformaldehyde in PBS overnight, rinsed once with PBS and the proportion of GFP-positive cells determined by FACS analysis (DAKO Galaxy).

Real-time quantitative PCR.

DNA was extrated from murine tissues using the QIAamp DNA Blood Mini Kit (Quiagen, 91974 Courtaboeuf, France). Ad5 genomes were assayed using the following fiber gene primers for real-time PCR (CORJON et al., Mol. Ther., 16, 1813-24., 2008):: GCTACAGTTTCAGTTTTGGCTG (SEQ ID NO: 1 ; sense) and ,

GTTGTGGCCAGACCAGTCCC (SEQ ID NO: 2; reverse).

BV genomes were assayed using the following gp64 gene primers (AYRES et al., Virology, 202, 586-605., 1994):

ATGAGCAGACACGCAGCTTTT (SEQ ID NO: 3; sense) and

GCTGAATGTGGGCAAAGAGG (SEQ ID NO: 4; reverse).

Murine beta-actin gene was used as internal control, with the following primers :

GCTGTGTTCTTGCACTCCTTG (SEQ ID NO: 5; sense) and,

CGCACGATTTCCCTCTCAGC (SEQ ID NO: 6; reverse).

Real-time PCR was performed using a LightCycler® 480 (Roche Diagnostics, F-38240 Meylan, France), and results were expressed as the number of viral genome copies per cell.

Electron microscopy.

Virions of BV ^CAR and BV ^CAR -Ad5GFP complexes were diluted in 20 μΐ

0.14 M NaCl, 0.05M Tris-HCl buffer, pH 8.2 (Tris-buffered saline; TBS) and adsorbed onto carbon-coated formvar membrane on grids. The grids were incubated with primary antibody (monoclonal anti-CAR or anti-gp64 antibody) at a dilution of 1 :50 in TBS for 1 h at room temperature (RT). After rinsing with TBS, the grids were post-incubated with 20-nm colloidal gold-tagged goat anti-mouse IgG antibody (British Biocell International Ltd, Cardiff, UK; diluted to 1 :50 in TBS) for 30 min at RT. After rinsing with TBS, the specimens were negatively stained with 1 % uranyl acetate in H20 for 1 min at RT, rinsed again with TBS, and examined under a JEM 1400 Jeol electron microscope equiped with an Orius-Gatan digitalised camera (Gatan France, 78113 Grandchamp).

Animal model.

All procedures were performed on 5-week-old female BALB/c nu/nu mice (Charles River Laboratories, St. Germain sur l'Arbresle, France). Studies involving animals, including housing and care, method of euthanasia, and experimental protocols were conducted in accordance with a code of practice established by the Experimentation Review Board from the Laennec School of Medicine. These studies were routinely inspected by the Attending Veterinarian to ensure continued compliance with the proposed protocols (PEYRUCHAUD et al., J. Biol. Chem. , 278, 45826-32., 2003). Mice received intravenously in the tail vein 2 x 10E10 vp of Ad5Luc per mouse (control animals) or BV ^CAR -Ad5Luc complex formed in the ratio of 15 BV ^CAR to 1 Ad5Luc vp (2 x 10E10 Ad5Luc and 3 x 10E11 BV ^CAR per mouse). At 48 and 96 h after injection, the mice were anesthetized, injected subcutaneously with endotoxin-free luciferin (Luciferin-EF™ ; Promega, Madison, WI) in PBS at 125 mk/kg, and 10 min later the whole body bioluminescence was visualized using the NightOWL II LB 983 imaging system (Berthold Technologies GmbH, Bad Wildbad, Germany). After noninvasive whole-body imaging, the animals were sacrificed and the level of luciferase expression assayed in different organs, using a Lumat LB 9507 luminometer (Berthold), as previously described (HONG et al., Embo J, 16, 2294-306, 1997; HONG et al., Hum Gene Ther, 10, 2577-86, 1999). Results were expressed as relative light units (RLU) per mg of protein in the respective cell lysates.

RESULTS

EXAMPLE 1: CHARACTERISATION OF THE BACULO VIRUS BV ^CAR PSEUDOTYPED WITH HUMAN CAR GLYCOPROTEIN

Expression of the CAR glycoprotein at the surface of the BV ^CAR virions.

We determined whether progeny viruses produced from BV ^CAR -infected cells carried the CAR glycoprotein on their envelope. Baculovirions released in the culture medium were concentrated by ultracentrifugation on sucrose cushion, and further purified by ultracentrifugation on a linear sucrose density gradient. The fractions at density 1.10-1.15 which contained the baculovirus particles were pooled and analyzed by SDS-PAGE and Western blotting using anti-gp64 and anti-CAR antibodies and anti-mouse IgG conjugate.

The results are shown on Figure 1 (a). A discrete band of anti-CAR-reacting protein species migrating at 45 kDa (an apparent molecular mass consistent with that of CAR glycoprotein) was found to be associated with BV ^CAR virions. This band was absent from the control, parental BV vector (AcMNPV-BGal expressing bacterial beta-Galactosidase).

Baculovirions were then analyzed by immunoelectron microscopy, after deposition on electron microscope (EM) grids and negative staining with uranyl acetate. EM grids were reacted with anti-CAR monoclonal antibody, followed by a secondary anti-mouse antibody coupled to 20-nm colloidal gold particles, and examined under the EM. The results are shown on Figure 1 (b-g).Under our experimental conditions, most anti-CAR gold grains were found to be associated with virus particles of CAR-pseudotyped BV ^CAR , and exceptionally in the background (Fig. 1 b, c). Most baculovirions carried one single gold grain (Fig. 1 d, e), and occasionally two, three or more gold grains (Fig. 1 f, g). With control parental BV virions incubated in parallel with anti-CAR and immunogold-labeled secondary antibody, we observed only the background labeling (not shown).

Occurrence of BV ^CAR -BV ^CAR complexes.

As CAR-CAR interactions contribute to the intercellular tight junctions (HONDA et al., Brain Res Mol Brain Res, 77, 19-28, 2000; WALTERS et al., Cell, 1 10, 789- 99, 2002) , we expected to find BV ^CAR -BV ^CAR complexes under the EM. This was the case, as shown in Figure 2A. Pairwise associations of BV ^CAR virions laying side by side were observed (Fig. 2 A, a-d), although in low frequency (< 5 % of total BV ^CAR virions examined). Interestingly, after anti-CAR immunogold labeling of the BV ^CAR samples adsorbed on grids, gold grains were often seen at the zone of contact between the two virions (Fig. 2 A, a-d), suggesting that the BV ^CAR -BV ^CAR complexes occurred via true CAR-CAR interactions.

