Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
RNA INTERFERENCE FOR CONTROL OF INSECT PESTS
Document Type and Number:
WIPO Patent Application WO/2017/106171
Kind Code:
A1
Abstract:
This invention provides methods and compositions for controlling an insect pest. The methods comprise contacting the insect pest with a composition comprising a yeast cell comprising a nucleic acid encoding a dsRNA molecule which specifically inhibits expression of a target gene in the insect pest, thereby controlling the insect pest.

Inventors:
CHIU JOANNA C (US)
MURPHY KATHERINE A (US)
Application Number:
PCT/US2016/066346
Publication Date:
June 22, 2017
Filing Date:
December 13, 2016
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
UNIV CALIFORNIA (US)
International Classes:
C12N15/63; C12N15/11; C12N15/64; C12N15/79; C12N15/80; C12N15/81
Foreign References:
US20090285784A12009-11-19
US20030108520A12003-06-12
US20120240288A12012-09-20
Attorney, Agent or Firm:
BASTIAN, Kevin L. et al. (Mailstop: IP Docketing - 221100 Peachtree Street,Suite 280, Atlanta Georgia, US)
Download PDF:
Claims:
WHAT IS CLAIMED IS: 1. A method for controlling an insect pest, the method comprising contacting the insect pest with a composition comprising a yeast cell comprising a nucleic acid encoding a dsRNA molecule which specifically inhibits expression of a target gene in the insect pest, thereby controlling the insect pest. 2. The method of claim 1, wherein the yeast cell is killed. 3. The method of claim 1, wherein the yeast cell is living. 4. The method of any of the preceding claims wherein the composition comprising the yeast cell is present in a lure trap. 5. The method of any of the preceding claims, wherein the yeast cell is Saccharomyces cerevisiae. 6. The method of any of the preceding claims, wherein the insect pest is a vinegar fly. 7. The method of claim 6, wherein the vinegar fly is Drosophila suzukii. 8. The method of claim 7, wherein the yeast cell is Hanseniaspora uvarum. 9. The method of claim 7, wherein the target gene is tubulin, vATPase, blw, RpL19, or acetyl choline esterase. 10. The method of claim 9, wherein the target gene comprises a target sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. 11. A composition comprising a yeast cell comprising an expression cassette comprising a yeast promoter operably linked to a DNA sequence encoding a dsRNA molecule which specifically inhibits expression of a target gene in an insect pest. 12. The composition of claim 11, wherein the yeast cell is killed.

13. The composition of claim 11, wherein the yeast cell is living.

14. The composition of any of claims 11 to 13, wherein the yeast cell is Saccharomyces cerevisiae. 15. The composition of claim 11, wherein the yeast promoter is a bacteriophage T7 promoter or a TEF1 polymerase promoter. 16. The composition of any of claims 11 to 15, wherein the insect pest is a vinegar fly. 17. The composition of claim 16, wherein the vinegar fly is Drosophila suzukii. 18. The composition of claim 17, wherein the yeast cell is Hanseniaspora uvarum. 19. The composition of claim 17, wherein the target gene is a tubulin, vATPase, blw, RpL19, or acetyl choline esterase gene. 20. The composition of claim 19, wherein the target gene comprises a target sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. 21. The composition of any of claims 11 to 20, which is present in a lure trap. 22. An expression cassette comprising a yeast promoter operably linked to a DNA sequence encoding a double stranded RNA (dsRNA) which specifically inhibits expression of a target gene in an insect pest. 23. The expression cassette of claim 22, wherein the yeast promoter is a bacteriophage T7 promoter or a TEF 1 promoter. 24. The expression cassette of claim 22, wherein the yeast promoter is an inducible promoter. 25. The expression cassette of any of claims 22 to 24, wherein the target gene is a tubulin, vATPase, blw, ΡφΙΛ9, or acetyl choline esterase gene.

26. The expression cassette of any of claims 22 to 25, wherein the target gene comprises a target sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

Description:
RNA INTERFERENCE FOR CONTROL OF INSECT PESTS

CROSS-REFERENCES TO RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. §119(e) to US Application No. 62/266,862, filed December 14, 2015, which is incorporated herein by reference.

FIELD OF THE INVENTION

[0002] This invention relates to methods and compositions for controlling insect pests using RNA interference.

BACKGROUND OF THE INVENTION

[0003] In recent years, RNA interference (RNAi) has shown great potential to become a powerful tool in pest management. RNAi is effective in many economically important insects, including honey bee, mosquito, Western corn rootworm, and Colorado potato beetle 1_s . Inducing mortality through RNAi has several advantages over conventional chemical pesticides. As a consequence of its sequence dependent mode of action, RNAi can be tailored to target only pest species and spare beneficial insects 6,1 . This is accomplished by choosing to target unique mRNA sequences within the pest species. Likewise, RNAi pesticides can be designed to target a broad range of insects by choosing sequences that are more conserved between species. Another advantage of RNAi pesticides is that the "active ingredient" is RNA, which is organic, biodegradable, and can be cheaply produced within microorganisms.

[0004] RNAi is a cellular mechanism that likely evolved to protect eukaryotes from RNA viruses To activate the RNAi pathway, double stranded RNA (dsRNA) can be fed to insects and absorbed into the cells that line the midgut. Exogenous dsRNA is usually processed into 20-30 nucleotide duplexes by the ribonuclease HI enzyme DICER 9 . These nucleotide duplexes are incorporated into the RNA induced silencing complex (RISC) by the catalytic component ARGONAUTE. The two strands of RNA are unwound and one strand is used as a guide strand. The guide strand binds to complementary mRNAs, and the RISC complex mediates degradation or suppression of the endogenous transcript. The RISC complex will cleave the mRNA when base pair matching is perfectly complementary, or alternatively, the complex can bind the mRNA and suppress translation when there are mismatched base pairs, leaving the mRNA intact. Degradation or suppression of transcripts

1 that code for critical genes in the insect results in decreased amounts of critical gene products and increased mortality. 10,11

[0005] Delivery of intact dsRNA into insect cells remains a challenge, although many delivery methods have been developed 10 . Crops can be genetically engineered to express dsRNA targeting insect pests. The use of modified plants has proven remarkably effective in managing coleopteran pests such as the Colorado potato beetle 4 . Another delivery method is to synthesize the dsRNA in vitro, and then apply to foliage by spraying 12 , or to roots by soaking 13 , resulting in a transient presence of dsRNA within the plant tissue. Studies have demonstrated that bacteria expressing dsRNA can be heat killed and fed to insects to induce RNAi 14 , or can even be fed in a viable state so that the genetically modified bacteria can colonize the gut and deliver dsRNA from within the host 15 .

[0006] Despite these advances, the prior art fails to show that other microorganisms, such as yeast, are useful as a delivery for vehicle for dsRNA. The present invention addresses these and other needs.

BRIEF SUMMARY OF THE INVENTION

[0007] This invention provides methods and compositions for controlling an insect pest. The methods comprise contacting the insect pest with a composition comprising a yeast cell (either killed or living) comprising a nucleic acid encoding a dsRNA molecule which specifically inhibits expression of a target gene in the insect pest, thereby controlling the insect pest. The compositions of the invention are typically present in a lure trap.

[0008] The yeast cell can be any yeast capable of transformation and can be, for example, Saccharomyces cerevisiae. The insect pest can be, for example, a vinegar fly, such as Drosophila suzukii. In those embodiments, yeast cell can be Hanseniaspora uvarum.

[0009] The target gene can be tubulin, vATPase, blw, RpL19, or acetyl choline esterase. The target sequence in the target gene can be at least about 90% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0010] The invention also provides expression cassettes comprising a yeast promoter operably linked to a DNA sequence encoding a dsRNA which specifically inhibits expression of a target gene in an insect pest. The yeast promoter can be, for example, a constitutively active TEF1 promoter. In some embodiments, the yeast promoter is an inducible promoter. The target gene can be tubulin, vATPase, blw, RpLJ9, or acetyl choline esterase. The target sequence in the target gene can be at least about 90% identical to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

DEFINITIONS

[0011] The terms "nucleic acid," "polynucleotide," and "oligonucleotide" refer to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. The monomer is typically referred to as a nucleotide. Nucleic acids can include modified nucleotides that permit correct read through by a polymerase and do not significantly alter expression of a polypeptide encoded by that nucleic acid.

[0012] The phrase "nucleic acid sequence encoding" refers to a nucleic acid (i.e., DNA) which is the template for transcription of a specific RNA molecule (e.g., a dsRNA) or an mRNA that is translated into a protein. The nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length sequences. A coding sequence can include degenerate codons (relative to the native sequence) or sequences that provide codon preference in a specific host cell.

[0013] The term "promoter" refers to regions or sequence located upstream and/or downstream from the start of transcription and which are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A "yeast promoter" is a promoter capable of initiating transcription in yeast cells. A yeast promoter can be a nucleic acid sequence originally isolated from a yeast, but promoters not initially isolated from a yeast are also considered "yeast promoters" for the purposes of this disclosure.

[0014] An "expression cassette" refers to a nucleic acid construct, which when introduced into a host cell (e.g. , a yeast cell), results in transcription of an RNA molecule (e.g. , dsRNA or mRNA). An expression cassette typically includes a sequence to be expressed, and sequences necessary for expression of the sequence to be expressed, such as a promoter operably linked to the sequence. Generally, an expression cassette is inserted into an expression vector to be introduced into a host cell.

[0015] The term "gene" refers to a segment of DNA involved in producing a protein; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene (e.g., promoters, enhancers, etc.). A "gene product" can refer to either the mRNA or protein expressed from a particular gene. [0016] The words "complementary" or "complementarity" refer to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second

polynucleotide. For example, the sequence A-G-T is complementary to the sequence T-C-A. Complementarity can be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing.

[0017] The terms "protein", "peptide", and "polypeptide" are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.

[0018] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified.

[0019] The terms "identical" or percent "identity," in the context of two or more nucleic acids or proteins of the invention, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters, or by manual alignment and visual inspection. See e.g. , the NCBI web site at ncbi.nlm.nih.gov BLAST/. For example, the sequence of a dsRNA of the invention can be compared using the above techniques to the sequence of a target gene in an insect pest, taking into account the presence of uracil in the dsRNA and thymidine in the DNA. Sequences that have at least about 90% sequence identity using the methods described above are said to be "substantially identical." This definition also refers to, and can be applied to, the compliment of a test sequence. The definition also includes sequences mat have deletions and/or additions, as well as those that have substitutions. Optimal alignment of such sequences can be carried out by any of the publically available algorithms or programs for determining sequence identity and alignment, e.g., BLAST. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figures la to lc show that D. s zukii larvae treated with in vitro transcribed dsRNA have increased mortality and decreased target gene expression, (a) Map of vector for in vitro transcription of dsRNA using convergent T7 promoters flanking -200 bp of D. suzukii target gene sequence. Black arrows indicate direction of transcription, (b) Survivorship of 2nd instar larvae following soaking treatment with dsRNA solution. Mortality' was assessed 24 hours after treatment and at the time of eclosion. A total of 160 larvae were tested in each treatment, and data represent mean and s.e.m. of three independent experiments, (c)

Suppression of target genes yTub23C and Vha26 in whole larvae 24 hours after treatment with dsRNA solution. Ten larvae were homogenized to obtain one RNA sample. Expression was quantified with RT-qPCR and normalized against housekeeping gene Cbp20. Each data point represents a biological replicate, and horizontal lines indicate the mean, (b) and (c) Asterisks represent significance as determined by two-tailed Mest (* indicates p < 0.0S, and ** indicates p < 0.01).

[0021] Figures 2a to 2d show that D. suzukii adults fed on yeast expressing dsRNA have decreased locomotor activity levels, (a) Map of transformation vector for expression of hairpin dsRNA in S. cerevisiae. -200 bp of D. suzukii target gene sequence was inserted into p406TEFl to form inverted repeats linked by 74 bp of intron sequence from the white gene. Black arrow indicates direction of transcription, (b) Expression of dsRNA in S. cerevisiae. Expression was quantified with RT-qPCR and was normalized against housekeeping gene actin. Data represent mean and s.e.m. of three technical replicates, (c) Locomotor activity levels in D. suzukii following a three day treatment with yeast expressing dsRN A targeting D. suzukii blw, yTub23Q Ace, and RpL19. Male adult flies were fed ad libitum with a choice between artificial diet and live yeast for three days. Activity was recorded for 6 days after the feeding period using the DAMS. The first through the fourth days of recording were averaged together, and days 5 and 6 were averaged. Data represent mean and s.e.m. of 3 independent experiments, and a total of 96 flies were tested per treatment. Each experiment was normalized to the average of the control treatment. One-way ANOVA was performed (p = 0.0009) and significance relative to the control was determined by post hoc Bonferroni corrected r-test (* indicates p < 0.05 and ** indicates p < 0.01). (d) Activity levels plotted over the second day of recording following three days of feeding treatment. Each bar represents average activity counts in 15 -minute increments. Black bars indicate lights off and grey bars represent lights on. Each eduction graph represents an average of 32 flies in one experiment. Representative eduction graphs are shown here.

[0022] Figures 3a to 3c show that the effects of yeast feeding treatment on adult activity levels are species specific, (a) Cladogram of melanogaster and suzukii subgroups. Only the tested species were included in the cladogram. (b) Relative locomotor activity levels in D. suzukii, D. melanogaster, D. simulans, and D. biarmipes following a three-day treatment with yeast expressing dsRNA against bellwether and yTub23C. Activity was recorded using the DAMS during the 4 days following the treatment. Data represent averages and s.e.m. of 3 independent experiments, and a total of 96 flies were tested per treatment. Each replicate was normalized to the average of the control treatment. Two-way ANOVA was performed (p = 0.0001) and significance relative to the control was determined by post hoc Bonferroni corrected Mest (** indicates p < 0.01, and *** indicates p < 0.001). (c) Activity levels plotted over the second day of recording following three days of feeding treatment. Each bar represents average activity counts in 15-minute increments. Black bars indicate lights off and grey bars indicate lights on. Each eduction graph represents an average of 32 flies in one experiment. Representative eduction graphs are shown here.

[0023] Figures 4a to 4c show that altered target gene expression in midgut following yeast feeding treatment. Relative expression of target genes bellwether and y-tubulin 23C in (a) adult midgut and (c) larval midgut following three days of treatment with yeast expressing dsRNA. (b) Relative expression in larval midgut of target gene blw following 24 and 72 hours of treatment with yeast expressing dsRNA. Ten midguts were dissected and homogenized to obtain one RNA sample. Expression was quantified with RT-qPCR and was normalized against housekeeping gene CBP20. The expression level in the control is scaled to one and treated expression levels are plotted relative to the control. Each data point represents one biological replicate and the horizontal line indicates the mean. For (a) and (b) n=4, and (c) n=5. Two-way ANOVA was performed and significance relative to the control was determined by post hoc Bonferroni corrected Mest (* indicates p < 0.05, and ** indicates p < 0.01).

[0024] Figures 5a to 5c show that yeast feeding treatment of adults and larvae decreases larval survivorship and adult reproductive fitness with species specificity, (a) Relative egg counts of D. melanogaster and D. suzukii. Virgin females and males were fed separately on yeast expressing dsRNA against blw mdyTub23C for three days. One male and one female were crossed and allowed to lay eggs for 48 hours (D. melanogasler) or 72 hours (D. suzukii). (b) Relative hatch rate of D. mekmogaster and D. suzukii eggs when parents were fed as described in (a). The hatch rate was determined by dividing the number of adults by the number of eggs recorded in that vial. Data shown in (a) and (b) represent mean and s.e.m. of three independent experiments and a total of 75 females were tested per treatment. Each replicate was normalized to the mean of the control. Two-way ANOVA was performed and significance relative to the control was determined by post hoc Bonferroni corrected f-test (** indicates p < 0.01). (c) Survivorship of D. melanogaster and D. suzukii 2nd instar larvae following 24 hour treatment with live yeast expressing dsRNA against btw and yJ'ub23C. Larvae were fed on a mixture containing 50% artificial diet and 50% live-pelleted yeast by volume. Mortality was assessed at the time of eclosion. Data shown in (c) represent mean and s.e.m. of six independent experiments and a total of 300 larvae were tested per treatment. Each replicate was normalized to the mean of the control and significance relative to the control was determined by a two-tailed f-test (* indicates p < 0.05).

DETAILED DESCRIPTION

[0025] This invention provides evidence that genetically modified yeast can be used to produce and deliver dsRNA to an insect pest, such as vinegar flies (members of the genus Drosophila), resulting in altered gene expression and decreased fitness in the insect pest.

Target insect pests

[0026] The present invention can be used to control any insect pest that will naturally ingest yeast in the environment. For example, yeast is an important endosymbiont and a major component of the microbiome in Drosophila 16 . Yeasts are naturally found growing on the surface of intact and rotting vinegars and produce volatiles that are highly attractive to Drosophilids 17,18 Palanca et al. quantified the attractive properties of wild yeast isolates and found vinegar associated isolates were more attractive than those not associated with vinegar, regardless of taxonomic positioning 19 . Additionally, they found that Saccharomyces cerevisiae was the most attractive to Drosophila melanogaster. Drosophila acquire yeast from the environment and can transmit yeast horizontally to mates 20 . Drosophila-associated yeast spores can be passed intact through the gut and deposited onto food sources 21 , where they can be ingested by larvae or adults. Thus, yeast is a chemoattractive, transmittable symbiont of insect pests, such as Drosophila. These characteristics make yeast an ideal and novel candidate to serve as a living biopesticide. [0027] Drosophila suzukii, commonly known as Spotted Wing Drosophila, is an invasive pest of a variety of soft skinned vinegars 22 . Native to South East Asia, this pest was first identified in California in 2008. Since then, infestations have spread across the United States, Canada, and Europe 23 , resulting in an estimated 718 million dollars in crop losses annually 24,25 . D. suzukii is sufficiently homologous to the model insect D. melanogaster to facilitate target gene selection. The D. suzukii genome has been sequenced, which further aids in the design of dsRNAs 6 . Additionally, yeast-baited traps have been demonstrated to effectively lure D. suzukii in an agricultural setting 27 , and evidence suggests that D. suzukii feed on yeasts in the field 28 .

[0028] Thus, the present invention is useful for control of Drosophilids (e.g. , D.

melanogaster. D. suzukii D. biarmipes. D. takahashii, D. erecta, D. yakuba, D. simulans, D. sechellia, D. ananassae, D. persimilis, D. pseudoobscura, D. willistoni, D. grimshawi, D. virillis, D. subpulchrella, D. biarmipies and D. mojavensis). One of skill will recognize that other insect pests that are symbiotic with yeast can be targeted in a similar manner. A number of examples of insect-yeast symbiosis are known (see e.g., Gonzalez F (2014) Symbiosis between yeasts and insects. Introductory paper at the Faculty of Landscape Architecture, Horiculture, and Crop Production Science. 1-52) . Examples of symbiosis between insects and yeast have been characterized in many of the important insect orders, including Hymenoptera (specifically wasps, bees, and ants), Coleoptera (beetles), Hemiptera (aphids and plants hoppers), Lepidoptera (Sigelgaita sp.) and Neuroptcra (lace wing).

RNA Interference

[0029] RNAi strategies for reducing or inhibiting expression of a target gene are known. RNAi techniques employ genetic constructs that encode double-stranded RNA (dsRNA). Typically, the genetic constructs comprise sense and anti-sense sequences which are placed in regions flanking an intron sequence in proper splicing orientation with donor and acceptor splicing sites. Alternatively, spacer sequences of various lengths can be employed to separate self-complementary regions of sequence in the construct. During processing of the gene construct transcript, intron sequences can be spliced-out, allowing sense and anti-sense sequences, as well as splice junction sequences, to bind forming double-stranded RNA. Alternatively, where secondary structure inhibits splicing machinery, the intron sequences are not spliced out and the dsRNA is supplied as a hairpin structure. When the dsRNA is expressed in a cell, as noted above, ribonucleases bind to and cleave the double-stranded RNA, thereby initiating the cascade of events leading to degradation of the target mRNA molecules, and thereby silencing target genes. The phenomenon of RNA interference is described in Bass, Nature 411: 428-29 (2001); Elbahir et al, Nature 411: 494-98 (2001); and Fire etal, Nature 391 : 806-11 (1998); and WO 01/75164, where methods of making interfering RNA also are discussed.

[0030] For example, to reduce expression of a target gene in an insect pest using RNAi, an expression cassette encoding a double-stranded RNA having the sequence of an mRNA transcribed from the target gene, or a substantially identical sequence (including those engineered not to translate the protein), or fragment thereof, is introduced into a yeast cell. The resulting yeast cell can then be fed to the insect pest to determine its ability to inhibit expression of the target gene and/or inhibit growth of the insect pest.

[0031] The RNAi polynucleotide can hybridize with the full-length mRNA encoded by the target gene or hybridize to a fragment of the target RNA or DNA (the target sequence). The target sequence will typically be at least about 10, 15, 20, 50 or 100 nucleotides in length, but usually comprise less than about 500 nucleotides. Often, the target sequence and/or the dsRNA sequence is between about 50 and about 400 nucleotides in length, usually between about between 100 and about 300 nucleotides.

[0032] Although the sequence of the dsRNA used for RNAi need not be completely identical to the target sequence of the target gene, it is typically substantially identical, e.g., at least 70%, 80%, 90%, 95%, 98%, or more identical to the target sequence.

[0033] Target genes can be selected based any of a number of criteria. Such criteria include for example: gene essentiality, midgut expression level, degree of divergence from related species sequences, and target effectiveness demonstrated in previous studies. In the case of Drosophilids, suitable target genes include, for example, y-tubulin 23C, blw, Ace, RpL19 and acetylcholine esterase. Suitable target genes for/), suzukii can be identified in the Spotted Wing Flybase (see, spottedwingflybase.oregonstate.edu). Suitable RNAi targets for three insect species: D. suzukii, Halyomorpha halys (brown marmorated stink bug), and Leptinotarsa decemlineata (Colorado potato beetle) are provided in the sequence listing. Other suitable targets include B aciin for Colorado potato beetle, V-ATPase for western corn rootworm, and hunchback for the pea aphid (Acrythosiphon pisum).

[0034] In addition to RNAi, other inhibitory RNA techniques are known. For instance, antisense technology can be conveniently used to inactivate gene expression. To accomplish this, a nucleic acid segment from the desired gene is cloned and operably linked to a promoter such that the antisense strand of RNA will be transcribed. The expression cassette is then introduced in the yeast cell and the antisense strand of RNA is produced (see e.g., Sheehy et al, Proc. Nat. Acad Sci. USA, 85 :8805-8809 (1988); Pnueli et al, The Plant Cell 6:175-186 (1994); and Hiatt etal, U.S. Patent No. 4,801,340).

[0035] Catalytic RNA molecules or ribozymes can also be used to inhibit expression of a a target gene. Ribozymes that specifically pair with a target RNA and cleave the

phosphodiester backbone at a specific location can be designed to functionally inactivating the target mRNA. In carrying out this cleavage, the ribozyme is not itself altered, and can cleave other molecules, making it a true enzyme. The inclusion of a ribozyme sequence in an antisense RNA confers RNA-cleaving activity, thereby increasing the activity of a given antisense construct. The design and use of target RNA -specific ribozymes is described in Haseloff etal. Nature, 334:585-591 (1988).

[0036] Another method of suppression is sense suppression (also known as co- suppression). Introduction of expression cassettes in which a nucleic acid is configured in the sense orientation with respect to the promoter has been shown to be an effective means by which to block the transcription of target genes. For an example of the use of this method to modulate expression of endogenous genes (Napoli etal., The Plant Cell 2:279-289 (1990); Flavell, Proc. Natl. Acad. Sci., USA 91:3490-3496 (1994); Kooter and Mol, Current Opin. Biol. 4:166-171 (1993); and U.S. Patents Nos. 5,034,323, 5,231,020, and 5,283,184).

Production of Transgenic Yeast cells

[0037] Production of recombinant yeast cells is well known. Yeast species of interest in the present invention include Saccharomyces cerevisiae, Pichia pastoris, and Hanseniaspora uvarum. H. uvarum has been isolated as the most common yeast species in the gut oiD. suzukii and is particularly useful for control of this species. Suitable promoters for expression in yeast are also well known and include, for example, the bacteriophage T7 promoter, promoters from GAL1 (which is induced by the presence of galactose), ADH1, the TEF1 promoter and the AOX promoter (an methanol inducible promoter) and the like. Many yeast cloning vectors have been designed and are readily available. Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant products polypeptides are also well known. Transformed cells are selected by phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine). [0038] In addition, in some embodiments, auxotrophic yeast strains are used. Use of these strains relies on marker genes that encode key enzymes in various essential metabolic pathways. Examples include the URA, HIS3, LEU2, TRP1, and AffiTV J marker genes which encode essential enzymes for de novo synthesis of pyrimidines, 1-histidine, 1-leucine, 1- tryptophan, and 1-methionine, respectively. Yeast strains are auxotrophic for the nutrient in question due to the absence of a functional chromosomal copy of the marker gene. The auxotrophic yeast strains can thus be propagated only in media that contain the appropriate nutrients.

[0039] Alternatively, synthetic auxotrophs can be engineered to require particular compounds. For example, bacteria have been engineered to be viable only in the presence of the synthetic molecule benzothiazole 39 , which prevents genetically modified bacteria from escaping and increases biosafety. This technology could be applied to yeast biopesticides to prevent unwanted escapes.

Lure Traps

[0040] Lure traps are commonly used to attract and kill insect pests. Design and use of such traps are well known to those of skill in the art. A lure trap of the invention can be any device into which the recombinant yeast of the invention are placed, and that prevents the insect pest from escaping once the insect pest has come into contact with the trap. The traps can be of various sizes, shapes, colors, and materials. Traps of the present invention can be designed and manufactured specifically for use as an insect trap, or can be a container converted and adapted from other uses such as, for example, a glass Petri dish, a metal coffee can, a cardboard box, or any ordinary plastic, metal, fiberglass, composite or ceramic container.

[0041] Considerable research has been directed at determining the natural volatile compounds that attract vinegar flies to their hosts, and incorporating them into lures for commercial traps. For example, yeast have been incorporated into lure traps for vinegar flies (see e.g., US Patent No. 8,940,287). Such a trap may comprise yeast in combination with a growth medium (e.g., sugar and water). The growth medium can also include chemicals or nutrients necessary to induce expression of the dsRNA in transformed yeast cell. The trap may also comprise dried or fresh vegetable matter. EXAMPLE

The following example is offered to illustrate, but not to limit the claimed invention.

Materials and Methods

Animal Models

[0042] For all insect bioassays, the researcher was blinded from the identity of the treatment during the course of the experiment. Insects were assigned to treatment groups by pooling same aged individuals from several rearing bottles and randomly redistributing into groups. A different generation of flies was used in each experimental replicate.

Fly strains and rearing

[0043] All Drosophila species and strains tested in our studies as well as their collection sites are Table 1. All lines were maintained in Fisherbrand square, polyethylene, 6 oz. stock bottles (Fisher Scientific, Pittsburgh, PA) containing SO ml of Bloomington stock center Drosophila food recipe. Colonies were kept between 22°C to 25°C in a cabinet incubation chamber (Percival Scientific, Inc., Perry, IA) with a 12: 12 h lightdark cycle.

Table 1: Drosophila strains

Target gene selection for double stranded R A (dsRNA) knockdown

[0044] Target genes were selected based on four main criteria: gene essentiality, midgut expression level, degree of divergence from related species sequences, and target effectiveness demonstrated in previous studies. We assumed that genes with essential functions in D. melanogaster would also have essential functions in D. suzukii. Genes with lethal null phenotypes recorded in Flybase.org were considered essential. We hypothesized that the dsRNA produced by the yeast would be absorbed by the midgut tissues in the fly, so we selected target genes that are expressed in the adult and larval midgut. Midgut expression was determined using the FlyAtlas database of microarray data **. Conservation of target sequences between species was also considered when selecting gene fragments. The D. suzukii y-tubulin 23C target sequence was designed to be highly divergent from members of the melanogaster subgroup by targeting the 3' untranslated region (UTR). The blw, Ace, and RpL19 target sequences were chosen from coding regions and are more conserved across species. Alignments of target gene sequences for/), suzukii, D. biarmipes, D. melanogaster, and D. simulans and identity scores (Table 2) were generated with ClustalW2 4S . Previous studies have implicated tubulin as an effective RNAi target in coleopteran pests 32 . dsRNA targeting blw and RpL19 caused increased cell death in D. melanogaster tissue culture experiments 46 , so we selected homologous target gene fragments from D. suzukii sequences. Chemical pesticides commonly disrupt neurotransmission by inhibiting the function of acetylcholine esterase, so we chose to target this gene as well. Target gene fragment sequences are listed in the sequence listing. Spotted Wing Flybase accession numbers were used as identifiers and sequences can be retrieved from Spotted Wing Flybase (see, spottedwingflybase.oregonstate.edu) .

Table 2: Sequence conservation of target gene fragments

Construction of vectors for in vitro synthesis of dsRNA

[0045] 1 ug of D. suzukii total RNA was used to synthesize cDNA using ThermoScript RT- PCR System (Life Technologies, Grand Island, NY) according to the manufacturer's protocol. Target gene fragments y-tubulin 23C and Vacuolar H+-ATPase 26kD subunit were PCR amplified from D. suzukii total cDNA using AccuPrime Taq DNA Polymerase (Life Technologies, Grand Island, NY) following manufacturer's specifications and ligated into pCR2.1 using The TA Cloning Kit (Life Technologies, Grand Island, NY). The primer sequences used for molecular cloning are listed in Table 3. The T7 promoter sequence (5'- TAATACGACTCACTATAGG-3 ') was added to the 5' end of the forward and reverse primer sequences.

In vitro RNA synthesis [0046] Target gene fragments y-tubulin 23C and vacuolar H+-A7 ase 26kD subunit were PCR amplified from pCR2.1 vectors containing the target sequences and convergent T7 promoters. PCR products were purified with the QiaQuick PCR Purification Kit (Qiagen, Valencia, CA). Purified PCR product was used as template for in vitro transcription using the MEGAscript T7 Transcription Kit (Life Technologies, Grand Island, NY) following manufacturer's instructions.

Construction of plasmid vectors for expression of dsRNA in yeast

[0047] Yeast expression vectors containing inverted repeats of ~200 bp D. suzukii target gene sequence joined by a 74 bp intron sequence from the D. melanogaster white gene were constructed in two cloning steps. The intron and the target sequence were inserted in the forward orientation in the first step, and the target sequence was inserted in the reversed orientation in the second step. Target gene fragments y-tubulin 23C, bellwether, acetylcholine esterase, and ribosomal protein L19 were PCR amplified from D. suzukii total cDNA using AccuPrime Taq DNA Polymerase (Life Technologies, Grand Island, NY) following manufacturer's specifications. A BamHI restriction site was added to the 5' end of the forward primer sequence, and a EcoRI restriction site was added to the 5' end of the reverse primer sequence (see Table 3 for primer sequences). The second intron of the white gene was PCR amplified from D. melanogaster total cDNA using primers with a BamHI restriction site added to the 5' end of the forward and a EcoRI site added to 5' end of the reverse primer. PCR products were purified with the QiaQuick PCR Purification Kit (Qiagen, Valencia, CA) and target sequences were digested with restriction enzymes BamHI and Xbal, and the white intron was digested with BamHI and EcoRI (New England Biolabs, Ips witch, MA). The S. cerevisiae expression vector p406TEFl (Addgene, Cambridge, MA) was digested with Xbal and EcoRI. Digested PCR products and vector DNA were purified with gel electrophoresis and the QiaQuick Gel extraction kit following manufacturer's instructions. The vector, target sequence, and intron were ligated together with T4 DNA ligase (New England Biolabs, Ipswitch, MA). Ligation products were transformed into E. coli and plasmid DNA was extracted from the clones. Sequencing was performed to confirm presence of the forward target sequence and the intron. Target gene fragments were amplified from the confirmed DNA clones using a reverse primer with EcoRI on the 5' end and a forward primer with Hindlll on the 5' end. Confirmed DNA clones were restriction digested with EcoRI and Hindlll. Digested PCR products and DNA vectors were gel purified and ligated together with T4 DNA ligase. The complementary sequences in the completed vectors created secondary structure that prevented Sanger sequencing, so completed clones were restriction digested with Xbal and EcoRl, or BamHI and Hindlll, and gel purified digestion products were used for sequencing for confirmation of successful expression vector construction.

Transformation of plasmids into & cerevisiae

[0048] DNA vector p406TEFl containing inverted repeats of D. suzukii target gene sequence were transformed into S. cerevisiae strain INVScl (Life Technologies, Grand Island, NY) using the Frozen EZ Yeast Transformation kit Π (Zymo, Irvine, CA) following manufacturer's instructions. Transformants were selected on minimal media without uracil and confirmed by colony PCR. PCR reactions were performed as described above with a forward primer located upstream of the multiple cloning site and the reverse primer located within the white intron.

Isolation of RNA from yeast

[0049] 1.5 mL liquid yeast culture was pelleted at 12,000 rpm for 1 minute. 300 μΐ of TRI- reagent (Sigma Aldrich, St Louis, MO) was added to the pellet and homogenized by vortexing with 100 ul acid-washed 425-600 um glass beads (Sigma Aldrich, St Louis, MO). One-fifth volume of 100% chloroform was added to each sample and incubated at room temperature for 10 minutes. Samples were spun down at 13,000 rpm for 15 m 390 minutes at 4°C. The upper aqueous layer was collected and nucleic acid was precipitated by adding an equal volume of 100% isopropanol and incubated at room temperature for 10 minutes. Samples were spun down at 13,000 rpm for 15 minutes at 4°C, and pellets were washed once with two volumes of 70% ethanol. Pellets were resuspended in 20 ul IX Turbo DNase buffer (Life Technologies, Grand Island, NY) and treated with lul Turbo DNase following manufacturer's instruction. RNA concentrations were quantified with aNanoDrop 2000 Spectrophotometer (Fisher Scientific, Pittsburgh, PA).

Treatment of larvae with in vitro transcribed dsRNA

[0050] 2nd instar larvae were separated from fly food and rinsed with water. 100 ul of a solution containing 1 mg/ml in vitro transcribed dsRNA, 3% Lipofectamine 2000 (Life Technologies, Grand Island, NY), and Schneider's Drosophila medium (Life Technologies, Grand Island, NY) was pipetted onto a plastic dish forming a droplet. 10 larvae were gently added to each droplet and soaked for 1 hour. Larvae were returned to a small dish of fly food and mortality was assessed 24 hours later and at the time of eclosion, or larvae were collected for RNA isolation at the same time-point when mortality was assessed. Yeast feeding assay for adults and larvae

[0051] Yeast colonies expressing dsRNA were incubated in 4 ml minimal media without uracil at 30°C and 225 rpm for 24 hours. 4 ml cultures were used to inoculate 300 ml cultures and incubated at 30°C for 24 hours. Liquid culture was pelleted at 5,000 rpm for IS minutes. To feed larvae, pelleted yeast was mixed with standard Bloomington Drosophila fly food medium at a ratio of 1 : 1 by weight and fed to larvae in 12- well tissue culture plates. After yeast feeding period, larvae were transferred to a vial containing standard Bloomington Drosophila medium to grow to adulthood, or were collected for RNA isolation. To feed adults, pelleted yeast was spread thinly on a wooden tongue depressor coated in YPD agar (Sigma Aldrich, St Louis, MO). The yeast-covered tongue depressor was imbedded upright in a vial containing standard Bloomington Drosophila medium and 30 adult flies were added to each vial. To confirm the adults and larvae ingest the yeast, red food coloring was added to the liquid yeast culture (McCormick), and midguts were dissected and inspected visually under a light microscope.

Activity monitoring

[0052] Male adult flies were loaded individually into glass tubes for activity monitoring using Drosophila Activity Monitoring System (DAMS) (Trikinetics, Waltham, MA) following three days of yeast feeding treatment. The glass tubes were filled at one end with media containing 5% agar and 2% sucrose by weight. Percival incubators were set to 25°C with a photoperiod of 12 hours of light and 12 hours of dark. Fly activity monitoring using DAMS and data analysis using FaasX were as previously described 47427

Assessment of fecundity and viability of offspring

[0053] Standard Bloomington Drosophila medium was dyed green with food coloring (McCormick) to provide visual contrast to eggs. 1 ml hot media was pipetted onto a small plastic spoon and allowed to cool. Once solidified, media was painted with a thin layer of wild type S.cerevisiae grown in liquid culture to encourage oviposition. Spoons were placed inside empty fly vials (Genesee Scientific, San Diego, CA) and one male and one female were added to the vial. After the egg-laying period, eggs were counted visually under a stereomicroscope. The spoon was transferred to a vial containing Drosophila medium and eggs were allowed to grow to adulthood.

Isolation of RNA from adult and larval midgut

[0054] Following yeast feeding treatment, live adults were anesthetized with carbon dioxide and live larvae were separated from yeast mixture. Adults and larvae were transferred to a microcentrifuge tube containing TRI-re agent (Sigma Aldrich, St Louis, MO) and kept on ice. Dissection of the midgut was performed immediately on ice in chilled RNAlater (Life Technologies, Grand Island, NY). Midguts were washed 2X in chilled nuclease -free water and 300 μΐ TRI-reagent was added to the microcentrifuge tube. Midguts were homogenized by grinding using a motorized pestle and RNA isolation was performed as described above in yeast RNA isolation.

Quantitative real-time PCR (qRT-PCR)

[0055] 1 pg of total RNA was used to synthesize cDNA using ThermoScript RT-PCR System (Life Technologies, Grand Island, NY) according to the manufacturer's protocol. Dilutions (1: 10) of cDNA samples were used in qRT-PCR reactions. Gene-specific primers were designed based on sequence analysis using the D. suzxihi genome scaffold and optimized at an annealing temperature of 63.3 °C. Melt curve and BLAST analysis were used as criteria to determine primer specificity. The qRT- PCR assays were performed using SsoAdvanced SYBR Green Supermix (Bio-rad, Hercules, CA) in a CFX96 Touch Real-Time PCR Detection thermal cycler (Bio-Rad, Hercules, CA). Cycling conditions were 95°C for 30 seconds, 40 cycles of 95°C for 5 seconds, followed by an annealing/ extension phase at 63.3°C or 55° C for 30 seconds. The reaction was concluded with a melt curve analysis going from 65°C to 95°C in 0.5°C increments at five seconds per step. Three technical replicates were performed for each data point of each biological replicate, and at least 4 biological replicates were performed for analysis of each gene. Data were analyzed using the standard AACt method and target gene mRNA expression levels were normalized to the reference gene Cbp20 mRNA levels. Finally, average relative expression values for treated samples were divided by the average control values to represent the fold change of target gene expression in the treated sample.

Results

Treatment of larvae with in vitro transcribed dsRNA reduces expression of target genes and decreases survival to adulthood

[0056] Previous studies have demonstrated dsRNA can be synthesized and fed to insects in solution or artificial diet, resulting in gene knockdown and mortality ^ 29 31 . This method is often used to select targets for in vivo testing. Critical genes tubulin and vacuolar ATPase are commonly used target genes and have effectively induced mortality in coleopterans 32 . First, we examined whether dsRNA targeting y-tubulin 23C (yTub23C) and vacuolar H+ ATPase 26kD subunit {Vha26) could be used to induce mortality in D. suzukii larvae. dsRNA was transcribed in vitro using a plasmid containing approximately 200 bp D. suzukii target gene sequence flanked with convergent T7 promoters (Fig. la). We found that a one-hour soaking treatment with in vitro transcribed dsRNA reduced survival to adulthood by 54% and 46% respectively (Fig. lb). Next, we asked if the increased mortality was due to changes in target gene expression level. RNA was extracted from whole larval bodies 24 hours after the one- hour soaking treatment. Target transcripts yTub23C and Vha26 were reduced by 76% and 50% respectively in treated samples (Fig. lc). These results suggest dsRNA in the soaking solution is absorbed and able to trigger an RNAi response in the larvae, resulting in mortality. dsRNA targeting critical D. suzukii genes is expressed in modified Sacch aromyces cerevisiae

[0057] DNA plasmids were constructed to constitutively express dsRNA hairpins targeting D. suzukii critical genes. Approximately 200 bp D. suzukii target gene sequence was inserted into a DNA plasmid to formed inverted repeats joined by 74 bp of intron sequence from the white gene from D. melanogaster (Fig. 2a). This plasmid is self-replicating and does not integrate into the host genome, so the host genome remains unchanged. Plasmids were transformed into S. cerevisiae strain INVScl using heat shock and expression of dsRNA was verified using RT-qPCR (Fig. 2b). Empty P406TEF1 plasmid was transformed to use as a control strain. As a control for dsRNA treatments, some studies use dsRNA targeting a gene from another species, such as GFP. We chose to use a yeast that contains empty plasmid and expresses no dsRNA as the control strain to avoid possible off target effects, such as suppression of critical genes that may have regions of sufficient homology to the control sequence to bring about an RNAi response 33 .

