Description and Background

Ricin is a potent poison of concern to national and local authorities because of the threat posed by groups or individuals carrying out criminal acts. When investigating suspected Scenes of Crime, there is a need to make a rapid threat assessment, without creating undue alarm. Existing field tests generally use Ricin-specific antibody-based technology. Although in samples containing a high proportion of Ricin, these tests are effective, in samples containing certain (mostly proteinaceous) powders, or materials containing wood-pulp derivatives, false positive results can arise. Dealing with false alert powder incidents is costly in time and manpower, due to the potential toxicity of such powders and materials. Thus there is a need for a field testing method that is both sensitive to concentrations of Ricin in mixed samples, but also highly specific, displaying no cross-reactivity with material likely to make up a hoax powder.

Additionally, there is no effective antidote or treatment (besides palliative care) in service for Ricin poisoning. There is a need for an agent that can block the active site of Ricin (A) and reduce its potency in collected samples, to enable safe handling.

Ricin is a lectin produced by Ricinus communis (Castor Oil Plant), and is one of a number of Ribosome Inactivating Proteins (RIPs) that are highly toxic to eukaryotic cells. These proteins are of profound interest due to their therapeutic value in targeted cell death, and also used as a weapon.

Like other RIPs, Ricin consists of a cell surface binding moiety (B-subunit) and an enzymatically moiety (A subunit) which enters the cytosol and disrupts protein synthesis. Reduction of the disulfide bond is required for enzymatic activity to occur.

Subunit B binds to galactose residues on cell surface glycoproteins and glycolipids. Approximately 106-108 Ricin molecules may bind to the cell this way. The whole Ricin molecule is than internalized into the cell by endocytosis by coated/ uncoated

pits and vesicles. A large number of Ricin molecules will be ejected from the cell by exocytosis, or vesicles may fuse with lysozymes, to destroy the Ricin. However, 1 molecule of Ricin is sufficient to inactivate more than 1500 ribosome's per minute and destroy the cell. Toxic action is completed when the Ricin molecule penetrates the trans-Golgi network, where ribosome's are inactivated. Ricin-B galactose binding is still required for uptake into the cytosol, though the exact mechanism of the uptake of Ricin into the cytosol is poorly understood. Ricin A-subunit is a N-glycosidase, depurinating adenine. The A-subunit targets 28S rRNA, and the nucleic acid sequence GAGA

Ricin has many applications in cancer therapy, by conjugation with monoclonal antibodies to facilitate targeted cell death ("magic bullet"), as well as other ligands. The use of Ricin as a weapon of mass murder is well documented. Recognition of the toxic properties of uncooked Ricin beans has been long recorded in ancient history. Stillmark was the first to purify the toxin, and coin the term "Ricin", in 1888.

The first experiments to consider the use of Ricin as a weapon were carried out by the United States during World War One. The US Bureau of Mines considered the use of Ricin to coat bullets and shrapnel (to poison blood), and also as an aerosol weapon (to produce a debilitating lung effect). Ethics and technical difficulties curtailed this programme. The lack of an anti-toxin was also a drawback, if used as an aerosol weapon.

During World War 2, the US, Britain, France and Canada pursued the weaponization of Ricin, either in exploding bomblets, or through production of an aerosol material. Agent W was a milled powder that retained toxicity. Trials indicated however, lethality was only possible if the powder remained visible to the eye. Ultimately, the use of Ricin by conventional militaries was curtailed by its delayed action, compared to other biological agents.

Nevertheless, postwar interest in the toxin continued, with at least 6 assassination attempts carried out using Ricin (for example, the assassination of the Bulgarian

emigres, Georgi Markov and Vladimir Kostov in 1978). Terrorist groups have continued an interest in the toxin, probably attracted by its ease of manufacture and apparent potency. A continuing challenge to the law enforcement agencies is distinguishing innocent powder materials from milled Ricin, or powders spiked with Ricin. Existing field tests can often give false positive tests in certain powders, especially those containing high levels of protein.

Summary of Related Art.

Modulation of Ricin Toxicity in Mice by biologically active substances; DF Muldoon and SJ Stohs; Journal of Applied Toxicology, Vol. 14 No. 2:81-86 (1994) discloses the effects of dexamethasone, difluoromethylornithine, butylated hydroxyanisole and Vitamin E have on increasing survival time following Ricin poisoning.

Ilimaquinone inhibits the cytotoxicities of Ricin, diphtheria toxin, and other Protein toxins in Vero cells; MP Nambier and HV Wu, Experimental Cell Research, Vol. 219, No., 2: 671-678 (1995) discloses the properties of Ilimaquinone, a metabolite from sea sponges, in inhibiting Ricin cytotoxicity.

Structure-based Design and Characterization of Novel Platforms for Ricin and Shiga Toxin Inhibition; DJ Miller et al., Journal of Medical Chemistry, Vol. 45:90-98 (2002) discloses the potential use of 8-methyl-9-oxoguanine as a Ricin inhibitor.

Inhibition of Ricin A-chain with Pyrrolidine mimics of the Oxacarbenium ion transition state; S. Roday et al., Biochemistry, Vol. 43 No. 17:4923-4933 (2004) discloses an adenine mimic, incorporated into a 10 mer stem tetraloop oligonucleotide inhibits hydrolytic depurination by Ricin-A.

US2003180308 discloses a Ricin vaccine based on a deglycosylated Ricin molecule. WO03072018 discloses a Ricin vaccine, based on a modified Ricin molecule. US6562969 discloses a family of heterocyclic Ricin A-chain inhibitors based on adenine mimicry.

Lord, JM, Roberts, LM and JD Robertus.(1994). Ricin: Structure, mode of action, and some content applications, The FASEB Journal 8:201-208.

Sandvig, K and B van Deurs (2000). Entry of Ricin and Shiga toxin into cells: molecular mechanisms and medical perspectives. The EMBO Journal 19(22):5943- 5950.

Kirby, R. (2004). Ricin toxin: a military history. CML Array Chemical Review, PB 3- 04-1: 38-40.

An object of the present invention is therefore to provide a Ricin-binding peptide. The present invention therefore also extends to uses of such a peptide in methods for the detection of Ricin or the treatment of Ricin toxicity..

According to a first aspect of the invention, there is provided an isolated peptide having a sequence of general formula (I):

X ₁ -X ₂ -X ₃ -X ₄ -X ₅ -X ₆ -X ₇ -X ₈ -X ₉ -X ₁₀ -X _1l -X ₁₂ -X ₁₃ -X ₁₄ -X ₁₅ -X ₁₆ -X ₁₇ -X ₁₈ (I)

where:

X ₁ represents alanine or glycine

X ₂ represents aspartic acid or asparagme X ₃ represents tryptophan

X ₄ represents threonine or Serine

X ₅ represents alanine or glycine

X ₆ represents leucine, cysteine or isoleucine

X ₇ represents arginine or lysine X ₈ represents arginine or lysine

X ₉ represents histidine

X ₁₀ represents phenylalanine

X ₁₁ represents aspartic acid or asparagine X ₁₂ represents serine or threonine

X ₁₃ represents valine, leucine or isoleucine

X ₁₄ represents phenylalanine

X ₁₅ represents glycine or alanine X ₁₆ represents serine or threonine X ₁₇ represents glutamine or glutamic acid X ₁₈ represents isoleucine or leucine.