Efficiency of CAR pseudotyping of baculovirus : quantitative aspects

The efficiency of pseudotyping of baculovirion by the foreign CAR glycoprotein was evaluated in comparison to the viral envelope glycoprotein gp64, a structural component of the virion called peplomer (SLACK & ARIF, Adv. Virus Res., 69, 99-165., 2007). Samples of BV ^CAR virions deposited on grids were negatively stained with uranyl acetate, then reacted with a monoclonal antibody against gp64, followed by 20-nm colloidal gold-labeled anti-mouse IgG antibody, and examined under the EM.

The results are shown on Figure 2B (panels a-c) We found that most gold- labeling localized near the head of the baculovirion, as expected from the gp64 topology.

The same experimentation was performed on performed on BV ^CAR -Ad5GFP complexes. The results are shown on Figure 2B (panel d). Note that gp64 and Ad5GFP virions are positioned at opposite poles of the baculovirion.

The number of anti-gp64 and anti-CAR gold grains per virus particle were then counted in a population of 70 to 100 individual baculovirions. The results are shown on Figure 3. In our anti-gp64 labeling experiments, ca. 15 % baculovirions carried no grain, implying that this percentage represented the experimental threshold of detection for the baculoviral envelope glycoprotein gp64. For anti-CAR labeling, the number of unlabeled baculovirions was not significantly different, and ranged from 16 to 23 %. In both types of labeling, the most abundant population consisted of baculovirions carrying one single gold grain. Baculovirions with two, three and more grains were found in both types of labeling, although in significantly lower frequency (Fig. 3 a, and refer to Fig. 1 and 2). Taken together, these results indicated (i) that recombinant baculovirus expressing CAR produced a viral progeny pseudotyped by CAR glycoproteins, and (ii) that the immunogold labeling (and hence the accessibility) of foreign CAR molecules on the BV ^CAR envelope was almost as efficient as that of the structural gp64 glycoproteins.

Topology of CAR molecules at the surface of BV ^CAR virions

To analyze the topology of gp64 and CAR molecules on the baculoviral envelope, we arbitrarily divided the baculovirions into 100 map units (mu), and measured the distance between the center of a 20-nm gold grain and the tip of the virus head. In order to compensate for possible distorsion and shrinking during the EM process, the results were expressed as the percentage of virus full length (ca. 250 nm), with the virus head being taken as the origin (0 %), and the end of the stem being attributed the 100 % value.

The results (mean (m) of three separate experiments, m ± SEM) are shown in Figure 3b.

From our knowledge of baculovirus structure, we could predict that most of the anti-gp64 gold grains would localize at or near the head of the baculovirions, and not along its stem structure. Our EM observations were consistent with this prediction: nearly 40% of all anti-gp64 gold grains counted were found within 0-10 mu, and 25 % between 10 and 20 mu (Fig. 3 b). Thus, almost two thirds of the anti-gp64 gold grains localized within 0 and 50 nm. Considering that the approximate size of an IgG molecule is about 15 nm under the EM, the baculovirus-associated primary and secondary antibodies accounted for 30 nm in length, and the colloidal gold for an extra 20 nm. The immuno-EM pattern of gp64 labeling was therefore compatible with the localization of the gp64 at the baculoviral pole. In contrast to gp64, the anti-CAR labeling showed a polydisperse pattern : anti-CAR gold grains were found all along the stem of the BV ^CAR virions, with some preferential sites between 70 and 90 mu (Fig. 3 b ; and refer to Fig. 1 d-g). This suggested that the CAR molecules were excluded from the polar region of the baculoviral envelope in which the gp64 peplomers were inserted.

EXAMPLE 2 : FUNCTIONALITY OF HUMAN CAR ATTACHMENT MOLECULES ON THE BACULOVIRAL ENVELOPE : OCCURRENCE OF BV ^CAR -Ad5GFP COMPLEXES

.We next determined whether CAR glycoproteins present at the surface of the baculovirion were functional as attachment molecules for Ad5.

gyCAR yjrions were mixed with the same number of Ad5GFP vector particles, incubated for 1 h at 37°C, and examined under the EM after negative staining with uranyl acetate, or further incubated with anti-CAR monoclonal antibody and 20-nm colloidal gold-tagged anti-mouse antibody. The results are shown on Figure 4.

Different types of BV ^CAR -Ad5GFP association were observed, but the most frequently seen consisted of binary complexes, or virus duos, composed of 1 baculovirion bound to 1 adenovirion (Fig. 4 a-d). Ternary complexes, or virus trios, formed of 1 BV ^CAR carrying 2 Ad5GFP were more rarely observed (Fig. 4 e-g). Modifications of the particle ratio between BV ^CAR and Ad5GFP in the incubation mixture did not change significantly this EM pattern (not shown).

In the majority of the BV ^CAR -Ad5GFP binary complexes, the Ad particles were found to bind to the stem of BV ^CAR , an observation consistent with the localization of CAR molecules on the BV ^CAR envelope, as determined by our anti-CAR immunogold labeling (refer to Fig. 3 b).

Since an adenovirion carries 12 fibre projections and is therefore multivalent in terms of attachment, we expected that Ad5GFP could bridge two or more BV ^CAR particles. Such higher order complexes were observed under the EM, although in rare occasions : they mainly consisted of ternary complexes formed of one Ad5GFP bound to two BV ^CAR particles (Fig. 4 h, i).

Examination of BV ^CAR -Ad5GFP complexes under the EM at high resolution revealed that some adenovirions were linked to their baculovirus carriers via filamentous structures which resembled the adenoviral fiber. In some cases, two filaments could be distinguished (Fig. 4 b, c ; arrows). This suggested that the binding of Ad5GFP to CAR molecules could occur via more than one single valence.