D. suzukii adults fed on yeast expressing dsRNA have decreased locomotor activity levels

[0058] Adult D. suzukii males were fed ad libitum for three days with a choice between standard Drosophila artificial diet and live yeast growing on solid agar. To verify that the flies consumed the yeast, yeast were grown with red food coloring and midguts were dissected and examined after feeding. When fed on live yeast expressing dsRNA targeting bellwether (blw), Ribosomal protein L19 (RpLl9), acetylcholine esterase (Ace), and

yTub23C, adult D. suzukii had decreased locomotor activity in the 4 days following treatment (Fig. 2c). The rationale for selection of these target genes is stated in the methods section. Although activity levels were reduced in flies treated with dsRNA, flies in all treatments maintained typical temporal patterns of activity through the day (i.e. anticipation of dawn and dusk, and peak of activity at dusk) (Fig. 2d). We found this effect on locomotor activity level persisted over the first four days following the feeding period, but the activity levels of the treated flies were not significantly different from the control flies by the fifth or sixth day following the feeding period (Fig. 2c). This result indicates the treated flies were able to recover from the dsRNA treatment.

The effects of yeast feeding treatment on adult locomotor activity levels are species specific

[0059] The benefit of using RNAi in pest management is that RNAi triggers can be designed to target pest species, but not beneficial insects. To demonstrate this, we fed yeast expressing dsRNA to other Drosophilids and found that even closely related species were unaffected by the treatment (Fig. 3b). D. biarmipes is closely related to D. suzukii, while D. melanogaster and D. simulans and more distant relatives (Fig. 3a). D. simulans, D.

biarmipes, and D. melanogaster were unaffected by treatment with yeast expressing dsRNA targeting bhv and yTub23C. All species maintained regular temporal patterns of activity throughout the day (Fig. 3c). Homologous gene target gene fragments were identified for each species by BLAST sequence alignment 34 , and sequence identity scores were calculated (Table 1) . The bhv target gene fragment was designed to be highly conserved, with 95% to 99% conservation between D. suzukii and the other Drosophila species. Surprisingly, closely related D. biarmipes did not have significantly reduced activity, despite 130 consecutive matching base pairs in the target gene fragment. D. melanogaster and D. simulans have 42 and 50 consecutive matching base pairs to the bhv fragment, respectively. The yTub23C target gene fragment was designed to be divergent by targeting the 3' untranslated region and is 90% to 74% conserved. We predicted HheyTub23C fragment would be less effective on species other than D. suzukii due to reduced base pair matching. The lack of an effect on activity in species other than D. suzukii suggests that a high degree of perfect base pair matching is required to reduce locomotor activity. These results imply the mechanism responsible for this reduction in activity level is target sequence dependent. Alternatively, it is possible that bhv is sufficiently conserved in other species to be susceptible to RNAi, but there are different regulatory mechanisms in other species that can better compensate for the knockdown of this critical gene. Another alternative explanation for the differences in activity level between species following treatment could be that the dosage varies by species, since the feeding assay was conducted ad libitum. Ingestion of yeast biopesticide alters expression level of target genes with species specificity

[0060] RNAi is not systemic in Drosophila, meaning RNAi only occurs within cells that contain dsRNA 35. The midgut is the only portion of the alimentary tract that is not keratinized and is thought to be the main site of dsRNA absorption, so we examined the midgut tissues post treatment to measure changes in target gene expression in adults and larvae. D. suzukii larvae fed on yeast expressing dsRNA targeting yTub23C for 72 hours had reduced yTub23C mRNA levels in the midgut, and larvae fed on yeast targeting bhv had significantly increased expression of bhv (Fig. 4a). Although RNAi directly reduces target transcript levels through cleavage and degradation, previous studies have demonstrated that compensatory mechanisms can cause upregulation of target genes following an RNAi response 36 . To determine if this was the case, we measured blw expression after 24 hours of treatment with yeast targeting blw and found that expression is decreased after 24 hours (Fig. 4b). This result suggests knockdown of blw is occurring soon after initial yeast exposure, and over several days, a compensatory mechanism causes increased expression of the target gene. Adult D. suzukii midgut gene expression following yeast treatment was similar to the results in larvae, i.e. bhv expression was elevated following treatment, dyTub23C was decreased (Fig. 4c). We did not find significant changes in target gene expression in D. melanogaster larva or adult midguts following 72 hour yeast feeding treatments (Figure 4a, 4b). The lack of change in target gene expression in D. melanogaster was not surprising, since we also saw no changes in locomotor activity. These observed changes in target gene expression in D. suzukii but not D. melanogaster indicate precise target gene sequence matching is required to elicit an RNAi response. Moreover, larvae were subjected to a no-choice feeding assay, so differences in gene expression between D. suzukii and D. melanogaster larvae are not dependent on dosage.

Ingestion of yeast biopesticide reduces reproductive fitness.

[0061] Decreased reproductive fitness of an insect pest can reduce the population size within a region, minimizing crop losses. To test if the yeast treatment affects reproductive fitness, we counted the number of eggs deposited per female post-treatment and measured the survival rate of the offspring. We found that yeast expressing dsRNA that targets bhv and yTub23C caused significant decrease in the number of eggs laid by D. suzukii, but not by D. melanogaster (Fig. 5a). One explanation of this result is that induction of RNAi reduces overall fitness, so females are unable to devote resources towards producing eggs. An alternative explanation is that because treated flies are less active, the first mating is delayed compared to the control, resulting in fewer eggs at the end of the test period. The survival rates of the offspring of treated adults as measured by egg hatch rate were unaffected in both species (Fig. 5b). In our assay, the food source was coated with wild type yeast to encourage oviposition, which may have interfered with passage of transgenic yeast from the parents to the offspring.

Ingestion of yeast biopesticide decreases larval survivorship

[0062] Ingestion of yeast expressing dsRNA targeting blw and yTub23C during the larval stages decreased survival to adulthood in D. suzukii, but not in D. melanogaster (Fig. 5c). Adults of all tested species fed on yeast expressing dsRNA did not have increased mortality in this study. Larvae consume a greater amount of food per day compared to adults. Since the larvae were fed in a no-choice assay, and the adults were fed with a choice between live yeast and artificial diet, we reason that larvae likely received higher dosage of yeast. Differences in dosage could explain why the yeast feeding treatment induces mortality in larvae, but not in adults. Alternatively, we speculate larval stages could be more susceptible to RNAi than adults due to differences in the absorptive properties of the midgut or robustness of the RNAi pathway.

Discussion

[0063] Here we show that genetically modified yeast can be used to deliver dsRNA to an insect pest, causing decreased fitness through RNAi. Ingestion of this modified yeast by adult D. suzukii results in decreased locomotor activity and reduced egg laying. Larvae exhibit reduced survival to adulthood when fed on yeast expressing dsRNA, and adults and larvae have altered target gene expression following yeast feeding treatment. We find the effects of the yeast feeding treatment on fitness are species-specific, even when testing closely related species. Since species with divergent target gene sequences, such as D. simulans, were unaffected by the yeast feeding treatment, we find it unlikely that sequence-independent effects were responsible for the observed decreases in fitness. Changes in target gene expression following yeast feeding treatment were observed in D. suzukii but not in D.

melanogaster (Fig. 4a). D. biarmipies, D. melanogaster, and D. simulans exhibited no changes in locomotor activity (Fig. 3b). Together, these results indicate sequence-dependent target gene knockdown via RNAi was the primary cause of decreased fitness observed in D. suzukii. [0064] This yeast biopesticide could be improved as a delivery vehicle by additional modifications to the yeast genome. S. cerevisiae lacks a functional RNAi mechanism 37 , which might make it a suitable dsRNA delivery vehicle if the absence of RNAi machinery promotes stability of dsRNA. On the other hand, the delivery of dsRNA pre-processed by DICER or other components of the RNAi machinery might induce a stronger RNAi response in insect cells compared to long, unprocessed dsRNA. Thus, the insertion of key dsRNA processing genes into the yeast genome should improve efficacy of this yeast biopesticide. Another improvement to the current design is to create modifications such that dsRNA is excreted from the yeast cells in membrane-bound vesicles. In the current design, dsRNA is expressed from circular DNA plasmids and remains within the cell. We hypothesize that dsRNA is absorbed into insect cells only when yeast cells are lysed within the insect midgut. It has been previously demonstrated that lipid encapsulated siRNA is more stable and more readily absorbed than naked siRNA 38 . Therefore, continuous excretion of dsRNA in membrane bound-vesicles from intact yeast should increase the dosage and absorption of dsRNA into insect cells.

[0065] The biosafety of this yeast biopesticide could be increased by adding a built-in mechanism of containment. A common concern with genetically modified organisms is their containment and potential negative impact on the environment. Yeast can be carried from one location to another by Drosophila, so it seems likely that genetically modified yeast could be spread beyond the boundaries of agriculture. Our design can be improved simply by placing the dsRNA under a promoter that requires the presence of an artificial molecule in order to prevent expression of dsRNA in the yeast where it is not wanted. Recently, bacteria known as synthetic auxotrophs were engineered to only be viable in the presence of the synthetic molecule benzothiazole 39 , which prevents genetically modified bacteria from escaping and increases biosafety. This technology could be applied to yeast biopesticides to prevent unwanted escapes.

[0066] We predict that this yeast biopesticide could be successfully implemented in the field to combat D. suzukii. The emergence of insecticide resistance and increasing popularity of organic food products may open the door to non-chemical means of pest control in both organic and conventional farming. A method for administering this yeast biopesticide in the field has already been presented, since yeast baited traps have previously been used in berry crops to lure D. suzukii 27 . Additionally, there is precedence for the agricultural use of genetically modified fungi, as the USDA has issued 26 permits for environmental release of genetically modified fungi since 1995 . A major limitation of the current design is that mortality is not induced in adults. However, we found this yeast biopesticide significantly decreases egg laying and therefore could decrease the population size of the next generation. This yeast biopesticide could be used in complement with chemical pesticides by targeting detoxification genes rather than critical genes. By altering expression of detoxification genes, D. suzukii could be made more susceptible to chemical pesticides. As different types of insecticide resistance emerge, the genes targeted by the yeast could easily and quickly be changed to compensate. Targeting multiple genes simultaneously may also increase toxicity of this biopesticide. Further screening is required to identify groups of target genes that will have additive effects when knocked down together.

[0067] Another characteristic of yeast that makes it an interesting candidate for a biopesticide is that unlike chemical pesticides, it can be easily grown with commonplace starting materials. Currently, live S. cerevisiae, commonly known as brewer's yeast, can be purchased in packets from any grocery store. The yeast in these packets is dry and does not require refrigeration. We envision that in the future, a yeast biopesticide could be similarly packaged and distributed to farmers in developing countries, where it could be cultured at the site of use.

[0068] A limitation of all RNAi-based technology is potential off-target effects. Only partial complementarity between the guide strand and the endogenous mRNA is required to prevent translation, so silencing of related transcripts in humans and other non-target species is a concern. In addition to sequence-dependent off-target effects, introduction of dsRNA into mammalian cells can have sequence-independent effects on the immune system 4l . For example, dsRNA can activate an innate immune response in mammals, resulting in increased levels of inflammatory cytokines such as tumor necrosis factor and interferons 2 . In this pathway, dsRNA binds and activates protein kinase R, which phosphorylates and deactivates eukaryotic initiation factor eIF2, thereby inhibiting translation in cells that contain dsRNA 43 . Since these effects on the immune system are not dependent on the sequence of the dsRNA, even careful selection of target sequences cannot mitigate these off-target effects. Pesticides containing dsRNA will need further testing to determine if they are safe for human consumption.

[0069] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

oning Tub(BamHI)R D. suzuhi

References

1. Coy, M. R. et al. Gene silencing in adult Aedes aegypti mosquitoes through oral delivery of double-stranded RNA. J. Appl. Entomol 136, 741-748 (2012).

2. Jarosch, a. & Moritz, R F. a. Systemic RNA-interference in the honeybee Apis mellifera: Tissue dependent uptake of fluorescent siRNA after intra-abdominal application observed by laser-scanning microscopy. J. Insect Physiol. 57, 851-857 (2011).

3. Li, H. et al. Long dsRNA but not siRNA initiates RNAi in western corn rootworm larvae and adults. J. Appl. Entomol. 139, 432-445 (2015).

4. Zhang, J., Khan, S. A., Hasse, C. & Ruf, S. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science (80-. ). 347, (2015).

5. Copeland, J. M. et al. Extension of Drosophila Life Span by RNAi of the Mitochondrial Respiratory Chain. Curr. Biol. 19, 1591-1598 (2009).

6. Zhang, H., Li, H., Guan, R & Miao, X. Lepidopteran insect species-specific, broad spectrum, and systemic RNA interference by spraying dsRNA on larvae. Entomol. Exp. Appl. n/a-n/a (2015). doi:10.1111/eea.l2300

482

7. Chen, A., Zheng, W., Zheng, W. & Zhang, H. The effects of RNA interference targeting Bactrocera dorsalis ds-Bdrpll9 on the gene expression of rpll9 in non-target insects.

Ecotoxicology 24, 595-603 (2015).

8. Obbard, D. J., Gordon, K. H. J., Buck, A. H. & Jiggins, F. M. The evolution of RNAi as a defence against viruses and transposable elements. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 364, 99-115 (2009).

9. Kim, D. H. & Rossi, J. J. RNAi mechansims and applications. 44, 613-616 (2009).

10. Zotti, M. J. & Smagghe, G. RNAi Technology for Insect Management and Protection of Beneficial Insects from Diseases: Lessons, Challenges and Risk Assessments. Neotrop. Entomol. (2015). doi:10.1007/sl3744-015-0291-8

11. Burand, J. P. & Hunter, W. B. RNAi: Future in insect management. J. Invertebr. Pathol. 112, (2013).

12. San Miguel, K. & Scott, J. G. The next generation of insecticides: dsRNA is stable as a foliar-applied insecticide. PestManag. Sci. n/a-n/a (2015). doi:10.1002/ps.4056

13. Li, H., Guan, R, Guo, H. & Miao, X. New insights into an RNAi approach for plant defence against piercing-sucking and stem-borer insect pests. Plant. Cell Environ, n/a-n/a (2015). doi:10.1111/pce.l2546

14. Tian, H. et al. Developmental control of a lepidopteran pest Spodoptera exigua by ingestion of bacteria expressing dsRNA of a non-midgut gene. PLoS One 4, (2009).

15. Taracena, M. L. et al. Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi. PLoSNegl. Trop. Dis. 9, e0003358 (2015). 16. Starmer, W. T. A Comparison of Drosophila Habitats According to the Physiological Attributes of the Associated Yeast Communities. Soc. Study Evol. 35, 38-52 (2013).

17. Becher, P. G. et al. Yeast, not vinegar volatiles mediate Drosophila melanogaster attraction, oviposition and development. Fund. Ecol. 26, 822-828 (2012).

18. Scheidler, N. H., Liu, C, Hamby, K. A., Zalom, F. G. & Syed, Z. Volatile codes:

Evolution of olfactory signals and reception in. Sci. Rep. in press

19. Palanca, L., Gaskett, A. C, Gunther, C. S., Newcomb, R. D. & Goddard, M. R.

Quantifying Variation in the Ability of Yeasts to Attract Drosophila melanogaster. PLoS One 8, 1-10 (2013).

20. Starmer, W. T., Peris, F. & Fontdevila, A. The transmission of yeasts by Drosophila buzzatii during courtship and mating. Anim. Behav. 36, 1691-1695 (1988).

21. Coluccio, A. E., Rodriguez, R. K., Kernan, M. J. &Neiman, A. M. The yeast spore wall enables spores to survive passage through the digestive tract of Drosophila. PLoS One 3, 516 (2008).

22. Lee, J. C. et al. The susceptibility of small vinegars and cherries to the spotted-wing drosophila, Drosophila suzukii. PestManag. Sci. 67, 1358-1367 (2011).

23. Asplen, M. K., Anfora, G. & Biondi, A. Invasion biology of spotted wing Drosophila (Drosophila suzukii): a global perspective and future priorities. J Pest SC (2015).

doi:10.1007/sl0745-006-9094-l

24. Walsh, D. B. et al. Drosophila suzukii (Diptera: Drosophilidae): Invasive Pest of Ripening Soft Vinegar Expanding its Geographic Range and Damage Potential. J. Integr. PestManag. 2, 1-7 (2011).

25. Bolda, M. P., Goodhue, R. E. & Zalom, F. G. Spotted Wing Drosophila: Potential Economic Impact of a Newly Established Pest. Agric. Resour. Econ. Updat. Univ. California. Giannini Found. 13, 5-8 (2010).

26. Chiu, J. C. et al. Genome of Drosophila suzukii, the Spotted Wing Drosophila. G3-Genes Genomes Genet. 3, 2257-2271 (2013).

27. Iglesias, L. E., Nyoike, T. W. & Liburd, O. E. Effect of Trap Design , Bait Type , and Age on Captures of Drosophila suzukii ( Diptera : Drosophilidae ) in Berry Crops. Hortic. Entomol. 1508-1518 (2014).

28. Hamby, K. a., Hernandez, A., Boundy-Mills, K. & Zalom, F. G. Associations of yeasts with spotted-wing Drosophila (Drosophila suzukii; Diptera: Drosophilidae) in cherries and raspberries. Appl. Environ. Microbiol. 78, 4869-4873 (2012).

29. Mao, J. & Zeng, F. Feeding-Based RNA Intereference of a Gap Gene Is Lethal to the Pea Aphid, Acyrthosiphon pisum. PLoS One 7, 1-7 (2012).

  46. Boutros, M. et al. Genome-wide RNAi analysis of growth and viability in Drosophila cells. Science 303, 832-835 (2004).

47. Chiu, J. C, Low, K. H., Pike, D. H., Yildirim, E. & Edery, I. Assaying locomotor activity to study circadian rhythms and sleep parameters in Drosophila. J. Vis. Exp. 1-8 (2010). doi: 10.3791/2157

D. suzukii gene target sequences.

Gene ID as annotated in the D. suzukii genome, the Flybase Gene ID for the homologous Drosophila melanogaster gene, and the gene name are provided .

"»" denotes the start of each gene fragment. In some cases, multiple gene fragments are provided for each gene. The minimum length for each sequence is 200 bp.

TTCGGAACTGAAGAAG CTGCGCA

DS10_00001763 , FBgn0005322 , nmd

ATGCACGGCTCACGCTCTCCTGTTCACGAATTCC

»TCCTGAGCTGCTGCAGCCGGGGCAATCGTTCGATCAAGTCCGCCGGTGAGTCCTCGAT AAACCGCG

ATTCCGGCGGAAGTTCCGGTCATTACACCCATCGCAGTGAGCCGTGCTACAAGAGAG AGCGCCAAAGG

GATGCGGCCGGAAGTGGGGCTCCGGCGAGCGGAACAATCAAAAACTGTTGCACCCTG GTGGCGGCCAC

CCGAAGGGACAGTGGTTCCTCCACCCAGCACAGTGCGAATTCCTACTGTGGCTATG

»ATTCCTACTGTGGCTATGTCACTCCGGCTGGGGAATACTCGGGAATGAGTGGAGGTCG CAACACGG

AGTCTTTGGATTGCCGTTGOVAACAGGACACCGGAAIX^TTCCGATTATCTGCT

ACTCCAGAGGTTCCGGAGGCCTTCCAGGACGACTACACACCCACTCCCCCATCACCTAGG CTCAAGAC

CCAGACGCCCCGATATTCGAGCTCATNCAGCCAGCAGCT

>>GCATCCGCTTCAAGAACAGGAATCGACTGCCAGTTCAAGGAGAACAAGAACG AATGCTAAGTATCA

AAAGGAAAAATCTGATCTGTGAAAACTCCTACGGGCAGCGCCTTAAAATCGCTGCCT GCCAATCGGGA

GTGGGCGTGGCATTTTTGGATTGCCGTTGCAAACAGGACACTGGAATGGGTTCCGAT TATCTGCTCAA

CTTTACGCCCACTCCGGAGGTTC

DS10_00003681 , FBgn0036374 , Spt20

»GATACTCGCTGGCCCTGCACTATGACGAGCACATGCTGCTGAACCCGCAAACGAACGA ATGGTCCA CCACCGCGGACAAGGACGAAGCGGCGAATGAGGCCGCGGGGTTGGGATCGGCAGCAGGAG CAGGCAGT CATCGAAGTCGGCCAAAGCCGGCGACCCTGGACGAAAGTCACGTCAAGACGGAGGCGGGC CAGGCCAA GCATGACTTTGGACTAGTGGAGGTGCTCCGGTGGCCCTATCAGAACGACCTTCTCCTGCA GTGCATCG ATCGTGAGATGCTGCCGGAGTTTCTAATGGATCTACTCGGCGCGGAGACGGTCAGTTTGT CGGACGGC GAGGGGACACGGGTGTACGCCAAGC

>>GAAAAGTATGCCAAGGCCTTCGAACCCCTTAACGAATTCAGCGAGGCCTGCA AGGACGGCTGCCAG CCGAATTGCCGGCACAACTTCCAACCGCAGCTCATCGAGGAATACGTCCTCGAAACGGAG CGTGAGGC CAGTGAAGGTCGGCGGGCGTTGTACCACATCAAACTGTCCATCTTCCAGCGGCCCTCCGA TGCCGAAT ATCTCGGCGAACTGTATGTGGACCGAGACTACCGGGAGGGCGAGCGCAAIXMCGAGTCGT GCCGCTTT G

DS10_00008484 , FBgn0001297 , kay

>>TGACGACGCCGACGTTGACCCCAACCACGACGCGCAGC^

CGGATACGCAAAATGATCGTGGAGCTGGCTGCGCGGGATTCGCCGTGCCCCTGGTGCTGC CCAATGCT

GCGAACGGAGGAAACGAGTCCAATGGCAATGGCATCGCCGCGATTCCCTGCCAGCAG CAGCCGTACGA

TGTGAGTCTGGTGGCAGGAAGCGATTCCGAGGACTCCAATGCCTCGTACAACGATAC GCAGA

»AGGAGGAGCAGAAGCGGGCTCTGCGCCGGGAGCGGAACAAGCAGGCGGCGGCCCGCTG CCGGAAGC

CATCCGGAAGGAGATCGAGGCGCTGACGAACAGCAAGAACCAGCTGGAATACCTGCT GGCCGCCCATC

GGCCCACCTGCCACAAGATCCGCTCGGATCTGCTGAGTGTGACCACCTGCAATGGGC TGATTGCTCCG

GCTGGACTCCTGAGTGCCGGCAGCAGTGGCA

>>GATCTCTGCAGACGCCGATAACGAGCACGGCGCCCGGAGGATTTGGTAGTGC CTTTCCGGTGACCA

CCAATGGAGGAGGAAACGGTAGCACCAGCATGAACAGTCCCACGCTGAATGCCCTGA ACAAGGTGCCC

AAGGAGCGGCCCAACACGCTGGCCTTTCAGCGACCCCTGGGCATGCACCTGACCCTG GCCAACAGCAA

GGCGCAGCACGGTGGCCCCACGCAGATCCAGGGAGTGCCCATCCAGACGCCCT

DS10_00000341 , FBgn0000097 , aop

>>CCTTTCGGTTAGGATGGGTTGCGTAGTACTCAGGGGAAACGAAAAACTAATC TTTGTAGAATTTGA

AGACATITCACTTGGAAGTITCATATGATAACTGGAAAAGAAATACTTTAATACACA CAAATTGTTAC

TCAAATTTAAAATCAAAGATTACTTTCCGTTCCTTTAGTTCTTTGCCAATGTACAAC G

CTTTCTGTATATAGAAATCACATCTGCAT

DS10_00006287 , FBgn0001218 , Hsc70 -3

>>ATAACATCAAT1TACAT1TTAAAAGTTAGAACTT1TTTTAAAAGTCGGTTAC TTGCTGCCCTACAT CCGTTTTCCAACACTGAACCACCACTGACGTGGCCCAGAGTTGCAAGCGTGTGCGTGTGA GCGTATCG CAAATCTGTGACTGTGTGCGTGCTTAGAAAGCGCCGGCAAAAAAATCAGAAAGCAGCAGC CACATATT C

DS10_00003662 , FBgn0028695 , Rpnl

»GCATGCTCTCGGCCACCGCCTCGCTGGGTCTGATACTTCTGTGGGACGTGGATGGCGG TCTGACCA

TGATCGACAAGTACTTGTACTCCACGGACGACAACATCAAATCCGGCGCTCTGCTGG CCTGTGGAATC

GTCAACTGTGGCATCCGTAACGAAGTGGATCCGGCCCATGCACTGCTCTCCGACTAC ATTGATAACCA

GAACACGTGCATGCGCGTTGGCGCCA

DS10_00006012 , FBgn0030189 , CG2909

>>TGCTGAAGGAITGCCGCCAGGTGAAGAAGCCCGTTGCTGGAGACAATGACTT GAAAAATATGATGG CCAAATCCGAGGAGTTTCCTCTGGAGTTTGGTGTGCAAAGTGTCCGGGTGAAGAGGCAAT CTCCTCTG CGGCTGGCCAGGATCAACGAGGAGGTGGCCTCCGCCTATCCGGTGATACACGAACGCACC CTGGGTCT TTATCTGCAGTATCTGGAGCACAAGTGCCATTGGGGGAACTCTGTGGAGAAGCCCATATA CAGGCCAC TCTCCCTCTGTGGATTTGTGCAGCGCCTCCTGGAGAAGCGCTGCGCCAGCTTCTTTGCCC GCAACGAC AAGTTCCTGCTGCTGAGCGGTGAGACGGGGGCCAGTGGCTTTGAATCAGTAGGCACGCCG GAGGAGAA GGCACCCCTGGTGCTGGCCGACGTTCTAAGCTACGACGACATTAAGTTGTCCGCCCTGCT CTCCGTGA GCTCACACACGGAGTTCGTCAACGAGGGCGAGCGGACCAACTGCGGTCACGTTGACTTGA ACACCAAG ACGCTGGAGCGGACAGGCGTTATCGTGGGCATGATTGGAGCCC

>>TAATCTTCACGCAAACCGGGGAGACTGAAAACATTCTTGATGCCGCCCGCCA GGGACTGATAGACG ATCAGCTAATCAAGATTGTAGATCCTACAACCAAGCAAGCGATTTCCATAACTGAAGCGA TAGCGCGT TCTATTTACGATCCCAAGACCGCCACTATACTTGATTCTGAAGGACAACCTGTGGACCTG ATCACAGC AACTAAACTGGGTCTATTGAGTGTCGIX3<MTGCCCCATTGGTTGCCGCCGAAGGAG CCCTTAGAACCG TACGCTTCGTCACCGATCCGCGAACCGGTCAACAAATACCTGTGGAGGTGGCTTACGAGA GAGGCATT GTCTCACGTGATCAGCTGCATCGCGGGCGATCCTTTGATAGTGAACCGGCGAAAGTTGAG GAGAAGGT GGTAGTGTTGCAAAGAATGCGAAAGGTCATTCTGAAGCCAAAGGATGCTTTAC

>>ATGCTTTACGAAAGGGAATTATCGACGAGGAGACATGTGAGATACTCGAGAA TACAAACAACTTCA CCAATCCTAAAGGTGAGGTGGTTAACATAAGTGAGGCTCTAAACACGGGACTGATTGATG GACGCCGT GGACAAATCATTGATCCTCAAAGCAATCGTTTTCTTAATTTGAGGCAAGCGGTGGAACAA ^ TGAACCCGATCAGACGAATCATATTCTAATGCCGTTGGCCAAGAGCT

>>CGGIX3GGTATGATATTCCCAGTGGCAGTGGAAAAGGGCCTTGTGGAACCGT CGAAGCGTGTGGTTC TGCACCCAACTACAAGGAAAGCCATTTCCATCAAGCAAGCCATTAAGGAGAACITCATTA TCTCGATT CCCTACTCACCGAAACCAGATGCTATAGAGGTGGTTACTGCGATGGAGCGAGATATAATC GATGTGGC TGCGCAGACGCTGACAGTCCCGTCCACTGGGGAACGTGTACCTCTGCGTCAAGCTATGGA AAATGGAA TTTTAGTAGTAAAGAATCTCTCCGATTTTGTCGTTACCCAGAAACCCATTCC

»GCGAAGAATCCACAACTCGAGAGACCAAGGCGGCGGCAGGAGAAAGTCCGGAATCGAT TGCTGCAC TAGCCACTAGCAGCGATCAAACTGTGGTAGTGGAGGAGCGCACCCAGACAGTGGTGGTAA GTTCGGAC ACACGCAAAGAAGAATTGCAAGTAGTCAGCACAACGCAATCCACCAAGGAAATACCGGTT TCAATATT GAGCGAAACCGAAAAGAAGGAACCATCAAAGACGTTACAGAATGTAAGAGATGCCGCCAA AATGGGGG CACTCGGAGTCATCGCAGCCCCTGTACTGGCCGGAGGAGCCATCGTGAGTGGCGTTAAAA GCCTCATC AAGTCTGTGAAGTCTCCCACAGAAGATGCCAAGTCCAATGCGAAACCAGAGCAACCTCAG AGCAGCTT CAITGACCAGGAGCGCCGCAATATGTTACAGCCACAACAAGTGCCAAGTGACGTGGATTA TCTTCTCG ACGAAACGAATAACTTTATTAGCTCCACAACTGCCAACTTCATAGCCAACGAAAATCAGC AGGATTCC AAAAAGTTACCACATGAAGAAGTGGGGCCTTTAACAGTTGAATCAACAAGGACACTGACC ACCACAAC AGTTAAGACCGTAACTACCTCAAAGACATCATCAGAGATCGCAAATCTAGAGCCAGTTGT GGTGGAAG ATGTCACCGCTAGCATTACTGTCGAGGAGAGTCCAAIX-GTAGAAATGGTAAATGAAGTA TCAGAGAAA CCTAAGCAAGTGTTGGAAGATAAAACAAATGCTTCCAAGGTAACTGAAATCATTACCACA GTTACAAC TAAGGAGACAGAITGTTTGCCAGAAAAACCATCTCCAACTAAATTCACTTCTGAAGAGCC AACAAAGA AGGAACCCAATGTTATGAAAGAACCGGAGTCCCCGAAGCCTGTTCAAAAAGACCGAACTC CCGACTCA GCTCAAGGAGAAGTATCTTCAGATGCAAATAAAACGGACTCGACTTCCGAGGTGGTTAAA AAAGAGAA AACTCCAGAGCC

>>AGAGAAAACTCCAGAGCCGGCCCAGATCACAGAAAAAGAAACTAATCGTGCA TCGGCCATTGAAAC AGAACCTTCCCCAGAGACCACTACAAAACCAGAACCCAAACCAAGAACTGGTAAAAAAGA AATGCATC CCGATATCGAGCCGCCTTTCACAGCACGACTTC

ACAGAAACCGAAATTAAACCCGTTGCTAGTTCTCAAACTATAACAACTATTACAACT GTAAAAACAAT TGAGGAGCATCCAATGATTGAGGAAGGTACTGTGACTAGCAAACCTGACATGAITGTTGA TGTGCAAG TAAAGGAACCAGCCGTCCAAGAGCCITCCAACAIXMATAAGCCAAGTCATATCACTAAGA AITCTITT AAGCCTGAACACACCAGTACAACAGTGCTCAATGAAAGCACT

AGAATCTACAGTAACAACAACAACTATTAGAACAACCACCACAGGCGCTGAGGCGAA CCCGCCCCACG

AGCTTAAAGTTACGGAGGAGAAACCGGCTGCGGAGGAGCTAGTACAACTTATCCCAG CTCAGCCCTCA

GAGACATCACAGAAAACTAGCGGTGAAGAAAGTAAGTCAGAACACACAGACACTGAG TCGCCAGATAA

GGAGCCAATACAAGATGATCCAACTCGACCTATTGAGACATCTCAGACAATTAAATC AGTGATCGCAA

AGACAACTGTCATTAGTGAAGAAAATCCACAACTTTCAAGTGATCTTGAGCGTACTG TTCTACCTCAG

CCTGCTTCGGACAAGCATCAATCAGTAGTTGATTTCATTGAGATGGAAAAAAGGCCA CAAGGGTCGGA

AAGTAGCACCAGCATTCTGCAGAACGTCAAGGATCCTGCTAAGTTAGGGGCTCTTGC AATTGTGGGAG

CACCCGTCCTCGCTGGCAAGGCTTTGGTAGATGTTCTAACCACAGAAAAAACACTCA AACCACAACAA

TCCAATCAATTGGGGCCTGAGACAGTGGAAGAATTGCCAACGGATAACATCTCCACC ATCCCCGCCAC

ATTAATAACAAAAGTCACCACTATAACATCCACCTCCACAACATCAACCGTTGAAAG CACTCCCTTAG

ATGAGTCCCATGACGTAGITGAACTGCCTGCTGAGTTTGCAGAAACAACTATCAAGC GAGAAGTGCCC

AGAACACTGCCCATTGGCGATGCCATTTCCCAAAAACTGATTAGCCCCGATGAGTGT CAGGTGATAGT

AGATGGAGAACAAGAGTCTCAAACTGTTTCCACGCTGCTCAAGGAGGAGCAGCTGAG TCCATT

AAGTGCAGATCATTGACGACAAACTGATTGTACTGCATCAGGTCACCTACCTGGTGG ACGCCGACACC

GAACTGACGCCCGAAAATCTGGGCGAGCTTAACATCTACGATCCCG

>>CCGGCAAATACGAGACTCTCACTGGAGCTTTGGAACGTCCTCTTCTGGACAG GCACACTGGTCACA TGGTCGATCCCAAGACAGGCAAGAAAATACCATTCTITG

GCGAAACCCGAGGAGCAGCGACAACCAGGCATTGATAACGTAACAATAGACACACAA ACCGGACAGGT GGTGCTTGACG

>>CCATTGAAATGGGCTTTGTAGAGCTGGAGACGACGTTGGTCAAGGATGCCGA TCACGACAAGATTT TGCCGGGCAAAGAGGCAGCAAAGGTGGGTCTTCTGGACACGGTTCGTGGTACCCTAAGCT CGCCCAAC ATCAGTCTCGATGAGGCCTTCGTTAAGGGCTATCTCATTAGCACCAAGAAGCCACTGTCT CTAGTCGA TTGTCTACTGCGIXMTCTCTACGATCCTTCGACAGCTAAATTCACCATCGACGACA

H. halys gene target sequences.

Gene ID as annotated in the H. halys transcriptome, the Flybase Gene ID for the homologous Drosophila melanogaster gene, and the gene name are provided.

"»" denotes the start of each gene fragment. In some cases, multiple gene fragments are provided for each gene. The minimum length for each sequence is 200 bp.