Optionally, The N-terminal residue X ₁ may be modified by biotin, bovine serum albumin (BSA), fluorescein (fluorochrome), horseradish peroxidase (HRP), alkaline phosphatase (ALP), colloidal gold and the C-terminal residue X ₁₈ may be modified by biotin, bovine serum albumin (BSA), fluoroscein (fluorochrome), horseradish peroxidase (HRP), alkaline phosphatase (ALP), colloidal gold as well as by other post-translational modifications, such as for example amidation, esterification with C ₁ to C ₆ straight or branched chain alcohols, polyethylene glycol (PEG). The free hydroxyl groups on the peptide may be glycosylated with a hexose or a pentose sugar, or a multimer thereof. The peptide may also be modified by acylation and/or phosphorylation. Such modifications may be made during synthesis of the peptide by chemical means or may be made post-translation where the peptide is synthesised by biological means.

Using the three letter and one letter codes the amino acids may also be referred to as follows: glycine (G or GIy), alanine (A or Ala), valine (V or VaI), leucine (L or Leu), isoleucine (I or He), proline (P or Pro), phenylalanine (F or Phe), tyrosine (Y or Tyr), tryptophan (W or Trp), lysine (K or Lys), arginine (R or Arg), histidine (H or His), aspartic acid (D or Asp), glutamic acid (E or GIu), asparagine (N or Asn), glutamine (Q or GIn), cysteine (C or Cys), methionine (M or Met), serine (S or Ser) and Threonine (T or Thr). Where a residue may be aspartic acid or asparagine, the symbols Asx or B may be used. Where a residue may be glutamic acid or glutamine, the symbols GIx or Z may be used. References to aspartic acid include aspartate, and glutamic acid include glutamate, unless the context specifies otherwise.

The peptide may be any variant of the above sequence. The variant peptide sequence may be any peptide variant that binds to Ricin-A, but not intact Ricin. The peptide may include any peptide that binds to reduced Ricin and related toxins identified by Library Screening. The peptide may include all truncated forms, extended forms and multimeric forms of the said peptide. The peptide and its variants may be labeled with a Gold particle.

The percent identity of two amino acid sequences is determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the first sequence for best alignment with the sequence) and comparing the amino acid residues or nucleotides at corresponding positions. The "best alignment" is an alignment of two sequences which results in the highest percent identity. The percent identity is determined by the number of identical amino acid residues or nucleotides in the sequences being compared (i.e., % identity = # of identical positions/total # of positions x 100).

The determination of percent identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art. An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul Proc. Natl. Acad. ScL USA (1990) 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. The NBLAST and XBLAST programs of Altschul et al, J. MoI Biol (1990) 215:403-410 have incorporated such an algorithm. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to a protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al, Nucleic Acids Res. (1997) 25:3389-3402. Alternatively, PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast

programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov.

Another example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). The ALIGN program (version 2.0) which is part of the GCG sequence alignment software package has incorporated such an algorithm. Other algorithms for sequence analysis known in the art include ADVANCE and ADAM as described in Torellis and Robotti Comput.

Appl. Biosci. (1994) 10:3-5; and FASTA described in Pearson and Lipman Proc. Natl. Acad. Sci. USA (1988) 85:2444-8. Within FASTA, letup is a control option that sets the sensitivity and speed of the search.

In the present invention, the peptide may have the sequence given above in general formula (I), although it is envisaged that alternative synthetic forms of the peptide could be made by substitution of one or more amino acids in the molecule. The invention therefore extends to the use of a peptide having Ricin-binding activity. The skilled person is aware that various amino acids have similar properties. One or more such amino acids of a substance can often be substituted by one or more other such amino acids without eliminating a desired activity of that substance. Thus the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains). Of these possible substitutions it is preferred that glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine and isoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic). Other amino acids which can often be substituted for one another include: phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains); lysine, arginine and histidine (amino acids having basic side chains); aspartate and glutamate (amino acids having acidic side chains); asparagine and glutamine (amino acids having amide side chains); and cysteine and methionine (amino acids having sulphur containing side chains). Substitutions of this nature are often referred to as "conservative" or "semi- conservative" amino acid substitutions.

Amino acid deletions or insertions may also be made relative to the amino acid sequence of peptides of the invention. Thus, for example, amino acids which do not have a substantial effect on the Ricin-binding activity of the peptide, or at least which do not eliminate such activity, may be deleted. Amino acid insertions relative to the sequence of the peptide can also be made . This may be done to alter the properties of a peptide of the present invention (e.g. to assist in identification, purification or expression, where the protein is obtained from a recombinant source, including a fusion protein. Such amino acid changes relative to the sequence of peptide of the invention from a recombinant source can be made using any suitable technique e.g. by using site-directed mutagenesis. The peptide may, of course, be prepared by standard chemical synthetic techniques, e.g. solid phase peptide synthesis, or by available biochemical techniques, e.g. enzymatic treatment of a larger pro-peptide with a suitable protease.

It should be appreciated that amino acid substitutions or insertions within the scope of the present invention can be made using naturally occurring or non-naturally occurring amino acids. Whether or not natural or synthetic amino acids are used, it is preferred that only L-amino acids are present, although D-amino acids may be used if desired.

Whatever amino acid changes are made (whether by means of substitution, insertion or deletion), preferred polypeptides of the present invention have at least 50% sequence identity with a polypeptide as defined in a) above more preferably the degree of sequence identity is at least 75%. Sequence identities of at least 90% or at least 95% are most preferred.

The degree of amino acid sequence identity can be calculated using a program such as "bestfit" (Smith and Waterman, Advances in Applied Mathematics, 482-489 (1981)) to find the best segment of similarity between any two sequences. The alignment is based on maximising the score achieved using a matrix of amino acid similarities, such as that described by Schwarz and Dayhof (1979) Atlas of Protein Sequence and Structure, Dayhof, M.O., Ed pp 353-358. Where high degrees of sequence identity are present there will be relatively few differences in amino acid sequence.

Peptides of the present invention therefore also include isoforms of a peptide of general formula (I). The term "isoform" as used herein refers to variants of a polypeptide that are encoded by the same nucleic acid sequence, but that differ in their pi or MW, or both. Such isoforms can differ in their amino acid composition (e.g. as a result of alternative splicing or limited proteolysis) and in addition, or in the alternative, may arise from differential post-translational modification (e.g., glycosylation, acylation, phosphorylation). As used herein, the term "isoform" also refers to a protein that exists in only a single form, i.e., it is not expressed as several variants.

The terms "peptide", "Ricin A binding peptide" and "bioactive peptide" as used herein refers to a plurality of amino acids joined together in a linear chain. Accordingly, the terms "peptide", "Ricin A binding peptide" and "bioactive peptide" as used herein includes a monopeptide, dipeptide, tripeptide, oligopeptide and polypeptide. A monopeptide contains one amino acid, a dipeptide contains two amino acids; a tripeptide contains three amino acids; and the term oligopeptide is typically used to describe peptides having between 2 and about 50 or more amino acids. Peptides larger than about 50 are often referred to as polypeptides or proteins. For purposes of the present invention, the terms "peptide", "Ricin A binding peptide" and "bioactive peptide" are not limited to any particular number of amino acids. Preferably, however, they contain about 2 to about 50 amino acids, more preferably about 2 to about 40 amino acids, most preferably about 2 to about 20 amino acids.