This observation raised the question of the degree of occupancy and/or accessibility of CAR molecules inserted in the baculoviral envelope. To address this issue, BV ^CAR -Ad5GFP complexes were reacted on grids with anti-CAR antibody followed by secondary 20-nm gold-tagged antibody, as above. Many individual BV ^CAR particles which were associated with one or two Ad5GFP particles were still labeled by anti-CAR, and carried one (Fig. 4 d) or several gold grains (Fig. 4 e, f). This indicated that when BV ^CAR -Ad5GFP complexes were formed in a binding reaction involving equal numbers of the two viruses, several CAR molecules present at the BV CAR surface were sti *ll unoccupied and available for anti-CAR antibody binding, or CAR-CAR interaction. This was also suggested by the anti- CAR labeling of BV ^CAR -BV ^CAR complexes shown in Fig. 2 A. Taken together, these results indicated that CAR functioned as a bona fide Ad5 attachment molecule at the surface of the baculovirions.

EXAMPLE 3: TRANSDUCTION OF CAR-NEGATIVE CHO CELLS BY BV ^CAR - Ad5GFP COMPLEX

Transduction efficiency.

The functionality of our BV ^CAR -Ad5GFP complex and the capacity of BV ^CAR to mediate Ad5 gene delivery by overcoming the lack of CAR at the cell surface was first assessed on CHO cells, which are CAR-negative and poorly permissive to Ad5 (BERGELSON et al., Science, 275, 1320-23., 1997).

CHO cells were transduced by Ad5GFP alone (MOI 100 vp(virus particles)/cell), or BV ^CAR -Ad5GFP complex (Ad5GFP MOI 100 vp/cell ; Ad5GFP : BV ^CAR vp ratio of 1 : 10) and cellular expression of GFP was observed by fluorescent microscopy.

The results are shown on Figure 5A (panels a and c). The transduction level obtained with a BV ^CAR -Ad GFP complex generated with a ratio of Ad5GFP to BV ^CAR virus particles of 1 to 10 in the mix was greatly enhanced, compared to Ad5GFP alone at similar MOI of Ad5GFP vector.

The efficiency of transduction was further quantified by flow cytometry. CHO cells were transduced by Ad5GFP alone (MOI from 0 to 500 vp/cell), or BV ^CAR - Ad5GFP complex, generated by mixing a constant amount of BV ^CAR (corresponding to 500 vp/cell) with increasing amounts of Ad5GFP (from 0 to 500 vp/cell). The transduction efficiency was expressed as the percentage of GFP-positive cells (mean of three separate experiments ± SEM).

The results are shown on Figure 5 B (graph a). 65-70 % CHO cells were transduced by the BV ^CAR -Ad5GFP complex at a MOI range of 100 to 500 in terms of Ad5GFP vp/cell, compared to 10-15 % in control samples transduced by Ad5GFP alone at the same MOI. Contribution of BV ^CAR to the augmentation of Ad5-mediated transduction efficiency.

The role of BV ^CAR in the transduction enhancement by the complex was evaluated using BV ^CAR GFP alone. BV ^CAR GFP is a recombinant AcMNPV expressing the GFP gene under the control of CMV promoter (the same promoter as in Ad5GFP), and pseudotyped with CAR by coinfection of Sf9 cells with BV ^CAR .

CHO cells were transduced by BV ^CAR GFP alone (1 ,000 vp/cell) and cellular expression of GFP was observed by fluorescent microscopy.

The results are shown on Figure 5A (panel b). The level of CHO cell transduction obtained with BV ^CAR GFP was lower than with the BV ^CAR -Ad5GFP complex, but higher than with Ad5GFP at the same MOI (refer to panels c and a in Fig. 5 A, respectively). This suggested that both viruses contributed to the enhancing effect on transduction by the virus duo, but that BV ^CAR contributed to a higher level than Ad5GFP.

Specificity of transduction by BV ^{C lj?} -Ad5GFP complex.

CHO-CAR is a CHO-K1 -derived cell line which constitutively expresses CAR and is fully susceptible to Ad5 infection (BERGELSON et al., Science, 275, 1320-23., 1997). CHO-CAR cells were infected with BV ^CAR -Ad5GFP, at constant MOI of BV ^CAR (corresponding to 500 vp/cell) and various MOI (from 0 to 500 vp/cell) of Ad5GFP, or with Ad5GFP alone at the same MOI as in the complex. The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM).

The results are shown on Figure 5B (graph b). At low MOI (inferior to 50 vp/cell, corresponding to 2 to 5 pfu cell), CHO-CAR cells were transduced with a slightly higher efficiency by BV ^CAR -Ad5GFP, compared to Ad5GFP alone (1.5- to 2-fold), an effect was no longer observed at higher MOI (100-500 vp/cell; Fig. 5 B, b). The absence of enhanced transduction of Ad5-permissive cells by the BV ^CAR -Ad5GFP complex suggested that this effect was specific in nature.

Role of CAR glycoproteins in BV -mediated cell transduction.

The AcMNPV envelope glycoprotein gp64 represents the major cell- attachement component of this virus (MONSMA et al., J. Virol., 70, 4607-16., 1996) . Gp64 binds to insect cell plasma membrane receptors, as well as to a large repertoire of mammalian cell surface glycoproteins (KOST & CONDREAY, Trends Biotechnol, 20, 173-80, 2002; HU, Adv. Virus Res., 68, 287-320., 2006; HU, Curr. Gene Ther., 8, 54-65., 2008).

In order to determine the respective roles of baculoviral gp64 and extrinsic CAR glycoprotein in the efficiency of cell transduction, CHO and CHO-CAR cells were incubated with CAR-pseudotyped vector BV ^CAR GFP at different MOI (from 0 to 500 vp/cell) and the efficiency of transduction was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM). The results are shown on Figure 5C. CHO-CAR cells were found to be significantly more permissive to BV ^CAR GFP than CHO (2- to 3-fold). This suggested that BV ^CAR GFP could use different pathways to attach to and enter CHO cells, e.g. one involving gp64 and its cellular ligand(s), the other mediated by interaction between baculovirus- displayed CAR molecules and cell plasma membrane-exposed CAR. This was reminiscent of the CAR-CAR interaction suggested by the EM observation of dimers of CAR-pseudotyped baculovirions (refer to Fig. 2 A).

EXAMPLE 4: TRANSDUCTION OF CAR-NEGATIVE HUMAN CELL LINES BY BV ^CAR -Ad5GFP COMPLEX

Nontumor cell line.

Human glandular tracheal cells MM39 fail to express CAR and are poorly permissive to Ad5 (GADEN et al., Am J Respir Cell Mol Biol, 27, 628-40, 2002; GADEN et al., J Virol, 78, 7227-47, 2004; GRANIO et al., Am J Respir Cell Mol Biol, 37, 631 -9, 2007).