ATGGAGAACATGGAAGGCAAGACTCCATGGAGCCAAATGAAGAATGGGTCGGAGCTGAAT GCCGTTGC CACCAATTGAAGCCGTTAGAGAGGAGAAGGAAACGAGAACAGCACCAGCGCTGCCTCGCA CATTCCCT AGTCGGAACACCAAATTATATTG

>>GAACACCAAAITATATTGCGCCAGAAGTCCTGCTTCGAACAGGCTACACACA GCTTTGTGACTGGT

GGTCCGTGGGTGTCATACTGTATGAAATGCTCGTTGGTTCACCCCCTTTCTTAGCCA ACACTCCAGCG

GAAACTCAGTACAAGGTGATAAACTGGGAGACTACTCTCCAGATTCCTAAGGCTGCT AAGGTTTCACC

CGAGGGCACTGACCTCATCCTGAAGCTTTGTACCTCTGCCGACAGACGTCTTGGTAA GAATGCGGCCG

AAGTCAAAGCCCACCCATTCTTCAGTTCGGTAGACTTTGAGAAGGGTGTCCGTCGCC AAGCCCCGCCT

CACATCCCCCGAATCAAGCATTCAACGGACACTTCGAACTTCGATCCCGTTGACCCT GATAAGCTTAG

GAACTCATCGTCAGACTCGTCTAAGTCTGACGAGTTAAGTGATAGTGGAAAACCTTT TCATGGAITTT

TTCAGTTCACGTTCAGGAGGTITTTTGATGACGGTGGTGCAGCACCGTATCCAAATA AAATTAGTCTC

GACGATACAGAAAACCAGGGTGCTGTTTATGTA

HHAL 001475 - RA , FBgn 0020235 , ATP syn - gamma

>>ATGT1TGCAAAATCAGGGGCTATAGCC^TTAATTATGGCAACCAACAACAGG TACGTGGAATGGCT

ACTCTCAAAGCTATATCTTTACGATTAAAGTCAGTTAAGAACATTCAGAAAATAACC CAGTCCATGAA

AATGGTGTCAGCTGCCAAATATACTAAGGCTGAAAGGGATTTGAAGCAAGCAAGGCC ATATGGTGAGG

GAGCGAAATCAITITATGAAAAAGCAGAAGTGGCCCCAGTTTCAGAAAGTCCAGATA AAATACTTATA

GCCTTGACCTCTGATAGAGGTTTGTGTGGAGCTGTTCACACACAGGTATCAAGACAG ATTAGAACTGA

AGITTGTGAAGATCCTGAACATACCAGAGTGATTTGTATTGGTGACAAATCTCGAGC CATTCTTCAGC

GTTTATTTGGAAAAAATATTCTGATGGTTGCAAATGAAGTTGGCAGAAAACCTCCTA

GCTTCAAAGATTGCTCAAGAAACAAGCAGATATAACTTTTCATCAGGTAAAATAATA TATAACAGATT

CAAGTCTGTTGTTTCGTACACAACTTCCGAGTTACCTCTTTTCAGTCAAGCAGCGAT TC

CTAAATTGAGTATTTATGATTCGATTGATTCTGAAGTC

TCATTACTTTACTATGCCATGAAGGAGGGTGCATGCAGTGAGCAATCTTCTAGAATG ACTGCCATGGA TAATGCTAGCAAGA

HHAL002664 -RA, FBgn0051155 , Rpb7

>>ATGAACCCTTTCGGAGAAATTAGAAATAGCAATTTAACGT1TACGGGAGGGA TATT1TCGAAAAAT GTTTCTCCAGTTGCACCAGGAATATCACAAATAACTACCCATTATCAACAACAAATTTCC AAGGATAT TGAAGATTTGACAAAACTAATAGTCGAATCAGCCCACTCIT

CAAATCATGAATITGAAAAATACAAAGCTATTGCAAAAATTCAGAATAGTGTATTGT TCATGACAAAT TTGATACATAAGTCAGAATGGAATGGACTAAGTGATATATCGCTGGAACACGATATAITA TTACACCC TAGATATT

>>CAGGACAAGGITTTGTAGTTTATCCAGTC

AAGTTGTAGATGCGATCGTTACTCAAGTGAACAAGGTTGGAATGTITGCAGAAATTGGAC CTTTGTCA

TGCTTOVTATCCOVTCACTCCATTCCTGCTGATATGGAATTCTGTCCTAATCAAACG CCACCATGCTA

TCGTTCCAAAGATGAGGATGTCGTAATAACAGCAGAAGATTTTGCAATTGGAACGCT TATGGATGATT

ACTTAGGGTATAAAAGGGTTTCTGGAGAA

HHAL002657 -RA, FBgn0015393 , hoip

>>TCGCTGCAGATGCAGAACCACTTGAAATCTTATTGCATTTACCTCTATTATG TGA

TGCCATATGTTTTTGTCCGTTCCAAGC^GCCCTTGGGAGAGCATGTGGAGTTTCACG ACCTGTCGTC GCTTGTTCAGTGACAGTGAACGAAGGATCTGAGCTGAAGCCACAGATTACAAAAAT^

AGAGAGACTCTTAGTG

HHAL009805 -RA, FBgn0029134 , Prosbeta5

>>GAAAAATCAAAATAAAT1TTGATCATGGTACTACAACTCTGGGAT1TGTTTA TAAAAACGGTGTTA TTTTAGCTGTTGATTCAAGGGCTACGGGTGGGCA^

GAAATCCATAAATATTTGGITGGTACCATGGCGGGTGGTGCTGCTGACTGTGTTTATTGG GATAGGGT

ACTTGCTAAGCAATGCCGCCTTTATGAACTTCGGAATAAGAGCCGTATTTCTACTGC TGCAGCTTCAA

AGCTCATGGCCAACATGGCATTTTCATACAAAGGAAIXMGATTATCGATGGGCATGA

TATGACAAAAATGGTCCTAGTCTGTATTATGTTGATTCCGAAGGTCAGAGAACAAAA GGCAAAGTTTA

CAGTGITGGTTCAGGTTCTCTCTATGCTTTTGGTC^

ATAATGAT

HHAL006797 -RA r FBgn0028686 , Rpt3

>>TACATGCTCAAGAAGAAGTCAAACGAATTCAGAGTGTCCCTCTAGTTATTGG TCAATTTTTAGAAG CAGTCGATCLAAAATACTGGAATCGTTGGTAGCACGACGGG

ACGATTCACAGAGAATTATTCAAGCCTTCAGCTAGCGTTGCTCTTCATAAGCACAGC AATGCCCTTGT TGATGTACTACCLACCTGAAGCAGATTCGTCCATTTCAATGCTTCAAGOVGATGAGAAGC CAGATGTTC AGTATTCGGACATCGGTGGCATGGACATGCAGA

>>ACATCCAGAAGCAGGAGATTCGTGAGGCTGTGGAGTTGCCTTTGACGCACTT TGAACTCTACCGC

AGATCGGAATTGATCCTCCTAGAGGCGTGCTAATGTATGGGCCACCAGGCTGCGGCA AAACAATGCTT

GCTAAAGCCGTTGCCCATCATACCACTGCGGCGTTCATCCGAGTAGTTGGATCTGAA ITCGTTCAAAA

ATATCTTGGAGAAGGACCTAGAATGGTTCGTGACGTTTTCAGACTCGCTAAAGAAAA CGCTCCTGCCA

TCATCTTCA

GCCAAATTCAAAACTTTTGGATGTGGTTCTGCAATAGCATCTAGTTCTCTGGCTACAGAG TGGGTCAA AGGTAAAACGGTTGATGATGCATTAAAACTTAAAAAITCTGATATTGCGAAAGAACTTGC TCTACCAC CTGTAAAATTACATTGCTCCATGCTGGCTGAAG HHAL005127 -RA, FBgn0086707 , ncm

>>ATGACTCTTTCTAGTTTAACCACCCTCGAAAAGAAGGTCACTATTGTTGATA ACACAGAAACCAAC

TTGATATCACTCAGAAAAACTATCTATCTAACAATTCAATCGAGTCTTGAITTTGAG GAATGTGCTCA

TAAGTTGTTGAAAATGGAAATTAAGCCTGGACAAGAGAAAGAACTTTGTCATATGTT TCTAGATTGCT

GTGCTGAACAGAGGACGTATCAAAAAITTTTTGGTCTGCITTCTCAAACTGGGAATA TATA

TTGGTGCGTTTCTGCCAAGTAAATAATACTTACATAGCACCTTTCGAACAGATATTT GCTGATACATA

TTCGACTGITCATCGCTTAGACACTAATAGATTGCGGAATGTGGCAAAAITATTTGC ACATCTTCTCT

TCACAGATGCTATTTCTTGGGCAGTGCTATCAAATATTCGACTTAATGAAGAAGATA CTACTAGCTCA

AGCAGAATTTTTATCAAAAITTTATTTCAAGAGIT^

GAGAITGAAGGATCCAACTCTTCAATCAGCCAIX-CAAGGTCTATTTCCTAGAGACAATC CAAAGAACA CACGATTCGCCATCAACTlTiTCACATCTATTGGTCTTGGTGGTCTTACTGATGAACTGA GAGAACAT TTAAAAAATTTACCTAAATCCATTCCTGTGTCACAACTCATTCAAGAATTGTCATCTGCA TCCTCCAC TTCTTCATCGTCTTCATCTTCATCTTCCTCTGAAACTGAGTCTTCATCGTCTAGTGATTC ATCAGGT HHAL009129 -RA, FBgn0262468 , vib

>>CATACAAGATTTATCATTTGGCTAGTAAAGTCCCAACATTCATTCGACTCTT AGTTCCAAAAGGAG

CITTAGAAATTCACGAAGAAGCATGGAATGCCTATCCATATTGTCGTACTATTATCA CAAATCCTGGC

TATATGAAAGAAAATTTTAGCATTTTGATTGAATCTTACCATATTGCGGACAGGGGA ACTCAGGAGAA

TGTTCATGAACTCTCAGCTCAAAAACITAAGAAACGAGAAATAGTAACGATTGACAT TGGAAATGATC

CTATCAATCAAGCTGATTATAAACCCGATGAAGATCCATCAAAGTTTACATCGCAAA AAACTGGTCGT

GGACCCCTGCAAGCCAACTGGATTGAATCAGTCCAACCAGTAATGACCTGTTATAAG CTCGTAACTGT

TGAATTCAAATGGTITGGACTTCAATCGCGAGTTGAAAATTTTATTCAACGTTCTGA ACGTAGGT^

TTACAACTTTCCACCGACAGCTATTTTGTTGGAIKM^^

CGTAGTATTGAAGAAAAGACAAAGGAAGAACTGGATAGACAGCGTAATGTTGGTGAAGTC AGAGGAAT

GAAGGCAGATGGTGAT

HHAL008699 -RA, FBgn0051992 , gw

>>TTGAATCAACTTCTACAACAGATAAAGAATCTCCAACAGCTTATGCAACACC ATACAGITA

GTTAATCCTCTTGGTAAACGAAGCTCAAATCATCTGTTACAATTATCTGTACAGATT ACGAAGACTAA

GCAACAGAITACCAATCTTCAGAATCAGATAGCAGCGCAGCAAGCTGTGT^

ACACTCCACCAACCACCGAATITTTCAAGAGTTCATTGCATGAACCAATTTCTGGTCTTC ATCCAAAT TTTTCTGATCTTTCTCTCAAAGATCCTCCGACTAGTGGAACTAGTCAACAGTCACGATTA AATCAGTG GAAGTTACCTGCACTTGAAAAAGACTGAGATATTGGTTCAGGTGAATTTTCAAGAGCTCC TGGTACAA CTGCTAAGTCAGCTCAGGGCTCCTCTTCACCCAATACCAATCTATTACTTGGGCAGGCTG ATGGTACC TGGTCTTCTGTAAATCGTGAGTCCAGTTGGCCTGATTCAGCTGGTGATGATGCATCTGGT AAGGATTG GCCAAATTCCAGTCAACCTCCATCTCAAGCATTCTCTGATCTTGTTCCTGAGTTCGAACC AGGAAAAC CTTGGAAGGGCAACCCATTGAAAAGCATTGAGGATGACCCTAGCCTTACACCAGGCTCTG TTGTGAGG TCTCCTCTTTCCCTACCTTCAATAAAGGATACACACATATTATCAACTAGTACTGGAGCT GGCAAAGC CTCACCTACCACCAGCTCCTCCTTGGATATCATTCCITCTCTIXMCTTATCATCCTCTAC TTGGAGCT TTAATCCACCCCCATCTTCATCTAACACTAGTGTGAAGCTGAATTCTAGTGGAGCAGGTG GAGGTGGT AGTGGATCAACATCAAATAATGGTGGAGGAAAAAATAGTGCTTCAACTTGGGAAACTAAT TCGTCTGA ATTGTGGGCTCCTAAAAGAGGACCTCCTCCAGGTTTACCAGCCAAACCTACTGGTGGTTC CAGTGGTG GGCAGGCTACTAATGGTTGGGGACCACTGTCTAGCAGCGGCCGTTGGTCTACTGGGCAAG GTTGGCCT GGGCCTAATCAGGCAGCTGCTACTCAGCCAGGCTCAACTTGGTTGTTATTGCGCAATCTT ACTCCTCA GATTGATGGTTCGACTTTGAAAACCCTATGTTTACAACAIXMGCCTCTATCAAATTTTCA TCTCTACC TAAACCATGGCATTGCTCTTGCTAAATATGCTTCTCGTGAAGAAGCCAATAAGGCCCAGG GTGCTCTA AACAATTG1X3TTCTTGGCAACACTACAATTTTTGCTGAAAGCCCCAGTGAGACTGATGT GCTGTCATT ACTTCAGCATCTTGGTGGGCAAGGGAGTGCTGCTAGCGGCAGCTCAGCCTGGCGCGGTAA GGAGGCCT GGGGCAATTCCCAGCTTTGGGGAGCCACAGGAGCGAGCTCAACCGCTGCTTCCCTGTGGG CAGGAGAT AGTGATCAACACCGCAATACTCCATCCTCGATAAATTCATACTTGCCAGGTGACCTTCTT GGTGGTGA GTCCATT

HHAL010695 -RA, FBgn0011211 , blw

>>ATGACAGAAGGTTTGTTCCTATTTCAGATTGACTTAGAAGAAACTGGAAGAG TACTCAGCATTGGT GATGGTATTGCTCGAGTTTATGGTCTTAAAAACATCCAAGGAGATGAGATGGTTGAATTT TCTTCTGG TCTTAAGGGTATGGGATTGAATTTAGAACGAGAGAATGTC

TGATCAAAGAAGGTGATGTAGTAAAGAGGACAGGAGCTATTGTTGATGTACCAATTG GTGAAGATCTC CTTGGACGTGTAGTTGATGCCCTTG

>>GTGTAGTTGATGCCCTTGGAAACCCCATCGATGGAAAGGGTCCATTAAATAC CAAGAAAAGGGCTC

GTGTTGGAATAAAGGCTCCTGGTATTATTCCTAGAATATCTGTCAGGGAGCCTATGC AAACTGGTATC

AAGGCTGTTGATTCATTGGTACCTATTGGAAGAGGACAGCGAGAACTCATTATTGGT GACAGGCAAAC

TGGAAAAACAGCTITGGCTATTGATACCATTAITAATCAAAAGCGTTTCAATGATC

AGAAGAAGTTGTACTGTATTTATGTTGC ACTATATTCGTGAGATTGATTCTTTATTCGTGACTGGTCAGCTTTGCCCTCTTTACGAAG TTCCCGGC

CCTAACTCGAAGAGGGCTAATAATTTTGTGAGAG

>>ATAATTTTGTGAGAGATTTCCTTCAGGAGTTGTTAAA

TCTTITGGAAAAGTAACGATACACCTAGACGGATAAGGATGGATGACATTAAAAAGGCTT TTCCATCA CACTCTGAAAGTAGCATTAGAAAAAGACTGAAATTATGTGCCGATTTCy-AAAGAACAGG TATGGATTC GAATTGGTGGGTAATAAAGCCAGATTTTAGGCTACCGACCGAAGAAGAAATTCGTGCTAT GGTTTCAC CCGAACAGTGTTGTGCTTATTTCAGTATGATATCAGCTGAACAGAGGCTTAAGGATGCAG GTTATGGT GAAAAGTTTATTTTCACTCAGCAAGATCACGACGATGA^

TAAAGTTGCTCCTTGGAATACTACTAGGGCTTATATTCAAGCCATGAAAGGGAAATGCCT TCTGCAGC

TCACAGGACCAGCTGATCCAACAGGCTGTGGTGAAGGTTT1TCTTATGTCAGGATGC CCAATAAACCA

GCTCTCAGTAAAGAGGAACAGGAAGCCCAACCAAAAAGGACCGTTACTGGAACGGAT GCCGATCTTAG

GAGACTTTCTTTGAACAACGCTAAAGCTCTGCTGAGGAAGITCGGTGTCCCAGAAGA AGAGGTATTTC

TAATAAAACCATTTAATTTT

HHAL000207-RA,FBgn0038815,CG5466

»ATGGAACTAGCAGTGGGAAATACAGAAATAATGAAAAACATCGTCGCTAAAGGAATAC AAACAGAA ATGGGAACTCCCTACAATTCAGGTTCAGGTTATGTGAGAG

TTTACAAAATAAAGGCTGGAATCATGATTTTCITCAATGITTTTCTGAATTAAAGGA TCCTTCAATGT

TGCCAAGTGCAGCTTATTTACAGATGATGGCATCTCGTATAACACTTGATTCTCAAG GTAGATTAATA

CITAGGGAGAATGGAAAGATAATTTTGCCATTTGAACATTTCGCAAATGCTGTAATG CTCAAACATAT

GAATGGTCCACACGGCCTTCATTTAGGTCTTGAAGCTACCCTCCGAACTGTTATGGA GTCATATACAA

TGGGAAGGGAAAATTTTGGGATGGAAAAGGAAITTGTAATTGAAGTAGTGAATAACT GTCCAAACCCA

GCTTGTCGTTACTATAAAACACAGTTGGATCTCTCTCACAATAAGCCTACATATATC CCAGAACCTAC

CATCTTGAAAGCC^TTTGGGAGAGAGCAGCAGTAGTCATATAGACAGGGTCAAAGGC ACGCCTATTC

CTGCTTCGCAGAATCAACACAAGCTAACAGACTTTCTCAAGTCAAGTCTCGACAATC TAGACAGCCTC

ACAAGTGCTAATAAAGACCTCCTAGCTGTTCATAACGGTGCATGGTCCAGCCATGAG GCTACTGAAAG

TAAAAGGCATTCTGCATCATCTAGCAGTGAAGTTGGGCAAGAGAAAATAGTACGGGC CTTTGGAGAAA

TTATGAAAAATATGAGCAGGATGAAAACTTGTATACGACCAGCCATGTGTAAACCTT ACGGAAAACAA

TCGGAATCTTTACAAAAAACGCTGATGGATACAATAGAGTTGGTTCAGTCATTACGA TCAATTCTGCC

CCCTCCACATATTGCTGTCAGTAGTTGGAAGAATGAAGACAAACATAGTGTGTCAAG AGAGGCCTATT

CTCAAGAGTTTGCGACAATGGATAGAATG

HHAL002779-RA, FBgn0000625 , eyg

»AGGAGTTCGACAAGAGTCACTACCCCTGCGTCTCGACGAGGGAGAGGCTGGCTGCCAA GACCTGTC

TGTCAGAAGCCAGGGTACAGGTATGGITCTGAAATCGTCGCGCGAAGTGGCGGCGAC ACCAGCGCATG

AACGCTCTCAAGTCGCAGGCTGCTGGAGGCGGCGGTGGCGACTGGAGGACGATGGGT GGCGAGAACTC

CGCCTTGAAGGCTCCGGACAGGATGTCGGACACCTCTGAGGAGATCAACGTCACGGA TTCCGAAGAGG

AGTCCCGCCAGGGTTCGGAGGTTGCGGTACCGCTTCATCGCCACTCCCCGCCACAGC AGCAGGAGCAA

GAGCTTCCTCGACTGGCGCCTCCAGCGGACCTCAGGGCCTCCATCGAGAGCTGGAGG GAATCGGCCCT

CAGGGCGGAGCCTCTCCAGCTCACCAAGTACGACAGGGATCGTGCCCTC

HHAL001895-RA r FBgn0037098,Wnk

>>ATGAGCAGTAGTCACCGTACCTACAGAAGGACTTGCAACAACAACGTTAATG TTGATAAGACTAGC AGTACAAGTGCTGGTATTTTCAATGAGTGTGATGAAAGTCGCACTAGTTTTTCTGCAATT GGCTGCAG ATTGACATTACCCTCCATCAGCCCCAGGACATCITATAATAGAACCAAATTTCCTAAAGA CATTATCT GTAACAGTGGTTTCCCATCACCTAGAGATTCACCAAGAACTGTAAAAAGCAGAACTCGAC CGACTACG AAAACGGGITCGACTATAGGACAAGCTGCTTCTAAGGTGCCGCTCCCCAAGGTGTTTGGT AGAGGGAG GCGTGCAGAAGAAATATCACCTCCCGGTAAGCCAGTACCTTCCAACGACACCAATACCAA TGAAAATA AATCAGCTCCTAGAGTTGTAGTAGGTCTGCCACCTACCAAAGAGGCTTTAAAGCTCCAGG CAGAGACA TCCTCTGTCTTCCCCGCCAAAGATGATCAAGGCCCTGTTCTTACCCCTGAGGCAGAATTA CCTGGAGA AATTCCACCCAGCCAAGCACAGGAAGATGATGAAGAAAAAGCTA

>>ATGATGAAGAAAAAGCTATTGGGGTATCTCCTGATGGCAGGTTTCTTAAATT TGAAGAAGAAATAG GAAGGGGTAGTTTTAAAACAGTTTACAAAGGTTTGGATACAGAAACCGGTGTGGCTGTTG CATGGTGT GAATTACAGGAGAAAAAGCTCAATAAAAATGAACGACAAAGATTTAGAGAAGAAGCCGAA ATGTTAAA AGGATTACAACATCCAA

>>TGTGTATGCTGGAAATGGCTACATCAGAATATCCCTATTCGGAATGTTCAGG TCCTGCCCAAATTT ATAAAAAAGTTAITAGTGGCATAAAACCTCAAAGCTTCGAAAAAGTAGAAAACCCAGAAG TGAGAGAA ATTATTGAGCAATGCATAAGGCTGAAAAGGGAAGAAAGACCTGGCATAAAAGAACTGTTG AACCATGT GITTTITGCTGATGATATTGGTTTGAAGTTAGAACTTGTATCAAGAGAAGAAGCAAAAAG TGGTATAA TAAGTGATGAAGATTCGCGTTCTGTGGAAAAGATGTTGATAGCTCAGATCATTTCATTGA AGAAAGCT AGAGAGGATCGTAAACTCCTTGCTGAACATACAITTGAGGATGAGTTACATCTTGCCAGA CAAGTTGA ATCTCATAGTCAGATAAATCCAGGTTTTGGAGACATCACAAATAGTCAACAACCAGTATA TGGTCAAT TAGGAACAGAATATGTGCCTACTTACAGCTCAGATATGTATGGGCAGGCTGATAAGTATG TACAGGAT TCAATGATAGTTACATCAATGCAGTGCCAGCCTATACAACATCCTGATGTAAGTCAAGGT TATCAAGA ACCATCTCAGGATATACACTTTGCTTTATCCCAAG

ACACTATGGCTACTGATAATATGCAACATAGAATATCTACAAATGTTCCTCCACAAG TTAGTGAAAAT

TCTGCTAAGGAGCCGTTCAAGAAAGGAGCTTGGTGGATGGAGAGTGAGAAACCTTGGCAA ACATTAGC

TACTTGTTTTGAAATACGCAATGCTTTGAACCATAGAGGAGGACCTGAAAGCTATCC TTGTTCTO

>>AAAGCTATCCTTGTTCTTTCCCAGTACATCAAGACGGCTCCTGCAATGGTCT CCAGCACTATGCAG

CGCTCGGTAGGGATACTTCAGGAGCAGAATCTGTTAATCTCTCTCCATCTGATGTAC CCCAGGATGTT

TATTCATGTGTTGCAGCTATTGTCGATAGAGAACGAGCAAAGGATGCTCAAAATGGA GTCGAAATTGC

TCAACATCITGATGGATTCATTCGAAGGAAAGTAATCAAGCAGACAGTGATGACTAC TGTATATGGAG

TGACACGGTTTGGGGCAAGGTTACAAATTGCAAAACAGTTGAAGGATCTTGAAGATT TTCCGAAAGAA

CATGTCTGGCAGGGATCTCACTATTTAGTTCATAA

GACGAGAGAAATTCAAGATTGGT

HHAL004247 -RA r FBgn0261617 , nej

>>TTGGCAACTACTGATAGTAGACTATCAACCCTTCAACTTCCCTCGGGTATTG GCGTCGGTCAGGTT ACTGCCAATCCTGTCCAGGGTACTAAGGAATGGCATCAATCTGTTACCCCGGACCTCCGC AACCATCT TGTGCATAAACITGTCCAAGCAATAITTCCTACTCCTGATCCTCAGGCAATGTTGGATAA GAGGATGC ATAACCTTGTTGCTTATGCGAGAAAAGTTGAAGGTGATATGTATGAAATGGCGAATTCAA GGTCTGAG TAITATCATCTTTTGGCTGAGAAGATTTACAAAATTCAAAAGGAATTAGAGGAGAAACGA CAGAAGAG AAAAGAACAGCAGCAATTGCAGCAG

»CAACAGCAGCAGGTTCAGACGCAGGCTCAAGTACAAGCCCAGACTCAAGCGGCGGTAG TTCAGAGG

ACACGGGGGATGGTAACTGGTGCCGTACCCGTTGCAGTTGTTCCTCCGCGGCAAGAT CCTTCTCAACC

TCTCCATTCTCAGTCACCAGGAATAGGTATTGGAGGTAACAGGATAGGGTCCCAAAT GGGTCCGAGTC

CTAGCGGTCCTGCTTCGCAGCAAAGCGTGACTGGACTCTCTCCATTTGCTGCGAACC CTCCCTCTGTT

CCACCAACAACAACTAGTCAATTTCAGAACACTAATCATCAGGCCAACGCTCGATTA CCAAACACTGC

CCAAACCTCACCTGCTTTTGGCCTACATCCGTTTCCTTCACCTCAGCAAGTCTCCGC CCCTGCAAGTC

AGTCTAACAGCGGGAGAGTGCCATCTCCTCCATCATCACCAAIXMCGAGTCCAACTG ITGCACCTTCT

CCATCCATGGGAAAATTTTCCAACCATACTCCGCCTTCTACTCTTGCTCGAACTCAA CAATCTAGTAG

TAATTCATATTCAAGTCAGATGGCCGCTATCACTGCTTCTCTCGCCAGAGATGAAGA TTCACCTACTT

CAAATAACAACCAAACAAGTAGAGGTAAAGGAGATATTAAACTGGAGCAAGATGAAA TGAAAGA

>>GCAAGATGAAATGAAAGAAGATGAAGAAGCTGAGAGAGGAAGCGGAAAAGGA ATAGGCACTGGAAA

AATAAAACAAGAGCCTATGGATGATATGCCTGCTAAAGATGAAATCAAAGAAGAACC TAAGTCACCTA

AAGTTAACGACACTCCTGATGTAAAACCAACTGTTGTACCTGAACCAATACAGCAGG GTGTCGGGGTT

GACAAGAAGAAAAAATGTTTATTTAAGCCTGATGACCTGAGGCAAGCATTGATGCCC ACATTAGAAAA

ACTGTATAGACAAGATGAATCGTTACCTTTTAGGCAGCCTGTAGATCCTCAATCCCT TGGTATTCCTG

ATTATTTTGACATCGTAAGGACTCCAATGGATTTGTCAACAGTGAAGAGAAAACTCG ATACTGGGCAA

TACTCGGATCCGIK¾-GAATATGTTGACGATGT^

AAAAACCTCTCGTGTGTATAGATATTGTACAAAGTTATCGGAGGTTTTCGAACAAGAGAT TGATCCTG TAATGCAAGCCCTGGGTTATTGCTGTGGTAGGAAATACACCTTCAACCCTCAAGTCCTCT GTTGCTAT GGAAAACAACTGTGCACTATTCCAAGAGATGCAAAATATTACAGCTACCAAAATAGAGGA TATGGTGT TTCCTGTGATAGATATACCTACTGCCACAAGTGCTTCAATGACATCCCTGGGGACACTGT TTCGCTTG GAGATCATCCTTCCCAGCCACCAACTGTGATAAAGAAAGATCAGTTCAAAGAAATGAAAA ATGATCAT TTGGAACTTGAACCTTTCGTTGAATGTACCGACTGTGGAAGGAAACTTCATCAAATTTGT GTCTTGCA CATCGAAAATATITGGCCTCAAGGCTITACTTGTGATAACTGITTAAAGAAGAAATCAGC CAAACGGA AAGATAACAAATTCAATGCTAAGAGGTTACCAACAACAAAACTGGGTACATATATTGAAA CGAGGGTC AAC^ITATTTGAAAAAGAAGGAAGCAGGCGCTGGTGAAGTGGCCATCAGGGTAGTCGCGA GCTCAGA TAAGATTGTCGAAGTAAAGCCTGGCATGAAAAATAAATTTGTTGAAAATGGAGATCTACC TGATCAGT TCCCTTATCGGGCAAAAGCCCTTTTTGCTTTTGAGGATATAGAIXMAACCGATGTATGTT TCTITGGC ATGCACGTTC

>>TTGGCATGCACGTTCAGGAATATGGATCAGAATGCCCAACACCTAATACGAG GCGGGTTTACATAG CCTATCTTGACTCCGTCCACTTCTTTAGGCCGAAGCAGTATAGAACTGCTGTCTATCATG AAATCCTA TTAGGCTAITTAGACTATGTGAAACAACTAGGATATACAATGGCACATATTTGGGCTTGT CCTCCATC AGAAGGTGATGATTATATATTCCACTGCCATCCTCAAGAAC

>>AGTATTTTTCGTTATTAGGCTACATTCTGCTCAAAGTGCTGCCAGCTTAGCG CCAATTCAAGATCC AGATCCTTTCATTAATTGCGACCTAATGGATGGCCGTGATGCTTTCTTGACGATGGCTCG AGAAAGGC AITATGAAITTTCTTCATTACGAAGAGCBLAAATTTTCATCLAATGGCTATGTO

CAAGGGCAAGATAAATTTGTCTACACTTGTAATAATTGTAAAGCCCATGTGGAAACT CGTTATCACTG TAOVGTATGTGATCATTTTGATTTATGCGTGAC

AAAAACTTGGTTTAGATATTGATGATGGTTCATCACCTGCGGATCAGAAACAAGCCA ATCCACAGGAG GCTAGGAAGTTATCCATCCAGCGTTGC^TTCAGTGATTGGTTCATGCTTGTCAATGCAGG GATGCCA^ CTGTAGGTTACCAAGCTGCCAGAGGATGAAGCG

>>CTGCCAGAGGATGAAGCGGGTTGTCCAGGACACTAAAGTTTGCCAGAGGAAG GCAAATGGCAATTG

CCCTATTTGCAAGCAGCTCATAGCTCTCTGTTGTTACCACGCGAAGTATTGTCAAGA AACAAAGTGTC

CAGTGCCTTTCTGTTTGAATATCAAGC^TAAGATGAAGCAACAACAGTTACAACAAC GTCTGCAACAA

GCCCAGCTACTTAGGAGACGTATGGCCGTCATGAATACAACAAGAGGTGGAGGAGGC GGTGGGGG

»TGGAGGAGGCGGTGGGGGTGGGGGTCTAAGCGGGGGGGCCGTGAGCCCTGGTGGAGCT GGACCCCC

TGCCCTCATGGCCCCCCAGCCTACTCATCAGTCCCTCGGCCTCAAGCCTGGTTCTCA GACCCCTCCTG CCAACGTTCTACAGGTTGTCAAACAGGTTCAGGAGGAAGCAGCGAGGCAGCAAGCGCCAC AGGCGGCC CTCGGTTACCCAGGAAAAGTTGCTCCTGAACAGCAA

CCAGCAGGTGCCTGGCCCGCCTCTCATTCCTCCCATTGAACAATGGACACCGAGGTA TCAGAACCAGG

TAGGGATGCCAGCGACAGCCGGGCAAAGACCTGGAATGTTGCCCGGAGGTGGGAGTG CGATGCCACCT

AGTGCTGCTGCCGTACCTGCTATGCGGGGGCAAGCTCAAACACCTGCCGTCCAGAAG CAAGTACTGCA

GCAGCTACITCAGACGTTGAAGAATCCTACTACTCCTGATCAGCAGCAGCAGATATT GCATATATTAA

AAACAAATCCTCAACTCATGGCTGCGTTTATAAAGCAAAGACAG

HHAL005570 -RA, FBgn0085447 , sif

>>ATGAAAATTGACAGCTGCAATGCTGGTAAGGAGCTTTACTCTCCAGAAGCAG AAACATCCCCTGCT CCACCAAACAGTGAACCAGCATCCAAAGAAACTACTAG

TAAAACTGCTGAACAGGTTACAGGATTCTGCAGATCTCCGGTTGAAACCAGAAAGTC AAGTCCGACTG GTAGTGTGGTTAGCTCAGGTCCAGGACTTACCCCCAGCAGACAATTGACAGATGCTGAAA AACTGAGG AAAGTCATTCTTGAATTGAITGACACAGAGAGAACATATGTAAAGCACCTAAACAGTTTA CTAGAAAA TTACTTAGAGCCTCTTAAAAAAGAAACATTTCTTTCTCAA^

TTCAAGAAATTGT1TCTTTCCA^GACAGTTTCTGCAGAATT1X¾3AAGAGGCTCTTGAA ATGGAGCCA

GACTTTCACAAGTTTGATCATCCCAGTCAATTCAAGAATGTATTATTCTCAGTCGGA AGTGCATTTCT

GTATTATGTCAACCACTTTAAACTGTACAGCTCITTCTGTCCAAGTCACTCTAAAGC TCAAAAAGTTC

TTCACCCTAATGAAGGTAACCAAGCATTGCAAGAATTCTTGGCAGCGAGAAATCCAA GGCAGCAGCAC

TCITCTACCCTCGAATCATACCTCATTAAACCAATTCAAAGGAITCTTAAATATCCA CTGTTACTACA

ACAGCTTAGAAACTTGACCGATCCACAGTCAGACCAGCATTTACLATTTATTAGAGG CTTTGAAA

TGGAAAAAGTAGCAGAACATATTAACGAGATGCAGAGAATACATGAAGAATATGGTG CAATTTTTGAC

CATCTTTTTAGACAGCACCAAAAATCATGCAAGCAGCCAATTGACTTGAGTCCCGGT GATCTCCTATA

TTATGGTGGCGTTGAATGGTTGAATATTTCAGATTTCCTTGGAAAAATAAAGAAAGG CCTGGAACTGC

ATGCTATGTGTTTTGTTTTTAAAT

>>TGTCTTTTGITTTTAAATCTGCGGITGTCTTTTTATGCAAAGAAA

TGATGAGTGTTGCTAGTAAAGGTAATCCAAATGAAGTTGAGATAATAAGATATCAAGTAC TGATTCCT

GTGACGGAAGTAOVAGTGAGAGCTAGTTCAGCTAAGGATATGGAATCTCAITTCCTT IX^AGCTTAT

ACATCTAAGAAGTCAGCTACAGAGAAGATCTGAAAAAGTGTATGTTCTCTCTAACAG CACTGGAGATT

TTAGAAATGCAITITTAAAAACCATAAGGCAGATTATTCGTGAAAGTGTGAGAAACA TGAATATT

GCTACAAAACCAGGAACACCTCAAGTGAGTGGTGCATCGACTCTTGGAAGGGGGCAG CAACAGAGTCA

TAAAGGAACAATGGTCGAACAGCCCCAACCTAAGACCACTGCCTCAGGTGCGGTTAT TATGCCTGGAT

CCCAGACTCTAGGAAAGTCTAAACGACCTCCAAAAGGCCCACAGCGTCATTCAGCAG GAAATATCGAC

TATGACGGAGAITCAAGGGAATCGAGTGTTGAAGGCGCTTCTCAGACTTTTAGATCT CGAAGTAAAAC

TGTATCTGATGCAGTTGATGATTCATCAGAAAAACATCGCCATGACTTAGATCCAGG TACTAAGTCCG

AAGGTGAGGAAGATGGAGGTAGCAAGAAGTCCGGCCTCGGAAGGACTCCTAACCACT TGACCCTCTCT

ACTACTTCTACTCTCTCAGCTGGTTCGACCGGTAGCGAAGCTCGCCTTATTCAATCC TCTCAACAACC

TCLAGAACTACCAACCACCTCCAGCAGACCTAGGTAATATTTGTGCACACTGCCACC AGCCGCGGTTG^

CTAAA

HHAL004720 -RA r FBgn0267002 , unc- 104

>>GTTATATCGAAATATACTGTGAAAGGGTTCGTGACCTGTTAAATCCTAAAAA CAAAGGTAATTTAC GTGTGAGAGAACACCCACTCCTTGGGCCTTATGTTGAAGACTTATCTAAACTCGCAGTTA CCAGTTAT GAAGATATCCACAATTTAATAGATGAAGGAAACAAAGCAAGAACCGTAGCTGCTACCAAT ATGAATGA AACGTCCAGCCGATCGCATGCAGTTTTCACAATATTC

CAITATCAACCGAGAAGGTCAGTAAGATTTCACTGGITGACTIXMCCGGATCTGAGC GTGCTGACTCA ACGGGGGCCAAAGGTACCAGGCTAAAAGAGGGTGCTAACATCAACAAGAGTTTGACTACT CTCGGCAA AGTTATATCCGCCCTTGCTGAAATAGCGACTAAGAAAAAAAAAAAAGAA

>>AAAAAAAAAAGAAAATTTCATACCATATCGTGACTCTGTTCTCACTTGGCTT TTAAGAGAAAATCT

TGGTGGAAATTCCAAAACTGCTATGATAGCAGCCATAAGTCCTGCAGATATCAACTA CGATGAAACTT

TATCTACATTAAGATATGCTGACAGAGCAAAACAGATTATGTGCAAAGCTGTTGTCA ACGAAGACGCA

AATGCCAAACTTATCCGAGAGCTTAAAGAAGAGATACAGAGGTTGAGGGATCTCTTG AAGGCAGAAGG

CATTGAAGTTCAAGAAGTGTTAACTTTTTTATTATTA

HHAL000089 -RA, FBgn0019925 , Surf 4

>>ATGGCAGCTATACCCAACGAATATCTTTCTAAAGGAGAAGATATTGCTGAGG AGGTTTATAAAAGG

ACAAAAGGAGTTTTACGAACTGTTGCTCGAATGTCCCTCATCTCAACCTTTCTT

GATGTGGGTACAATGGTCTGAGCAGAGGGAATACATGGACATGTCATGGGGTTGTGG GCAATTTTTAG

CCACAATGITTGTITTAGTGAACTTAGTGGGACAATTGGGGGGTTGTGTTATGGTTC TAATACAAAAG

AAAGTCACTATAGCTGTCGGAGTACTGTTTTTTATTGTAATATTACAGACATTAGCA TACAGTATACT

ATGGGATTTTCAATTCCTGITGAGGAATCTTGCACTGATCGGTGCCCTCCTTTTCGT GCTAGCTGATT

CACGCAAAGAAGCTCGGAGTCTGTTCGCTGGAGTTCCCACTCTAGATGACAACAATC CTAAGAGTTAT

TTGCAATTGTTTGGGAGAATTCTACTCGCATTTATGI^

CCTTCAAATTGTACAAGATATAATAGGAACTATTATGATTATCTTGGTCACTATTGGATA CAAAACTA AACTCTCTGCTTTTGTTTTGGTCTTGGTGTTATCTCTGTTGAATTTATATCACAATC

TACTGATITTGGGAAATITGATCATCCCCAACAACTT

AGAAAGAAITTGGCAAGTTGCCTTCACCATGGGACAACAAAAATGCTTCAGATT^

AAGTCTGTITTATCTGACTTAAGCTTGGATGTTGAATTGAATGAGAAGCTTATGGAACAA TTTGCTAA

AAC^TGTTCCGGAAATATGAATCCCATTGATGCGTTTATTGGTGGTGTTGTTGCCCA GGAAGTAATGA

AAGCTTGTAGTGGGAAGTTTCATCCAATTTTCCAATGGTTGTATTTTGATTCTACCG A^

ACTGAAGATCTAAGTCCCAATGACTGTGCAGCTACTAATTCTC^

TGGAACAGAATTTCAGAAAACTTTGGGTGCACTGAAATATTTCGTTGTTGGTGCTGGAGC GATTGGAT GTGAACTTCTTAAGAATTTTTCGATGATGGGTGTAGGAGCAGATGGTGGAAAAGTAATTG TAACAGAT ATGGATCTTATTGAAAAATCTAACTTAAATAGACAATTTTTAT

>>AAATAGACAATTTTTATTTAGACCTGATGATGTT^

AATAAAAAAAATGAAT C CATTAATG AACGTGATTGC TCATGAAAATCGAGTTGGGC C AGAAAC TGAG A AAGTITATGATGATGCCTTTTTTGAGGATTTAGATGGTGIT^

AGGATATACATGGATCGTCGTTGTGITTATTACCGTAAACCATTATTGGAATCAGGAACT CTTGGTAC AAAAGGTAATACACAAGTTGTTGTCCCCTTCCTTACTGAATCTTACAGTTCTTCTCAAGA TCCACCTG AGAAAAGCATTCCTATATGTACTTTGAAGAATTTTCCTAATGCGATTGAACATACCCTTC AGTGGGCT AGAGATGTTTTCGAAGGCTTATTTCGCCAGTCTGCTGAAAATGCTGCTCTTTACTTAAGT GATGCTAA TTTTAITGATAGAACTTTGCGTTTGCCTGGGGTCCAACCAATGGAAGTTTTGGAATCTAT CAAACAGG CTCTAATTGACGACAGGCCAAAATCTATTGAAGATTGTATCGCTTGGGCTAGAAATCATT GGCAAGAA CAATATTCAAATCAGATACGTCAACTTCTTTTC^TTTCCCACCCGATCAGATGACAACCA ATGGCCA ACCATTCTGGTCAGGTCCCAAAAGATGCCCTGTACCATTAGTCTTCGATGTGAATAACGA TCTACACT TGGATTACATTCTAGCTGCTGCTAATCTCAAGGCTGAAGTGTACGGAATTCCTCAGGTCC GTGATAGA AGCTTAATCGCTAAAGTAGTACAGAGTGTACCTGTTCCTGAATTTACTCCAAAATCGGGG GTGAAAAT TGCCGTAACTGATTCACAGATGGCCAACGGAGCTGGTGGGCAAATAGATCAAGATAAAAT TGGTCAGT TACAGAATGAACTTCCATCGAAAGAAATGTTTAATGGCTTAAACATCACACGACTCGAAT TCGAAAAA GATGATCATAATAATCTTCATATGGAITTCATTGTTGCTGCATCAAATCTAAGAGCTGCA AATTACAA CATACCAGCAGCAGATAGACATAAGAGTAAGTTGATAGCTGGTAAGATTATTCCAGCAAT AGCAACTA CAACATCTGTTGTTGCTGGTTTGGTTTGTATTGAACTTATGAAGCTAGCTAAGGGGTATA ACGATATA GGTCAGTTTAAGAATGGTTTTGTTAAT