In particular aspects the invention is directed to selection of peptides that surprisingly interact with reduced forms of Ricin and related toxins but not with native or non- reduced toxins. Such compounds preferably are selected by the invention to be able to bind to reduced forms of toxins for greater than 30 minutes, preferably greater than 3 hours Specific examples of such compounds include linear or cyclic peptides, preferably between about 6 and 40 amino acid residues in length, and combinations thereof, optionally modified at the N-terminus or C-terminus or both, as well as their salts and derivatives, functional analogues thereof and extended peptide chains carrying amino acids or polypeptides at the termini of the sequences.

In preferred embodiments, the "Ricin A binding peptide" is a bioactive peptide that neutralises or reduces the toxic effects of Ricin A chain and related molecules. The bioactive properties of the "Ricin A binding peptide" thereby provide for pharmaceutical formulations and novel pharmaceutical compositions. In certain aspects, the invention provides for methods of using the novel compositions including the therapeutic use of the "Ricin A binding peptide".

In a further embodiment, the "Ricin A binding peptide" may be further modified with membrane translocating properties. Such properties may be conferred, by way of example not limitation, by synthesizing the "Ricin A binding peptide" with membrane permeable non-natural amino acids, or by conjugation with membrane translocating peptides such as peptides derived from antennapedia or TAT amongst others.

It is also possible to use a variant of the "Ricin A binding peptide" described herein. A number of variants are possible. A variant can be prepared and then tested, e.g., using a binding assay described above (such as ELISA or LFA). If the variant is functional, it can be used as an affinity reagent to detect Ricin or therapeutically to ameliorate Ricin toxicity.

One type of variant is a truncation of the "Ricin A binding peptide" described herein. In this example, the variant is prepared by removing one or more amino acid residues of the "Ricin A binding peptide" from the N or C terminus. In some cases, a series of such variants is prepared and tested. Information from testing the series is used to determine a region of the "Ricin A binding peptide" that is essential for binding to Ricin. A series of internal deletions or insertions can be similarly constructed and tested.

Another type of variant is a substitution. In one example, the "Ricin A binding peptide" is subjected to alanine scanning to identify residues that contribute to binding activity. In another example, a library of substitutions at one or more positions is constructed. The library may be unbiased or, particularly if multiple positions are

varied, biased towards an original residue. In some cases, the substations are limited to conservative substitutions, as discussed herein.

A related type of variant is a "Ricin A binding peptide" that includes one or more non-naturally occurring amino acids. Such variant ligands can be produced by chemical synthesis. One or more positions can be substituted with a non-naturally occurring amino acid. In some cases, the substituted amino acid may be chemically related to the original naturally occurring residue (e.g., aliphatic, charged, basic, acidic, aromatic, hydrophilic) or an isostere of the original residue, as discussed herein.

Also included are non-peptide linkages and other chemical modifications. For example, part or all of the "Ricin A binding peptide" may be synthesized as a peptidomimetic, e.g., a peptoid (see, e.g., Simon et al. (1992) Proc. Natl. Acad. Sci. USA 89:9367-71 and Horwell (1995) Trends Biotechnol.13: 132-4). A peptide may include one or more (e.g., all) non-hydrolyzable bonds. Many non-hydrolyzable peptide bonds are known in the art, along with procedures for synthesis of peptides containing such bonds. Exemplary non-hydrolyzable bonds include -[CH ₂ NH]- reduced amide peptide bonds, -[COCH ₂ ]-- ketomethylene peptide bonds, — [CH(CN)NH]-(cyanomethylene)amino peptide bonds, --[CH ₂ CH(OH)]-- hydroxyethylene peptide bonds, -[CH ₂ O] —peptide bonds, and -[CH ₂ S]- thiomethylene peptide bonds (see e.g., U.S. Pat. No. 6,172,043).

Preferred peptides according to the general formula (I) are as follows:

Ala-Asp-Trp-Thr-Ala-Leu-Arg-Arg-His-Phe-Asp-Ser-Val-Phe-G ly-Ser-Gln-Ile

and

Ala-Asp-Trp-Thr-Ala-Cys-Arg-Arg-His-Phe-Asp-Ser-Val-Phe-G ly-Ser-Gln-Ile

According to a second aspect of the invention, there is provided a nucleic acid sequence encoding an isolated peptide of the first aspect of the invention, or a nucleic acid sequence complementary or homologous thereto.

A nucleic acid sequence which is complementary to a nucleic acid sequence of the second aspect of the invention is a sequence which hybridises to such a sequence under stringent conditions, or a nucleic acid sequence which is homologous to or would hybridise under stringent conditions to such a sequence but for the degeneracy of the genetic code, or an oligonucleotide sequence specific for any such sequence. The nucleic acid sequences include oligonucleotides composed of nucleotides and also those composed of peptide nucleic acids.

Stringent conditions of hybridisation may be characterised by low salt concentrations or high temperature conditions. For example, highly stringent conditions can be defined as being hybridisation to DNA bound to a solid support in 0.5M NaHPO ₄ , 7% sodium dodecyl sulfate (SDS), ImM EDTA at 65 ⁰ C, and washing in 0. IxSSC/ 0.1%SDS at 68 ⁰ C (Ausubel et al eds. "Current Protocols in Molecular Biology" 1, page 2.10.3, published by Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York, (1989)). In some circumstances less stringent conditions may be required. As used in the present application, moderately stringent conditions can be defined as comprising washing in 0.2xSSC/0.1%SDS at 42 ⁰ C (Ausubel et al (1989) supra). Hybridisation can also be made more stringent by the addition of increasing amounts of formamide to destabilise the hybrid nucleic acid duplex. Thus particular hybridisation conditions can readily be manipulated, and will generally be selected according to the desired results. In general, convenient hybridisation temperatures in the presence of 50% formamide are 42 ⁰ C for a probe which is 95 to 100% homologous to the target DNA, 37 ⁰ C for 90 to 95% homology, and 32 ⁰ C for 70 to 90% homology.

The substances of the present invention can be coded for by a large variety of nucleic acid molecules, taking into account the well known degeneracy of the genetic code. All of these molecules are within the scope of the present invention. They can be inserted

into vectors and cloned to provide large amounts of DNA or RNA for further study. Suitable vectors may be introduced into host cells to enable the expression of substances of the present inventions using techniques known to the person skilled in the art.

According to a third aspect of the invention there is provided a vector comprising a nucleic acid according to the second aspect of the invention. Such vectors include, but are not limited to plasmids, viruses (e.g. adenovirus or lentivirus), cosmids etc.

According to a fourth aspect of the invention there is provided an isolated host cell comprising a vector according to the third aspect of the invention.