MM39 cells were transduced by Ad5GFP alone (MOI 20 vp/cell), BV ^CAR GFP alone (500 vp/cell), or BV ^CAR -Ad5GFP complex (Ad5GFP MOI 20 vp/cell ; Ad5GFP : BV ^CAR vp ratio of 1 : 25) and cellular expression of GFP was observed by fluorescent microscopy.

The results are shown on Figure 6A. As observed with CHO cells, a net augmentation of the transduction efficiency (30- to 40-fold ) was obtained when MM39 cells were incubated with BV ^CAR -Ad5GFP, compared to control MM39 samples transduced with single vectors at the same MOI, Ad5GFP or BV ^CAR GFP.

Tumor cell lines.

Gene transduction mediated by BV ^CAR -Ad5GFP complexes were also evaluated on rhabdomyosarcoma cells (RD), ovarian carcinoma cells (SKOV3) and breast carcinoma cells (S BR3), three human cancer cell lines which are poorly transduced by Ad5 (HENNING et al., Hum. Gene Ther., 13, 1427-39., 2002).

RD, SKOV3 and SKBR3 cells were transduced by Ad5GFP alone (20 vp/cell), BV ^CAR GFP alone (500 vp/cell), or BV ^CAR -Ad5GFP complex (Ad5GFP MOI of 20 vp/cell ; Ad5GFP : BV ^CAR vp ratio of 1 : 25). The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM).

The results are shown on Figure 6B. The efficacy of BV ^CAR -Ad5GFP transduction was significantly higher for the three types of cancer cells, compared to Ad5GFP alone. For RD cells, the percentage of transduced cells improved by almost one order of magnitude, from 5% with Ad5/GFP to 45 % with BV ^CAR -Ad5GFP, and for SKOV3 cells, the augmentation was 7- to 8-fold higher, from 2.5 % (with Ad5GFP) to 21 % (with BV ^CAR - Ad5GFP). However, in the case of S BR3 cells which were slightly permissive to Ad5, the increase in transduction was only 2- to 3-fold, from 12 % (Ad5GFP) to 35 % (BV ^CAR - Ad5GFP). As for CHO and MM-39 cells, the levels of transduction of RD and SKBR3 cells by the control vector BV ^CAR GFP alone was intermediate between those of Ad5GFP and BV ^CAR -Ad5GFP. Interestingly, the level of SKOV3 transduction was almost equivalent using BV ^CAR -Ad5GFP or BV ^CAR GFP, confirming that the contribution of BV ^CAR to the transduction enhancement by the BV ^CAR -Ad5GFP complex was greater than that of Ad5GFP.

For the three human cancer cell lines tested (RD, SKOV3 and SKBR3) a significant augmentation of gene delivery (3- to 10-fold) is observed with BV ^CAR -Ad5GFP.

EXAMPLE 5: TRANSDUCTION OF HUMAN PRIMARY CELLS BY BV ^CAR -Ad5GFP COMPLEX

Several types of human primary cells have been reported to be refractory to or poorly transduced by Ad5 vectors, e.g. dermal fibroblasts and synoviocytes (TOH et al., J Immunol, 175, 7687-98, 2005).

Dermal fibroblasts, synoviocytes, human mesenchymal stem cells (MSCs), immature monocyte derived-dendritic cells (DCs), and PBMCs were transduced by Ad5GFP alone at increasing MOI, or by BV ^CAR -Ad5GFP complexes at constant MOI of BV ^CAR (500 vp/cell) and increasing MOI of Ad5GFP, and analyzed by flow cytometry. The same cell types were transduced by Ad5GFP alone, BV ^CAR GFP alone, or BV ^CAR -Ad5GFP complex at the maximal infectivity of each separate vector or of the biviral complex, and analyzed by fluorescence microscopy and flow cytometry.

The results are shown on Figure 7.

For dermal fibroblasts cells (Fig. 7 a), a progressive increase in transduction was observed with increasing MOI of Ad5GFP, and the maximum transduction efficiency (82 % GFP-positive cells) was reached at Ad5GFP MOI of 20 vp/cell.

Synoviocytes (Fig. 7 b)were moderately permissive to Ad5, and only 20 % cells were transduced at Ad5GFP MOI of 20 vp/cell. However, a transduction of 80 % cells was obtained using the BV ^CAR -Ad5GFP complex at the Ad5GFP dose of 20 vp/cell.

MSCs (Fig. 7 c) were transduced to about 25-28 % with BV ^CAR -Ad5GFP, versus 2% with Ad5GFP alone at MOI 20, i.e. a 10-fold increase.

In the case of immature monocyte derived-dendritic cells (DCs: Fig. 7 d) there was a moderate increase in transduction with BV ^CAR -Ad5GFP (2-fold), and the number of GFP-positive DCs plateaued at around 12-15 % at the relatively high Ad5GFP MOI of 500 vp/cell.

For PBMCs (Fig. 7 e), the transduction levels were low, but the increase was significant, from 0.1 % with Ad5GFP alone to 2 % with BV ^CAR -Ad5GFP at Ad5GFP MOI of 1 ,000 vp/cell.

As for CHO, RD and SKBR3 cells, the levels of transduction of the primary cells treated with control vector BV ^CAR GFP was intermediate between those of Ad5GFP and BV ^CAR -Ad5GFP (Fig. 7, black bars in the graphs; middle panels on the right). In the case of dermal fibroblasts, synoviocytes and mesenchymal stem cells, BV ^CAR -Ad5GFP-mediated transduction increased by one order of magnitude, and, more importantly, at a significantly low Ad5GFP inputs (MOI of 20 vp/cell). For cells of myeloid origin such as PBMCs and monocyte-derived DCs, the increase in BV ^CAR -Ad5GFP-mediated transduction was less pronounced (only 2-fold), and only observed at high Ad5 vector doses of MOI 1,000 and 500 respectively.

EXAMPLE 6: REQUIREMENTS FOR BV ^CAR -Ad5GFP COMPLEX FORMATION AND CELL TRANSDUCTION ENHANCEMENT

Transduction efficiency versus ratio of BV ^CAR to Ad5GFP particles.

In order to determine the optimal conditions for cell transduction by the biviral complex, we prepared a range of BV ^CAR -Ad5GFP mixtures differing by their ratios of BV ^CAR to Ad5GFP vp, and assayed their gene transfer efficiency on two types of primary cells, dermal fibroblasts and synoviocytes. The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM).