>>ATGG1T1TGITAATTTGGCACTTCCATTCTTTGGATTCTCTGAGCCGATATC AGCTCCTAAATTGA

AGTATTACGAAAACGAATGGACATTATGGGATCGATTCGAAGTTACTGGAGAGATGA CTCTCAAAGAG

TTTATCGA1TAT1TTAAAGAGAAACATGAGCTGGAAATAACCATGTTATCTCAAGGT G

TTATTCTTTCTTCATGGCTAAAAGTAAATTGGAAGATAGACTCAATCTTCCTATGTCAGA AGTGGTTC

GTAGAGTATCTAAAAGAAAACTCGAACCTCATGTTAAAGCTCTAGTGTTCGAACTCT GCTGCAATGAT

ACAGATGGCAATGATGTGGAAGTACCCTACGTGAGGTATACATTGCCT

HHAL007199 -RA r FBgn0028969 , deltaCOP

>>AACAACATACATTTGTAGAAACTGATTCAGTGCGGTATGTGTATCAGCCCCT TGAGAAACTTTACA

TGGTGCTGATTACCACTAAGGCCTCAAATATTTTAGAAGATCTTGAAACACTTAGAC TATTCTCTCGT

GTGA1TCCAGAATATTGCCGCAATA1X¾3AAGAATCAGAAA1TACTGAAAATGCA1 TTAATC1TAT1^

TGCATTTGACGAAATTGTGGCTCTAGGTTACAGGGAAAGTGTTAACTTAGCTCAGAT TAGGACTTATG

TTGAAATGGATTCCCACGAAGAGAAAGTATACATGGCTGTAAGACAGTCTCAAGAAA GAGAAGCTAAA

AATAAAATGAGGGAAAAAGCCAAAGAACTGCAGAGACAAAGGTTGGAAGCCGGAAAA AAAGGCTACAA

AACTCCAAGTAITGCTGGITTCGGTTCGTCATCAACATTTACAAGCCCTGTTGTTGA AACTATTGATC

TGCCTAAACCTACATACACTCCTGCGAAACCCGTCTTATCAGCGAAAGCTATGAAAC TTGGTGGTAAA

TCTAGAGACGTTGAATCATTTGTTGATCAACTAAAATCTGAGGGAGAAAATGTCATT TCTCAAGTAGC

TGCAAATAAACCTGTAGTGGCGAAGTTAGCTTCTACACCAAATATTCATATGGAAGA G

HHAL010076 -RA, FBgn0038925 , Cchl

>>ATGGGGAATACAGTTTCGGGAGCTCATAAAACTGCTGGTCAATTGGTTGGTC CCCTCGCTTTGGGG

GACCAGTCTCATGTGAAACCAGGCATTGATTATTCTITTATTCCAGCAGAATGTCCT CTGTATAAAAA

AGATGCTGCAAAGAGTGCTTCTAATGATGAAATTAATCCTCTTAACATGATGCATCC TCCAAACCAAA

AGCCAGCACCTGATCAGCCITTTCCTCTTCCAACAAAAAGAGAAGTGTCATCGATTC CCAAAGCAACA

CCACAATTTGAAGGAGACAATTATTGGGTTTATCCTTCACAGCAGATGTTTTGGAAT GCAATGT

>>TGT1TTGGAATGCAATGTTGAGGAAAGGGTGGAGGTGGAAAGATGATGATTT AAAACCA^

TGGAGGATATTATCAAAATTCATAATGCCAATAATGAACAAGCATGGCAAGAGGTAC TCAAATGGGAA

GCLACTCCATTACAAAGAATGTTGGACTCCTAAACT^

TCCAAGAGCCCGTATACGTCAGTTGATGGGGTATGAACTACCCTTTGACAGGCATGATTG GGTCGTGG ACCGTTGTGGCAAGGATGTAAAATATATCATTGACTATTATGATGGAGGGTCTGTGGATC CC^AACAC AGGTATAAAATTAACAATCTTATTGTGGTT HHAL006958 -RA, FBgn0002622 , RpS3

>>ATGACTTGTGCTACCCCTGTATCGAAGAAAAAGAAGTTTGTGGCAGATGGAG TTTTCCGAGCGGAG CTAAATGAGTTCCTCACCAGAGAACTTGCTGAAGAAGGTTACTCTGGTGTAGAGGTCCGT GAAACTCC TAGTAGAACTGAAATTATAATAATGGCAACCCGGACGCAAAGTGTATTAGGTGAAAAAGG CCGAAGAA TAAGGGAGTTGACATCTGITGTGGAGAAACGCITTAACTTC

GAAAAAGTTCCAACTAGAGGTTTATGTGCTGTTGCTCAAGCTGAGTCCTTGAGGTAC AAATTGATTGG

HHAL006431 -RA, FBgn0015949 , hrg

>>CAGCACCAGCAGCAACAGCGCACTCTTGGGCTGACATCAGCCATCACACTTG CTGGTCCCAAGCC

ATCGATTACCAGAAGACTAATGAACTTATAGAGACTCTTAAACCGTACAATGTTATG GAAACTGAGGA

AGAACTCAACCACAGGATGGAAATAITAAGCAAGTTGAACAGCCTGGTAAAGGAATG GATCAGAGAGG

TGAGCATAAGTCGTAATATGCCTGAAAGTGTAGCTAACTCAGTCGGTGGCAAGATCT ATACCTTTGGT

TCATACCGCCTGGGCGTCCACCATAAGGGGGCTGATATTGATGCTCTCTGCGTTGCA CCTAGGCATAT

CGACAGGTCTGATTACTTCACTTCATTCTTTGAAAAATTGAAGTTACATACGGAAGT AACTGATTTGA

GGGCAGTGGAAGAAGCATTTGTTCCTGTTATAAAGATGAAITTTGATGGTATTGAAA TAGACATGTTA

TTCGCTAGACTTGCTCTAAAAGAAATACCTGATTCTATGGATCTCAAAGATGACATG TTGCTCAAGAA

TCTTGATCAGAAATGTGTAAGAAGTTTAAACGGCTGCAGGGTCACTGACGAAATACT TCGGTTAGTAC

CTGATATAGAAAATTTTCGCCTCACCCTTAGAACTATAAAGCTGTGGGCTAAAATTA ATGGCTATTTT

ATTTCTTTTTCAAATTTTAATGTATCTAAATGTCT^

ACACCITGTTATCATAATTCAACTTTTAATGTTTCTGCATCAACAAGAACTATTCTTCAG GAGGC TAATAATGGCC

HHAL008669 -RA, FBgn0250791 , alphaSnap

>>ATGGGAGACAACGAACAGAAAGCCCTGCAATTCCTTGCAGAGGCCGAAAAGA AGTTGACTTCCAAT

AAAAGITTCTTTGGTTCGCITTTTGGAGGTACITCATCAAAAGTTGAAGAAGCTATT G

AAGGGCAGCAAATATGTTTAAAATGGCCAAAAAATGGGGAGCTGCAGGAAATGCATT TTGTC

C

>>ATCAAACTATTGCTGAAATGTATGAAACTGAAGCAGTTGATCTTGAAAGAGC TGTTCAACATTATG

AGC^GCGGCTGATTTTTTTAGAGGAGAAGAAAGTAATTCTCCTGCAAATAAGTCTAT GCTAAAAGTT

GCTCAGTATGCTGCACAGTTAGAAAACTATGACAAAGCTATTCAAATTTATGAGCAG TATGGTAGTAG

GCCTGCTITACTAAAATGCTTATCAAATGTAATGGAGCATAATAATTTTACAAAGGT TCATATITTTA

GGTTCTACATTTTTTGTTATGTACGACTTTACCTTCTTAGTCTATATAATATAGAGT CTGCTTCT

HHAL004823 -RA, FBgn0261606 , RpL27A

>>ACCATCATCGTATCAACTTCGACAAGTACCATCCAGGATATTTTGGAAAGTT GGGTATGAGGAATT

ACCATCTTAGACGTAATCAGAAGTTCTGTCCCTCATTAAACTTAGATAAGCTATGGA CATTAGTTACT

GAGCAAACCAGGCTTAAGTATAAAGATCACCCGGAAGGCAAAGCCCCAGTTATCGAC TGCATCAGGGC

GGGTTATTACAAGGTCCTTGGAAGAGGACAATTGCCCAAGCAACCTGTCATCGTACG AGCCAAGTTCT

TCTCTAAGTATGCTGAAAGGAAGATCAAAGCCGTTGGTGGAGCTTGCATTTTATCTG CT

HHAL009415 -RA, FBgn0002183 , dre4

>>ATGGGTATCGAATTTCGAGAGAGCTCTCTGCTTATTGGACCAAAAACTCAAA CCATTGCTCTAAAA

ACACAAGTTTACAACTTGAATGCTGGITTATCAGGACTTTCTAATAGTCAAGCTAAG GAAAAAGAAGG

AAAGACGTATGCTCTATTTATTGGTGATACAGTGATAGTTAACGAGGGTACCCCTGC TTCAATCTTGA

CACCAGCAAGAAAGAAAATGAAGAATATTGGTGTTTITCTTAAAGACGGGGAAGAGG ATGAAGATGAG

>>GAGAAGTAAAAGAACTGAAGATTTTTGTTGATAGGAAGTATGAAACAGTTAT ACTTCCTGTATTTG

GAATACCTGTACCTTTCCACATCTCGACCATTAAAAACAITTCCCAAAGCGTAGAAG GAGAITATAC

TACCITAGGATAAATTTTTTCCATCCIXMAGCCACTATGGCTCGTAATCAAGGTCCC GCAITCGCTC^

ACCTGATGCCACATATGTTAAAGAAGTGACCTACCGAAGCACGAATACGAAAGAACC AGGAGAAACTG

TAGCACCATCGTCTAATTTAAATAATGCATTCCGTATCATTAAAGAAGTACAAAAGA AATTTAAATCT

AGAGAAGCAGAGGAGAAAGAGAAAGAG

>>GGAGAAAGAGAAAGAGGATCTTGTCAAACAAGACGTTCITGTACTTTCCCAA AATAAAGGAAATCC

TAAACTGAAGGATCTTTATATTAGGCCGAATATTGTCAACAAAAGAATGACAGGATC TTTGGAAGCTC

ACACAAATGGAT1TCGTTATACATCGGTCCGTGGTGATAAAG1X¾3ATATTTTATA CAACAACATAAAA

AATGCCTTCTTTCAACCATGTGATGGTGAAATGATTATT^

TATGTTTGGTA

HHAL003060 -RA, FBgn0020445 , E23

»CTGCTCAACTGCCTGGCTGGCCGGGTCAAACTGGACGCAGGCAGTATCAGACTGAATA GGGAGAGA CTGAACAAGAGGTGGAAGCGGAGGATATGCTACGTTCTGCAGCAGGACATCTTCTTCCCC GATCTAAC TCTCAGGCAGACTTTGGAGTACGCGGCCCTGTTGAGACTGCCGGACTCGCTCTCTCACTC GCAGAAGA TGCAGTACGTGGACCACATCLATCGACGTCCTCGACCTAGGCLAACTGCCLAAGACACGA TTATTGGTGAC TACCTGAAACGTGGTCTTTCTGGAGGTGAGAAAAAGAGAGCTAACATTGCCTGTGAATTG CTCACAAA CCCTTCACTCATGCTGCTCGATGAGCCTACGTCTGGCTTGGACTCGCATTCAGCATATTC CCTCATGT GTTGTCTGAAGCGCTACGCAGAGAAAGAAGGGAAGACAGTGGTGGTTACGGTACATCAAC CTTCGTCT CAAATATTCCACATGTTTGACAAGCTCCTTCTCCTATGCAATGGCCAAACTGCTTATTTT GGTGACAC AAATAGTGITGTAGATTTTTTCAACAACATTGGACTGACCGTGATGCCTCACTATAACCC AGCTGACT TCATTCTTGAGCAAGTAAAAGGAAGTGAAGAAATGAAGGAAAAAATCATTGCCGCATCGA GAGAAGCA AGGCTGAGAGCTGACTATCCCCATGAACTATTGCCTGAATATTTCAACCCCACCATCTGT GATAAATT CCTCAACAATTATCATGAAACCCAGATCCATCAGTCTAACGGTCAAGTCGGCAGTGGATG TGGCTGTC AACAGGAAATGTGGTCAAGAAATGGAAATACTCAAACTGGGCAGGATCCAGTCTGCGTCA CTGTTGCA CTTGGAGAAACAACTGAGTCACATGGAAATGTTTATACAACCATAGCTGTTAAAGAAGAT GAAGGAAA AACACTATGGTTAGATAACCAAAGCCACGCTTCTTCATCTGTCAGTAGTAGTG

GCTCCTTCGACCTCATATATACCAGCTAAGACACATCCTTCTCAAGATCCCCATCAGGCT TCAGCTCC AITCTTGAAGAATGATGATAGCCCTGAGACAACAAGAAGTATC

CACTAGATAAAACTCAAGGGATGAAACCAATACTGTCTTTGCCTTATGACAAATCTT ATTACACACAT GAACCATTGGCAAACAGACCACCTAITGACTTTGAGGATTATGAAGA^

AGACTATAACAATCCTAATGATGCTCCAACTCTCAAAGTTAAAGATGATTTAAGAAGGCA TAATAGTA TAGAAACAGATATTTTC

HHAL011327 -RA, FBgn0085383 , CG34354

>>CCATCAAGGAGCTGCGACCGCTTTAGCTGCTATGAACAAACGTGTGTTTCTG GAAAAAGAAATGAA AGTTAATTGGGCTACTTCTCCAGGTAATCAACCAAAATTAGATACTAGCAACCATCACCA TATATTTG TTGGTGACITGAGTCCTGAAATTGAAACTCAAACTTTAAGAGATGCATTTGCACCTTTTG GTGAAATT TCAAATTGCAGAATTGTTCGTGATCCACAAACCCTTAAAT^

TAAAAAAGCAGAAGCTGAGAATGCTATATTAGCGATGAATGGTCAATGGCTTGGAAGCAG AAGTATTC

GAACAAATTGGTCGACACGGAAACCACCACCACCAAGAGATAGTAGAAATCGTCAAA ACAATGCTAAA

GCTCCTACATTTGATGAAGTATACAATCAGTCAAGCCCAACTAATTGTACTGTCTAT TGTGGTGGCTT

TGITAGTGGAATCTCAGATGAGTTAATGCAAAAAGTITTTTCTCCTTATGGTACTAT TCAAGATATCA

GATGCTTTAAAGATAAAGGTTATGCATTTATCAAATTTACAACCAAGGAAGCTGCTA CTCATG

>>AGGAAGCTGCTACTCATCCTATTGAATCTGITCATAATACTGAGATCAATGG ACAGGTTGTGAAAT

GTTTTTGGGGTAAAGAAACGGCTGATCCTAATGCTGCTTTAAACAATTCTAGTAACG CTAATCAGGTT

GGAGCTGCTCAATGGTCATACATGTATGGTAATATGGGAGGAGGTTATTGGTACCCA CAGGGATATTC

TACACCCCAGATGCAACAACAGTATCTACAAGGTATGCAAGGATATCCATATGGCCA GTTTGGTTATC

AGCAAAATTATGTCGGTAGAATGGGTATGCAGATCCCAGCAGGTTCGTCGCCTGTCA TTGGTC

TCTGGAAGCGCACAAGGAAACGAACAAATGGCACAAGCTTCAGGTATGCAACC

GGCCTATACTATGCAACAGTTTCAAACACAG

L. decemlineata target sequences.

Gene ID as annotated in the L. decemlineata transcriptome, the Flybase Gene ID for the homologous Drosophila melanogaster gene, and the gene name are provided.

"»" denotes the start of each gene fragment. In some cases, multiple gene fragments are provided for each gene. The minimum length for each sequence is 200 bp.

LDEC004239 -RA, FBgn0015818 , Spx

»ATGGCAAATGGACCAATAGCAGAAAGAAATCGAGATGCTACTATATATGTTGGAGGCT TGGATGAC AAAGTGTCGGAATCTCTTTTATGGGAACTTTTTGTTCAAGCTGGACCATTGGTCAATGTT CATATGCC CAAAGATCGGGTAACTATGATGCATCLAGGGATATGGATTCGTTGAATTCAIX3<MC GAAGAAGATGCTG ACTATGC

>>TTAAAATAATGAATATGATTAAATTATATGGAAAGCCTATTCGAGTCAATAA AGCCTCCGCACACC AAAAAAATTTAGATGTTGGGGCTAATATCTTCATAGGAAAITTGGATCCTGAAGITGATG AAAAATTG TTATATGACACATTCTCTGCATTCGGAGTCATTTTGCAAACTCCTAAGCTGTCTACTTCT CATCAAGA GTACCATCTAAGATATGGAATTTGTTTCTGGGGAAATCATTTC LDEC015340 -RA, FBgn0265296 , Dscam2

>>ATGGTGGAGGATGGTGGTCAATACACGTGCACAGCAGAAAACAGAGCGGGTA AAAGTTCCCATTCT

GCCAGGCTGAATATATACGGAATGCCCTACATCCGGCTGATCCCGAAAGTGACCGCC GTCGCGGGTGA

GACGCTCCAGCTGAAGTGTCCCGTGGCGGGATATCCCATCGACGAGATCCACTGGGA AAGGGGCGGCA

GGGAGCTGCCCGACGATCTGCGGCAGAAAGTCTTGGGGGACGGCACGCTCGTCATCA ACCCCGTCGAA

AAAAAGGCCGACTCGGGGGTGTACACGTGCTGGGCGAGAAACAAGCAGGGGCACAGC GCCAGGAGAAG

CGGAGAGGTCAACGTC

LDEC006073 -RA, FBgn0031020 , Natl

>>ATGCCCTCTAGTAATCCATTACCACCAAAAGAAAATGCCTTATTTAAGAGAA TTTTGAGGTGTTAT

GAACAAAAGCAATACAAAAATGGGCTGAAATTCGCAAAGCAAATTCTGTCC^TCCTA AATACACAGA

ACATGGAGAAACTCTTGCTATGAAAGGACTTACTCTGAACTGCTTAGGACGAAAAGA AGAAGCCTACG

AATACGTTCGTAGAGGTTTAAGAAATGACTTGCGTTCCCATGITTGTTGGCATGTTT ACGGACTO

CAAAGATCTGACAAAAAGTATGACGAGGCAATCAAATGTTATAGAAATGCTCTCAAG TGGGAGAAGGA

TA

>>TCAAGTGGGAGAAGGATAATATTCAGATCTTGCGAGATTTGTCACTCTTGCA AATTCAAATGCGGG

AITTGGAGGGATACAGGGTGTTACCTGTTTCCGTTAATGATACTCGATATCAACTAC TTATGTTACGG

CCAATACAAAGAGCTTCCTGGATTGGTTATGCAATGTCTTTCCATCTGTTGGAGGAA TACAAAAATGC

TCTTAGCATATTGGAGACCITTTTGGAGCAGCAGAAGGGAGGCLAATTTTGACTATC

TCATCCTTTACCAGAACCTCGTGATCCAAGAATCCGGCGACCTAAAAGAAGCCCTAC AACATCTAGAA

GATTCACAGGATCIAAATCGTCGATAAACTAACTTTGAAAGAAAAGTTTGGCGAATT GCATTTA

GAAGCAGCATGACAAAGCTGCTGAATATTACGAACAGCTCATCCAAAGAAACCCAGA AAACACGATAT

ACTACAAGAAACTGATAGAAGCGAAACAGTTGACTAAACCAGAAGAAATTGTTGATT TTTACGCAAAG

TACACGGAAAAGITTCCACGTGCTATCCCACCTAGAAGACTGCCACTGAACTATGCG ACCGGAGAGCA

GTTCAAACTCCTAGCTGATAAATACATGAGGAAAGCCCTCTCGAAAGGGGTCCCTCC ACTGTTTGTCG

ACATCAGGAGTACTTACGCGGACCAAAGCAAAGTGGAACTGATAGAGAATTTACTGC TGCAATATGTT

GAAGCTTTAAAGAAAGTAGGTAAATATAGCGAGACGGAGGTAAAGAATGGACCAAAG GAACCAGCAAG

TGCAITACTGTGGGTGTAITATTATTTAGCGCAACATTATCACTACCTCAATCAGAC TGAGAAAGCTT

TGAGTTATATCGATGCTGCTATCGAACIACACTCCTACGTTGATTGAGCTGTTTGTT GCCAAGGGACGG

ATATACAAGGGGTCACACTTCGGTCTCTTATTGTTCAATTTAITTATTAACGACATT ATTCATTCCTT

TCGGCACGCCAAAGCACTATTATTTGCAGATGATTTAAAACTTCTCCTAATTATTGA AACCTCTTTGG

ATGCCCATAGGCITCAGTCTCACCTTGACAATCTATCAAACTGGTGCTCCTTAAATG GCAIXMACTTG

AATGCCIACAAACTTCAATGTACATATACCCACGGCTATCCATGAAGCCIATGAAAA TGATATGGTTTAT

CAAACGGCTAACCCACGAATTAACTGACCCAACTGTTATTAAAGCCCTTTATTGTTC ACTGGTCCATC

CACLACTTGGAGTATTGTTCTTCTGTCTGGTCCCCTCATTCACCAATCTGGAAATCA TTACAACATAAA

GCACAATCAGTGGCATACGGAATGATAGTCTGGAGACA^

ACAGAAAAAGTGCIATTTGTGCCATGTTATGCAAACCCCAGAAGAATCTAGTAGACCTCT CTTTAGAAA

GCCACAAGTATTACCCTTCATTTCTCTTTTCATCAGAAACTGCTTGT

LDEC009322 -RA, FBgn0020910 , RpL3

>>ATGGGATTCTACCCTAAGAAAAGGTCCCAAAGACATCGTGGTAAGGTCAAGG CCTTCCCAAAGGAT GATCCTTCCAAACCAGTACATCTAACTGCATTCATGGGCTATAAGGCTGGTATGACCCAT GTTCTTCG AGAAGCTGATCGTCCTGGATCAAAGATAAACAAGAAAGAGATCGTAGAAGCTGTAACCAT TTTGGAAA CTCCTCCAATAGTTATAGTAGGCGTAGTTGGTTACATTGAAACTCCTCATGGACTTCGTG CTTTGGCT ACTGITTGGGCAGAGCATCTTTCTGAAGATTGCCGTAGACGCTTCTATAAGAAITGGTAC AAGAGGAA GAAGA

ATAAACTCAATGATTACGAAATGATGATAGCAGCCCATTTAGTTCACCCGCAAGACATCA CAGTCACA TGGGAAAGCATTGCAGGGCTGGAGGACCTTATCC^GGAACTGAGGGAAACCGTCATACTG CCCATTCA GAAGAAGGAGCTGTTTGCTTACTCACAACTCACGAGTGCTCCGAAAGGCGTTTTACTACA TGGACCAC CTGGATCCGGCAAAACTCTCATTGCCAAAGCCACCGCACGAGAAGCTGGTACTCGCTTGA TAAATCTA GATCTGTCCATACTGACAGACAAATGGTATGGTGAAAGTC

>>GATGAAAGCTCAGTTTATGTCTCTCTGGGATGGACTTATCACAGATTCCAAT TGCACGGTAATTAT AATGGGGGCTACCAATAGGCCTCAGGATTTGGATAGGGCTATTTTGAGAAGAATGCCGGC TACGTTTC ATGTACCCATGCCTAATCITGGACAACGCAGAGAAATTATAAGATTGATCCTTGAAAACG AACCGATA GCAGAGGATGTGAACTATGATGAATTAGCCACTATCACAAATGGCTTTTCCGGCTCAGAC TTGAGGGA GCTGTGTCGAAACGCTTCAGTATACAGAGTGAGAGACTATGTGCGGGACCACTTTGAACA TGCCTATC CAAACACAAGCCAGAACGAGTCTGAAGAGAAATTCTATGATACTCTTCGGCCCATTACGA TGGCGGAT TTGAAATATTCGTATAACAAAATGAGGGATAGCAAAGTTCAGTGCAATACCTTGTCCTTA CAGACTAG AATAGATCTGGAT

LDEC008084 -RA, FBgn0034743 , RpS16

>>ITGCTCCATCACTTTCGGAAGTACACTTTTGATCGCTGTCAGTTGTCACTTC CAACTTCCTTCTTT

CAATTGTCCACAATGCAGGCGCCTACACAGAAGCCGAAAAAGGAACCAATCCACTCT GTCCAAGTTTT

TGGCAGAAAAAAAACAGCTACCGCAGITGCATATTGCAAAAGGGGTAGAGGAGTACT AAGGGTCAATG

GGCGCCCTTTGAGCGAGGTTGAGCCTAAAATGCTCCAGGACAAACTTCAAGAACCGA

GGAAAGGACAAGTTCTCTGCAGTAGATGTGAGAGTCCGTGTAAATGGTGGAGGACAT GTTTCCCAAAT

CTATGCTATTAGGCAGGCGATATCCAAAGCTCTGGTAGCGTACTATCAAAAATATGT TGATG

LDEC004542 -RA, FBgn0259243 , Pka-Rl

>>ATGGGCATTGCCGAACAAGCCTTAGATGCCAAACAACAGGCAGCGTCCCCGG AGGATACGGAGGAT

CTGTCGCCTTTGCCGGCGCACGCGCAGCAACCGGTCAGACGCAGGGGCGGCATCTCC GCAGAACCGGT

CTCCGAGGAAGACGCCACCAGCTACGTGAAGAAGGTCGTCCCGAAGGATTACAAAAC GATGGCGGCCC

TCTCGAAGGCCATCGCCAAAAACGTGCTCTTCTCCCATCTGGACGAGAACGAGCGGT CGGACATATTC

GACGCCATGTTTCCTGTCAACTGTCTTCCTGGCGAGGCCATCATCCAACAAGGCGAC GAGGGGGATAA

TTTTTACGITATCGATCAAGGGGAAGTGGAGGTTTATCTAAATAATGAGITGGTGAC GACA^

AAGGTGGTAGTTTTGGCGAACTGGCCCTCATTTACGGTACTCCGAGGGCGGCCACTG TGAAAGCGAAA

ACGGACGTCAAGITGTGGGGGATCGATCGGGAITCTTACAGAAGGATTCTCATGGGT TCCACTATAAG

AAAAAGAAAAATGTACGAAGAGTTTCTTTCCAGGGTGTCGATATTGGAGAATCTCGA TAAATGGGAAC

GTCTTACGATGTCTGTCAACTCCAGCAGAACTGAGATAATCCCCTTCACCAGGAGGA AAACATTGGAC

GATCTAACGCCACTTTTCCTCAATGGTGAGGTCACTCCATTTGGTACGGAGGTGAAA TATCTTGGCAT

TGTCCTTGATAAAAGACTCGCCTGGAACGCTCACTTGGAAAAAGTTTTACAGAAAGC CAGACTGTCTC

TATGGACATGTCGAAGGATTTGTGGI-1AAAACTTGCAGTTTAGGTCCCAAACAAAT CCATTGG

G1TATGATTGTCAGAGCAATGATGGTACAATTGCCTGATGGCAATTGGTCTAGATTC CTGGCCATGTT

GACCTGGAAGGCAATTAGGCTGCTGACTCCCTTGCAAAGGAGGATGCTGCAAGCAGC TTCATCGGACC

AGAACCTATCATTGGCATCGCTT

LDEC001741-RA, FBgn0010750 , atms

>>ATGCCTCCAACGATCCAGCAAAGCGGTCAAAGTACCGCa^IXMTGTGGAGAA AAGACCTGTAAAA CCCGTGGAAAAAAGGTCAGATTTAATATGTAAAGTTAAATATTGTAATACGTTACCAGAT ATTCCGTT CGATTTGAAGTTCATATCCTACCCTTTTGAATCGATA^

AACGCAATTATCGGTATGAAGTGCTAACGGAACATGATTTAGGAGTAAGCATCGATCTAA TCAATAAA

GATATATATGCAATTGAGCCIAGGTGCATATTTAGATCCAGCCGATGAGAAGCTGTT AGAAGAAGACAT

TTTGACGCCTCAGGACTCTAAAAGATCTCGGCACCATGCTAAATCAGTATCATGGCT CCGCCGTACAG

AATATATTTCAACAGAACAAACCCGCTTTCAGCCCCAGACCATGGACAAGGTTGAAG CCAAAGOT

TACAGCATCAAGAAGTCTCITAACAATCAGACAITGTATATCGATCGTCATTCACA

TGAGAAGACGTTTGAAGATTCTAAAATACCTATCGAGAAACATTATAGTAAGCCGAA TGTGGTACCTG

TTGATATTCTTCCCGTGTATCCTGACTTCAATCTGTGGAAGTATCCTTGTGCTCAAG TCA

>>AAATTGAAGAAATGTCACAGGCTATGATTCGGGGTGTCATGGATGAGAGTGG TGAACAGTTTGTTG

CCTACITTCTTCCTACGGAGGAAACCITGCAGAAGCGAAGGGAAGATTTTGCAAATG AAATACCCTAT

CAAGATGATGAGGAGTATGAATATAAAATGGCTAGAGAATACAATTGGAATGTCAAG AGTAAAGCAAG

CAAAGGATACGAAGAGAATTACTTCTTTGTTGTTAGACAAGACGGTATTTATTATAA CGAATTGGAAA

CTAGGGTAAGACTGAGTAAGAGGAGACAGAAGATTGGCCAGGCACCCAGCAATACAA GGCTCATTGTT

AAGCACAGACCAATGGATGCCAATGAGTTTAGGATGOVACGCTACAGAGAGAAACAA CTTGAACCTCC

GGGTGAAGAAGACGAAGAAATGGAGGTAGAGGAAACACAGGAGGAGACTCAGGAAGA GACTCAGGAAG

GGCAAGGCAATGAGAGTCAAGCAGAATCTGATCAGGAAAACCGAGAAAAAGCAGGAA GCGGAAAGGAA

GAAGGTTCACGAGCCTCTTCGAGATCTTCCAGGAAATCAAAATCCCATCCCGATCCA ATTCATCAGCA

AAGTCACGTTCAAGATCTAGATCGAAATCAGCITCCAAATCGAGGTCCCAATCTAGA TCAAGGTCCAG

GTCAAAATCTAAGTCAAGGTCACGTTCTGTATCTAGGTCTCGATCAAGATCAAAGTC TGGCTCAAAAT

CTCCGTCGAGATCTAGATCCAGATCTGGCTCAAAATCTCCTTCTAGATCTAGATCTT CATCTAAAGCA

TCGTCAAGATCTAGATCAAAGTCTAGGAGTAGATCTGGTTCTCGTTCGAGATCTAAT TCCAAATCTCC

TTCAAGATCTAGATCGGGITCTAGATCTGGATCTGACAGTGAGTGAAGTTGAAAATA TGAAGAGCTGT

TACAGGTGTATGATGAAATTTGGATTACTTTTGAGGCTCCCTGTGAAATGCGGTGAC AATTTGATGAT

TGTCAGGCAAATCTTCTTACGTGAGCGCACCATCTCCAGCTCCACCAACCGATGGGTCGT ACTTCAAC ATGTCTGACCGATACCTGTCGTATCCCCCTCCACTGGACTTCCAATCAGCGCCACCTATA CCTGCACA TCCGCACATCACACATACTCACGTGCCGATCACGCCTCCGCTGCCATCTAACGGATCTCT GTTGCGTC ACCAGAGGGGCGITCTGCCTCCAGACGTTTTACACA

CAAACTCTCGCCCAGAAACGGGAGCTGTCCAGTTTCGGTAACGGTTACGGCGTGAAC GAACAGGAAGG ACATCTTGTG

LDEC003557-RA, FBgn0039175 , CG5706

>>TTGAAATATTGTGAAATGCCTACTATAGGAGITAAGCGTCACTTAITATTCA AGTCCTTGGGa^

TCATACACCGATGAAGAATTTCAAACTCTGTGTTTTGAGTTTGGACTAGAATTGGAT GAAGT^

TGAAAAACAAATAATTTCCAAGGAGCAGGGTGAAGATTCAAACC

TTATTTATAGAATTGATATACCAGCAAATCGATATGATCTATTATGTTTAGAAGGTT TGGTTCATGGA CTTCITGTCTTCCAAGGAAAAATTCCACAACCAAAGTTT^

GGAAAAACTCATCATAAAACCAGACACTGCAAGAATTCGGCCTTACGCAGTGGCIXMCAT TTTACGTA

ATGTAAAATTTGATCAGGATAGGTATAACAGTTTCATAGACTTGCAAGACAAATTAC ACATGAACATT

GCTCGTAAAAGATCTCTAGTTGCAATAGGTACCCATGATTATGATACAGITAAAGGA CCATTCTACTA

TGATGCAAAACCCCCCAAGGATATCAAATTTATTCCTCTTAATCAAGCCAAGGAATA TACAGCTGAGG

AGTTGATGACTTTGTATTCGACACA1X3CCCAACTCAAACAATATTTACCAATAATC AGGGATAGCCCA

GTTTATCCAGTCGTGACAGATAGTAATGGCGTAGTCTTATCTCTACCTCCAGTTATC AATGGCAACCA

TACAAGGATAACACTTGAGACCAAAAATGTTTTTATAGAATGTACTGCTACTGATTT AACTAAGGCTA

AAATTATTATTGATACTCTGGTATGTATGTTCAGTGAGTATTGTAATGAAAAATATG AAATTGAGTAT

TGCGAAGTTGTAAATACTGACGGAACTCCAGTTTTATACCCAGAATTGGATTATAGA ACAGAAATAAT

ATCTGTTAAGAAATGCAATAAAAGAATTGGTATTAATGAATCTGCTGAAAGCATGGT CAAACTATTAT

CCAAAATGTCTTTGAGGGCTGAACTGACCAATAATCCTGATAATATTAAAGTCACTA TACCGCCAACA

AGACATGATGTAATACATGCTTGTGATATATATGAGGATGTAGCAATTGCTTATGGA TATAATAATAT

AAAAAGAACTAITCCCAAAACTAATACGATTGGCCAGCAAITTGCTGTAAATAAACT GACAGATTTAC

TGAGAGGGCCGATAGCAGAAGCTGGGTTCACAGAAGCTTTAACTTTCACATTGTGTT CAAGAGATGAT

ATCTCGACCAAGTTGGGCCTTGATTCTATTGATOVAGTACCTGCAGTTCATATCTCT AACCaU^AC

CCTTGAGTTCCAAGTCTGTCGAACTACACTTTTGCCAGGTATCCTGAAAAGAATTTC AGCTAATAAGA

AGATGCCTCTACCAATAAAAATATTTGAAATATCGGATGTTGTACTTAAGGACTCTG AAGCAGAGGTA

GGTGCGAGGAATGAAAGAAGGATATGTGCAGTTAATTGCAACAGAACTGCAGGATTC GAAATTGTTCA

TGGGTTACTAGATAAAATAATGTTACTCCTGGAGGTATCATGGTCCCGTAAGAAAGA TTCTGTTGGAT

ACTATTTGAAAGCAGCAAATGATCCTGCTTATTTCCCAGGAAGATGTGCAGAAATAA TCTGTCATGGA

ACACCAATAGGCAAAATCGGTGTCTTGCATCCTGATGTAITAT^

TTCAGCCCTTGAGATAAATATTCAATCTTTTGTT

LDEC005914-RA r FBgn0005593,RpL7

>>AACCΑΑΤΑΑΤΊΤΤΑΟΑΑΤΊΤΤATTTTAGGGCTAAG AAGACCACGGAAACCAAAACTGTAAAGGGGC TACCAGCAGTTCCCGAATCTGTCCTGAAGCACCGCAAAAGGCGCGAGGCTTCCCGTGCGA AGAGTTTA CAGATCGCCATTAAAAAGAAGTCTGAGCAGATCAAAAAACGCAAAGATATCTTCAAGAGG GCCGAACA GTATGTTAAAGAATACCGGCTCAAAGAAAGGGATGAAGTTAGGTTGATCCGACAAGCTAA AACCAGAG GAAACTTTTACGTTCCCGCTGAAGCCAAGTTGGCATTCGTAAITCGTATTAAGGGTATCA ACAAAGTA GCTCCTAAAGTACGCAAGGTTCTCCAATTGTTCCGGCTCC

GCTCAACAAAGCTACCATCAACATGCTCAGAATATGCGAACCTTACATCACTTGGGG ATACCCTAACT TGAAATCTGTCAGAGAACTGATTTATAAGAGAGGTTTCGCCAAGGTGAACGGCCAAAGGG TGCCAATC ACTAGCAATCAAATCATCGAAGACAAATTAGGAAAGTCCGACATCATATGTCTTGAAGAT TTGATCCA CGAAATCTTCACTGTCGGAAGTAGGTTCAAGAACGCTTCCAACTTCTTGTGGCCATTCAA GCTTAAC^ LDEC012557-RA, FBgn0267001 , Ten-a

>>ATGAGAGGTCAAGTGGTAACACCGCAGGGACTGGGAATTGTTGGCATCAGAG TCTCCGTTGATAAG GAATCAAGGTTTGGTTTCACTCTCACAAGGCAAGGTGGATGGTTTGATGTATTAGTTAAT GGTGGTGG AGCAGTCACATTGCAGTTCCAAAGATCACCCTTCAAACCGATGACAATAAC

ATCAAATTATAGTACTTCCTCCTGTGCATATGCAGCTCAGCGATGATCCAGACGITG GTCATCTCAAA ACAAGCTTTTTGGCCATGAATCCGGCTCTGAACTTCCCCGGCGTATCCCGGAGCTTCTTC GGCCCCGA TGGGGGGCTCCCCAACACATGTGACGACCACGACCCCGA

GGCTGCCGGAAGCTGTGGGCGGCATGCAGGGAAAGAGCGTCGTCTTCGCAGAGACGC AAATCGTGCAG GAGTCGATAGCGATTCGAGGGTCGGACTTGGACATTCT

GAGTACTATTTATATGAAGCTGACGGGGCCTACGATTCCTGAGAGTTTAACTCATGT TTATATCAGGG TGGAAGTGGAAGGTTCTCTGCACACGAAAACATATGAAGCTGATCCTAACCTGACCCATA CTTTTGCC TGGAGTAAGCGGAATATTTACAAACAGAAAGTCTACGGTATCGTTCAAGCGAAAGTCTCG ATCGGTTA CCAACACAGCACCTGCTTGGAGCCTGITTGGGAGACGCAAACGACTGACATCAAAGGATT CGATGTCG ACATATCGGATATTGGAGGCTGGGGATTGG

>>TTGGAGGCTGGGGATTGGATATTCACCACCATTACAACTTTCACGAAGGTAT 1TTACAAA ACGGCTCGACTCTGCATTTCAAACAATACCCCCGCATGGTGCGGGTCATCATGGGAACCG GCCTCCAG AGATCGCTGAAITGCCCGGGACAATGCGGCGGGCCTGCCAAAGACGCGAAGTTGTTAACA CCGGGATC GTTGGCCACGGGACCCGATGGCAGCATTTACGTGGGCGATTT^

CTTTGCTTATGCAGACTACGAGGAAGGAAGACTGAAATATGAAAAAGTACACCAAATTTA TTCTAAAT

AITTGGAAATCAAGGATATCGATCCTACACTGGC^TACATTCAGTACATGAAGTTTG CAAGACGAGCA

GAAGGAATCAAATCAGCCAGAGCAGTCTTTAAAAAGGCCAGAGAAGACAACCGTTCC AAATACCATTT

GTTTGTCTGCGCCGCTCTTATGGAGTACTACTGCAGTAAAGACAAAAACATTGCTTT TAGGATTTTCG

AACTTGGACTGAAAAAATTTGGAGCTATTCCTGAGTACATTACTTGCTACATAGACT ATTTGTCTCAC

TTGAATGAAGATAACAATACGAGGGTTTTGTTTGAAAGAGTTCTATCATCCGGAAGT ITAGAACCAGA

AAAGTCTGTCTGTATCGTTTCAAAGTGCGATCCCTCAATGTTACAAGGTATCTCAAA ATACATCATTG

AAAACAAACATGGCGTCGAAGTGTACAGGGTGCGTCAAAATACATCATTTAAGAAAA AACATAACAGT

TCCACGAGGCTGGAAGTTTTCAACGTGCGTTCCCTCAATGTGTACAAGGTATCTGAA AATAGATCAOT

GAAAAAGAAATATGACGTCGAAGTGTAGAGGGTGCGTCAAAATATATCATTTAAG

LDEC016168 -RA, FBgn0261698 , CG42732

>>ATGTACTCAACAAATGGGAATGACGAGGCCAAAGATAATCACAATCAGCAAA ITGAGCGAGCAGA^ ATTGCAAATCTGGTGAGATCGAGAAIXMAGAGITTGAACITGCCAACCATCGAITATAAT GATGTTAG TGAAAAACGAAATAGTTTATCATATGTGATCATCIAACCCAAGTTGTGATCTGAAATTGG AGGAGGGTG ACATAATG

LDEC002047 -RA, FBgn0035756 , unc- 13 -4A

>>ATGITTTGTCAATTAAGAGACTTCIX-<3AGACTCCTGCAATGGCCTAA ATCTCATTCCATACTATTA CTGTCGCAGCTCTTGGACTGCATCTGTTCTGCAGCGCTGCTCTACGCAGACATCACATAT CAGAGCCT CATCGAGACAGGCTACTTCGACAGGCTTGGCCCATTCAGGATAAGCGACGAGATGTGCAT TGCTTCCA ACAATTTAGAATATGTTTACAAATTCATITCGC