According to a fifth aspect of the invention there is provided a process for the preparation of a peptide of the first aspect of the invention, the process comprising transfecting a host cell with a nucleic acid sequence according to the second aspect of the invention and causing the nucleic acid sequence contained in the vector to be expressed. Suitably, the nucleic acid sequence may be in the form of a vector according to the third aspect of the invention.

Techniques for cloning, expressing and purifying proteins and polypeptides are well known to the skilled person. Various such techniques are disclosed, for example, in

Sambrook et al [Molecular Cloning 2nd Edition, Cold Spring Harbor Laboratory Press

(1989)]; in Old & Primrose [Principles of Gene Manipulation 5th Edition, Blackwell

Scientific Publications (1994); and in Stryer [Biochemistry 4th Edition, W H Freeman and Company (1995)]. By using appropriate expression systems substances of the present invention may be expressed in glycosylated or non-glycosylated form. Non- glycosylated forms can be produced by expression in prokaryotic hosts, such as E. coli.

Expression of a nucleic acid encoding a peptide of general formula (I) may be driven by an appropriate primer which may be constitutive or inducible and can be selected from the large number available to the skilled person in the art depending on the host cell system being used. Expression may be in any suitable cell, such as a mammalian cell

(e.g. CHO cells, HeLa cells etc), an avian cell (e.g. Gallus gallus), a yeast cell (e.g. S. cerevisiae or S. pombe), a bacterial cell (e.g. E. coli), or a plant cell (e.g. Λ. thaliana).

For example, one expression system according to the invention can utilise a TAC promoter, Rep A gene, CIS and Ori region in E. coli. An example of a preferred strain of E. coli is SLl 19 (ref. Odegrip et alPNAS USA vol. 101, pages 2806-2810 (2004)).

Polypeptides comprising N-terminal methionine methionine may be produced using certain expression systems, whilst in others the mature polypeptide will lack this residue.

In addition to nucleic acid molecules coding for substances according to the present invention, referred to herein as "coding" nucleic acid molecules the present invention also includes nucleic acid molecules complementary thereto. Thus, for example, both strands of a double stranded nucleic acid molecule are included within the scope of the present invention (whether or not they are associated with one another).Also included are mRNA molecules and complementary DNA Molecules (e.g. cDNA molecules).

In view of the foregoing description the skilled person will appreciate that a large number of nucleic acids are within the scope of the present invention. Unless the context indicates otherwise, nucleic acid molecules of the present invention may be DNA or RNA; be single or double stranded; may be provided in recombinant form i.e. covalently linked to a 5' and/or a 3' flanking sequence to provide a molecule which does not occur in nature; may be provided without 5' and/or 3' flanking sequences which normally occur in nature; may be provided in substantially pure form. Thus they may be provided in a form which is substantially free from contaminating proteins and/or from other nucleic acids; they may be provided with introns or without introns (e.g. as cDNA).

According to a sixth aspect of the invention there is provided a process for the preparation of a peptide of the first aspect of the invention, the process comprising the sequential addition of amino acids together. Such chemical synthetic means are well described in "The Chemical Synthesis of Peptides ^' ", J. Jones, OUP, (1994).

According to a seventh aspect of the invention there is provided a method for the detection of Ricin in a sample, comprising contacting the sample with a peptide of general formula (I) and detecting bound Ricin-peptide conjugates.

The sample for assay be from any source where the presence or absence of Ricin is to be analysed. The sample may be a biological sample, such as blood, sweat, tears, milk from an individual, or it may be a biological sample such as a food stuff or a drink, which may be a prepared or raw food stuff or drink. The sample may be of any liquid, powder, paper, cloth, plastics or other substrate capable of being analysed using a peptide of the present invention.

The methods of the invention are designed to detect Ricin, suitably the Ricin-A subunit. References to Ricin or to Ricin-A subunit include reduced Ricin RCA60 and RCA120 plant lectin, unless the context specifies otherwise.

The peptide may be placed in contact with the sample by simple addition of the peptide to a sample to be analysed. Alternatively, the peptide may be bound to a suitable substrate and the sample may be added, such as for example in a well. Such multi-well plates or substrate "chips" are well known in analytical procedures. The peptide may be bound using a synthetic chemical bond, or by using a biotin label on the peptide to bind the peptide to a streptavidin coated well or multi-well plate. If the sample contains Ricin, the Ricin-peptide conjugates may be detected using a labeled antibody, such as a polyclonal or monoclonal antibody which is specific for Ricin. The antibody may be labeled with a detectable marker, such as a chemical, fluorescent, enzymatic or radioactive label. Alternatively, a secondary antibody may be used to bind to the primary antibody, where it is the secondary antibody which is detectable. Suitable detectable chemical markers are coloured dyes, suitable fluorescent markers are fluorescein, rhodamine, suitable enzymatic markers are Horseradish Peroxidase (HRP), Alkaline Phosphatase (ALP) and suitable radioactive markers are P ³² , S ³⁵ , I ¹³¹ or I ¹²⁵ . Such methods therefore include those of the "Enzyme-Linked Immunosorbent Assay" or ELISA.

Other assay formats include lateral flow assays (or half-dipstick format). In such methods the peptide is labeled with a reactive label, such as biotin, and then reacted with a suitable specific labeled antibody (e.g. a gold labeled antibody) which binds to the reactive label (e.g. an anti -biotin antibody). An absorbent sample substrate material (e.g. an immunochromatographic membrane, such as nitrocellulose) is prepared comprising anti-Ricin A antibody which forms the lateral flow device. Sample to be assayed is then mixed with the conjugated peptide-antibody and then the resultant mixture is applied to the lateral flow device. The presence of Ricin is detected by the formation of bands which can be detected on the lateral flow device indicating the concentration of Ricin present.

Another assay format may comprise the use of a dry chemistry lateral flow assay which also uses the technique of a trapping antibody immobilised on a suitable substrate (e.g. an immunochromatographic membrane, such as nitrocellulose), together a labeled-detector species (e.g. gold labeled). This embodiment of the present invention differs from previous forms of such assays in that the detector is a binding peptide of general formula (I) rather than a second antibody. The substrate material contains a so-called "Test Window" for viewing the results and a "Sample Window" for administration of a sample. The "Test Window" contains two lines, one of which is a "sample line" and the other is a "control line". The "sample line" comprises anti-Ricin A antibody and the "control line" comprises a suitable antibody relevant to the peptide conjugate being used to detect Ricin.

The sample is aqueous form is loaded in the "Sample window" on the substrate material and is allowed to migrate along the membrane to the "Test Window" where the results are seen. In a positive test, two lines are visible and in a negative test only one line (the "control line") is visible.

Other variations in the assay format may be as follows:

The trapping substance (at "+" as illustrated in Figure 6) can be substituted for the peptide previously described, without any post-synthesis modification. In this case,

the detection agent (i.e. the component carrying a gold label) would be a polyclonal antibody or commercially available monoclonal antibody against Ricin-A.

Cosmetic changes to the test, such as altering the colour of the lines, the colour of the background, the shape of the lines, the shape of the background, the shape of the cassette, more than one test per cassette, transposition of the control and test lines, elimination of the control line. The components used in the sample collection system may be changed where such changes do not impacting on the fundamental nature of the assay itself. The nature of the reducing agent used may also be altered instead of tris[2-carboxyethyl] phosphine (TCEP).