In one set of transduction experiments, the number of BV ^CAR vector particles was kept constant (500 vp/cell) and Ad5GFP MOI varied from 0.1 to 20 vp/cell.

The results are shown on Figure 8(a). For both cell types, the level of transduction increased in an Ad5GFP dose-dependent manner and 80-85 % cells were found to be GFP-positive at 20 vp/cell.

In another set of experiments, Ad5GFP MOI was kept constant (20 vp/cell) whereas BV ^CAR particles varied from 0 to 1,000 vp/cell.

The results are shown on Figure 8(b). A plateau of maximum cell transduction (80-85 % GFP-positive cells) was obtained for both cell types at a ratio of 20 Ad5GFP to 500 BV ^CAR particles. Increasing the number of BV ^CAR particles over this value did not augment the transduction efficiency.

A wider range of Ad5GFP to BV ^CAR vp ratios was then tested, and the transduction efficiency represented as a function of the vp ratio values. The results are shown on Figure 8(c).

The bar graph representation followed the Gaussian mode, with the highest transduction efficiency obtained at a ratio of 100 BV ^CAR to 3 Ad5GFP particles. We interpreted this value in terms of cell transduction as the result of several parameters influencing the cell transduction. These included (i) the occurrence of a certain number of CAR-negative BVs in the population of virus carrier, as shown above, (ii) the dissociation constant of the equilibrium reaction between free and BV ^CAR -bound Ad5GFP in the mixture, which has not been experimentally determined for Ad5 virion and pseudotyped BV ^CAR , and (iii) the cellular response to this viral duo. Unless otherwise stated, we generated BV ^CAR - Ad5GFP complexes using vp ratios ranging from 20 BV ^CAR : 1 Ad to 30 BV ^CAR : 1 Ad. Requirement for the knob domain on Ad5GFP.

In order to verify that the Ad5 virions present within the BV ^CAR -Ad5GFP complexes bound to BV ^CAR via their fiber knob domain, we transduced dermal fibroblasts with a mixture of BV ^CAR (at a constant MOI of 500 vp/cell) and Ad5GFP-R7AKnob (at increasing MOI of 0 to 1000 vp/cell). Ad5GFP-R7AKnob carried knob-deleted (AKnob) short-shafted fibers of seven repeats (R7) and lacked its CAR-binding domains. The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM).

The results are shown on Figure 9(a). No detectable enhancement of Ad5GFP-R7AKnob-mediated transduction was observed in the presence of BV ^CAR , compared to Ad5GFP-R7AKnob alone, implying that the integrity of the knob domain was indispensable for the positive effect of BV ^CAR on Ad5 transduction.

CA R

Requirement for CAR on the envelope of BV

The enhancement of Ad5GFP-mediated cell transduction in the presence of gyCAR _m jgh _t k _e foe to a certain degree of nonspecific cellular engulfment of Ad5 vector in the presence of baculovirions, and not to the formation of BV ^CAR -Ad5GFP complex via specific CAR-fiber knob interaction. To address this issue, we mixed Ad5GFP at constant MOI (10 vp/cell) with nonpseudotyped BV, (parental AcMNPV) empty vector at various doses (0, 250, 500 vp/cell), and analyzed the transduction level of synoviocytes and dermal fibroblasts using the mixture of unbound viruses, in comparison with the transduction mediated by BV ^CAR -Ad5GFP complexes generated with the same virus ratios. The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM).

The results are shown on Figure 9(b). No significant effect on the level of cell transduction was observed with the mixtures of unbound viruses, compared to the corresponding BV ^CAR -Ad5GFP complexes. This indicated that the enhancing effect on cell transduction by the complex depended on the presence of CAR molecules at the surface of the baculovirions, and on CAR-mediated interaction with Ad5GFP.

Blockage of BV ^CAR -Ad5GFP-mediated cell transduction by anti-CAR antibody.

To further demonstrate the role of CAR glycoprotein in bridging Ad5GFP to gyCAR j _n ^ _e ^ _ua j _v j _{ms m} i _x ure, we analyzed the effect on dermal fibroblasts transduction of an anti-CAR monoclonal antibody added at different dilutions.

Human dermal fibroblasts were transduced by a mixture of BV ^CAR (MOI 250 vp/cell) and Ad5GFP (MOI 20 vp/cell). In a first set of experimentations ('post'), the two viruses were premixed and incubated for 1 h at 37°C before the anti-CAR antibody was added. In a second set of experimentations ('pre') the anti-CAR antibody was added simultaneously with both viruses. The virus and antibody were further incubated for 1 h at 37°C. Controls consisted of Ad5GFP at the same MOI incubated with the same antibody dilutions. The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM).

The results are shown on Figures 9 (c) and 9 (d).

When anti-CAR antibody was added after the mixing, when CAR-fiber bonds had already formed, no effect in Ad5 gene transfer was detected (Fig. 9 c). In contrast, when anti-CAR antibody was added simultaneously to the viral mixture, inhibition of gene transfer was observed in a dose response manner, and the basal level of transduction was reached in the presence of the undiluted antibody sample (Fig. 9 d). These results confirm the role of CAR in the generation of BV ^CAR -Ad5GFP complex, and its requirement for the cell transduction enhancement.

EXAMPLE 7: MECHANISM OF CELLULAR UPTAKE OF BV ^CAR -Ad5GFP COMPLEX

Kinetics of cell binding and uptake of BV ^CAR -Ad5GFP.

There were several parameters, in addition to baculoviral tropism, that might lead to the superior transduction of CAR-negative cells by the dual vector BV ^CAR - Ad5GFP.

In order to investigate the possible kinetic benefits of this complex, CHO cells were incubated at 37°C for 50 min with Ad5GFP alone or BV ^CAR -Ad5GFP complex at the same MOI in terms of Ad5GFP vector. Cell samples were withdrawn at 10-min intervals, and cell-associated virions were assayed in cell lysates using real-time quantitative PCR Results were expressed as the number of adenoviral and baculoviral genomes recovered per cell, using beta-actin gene as internal control.