TCTATCGCGTCGGAAATCCAATTTGCGACGTTAACGAACCAATTAGACAGCACTTTG AGCCAGCTACA

GGTGAGGATACGCGACATACTGAAGAGAATCGGACCGCAGATGCAAGAGGCATTGAG GAAAGCAATGT

TTCACGTAGCGTGGTCGCCAGACACGTTGCCGACAAATCAAGCGGTGGCGCCTCTTT TCGACTATTTG

CATGGACATCTTCAAGCCCTCAACATAAATCTGCTACCTCAAAATTTCCAAAAAGTT CTTCAAGAGAT

ATGGGAATACACACTGGCCGAGCTGAACCACCAGATGGACAGCGGAGCCAACAGCGA CGAAATTCCCC

CCATGTTCCACGAGAAGCTCCACTCCGCCCTGGAGCTCATGGTGGAGTTCTTCCACG CGGACGGACAG

GCTTTGACCATGCAAGTTCTGCACTCGCCCGCCTACAGACAAATAGAGCAAAGACTG CAATACCACAG

GACCGATACCGAAACACTGATGGAGATCTTTTACGGACAACGGCTGCAGGACCAGCT CAACACATCTA

CCAGCCCGTATGGTGTGCTGGCCGTCAGGGCGTACTTGAACCACGATTCGCTTTGCG TCGAGGTCCTG

CATGCCCGCGACATCATCCCTCTGGACCCGAACGGCTTCAGCGACCCCTTCGTGATC ATCGAGCTGCT

GCCGCACCGTATATTCCCGCACTGCAATGACCAGGAGACGAACGTCCACAAAAAGAC GCTCCA

TCTTCGACGAGTGCTTCGAGTTCAGCGTGTCGCTGGACCAATGTCGGTACCCCGGCA CTATGATCGGC

TTCACGGTCATGGACCACGACGTGCTCACGGCTAACGACITTGCGGGTCAAGCCTTC CTCGCGCTAGG

GAGCATTCCGGGTGTCGCGGACGCGGGGTCCGGCGTCGACAACTTCCATGGCCTCAA ACCAGTAGAGC

TCGTCCTCATGCLAGCAGCACCAGAGGAATCATCCCATACTGCAAATACTGGAATCC AGGGTGGGTGAT

CGTGTGGCTGCGGACTTCGTTAAAAAGCAGAAGCAGAGAT

LDEC016378 -RA, FBgn0028684 , Rpt5

>>ATGTCGTCTACTCTAGAAGATAAAGCTATCIX-^AAGATCGGGAAGAATCAT TGGGGGAGGAAGTT CTGAGGATGTCGACTGATGAAATAGTCAGCCGGACGCGTTTACTCGATAATCAAATCAAA ATAATGAA GAGCGAAGTAATGAGAATAAACCATGAACTCCAAGCCCAAAACGAAAAAATCAAAGAAAA CACTGAAA AGATAAAGGTAAATAAAACGCTACCTTACTTGGTATCTAATGTTATAGAACTGCTAGATG TGGACCCT CAAGAGGAAGAAGAAGACGGGGCAGITGTAGACITGGATTCTCAAAGAAAGGGAAAATGT GCCGTTGT AAAAACIATCTACTCGTCAAACATATTTTCTACCAGTAATCGGGCTCGTTGATGAAGAAA AGCTCAAAC CIX-CAGATTTAGTGGGTGTGAACAAAGATTCTTATCITATCCTAGAAACATTACCAGCG GAGTATGAT GCAAGAGTAA

>>GGAACTGGAAAAACTTTGTTGGCTAGAGCATCTGCTGCTCAGACAAAATCAA CATTTTTGAA^

GCTGGACCCCAATTAGTTCAGATGTTCIATAGGAGATGGTGCTAAACTTGTAAGAGA TGCTTTTGCGTT

AGCCAAGGAAAAGGCACCAGCTATAATITTCATCGATCAATTGGATGCTAITGGTAC GAAACGITTTG

ATTCTGAGAAGGCTGGTGATCGTGAAGTACAACGTACIAATGTTGGAGCTTTTGAAT CAGTTGGATGGT

TTTAGITCAACAGCTGATATAAAAGTAATTGCAGCTACCAATCGAGITGATATCITA GATCCTGCTTT

ACTTCGATCAGGTCGGTTAGATCGTAAAATAGAATTTCCTCATCCAAATGAAGAAGC TA

>>CAAATGAAGAAGCTAGAGCAAGAATAATGCAAATTCACTCAAGAAAAATGAC TGTTAACCCAGATG

TAAACTTTGAAGAATTGGCTAGATCCACTGATGACTTCAACGGTGCTCAGTGTAAAG GAGTTTGTGTT

GAAGCAGGTATGATAGCTTTGAGAAGAAATGCCACTGCTGTTACCCATGAAGATTAT ATGGATGCTAT

TATGGAAGTTCAAGCCAAGAAAAAAGCGAATCTTAATTATTATGCT

LDEC009934 -RA r FBgn0017545 , RpS3A

>>TGGCGGTGGGTAAAAATAAAGGTCTTTCTAAAGGTGGCAAGAAAGGAGTGAA AAAGAAGATTGTAG ACCCGITCACAAGAAAAGAITGGTATGATGTCAAGGCCCCGTCAATGITTGCCACCCGAC AGGTTGGC AAAACCTTGGTAAACCGTACCCAAGGTACCAAGATTGCCTCTGAAGGTTTGAAATCCAGA GTGTTTGA AGTATCCCITGCTGACTTGCAAAACGATAATGATGCTGAACGCTCCTTCAGGAAGTTCCG TCTTATTG CTGAGGATGTGCAGGGTAGAAATGTATTGACCAATTTCCATGGGATGGATTTGACTACTG ATAAACTG AGGTCAATGGTCAAAAAATGGCAGA

Ċ

AAGAGACTCGTACCAAGTGCCTTTGAAAAGCAGGGATCTGCCAAACTGGAGAAGGCTGAA ATCCTGCA GATCACTGTGGACCATTTGAAAATGCTTCATTCTAAAGGTAGGITCAAATTA LDEC004865 -RA, FBgn0034138 , RpS15

>>ATGGATCGATGTGAACAGCTGATGGAACTCATCCATTGTAGAGCAAGAAGGC GTTTCACTAGAGGA

CTTAAACGTAAACCTATGGCGTTAGTAAAGAAACTCCGTAAAGCCAAGAAAGAAGCC CCTCCTCTAGA

GAAGCOVGAAATTGTAAAAACACATCTACGTAATATGATAATAGTGCCTGAAATGGT IXMTTCTATTG

TTGGTGTTTACAACGGTAAAGCCTTCACGCAGGTTGAAATCAAACCTGAAATGATTG GACACTACCTT

GGAGAATTTTCITTGACCTACAAACCTGTCAAACACGGTAGGCCTGGTATTGGTGCT ACCCACAGCTC

CAGGTTTATTCCTCTCAAA

LDEC013831 -RA r FBgn0015324 , Vha26

>>TGAGAAGAAAGAGAAACAGGTCGAACTCCAGAAAAAAATCCAATCGTCTAAC ATGTTGAATCAGGC

TCGAITGAAAGTATTGAAGGTTAGGGAAGATCACGTTCGTACCGTACTAGAGGAGGC GCGTAAACGAC

TTGGTCAGGTCACAAACGACCAGGGAAAATATTCCCAAATCCTGGAAAGCCTCATTT TGCAGGGATTA

TATCAGCTTTTTGAGAAAGATGTTACCATTCGAGTTCGGCCCCAGGACCGAGAACTG GTCAAATCCAT

CAITCCCACCGTCACGAACAAGTATAAAGATGCCACCGGTAAGGACATCCATCTGAA AATTGATGACG

AAATCCATCTGTCCCAAGAAACCACCGGGGGAATCGACCTGCTGGCGCAGAAAAACA AAATCAAGATC

AGCAATACTATGGAGG CTCGTCTGGAGCTG ATTTCG CAGC AGTTGGTGC CACAAATC CGTACGGCTCT

GTTTGGACGTAACGTC AACAGGAAATTCAC CGAT

LDEC010660 -RA, FBgn0042693 , PP2A-B

> > ATGGTTCATTCAAC CTACGCC CAAGGTC ATGTTATGGGAGGTCGTGACTCGGGTC CTCTGGGCATC

CCGAAATCGCCGTCATTTCACAGCGGACTCGATTTAGTAGCCTCGGCAAGCGTGGAT TCTCTCAAAGC

CGCCCTCGACCTGCAGGACAATACCGGTTTCCCGAGCAAGAGTTCCCTTTACGGAGA GGGCGGTAGAG

CCGCCACAAACGGTGGGGAAATGACAACTGTTGGTGATGCAGCTCCTGACGATAGAG AAGAATTCTTT

GTTCAAAAAATCAGACAGTGTTGTGTCCTTTTTGATTTCGCGACAGATCCTTTATCC GATCTCAAAGG

AAAGGAAATCAAAAGGGCTCCCCTCCAAGAAATGGTCGAATATGTTACACAGCAGAA AGGCGCAATCA

CCGAGACTATATATTGTGAGGCTGTAAATATGTTTGCTGTGAATCTTTTTCGAACGT TGCCGCCCTCC

TCCAACCCTAATGGAGCCGAATTTGACCCAGAAGAAGATGAGCCCACCCTAGAAGCT GCCTGGTCGCA

CCTCCAGCTAGTCTACGAGTTATTCCTCAGAGTATTAGAAGCACCAGATTTCCAGCC CAATGTCGCTA

AAAGATATATAGACCAAAAATTCGTGITGCAGCTGTTGGAITTGTTCGATTCGGAAG ATCCTCGAGAA

AGAGATCTACTGAAGACAACTCTTCATAGAATTTATGGCAAATTTTTGGGTCTGAGA GCTTTTA

TAAACAAATAAACAATGTATTTTATAGGTTTATATATC

TTTTAGAAATCCTGGGATCCATTATCAACGGGTTTGCTTTGCCCTTGAAGGAAGAGC ACAAGGTATTT

CTCTTGAGAGTTTTAATGCCCTTACACAAGGTGAAGAGCITATCAGTATACCATCCC CA^

TTGCGTAGTCCAATTTCTAGAGAAAGATCCGTCTCTTACACAACCAGTCATGAGGAGCTT ACTAAAGT

AlTGGCCfiAAAACGCACAGTCCCAAAGAGGTCATGTTCCTGAATGAACTAGAAGAAATC TTAGATGTG

ATCGAACCGGCTGAATTCCAGAAAGTTATGCTCCCTCTGTTCAGACAGTTGGCTAAA TGTGTGAGTTC

GCCTCATTTTCAAGTAGCCGAAAGGGCCTTGTACTATTGGAATAACGAGTATGTGAT GTCATTGGTAT

CGGAGAATGCTGCTGAGAITCTGCCCATTATGITTCCGAGCCTGTACAGAAATTCAA AGAGCCATTGG

AATAAAACTATAC^TGGCCTCATTTATAATGCTITGAAGTTGITCATGGAGATGAAT CAAAAGITA^

TGATGAGTGCACGCAACAGTATCGACAAGAAAGACAAAATGTTGAGAAC

LDEC015753 -RA, FBgn0015904 , ara

>>ATGTCGCCGIXMAGCAGTCCCGGTCTTCAACCAACAACAGGGTACTATCCGT ACGATCCTACTTTA

GCAGCTTATGGGTATGGCGCAGGGTACGATCTCGCAGCCCGACGCAAAAACGCGACG AGGGAATCAAC

GGCCACCTTGAAAGCGTGGCTGAACGAACACAAGAAAAACCCCTACCCCACCAAAGG AGAGAAAATCA

TGTTGGCCATCATCACGAAGATGACGTTGACGCAAGTGTCAACGTGGTTCGCCAATG CTAGGCGAAGG

CTCAAAAAAGAGAACAAAATCACTTGGGAGCCCAAGAACAAAACCGATCATGATCAC GACGCTTTGAT

ATCTGACAGCGACGACAAAGATAAAGACGATGACGACAAGAGGGATGAAACAGACAT CCACGGC

»GAAACAGACATCCACGGCCGTATAAAATCGGAACGGAACGGTAAGGACTTAGACGACG ATGATATG

ACCGACGAGGACCGAAAGGACGACATTCTGGGAGGAAACATGCACCACATCCTTGGC AACGGTTTCGG

CCTGAAGTCCGAAGTGAAATCTTCAGACTGCGGGATTCCGCTGCCCCCATCCAAACC CAAAATCTGGT

CCCTGGCGGATACCGCTGCTTGCAAGACCCCTCCACCCCCTCCGTCCTCCCAGCAGC AATGGTTGGGG

GGAAATGGATTCGCCCTCCCGAGTTCCCGATACAGCGGGAGTGGATTCCTTCCCAGC CACTGTCAGCA

GGGGTTTCCCGATGTTCAGACTGATACGCCCCCACAGACCCCCCCGAATATGAAGCT TCCCAGTGTGG

CTGGTAACCTGATCCCTGGACAAGGACCCTGCATAGGGTCTTCTTCGGGAAATGGTG GTTATGGACAG

GCTGGGTTTTTGGGGGGATTCGGAAGGATTCAGTCACCGCAGAGAATACAAGGTCAA CAGTCGAGTCA

GATCCCCGCCCCCACGCAAGACAATGCCGCCTTCAAGCCTTTITATAAAAGTACGA^

ATTATGTGAACAAATTGCCGAAAGAATTCGATAAATTTCCCCATCGTTTCCTCCCAAAGC ATGAACGG

AGGGITTGTGTCGCCGGTTTGAGCCGCTCCCTACATGGCGAACGAGITTCCGAAGTC AACAAATTACG

GGCAAAGTGCAAACGAAACAAGTATAGAGTGAGTGATGAAGACTTGAAGCAGTCTGT TGTAGATTTGT

GTAAATGCATTTATTTATATCTG

LDEC005148 -RA, FBgn0052264 , CG32264

»ATGCCTCAGCCAGATCCGTCGATAGATACCAGCAGGATAGATGAGATTCCGGCAAAAG AACCTAAG CTGAATGCTAAACCTCTGAAGTCTGCGATGAAAAAGAGGCCAGGAAGTCAGGAGGGATTC TCTCTAAT GATTACAAGCAAACCGGTACGATTTGGCTTGCCAACCACTATTGAAAACAAGGAGAATGC CAGGCCGA

ACATAATTCACGAAGATGATGACAGCGACTCAAACGATGGTCCCATTCTGTACAGAG AAGATGGAAGT

TTATCAGAAGAACGTATGCTGGCTCTAAAAATAGCGAGGAAAGAAAGTTTGTCGCTC AAGCTCGCTCT

TAGACCTGACAAACAGGAGCTCATCAACAGGA

LDEC016278 -RA, FBgn0011284 , RpS4

>>TTGAAGCGTTTGAATGCCCCAAAAGCATGGATGTTGGATAAATTGGGAGGTG T1TTCGC^

CCATCTACAGGACCTCACAAATTGCGAGAGTCTTTGCCCTTGGTGATCTTCCTACGT AACCGATTGAA

GTACGCTTTGACTAACAGCGAAGTTACTAAGAITGTTATGCAAAGGITAATCAAAGT AGATGGAAAAG

TAAGGACCGACTCCAATTACCCTGCTGGGTTTATGGATGTTATTACCATTGAAAAAA CTGGTGAATTT

TTCCGACTCATCTATGATGTTAAAGGACGATTTGCAGTGCATCGTATTACCGCTGAG GAAGCAAAGTA

CAAACTATGCAAAGTCAGGAGGATGCAAACTGGCCCGAAAGGAATTCCCTTCATAGT GACACACGACG

GACGTACCATCCGTTATCCTGACCCAAACATCAAGGTGAACGAC^

TGCAAAATCCTCGATTACATAAAATTCGAATCIXMAAATTTATGTATCATAACIXMAGGA AGGAAT^ GGGTCGTGTTGGTACGGTCATCAATAGGGAACGTCATCCAGGTTCCTTTGACATTGTACA TGTCAAGG ACGC CAATGGACATGTTTTCGCT ACTAGTTTAAGGAGG LDEC001744 -RA, FBgn0032518 , RpL24

>>ATGAAGATCGGACTCTGCGCCTACAGTGGGTATAAAATTTACCCAGGCCATG GAAAAACTATGGTT

AAAGTTGATGGAAAGACATTCACCTTCCTCAACTCAAAATGTGAACGGGCTCACCTT CTTAAGAGGAA

TCCTCGTAAAGTAACTTGGACTGTCTTGTACAGACGTAAGCACAGGAAGGGCCAGGA AGAAGAGGCCA

CAAAAAAGCGAACTAGGAGAACTCAAAAATTCCAGCGAGCTATTGTAGGAGCATCTC TGAATGACATC

ATGGCCAAGAGGAATCAGAGGCCCGAAGTGAGGAAAGCACAAAGGGAACAAGCTATC CGTCCTATCCT

GCTTAAATGTAATTGGATGAAAGTGAACCAAATTGCTAAAACCACAACAATTTATCG GGC

TCAATACTCTGTTGAGTGCA

LDEC 020449 - RA , FBgnO 051145 , CG31145

>>ATGAATTACCACAAAATAAACAGACTTTTTGGATTTAGGCGAGCCATGCCTG TGACAGGAAGAATT CTGAATATGACAACAGAGCTCTATCAAAAAGCCGAAGGTGATCTATTGAACACATTTTTC GTCTCTCC AAGCGATAATCTGTGCTTCCATGGCAAATGCTCGTACTATTGCGATACGTCTCATGCCAT TTGCGGAA ATCCTGATACGCTGGAAGGAAGTTTCGCCGCCTTCCTGCCGTCCAGTAAACTTGCTCCTA CAAAGGAG TTATTAATTTTTGAGAAAGAAAGTTTTTGGCTTTCT

CTGGAGTTTTTTCCCAACACCAAATCGTTATTTCTACACCGCGACACGTGTTTCGAT CACCA^ LDEC007648 -RA r FBgn0004101 , bs

>>ATGTCTTTTACCGGCAGTTTCCACCAAACAAGCCAGTTTGCGTTCTCAGCTC GCGTCCGCCGACAT AAATTCCTGCAGCGACATATAAATTCCCTGCACCTCGATACTTTTAATCCACTAATACCA AAAAACCG ATATCGTATTGTTTCTTTAACAGTTCTTGGTCTCTGTACAGGGAAGGCCCTCATCCAAAC CTGCCTGA ACTCCCCGGACCCCCCCGCCGGCTCTGCGGGCGGTGACCAGCGGATGTCGGCCACCGGAT TCGAAGAG ACCGAGCTGACCTACAACATCAGTGACGACGACTCCAAAGTAAGACAAATGGTGTACGGC TCGCCGCA CACACACGCACACCCGC

>>ACACACACGCACACCCGCACTCTTTGGCCAGCCAGGGTCACTATTCGCACCT AGAACAGACCCATC

TGGGTTTGGGGGGGTCGCCGCAACACGGGGGCTACTCGCAAGCGTGTCCCAGTCCGC TGCCCCCGTCG

CACCAGGGTTACGGCCACCCCCAGCATCCCCACGCGCATATGCACTCGCACCCCCAA CGATATTATTC

TATGAGCTTCAAGATTCCATCAACAAGGTATCGAAAACAAACATTGCAAAGAGATAT TTTTT^

AAACATATTTTAITTTTTGTCAGTTTTCTTTAAGAATGAATTCAA

LDEC018935 -RA, FBgn0001218 , Hsc70 -3

>>GGACAAAAAAGAAAAGGATGATGTTGGTACAGTCATTGGTATCGATCITGGA ACTACATATTCTTG

CGTTGGAGTGTACAAAAATGGTCGAGTTGAAATTATCGCCAATGACCAAGGAAACCG TATAACTCCGT

CTTA1X3TAGCTTTCACTGCTCATGG1X3AACGTCTAATTGGAGATGC1X3CTAAAA ATCAGTTGACAACT

AATCCTGAAAACACTGTCTTTGATGCCAAGAGACTGATTGGTCGTGACTTCACAGAC TCCACTGTTCA

GCATGATCTCAAACTGTTTCCTTTCAAAGTAATTGAAAAGAATCAGAAACCTCACAT TCAGGTAGAAA

CAAGCCAAGGTAATAAAGTGTTTGCTCCTGAAGAAATATCTGCCATGGTTTTGGGAA AGATGAAGGAA

ACGGCAGAGGCITACTTGGGTAAAAAGGTTACCCATGCAGTGGTCACGGTACCTGCT TACTTCAACG

»ACAAGAAGAAGAAGGGCAAAGACATCAGGAAAGATAACAGAGCTGTGCAAAAGTTGAG ACGTGAAG

TGGAAAAAGCCAAGAGAGCCTTGTCTGCCAGTCATCAAGTTAGGATTGAAATCGAAT CATTCTTTGAA

GGTGATGATTTCTCAGAAACCTTAACCAGAGCTAAATTCGAAGAATTGAATATGGAT CTGTTCCGTTC

AACTATCAAACCAGTTCAAAAAGTACTCGAGGATCCAGATATGAACAAAAAAGATCT TC

TCCTCGTTGGAGGATCCACACGTATCCCAAAAGTACAGCAACTCGTCAAAGAATTCT TTGGTGGCAAA

GAAC CTTCAAGAGGCATCAATCC CGATGA

>>AAGGTGAACGTCCAATGACCAAGGACAATCATTTACTCGGTAAATTTGATTT GACGGGCATTCCAC CAGCTCCCAGAGGTGTTCCACAAATTGAAGTAACATTCGAAATTGATGCTAATGGTATCC TCCAAGTA TCTGCTGAAGACAAAGGTACTGGAAACAGAGAAAAGATTGTTATCACCAATGACCAAAAT AGGTTGAC CCCTGACGATATTGACAGAATGATCAGGGACGCAGAGAAATTCGCCGACGAGGACAAAAA ACTCAAGG AACGTGTTGAAG C CAGGAACGAATTGGAAAGCTATG CAT ATT CATTG AAGAATC AAATTGG CG AC AAG GAAAAACTTGGTGCTAAATTATCTGATGACGAGAAGACCAAAATGGAGGAAGCCATCGAT GAGAAGAT CAAATGGTTAGAGGACAACCAAGATACTGAAGCAGAAGACTACAAGAAACAGAA LDEC012729 -RA, FBgn0000097 , aop

>>ATGAAGCATTTACTCAAAAGCTCGTACACTCGGTIK^^

CCCATCGCAACAAGCACAAATATGGACCGTATTCCTTTGCCTCTATCGTTCAATGCAGAT CTGCTATG

GAGGTATCCATTAGGTTTTCCACCTTTATCTCACCAGAATCCACCTTCGTCTCCTTT GTGGGATTACA

AAAGTCAACTTCCAGCTTCGCTTCCTTCAGACCCGAGACTCTGGAATAGGGAAGACG TAATTACTTTT

TTGCAATGGTCAGAAAGGGAATTTGATATACAACCTATAGATCATGAAATGTTTCAA ATGAATG^

AGCTATGTGTTTTCTTACCAGAAATGATCTATCTGAGAGAGCTCCCGGTTCCGGAGA TGTATTGCATA

ATGTAITGCAAATCTTAGTGCGGGAAGCAAACAATTTGCAGAGGATGCTACCAAATA GTCCCGTTACG

CCGACATCAAGACATCCGTATCCATTATCACCACATTCACATCCTCCTACACCTAAC TGGAACATATT

ATCACAAAACAACGAATCTTCGCCTTCTTCACATGCTGCTTCACTGGCTGCTCAGTT GATGGCCCAAA

GTAATTCAGTGATTCTTAGTCCTGCTCCATCGATCGACAGCCAAACAAGCAGCCCAT TGCATGCGGAT

AACCAGGGTTTCGGACACTCTATCTTCAATGTGAATGGAAGTAATGGCAGTGGTTCT AATCCTTCGGA

TTCAGATGAAGATAATGCAGATAAAAAAGGTTTTAATGGAAGCCCTCCTAGCACTCC TAGTGCCTACA

GTTTAATGCCTCAAATACCATATCTACTTCCTAGAAGCCCACAAGAATCGGCTTCCA GTCCTATCAGT

TATAAGAAITCTGGTCGGGAGTTTTTTCCCAGTGACTCTCCTGAGCCAAATACAAAT GGAAGGTTACT

GTGGGATTTTTTACAACAATTACTCAATGATCCTGCTCA

ATCGTCAAACTGGAGTATTCAAAATAGTTGATCCATCGGGTCTTGCAAAGCTTTGGG GAATCCAGAAA

AACCATTTATCGATGAATTACGACAAAATGTCTAGAGCTTTAAGATATTATTATAGG GTGAATATCCT

AAGAAAAGITCAAGGAGAAAGACATTGTTACCAATTTCTCAGAAACCCAACTGAACT GAAGAACATCA

AAAACATATCACTATTGAGACAACAAATGTCCCCCACTAGTACTAAACCACCAATAG CTACAAATATT

TCCCAGAGTATAGTTAAATCTGAACCTGCCGAAATGTCTGATGAAATAACTTCCTCT AGATCTTCCAC

TGAGTATGATGAGAAACCAACGGATTTGAGTATTGATGGACCTACTGACCTCAGTAA CAACACAAGAC

ACATAAATATTGTTTGTTCGCCTGACCCTCCCATCACAGGACCCCATCAT

LDEC022369 -RA, FBgn0028695 , Rpnl

>>ATGACCATAAGGGCTATCCAGAAGCAGTTGGCCTTCATCTTGGGTAGACAAC AGATTTACATAGAA ATTCCCGAGAGTACTCCAGAATATGAAGATATTATAGAAATTATGGCTAACTGCCACTTG AACAATCA CITCCTGAATCTTGCCAGGGAGCTTGACATCATGGATCCGAAAACTCCCGAAGATGTTTA TAAATCCC ATTTGGAAAATAGTCGTCCTCCCTTTGGAGGCAGTCAAGTTGATTCTGCCAGGCAAAATT TAGCAGCT AGTTITGTGAATGGATTCGTAAATGCGGCTTTCGGCCAAGACAAACITCTAATGGAGGAT GGAAATAA ATGGCTTTATAAAAACAAAGAGCATGGAATGCTGAGTGCCACCGCCTCCCTTGGGTTAGT CCTCCTCT GGGATGTTGATGGTGGTCTGACTCCAATTGATAAATACCTGTAITCTTCCGAAGATTACA TAAAATCT GGAGCTCTGCTAGCTTGTGGTATTGTCAACTGTGGAGTCCGAAATGAGTGTGATCCTGCC TTAGCCCT CTTGAGTGACTATGTTCTTCATAATACTAATAITATGAGGATAGGAGCCATTGITGGTIT AGGTTTGG CTTACGTTGGTTCTAACAGAGAAGCTGTCCTGAGTCTGCTCACTCCAGTATTCTCAGATC CTAAATCC AACATGGAAGTAATAGGCATGTCGGCATTAGCCTGTGGTATGATCGCTGTTGGATCTGGC AACCCCCA AGTCACCACAACAATTATGCAAACTCTAATGGAGAAATCAGATACAGAACTGAAAGATAC ATACGCTC GGTTITTGCCTTTGGGTCTGGGTCTTTGCCATTTG^

ACTTIXMAAGTCATACCTGAACCTTTCCGGTCGATGGCTACAACAAIXMTGGACATTTGT GCCTACGC TGGAACGGGAAACGTTCTCAAAGTTCAGAATTTGCTGCACA

>>TCAGAAITTGCTGCACATTTGTTCAGAGCATTATGAAGGCTCTGATAGCACC GACAAAAGCTCCAA AGATAAGGACAAAAAGGAAACTGTTAAAGAAAAAGATCTATCTACCAGGCAGGCTGTAGC CGTACTTG GTAT1X3CATTGATCAGCA1X¾MGGAAGATATTGGCAGTGAAATGGC

CTTCGTTATTGTGAACCAGCGATTCGGCGAGCTGTACCTCTGGCTTTGGGACTCATCTCC GTGTCCAA

TCCAAAGTTX3GGCATTCTCGACACCCTCAGCAAGTTTTCACATGACAGTGATGCAG AGGTCGCCCACA

ATGCTATITTCGCCATGGGATTGGTCGGAGCTGGTACTAATAATGCCAGACTGGCAG CCATGTTGAGG

CAGTTGGCACAATTTCATGCCAAGGACCCAAAC

LDEC005226 -RA, FBgn0039338 , XNP

>>ATGATTGACAGCAGTGATACTGATGAGGAATTTAGTAAATTTTGTTCGAAGA ATGAAAAATCCAGA

CAAGATATCGTTAGTAAAGCCAAAAAACGGATAAAAAAAACCATTGTTCTCTCTGAC TCGGACGAATC

TGGTAGTGATAAAAAGAAGAAAAACAATAGTGAAGACTCTGACATTAAGAGTGACAA ATCAGATTCGA

ATAAATCTAGTGAAGACGAGGGAGAAAGTGAAGAAAATAAGAAGCCCAAACGTAAAA GAATTAAGAAA

ACAAAAGACAGTAGTAGTAGTAGTGAAGAAGATAGATCTACCAGAAAACAAATCAGA AAAGTATTAGA

TAGAGCCTCTTTATCTGCAACTACCAAAAAGGCAGAAGCTGATGAAAAGGAACGTAA GGCTCGTATCG

CTGAAAAGCAAAAAAAATATAATAATATTTTTGAAGAAAAGAAAGAITCTAAAATAG AAAAGCTTG^

TTGGACCATGACGAGAATACAAAGAAAGATGTACTTGAAGTTCATAAAAAAATTGTC AAAAAATTGAA

ACCACATCAAGCAAATGGTATCCAATTGATGTGGGATGCTTGCTITGAGTCTGTCGA AAGGTTAA

AAGAACCTGGATC

>>AGCAGAATTCAAAAAGTGGATTCCCAGTAGTGATAGACTTGAGGTTTATGAA CTAGTGTCTTGTAA GAAAAATITCGAAAGACAGTACATTGTGAATGAATGGCATCAAGAAGGAGGAGTITTAAT AATAAGTT ATGCCATGITTCGAAACTTGAGCAACCCTGATAATAAGAAACITAGTAAAAAGCTAAGGA ACGCTTTT CAGGTGGGATTCATCGATCCAGGTCCAGATTTGGTGGTGTGCGATGAAGGTCACCTACTC AAGAATGA GAAAACCAATTTGAGTATTGCAATGAATAGAAITAAGACTGCTCGCAGAATAGTCCTC^C AGGTACAC CACTACAGAACAACCTTAAGGAATATOMTGCATGGTGCAATTCATAAAACCCAATCTGCT TGGTACT

LDEC018707 RA, FBgn0038578 , MED17

>>ATGAAGACTTCCCAAACAGAAGCTGCCAGAAATCGAACAACTCTAGACTTCC ACATAGAACTATTG AGGCTGAGACAGAATTGGCGATTGAAGAAGGTGTCCAATACGATAATTGGAGGTCTCAGC TACCGAAC

TCCAGAAAGTCCAAGCAAGGCTTGTACGTGAGCTGGAAAAGAAGTTCAGTGGCAAACATG TGGTGTTT

GTAGGTGAACGAAAAATTCTTCCCAAGCCAACACGTAAAACTCGTGCTGCAAATAAA CAGAAA

AAGGTCTCGTACACTTACTTCAGTGTATGATGCTATTTTGGAAGACCTTGTGTTTCC TGCGGAAATTG

TTGGTAAACGTAirCGTGTGAGGTTAGACGGCTCACAACTCATTAAAGTCOVCCITG ACBLAAAATC^

CAGACCACAATTGAGCATAAGATGTGTTTCGCTAACACCGTAGCTTTCTTGGTGGAC ACATTTGCATC

AGTATAGAAGAAATTGACTGGAAGGGAAGTTACTITCGAATTTCCAGAACCCTATTT G

LDEC018502 -RA, FBgn0014366 , noi

»TCACAGATGAAGAGGGATACGGAAAGTATTTGGATCTGCACGAGTGTTATGAAAAATA CATAAATC

TAAAAGGAATTGAGAAAGTAGATTACATCACGTACCTTGGAATGTITGATCAACTTT ATGACATTCCC

AAAGAAAGAAAAAGTGGTGAATACCGAAAATATTTAITATGTCTTATAGAGTATTTG ATGTGGTTTGT

CCAAAGGATCAAGCCATTAATGGAT1TAGAAAGTGGTTTACAGGAAGAAGTTGATAG AGTTATTGCTA

CATGGGAAAGTGGCACAGTACCTGGATGGCCTAAAGAAACGGGTTCTGCT1TAGCCA ATGTTGGTGCA

CATTIXMATCTTTCTGCAITITCCAGCTGGGAAGAATTGGCTTCTITAGGTCTGGAT CGTCTTAAATC

TGCTCTTATGGCATTAGGGCTGAAATGCGGAGGGACTITGGAAGAACGAGCTCAAAG ATTGTTTTCAA

CCAAAGGAAAAGGTTCTTTGGATCCTTCTCTTATGACTAAAACCAATAAAGGAAAAG CTAGCAAAGAA

AAGGAACAACTTCAATTAGTTGCTGTTCAGAGAACAGGAACAAAAGAGAATC

ACGCACAGATGGTGAACGTGATGATAGCGAAAATGAAGAAAGTGATGAT

LDEC019308 -RA, FBgn0042630 , Sox21b

»AGGAGCACCCCGACTACAAATACCGGCCGAGGAGGAAACCCAAAGGACCTCTCACCAG TGGCTTGA AACCTGCCATGGGGTTCCCCATGCCCCAGCTGCCGTACCCTTTTCCAGGAATGGATTCTC TGAGCAGT CCGTATCCTTACITCAACCCTGCGTTCGATTTTTCGAGGATACAAGGTATAAAACACGAA GAACCTTC TTACATTCACCACCAACCCGCCGTTATATCGTCTCCTTAC^

CCTCGTTCTATCAGCAAAAAGCTCTGACGACGTCTCCTATGGGTATGTTCTCCACIAATG CCTTCGACA ATATACTCGACTACCTCGAGTCCAACAACAACTCCATCGACCTCAGATCTGGAAATCCGA AGACCGGT TCCGGTGATGTAC

LDEC009768 -RA, FBgn0265523 , Smr

>>CTGCAGAAAATCTATGCGGAGAACAGAAAAAGAGCCCAAAAIK-CT

GGCCAGAAAGTCGAGTGGCCTCTCTACAACCAACCCAGTGATGCGACCGCCTATCAGGAC AACAAAAG

GAAGCACGTGTCTITCAAAAGAAGGCTGTTGGAGTACTTTAAGC^GAAGCAGAAGGA AAACGA

GGAACAAATTTCTGACTGAGACTTACAGCAAAATGATGCAAGATTGGTTGAGGAAAG TCGACAAAATA

GAATGTAGCACGAAGCGAAAAGCAAAGGACGTAAAAAATAGGGAATTTTTCGAGAAA GTTTTTCCAGA

ACTGAGGAAGCAGAGAGAGGACAAAGAAAGGTTCAACAGAGTGGGGTCTCGAGTGAA GTCAGAAGCTG

ATATGGAAGAAATTATGGATAATCTTCAGGAGCAAGCTCTGGAAGATAAGAAAATGC GTAGCTATGCA

GTCATACCTCCGATTCTTTTCGATAAGAAGGCGAAGCGGATCAAATACGACGACAAC AACGGTTTCGT

CGAAGATATGGACGTCGTCTATAAGAGCAGACGGTTITTAAATGTGTGGACTGCCAG TCAAAAAGAAA

TATTCAAGGAGAAATATCTTCAGCATCCGAAGAACTTCGGTTGTATAGCGTCATATT TAGATAGAAAA

TCGGTGTCCGACTGTGTACATTACTACTATTTGAGTAAAAAAACTGAAAATTATAAA CAAITATTTAG

GAAGGCTAGGCAGCGAACGAGGAGCTCGAGGAATAACACGCAGAAGGTTAGCAATAG CGGGAATGCTT

CCGTTGTGGACATCTTGACTTCAGGCGTAACAACTCGACTTCAAAGAGAACAACAGG CTAAAACGGGA

AATCAACAGTCTCGAGATCCGAATCAGCCGTTGGAACATCCGACGTCGACGACACCG CCAGCAACATC

CGCACCCACTCCCAGCACCGCAGTGTCTGTCGACAGCCCTCCGTCGACCGTTACGAC GACTACCACCA

CCACGTCCACGTCAAGCCCGGCGACGACAACCTCCGTACTGCCGTCTACGCCGCCAC CGTCGGCCGTT

TCAACGTCAGATAAAACCGTGGTCGGTGGTTCGATGACACCGACAGTTTCTGGAGTG ACTACTACCCC

GACAACCGCGATATCGAACTGTATATCTTCTTCTAGTACATCTGTGATTACGACTAG CAGTAGTGGCG

CGATCGTGACGGCGTCCACGGCGACGACGACGCCGTCCGTCGTCGTTTCGGCGTCCG TGACCGTGACG

ACGATGAACGATAAAGAATCGACTCCGATGGAGGTGGACACAGTTACGGAAGACGTG AAACCGAAGAC

TTTTTTGGGGTITGGTTCGATGGACGAGTACATGGCGAAGAGCAGTTACTTCGAAGA GGTCGGCGGTT

GCGGAACCGGCAGCGGTAAAGACGGCGCGGCTGTAAITTTGGACGGGCAGAAGCAGA AGAGCGTTGTG

GTGGACGGAACTACGAGCCT

LDEC019906 -RA, FBgn0027548 , nito

>>ATGGAAAAAAT1TATACTGGAATCAGTAGTGGCGAGGTTGCTGCTGCAGTAT TTTGTGATTTCTCG

AAGGCTITCGACTGTGTGGACCACGAAATACTGCTGAGAAAGCTTCCTTATTACGGT TTCAGAGGAGT

GATACTGAGCTGGTTCAGCTCATATTTGTCAGGTCGTAGCCAGATGGTGGAAACAAA CCACCGCTCAG

AAATTGGAGAAATACATAAGGGTGTACCTAAGGGTTCAATACTAGGGTCAATATTGT TCCTCATCTAC

TTCAACGATTTGACAAGTAAATTCACACTATTTTCAGATGATACTACTATTTTTTGG CAG

TGCAAACGATTTAACTAAAATCATATCCBACGATATGATGACAGTGAAAAATTGGTG TCATTCAAATC

GTCTTTCTCTAAATATTTTGAAAACTGATATATTTTCTATTATTTTGC

>>TAITTTCTAITATTTTGCATGAAITCACAAATC

AAGACATCGATATCAAGAGACCTCCTCCTGGAACAGGTAACGCTTTTGCTTTTGTCCGTT TCAACACG CTGGAC^TGGCCC^CAGGGCGAAGGTCGAGCTGTGAGGACAGTACATCGGAAAGTTCCAG TGCAAAAT TGGGTACGGCAAAGCCACCCCCACAACCAGAATCTGGGTGGGAGGCCTCGGCCCGTGGAC TTCGGTAC CGOVGCTCGAGAGGGAGTTTGACAGGITTGGAGCCATAAAAA^ CAGGCTTTAATCCTCTATGACAGCATCGATGCTGCTCAAGCTGCTGTGAAGGAAATGAGG GGTTTTCC CTT

>>TGAGGGGTTTTCCCTTGGGAGGACCTGAGAGGCGGCTCAGGACTGACTTTGC TGATGTCACTCCTG GAGTGAACTTCAGACCCAAGGCCCCGTATGCTGATGATTACAGAAGGGACCCTGAAGGAG ATTTTGAC TACAACGCAGCATACAGAAGAGGATTCCCCGATAGAGGCAGAGGGAGTAGCAGAGGGCCG TACCGCTA TCCCGATGGGGTCGAGGACGAATTTGGCAGAATCAGGGATCCAGAGTATGACCGCAGGCG CTCCGGAT CCAGGGGCGTGGACAGATCCAGGTCACGATCGCCTAGGCGCTCGCCCGATTCTGATTCTG ACAGTGGT TCTCGTAGAGCTGGCCTTTTAGCCTCCAGTCGTACCCTGCCCGAGGTCGCCAGAAAGTGC AACACCGT CTGGCAGGGGGCCCTGATCCTCAAAAACTCCCTCTTTCCTGCCAAGTTCCACCTGATGGA TGGGGACA CTGATATTGTTGACGGATTGATGAAAGACGAAGACGGCAAGCACCAGTTGAGGATAACGC AACGTCTC AGACTGGACCAGCCCAAATTGGAAGATGTGCAGAAGCGCATTTCTAGTGCCAGTTCGCAC GCTATCTT CCTGGGGCTGGCCGGTTCGACAGCGTCCGTAACTAATGACGACGCAACCGTCCAAACTCG GCCTCTAA GGAAITTGGTGTCGTATCTCAAGCAGAAGGAAGCCGCCGGAGTTATTTCGCTGCTGAACA AAGAAACT GAAGCGACAGGCGTCCTGTACTCTTTCCCCCCTTGTCCTTTCTCTACTGAGCTACTGAAG AGATCGTG CCCCAACTTCTCGGAAGAAGCCATCAAGGAAGATCAITTGATCATTGTAGIXMTACGTGG GGGTACAG CA