The Gold label described can be substituted for paramagnetic particles, latex particles or chromogenic-enzyme tags (e.g. Horseradish Peroxidase, Alkaline Phosphatase)

The recording of results may be substituted from a visual means to electronic reader means.

The Nitrocellulose membrane described could be changed to any membrane filter or binding support matrix with adequate protein binding capacities. In addition, the membrane could be changed to a different porosity in order to increase or decrease the capillary flow of the Ricin-peptide complex, affecting the sensitivity and time of the test.

The Lateral Flow Assay may be substituted with a Flow-through assay, where a trapping antibody (or peptide as noted above) is immobilized on some protein binding matrix (e.g. frit), and the peptide-Ricin-A complex (or antibody-Ricin-A complex as noted above) is flowed through. Visualization is achieved by use of an appropriate tag

(for example, but not limited to, gold, chromogenic-enzymes, latex beads). This format shares the same basic principle of the Lateral Flow Assay described previously.

Such assay devices may also be provided in combination with suitable equipment for monitoring and detecting the results of the assay, such as chromatometers, fluorometers, scintillation counters and the like, optionally connected to means for providing an analysis of the data.

According to an eighth aspect of the present invention there is provided a method for the treatment of or protection from toxemia caused by exposure to Ricin, comprising administration to an individual of an effective amount of the peptide of general formula (I) or pharmaceutically acceptable salt thereof. Toxemia is also known as blood poisoning, or the presence in the bloodstream of quantities of toxins sufficient to cause serious illness.

This aspect of the present invention therefore extends to a peptide of general formula (I) for use in the treatment of Ricin toxemia (toxicity) or poisoning. The use of a peptide of general formula (I) in the preparation of a medicament for the treatment of Ricin toxicity is therefore also within the scope of the present invention.

The peptide for use in such methods may include all peptide variants described above adapted for therapeutic use (for example, but not limited to, inclusion of non-natural amino acids or variants adapted for serum stability). The peptide may include fusions with cell-penetrating peptides.

According to a ninth aspect of the present invention there is provided a pharmaceutical composition comprising a peptide of general formula (I).

The medicament will usually be supplied as part of a sterile, pharmaceutical composition which will normally include a pharmaceutically acceptable carrier. This pharmaceutical composition may be in any suitable form, (depending upon the desired method of administering it to a patient).

It may be provided in unit dosage form, will generally be provided in a sealed container and may be provided as part of a kit. Such a ldt would normally (although not

necessarily) include instructions for use. It may include a plurality of said unit dosage forms.

The pharmaceutical composition may be adapted for administration by any appropriate route, for example by the oral (including buccal or sublingual), rectal, nasal, topical (including buccal, sublingual or transdermal), vaginal or parenteral (including subcutaneous, intramuscular, intravenous or intradermal) route. Such compositions may be prepared by any method known in the art of pharmacy, for example by admixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.

Pharmaceutical compositions adapted for oral administration may be presented as discrete units such as capsules or tablets; as powders or granules; as solutions, syrups or suspensions (in aqueous or non-aqueous liquids; or as edible foams or whips; or as emulsions). Suitable excipients for tablets or hard gelatine capsules include lactose, maize starch or derivatives thereof, stearic acid or salts thereof. Suitable excipients for use with soft gelatine capsules include for example vegetable oils, waxes, fats, semisolid, or liquid polyols etc. For the preparation of solutions and syrups, excipients which may be used include for example water, polyols and sugars. For the preparation of suspensions oils (e.g. vegetable oils) may be used to provide oil-in-water or water in oil suspensions.

Pharmaceutical compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. For example, the active ingredient may be delivered from the patch by iontophoresis as generally described in Pharmaceutical Research, 3(6):318 (1986).

Pharmaceutical compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols or oils. For contamination of the eye or other external tissues, for example mouth and skin, the compositions are preferably applied as a topical ointment or cream. When formulated in an ointment, the active ingredient may be employed with either a

paraffinic or a water-miscible ointment base. Alternatively, the active ingredient may be formulated in a cream with an oil-in-water cream base or a water-in-oil base. Pharmaceutical compositions adapted for topical administration to the eye include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier, especially an aqueous solvent. Pharmaceutical compositions adapted for topical administration in the mouth include lozenges, pastilles and mouth washes.

Pharmaceutical compositions adapted for rectal administration may be presented as suppositories or enemas.

Pharmaceutical compositions adapted for nasal administration wherein the carrier is a solid include a coarse powder having a particle size for example in the range 20 to 500 microns which is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. Suitable compositions wherein the carrier is a liquid, for administration as a nasal spray or as nasal drops, include aqueous or oil solutions of the active ingredient.

Pharmaceutical compositions adapted for administration by inhalation include fine particle dusts or mists which may be generated by means of various types of metered dose pressurised aerosols, nebulizers or insufflators.

Pharmaceutical compositions adapted for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations.

Pharmaceutical compositions adapted for parenteral administration include aqueous and non-aqueous sterile injection solution which may contain anti-oxidants, buffers, bacteriostats and solutes which fender the formulation substantially isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. Excipients which may be used for injectable solutions include water, alcohols, polyols, glycerine and vegetable oils, for example. The compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized)

condition requiring only the addition of the sterile liquid carried, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.

The pharmaceutical compositions may contain preserving agents, solubilising agents, stabilising agents, wetting agents, emulsifiers, sweeteners, colourants, odourants, salts (substances of the present invention may themselves be provided in the form of a pharmaceutically acceptable salt), buffers, coating agents or antioxidants. They may also contain therapeutically active agents in addition to the peptide of the present invention.

Dosages of the substance of the present invention can vary between wide limits, depending upon the disease or disorder to be treated, the age and condition of the individual to be treated, etc. and a physician will ultimately determine appropriate dosages to be used. This dosage may be repeated as often as appropriate. If side effects develop the amount and/or frequency of the dosage can be reduced ,in accordance with normal clinical practice.

In addition to the uses discussed above in relation to treatments, substances of the present invention can be used in diagnosis. For example, in a method for the diagnosis of Ricin poisoning in an individual, a sample from the individual may be assayed according to a method of the present invention as described herein to detect the presence and/or amount of Ricin in the sample.

Substances of the present invention can also be used in research. For example, they can be used in screening for the presence of Ricin in a sample using a method as described herein.

One further use of the peptides of the present invention is in raising or selecting antibodies. The present invention therefore includes antibodies which bind to a peptide of general formula (I) of the present invention. Preferred antibodies bind specifically to

peptides of the present invention so that they can be used to purify such substances . The antibodies may be monoclonal or polyclonal.

Polyclonal antibodies can be raised by stimulating their production in a suitable animal host (e.g. a mouse, rat ,guinea pig, rabbit, sheep, goat or monkey) when the substance of the present invention is injected into the animal. If necessary an adjuvant may be administered together with a peptide of the present invention. The antibodies can then be purified by virtue of their binding to a peptide of the present invention.