The results (mean of three separate experiments ± SEM) are shown on Figure 10 (a) for Ad5GFP and Figure 10 (b) for BV ^CAR . The number of Ad5 genome copies recovered per cell was found to be 2-fold higher for BV ^CAR -Ad5GFP at all time points, compared to control Ad5GFP. In addition, the slope of the curves of cell-bound viruses versus time indicated that the cellular uptake of Ad5GFP occurred at a significantly higher rate when complexed with BV ^CAR , compared to Ad5GFP alone (2-fold ). By contrast, the cell binding kinetics of BV ^CAR and the number of cell-associated baculoviral genome copies did not change significantly when BV ^CAR was alone or in complex with Ad5. These data suggested that the presence of BV ^CAR in the complex provided significant kinetic benefits to Ad5GFP, and not only an advantage in terms of cell tropism. Interestingly, the ratio of viral genomes recovered from BV ^CAR -Ad5GFP-infected cells at 30-50 min pi (2 Ad5GFP to 50-60 BV ^CAR ) corresponded to the ratio required for optimal cell transduction (refer to Fig. 8 c).

Role of baculoviral glycoprotein gp64.

We next addressed the question as to whether the envelope glycoprotein gp64 of BV ^CAR was involved in the cell attachment and uptake of the BV ^CAR -Ad5GFP complex, using dermal fibroblasts as the cellular target. BV ^CAR -Ad5GFP complex, at the BV ^CAR : Ad5GFP MOI ratio of 500:20vp/cell, was preincubated for 1 h at 37°C with different dilutions of anti-gp64 monoclonal antibody, and added to monolayers of human dermal fibroblasts. The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM).

The results are shown on Figure 10 (c). We found that the BV ^CAR -Ad5GFP- mediated gene transfer was inhibited in the presence of anti-gp64 monoclonal antibody in a dose-dependent manner, suggesting that gp64 was the major attachment protein of the complex. However, cell transduction was not totally inhibited, and the inhibitory effect plateaued at a residual value equivalent to 2-fold the basal level of transduction observed with Ad5GFP alone. This suggested that baculoviral envelope glycoprotein(s) other than gp64 (e.g. CAR) might play a role in the cell attachment of BV ^CAR -Ad5GFP, or/and that the residual transduction was due to an alternative cell entry pathway, e.g. via macropinocytosis.

Influence of Ad5 virions on BV ^CAR -Ad5GFP-mediated cell transduction : endosomal escape and cell entry.

It is known that Ad5 is very efficient in endosomal escape, and this represents one of its advantages as a gene vector (HONG et al., Virology, 262, 163-77, 1999; GADEN et al., Am J Respir Cell Mol Biol, 27, 628-40, 2002; RUSSELL, J. Gen. Virol., 81 , 2573-604., 2000). In order to determine whether the adenoviral moiety of the BV ^CAR -Ad5GFP complex was beneficial to the internalization of baculovirions, we used GFP-expressing BV vectors with or without CAR-pseudotyping, BV ^CAR GFP and BV-GFP, respectively, for transducing human mesenchymal stem cells.

BV ^CAR GFP vector was incubated with Ad5Luc, an Ad5 vector expressing the firefly luciferase (HONG et al., Embo J, 16, 2294-306, 1997; MITTAL et al., Virus Res, 28, 67-90, 1993). BV ^CAR GFP MOI was kept constant (500 vp/cell), while Ad5Luc MOI varied in the mix (MOI 0, 50 or 100 vp/cell). Control samples consisted of (i) BV ^CAR GFP alone without Ad5Luc, and (ii) nonpseudotyped BV-GFP at the same constant dose (500 vp/cell) mixed with increasing MOI of Ad5Luc. The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry (mean of three separate experiments ± SEM).

The results are shown of Figure 10 (d).

A modest, but significant increase of GFP expression was detected in MSCs transduced by BV-GFP in the presence of Ad5Luc, compared to BV-GFP alone (50%; unbound Ad). A similar level of enhancing effect was observed with BV ^CAR GFP mixed with Ad5Luc (BV-bound Ad), compared to BV ^CAR GFP alone. This indicated that Ad5 had only a discrete positive effect on the cellular internalization of the BV-GFP vector, and that this effect did not require a physical bond between baculovirion and adenovirion. Role of penton base-RGD-integrin recognition.

To determine the contribution of RGD-dependent integrins in cell transduction by BV ^CAR -Ad5GFP complex, we generated another baculoviral-adenoviral complex using Ad5EGD-GFP mutant instead of the Ad5GFP vector. Due to its RGD-to-EGD substitution at position 340 in the penton base, Ad5EGD-GFP mutant vector failed to recognize RGD-dependent integrins. However, since the penton base mutation could mask or bias possible effects of BV ^CAR in the BV ^CAR -Ad5EGD-GFP complex, we first analyzed the intrinsic infectivity of Ad5EGD-GFP in permissive cells, in comparison to control Ad5GFP. Ad5EGD-GFP stocks showed a range of infectivity indices (pfu :vp ratio) slightly inferior to that of control Ad5GFP vector grown in parallel, e.g. 1 : 108 versus 1 :48, respectively, for the samples used in the present study.

The transduction efficiency of Ad5-permissive cells HEK-293 cells by Ad5EGD-GFP mutant versus Ad5GFP was assayed. Aliquots of HEK-293 cells (1.75 x 10E5/well) were infected for 1 h with Ad5EGD-GFP or control vector Ad5GFP at different MOI (from 0 to 1000 vp/cell), and the percentage of GFP-positive cells determined by flow cytometry at 48 h pi

The results (mean of three separate experiments ± SEM) are shown on Figure 11 (a) The MOI required for 50 % cell transduction (transduction dose efficient-50 % ; TDE-50) was found to be 500 vp/cell for Ad5EGD-GFP, versus 5-fold lower for Ad5GFP (TDE-50 =100 vp/cell), and the maximum transduction was obtained at MOI 1,000 vp/cell for Ad5EGD-GFP, versus MOI 500 for Ad5GFP (Fig. 11 a). These data showed that Ad5EGD- GFP infection was delayed, compared to control vector Ad5GFP.

The growth rate of Ad5EGD-GFP mutant versus Ad5GFP in HEK-293 cells was also assayed. Samples of 5 x 10E4 HEK-293 cells were infected at a MOI of 10 pfu/cell at 37°C for 1 h, rinsed once, and further incubated in culture medium at 37°C. Cells were harvested at 24, 48 and 72 h pi, lysed by freeze-thawing in 0.2 ml PBS and soluble supernatants titered on HEK-293 cells. Titers were expressed as pfu/cell.