LDEC010448 -RA, FBgn0019662 , qm

>>ATGTACAAAGTTTTTTTTCAGAAACTACTGGAACC^

AACATAAGGTCCAAACTATCAAGAGCATTCAATCACTGGCTAAATATATCTGAAGAGAAA CTAAACCA AATCACTGATATTGTCCAAATTTTACATAATTCTAGTCITITGTTAGATGATATTCAAGA CAATTCGA TATTGAGAAGAGGGATACCTCTGGCTCATTCAATCTATGGTCTTGCTAGTACCATAAACA CTCC^AAT TATACTTCTTTCATTGCTTTGGAGCGAGTAGTAGATTTACAACACCCTGAAGCAATACCT ATAGCTTT AGAAO^TCCTAGAGTTGTACAGAGGTCAAGGAATGGAAATATATTGGAGAGAC^ITTTTC CTGCC CAACTGAACAGGAATATAAACAAATGGTAGTTCGAAAAACTGGTGGTCTCTTCATGTTGG CTATAAGA TTGATGC AG C TTTTTAGTG AAAATAAAGAAGATTAT AC CAAAATAACGG C AATATTGGGATT AATATT TCAGATTCGTGATGATTATTTGAATTTAGTGTCTACAGATTATATGCATCATAAGAGCTA CTGTGAAG AITTAACGGAAGGAAAATTCAGTTTTCGBAT^

GTTATACTTTCGCCCCTTAAAGTCAGATGGCACTATATTCTTCGCCAGAGAACCAAGGAA GCTGAAGT

GAAGAAATATTGCGTCTCITTACTAGAGAAATAIX-GTATCTGCCCACTATACCGTA CCAAACCA

LDEC017471 -RA, FBgn0039411 , dys

>>ATGTATATCTTGTACGAACTGGTTCACAATTTTC

TGTATCCCAAAGTTAGATGAGTTTGAAGATGAGGCGTTGAGTGGATTCCTGATGATGATG ACGCAAAA

TGGAAAACTTTTGTACATATCGGATAATGCTGCTGAGTACCTGGGCCATTCCATGGT GAGTGTTCTAC

AGGAGGACCTTTTAATCCATGGAGATAGTGTATATGACATAATAGATAAGCAAGATC ACCAGACAATT

CAATGTGAATTGGGACGGCCAGTAAATACGGGGTCTAACAATAATCCAAATCATGAA ATTCGGCTC

TTTATGTAGGATGAATGTTTCTAGGAATGTTAGGAGACAAATGCGATTTGGCGATCA GAAGGTTGTAT

TAGTACAAGGGAGGTACCTATCGTTCCTTCCCCTTTGTAGTCGTAATGAACCAGTAT TTCTGGCATCG

TGCACCCCTGTAGCCATGCCCGAAACGAGGGAGTGTGTAGTCCAAGGTGCCACCAAC GTCT

>>GTGCGACCAACGTCTTCAGATCCATAC^

GTCAATTCTACCTGGGCTTTCCGCGCTCCGATCTGCAGGGGGTGTCCTGGTATCGGCTGC TGCACTGG

GAATGCACGCGTGAGGCCCAGACCAAACATCGCTTGATAACCCAATCGGAACAAGAA AGATCATGCAT

CCTGCIXMCGCAAATTCAACGGCGTACAGGCGAGTGGATGTGGATGCACTGCGTGCT GCAAGTGAAAG

AGAGCTCGGAAAGCAGTCAACAACCCGTAATCGTGTGTACTAACCAAGTCCTCAGCG ATGCCGAAGCG

GCTGTCATGAGAACGAATAGCTGGCTCTACCACTACTATTCCGTCCAGAATAAGCTC CAATACGGTCT

CACTTACGACGTCGGTCCTTCGTCGCGACTCCTCTACTACCCGGAGCGGTCGCAAGC CCCAGAGTTTG

CCGCCTCCCACGACGTGAGCGGGTACGCGCATCTGTCGACGATGCCCGCCGCCCTGC AACCCCATCTA

AGTCATCACAGCGCGTCCACGCACACACACCACAACCCTCACCACCACCACCA

»CCTCACCACCACCACCACCGACGAGCTGACTCCGAGCCAGTAGATTATTCGTACAGTA AGCGCAAG

CCCAAAGAATTACAAAACCTCGAATTAGAAGTAACTGACCACGATGTGTCTGATGCT GATGGAGGTAG

CAGCGGCCTGTTGGTAATATCGCATATGTCAGAAAGGCCAAGGACGCTACTTAAGGT CGATCCCAGCG

AGCTGATGGACCAGTGGAACCCCAGTCCGCCTTGGTCGGACACCTTGCAGAAGGTTC CCGACTTGTGT

CACCAGGAACTCAGTCCCTACATAGGGAGTACTCCCCCTACTCCAACTGCGACCCCC AGCACGCAAAC

CAGCGCATTTTCCTTCGACTGGATGCCGGAACAATACGTCCCTTCGATAGCTTCAGC TGCACCAGCTG

AAGACGCCGAAAGACAGGITTACTGGCCCACGGAACATCGATTATTTCCGTTGCAGC CTCCTCCAAAG

AGGAATCATCCGCCCCCAGGAAGATCTGAGTCGGCTGATCGAGACACTCCT

LDEC002428 -RA, FBgn0261873 , sdt

>>AATACGAGAAAGCCTATTATGGTACTTCGTTGGATGCCATTCGATCTGTGGT CAATTCCGGCAAAA TTTGCGTTCTGAATTTACACCCGGAGAGTTTG

GTCTTTGTAGCACCCCCCAGTCTGGAAAAGTTGAGGCAGAAGAAAATCAGAAATGGA GAGTCTTATAA

GGAAGAAGAACTTAAAGACAGAATTGAGAAAGCACGAGAAATGGAAGAGAAATACGG ACACTTCTTCG

ACCTGATAATTATAAATAATGATACAGAGAGGGCTTATCACCAGTTATTGAATGAAA TAAATAGTCTA

GAACGAGAACCTCAGTGGGTTCCAGCAGCATGGGTCAAGGCGCCG

LDEC003762 -RA, FBgn0005278 , Sam- S

>>CAGCAGCAACAGCAACAGTAGGTTCAATCTCAGTCAAAGCCCAGACACCAGT CAAGTCTTACTGAA CAACAACGTGCCCCAGTTGGACCAAAATCTGTACTTAGACTCCAAGTTGGACGAOVATCC CTTCTCTT TACCAAAAACTCAGTATTATCCTCAACCAAGTTCCTTGGAGAGCAGTTACAGACCCTCCG GCTACGAC CTGACTGAAAGTAAGCCTACTTACTCTGGAGAAGATAAAGGCTTCCAGGTTTTCGAGCCT TACCACGC TTCAAAGGCGTATACCAAGTCCAACCAAGACGAATACATCGACCTAGGGCAGTACAGCGA GTACAGCC ACTTTCTCAACGTGTACGATAACAACAAAATGGCGGAAAGCGCCATGTTCAACGACCTCG ACTTCAGA ATCCAGAGCTCTTGCGTGCCCTCTATCAGCAATCTGCATAGCTACAGTCATGATACTTTT GATGTGAT GTCTCACCAG

LDEC005567 -RA, FBgn0028697 , RpL15

>>ATGGGAGCTTACfiAATAC^TTCAGGAATTGTATAGGAATTCGAGTGTGGCA ATATCGCCAGTTGAC AAAACTCCACCGTATTCCAGCACAGTCCAGCCGTCCCGTATCCTTGTACGACGTGCTGGT CGTAAACG TCCTGITCCGAAAGGAGCCACCTATGGTAAACCAAAGAATCACGGAGTAAATGATTTAAA ACACATCC GTAACITGC^GCTACTGCIK-AGGAACGTGTAGGAAAAACATGTGG

TACTGGGTTGCTCAGGACTCTACTTATGAATATTITGAAGTTATTCTGGTTAACCCATCA CATAACGC

AGITTGTCGTGATCACAAAGTTAATTGGATACAGAATCCTGTCCACAAACATCGTGA ACTACGTTGTA

AAACGTCTGCAGGAAAGTCTTCACGTGGTTTTGTCAAGGGATACAGATATTCCCAAA CAAAGGGTGCT

TGGAGACGAGCTGTCTGGCTCAGACGAAACTCTCAGCAATTGCGCAGGAAACGA

LDEC004253 -RA, FBgn0039359 , RpL27

>>ITGCCATCTGATTTCATAGTTATTTTAGCAAAATITGTATACAGTGATAGTA ATTITT^

GAACATTTTTATTTTCAGATCAAAATGGGTAAAATAATGAAATCTGGTAAAGTCGTATT

AGGCCGATACGCT∞AAGAAAAGCAGTAGTCATAAAAAATTACGATGATGGGACGTCAG ATAAACAAT

ATGGACATGCCGTGGTGGCTGGAATCGATAGGTACCCTAGAAAAATCCACAAACGTA TGGGCAAAGGA

AAAATGCACAAGAGGTCCAAAATCAAGCCCTTCCTTAAGGTGCTCAA

LDEC024513 -RA, FBgn0039713 , RpS8

»ATGGGTATCAGCCGAGATCACTGGCATAAACGAAGATCAACCGGAGGCAAAAGGAAGC CTCTGCGT AAGAAGAGGAAGTTTGAATTAGGTCGCCCCGCAGCTAGTACTAAACTAGGACCTCGCAGG ATCCACTA TGITCGTACCAGAGGTGGTAATTTGAAATATAGGGCTCTAAGGCTCGACACTGGAAATTT TGCCTGGG GTAGTGAAGGAACTGCGAGAAAAACCCGTATTATTGATGTTGTCTACAATGCTAGCAACA ATGAGTTG GTGCGTACCAAAACATTAGTCAAGAATCCAATAGTTGTTGTAGA

TGAGAATCATTACATCCTGCCTTTGGGTCGCAAGAAGGGAGCCAAACTGACTGCCGA AGAAGAGGCTC TTTTAG

LDEC007659 -RA, FBgn0086674 , Tangol3

>>ATGCAACTGAAGCGACCTTTCCGGGGAGGTCTCAAAAAGGCCTTTGGGGTGA TATGTGCCCTCTTG GTCGTGTACCTGTTGGTACACTCGGTTGGACTGATAAGTTGAGATTTTCCCACTATGGTT ACTGACCA GAAGTATGTCGTTGGAGACGATAAGAAAATTTACGAATATAACAGGCAGATCCCGCTTAT TTTCATCG GCGGTGTTCCGAGATCTGGAACTACTCTGATGAGGGCCATGTTGGATGCGCATCCCGATA TCAGATGT GGTCAGGAAACCCGTGTGAITCCCCGTCTTCTTCAGATGCGATTCCACTGGCTCAAATCC GAGAAAGA ATCCATCCGATTGAATCAGGCTGGTAITACAAAGTCAGTTCTCGATTCTGCCATAGCAGC ATTCACGT TGGAAATCATAGCGAAGCATGGCGAGCGAGCTCCGAGACT^

AIXMGCACCTACGTCATCGATCTCTTCCCCAACGCCAAGTTCAITTTCAIXMTTCGCGAC GGTCGTGC

CACLAGCCCATTCCATCATATCTCGAAAAGTTACAATCLACCGGTTTTGATTTGACC GATTACAGGCAGT

GCCTGAAGAAATGGAACAGTGCTGTGGAAGCGATGAACAGCCAATGCAGGGAACTGG GGCCTGATAGA

TGTTTGCGGGTACCCTACGAGCAACTGGTGTTGCATCCCAAGAAATGGATGGAAAAA GTTCTTGAGTT

TCTCGATATCCCTTGGAGCGATTCCGTGCTTCATCATCAAGACTTCATCAATAACGG AATCGAGCTCA

GCAACGTTAAAAAAAAGGCTCTGTCAAAATGGGTTGGCAATATACCAGAAGACGTCA TAAAAGATATG

GCCCATATTGCTCCGATGTTATCAGTTCTGGGTTATGATCCTTATGCTAATCCTCCA AATTATGGACA

ACCAGACGCAGAAGTTGCCCATAAAACAAAGGAAATTCAAAGGAACAAAAACGTTTG GGAAAGAAAAG

CCAAAGAAATGTTTGACGTCGGTTGGGATAATGCTGATGGAGATACTGCTCTAGACA AAGAACCGAGT

GATAATCCCAACAACATTACG

LDEC017315 -RA, FBgn0015797 , Rab6

>>CCAGATTCATGTATGACAGCTTCGATAATACTTACCAAGCAACTATAGGTAT TGATTTTTTATCGA

AGACAATGTATCTTGAAGACAGAACGGTTAGATTGCAGCTCTGGGATACTGCAGGAC AGGAACGTTTC

AGGTCCCTCATACCTTCTTACATTCGGGACTCCACTGTTGCTGTGGTAGTCTATGAT ATCACTAATGC

CAATTCCTTTCACCAGACATCCAAGTGGATTGATGACGTGAGAACTGAGAGAGGCAG CGATGTGATAA

TAATGCTGGTTGGAAACAAAACTGACTTGTCCGATAAACGACAAGTTAGTACGGAAG AAGGTGAGAGG

AAAGCTAAAGAACTGAATGTAATGTTTATTGAAA

LDEC007059 -RA, FBgn0011739 , wts

>>CATCAAACCCGACAACATCTTGATAGACAAAGACGGCCATATGAAACTGACC GACTTCGGTCTATG

CACCGGTTTCCGTTGGACCGACAATTCGAAGTACTACCAACCTAACGGAGACCAGAG TAGGCAAGACT

CGATGGATCCGATCGACGACTGGAATGAAGAGTGGAAGTGCAAGAGTCTGAAGCCTT TGGAGAGGCGG

AGACGCCGCGAGCATCGATGTTTGGCGCACTCTCTGGTCGGCACGCCGAACTACATC GCACCCGAGG

>>TGCTGGTGGGTCAGCCGCCGTTCITGGCGAATACACCGGCAGAAACGCAGTA CAAGGTTATAAACT

GGGAGACAACTCTCCAGATACCGAAGCAAGCGAATCTCTCTAAAGAGAGTACGGACT TGATACTTAAA

>>ATGGCCCCAAGGTACGAAATCGCCGTTGGGCTCCAAAGGGGACACAAAACCA CAAAAATCGACAAA AAGATCAACAAAGTTCGTCCCGCGAGGTTGAAGGGGATCCAAAC^

TATTATCCGAGAAGTTGTAGGTCATGCCCCTTATGAGAAGAGAGCCATGGAATTGTTGAA GGTTTCGA

AAGATAAAAGGGCACTTAAGTTCCTCAAGAGACGTCTTGGCACGCACATCCGTGCCA AGAGGA

LDEC020740 -RA, FBgn0010217 , ATPsyn-beta

>>ATGTTGGGTGCTGTGGCAAGGGCAAGTTCTAGCCTTTTGGCTGGAAAAACTA TCGAAAAGAITGGA GCAGACTCTCTTAAAATAGTGTCATCATACAATGTTTCCAGCAGGAATTATGCTGCTAAG GCCGCAGC CTCCGGTAAAAGTCCTGGTAAAGTTGITGCCGTTATTGGTGCCGTAGTGGACGTCCAGTT CGACGAAG AATTACCACCCATTCTCAATGCATTGGAAGTACAAAATCGAACTCCTAGACTTGTGTTGG AGGTTGCC CAACATTTGGGAGAAAATACAGTACGTACCATTGCTATGGATGGTACCGAGGGTATTGTT CGTGGACA GCAAGTGAATGATACAGGCTACCCTATCCGAATTCCTGTAGGTGTAGAAACATTAGGAAG AATCATGA ATGTAATTGGGGAACCCAITGATGAGAGAGGTCCAATTCCCACTGATAAATTGGCTTCCA TTCACGCT GAAGCTCCAGAGITTGTTGATATGAGTGTTGAACAAGAAATTCTAGTAACAGGAATCAAG GTTGTGGA TCTTTTGGCTCCATATGCCAAAGGAGGAAAGATTGGTCTGTTTGGTGGTGCTGGTGTAGG CAAGACTG TACTCATTATGGAACTGATCAACAACGTTGCCAAAGCCCATGGTGGTT

>>AATATTTCCGTGATCAAGAGGGACAAGATGTATTGC1T1TCATCGACAATA1 T1TCLAGATTTACTC AAGCIX-CTTCAGAAGTATCTCCTCTGITGGGTCGTATTCCCTCCGCTGTAGGTTATCAA CCAACTCTG GCCACCGATATGGGTAGCATGCAGGAAAGAATCACCACCACCAAAAAGGGGTCCATTACT TCTGTACA GGCTATCTATG

>>ATCCTGCTCCTGCTACTACTTTTGCTCACTTGGACGCTACCACTGTATTGTC ACGTGCTATTGCAG AATTAGGTATCTACCCCGCTCTCGATCCATTGGATTCCACCTCACGTATCATGGATCCCA ATATCATT GGAGCAGAACATTACAAAGTAGCTCGTGATGTACIAAAAGATCCTTCAAGATTACAAATC TCTACAAGA TATCATTGCCATTTTGGGTATGGATGAATTGTCTGAAGATGACAAACTAACTGTTGCTCG TGCTCGTA AAATCCAACGTTTCTTGTCACAACCTTTCCAAGTAGCCGAGGlTiTCACTGGTCATGCTG GAAAACTT GTACCTCTTGAAGAAACAATCAAAGGATTCCAGAAAATCCITGCAGGTCACTATCATCAT TTGCCAGA AG

LDEC001726 -RA r FBgn0030321 , CG1703

>>AAAAACAAGAAGAAGAAACTGCTCCTACTGAATTGCTGCAAAGACCTAAAGA TTATTTGGTTAAAT

TCAGAITCCCAGAACCACCACCTCTACCACGACCAGTTTTAGGATTACACAATGTCA CCTTTGG

CCAGGACAAAAACCTTTACTAGTTAAAACAGACTTTGGTATTGATATGAATAGCAGA GTTGCCATAGT

GGGTCCGAACGGTGTAGGAAAATCAACTTTTTTGAAATTATTGACTGGAGACCTTAG TCCTATCAGTG

GAGAAAATAGAAAAAATCACAGATTGCGAATCGGTCGATTTGACCAACACTCTGGTG AACACTTGACA

GCTGAAGAAACCCCTTCGGAGTATCTGATGCGITTATTCGATTTGCCGTATGAAAAA GCTAGGAAGCA

GCTTGGAACTTTTGGCCTGGCTAGTCACGCACACACTATTAAAATGAAGGACCTATC TGGTGGTCAAA

AGGCAAGAGTGGCCTTAGCTGAATTGTGTCTCAATGCTCCGGATCTGCTCATTCTGG ATGAACCTACG

AATAACTTGGATATCGAATCTATAGATGCACTGGCAGAAGCAATCAATGAATATACA GGAGGTGTTAT

AATTGTATCTCACGACGAACGTTTAATTAGG

LDEC010249 -RA, FBgn0260657 , CG42540

>>ITGGGACGTCTTCTATCGGGCGGAGCAAAAGGACCAGGAATATTCTTCATTT TGCCGTGTATCGAT

GCCTATGCGAGGGTTGACTTAAGGACGAGGACCTACGACATTCCTCCGCAAGAGGTC CTGACGAAGGA

TAGCGTTACAGTCTCCGTGGATGCCGTTGTCTACTACCGGGTATCAAATGCCACTGT GTCGATCGCTA

ACGTGGAAAATGCGCATCAITCCACAAGACTTCTCGCCCAGACCACCCTAAGGAATA TCATGGGCCAG

AGACCACTCCACGAAATTCTCAGTGAACGTGAAAGCATTTCT

LDEC002447 -RA, FBgn0027779 , VhaSFD

>>TTGCAAAAAATGGCATCGAACCTAGCAGCGGCCGGAACAGATCCGAAAATTA AAGAAATAATAACG TCTTTAGATGACGACAAAATAGATATCTTGGCTCCTACCAGTGTTTTGCAGCAAAGGGCA ACTGACAT CAGGAATCAGCATGTTAACTGGCAGTCTTATTTTCAGTCT

TCATTGTAGCTTTTGATGTCACAGATAGCGCTAAACGAGAAGCACTTTTGCAAAAGG ATCGTAATCAG TGTGCCCAGACCTTTTTGAATCTGTTGGGACATGTTTCAAAA

TTTGGTAGATGATATGTTGCAGGAAAGTAGAAGCCGTGTGGAGATCTTTCATGAATA TGCCAATAAAA AGAAAGAATCAGTTTGGGGACCATTCTTGAACCTACTTAATCGACAAGATGGATTCATTA CCAACATG ACATCCAGAATCATTGCAAAA

>>TCCAGAATCATTGCAAAAATCGCATGTTGGTCCCATACTCCGATGGAACGAT CTGATTTGCACTTC TATCTGACCTGGITGAAAGATCAGTTGAAAACTCAGTATGAAGCTTTGGCCGCITCGCAA CCAACTTT AGATACCTTGAAGGGAGCTGCAACTGAACATTACTCGGAATCGTCGTTCGATCAACAGTC CTCCCCGC AAACGATATCGAATAATGAGTACATTCAGTCCGTTGCCCGATGCCTACAAATGATGCTCC GCATCGAC GAATACCGCTTTGCCTTTGTCTCCGTTGATGGAATTTCCACCCTCCTATCGGTACTGTCT GGTCGAGT CAATITCCAAGTACAGTATCAACTCATCTTCTGTCTGTGGGTGTTGACCTTCAATCCTCT GTTGGCCG AGAAAATGAACAAGTTCAACGTCATCCCTATCTTGGCGGACATTTTGAGCGACTCCGTCA AAGAAAAA GTAACC^GGATCATCCTGGCCGTGTTC^GGAATlTGATAGAAAAGCCTGAAGATa^CAGG TAGCCAA AGAGCACTGCATCGCTATGGTACAGTGTAAGG

>>CTATGGTACAGTGTAAGGTTTTGAAACAATTAACTATTTTAGAGCAACGTAA GTTTGACGATGA^ ATGTTACCGGCGATGTGGAGTTTTTGACAGAGAAGTTGCAAAGTTCTGTTCAGGATCTTA GTTCCTTC

AAGATAATGCCGTGAGCACATTTAGGCAAACTTATGATAAGACAGTTT^

AITAITITCCATTTAATAAGAATAGGCTTATTCTTCATGGATCATGATCTCATCLACTAG AAATATTGA AAAAGCAAAAACTTTAATAGAGGAAGGTGGTGATTGGGATA

>>AAGGTGGTGAITGGGATAGGAGAAATCGCTTGAAAGTATATCAGGGTGCTTA CTGTATGGCAGTAA

GAGATTTTAAGACTGCAGCAAACTTGTTTATAGACACAGTCAGTACTTTCACATCTT ATC

GAITATAAAGCATTTGTCCGCTACACAGTTTATACATCTATCAITAGTCITCCAAGG AACCA^

AGATAAGGTTGTTAAAGGGTCAGAAATTCTGGAGGTTCTTCATTCTGAACCATTTGT TAAGGATTATT

TATTITCACTGTACAATTGCCAGTATGCAGAAITCTTCTCAAATTTAGCGGAAGTAG AAACCACTCTC

AGAAAAGACTACTTCATGAATCCTCATTATCGCTATTATGTTCGAGAAATGAAGATT TTGGCCTACAC

ACAGTTACTAGAATCATATAGATCTCTCACCCTACAGTACATGGCTGAAGCTTTTGG TC

AATACATTGATCATACTGATAATTACGAGAAATTAAATCAATTTTATGGGATCCTAC TGGTCCAACTT

CACTGTAAGGCAATAGAGITGTCAACATTCATTGCTGCGGGTCGACTACATTGCAAA ATTGATAGAGT

TGGAGGAATTG1X¾3AAACCAACCGTCCAGATCTAAAAAA1X3CACAA1TCAATTC TCTTGTTAAACAGG

GAGATTTGCTTTTGAATCGAGTGCAAAAGCTGTCTCGTGTCATTAATATT

LDEC010190-RA,FBgn0037351,RpL13A

>>ATGACTGGGTTCAGTGAAAAGGCCATTCTCATCGATGGCAGGGGCCATTTGT TGGGCCGCCTTGCT GCTATCGTTGCAAAAACACITCTGCAGGGCAACAAAGTGACTGTAGTTAGGTGCGAACAA ATGAACAT ATCAGGAAATTTCTACAGAAATAAACTCAAATTCCTATCATTTCTTCGCAAGCGTTGCAA TGTCAATC CAGCCCGTGGTCCATTCC

>>CCGTGGTCCATTCCACTTCAGAGCACCATCCAGAGTTTTCTGGAAAACTGTG AGAGGAATGTTACC CCACAAAACTGAGAGAGGAAAACAGGCTCTTCGTAAATTGAAAGCATACGAAGGAATTCC ACCACCTT ATGATCGTAGGAAACGTGTTGTAGTTCCTGGTGCTCTGAGAATTATTTGTCTTAAACCAG GACGTAAG TTCTGTCACGTAGGAAGATTGTCCCATGAAGTTGGAIXMAAGTACCAATCTCTTGTACGC ACTTTGGA AACTAAACGTAAAGTTAAGGCAGTGTTGTCCATTCGTAAACGTGACAAGCTGAAGAAAAT CACTAAAG CTGCITCTGAAAAAGTCGCGAAGCAGACAAAACCTTTCACAGATGTTATTAATTCTTACG GTTATAAC LDEC017098-RA,FBgn0011211,blw

>>ITCCAACAAATGTCATTTCTATCACCGACGGAGAAATCTTCTTGGAAACAGA GCT

GTATCCGCCCAGCTATCAACGTAGGTCTCTCTGTGTCAAGAGTCGCCGGTTCCATGAAGC TAGAATTG

GCTCAGTACCGTGAGGTAGCCGCATTTGCCGAAITTGGTTCTGATCITGATGCAGCT ACTCAACAAC^

GTTGAATCGAGGAGTTCGTTTGACTGAACTGTTGAAACAAGGACAGTATGTGCCCAT GGCAATTGAGG

AACAAGTGGCTATTATCTACTGCGGTGTAAGGGGACACCTGGATAAAATCGACCCAT CTAAAATTACT

GTTTTTGAAAAACAGTTCTCAGAACACATCAAGAGCAGCCACCAGAATATTTTGCAA AGTATTGCCAA

AGAGGGTAAAAITACAGAAGAGACAGATGCCCAACTCAAAAAA

TTGCTGGA

LDEC017401-RA r FBgn0000319,Chc

>>TTGTGTGTTTTGTTGCAAAAATACAGCAACATGACGCAGCAGTTGCTTCCTA TAAAGTTCCAGGAA

CACTTACAGCTCACCAATGITGGTATCAACGCTGCCAACATCACATTTGCCACTCTC ACC^

TGACAAGTTCATCTGCGTGAGAGAAAAGGTTGGTGAAATATCCCAGGTGGTCATCAT CGACATGGCTG

ATACGTCCAATCCGATCCGTAGGCCTATCACCGCAGAGAGCGCAATTATGAATCCTG CTTCAAAAGTC

AITGCTCTCAAAGGTATCGGTAAGGCAGGTGTGGAAACACAAAAAACACTCCAAATT TTCAACATAGA

AATGAAATCCAAAATGAAAGCACACACAATGTCCGAAGATGTTATTTTCTGGAAATG GATCAGCCCTA

ACACITTGGCTTTAGTCACTCAAACATCCGTATACCACTGGTCCATGGAAGGAGATT CGACTCa-CAA AAAATGTTTGATAGACATTCCTCTITGAACGGTTGTCAAATC

AAACTGGCTACTTTTGGTTGGTATCAGTGCTCAACAATCTCGAGTCGTGGGAGCTAT GCAGTTGTACT

CTGTGGAAAGAAAATGCTCCCAACCAATAGAAGGGCATGCCGCCTCTTTTGCCACCT TTAAAATGGAG

GGTAATCCCGAACCATCGACTCTCTTCTGTTTCGCAGTGAGGACTCTGCAGGGTGGA AAGCTGCATAT

TATCGAGGTTGGTCAAAGTCCTGCTGGTAACCAACCATTTCCCAAAAAGACCGTTGA TGTATTTTTCC

CTCCGGAAGCACAAAACGACTTCCCAGTGGCTATGCAAGTTTCCGCCAAATACGATG TCATCTATCTG

ATAACCAAGTACGGATACATCCATATGTATGATATTGAGAGTGCCACATGCATATAC ATGAATCGAAT

ATCGAGCGAAACCATCTTTGTTACTGCCCCACATCAAGTATCTGGTGGTATTATTGG TGTTAATAGAA

GAGGTCIAAGTCTTGTCAGTTTCCGTAGACGAAGAGAGCATAATTAGATATGTCAAT ACAATTCTTCAT

AATCCGGAITTGGCGCTACGTATGGCCATCCGTAGCAACTTAGCAGGTGCAGAAGAA CTATTTGTCAG

CAAATTCCAGATGCTTTTCCAAAATGGACAGTATGCTGAAGCAGCGAAAGTTGCTGC CAACGCACCAA

AAGGTATCTTGAGGACTCCTGCTACAATCCAAATGTTCCAACAAGTGCCAACTCAAG CTGGGCAGAAT

AGTCCACTTCTTCAGTACTTCGGTATACTTTTAGACCAGGGAAAGCTGAATCGATAC GAGTCTTTGGA

AITGTGCAAACCGGTTTTGTTGCAAGGACGAAAACAGTTATTGGAGAAGTGGTTGAA AGA^

TGGAATGTTCTGAAGAATTAGGAGATCTTGTCAAACAAGCTGATCCTACTCTCGCTC TATCTGTCTAT

CTTAGGGCCAACGTACGAGCCAAGGTAATTGAAAGTTTTGCTGAAACTGGAGA

CCTCTA

>>TCAAAAGATTGTCCTCTACGCCAAGAAAGTATCTTATACTCCTGACTACATA TTCTTGCTTCGCCA AGTTATGCGTACGAATCCTGATCAAGGAGCAGCTTTTGCTGGTATGCTGGTTGCTGACGA AGAGCCAT TAGCCGATATCAACCAGAITGTAGATATTTTCAIX-GAGCAGAACATGGTTCA

TTGTTGGACGCTCTGAAGAATAACAGGCCCACCGAGGGACATTTGCAGACAAGGTTATTG GAAATGAA

AATACTCTCAATACGACCAACACTTCAGATAGTATGCATAGTTTTAGTTCAGATAGTGAT GATTGTTT

ACACCCTATGAGCTCATCGACGCCAAACAGAAGACATAGATCAAAAATGGTACCATC AAAGAGCATGA

GTAATGTTAAACAGAATATTTTGGACATAAGTACGAGGTCAGAGAGAACTAGACCAA AGCAGTTAAAC

TTCGATCCAAATATGTTGCACTCAAAITTAGAATCGAGTTTATCGAAAAGCCTGAGT AATATCAAATC

ATTCACAGACGTAGATTATCCTTCGGCTACGTATCTTAAACCTATGGATCTCTTAAG ACCTCCAGAGA

GTGTTGACAACTTCAAAATACCGGATGTCCATCCTCAGTCCAGCTCCAAAGATCTCG CAAGCGGAATA

CTTCAGGTTTATGCTGCCTACGAAACAGGCCTGGCCACTGGTACCAGCCTGAAGCTG CACGTCACTCC

AAGAACTACAGCACGCGAGGTTGTTGATCTCGITGTGAAACAGCTCAACATGGCTGT GGTACTAAAAG

GAAAAGAAGGTCCTATTTATAACATTGATAAACTCAAAAACTTCTGTTTAGTCGCTG TAATTGGTGCT

AGAGAACG1TGCTTAAGAGATGATTTCAAACCT1TGCAACTCCAAAATCCCTGGAAG AAAGGGAGGCT

CTATGTTAGACAGAAACATGATGTTCTAGCTGCTCTCGAGCATAGTAGCAAACACAG CACAATTATT

LDEC020505 -RA, FBgn0259162 , RunxB

>>ATGCACTTGGCAAGTGAAGTGTCATCCACCACAGGTCACTACGACCGTACTT ATGGCAACTTGACA

GCCGAAATGCTCGCAGAGAGGACCATCGATGGGCTCCTTGCGGAACATCCTGGTGAA CTGGTGAGGAC

CGGGTCGCCTCATGTAGTTTGTACTGTTTTGCCTCCCCACTGGAGGTCCAACAAGAC GTTACCTGTAG

CCTTCAAGGTGGTCGCTTTGGGGGATGTTGGGGATGGGACGGTGGTGACTGTGAAGG CGGGGAACGAT

GAGAACTTTTGTCCGGAGITGAGGAACTGTACCGCTGTTATCAAGAATCAGGTGGCG AAGTTTAATGA

TTTGAGGTTCGTTGGGAGGAGCGGAAGAGTCAGATGGTGGAAACAACCCATCGCT

LDEC021145 -RA, FBgn0036827 , CG6843

>>AAGAAAGGGAGAGAGAGGATAATGAGCCAGAGTATAAGTTTGAATGGCAGAG AAAATACAATGCAC CTCGTCAAAGTTACTGCAAAGGTGATCAAGAAAITCGTGATCAGCCCITTGGAATTCAAG TCAGGAAT GTTCGCTGTATCAAGTGTCACAAATGGGGACATATTAATACTGATAAGGAATGCCCTATG TACAGCTT GTCTATGAGTGCTGCAAGATCTTTGGAAAATGCTACAGTCCTCGACCAGAATTCTTTAGT TCAGCAAA TGCTTGATGATGGTTTAGCTTTAAAAAAACAGCATATCAATACAACCGAAGCTAATAAAC ACCTGCTA GTGAATCAAGATCTAGAAGAAAATTCAGAAGTGGCTTTTATAAAATCITTAACAAAAAAA CAAAAGAG

A

>>ACAAAAAAACAAAAGAGAGCATTATTGAGAAAACTGGAAAAGCTAGAGAATA ATTTAAATTCTAAT

TCAAAAAATAATGATGAGTATAGTGACAGGGAATTATCCTCGGATGAAGACACCCGA AAGAAACCTAG

GTCTAGAACTCATATGAAAACAGAAGACCGGTATAAGAATGAAAAAAAAAGAAGTAA GAGTAAAGAGA

GGAAGAGGAAAAGAAG

LDEC006373 -RA r FBgn0053547 , Rim

>>ATGTTAGATATACGTCAACTGTATTTCCTAAAGGTTACCATTTATCAACACT TTAGAAAATATGAG

CTCCTAGCCATAGAACACCACCACAACACTAGGAGGAAAGCCGATGAGGTCCAAATA TTGGAGGAGAC

GATACGAGCCCGAAACGAAGAACAGAAAAAGGCCGGGGTGGAGCTGGACGCTACATG TCACATTTGTC

TCAAGACCAAGTTCGCAGATGGCGTCGGACATATTTGTAACTATTGTTCCATAAGGT GCTGCGCCAGA

TGTGGTGGAAAAGTTACACTCAGATCTAATAAGGTAATTTGGATATGCATCCTTTGC CGAAAAAAGCA

GGAGCTCTTGAGTAAAACGGGTCAATGGATGTTAGGTGGGCCAAACCCAGAAACGGA CCTTCCACAAA

TCCAGCAAGCGCCCTCGGACAAACGACCGAAACTAGAACGAGCGCACTCTGCCGCCG AAAAGGAAAAT

CTACCGTTGCAAAGGTCGGGTAGTGTTTTGCGTAGACAATATTCAGAGCAAGAACCT AGAGCCCCTTC

TTGCGAAAGGTATCAACAGTATAATGAGGAAGATCCCAGGTTITACCAAGGAGAACT AGAGGGCCTTA

TGAGAACGCATCCGCATTTGGTTCCAAGAAGGTTTCCGAGGAAGACCAGTCTTGAT

LDEC002041 -RA, FBgn0052296 , Mrtf

>>TTGGACCGCGACTTGGTGGACACCATCTCCTCGATATACCCCGAGTGGTTCA GGAACAACATGGCG GAGGGAGGAGGCCCTCCTTCCAGCCCCCGGACTTCCCCTCCGAAAGCGGTCGTCGACACA TCGCCCAT CATGATCGACCAAAACAAAGAATCCCTGAAGGTGAAGTTGCTGCTGCGTCGGCCGTTCGA CCAGCTGG TCGCCCAAGGAATCATGCCCCCACACAAGACACCCGCCGCCTTTCATGGCCAGCGCCGTC AACTGGAA CGGGCGAAGA

»TGGAACGGGCGAAGACCGGCGACATGCTAAAAGCGAAAATCCAGCAGCGCCCGCCTCG GCAAGAGC TCGAACGGCGCCATATCCTCGAAATCGACCCTAGTCACGTGGACCCGAGCATAGCCGAGC GGCAACGC ATGCTCAAGAAGGCCAAACIXMCCGATCAGCTCAACGACCAGCTTTCGCATCGGCCCGGC CCGCTCGA ACTCATCCAGAAGAATATTCTACATACCGAGGAGCCCATCGAGGAGGCGGTCAAGACCGG CCGAATCC CGTACAAGGCGACCTGCGAGGGCCAGCTCCACAGGCCACAGCTGCCCTCAAACTACGTCA ACCCCGAG GAGGACTCGCAGAGCTCCGAAGGTGACACCCGCGTCAGCCCGAGTCCGACAGATGTGCTG GAGACAGC GGCCAAATCGGCAGGTATAGTAGTCTCCTTGATACAACCGACGGAAGGGACGTTTGTCGT AACGACAG CAACCGCGCCCAAAGACAATACCGAAATCGTGTTCGCGGACCTTTGCAGATCCGTCGCCG CGCCCCTG ATCTCGGCGACAAGCCCCGCCTCTCTCTGCACTTCCTCTACATCCTCCCTGAGTCCCCTC TCGTCCGT CGCTAGTCCGGTGCCTTCGATCGTATCCCAACCGGCGACGCCGGCGCCCCCTCCACCGCC CCCACCTA TCTCCCTCATAACCAGAACCCTGCCCTCGCCCGCCAAGAGCGAATCCTCCGGCAAGGATA AAAGCAGG AAGAAATCCAAGCTGAAGTCCGTCCCGAAGACACGCACCATCAAATTCCACGAGTACAAA GGCCCGCC AAGCGCCCACAAGACTTCCGCTTCCAGCTTGAACCCCGAAGAGAGCTCGTACGACCTGCT GCTGAAAC AGCAGACGCTGCTGCTGCAGTTCCAG

>>GCTCGAAGCCGCAGCTGATAGAGAGACTGAAACCGTTCGCGGCGGGTGACGI TGTCAACCAAAACC CCGCCTCTATAGACTCTTCTGCACACAGCAATGCCAGCGTGGATCAGTCGCATAACTCGC CTGTCTAC CAGGACATAGACTCGCCCTATGACACCACCAAGGACGAACAAACCGAGCACATGGAACTC GACCCGAC GAGCCCTTCGCCTCAGCAGATTCACGAGCAATTCGTTCAGAACCAAGAGCAGAAAGCCAA GGAGGACA TCGTACGCGAGCAGCAGAGACAGATCGAGGTGCTCCAGAGAGAGTTAACTCTGTCACAGT TGAAACTG CAGGCCGCGACGAGGTCCGAGCCGAAGGCGCAGATGATCGCACTGCAGAAGCACCTGCAG GCCCGGCA ACAGCAGCAACAGCA