Monoclonal antibodies can be produced from hybridomas. These can be formed by fusing myeloma cells and spleen cells which produce the desired antibody in order to form an immortal cell line. This is the well known Kohler & Milstein technique {Nature 256 52-55 (1975)).

Techniques for producing monoclonal and polyclonal antibodies which bind to a particular protein are now well developed in the art. They are discussed in standard immunology textbooks, for example in Roitt et al, Immunology second edition (1989), Churchill Livingstone, London.

In addition to whole antibodies, the present invention includes derivatives thereof which are capable of binding to substances of the present invention. Thus the present invention includes antibody fragments and synthetic constructs. Examples of antibody fragments and synthetic constructs are given by Dougall et al in Tibtech 12 372-379 (September 1994). Antibody fragments include, for example, Fab, F(ab') ₂ and Fv fragments (see Roitt et al (1989). Fv fragments can be modified to produce a synthetic construct known as a single chain Fv (scFv) molecule. This includes a peptide linker covalently joining V _h and Vi regions which contribute to the stability of the molecule. Other synthetic constructs include CDR peptides. These are synthetic peptides comprising antigen binding determinants. Peptide mimetics may also be used. These molecules are usually conformationally restricted organic rings which mimic the structure of a CDR loop and which include antigen-interactive side chains.

Synthetic constructs include chimaeric molecules. Thus, for example, humanised (or primatised) antibodies or derivatives thereof are within the scope of the present invention. An example of a humanised antibody is an antibody having human framework regions, but rodent hypervariable regions. Synthetic constructs also include molecules comprising a covalently linked moiety which provides the molecule with some desirable property in addition to antigen binding. For example the moiety may be a label (e.g. a fluorescent or radioactive label) or a pharmaceutically active agent).

The antibodies or derivatives thereof of the present invention have a wide variety of uses. They can be used in purification and/or identification of the peptides of the present invention.

According to a tenth aspect of the present invention there is provided a method for the neutralization of Ricin in a sample, comprising contacting the sample with a peptide of general formula (I). A method of this aspect of the invention will enable safe handling of materials contaminated by Ricin toxin.

The present application describes, by way of example, production of novel peptides able to specifically bind to the Ricin-A toxin subunit of Ricin, and as such can be used as a means to detect Ricin in environmental and mixed samples, by virtue of the sensitivity and high specificity of the novel peptides. The peptides are advantageous in that they specifically bind reduced Ricin (Ricin-A) but not Ricin.

This peptide can be incorporated into existing assays normally used for immunoassay, and represents a novel approach to biosensing, providing a means to block the enzymatic activity of the toxin, and a means to treat Ricin poisoning, as well as to reduce the toxicity of the toxin.

The present invention includes use of Ricin-binding peptide to inhibit cell death, use of Ricin-binding peptide as a therapeutic against Ricin poisoning and use of Ricin- binding peptide to inhibit the potency of Ricin.

Preferred features for the second and subsequent aspects of the invention are as for the first aspect mutatis mutandis.

Various examples of the present invention will now be described, by way of example, with reference to the accompanying drawings, in which:

FIGURE 1 shows illustrates a format of Sandwich ELISA Assay;

FIGURE 2 shows is a graph showing the full range of detection of Ricin by Peptide-PAB ELISA, blank corrected;

FIGURE 3 shows is a side elevation view of a half dipstick format assay;

FIGURE 4 illustrates detection of Ricin-A by half-dipstick format assay;

FIGURE 5 shows is a perspective view of lateral flow assay components;

FIGURE 6 illustrates a test cassette layout where "+" denotes the position of trapping antibody, "C" denotes the position of a control line and "S" denotes the position of sample administration; and

FIGURE 7 shows different responses of the test cassette of Figure 6 in different circumstances.

Various examples according to the present invention, which are not to be construed as being a limitation, are described below.

Example 1

The following example discloses the technique used to select Ricin-binding peptides.

Production of Ricin-A binding Peptide

Selection of linear NNB-18mer peptide vs. SH-biotin-Ricin (RCA60)

Biotinylation ofRicin

SH-biotinylation of Ricin was carried out according to the protocol of Vater et al. ("Ricin A chain can be chemically cross-linked to the mammalian ribosomal proteins L9 and LlOe" by CA. Vater et al. Journal Biol. Chem. 1995, 270, 21, 12933-12940), except that RCA 60 was the target molecule used.

Library construction and in vitro transcription and translation (ITT)

DNA encoding an 18mer peptide library was cloned into an expression cassette containing a TAC promoter, RepA gene, CIS and Ori region, allowing the generation of protein-DNA complexes, displaying expressed polypeptides bound to their coding sequences. Recovery of library DNA was carried out via a series of nested primers. Library construction and ITTs were carried out as described ("CTS display: In vitro selection of peptides from libraries of protein-DNA complexes" by R. Odegrip, et al PNAS, 2004, 101, 9, 2806-2810).

Selection procedure lμg of SH-biotinylated RCA 60 was added to 900μl selection buffer (2% milk protein, 100μg/ml Heparin sulfate, 10μ.g/ml Herring sperm DNA in sterile PBS). 100/d of ITT product was added to the selection buffer. Solution was mixed briefly and then incubated on ice for 2 hours.

50μl Dynal M280 streptavidin-coated paramagnetic beads were added to the selection solution, mixed and incubated on ice for 5 minutes. Beads were then removed from solution and washed five times with ice cold PBS/tw*l, and two times with ice cold PBS.

Beads were then resuspended in 100μl PCR buffer and bound DNA was eluted via incubation at 65 ⁰ C for ten minutes. Library fragments were recovered via PCR, using nested 5' primers: 133, 134, 136, 78, 226 & 3' primer, 253. Library fragments were reassembled onto RepA gene-CIS-Ori as described (2) and PCR amplified for the next

round of selection. Selection procedure was repeated for four subsequent rounds. *lPBS/tw: PBS/ 0.01% v/v Tween 20 ™.

Screening. Screening (determination of specificity) was carried out by sandwich ELISA.

Anti-Ricin antibody was coated at 2.5μg/ml onto Maxisorp wells. Ricin was treated with 10OmM dithiothrietol for 20 minutes at room temperature, and then diluted 1:50 in PBS (final DTT concentration = 2mM) and added to anti-Ricin antibody coated wells. Wells were incubated for 45 minutes at room temperature.

SH-biotinylated RCA60 lμg/ml was added to Streptavidin-coated 96 well immunoassay plates (Streptawell - Roche) and incubated at 25 ⁰ C for 20 minutes. Plates were washed once with PBS then blocked with blocking buffer* for 1 hour at 25°C. G3 fusion phage supernatant diluted 1/1 (v/v) with blocking buffer were then added and incubated for 45 minutes. Wells were washed 3 times with PBS-Tween and 2 times with PBS. Anti- M13 HRP detecting antibody (in 2% milk protein/PBS/Tween) was added and plates were incubated for 45 minutes. Wells were washed three times with PBS-Tween and 2 times with PBS. Detection was carried out using the TMB chromagen substrate.

*Blocking Buffer: 4% milk protein in PBS.