The results (mean of three separate experiments ± SEM) are shown on Figure 11 (b) The growth rates were similar for both vectors in HEK-293 cells, but the titer of infectious virus progeny recovered at 24, 48 and 72 h pi was 3- to 4-fold lower for Ad5EGD- GFP, compared to Ad5GFP (Fig. 11 b). These data indicated that Ad5EGD-GFP was slightly, but significantly impaired by its penton base mutation.

Taking into account this phenotype of Ad5EGD-GFP we infected human dermal fibroblasts with Ad5EGD-GFP alone or BV ^CAR -Ad5EGD-GFP complex at higher MOI than those used previously with Ad5GFP and BV ^CAR -Ad5GFP. Of note, human dermal fibroblasts express alphaV integrins (HIDAKA et al., J. Clin. Invest., 103, 579-87., 1999)

For testing the transduction efficiency dermal fibroblasts and mesenchymatous stem cells were transduced by Ad5EGD-GFP alone or a mixture of BV ^CAR at constant MOI (500 vp/cell) and Ad5EGD-GFP at increasing MOI (from 0 to 1000 vp/cell). The transduction efficiency was expressed as the percentage of GFP-positive cells, assayed by flow cytometry at 48 h pi (mean of three separate experiments ± SEM).

The results for dermal fibroblasts are shown on Figure 11 (c). Less than 10% cells expressed GFP after transduction by Ad5EGD-GFP at MOI 1 ,000. With BV ^CAR - Ad5EGD-GFP however, a 2- to 3-fold increase in transduction efficiency was observed at MOI 200 and higher.

This moderate, although significant augmentation was confirmed with other primary cells, mesenchymatous stem cells, as shown on Figure 11 (d). MSCs were transduced by B V ^CAR - Ad5 EGD-GFP with a 20-fold higher efficiency at MOI 100, and 10-fold higher at MOI 200, compared to Ad5EGD-GFP alone. This implied that the integrity of penton base RGD motifs and their interaction with cellular integrins were not required for the BV ^CAR - mediated augmentation of Ad5EGD-GFP transduction, and that the BV ^CAR -Ad5GFP complex could bypass the RGD-integrin endocytic pathway.

EXAMPLE 8: EM ANALYSIS OF CELL ATTACHMENT AND ENTRY OF BV ^CAR - Ad5GFP COMPLEX INTO CAR-DEFECTIVE CELLS

Monolayers of CHO cells were incubated with BV ^CAR -Ad5GFP (complex generated with a Ad5GFP to BV ^CAR ratio of 1 : 25) for 1 h at 37°C, and cells harvested at the end of this incubation period, fixed and processed for EM analysis.

The results are shown on Figure 12. Complexes were seen at the cell surface, near or in close contact with the plasma membrane (Fig. 12 a-d). At the point of BV ^CAR -cell contact, a curvature of the plasma membrane with electron-dense material at its inner leaflet suggested the formation of clathrin-coated pit (Fig. 12 c), as previously described (LONG et al., J. Virol., 80, 8830-33., 2006). Co-endocytosed baculovirions and adenovirions were observed within cytoplasmic vesicles (Fig. 12 d, e). Adenovirions were occasionally seen in the process of vesicular escape with partial disruption of the endosomal membrane (Fig. 11 g), or free within the cytoplasm, at the vicinity of nuclear pores (Fig. 12 h). In contrast to Ad5 particles, baculoviral nucleocapsids were not observed within the cytoplasm, and were still found within vesicles at 1 h pi (Fig. 12 f). This suggested that adenovirions were released into the cytoplasm at a faster rate than baculovirions. In none of the numerous cells examined we observed a simultaneous endosomal escape of the two virions. This EM pattern was consistent with the relatively slow rate of baculovirus release into the cytosol of mammalian cells (VAN LOO et al, J Virol, 75, 961-70, 2001), and supported the data on BV- bound and unbound Ad5Luc presented in Fig. 10 d.

The results described in Examples 6-8 above show that the mechanism of augmentation of cell transduction of primary cells (e.g. dermal fibroblasts and synoviocytes) by BV ^CAR -Ad5GFP in vitro, compared to Ad5GFP alone, required (i) the interaction of adenoviral fibers with CAR molecules inserted in the baculoviral envelope, and (ii) the cell attachment of the BV partner via its gp64 peplomer ; (iii) however, it did not depend on the interaction of penton base RGD motifs of the Ad5GFP partner with cellular integrins ; (iv) kinetic analysis of the virus-cell binding reaction showed that the presence of BV ^CAR in the complex was beneficial to Ad5GFP, in terms of number of cell-bound virions, and rate of cell attachment ; (v) by contrast, the benefit provided by Ad5GFP to its BV ^CAR partner in terms of rate of endosomal escape and cell internalization was modest.

Our data with control nonpseudotyped baculoviral vector BV-GFP, and BV- bound or unbound Ad5 vector, suggested that the helper function of BV ^CAR towards Ad5GFP vector (2- to 40-fold increased transduction in the various cell types tested), was much higher than in the opposite scenario, when Ad5 was used as the helper of BV ^CAR -GFP (only 50 %). We assume that this was due to the mechanisms of vesicular escape, which differ for the two viruses. Both BVs and subgroup C Ads are endocytosed into early . endosomes, but are released into the cytosol by different mechanisms: Ads rapidly escape from endosomes by endosomolysis (HORWITZ, Adenoviruses, In D. M. Knipe and P. M. Howley (ed.), Fields Virology, 2301 -26., 2001. Lippincott, Williams & Wilkins, Philadelphia), while BVs use membrane fusion between baculoviral envelope glycoprotein and the endosomal membrane (SLACK & ARIF, Adv. Virus Res., 69, 99-165., 2007). Our data indicated that the cell entry pathway and rate of endosomal escape of BV ^CAR via gp64-mediated membrane fusion were not greatly affected by the presence of its Ad5GFP partner in the BV ^CAR -Ad5GFP complex. However, both partners of the BV ^CAR -Ad5GFP duo played their own partition in one or the other step of the cell entry pathway, and cellular transduction benefited from the ensemble.