>>AGCAGCAGCAGCAGAACTTCGCTCTGCAAATGAAGCAGCTGCAGGCGCTGCA AGCGAGGO^GCAC TCGTGAACGAAGAGCAGCAAAGGATACAGCAGCAGATCTCGTTGCAAAACCAGAAGAATA TCGCCGGC GGATTGATTTTGAATAGCGCTGACGCGGCTCTCGTCTTCAACCAGTTGATGCAGCAGGGC AAGGCGAA AATTCTCAACGGGCACGGCAGGAGCCAGTCGTCGCCAAATTTCCTCAATTCGATAGTAAC CCCACTGA TTACCGCCCCAGATGTCAAAGCGGACTACATAGAGGATCACAAGCCGACTCCCGAGATCA AAATCGAG TTCCGGGATCAGATGAAGCCGCCCCCGCCACAGTACAACGAAGCCACCAAGCAGATGAAT AAGAAGAA CCACATCAAGAGTCAAATCGTCGACGACGTCTTGGAGATTTTAATAAAGAACGGTGAACT GCCCCCGA GTGCTGCCAATGATCCCCTGACGCCAAACTCGGCAGGTACCAAGTCCACCGAACCTATCT ATCCTTCT TCTCCGCCTAGCGACAACCACAATAACCGCATCGAAACCCACGTCGACATCAACGATGCT CTGGACAA CATCCACGCAAGTCACAACAACGAATCGATGGAGGAGCCTGACAGCTCGGAAACCGCTCT GGAGATAG ACCCGACTGACCTGCTCGAAACGTTGGATAATCTCGATAACATGGACTTCTCGCAGCTGG TCATGGAG CTCGGCGGTTGCCACACCCCCGTCGATAACAACAACTACCATGGGGAACCGATGATGGAC GACGATAT GGCTATGGACACCGACGACTGGCTGGAATCGCTGCTCCCCAGCGAGAGCTCCGAGTATAA CGGCAACA ACGGCGTTTCCACCACCACCGCGCCGTTAGCTGTCCCTGAGAGCGATCTAAGCGGATACG ATCCTTTG TTAGGCATCGCGCACGACCCCTACGATCCTTTCAATCTGGAAGACTTCCGATCTGCGTCT GATCTGAC GGCCGCGCTCTCCTGGGACAAGGTTGACTACGCCACG

LDEC003403 -RA, FBgn0266579 , tau

>>TGAACAAAAITCAAGTGGGGTCGGCTCCTTCACCAAATCTGAAGGTAGTGAA ATCTAAAATCGGTT

CTCTGGAAAACGCTAGTTATAAACCTGGAGGAGGGAAAGTGAAAATCGAAAGTAAGA AGTTGGACTTC

AAGTCTGCTGCGCCCAGGATAGAAGCTAAGAATGAAAAATATACCCCGAAAGGTGGA GAAAAGAAGAT

AGTACAGCAAAAATTGCAATGGAGCGCAAAATCGAAAATAGGCTCGTTGGAAAACAC AACTCATAAAC

CGAAAGGCGGAGACAAAAAAATCGAAACTGTGAAACTAGAITTCAAGGGGAAAGCGA AGCCAAAAGTA

GGGTCGAAAGACAATATCAAACACGTTCCAGGAGGGGGAGATATTAAGATAATTGAT TTTCCTTGCTG

TTCTCATAATATCAGAGGTGTTACTTATATTGCTGACTATCTCATTTTTACAATTCT ACA^

CC

LDEC004541 -RA, FBgn0010355 , Taf 1

»ATGCCTCTGATGGGGCATATCAAGAAAAAAGCGAAGGAAAGAGAAGCTGAGAAAAAAG CTTTCGGA GGTCTCGATGTGTTCTCTATGAGGACTCCTGAAGACTTGACTGGTCGAGAIX-GTGAAIT GATTTTGCT AGAATTTTGTGAGGAATATCCCCCATTAATGAATCAAGTTGGAATGTGTTCCATAATGAA AAACTATT ATAAGAGGAA

»AAACTATTATAAGAGGAAAGCTGGGAAAGACTCTGGTCCTCCTACATATAGATACGGA GAGACTGT CTATGCTCGTACTTCTCCGTTTTTAGGTGTATTGCTCCCGGGTCAGTCCATCCAAGCTAT AGAAAACA ACATGTATCGGGCTCCAGTTTATGAACATAATATTCCAGAATCTCATTTCATAGTCATAA GAACTCGA CGGCAGTATTATATTCGGGAAATGGATTCGATATATCTTGCTGGCCAGCAATGCCCTTTG TATGAAGT GCCAGCGCCAAACTCCAAAAGGGCAAATGATTTTGTTAGGGACTTT^

TATTCTGGAGAAGCAAAGATAACCCTAGAAAAATAAAAATGGACGATATTAAAAGAGCCT TTCCCTAT TAITCCGAGAACAGCATTAGGAAAAGATTGAAGCTTTCTGCTGACTTCAAAAGGACAGGC TTGGATTC GAAATGGTGGGTTATCAAATCAGAATTCAGACTACCAACCGAAGAAGAAATTAGAGCTAT GGTATCTC CTGAACGTTGTTGTGCATACTTTAGTATGATAGCTGCAAAGCAAC

>>TGATAGCTGCAAAGCAACGTTTGAAGGATGCTGGCTATGCCGAAAAATTCAC TCCCGCGGAAGATG ATCATGAAGAAATACAATTGAAAATGGAAGATGAAGITAAAGITGCACCTT∞AACACT ACTCGAGCA TATATTCAGGCTGTGAAGGGCAAGTGTCTCCTTCAGTTGACTGGACCTGCTGATCCTACA GGTTGTGG GGAGGGTTTCAGCTATGTCAGAATCTCCAATAAGCCAACTCAGAATAAAGAACATGAATC TCAACCAA AAAGGGCTGTAACTGGAACCGATTCAGATTTAAGAAAGTTGTCTCTAAACAACGCCAAAG CCTTGTTG AGAAATTTTGGAGTTTC

>>AGAAATTTTGGAGTTTCAGAAGAAGATATTAAAGAGCTCACACGTTGGGAAA TTGTTGATGTGGTG AGAACACTTTCTACAGAAAAAGCTAAAGCTGGGGGAGAGGGAATGGACAAATTTTCCAGA TGTAAGAG ACTTTCTATAGCTGAAAATCAAGAAAGGTACAAAAAAGAATGTCAATGCATATITGACTT GCAAAATC GAGTTTTAGCAAGTGCTGACGTACTGAGTACTGACGAGGAAGAGAGTTCGGAGGATGGAA GTGATGAA GATATCGAGGAAATGGGCAAAATTATTGAAAATATGTTAAATAACAAGAAGACAAGCACG CACCTTAC GCTAGAGCGAGAAGAGCTAGAAAGACAAAAATTGATAAAAATGATGGAGGGCGCTAAAGA TAGACCAG AAGATAAGAAGAAATGTACAGAAGTAAATGATGGCCAACGTTACCCGCAAGGCCGAGTAT TGAGAATA GITCGTACACTCAAAACCCGTGAAGGCGAGGAGTACCATAGACAAGAAATCGTTCGAAAC CAAGCTGT GATAGACGCTTACGTTAAAATCCGTAAGTCAAAAGATGAAGCTTTCATCCGACAATTTTC TTCTTCAA ATGAAGCTGAAAAAGAGGAATTGAAGAAAGAAAAACGTAGGATTCAAGATAAAITAAGAA GGATTAAG AAAATTCAAGAAAAGAAGGGAACGGCTGGTGGTGATGTGCAGACTACACCAATTGTTAGT TTACCGTC TGCAAACTCTGCTCGTGTCACACCTACGTCGAGCAAAAGTACAACTCCCTCGCTCCCCAA GTCATCAA GGAAGACTAAACACATGACTGACTCAAAATGTGGGTTAACAGGCATGAGTACTGCTATAA ATGTTGCT ATGACAGATAATCAAGAGAGATGTATTGCAAATCAACTCAACACTGGTGATGAAGAGATA AAACATGA AGGTTCAATGCTAAAAGTGCCTAGAAACGATCTGTGCAATAAGAAGAGACCGCGGGAAAT CTCTGATT CACACTGTGAGGGATTGGCGAAAAGGAGACGAACTGTTCCAGTTGTTCGGTTGTCCGATC TGCCTTTA CGAGCAGTTGAAGAATCACATCATGAAACCGCAATGAAGTTATATG^

TGACGATGAAGTTTCCAATACTCCTCAAGAGCCTATGCAGGAAGATTATGATGCAGACGA TCTTTGGT TT

LDEC009758 -RA, FBgn0267337 , rn

>>AGCACATGCAGAAACACGCCGAGAGAACGGACAAAAGGCCGCCTATAGGGCC TGGGCTAGGGCTGA ACCACCGCGGTCTGGACCACCCCTACTGGCCCAAAGTGAGCCCAGATAGCGCAGAGAACA TGCACGAC TACCCCAACGATATTCCCCGTCAGAITTTGGAGCAGAACGAAGACTTGGTCATCATCAGG CAGCAGCT TGGTCAGAATCCTCCCGCCCCTCCTGGTACACCCAACACGAACCTGGGAAATTCCTACGA CACGTCAA TTTCGAAATCAAACACTAACTCAGCATTCACTCCGATCAATTCCATGTCGGGTCACTTGA ACCTCAAC CATCATCAACTGGCCCCAAACAGACCTTACATATACGATGCTITGAGTTTCCAGAAACAG AATAGTTT GGATATACCGAAGTCGCAGCCTTCTAACGGATTCCCTAACCAGCTGATCAGCTTGCATCA GATAAGGA ACTATCCTCACCAGCCAAACCCTACATCCTTGAIXMAGCAITCTATCITAGGGTTAGGTA AAGATAAG LDEC003177 -RA, FBgn0004652 , f ru

>>ATGGATCAACAGTTTTGTCTGCGCTGGAACAACCATCCGACAAACCTGACGG ACGTGTTGAGTAGC CTCCTGCGCAGAGAAGCCCTATGCGACGTAACTTTAGCCTGTAACGGCGAAACGTTCAAA GCTCACCA AACCATACTCTCGGCGTGTAGTCCATATTTCGAAACAATTTTTATACAGAATGCTCATCC TCACCCCA TAGTTTTTCTCAAAGATGTCAATTACAACGAAATGAAAGC^

GTCAATGTTTCTCAGAATTTACTACCGATGTTCCTAAAAACTGCGGAGGCCCTGCAGATT AGGGGGCT CACCGATAACAATTCTCTGAGTAAAAATGAAGAATTATCAGAAGTGCCAAGAAGAGACAG GGATAGAT TAGTTGAAAGAGACAGCCCTCCAAGTGAAAAACGAAAAAGAAAATCA

>>AAACGAAAAAGAAAATCATCTTCGAACTGTGATATGACATCAAACTCAAACT CTGAAAGATTTAAC GACTCTCAGGCCACTCAAAAGTTAAACACTAGCGTACCAAAGTTGAATCCCATATCGCCG GTCGATAG GGAAAATAGTTCGGGTGCGGAGGATATGCGTGTATCCTCTCCTGTAATAAAGCAAGAGCC GATGCACG ACTCCAGCCCGCTTATAGAITCCTTCCATTGAATC^

AGAGATGGGGACGTAGAAACTCTACCAGCGGCTCGGTTACCACAGCATTCAGCTTTGCGT CAGTACCT AACAGCGCCACCTTTGAGTCAATCGCCGAAGGACTTCACGTACTCGAACACTATCGGGGA TGTTTCTG TAAAGCTCGTAGACAATGCTTTCGCTAGAAGTCACCAAGAGGACGTAGATTACAACTACA ATACGACT TTGACGACGCTGCAGCCCGITAATCTGGCAAACTTGCCTTCTGTGTATCCTAGAGCGCCC GTTCCGGG GCCTGCAGAGTTGAACGTGCCTGTCGTGACGTCTCAGGAGTGCTCCGTGATTCAGTCTTC CCAGGGCG GAAGCCCCAAGCCAATCCCAGCTCGGCCTAACGTAGGAAGAAAG

TTGGGGTCGTATATCTGGTTGCAGTACGACGAGGCACAAAACGTCATGTATTGTAAG TACTGCAGAAA GTGGAGCCACGACATGCCGGATATACGTACTTCTTTCGCTGTC

TCGTTAATCACCACGAAAAGTGCAAGGCGCACCGCATGTGCATGGCTAGGGAGTTTC ATTCGGAGACT

AGTCCGAGTGCACAGAGTATCGAGATGAAAATCCAACAGGATCATGGT

LDEC011614 -RA, FBgn0000625 , eyg

>>GCAGCATCAACCGAATCCTTCGAAATAGGGCAGCTGAAAGGGCGGCAGCGGA ATTTGCCCGGGCAG CTGGCTATGGTCTATATCACCACCACCCCTATGCTGCTGCTCGATTCCCTTGGCATTCAC CCCTATGG CCCAATGGACCTTTGCACGGTCTTCAACCTCCCGGAGCTGGCAACCCAACAGTTATGGCC GCCTCCCC AGTATCATCCGGTTCTCCCCACCCCGACCACGGGCTCATGAGCTCACCCCCCGGTCTGGA CAAGGACG ATTCCAGTCTAGACAGCTCAGAACAGCCAAAGTTCAGAAGAAATAGGACAACATTCAGTC CTGATCAG CTTGAAGAATTGGAAAAGGAGTTCGAGAAAAGTCACTATCCCTGCGITTCCACTAGAGAG AGGCTTGC TTCCAAAACGTCACTTTCGGAAGCGAGGGTTCAGGTTTGGTTTTCCAACA

>>GGTTTTCCAACAGACGGGCGAAATGGAGGCGGCACCAACGCATGAACCTACT GAAGCGGTCATCTC CGGGCCCGCAGGGCAGCGGCCAGTCTTCGATGTTCGGCGGCCGCTTGACCCCCTCGCCAC ACTACAAG GGCGGCTCCACCCCTGGCTCGCCGCITACTACGCATCTCACCTCCCACCCCGCGGCTTCG TCCCTTTT GTTGGGGATGGGCGGCGAAAATAGCGCCTTCAAGGCTCTGGTGCCTGGAGGGCTGATGAA TTCCCAGG AGAGTCTCAGGCGG

LDEC012245 -RA, FBgn0026380 , Prosbeta3

»ATGTCAATCCTAGCCTACAACGGTGGAGCCATGGTGGCAATGAAAGGCGAAAACTGCG TCTCGATA GCAGCAGATCGCAGATTCGGCATCCAAGCGCAAACAGTGGCAACAAACTTCGAAAAAATA TTCGAAAT GGGCCCTCACTTGTACGTCGGTCTCCCCGGTCTGGCAACCGATACTCAAACCGTCATGGA GAAGCTGC GATTTAGAAAAAACCTGTACGAACTCAAAGAAAACAGGATCATATCCCCTAAAGTGTGTA GCGCAATG CTCTCAAACATGCTGTACGAGAAAAGGTTCGGACCCTTCITCGTGGAGCCCGTCGTGGCC GGGTTGAT GCCAAAGACGTACGAGCCATTCATTTGCAACATGGATCTCATCGGGTGCATCAACCCTCC TAACGATT TCGTCGTGGGGGGCACCGCTTCTGCGCAGCTGTATGGTATGTGCGAGGCGCTCTGGGAGC CCAATCTT AGTCCGGAAGACTTGTTTGAGACGACCTCTCAGGCACTGATCAACGCTTTCGATAGGGAC GCTATTTC TGGATGGGGTGCTACAGTGTATATAATAGAGAAAGACAAGGTCACCAITAAGAATTTGAA GACTCGTA TGGAT LDEC001898-RA,FBgn0037098,Wnk

>>CTGGAAITGGACGATACLAAAAAAGGTTTCTGGAATATTTAGGCATGTTACT TATAGGA

AATGGAACACAAGTTTTGAGAGGATTACATTGTCAGGCTTGCAATCCATCAAAAAATAGA AACACGGG

ACAATCTTGCCCTAAACTTGACTGAGGAGGATTTAATAGTO

CAAGTACGAACAACAAAGGAAGTACACGCAGCCTCCATGGTTGGACTAAATCCCTAA CGAGACACTCG TCTAAATCATCGGGACATAAGAGAACAATTTCCAACGCTTCTACAACCTCTTGTGAGTTG GGGGAGGA GGCTTCCAAGGTGCTCATTGCTCCAGGTGTCTCCTCCCCTGCTATCACATGTTCACAACC TACACCTA TACCTAAAAATAATGCTGAATCCCCACTTCCACCAATCAAAGGTAGCGTCTCCACACCTG AAAAACAA GCTTCCTTTGAAACAATTGATAATATTGAATTTATCGATCAGTCTACACCCACAGATATA AGCACTGT GGCAAAAAAGGGCTATCATACTATTGATACAGATCTAGAGCAAA

GTACTGAGGACGATGTTTTTAGGACATCAGCTAACAAACCTTCAAAAGTCAAGATAC GACCTAAAACC AATGGCAACAAAAAGAAGACTAAGAAAGATAAGGTAAAGCCGATTGTTAATATAGAATTA AGTCCCGA AAGGTCAGAATCAGCAGTGGGAAAAAIXMATAAAAACAAACCTTCAAGAGAAAAGACACC ACCTAATG AAACTATTACTAAAATACGAACTGTAACAACCGACACAGAAACTACAAAAATTGTAACAA CAACTACA AGTTTGAATAGATACACTTTCATGAAAATTATGGATGATGATAATG

>>TTATGGATGATGATAATGCTTTGAAGCCTGACAAAAAGTTCAGAACGCATAG CTGCAGCAGTATTC

CTTATCATAATAITATAGAAAATCTAGCACCCITTAGAAAAAGATITTCTAATGITC AGTTATTTCCA

GATAATGATGAAGAGAGGGATAATGAGAACGATGAAGAAAATGATAGGAAAGTTTAT GATGAAGAAGA

TAAAAAACGTCATGAAGAAAAAATTACTGGAAATGATGTCGAAGACAAGTTGATGCG AGAAGAAATAA

CACCTGTTGTGGAATCAATTCTTGAAACAATTTTCGAAATGGCTGTTGCCCTAATAG AGAAGAATCAA

CTGCAATTTGAAAAAGTAAACAAAAAATCAAG1X3TTCAACTCGAATTGGGTCGTCG AGCATCCGAATA

CAAAAGTCGAATGAGATGTAATACAGGTGATACTCTAACCTCACTTTATATACCTAA AATAATCCAAC

CATCTATAACGGACAATCTCATTGATGCAAGAAACTTTGTGGAAGAATATGAAGAGT ACCACGAATCT

TGTTCAGAGATGCATGATTCAGAGATTGCCATTGGTCIATGTTATCAATGAATTGGG AGCAAGTGTAGA

TCGAATAATAGITGAAAAGCAAAGAAATAAACGGAGGGATAAATCGGTTAAACATGG AGGTGTCACTA

GCTTGATACCAATAGAAACTGACTCTAATGCAGAGGATGACTCGGAAGTTGTTCAGA ATGACAAAAGA

CTGTTGGAAGTTGGGGCAATGTATAATATCCCCAAAAATCTGTTCCAAAGTACTGAA ATGACTGAGAT

TACTGAACAGACTATAGATGAACTACACAGGAATGATGAAAATGCAGAAA

>>ATGATGAAAATCCAGAAAACAATCCTGATTTGGTTGAAC^

CAAAAGAAGGAAAGGTGGAAGACGAGGATGATGTCTATAGGCCAATAGCTGTTAGTCCAG ATGGAAGG

TTTTTCAAGTATGAAGAAGAGATTGGACGAGGTTGAITCAAGACCGTATATAGAGGC CTGGACACT

AAGAGGAGTCGCTGTAGCTTGGTGTGAATTGCAAGAAAAAAAACTCAACAAAGCAGA GCGCCAACGAT

TTAGGGAGGAAGCTGAAATGTTGAAGAAATTGCAACATCCAAATATCGTAAGAITTT ATAAITATTGG

GAATCTCCTGGAGTCAAAAAAAAGAATATTGTACTGGTTAGAGAATTGATGTTGAGT GGCACTTTGAA

AACATATTTGCGACGATTTAAAAAAATAAACCCCAAGGTGTTGAAATCATGGTGTAG A

AAGGTCTGGCTTTTCTGCATTCTAGATCTCCTTCTATCATACACAGGGACTTGA

>>TCATACACAGGGACTTGAAGTGTGATAAGAITTTCATAACTGGAACTACAGG GTCTG

GCGAITTGGGAITAGCCACCCTGAAAAACAGAAGTTTTGCTAAGTCGGTTATTGGTACAC CAGAATTT

ATGGCTCCCGAAATGTACGAAGAACATTATGACGAAAGTGTAGATGTTTATCCCTTT GGTATGTGTAT

GITGGAAATCGC^CAAGTGAATATCCTTATTCAGAATGTACAGGTCCTGCTCAAATI TAC^AGAAAG

TTATATCGGGCGTTAAACCAGCCAGTTATGAGAAAGTGCAGAATCCAGAAGTAAAAG ATGTTATCGAA

AATTGTATTCGGCCTAGAAAGGAAGACAGACCTAAAGTCAAAGATCTCCTGAGTCAT GCTTTCTTTGA

AGAAGATGTTGGACTCAAAGTTGAAGTAGTATCGCAGGAAAACAAAAAAATTGTTTT TCGTTTACGTG

TTATTGATCCTAAAAAAAGAACACACAAGCATAAGGAGAATGAGGCAATACAGTTTG AATTTGATATG

GAAACTGATAGATATAATACAATATCAGAAGAAATGGCAAAATCTGGTATTATCTTT GAAGATGATGC

TAAAACTGTAGCTCAATTATTGAAAACACAGATTACACAGATAAACAAAGAGCGTGA GAAGAAAAATA

AAGAGGAAGAA

>>AAAAATAAAGAGGAAGAAGCTTTGGCTCAGCAGCTCCATTATCAACAGTATT TACAACAGCAGGTT

GAACAACAGATGTCCCAACAGCAACAACAGCAAACGCAGACTACAACAATACCTCAG CAACAAAGTCA

GCAACAGACACAGCAAAATGTGGCTTCTTACCAACAGACTCAGCAAGTCAGTCAACA GCAACAATATT

CCCAGCAGCAGAATTATCAGGGGCAACAAGTTATTCATTCAGAACAGCAAATTCAAT ^

GTGGGTGAGGATCAACAATTTCAACAGGAGCACAATCTAGAGCAAC^

TCAGTATAT

>>GCAGCAGCAACATCAACCACAGTTGAATCAGGAGTCAGCTCCTGirCTTCAA AGGOVAG

TGAACCTGTTCAACAGCAGACCATTATTCTGAATCAGCCTGCACCCACTCATTTCAT TCAGCAGAATT

AITTAGGTGATGGCCATCCTGAACAAGCTGAATATTTC

ATTTCTAGTATATCTCAACCTGAATTGCTTCATGCTACTCCTCCTGTTCATGAACAT AGATTAAGTGT TGATGGTCAGATGGATTCAGGACAGAAAGGCATGGTTCCTGAAOVGAAAGGGCTAGGAAA CITTCaAC AATCTACTTTTCAGCAACAGCAACCCACCTATGCTCAAGTTGCTCAACATCAACCACAAA ACTATCAA CACCAAACACAAAGTTATCAGCAACCAGATCCAC-^

TTO-AACTATCAATCTCAACAGAGCTATCAATCCCAGGATAGTC^GACTTATCAGCAACC AAATTACC AACAGCAGCAAAGTTACCAGCCTAGTCAACAGCAAGAACCCATO

CATCAGCCACAAGATATGAATCCACCTTATGGAACTCAGCAACAAAGCTATCCCCAA CCAAGTGCCCA ACCAGCTCCCCAGTCTTATCAGCAACCATCACAGCAGTCCTTCCAGCAACCTGTTCAACA GCAGCCCT

ATGTGCAAGCAGCTCAGCCAGCACCATATCAGACCCAGCAGAGITATCAACAAACTA ATCAGCAA

ACTGTTTATTCTCCCCCGCAGAACGCTCAGCAACAGAATTACTCTCAGCAACAAAGT AATCAACCATC

TGCTAATTATAACCCCCCACAACAAAGTCAAGTGGCATATGCACCTCAACCTGGACA ACAACAAATGA

ACTACGAACAACAAATTAGTAGCCAACTTCAATCCAATTTAC

GGACAGCAGCAATATCAACA

>>TATATACAGAAATCAAATATAGATCCTAATCACCAATATTCTCAGTCAAATG TTGATTGCAGTCAG CAGTATCTTCAGCAAAGTGITGATCCTCCTC^CAAT

AAACTATATACATCCACAGCTGGTAGAACCAGTTCAACAAATATATCAACAGATAACTCC TCATCAAA

CACAGACTATTCAAGCAACAGGATATACAGAACAAGITTTACAGCAATCTCAGCAGC AAGTTA

CCTGAAACAGACATTGAACCAGTGGGTAATCGATTGTCTAATATCGAAATACCACCA ATGAATTTAGC

CGAGITACAGCAGAAACTTGCTCAACAGCATTTACAACCAGCAAAAGACCAACACAG AGCITC

CTTCAITACCCCCAGCAACGAATTTCGATGTCCAACAGAITGATCATAGGAGATTGT CAACTGTATCC

CAACCAGCTTCGTCCCATGATTATATACAGTGCACTATTCAGCAAATTGCTGAGCLA GCAAAATCAAG

GTATCAGGCTCAGAAACACGTTGGTCAGGTAACAATGCCACAACATGAATCTCTTCC TCTAACTCCCG

AAAATCTTGATTTAATTCCATCTCAAGTACCTTTGGAGTCTATTTTATCTTCCCAAT GTGTGACCTCT

AATGTAGGTCAGGAAGCTGTACCTCTAGATGACATTTCAACATCAGAACAAGTAAGT TTGGAAATATC

ATCATCCTCGTCGACCGACGAGAAACCGAGAAGAAAAAGAGGTTCTCTCAAGTATCA ATTAATAGTAG

ATAAAGTTCATCCCGATGGTATAGTAGAGTGCCAACTACTTTGCAAACAGAAACAGA ITAGTTTTAAG

TTTAACAGGTCAGGCACAAAGCCATCGGATATTATAGATGGAATGATCAAGCAAGAG TGTCTAGATGA

ACCTCATAAGCAATTGAGAGATCATCTACAAGAAGTGATAGATAAATTGAATGTAAA TCCTGATAGGA

TTCCGGAAAGTGCAAGAGCTAAGCCTTGGGCTTATGTTCAAAAGAGAGATGACTCTA GTGGCCAAACA

TTCATCAAATCCAACTACATAGACCCATCTCCAATTCAAGATGAATTTCAAGGAATC AAAACAACACT

TGCAGAAAACATTTACCAGAATTTACATCGCCGAGAAAGTCTGAATTCTAGCGGTAC TGTTTCACGCA

AAACAAGCACCGCCTCAGAATACACCCCTGAACATACACTTATAGTGAATAGATCTG CTGGCCATTCT

GAGCAGACGATTGTCAGTTACGCAACTGAAAGTTCTATATGATCACCAGGAGATCCT CAACCTGTTCC

CGAGAACTCTGTAGAGGTTCGAGAAAGTCCTCAAAAAAAATCACTTCAGGATAATTC TGATTGCA

ATGCAATGAAAACTGAGTTTAATTATAGTTTATTGCAGAAAGATGTAGGTAAACTAT TTCCTGGTCAG

AAAGITAACTTGAAGGTTTTTGTAATGTCTGTTGATCAGAAAGATGAAGTTATTGAT AATGAACCTGC

TTCAAAAACTGAAGAGCCTAATGAGAGAGTAATAAAAGTAAAACTTGAAGATGGAGT CAATAATGACA

GTATTAAGACCAATAATAGTGAACCTITGACCGACAAATCATCAGAAACTGCTTTGA AAGTTCCACAA

AGGAAAATATCAAGGTTTTTAGTGAGTCCAGTATTGTCAGGGCAATTGGAGATGCCT AAAGACAAAGA

TTTCAATGTTGAAGGTTATCAACAGCAACTGTCGTCATTAGAGAATCTGACTGATTC AGGTCCTACTG

AAAATTCTGTTGAAAATAAAACAGTGCTATCCACTATTATTAATGATGCAGTTTCGT CAGAGCTTCCA

AGAAAGATATCAGCCCCTCTTGAAGCCACGAGACATACTTTAGAATTAGAAAATAGA ACTGTAGAGCA

AAAAGTTAGTGTGTCTTCGATGAAAGAGGAGAGTACTAAAGAAGAACCTGCTCAAGT TTGCGGACCTG

AACTCATCAACACATTAGAACAGCTTAAAATCAGTTTGGATAATTTGAAACAC^

AAAGATTCTGGTGAAATGGATTCAAAAAAAGTAACATCCACAAGCGATTTGACAACAGCA AAGGGAGC

ATCTAC^GTGCCACCTCAAC^GCCAGTAGCCCAGCAGCCAGGATCTCAATTCATAGC TCCATCAACAA

TTTCAAGTGTTACTCAGCAGGCGACCTCAGTTCAGCAGATTATTCAACCTACTCAGC AGACAGTACCC

CAGCAAACAGTACCCCAGCAAACTGTATCTCAGTCTCACTCGACTTTACCACAGTCT CAACCTGTTTT

ACCACAATCCCAGTCTTCTATACCTCAACCAAAATTATTACCACAATCTATGCCTCA GACTCAGAATA

CTTTTCCGCAATCTCAGCCTGTTTTATCTCAAATACAACCTTCTTTACTTCAGCAAC AACCTATTATG

CCTCAGTCCCAACCTGTCATTCCCCAGTCCCAGCCTGTTATGCCTCAGTCACAGCCT GTTATGCCTCA

GTCTCAACCAGTTATGCCTCAGTCGCAGCCTGTTATGAATCAGTCGCAGCCTGTTAT GAATCAGTCGC

AGCCTCTTATGAATCAGTCGCAGCCTGTTATGAATCAGTCGCAGCCTGTTATGAATC AGTCGCAGCCT

GTCAGTCGCAGCCTGTTA

LDEC006770 -RA, FBgn0261938 , mtRNApol

>>TGAAATGTATTCTTTGTGGTGCGAATGTTTGTACCGATTGTCTTTGGCCAAC CACTTTCGCG

TGTCITTTGGCITCCACATAATATGGATTTCAGGGGGAGAGTTTACCCAATTCCACC ACATCTGAACC

ATCTGGGCTCTGACTTGGCCAGGTCCCTCCTAATTTTTGCCGAAGCGAGGCCACTCG GTCCAGACGGT

CITGATTGGTTGAAAATTCATCTCGTC^TTTGACGGGGTTGAAGAAAAGGGAACCTA TCCGTGAAAG

GCATGTGATCCACGCAAATGACTTTTTGTCTTGCATAAGCTTCATACTATTGAACTA CGCCAACAAGA

ACATCGATTCGATCCTCGAGTCGGCCGACAATCCGTTATCTGGATCACGTTGGTGGC TTAATTCGGAT

GATCCATGGCAAACGCTGGCCTGTTGGATGGAAATCGCCGATGCGGTTCGTTCTCCG GATCCGGAAAA

ATACATGACCCACTTCGCCATCCATCAGGACGGC^GCTGCAACGGTCTTCAACATTA CGCCGCTTTGG

GCAGAGACACGGCCGGCGCTCACAGCGTCAATCTGACGCGTTCGGACACTCCTCAAG ACGTTTACAGC

ACGGTGGTGAACTTGGTCGAGGAACAGAGGGCTGAAGATGCAGAGGATCGAGACGAG CATTCGACTCG

G

LDEC001653 -RA r FBgn0261617 , nej

>>TTGGAATTATGGCCAACAAAGTATGTTCTCTCAAATATGGACATGCTTGATC TGGAAAATGATCTT CCGGACGAGCTCATGTCTTCATCTCCTTGGGGACTTTCCGATAACATGGGCAATACTAAG CCCCCTGC TCAAGGTCCAGGTCCAGGAAGTTTGCAGAACGGCATCGAAAACTCTGACAGTAACAACCT GAGACAGC AAATGCAACTTAGTCACCTGTTGCAGCAGAGTAATAAAGGTTTAGCAGGCAATGCATTAG TGTTGACT AGTCGTCCITTAGGTAGTAAGAGTCCTAATCTTCAGTCTCCTCCTAATGTATCTGTTGCA AAAACTGG CGTAGTAGAAATGAATTTGGGGAGTTTACCTTCAAGTCTGTCTAACAATACAGGGCTTCA GTCCATGG CCAATAATTGGAGTTCTGCTCAAGTTATGAGTTCCATTGAAGGCTCCATTC^

GGAGGAAATATGATTATGACCAGTAGCAACATAAATTCAATGGGAAACATGGCAGGAGGG GGGCTAAT AGTGAGCAGTAGTATAAACAAACCTTTGT

>>GTATAAACAAACCTTTGTCAAATACACCTAACATGTTTTCACCTGGTCATCC TCAACATCCCGGCA ATC^TAACGTCCAGGGGTTACCAAATGGACCAATGTTGAACAGAGTAGGCATGCACATGA ACCAGCAC GCTCCTGGTTCCCTTCACATAGGACCTCGGTTATGCGGAACAAAGTGTAATACACCAAAT ATGCCCGG AAATCCTCCATATGCAACTTATCCCAACTCCGGTGCCCAAGGAGTGCCTGTAGGTGTAGT CACTCCCC AGCAAAAACTGAATATGCAGAACCAGGGTCCAAGGTTTGGAGGGCCACAAACTACTTCTG TTGTAGGA CCLAGGTTGTGGTGGCGATGGTGGTA1TGTGGAGACA

GTCGGGTGCTCCCAGCGGAACTCAGTCAACACCTCAGCAAGCAACGCAGAATCCGGGGAG TCAACCTG

GTGCAGCCCCACCACCATCTACTGCAGACCCTGAAAAGAGAAAGCTTATACAGCAGC AACTAGTTCTT

CTGCTGCATGCTCACAAGTGTCAAAGAAGAGAATCACAGGCCAATGGTGAGGTGTGG TCTTGTACTCT

GCCGCATTGTAAGACGATGAAAAATGTITTGAATCACATGACAAGATGCAATGCTGG AAAAGGTTG

CTGTGGCACATTGTAGCTCGTCCCGTCAGATAATAAGCCATTGGAAGAACTGTATAA GAACGGATTGT

CCTGTTTGTCTTCCTCTCAAACAGGCAGATAAGAATCGCAATAATCCTAATGCGGCT ACAAACCCTCC

TCAAAACAACCAATCTCCTAACCCGTCAGCAACTGATATGCGAAGAGCGTATGATGC TCTTGGAATCC

AATGCCCAACAACAGGTGCAGGTCGACCTCCTGCTGGTCTGATTCGAAACCCTGTTC CGTCAAGGCGA

GCTTTAAGGTTACCTCTGAATCCTGGACAAAATATACCTAGTTTAGGTAATATGAGA TGTTTAGCTCC

ACCCGGCCCAGCTGCTCCCAATGTATCTCTACCTTTGAATAATGATCCCTCTTCCAA CTCGGCTCAAA

TTCAAGGTGTTGATCAGACTGCTGCCAGCTTACGACAAAGCGTAAATAGTCTGATGT TTGGTCTTGCT

AGTGGTGCAGAGGCAGTCAATCAAGGTTTGGTAGGCCAGTTGCCAGGAGGTTT

GACTGCATCTCCTCTAGCIX-CAACTAAGGAGTGGCATCAGTCTGTTACTCCAGATC TCAGAAACCATT TGGTGCATAAGTTGGTGCAGGCTATATTTCCTACGCCCGATCCCCAGGCTCTGCTCGATA AAAGAATG CACAATTTGGTTGCCTATGCAAGGAAGGTAGAAGGAGATATGTACGAAATGGCCAATTCG AGGTCTGA GTACTACCACCTACTGGCAGAAAAAATCTACAAGATTCAGAAAGAGTTGGAAGAAAAAAG ACAGAAGA GAAAAGAACTGCAATTACAACAGCAGCATACACAGCCTATCAGACCAAATCTTCAAGGAA TGGGACCG AGACCTCCAGTACCAGGTAATATTCTTCCGGGGCAACAGCAGTCCCCTGCCCAGACCCAA CCAGGTTT GAGAAGCAGTTCCCCATCTCTCGGCGGTCCTCCTCTAGGAGGTCTTGGTGITATCAATCA ACCTGGAA ACCGATTACTATTCTCTACTCAACAGCCCACTCAACAAACCGCACAGCAGCCTCAGCAAA ATGTTGGT TTAC

>>CCCTCTTTCTC^GGTAGTACCACC^CTTCTTCCAGCAACCAGTTTCCTACAA CAAGCAATGGACC TGTCAGCCITCCTCAAGTGTCGCCTAGTGGACAGAACTCTa^GCAAATCATTATGGAGAT ATGTTGA AGTCCAGTCGGATATCTCCTTCACCATCGAGTTTTGTTCAACAATCGCAAAACTTGCAAC CGGTTTCT GCTCAGAATGGCAATAGAATACCTACCACCAGTTCAGATTCGGTACTCACTCCACATGCT ACAACTGC AGGTCCCAGGTCAGTCAGTTCTTCCAGGGGGGCTTCTCCAGCACCAGCAACTCCGATTCA GGCCTCAC CGTCATCAGTTGCCGCCAGTATGGGAAAGGGCATGAGTAGTGCAGAGCGTGCTGCCTTAA ATGCTCCA AGGCAGTCATCTCTGTCATCCCAAATGGCAGCGATAACTGCAGCAGCTGATAGAGATGAA GAATCCCC ATCACCTCCTCGGGGAGGTAGTAAAGGAAAGTTGGAGGAAGTCAAAATGGAAGTTGGGGC AGAAGAGG GAGAGATGAATGAATCACAGATGGAGAGTGTGGGCGGCAAAGGAACGAGAAGTGAGATTA AAATGGAG ATTAAGGAGGAGATTGCATCAGAATCGATCGGGGAACATGGCAATATGATAAAGGAAGAA CCTGGCTT GGTCAAAGAAGAACCGGGCATCTCTGAAATCTCTGCAGATGTGAAACCCTCCGTTGATTC AACCAGTG TTGTAGCAACAAGCGAAAGGAAGAACAAGAAATTCAAACCGGATGAACTCAGACAGAAGC TGATGCCA ACCTIX-CAGAAACTATTCAGACAAGACCCAGAAAGTATTCCATTCAGGCAACCTGTAGA TCCGCAGAC TTTAGGTATCCCAGACTATTTTGAAATTGTTAAAAGGCCTATGGATTTGTCAA

>>GGCCTATCGATTTGTCAACAATCAAAAGAAAACTCGATATTGGACAGTATGC AGACCCCTGGGAGT ATGTGGACGACGTGTGGCTAATGTTCGATAATGCATGGTTGTACAATAGAAAAACAAGTC GAGTATAT AGGTAITGCACAAAGCTGTCTGAGGITTTCGAACAAGAAATCGATCCTCTTATGCAGTCT ATCGGTTA TTGTTGTGGTAGGAAGTATACTTTCAATCCTCAGGTGCTGTGCTGCTACGGTAAACAACT ATGCACAA TTCCCAGAGATGCCAAGTATTACAGTTATCAGAATAGTATGAAAGCATATGGATTAGGAT CTGATAGG TACACTTTCTGTCAGAAATGTTTTAATGACATCCAAGGAGATACAGTAACGCTAGGAGAG GATCCTAC ACAAGCCCAAACAAATATAAAGAAGGATCAGTTCAAGGAAATGAAAAACGATCATCTGGA GATGGAAA CGTTTGTGCATTGCAATGACTGTGGGCGAAAACTCCACCAAATATGTGTTCTTCATATTG AAGCCATT TGGCCCCTAGGTTTTATTTGTGATGAGTGCCTCGAAATCAAAGGACTGAAACGTCGGGAG AACAAATT CAACGCGAAACGGTTGCAGGTTACGAACTTAGGCATTTACATTGAAAACAGGGTGAATCT TTTCCTCA GGAAGAAAGAAGCTGGAGCGGGTGATGTATCGATTCGTG1TGTATCAAGTTCGGAAAAAG 1TGTTGAG GTTAAACCGGGGATGCGTTCCAAGTTTGTTGAAACCGGTGAACTTACAGGAGAGTTTCCA TATCGGGC GAAGGCCC'l"l'l"ri'GCCTTTGAGGAAATCGACGGTGTGGACGTTTG'rrrr'l _ l _ rGGGATGCACGTTCAGG AATACGGTTCGGAGTGTCCTATGCCAAACACGCGGCGAGTGTATATAGCGTACTTAGATT CTGTTCAC ITITTCAAACCCAGACAAITTAGGACTCCTGTGTATCATGAGAITITATTAGGTTATATG GACTATGT GAAACAGTTAGGTTATACTATGGCTCATATATGGGCTTGTCCCCCTTCGGAAGGTGATGA TTATATCT