Primer sequences 78 5' gtaaaacgacggccag

133 5' catcatgcgccagctttcatcc

134 5' gacagcagacgtgcactggccag 136 5' gtgtaaaccttaaactgccgtacg 226 5' gtctgcttcagtaagccagatgc 253 5' tggtgaagatcagttgcggccgctag

Example 2

The following Example discloses a wet chemistry enzyme-linked immunoassay aimed at determining if an aqueous sample contains Ricin at concentrations above or below 10.0 jUg/ml. This assay provides the advantages of accuracy and simplicity.

Detection of Ricin by Enzyme-Linked Immunoassay.

The same basic protocol was adopted for all experiments, illustrated in Figure 1.

The peptide (sequence Ala-Asp-Thr-Ala-Leu-Arg-Arg-His-Phe-Asp-Ser-Val-Phe- Gly-Ser-Gln-Ile) was synthesised in a biotinylated form, with a GGS-Lys(Biotin) group attached at the C-terminal end. In the tested format, biotinylated peptide was bound to commercially available (Sigma-Aldrich) streptavidin-coated multi-well plates. Ricin RCA60 (Sigma-Aldrich) was pretreated with a solution of dithiothrietol (this cleaves disulfide bonds, separating the two subunits of RCA60, subunits A and B) prior to incubation on the peptide-coated plate. Following a suitable time for incubation (unless noted, all incubations were carried out at room temperature), a further, more rigorous wash step was carried out. Binding sites on the peptide were then blocked using a suitable protein aceous buffer solution (skimmed milk protein is the usual choice). Blocking reduces non-specific binding. Specific binding molecules (antibodies) will have a higher binding affinity for epitope sites and will displace the non-specific (milk) protein. Blocking buffers though have been known to mask some epitopes.

Following blocking, and another wash step, the peptide-Ricin complex was incubated with the primary (Ricin-binding) antibody in a half-strength blocking buffer. Again, this was incubated for a suitable time, and put through a wash regime as before. The antibody used was either a polyclonal or monoclonal antibody. In general, polyclonal antibodies will give a stronger detection than monoclonal, though monoclonal antibodies can show higher specificity. After washing, the secondary antibody was added. In this case, this was an antibody chosen to bind to the immunoglobulin class of the primary antibody, and conjugated to horseradish peroxidase. Again this was incubated for a suitable time, washed and then incubated for 5 minutes with freshly made o-Phenylenediamine (OPD). This substrate for peroxidase is reasonably

sensitive to low concentrations, and gives a well defined coloured product. After 5 minutes the reaction was stopped by 1 volume of 4N HCl. Absorbencies were read at 492nm and recorded.

Methods and Materials.

1. Coat streptavidin-coated multiwell plates with biotinylated peptide at 1μg/ml; incubate overnight in fridge.

2. IxPBS wash. Bang plates hard to remove excess liquid.

3. Dilute 35μl of Ricin (and ovalbumin (OVA) for control) (3mg/ml) with 140μl PBS and 1 vol. of 10OmM DTT (175μl) for 20 minutes at room temperature in water

(0.154g in 10mls), to create 300μg/ml stock.

4. Dispense Ricin and Ovalbumin (OVA) solutions to a streptavidin-coated 96-well ELISA plate (Sigma). Incubate at room temp 45 minutes

( 100μl per well) 5. Wash wells once with PBS-T

6. Block wells with 4% milk powder in PBS-T (PBS with 0.02% Tween-20) for 1 hour, 300μl per well

7. Wash 4x PBS-T

8. Add anti-Ricin antibody (Sigma PAB) diluted in 2% milk-PBS-T 1:1000 (1 μg/ml): 10μl + 9990 (10mls)

9. Incubate 45mins

10. Wash wells with 4x PBS + 0.02% Tween™

11. Make up OPD substrate (SigmafastTM phenylenediamine) 15 minutes before use; follow instructions on foil wrappers. 12. Add anti -rabbit Horseradish peroxidase (HRP) conjugated antibody (Sigma) 1 in 1000 dilution in 2% Milk in PBS-T. (10μl + 9990 μI PBS)

13. Wells washed with 4x PBS-T

14. Add OPD 100/μl per well 15. Stop with 100μl 4N HCl

16. Read at 492nm

Results

Figure 2 illustrates that Ricin was effectively detected in an ELISA format at between

10 and 100μg/ml.

Example 3

The following Example discloses a semi-dry dipstick assay aimed at determining of aqueous samples contain Ricin-A subunit concentrations above or below 0.05 μg/ml. This test offers the advantages of speed, accuracy and simplicity.

Detection of Ricin-A by Lateral Flow Assay (Half Dipstick format)

Biotinylated Peptide (sequence Ala-Asp-Thr-Ala-Leu-Arg-Arg-His-Phe-Asp-Ser-Val- Phe-Gly-Ser-Gln-ϊle) was reacted with anti-biotin mouse monoclonal antibody, previously labeled with 20nm Gold (British Biocell International). Successful conjugation was assessed by checking for excess peptide in centrifuged supernatants, using the ELISA technique previously described. The conjugate was diluted to an optical density of 1 in buffer (TBS, 1% BSA).

Anti-Ricin-A antibody (Sigma-Aldrich) was diluted to a concentration of lmg/ml and 5mg/ml, and applied to Millipore HF240 lateral flow nitrocellulose membrane (or equivalent) at a rate of 2/xl per cm, 20mm from one side, in a discrete line. The membrane was air dried, and 5mm wide strips cut. A similarly sized strip of Millipore Sample pad was added to one end, using medical adhesive (Figure 3)

20μl of prepared gold conjugate was mixed with 20μ.l of sample (various concentrations of Ricin-A, or reduced Ricin, where the concentration of dithiothrietol has been diluted to less than 2mM before testing, diluted in TBS-I % BSA-0.5%

Tween-80), and incubated at room temperature for 5 minutes, prior to transfer to a microti ter plate well. The dipstick strip was then placed in the well, with the sample pad at the top. After 10 minutes incubation, the strip was examined, and the intensity of any resulting coloured bands scored using a simple Rann scale (1-10, 1 being least intense).

Results

Figure 4 shows a test card, with model bands, scored (Rann scale) (from most intense to least) 10, 8, 6, 4, 2. A Rann score of 1 is just detectable to the human eye. The lowest detectable Ricin concentration was 0.05μg/ml (Rann score of 1).

Example 4

The following discloses a dry chemistry, lateral flow assay aimed at determining if suspect powders and other environmental samples (paper, cloth, plastics etc) contain Ricin at concentrations above or below 0.5μg/ml Ricin.

Principle of Ricin Test Assay.

The lateral flow assay utilizes the common technique of a trapping antibody immobilized on immunochromatographic membrane, together with a gold-labeled detector. The assay is novel in that rather than the detector being a second antibody, it is a binding peptide.