EXAMPLE 9: BIODISTRIBUTION OF BV ^CAR -Ad5LUC COMPLEX IN VIVO IN A MOUSE MODEL

The preferential tissue localization of unmodified baculoviral vectors injected in the mouse tail vein has been reported to be, in the decreasing order, heart, spleen, liver, kidney, lung and brain (KIM et al., J. Biotech., 125, 104-09., 2006) . However, Ad5 vectors administered via the same way are preferentially delivered to the liver (KALYUZHNIY et al., Proc Natl Acad Sci U S A, 105, 5483-8, 2008; PARKER et al., Blood, 108, 2554-61 , 2006; VIGANT et al., Mol Ther, 16, 1474-80, 2008; WADDINGTON et al., Cell, 132, 397-409, 2008). It was therefore of interest to determine the biodistribution of our BV ^CAR -Ad5 complex, and evaluate the respective influence of one or the other partner of the duo on the biodistribution of the complex in an animal model. To this aim, 5-week-old Balb/C nude mice received intravenously a bolus of 2 x 10E10 vp of Ad5Luc or of BV ^CAR - Ad5Luc complex (2 x 10E10 Ad5Luc and 3 x 10E11 BV ^CAR , i.e. a ratio of BV ^CAR to Ad5Luc vp of 15 to 1), and the level of luciferase expression analyzed by noninvasive whole-body imaging at days 2 and 4. The bioluminescent signal localized massively within the liver, and no qualitative difference could be detected between control mice receiving Ad5Luc alone and mice receiving the BV ^CAR -Ad5Luc complex (not shown). Luciferase expression was then quantitatively assayed in different organs, and again the results showed that hepatic tissue was the preferential localization of both Ad5Luc alone and BV ^CAR -Ad5Luc complex. In the other organs investigated, spleen, kidney, lung, brain, heart and skeletal muscle, no significant difference in the levels of luciferase expression was found between Ad5Luc alone and the BV ^CAR -Ad5Luc complex. The same organ distribution was observed when adenoviral genomes were quantitatively assayed using real-time quantitative PCR (data not shown). Of note, baculoviral genomes were recovered from the liver, as well as from the other tissues, and their relative distribution paralleled that of adenoviral genomes (data not shown).

Therefore, in vivo, after intravascular administration in Balb/C nude mice, the biodistribution of BV ^CAR -Ad5Luc complex was unchanged compared to Ad5Luc alone, and the liver remained the preferred destination of the viral duo.

EXAMPLE 10: INFLUENCE OF FX ON BV ^CAR -Ad5GFP-MEDIATED TRANSDUCTION OF CAR-NEGATIVE CELLS IN VITRO.

It has been shown recently that Ad5 hexon interacts with blood coagulation factor FX, and to a lesser degree with FVII, FIX, and anticoagulant factor Protein C (KALYUZHNIY et al., Proc Natl Acad Sci U S A, 105, 5483-8, 2008; PARKER et al., Blood, 108, 2554-61 , 2006; VIGANT et al., Mol Ther, 16, 1474-80, 2008; WADDINGTON et al., Cell, 132, 397-409, 2008). The hexon-FX interaction is considered as the major determinant of the preferential delivery of nonmodified Ad5 vectors to hepatocytes after in vivo administration. The next experiments were aimed at determining the possible role of FX in the hepatotropism of the BV ^CAR -Ad5 complex, using an indirect, in vitro approach. Transduction of CHO cells by BV ^CAR -Ad5GFP or Ad5GFP alone was performed in the presence or absence or FX. As expected from previous studies, a 20-fold increase in gene transfer efficiency was observed with Ad5GFP + FX, compared to control Ad5GFP without FX : 42.6 ± 7.2 versus 1.9 ± 0.3 (mean ± SEM ; n = 3). However, when CHO cells were transduced with BV ^CAR -Ad5GFP complex (generated with a suboptimal ratio of 10 BV ^CAR to 1 Ad5GFP) no significant increase was observed : 26.1 ± 5.0 with FX versus 19.6 ± 1.5 without FX. This result suggested that FX had no direct effect on BV ^CAR -Ad5GFP-mediated cell transduction in vitro, in contrast to transduction by Ad5GFP, which was drastically enhanced in the presence of FX. Therefore, the BV ^CAR -Ad5GFP-mediated cell transduction appears independent from Ad hexon-FX interaction.

CONCLUSION:

In conclusion, the advantages of using CAR-pseudotyped BV as a carrier of Ad vectors are multiple.

(i) Many cells which are poorly permissive to Ads can be transduced only at high MOI of Ad vectors, and up to 10E4 to 10E5 particles per cell are necessary to obtain a minimal level of transgene expression. Such high MOI are hardly compatible with the cell physiology and intrinsic vector cytotoxicity is likely to interfere with biological function(s) of transgene product(s). By comparison, our BV ^CAR -Ad vector complex efficiently transduced Ad-refractory cells at MOI 10-20.

(ii) In the same line of arguments, Ads have an early cytotopathic (ECP) and cell detaching (CD) effect, and the CD effect has been assigned to one of the major capsid proteins of incoming virions, the penton base and its integrin-binding motifs RGD. Results with penton base EGD mutant Ad5 suggested that our BV ^CAR -Ad vector complex could bypass the RGD-integrin endocytic pathway.

(iii) It is relatively easy to insert a gene of interest in the El -deleted region of Ads, and many commercial kits are available to generate recombinant Ads. It is less easy, however, to modify the adenoviral capsid so as to redirect the Ad vector to a desired cell target via cell-specific ligands, while respecting the viability and the productivity of capsid- modified vectors. Our strategy of using BV ^CAR as a macromolecular adapter of Ads vectors therefore represents an alternative to hazardous Ad capsid modifications.

(iv) BV ^CAR , and a fortiori our BV ^CAR -Ad vector complex, could be redirected to cell targets by insertion of specific peptides or proteins in the envelope glycoprotein gp64. In view of the results described above, showing that the BV ^CAR -Ad5GFP duo is significantly more efficient than BV ^CAR -GFP alone in cell transduction, is expected that this BV ^CAR -Ad vector complex allows a more efficient transduction of mammalian cells than a recombinant BV vector expressing the gene of interest under a mammalian promoter, and displaying a cell-targeting ligand..

(v) Given the possibility to transduce Ad-refractory cells belonging to the immune system by our BV ^CAR -Ad vector complex, one could envisage to deliver oncolytic Ads to tumors via cell carriers with specificity towards tumor cells.

(vi) Although results of in vitro experiments could hardly be extrapolated to in vivo situations, our preliminary data suggested that the hepatotropism of the BV ^CAR -

Ad5GFP complex was independent of Ad hexon-FX interaction.

(vii) Lastly, our system of coupling two viruses which are both vectors of gene transfer also offers the possibility of expressing several transgenes within the same target cell, while limiting the risk of interference between transgenes and promoters carried by one single recombinant genome.