A peptide (ADWTALRRHFDSVFGSQI) able to bind specifically to Ricin-A was produced using an In Vitro Peptide Expression Library system, disclosed in WO2004022746. The subsequent peptide sequence was modified to allow two methods of gold labeling:

1. AD WTALRRHFDS VFGSQIGGS-Lys(Biotin)-OH (A)

2. ADWTALRRHFDSVFGSQIGGS-OH-BSA (B)

Peptide A was labeled with 20nm gold by use of a anti-biotin mouse monoclonal antibody previously labeled with a 20nm or 40nm gold particle. Peptide B was directly labeled with 40nm Gold via the BSA group. The basic arrangement of the lateral flow assay is illustrated in Figure 5. The assay can be run in two formats, with either Peptide A or B. The Sample Line consists of a stripe of an ti -Ricin A polyclonal antibody (Sigma-Aldrich or equivalent), applied at 5mg/ml, 2μl/cm nitrocellulose membrane (Millipore Hi-Flow or equivalent). The Control Line consists of a stripe of

either, in the case of Peptide A, anti-mouse polyclonal antibody (Sigma-Aldrich or equivalent), or, in the case of Peptide B, anti-BSA polyclonal antibody (Sigma- Aldrich or equivalent). Both lines are air dried after application. 20μl Gold-labeled conjugate, in 5% Trehalose or Sucrose solution and at an optical density of 2.0 to the 25mm conjugate release glass fibre pad, and air dried.

The assay components are then assembled as illustrated in Figure 5, using medical- grade adhesive, and loaded into a proprietary cassette. (Figure 6), where the stripes of antibody are visible through a clear plastic sealed window (Test Window), and sample can be administered via an open sample window (Sample Window).

Sample, in an aqueous phase is loaded on the sample release pad. The assay works on the principle of immunochromatography. As the sample front migrates up the membrane, it first comes into contact with the peptide, and binds (the peptide is not immobilized, merely dried). The combined sample-peptide complex continues to migrate up the membrane until it comes to the Sample Line. Any Ricin-peptide complex would bind to the immobilized antibody, producing a concentrated line, allowing visualization of the gold. Excess or unreacted peptide would continue to migrate to the Control Line, forming a second line. In a positive test, two lines are expected to be visualized. In a negative test, only one (the Control Line) will be visible.

Description of Full Ricin Field Test. A supplied test kit consists of the following components:

1. Sampling device (Quicksilver Analytics BisKit or equivalent).

2. 5ml polystyrene bottle containing TBS buffer, azide preservative, TCEP solid reducing agent.

3. Lateral Flow Assay cassette device (Figure 2) 4. Screw-top dropper cap

5. Hazmat disposal bag with recording label.

The suspect sample is collected by a suitable means (e.g. BisKit (Quicksilver Analytics), and transferred to a TBS buffer, containing a solid phase disulfide-bond reducing agent (Tris[2-carboxyethyl] phosphine) and polystyrene beads (to allow mechanical maceration of the sample). The mixture is thoroughly agitated, and allowed to mix for 10 minutes. The reacted mixture is then passed through a Swinnex- type filter, to remove the reductant and applied to the sample window on the cassette. After an appropriate time, a dark red coloured stripe or stripes will appear in the test window. The result can be interpreted as follows (illustrated in Figure 7):

1. Two stripes; Ricin detected in excess of 0.05μg/ml buffer, test successful

2. One stripe appears at "C"; Ricin not present, test successful.

3. One stripe appears at "+"; Test invalid. Repeat. Dilute test sample if necessary.

4. No stripes: test invalid. Repeat. (Figure 7)

Example 5

The following example discloses a wet chemistry enzyme-linked immunoassay comparing the performance of a peptide of sequence Ala-Asp-Thr-Ala-Leu-Arg-Arg- His-Phe-Asp-Ser-Val-Phe-Gly-Ser-Gln-Ile ("Peptide A") and a peptide of sequence Ala-Asp-Thr-Ala-Cys-Arg-Arg-His-Phe-Asp-Ser-Val-Phe-Gly-Ser- Gln-He ("Peptide B").

The same protocol was adopted for all experiments, illustrated in Figure 1

Both peptides were synthesized in a biotinylated form, with a GGS-Lys(Biotin) group attached at the C-terminal ends. In the tested format, biotinylated peptide was bound to commercially available (Sigma-Aldrich) streptavidin-coated multi-well plates. Ricin RCA60 (Sigma-Aldrich) was pretreated with a solution of dithiothrietol (this cleaves disulfide bonds, separating the two subunits of RCA60) prior to incubation on the peptide-coated plate. Following a suitable time for incubation (unless noted, all incubations were carried out at room temperature), a further, more rigorous wash step

was carried out. Binding sites on the peptide were then blocked using a suitable proteinaceous buffer solution (skimmed milk protein is the usual choice). Blocking reduces non-specific binding. Specific binding molecules (antibodies) will have a higher binding affinity for epitope sites and will displace the non-specific (milk) protein. Blocking buffers though have been known to mask some epitopes.

Following blocking, and another wash step, the peptide-Ricin complex was incubated with the primary (Ricin-binding) antibody in a half-strength blocking buffer. Again, this was incubated for a suitable time, and put through a wash regime as before. The antibody used was either a polyclonal or monoclonal antibody. In general, polyclonal antibodies will give a stronger detection than monoclonal, though monoclonal antibodies can show higher specificity. After washing, the secondary antibody was added. In this case, this was an antibody chosen to bind to the immunoglobulin class of the primary antibody, and conjugated to horseradish peroxidase. Again this was incubated for a suitable time, washed and then incubated for 5 minutes with freshly made o-Phenylenediamine (OPD). This substrate for peroxidase is reasonably sensitive to low concentrations, and gives a well defined coloured product. After 5 minutes the reaction was stopped by 1 volume of 4N HCl. Absorbencies were read at 492nm and recorded.

Methods and Materials

1. Coat streptavidin-coated multiwell plates with both biotinylated peptides (Peptide A and peptide B) at lμg/ml; incubate overnight in fridge.

2. Ix PBS wash. Tap plates hard to remove excess liquid. 3. Dilute Ricin, Ricin-A (Sigma-Aldrich) and Ovalbumin (as a negative control) (3mg/ml) with PBS and 1 vol. of 10OmM DTT (175μl) for 20 minutes at room temperature in water (0.154g in lOmls), to create a 250μg/ml stock.

4. Add Ricin and Ovalbumin to a Streptavidin-coated ELISA plate. Incubate at room temp 45 minutes (100μl per well)

5. Wash wells once with PBS-T (PBS with 0.02% Tween-20)

6. Block wells with 4% milk powder in PBS-T for 1 hour, 300μl per well

7. Wash 4x PBS-T

8. Add anti-Ricin antibody (Sigma PAB) diluted in 2% milk-PBS-T

1:1000 (1 μ g/ml): 10 μl + 9990 (10mls)

9. Incubate 45mins 10. Wash wells with 4x PBS + 0.02% Tween™

11. Make up OPD substrate (SigmafastTM phenylenediamine) 15 minutes before use; follow instructions on foil wrappers.

12. Add anti-rabbit horse radish peroxidase conjugated antibody, 1 in 1000 dilution in 2% Milk-PBS-T (10μl + 9990μl PBS)

13. Wells washed with 4x PBS-T

14. Add OPD 100μl per well

15. Stop with 100μ l 4N HCl

16. Read at 492nm

Results

Figures 8 and 9 show reduced Ricin and purified Ricin A were detected by both

Peptide sequence variations effectively over a range of 10-50μg/ml.