ACGGCATTAAATGTCACTCTGGTGGAGAGGTTCTTCTCGTCAATGGATGTTGGGACACGT CGAATAAA AITCCCAATATTGTAGCAGAAATGCATAACTTCAATACAGAAGATTTC^

CGTAGTTCAAGAATCTTCTAGAGATCTCACCAGTCCAAGTCCAAGAAGTTCTGACAGCGG AATCGAAT CGGAITGCACGGATGGAAGTCTTTCITGGCTCCTAAATTATAAAATCCATGAGITACCTC CAGTTCCA GATGCCACGAGCTCAGAAAATACTGGTACCCCAAGAGGACAGTTCCAATCGCATITAATT CAGGTGCC AAGAGTCAGTGATAACTTTGCTCAGCCTAACGACGCCAAAAACAATCAGAATGGACATTC CTACAGAT ATTCTGGTCCGAAGAAACCACCTTTTACTTATACAGAACTCATAGAATACGCATTGAGCG AGAAAGGG GAGCITACTGTGTCCGGAATATATCAATGGATTTCGGATCATTT^

TAGGTGGAAGAACTCAGTGAGGCATAACTTGTCCATAAACCCTCATTTTCGAAAAGGTGG TAAAGCAG TTCAAGGTGCTGGACATCTCTGGACTATTGCTCAAAGGGATGACAAGAAATCCTGGCAAA TTCGCCAA AGAATGACTCAGTTTATTCAAAATACATACAAAGACGCTAAAGCCCAGGAACAAGAAGCT TTCGATAA GGAAITGCAAGCTGCAACTGAAAGTAITTTAGGAGAAATAAACCATCATAC^

CTTTAAAGAGGGAGTCTAATAGCATAGAAGTACAGTACATCAATGTAGAAGATACAACAA ATAGTTTA

GGAGATTTCCTGGCACCTCCAGTTTCCAAACAAGAAATAGTGAACGAATGCGGCCTG GGTAGTGACTT

CITCATAACGGACATCAATCCGAACGTGTTGGGCCTGAATTTAGTGGAATCTGAGGC GATTTCAGACG

CTTACGACGACGTGTTCGAATATTACGGTGTCAAGGAA

LDEC017235 -RA, FBgn0267002 , unc- 104

>>ATGTCATCTGTCAAAGTAGCTGTAAGAGTCAGACCATTCAATAATAGAGAAA TCAATAGAGAATGC

AAATGTATTATTCAAATGAGTGGCAATACGACAGTTGATAAAGACTATATGGAGATT GGACAAAGATT

CAAATTGAAATCCATCACCAATCCAAAGGCAGAACCAAACACGAAAGATGCTCAAAA AAGTTTTAATT

TCGAITATTCGTACTGGTCACATGACGAGAGTGATCCGAAGTTTTCTTCGCAAATAG TAGTGTACAGA

GACATAGGCGAGGAAATGCTGGAACACTCCTTCGACGGGTACAACGTCTGCATCTTC GCTTACGGCCA

AACTGGTGCAGGAAAATCCTACACGATGATGGGGAAGCAGGAAGACGGTCAGGAAGG CATCATACCGC

AGATATGCCAGGACCTGTTCAAGAAAATTCGAAACAACAGCTCGTCCGACGTGAAAT ATTCCGTGGAG

GTTAGITACATGGAGATTTACTGCGAGCGGGTAAGGGACCTCCTGAATCCGAAGAAC AAAGGAAATTT

GAGGGTGAGGGAGCACCCGCTGCTGGGGCCATACGTCGAAGACCTCAGCAAGTTGGC CGTCATGAGCT

ACCAAGATATCCATGATCTCATCGACGAAGGTAACAAGGCCAGGACCGTGG

LDEC001822 -RA, FBgn0003134 , Pplalpha- 96A

>>ATGGCTGAAGCAGATAAATTGAACATTGATAGTATAAITGCCCGITTGTTGG AAGTACGAGGAGCA CGACCTGGTAAAAATGTACAGTTAACCGAGAACGAAATCAGAGGATTGTGCTTGAAATCC AGAGAAAT TTTTCTTAGCCAGCCGATTCTACTAGAATTGGAAGCTCCCCTCAAAATTTGCGGTGATAT TCATGGGC AATATTATGACCTCCTTCGTCTTTTTGAATATGGAGGGTTCCCCCCAGAATCCAATTACT TATTTTTG GGAGAITATGTAGATCGTGGAAAACAATCTCTTGAAACAAITTGCTTACTACTGGCATAC AAAATTAA ATACCCAGAAAACTITTITITGTTGCGTGGTAATCATGAGTGCGCTTCAATTAATCGTAT TTACGGAT TCTATGATGAATGCA

>>ATTCTATGATGAATGCAAAAGGAGGTACAATATAAAGTTGTGGAAAACATTC ACTGACTGTTTCAA TTGCCTACCTGITGCTGCAATCGTAGATGAGAAAATATTCTGCTGTCACGGAGGATTAAG TCCTGACT TACAGTCAATGGAACAAATCAGAAGGATAATGAGGCCAACTGATGTGCCTGACCAGGGGC TCTTATGT GACTTGTTGTGGTCTGATCCAGACAAAG

>>GGTCTGATCCAGACAAAGACCAAATGGGCTGGGGCGAAAA1X3ACAGAGGGG TCAG1TTTACTTTTG GCGCAGAAGTCGTAGGGAAATTTCTGCACAAACACGACTTTGATTTGATATGTCGAGCGC ATCAGGTT GTTGAAGACGGGTACGAAITTTTCGCAAAACGACAACTTGITACTCTCTTCAGTCCGCCA AACTATTG TGGTGAGTTTGATAATG<-AGGTGCGATGATGTCAGTTGACGA^

TAAAACCAGCAGACAAAAGGAAGTTTCAGTACAACATGAATGCTGGTAGACCTGTAACAC CTCCGAGG GGTG C CACGAATAAAAACAAAAAGAAG

LDEC016690 -RA, FBgn0019925 , Surf 4

>>ITGACTGCGTGGAGCTTTTGGGGTTGTCTCTGTTITG

AACGAATATGTCTCAACGGCAGAGGATATAGCAGATGGGGTAATTAGAAAGTTGAAACAC ATACTACC AACCCITGCCAGGCTATGTCTAATTTCCACTTTCTTCGAAGATGGTTTACGCATCTGGTT CCAGTGGA CAGAACAGAGGGAGTACATGGACATGTCTTGGGGGTGTGGCAAGT^

ATAAACTTGATCGGACAGCTTGGAGGCTGTGCGATGGTAATAGTACGCTACCAAGTGAAT ATTGCTTG CGGAGTGCTATTTTTCATTGTTGTTTTACAGACCCT

TATTCAGGAACITAGCTCTGATTGGGGCCCTCCTTCTGGTATTGGCTGAAAGTAGAG GCGAGGCTAAG AGCCTITITGCAGGAGTACCATCTTTAGGAGACAATAAACCAAAGAACTACCTGCAGCTG ACAGGTCG CATATTGCTGGCCTTCATGTTCAT

>>TGGCCTTCATGTTCATCACATTGATCCGGTTCGAGTTTAGTTTTCTACAGAT TCTGTTGGATCTTT

TGGGATCAGCTCTCATGGTGCTAGTGACAGTAGGATACAAAACAAAAITGTCGGCTT TGATTCTAGTC

TTGCTGCTCTCAACTCTGAACTTTTACCATAACGCCTGGTGGAATATACCCGACTAC AAACCGTTACG

TGACTTCCTCAAGTACGACTTTTTCCAGACGCTGTCCGTTATCGGAGGCCTCCTAAT GATCGTCTACT

TAGGTCCCGGAGGCGTTTCCATGGACGAGC

LDEC002531 -RA, FBgn0033246 , ACC >>CAGGATGGGGTCATGCATCTGAAAACCCAAAACTACCAGAGTTATTACACAA GAATAACATATCGT TCATTGGGITAACTGCCCAATACAGCGGGAAGAAAATCAAAATATCATCAGAACTITTTG CAAAAGGT TGTGTTAATACACCAGAGGAAGGTITAGCAGCAGCTCACAAAATCGGTTTTCCTGTGATG ATAAAGGC TTCTGAAGGTGGTGGCGGAAAAGGAATCAGAAAAGTAGAAAACCCTGATGATTTTCCAAC TGCTITC^ GACAGGTACAAAGAGAAATACCGGGATCTCCAATATTTGTAATGAAACTTGCCAAATGTG CCAGACAT TTGGAAGTACAACTTTTAGCAGATATGTATGGTAATGCCATTTCATTATTTGGCCGTGAC TGTTCAAT TCAGAGGAGACATCAAAAAATCATCGAAGAAGCTCCAGCAGTTATAGCTGAACCCGATAT TTTTGAAG ATATGGAAAGGGCTGCTG1TAGGCTGGCAAAAATGGTGGGTTATGTTTCCGCAGGGACTG TGGAGTAT TTATATGACCCCTCTGGGCATTACTACTTTTTGGAATTGAATC

>>ACTTTTTGGAATTGAATCCCCGTCTGCAGGTGGAACATCCITGTACTGAGAT GGTTTCCGATGTGA

ACCTACCAGCAGCCCAGCTTCAGATTGCTATGGGCTTGCCTCTTCATTATATCAAAG ATATCAGATTG

TTGTAIXMAGAATCCCCATGGGGAATGACTGAGATAGACITTGATCAGCCaVGACAC AAACCCCAGCC

GTGGGGCCATGITATAGCTCCGAGAATAACTTCAGAAAATCCAGACGAAGGTTTCAA ACCGAGTTCAG

GTACAGTGCAAGAATTGAACTTCAGATGATCAAAAAATGTTTGGGGGTACTTCTCTG TTGCTGCTTCT

GGAGGTCTACACGAATTTGCTGATTCTCAGT

LDEC001490-RA,FBgn0263072,CG43347

>>ATGAGATCAACAACAATCCCAGGTAAACACGATTTACGATTTACGACTGGTC TGAAAAATGATGAG AAATTTGATGTTCTATGCTTAGGATTTCGGTGGTTTATC

GGCATTAGGTGACGTCACCAAAGTCGATATTAAAGGGGATAGGACCATTATCAATCT ATCGCCTTTAA AGAGTGACGGTGTCGGTGAATGTGTAAATGATAATGACAAACTAGCAGATAATATTTTAG CTAGGTTA ATAGGGCCCATCAATGTTAAAAAATGGCATGCTCTGAAAAITGTATTGTCCTCCAAAACA AATGAAGA ATTCGTGACGAAACTACTGGAAATCGCTCAGGAATTCCTGGATAGGCAAGGAGGACAACT TGAGAATG TTCATGCAAAGAAACAGAAAAGTTTGAACAAAAAGCAAAAACTCATCTCATCAAAAGTCA TTCACAAT GGAAAAAGTGAACCCAGCGAAATAATTGTTGAAAATGTACTGGAAGACCAAAACTCTAAT AATGAAAG CAATGATAATAACGAAATTGATGCTGAGAAACAAGAAGTTGTTTTACCAAAGCCAAAGTC TGAAAGTA ACAAGCCATCAAAAAAGGTGACAAAAAAATCTGAACATTCAGATAGTTCCAAATCGAAAG TATATCAA TTAAATGATAGAAATATATTACCTTTGAAGGATATACA

TACGAAAAAAAATACTGCGCCAGAAAGTGATCAAGCTGGTAGCCAACTGGACAAAAT AAAAATTAAGT TATGCCACTATTGCAAGACCCATGATATTCAAGATCAATGCCCAATTAATTT^

AATGATGCCTTGAACACCACAAGTTGGAAGGAAAAATTCAAAACCCTCTACGAAATTAGC AGCAATAA AGATAAAAACGAAGTTAATGGTGAAATAGTTGCOVAAGATTGTAAATACAGCTATTCAAC CCTGTCTC TACCAAGCGTGGTTCATATCAAGGAAACAAACACTCCTCACGGATTAGGAGCATTCACGA AAAGTGAC ATTGAACCGTTCACACAAITTGGGCCTITGGTTGGAGAAATCGTCAAAGAAATGGACATC GCCGAAGA CGTGAACATGAAGTATATTTGGGAAATAAACGCCGACTCTGGACACTTATATTTCCACAC AGAAAGCA CTGTTAAATCAAACTGGCTGAGATTTGTGAGACCAGCACCTACTAGAGATGAGAGGAATC TGTCTGTG ATATCAAAAGATTCAAAACTTTATTTTGTTTCTACGAAATTC

TTGGCAGGACTCATGCGGAGGGTGTAATATGGAITTCAGTCATCCCCATTACTACAG AATACACTGTT CTTTAITCCATGATGTGAGATACAGTCTGACGATAAAAAAATATC^

GTATTAGGAAAGGAAAATATTATGAAACATGCTGCCGAGTTACACAATGGACAAGGAGCA TACCAATG CCAATTTTGTAAAAAGTTTTTCATGAGGTTGAATTACTT^

CAAATCCACACAGATCTCGTCCTCTATGCGACTTTTGTGGTAAAAAGTTTTGCCAACCCC AGAAACTA AAAGTACACATCAAGCGGATCCATAGCGATATTTCTCAAGITTTGAAGGAGTTTCAGTGT AAGAATTG TTTGAAAATTTTGGGATCTAGAGCCGCACTACAAAGGC

AAGGACAGTCTTCTTGTTCTAGATGTGGGAAGAGATTTCAAAATAAGTCGAATCTCA AAATACATATA

TGTAACAGTTGTGATGGAGCTITGACTACCAAACAATGCCTGCAATTTCATTACAAA

TTTCACCGAAGATAATATGCCAAAAATAGAGAGAAGTATCGATTATACCTTTCAAGC GTATAGTGGTG

CTAAAGATGAATCTGATCATAACAAAAACGAATCATCTCCAAATCAAGCAGATAGAG ATACCGAATCT

GACAATGGAAACGATTGTGCGAAGAGTGATTTGACGAGTATTAACGGGAAGGTATTG AGTAAAGGTTC

CAAAAAATGGATTGGCGATGAGCTCTCTGCCGTAACGAAATTACCGGACATATATTC GGTGGAGCGAC

TCAGTAAGGAAGACTTGTCGGGCATAACGTTACAAGGAGCAGAAATGTATGAGAAAA ACAAACTTTCA

AACATCAGCGATTTCGGGAGACACGAAGCTTCAAACGCCAGTCTACTAGTTGAGGCA GCTCTAGACTC

GGTCTGCCACGAACCTAACATAGATATCGACGTGAGCTCCACTCCGAACTGTACCGA TTCCCTTGTCA

ATAATCTGTACAACTTGACGCAGCCGGATAGTTTAGCCGACGTGAACTATAATGAAA CGTGTATTAAC

GACTCCAGAGACATAAATTTGATGTCGCCTTCTGTCAATGACCGCGTGTCAGTTACA GACGAATTTAA

CGAAGAACTAAGACAAGACGATAACATTAGCATGCACTACCCTAACTTTCACCAGAA CGATTTCAGCC

CTCCACATAGTCCTGACATTGACAGATCGAATTTCGTCAGGAACTACATCAATAGTT TC

AACTCGTACGAACAAAAAAATAATACTCCCGTTCCGAGTCCTCCTAGGTATGACTTC GGACATGCGGT

CAATCCGGAGCAITTATCATCCGATGACAGCAACGGaVTGACCGTCCAGAATCTCAG CCTGAATGATT

CTAAAAATGGAATTCAATTGGATCTCTCATTGTACAAGTCTTACAAGGATACAAGCC AGGATTACGTT

AGGAAATTGAAATTTGCTAOVGCTAGCGACACTTTGGAT

TCTCCCTAGTAGCATTTCAAATATGGAGTCCGACAAGGAACTCGTCGAGAGAGATGA CCATCCGAAAT ACTCGGACGAACTATCAGCTGAAATACGCAACAAGTTCGAACTGGATTTAGACATGCGAC TGAAGGGT TATGAGAGTATTGACAGTGAAATCCTGAGGCAGAGAAACCACACTTATGAAAGCGGAGAA TTGGATTT CCGGAATAAGACTTATGACTTGATAGACCAAGTCGAGAACCGCAACAAACCGTATGATGG GATCGAAT CGGACTTTCGGACTGACCGAAGTTTCGAGCCGATAGTACTGAATTCGTCAGAGATGCAAG GGCTGGAT ATGTCTGCGAGGAGTTTTCACAACTACCCCAACATCAACAGATATCACCCGCTCTATCCG GACGTAGA CAGAGTAGATCTGCGGTTGAACTATAGCCCTCCGCCTCCTACATATACGCACGCGGATAT TCTAAGAG CGGTCTCCCTCGATCTCACTTCTCCCGGCAGACACAGCGTCGATCTCAGTTTGAGGAACC ATCCCTTG CATCAAATCGCCAATTCTCGCTTGCTGACAGAACATG^

TCAGAGTCGGTTGTTAGGCGCTGAACTGACTTCGACTAGACATTTAAATGGCGAGAGAAT GATGGCGG ATGCCAGCAGTCGAATTCTGACAGATCACAGTACGTCGAGGATATTAAATAATGAGCAGT TGAGCACG AACCATCTGCTAAACTCGGAGCAAAACAGGCTTTTGAGTGACGAGAGTAGATTGCTCGGA GATGGTAG GAITCTCGGTTCGTCCACAAGTGGAGGAGTTTCGCCGGTGCAAGGATTCAGTGGATATTC CATTTCTC AAAATCCGTATCATCCCACTCCTATACCGACGAGGCCGCACAGCATCACATGCTTCATGG CCCTATCT GATGCCACCACTGCACTGGAGGTCACAGAAACAGAAAATACTAAATCAAAGAAAAACAAG CTTCTCAT T

LDEC019981-RA, FBgn0250843 , Prosalpha6

>>TAGAATATGCAATGGAAGCCGTTAATCTAGGTTCAGCGACTCTAGGTTTGAA AAGTAAAACTCATG

CAGTGCTCATTGCTCTTAAAAGAGCCTCTTCGGAGCTCTCTGCCTATCAGAAAAAGA TCATCAACATC

GACGAGCATATTGGAATAACTATTTCAGGACTCACTGCAGATGCTAGGATCCTTAGT CGTTATATGAG

GAATGAGTGTTTGAATTACAAATATTCTTTAGATGCCCATATGCCTCTGAATAGACT CATAAGCACGT

TAGGTAATAAAATGCAGCATTGTACTCAGCGCTATGACCGTAGACCATT1X3GAGTT GGTCTTCTAGTT

GCTGGCTATGATGAGTCAGGTTCTCATATCTATCAAACATGTCCGTCAGCCAACTTT TATGACTGCAA

AGCTATCTCAATAGGCGCTAGGTCCCAAAGTGCGAGAACITACCTCGAAAAACACCT AGATGAACTTC

CTTCCTGTTCCCTGGAGCAACTTGTCAAACACGGTTTACGTGCCTTAAGAGATACCT TGCCCCCAGAG

GTAGACTTGACTACAAAAAATGTTGCGATTGGTTATGTTGGTAAGGGACAGCCTTTC CAAATATTGGA

AGAAAATGAAACGGCTCCATATTTGGCCCTGATTGAGGGAGAGGAAAGAAGAGGTGG TGGGGCAGGAG

GAGCTGGTGTTGAGGCTCAGCAAGCCGATCCCCTAAGAGAAGATACGGGGGACGAAG GGCCCAGAGAC

CCAGTGCCAACAACAGCAATGGATACCACAGAA

LDEC008911-RA, FBgn0046222 , CG1109

>>ACAACGTCAAGATGTTCCAAGCGCACAAAGAAGCACTTCGTGGCATAAGCTT CAGCCCTTCGGACA

ACAAAITCGTTACGTGTTCGGATGACGGCACCCTGCGCAITTGGGACTTTTTTCGGT AT^

CAAGTACTCAGAGGTCATGGAGCTGACGTAAAATGTGTTCACTGGCACCCTCAGAAAGCC CTCATCAT

ATCTGGTAGCAAAGACAACCAGCAACCTATAAAATTATGGGATCCCAAATCGGGACA ATCATTGGCGA

CGCTGCACGCTCATAAATCGACTGTGATGGATTTAAAGTGGAATGATAACGGCAATT GGCTAATCACA

GCTTCTAGAGATCATTTGCTGAAATTGTTCGACGTCAGAAATCTTAGCCAAGAAGTC CAAACATTTAG

GGGTCACAAAAAGGAAGCTTCGAGTGTAGCGTGGCACCCTATTCATGAAGGACTTTT CAGCAGTGGCG

GirCCGATGGGGCCATTATGTTTTGGOVCGTGGGTGCTGATAAAGAAGTAGGAGaVATAG AACAAGCG

CATGACAGTATAGTTTGGACTCTTTCGTGGCATCCGCTCGGACATATTCTTTGCTCC GGATCTAACGA

TCACACTAGTAAATTCTGGACAAGGAACAGGCCCGGAGACCAAATGAGGGATAAATA CAATTTGAACA

CACTACCATCGGGAATCGCAGGACTGGAAGATTTAGAAAIX-CGTAATAACGACGAA CCGACTTCGATA

AITCCTGGAATGGGTCCTGAAGATAAAGTTGATATTACCTCCATTATAACCGATGAA AATCAAGCAAT

TCCAGGATTGGACTTGGACGGTATCGGTAATGAAGAAAAACCAAAGCCTAAGAAAGT GCCTTTCAGCA

AACCCATTCCACGTAATTTCCAAGCTCAATGGAACGAGACAAATGATGATCCTGCAG GAGCTCTTAGT

GAAGTCATTACACAAATTGTAGAAAATACTCCIX-CAGTAGITCCTTTGCAGCAAAT TGCCCCTAATGC

TATAATAATATACGGGAAACTGATTCCAGTAGAACCCGGATCAAAACTGGAACAGGC AATTGCCGACG

GACCGGACGCCCTCCAGAAATTCATAGCTTCAGGCCAAATCGAAGAGCTTCACGACG TGATGCCGTTA

AACGACGAGGAAGACTATCTGAACGACGACTATGACGATGACAACGATAAAAGCAAC ATTCCAAGCAA

AGACCTCAAAAACTCGAAAACGGATTTCGATATCCGGCAITCTGATCAAGACATCAG GCAGTTCAGCG

GAAGGGATAGCGACATGCGCAACATGGGCGACGTTGACTTTAGAAAAGCTCCTATGG ATATCGACTTC

CGAAATAAACCACGTAGAGACTTTGATATGCGGAACTCTCTGCGTAATAAACCCCTA GACGAAGATTT

CCGTTACAACAAGAGGGACGACAAAGAATTCAGGAATAATCAGTACGACGAAGAAGA AGATTATAACG

AAGACITTTATGAAGATGGAAACTGGCCCCGCAACGGGAAGTTCAACAATTTCCGTC GAGGTCGGGGT

AACCTTTCGGCAGGC^GAGGTAAAATGCCCTTCAACCAGGACTTCAGAGGAAATAGT TTCAAACCGAA

CAGTGGGAAACCGGACGACAGGAAATGGGGCAACGAAAAAGAAGAT^

GCAAATGGAAAGACAACAGCGATGACAACTGGAACGATAAAATGGATGGTAACTGGAACG ACGACGGA AACTGGAACGACCAAAACGAAGGCAACTGGAACGATCCAAGCGAAGACAGCTGGAACGAC CTTGGAGA TGACGGTTGGAATGACCGTAACGAAGATGAGTGGACTGAAATGCCTCCTTCTTCCTCCAA TGACTTCC GAGGCAGAGGAAGCAACCACAGGGGGCAGAGAGGGGGCGGTCCGAGAGGGAGCAGAGGCA ACCAGCGC GGTAGAGGGGGAATCGCTCTGGGAAGCGGAAGGGTTCAAAAGATAGGAAGAGGCGGCGGT GGTAACAG AGGCTCAAGGGGAGGTCCTGGCATTAGGGGTCCGAGGGGCGGTGGCCCTGGTAAAAGAGG CGGCAGTT GGGGTGAGAGGGGAAATCGCGGGCTAGGTCGCGGTAGGGGAGATCAGGGAGGGCGAGGAC GGTTTTCG LDEC016479-RA r FBgn0003392,shi

>>ATGGCAGGGAATACCGGAATGGAGCAGCTTATTCGAATTGTGAATAAGCTGC AGGATGCTTTCACA CAACTGGGTGTTCATATGACTTTGGATTTGCCACAAATCGCTGTAGTGGGCGGACAATCC GCTGGAAA AAGTTCGGTTTTAGAGAATTTCGTTGGAAGAGACTTCCTTCCTAGAGGATCTGGAATTGT TACTCGAA GGCCACTCATTTTGCAGCTTATTAATGCAAATACTGAATATGCGGAATO

AAATTCGTGGATTTTGAAGAAGTTCGOVAGGAAATCGAGGCTC^

TAAGGTGCCGATTGGTGATCAACCAATTGATATTGAGCAACAAATCAGAGCGATGATTCT CCAGTTCA TCAAAAGAGAATCGTGTCTGATTCTGGCAGTAACTCCAGCTAATACGGATTTAGCTAATT CTGATGCG CTTAAATTGGCCAAAGAAGTTGATCCTCAAG

>>AGAAGTTGATCCTCAAGGTATTCGTACAATAGGTGTTATCACGAAACTAGAT CTTATGGATGAAGG

CACAGATGCCCGTGATATTTTAGAAAATAAGCTCTTACCCCTTCGAAGAGGGTACAT CGGTGTGGTTA

ATCGITCCCAAAAAGACAITGAAGGTAGAAAAGACATAAACGCTGCCTTGCAAGCGG

TTTTACAGTCATCCGTCGTATCGACATATAGCGGATCGTTTAGGAACACCCTATCTT CAAAGAGTGCT

CAACCAACAATTGACAAATCATATTCGAGACACGTTGCCCAGCTTGAGGGATAAATT G

ATCTGACTCTAGAGAAAGACGTGGATCAGTTCAAACATTTCAGACCCGACGACCCGG CTATTAAAACA

AAAGCTATGCTCC

>>AAACAAAAGCTATGCTCCAGATGATACAGCAGTTGCAAGTAGATTTTGATAG AACGATAGAAGGTT CCGGCTCAGCTCAAATCAACACGATGGAATTATCAGGTGGTGCTAAGATCAATCGGTTGT TCCACGAG CGATTTCCCTTTGAAATAGTCAAAATGGAGTTCGACGAGAAGGAGTTGCGGAGAGAAATT GCCTTTGC AATCAGGAATATCCACGGTATCAGAGTTGGATTGTTTACTCCAGATATGGCGTTCGAAGC AATAGTTA AAAAGCAGATATCCCGCTTGAAAGAACCGTCACTCAAGTGTCTGGAITTGGTTATGTCAA GGTACCCT CGTTTAAGAGAAGAAGCAGAAAGAATCATAACTACTCACATCAGACAAAGAGAACAGTAT TGTAAAGA GCAGCTCTGCTTACTCATCGACTGTGAATTAGCATATATGAACACCAATCACGAAGACTT TATAGGAT TTGCAAATGCTCAAAACCAGTCGGAAAGTGCCACTGCCAAAGGTACTCGTGGTACGCTCG GTAACCAA GTCAITCGTAAGGGTTACATCTGCAITCATAACITGAGTATCTTGAAGGGTTCGAGGGAT TACTGGTT CGTTCTCACTTCTGAGAACATTTCGTGGTACAAGGACGAAGAGGAACGGGAGAAGAAATA CATGTTGC CITTGGATGGACTCAAATTGAGAGACATCGAACAGGGCTTTATCTCGAGAAGGCATATCT TTTCTATT TTCTTTCCGGATGGCAGAAACGTGTATAAGGACTACAAGCAACTTGAATTGAGCTGCGAA ACTTTGGA CGAGGITGACTCGTGGAAAGCTTCTTTCTTACGTCCTGGTCTGTATCCAGAAAAACAAAC TCAAACTT TGAATGGGGAAGAT

LDEC000567 -RA r FBgn0038475 , Keapl

>>ATGGAAACGGAAGATGACCGGTATTCCTATTGTTCAAGAAACAACCTGAAAA CCACGAATGGTAGT

TTGGGGGAGACGGGCATACTAACCATCATTGATTATCTGAAGGACGCTATGAAGGCC ATGGATTTGAT

GAGGAGCCACCAGATGTTGACTGACGTAGTATTAGAAGTGGGAAAAGACGTGTTTTA CGCCCATAAAG

TGGTCCTGGCAGOVGCCAGTCCGTATTTCAAGGCCATCTTTACCGGAGGACTGAAAG AATGTGATATG

AATAGAGTTAAGTTACAGGGGGTGTCGCCGACGGCATTAGCTAGGCTCATGAATTTC ATGTATACCGG

CAGGATAAGAGITACGGAAAATAATGITTGCCAACTATTGCCAGCAGCTACCATGCT CCAGGTTTC

ACGTCATCCAGGCTTGCTGCGACTTTCTAGAGCACCAGCTGGATCCGAGCAACGCGA TAGGTATTGCG

ACTTTTGCAGAAC^GCACGGTTGCATCGACCTATGCAAGAAGGCAAACCAGTACATT GAACGATATTT

CAGTCAGATATGCCAAGAGGAGGAATTCTTACAACTGAATTCGTATCAGTTGGTAAG TTTGATAATGA

AGGACGAGTTGAACGTCCAAGACGAGAAAGAGGTCTAGAATCCTGTACTCAAGTGGG TGCGTTACGAC

GAAGAATCGCGACAAGCAAAAATGGAGGGTATTTTGTCTGGGGTGCGATGCCAGTTT CTTCCGCCTCG

AITCCTGAACGAGGAAATGAAGACTTGTGACGTCATTAAGAAAGCGCCGGCCTGCAA G^

CTAGGATTTTTAAGGATTTGACTTTACACATAAAA

>>TTGACTTTACACATAAAAACCGTCGTTAAAGAACGATGTCCGAACATTCCAC GTGTCATATACATT

GCCGGAGGTTACTACAAACAGTCCCIX-CACGTACTAGAAGGTTACAACGTTGACGA GAAAATGTGGTA

CACTCTGGACCGACTCACGGGATATTTTTATGCCGTCGGAGGAAGGAACAACAGTCC CGGCAACAGTT

ATCATTCGGATTGGGTGGATAAATATAATCCTATCAAAGACCATTGGAGGCCCTGTA ATCCAATGTCT

GTGCCACGAAATAGAGTGGGAGTGGCTGTTCTAGATGGACTTCTGTATGCTGTGGGT GGTAGTGAAGG

ATCCAGGTACCACAGCAGTCTGGAAITTTATGATCCGGAACTGGACCTTTGGACTAT GATAAAACCAA

TGCACTTCAAAAGGCTCGCTGTAGGCGTGGCGGTTGTGAACAGGCTGCTGTATGCTG TGGGAGGCTAT

GATGGTGTCGATAGACTTAATACCGGGGAGTGTTATCATCCCGAAAATAATGAGTGG ACCATGATAGC

CCCAATGAAGATAGCGAGGAGTGGAGCAGGAGTGGCAGCCATCAACCAATTCATTTA TGTGATTGGGG

GTTATCATGGTAAGAAGCAGTTGAAITGTGTGGAGAGATACGACACAGAAAAGGATC GCTGGGAGTTT

GTGAAATCCATGAGAATATGTAGAAGTGCTCTCAGTGTGACTGTACTGGATTGTAGA ATATATGCAAT

GGGAGGCTATGACGGCATGAATTTCCTGACCGACGTCGAAATATACTGTCCAGTCAC CGACACATGGA

TGGATGGAGTTCCATTAACATCCGGAAGATCTGGTCACGCAAGTGCGGTTTGTTACC AGGCTTCGAGC

TCTGAAAAAACCTGCGCCAITCTAGGCCAACCAACTCCCGATTGTTCAACATCGAGA AGACCGCAATT

CGATAACTCGATACAGAAAAAAAAGTTTCCCGAT

LDEC001290 -RA r FBgn0264848 , vih

>>TCAAGTGGGTGGGCACCATTATGGGGCCCAAAGATACCGCCTACGAGACGCT GAAGTTCAAGTTGA GTCTGCAGTTTCCCAACTCGTATCCCTACTCAGCGCCCACAGTOVAGTTCGTCACCCCCT GCTTCCAC CCCAAGATCGACATAACTGGAAACATTTGCCTCGATATCCTCAAAGATAAATGGTCAGCC CTGTATGA CGTCAGGACTATCCTGCTTTCCATCCAAGCTCTCCTGTCCGAACCGAATATCGATAGCCC TTTGAATG CTGAAGCCGCCGAAAAATGGCAGGTTCCCGAAGAATACAGGTTATTAGTTTTACAGACCC ATAGAGAG GCG

LDEC009012 -RA, FBgn0013733 , shot >>ATGTCTGACGAGTATGATTTCCGACATGAGTTGGGAAATGTGCCTTGGAGAT TGGTCGAACAGATG CAACCACfiACCATTCCGAACCTTCAGATCTGAATTCCACATGAGCAGTACCAGCGAACA CACTTCAAC ATATACTACAACAACCCACTACAGCAAACAGTATGTCCAAACTACAAAAACCTCTTCCAA CTCTGAGA ACGGCACAACCATCAAAATCACAGATGAGCAGACAAAAGATAACTGGAAAAACGATGAAG TGGACCAC ATAACTAACGGTCGTCCACCAGACAAACACACCACCCTGACTAAAATAATTCAAGAACCC CAAAGATG GGACAGCTCGATGCfiATTCACAGAAATCfiAATCACTGAAAAGGAGCCATAACACTCCC GAAGGATTAG ATATCCTCGACATCGCCGGAATCATCAATCCCTATACGGGAGAATTACTGACAATACGAG AGGCCATC GCCGAAAGAATAITAGACGTCAGGACCGGTAAAGTAGTTGCCTCTATGGACGGCACCCAA ATTTCTAT AGGCGAAGCTCAAAGAGCGGGACTAGTCGAACCTAAAATTGCAGAAAGACTGAGCAGCCC CTGTGGAA GCACTGAAGATGGTCGTGATCTCACACTTCTGGAGGCAATTCAACGCGAAATCTATGAAG CGGAGCAA GGTTACCTAGACCCATCTGAGAAGAGAATGAAGGTAACCCATTCCATCACTATAAACCAA GCCATCGA TGATGGAAGAGTCGATATTCAGTCCGGAACGTACACGCTAGACAACGGAGAAACAATTGA CATCAGGG AAGCITATAAGCGAGGGTACCTTCTTCAGCACACGGAAGTCAAGTTACAAACAGGTGCAG TGCCCTTG TCAGACGCCATTAGTCAGGGCTTGATTGATGATAAAACCGGGTGGATTGTGGACCGCAAC TCGGGAAA TAAGTATCAAATCGATGCCGCGGTTAAATGTAACGTCGTCGATGGTGACATCAGGGAAAT CGTTGATC CCAAAACGGATAGTAAAATAACAGTAATACAGGCCCTAGAGAGTAATTTAATCAACCCGA AATTAGGC AAGTACGTATTAGGCCACGAGAAATTGAATTTCCTCGAGGCTAAGCGCCGGCAGCTGATA GTCAAACC AAAATCTCTGAAAGAAGTAGTTGACGATAACTTGATGGACGATGAAGGTAAGATTTTCTC GCCGATGC ATCAAACGAAATTGACTCTATTAGAGGCTGCTAATCGCGGCGTTCTAGACCTCGACTCCA CTAAGACC ATCTTGGATCTGAGAACTAACGAGCATGTAACGCTGAGCGAAGCTCTCAAAGAAGGCATA ATTTTGCC TGACAGCAAGTTCAGGAACTGCGTAACGGAAGAGGTCGTTACCATCCAAGAGGCCGTTAG CAGGGGTT ACATAATATCCGTAGTCAGGAAGTCCATCTTTGACGTCGACGGTTTTCAACCGCCTGATA AATCAGAT CACATCAGCTTCAATGCCGCCAACGTAAAAGGTITCATCAGCAAAAAGAAIXMGGGTAGT CTATTGGT GAGTAAAAAGAGCGGCAAGCTAATTCCGTTTATAGAAGGGGTAACGTCCGGGGAGGTAAA ACCGGAAG TTTACGAAAATCTAACGCGACCTATCGGTATAATCGAAAACCAGCGTCAACTGAATCTTT TAGAAGCA GTATTTCGCGGCTATATCGACCCGAAAAGCGGTAACCTCATAGACTTAACCACAAACAAA ATCGTCTA CCTGAATGAAGCCATTGCGCAAAACCTTATAACTC^

ACCTGAACGTGTCTACACGCGTCACGCGCACCCTAGTTCAGAGGTACGTCACTGTCACGA GCAAAGAT GTAAAACAGGAAGTTATCACTTATACGGAAGCCCTTCGGITGGGTCTGATAAATAACGAA GAACAGAC TTATACCGATCCCCAAACCAAAACCGTTATTCCGATCGTTGAGGCGATCAGCGAAGGTAA GTTAGCAC CCGATACCGAAAGTTCCGAAAAAATCGTAAGCCCCAGTACTTCGAAAACGTCCACTGITT CTATTCAT AGTAATAAAGGTTATCCCGTTGCGAGAGATTCTGATTCGTCCAATA

>>ATTCTGATTCGTCCAATACCAAAAITCAGTCGTCGGAAITCATAACTAATGA GAAGAAATCTTTCG AAAAATACGTGTATGATGTTCCCAAAGAAGGTTGGAACCTGGCAGACGCCATAAATCGAG AATTGTTC GATCCCGTTAGCGGTTTGTTTATTATATACGGCACTGACCGTCTGGTGACATTCGAAGAA TGTATCAC ATTAAAACTTATCAACAGCTCTTCCGTAGTTGTGGTAGATCCCCTCACCAAACGTCAAAT TCCAGTCA CAAGAGCCTTAGAGAAAAAAATTGTGAACGCTACTGGGCAITACATAACTGAAACAGAGC AGCTTACA ATGCAAGAAGCTATCAACAGAAACGTTATACTACTAGGAGGGAAAGTGGAGACAGATCAC ACATCCAA AGCAGAGTCTAAATCTCTTGAACCAGTGCAAATTCAAACTGGTGTTATTTACGACCCCAA ATCTACTT TGGTTATAITCTCGCAGGAAAACCAGTCATCAGATCTCATAACAGCAGTCCTTGAGAACA AAATCTCT TCAGAAACTATAAAAGTTAAAGACCCAAAATCGGGAAGAGATATCTCTATAAAGGAAGCA ATTGCACG TAATGTAATTCATCCTGAGGAAAAAACTTACACCGATAAATCTGGAAATAAAATATCTTT GCAGGACG CGACTAAGTCAGGTCTACTGGCCGTTGTTGGAACGCCTATTTTAGCCACGAAATCGATGA TTGGAATC GTCAAGAACATTTTTGTCGTAGATCCGAAAACAGGTGAACAAATACCGGCTGAGGTAGCC CTGCAACA AGGTCTTATCGATCAGGAGGCATTTGACAATTTAAGATACGCAAATTCTACCCATGTAAC TGATCAAG GCGTTCAGTCTGTAATCACTCAAACCCACAGTTCTATACGAATTACCGATCCTAAAACCG GGAAAACA TATACATCTCATGAAGCTCTAGCTGAAGGAATCATCACACCTGAGCAACTGGATGAAATC AAAGTCCA GAAGGAAGATATCCCTAAAATGAAGAAACTGGGTACAGTCTCGATCAGTCTGGACGAACC AAGTAAAA TGTCGGAGGCAGAAAAGACCAGAGCGCGTATTACTATCGAGCCTACGTACAGAGTGAAGA TTGGACGA GCTCAATCTTTGAGCCCAGAAAGAGAAGCTAAACGAGTAGITTTGCAAAAACTTAGAAAG AAAATAGT GAAACCTATGGAAGCGCTCGAAACAGGTATCATAGATGAGGATACAGCACAAATTTTGGA GGAGAGAG AAAGGTTCATTTCCTCTGAAGGTGAGCAGCTGACTCTACAAGAAGCTCTAGAAGCCCGAA AAGTGGAC GGCCACCAGGGCAAGATCGTGGATCCTCAACGAGGTGACTTACTCACCATCAAGGAAGCC ATCGAGCG TGGAAITTTGGACCCTGATGGTACCAATGAACTATTAGTGCCTTTGAATCGAAGTCTGTC CATTCCTG AATTGGTGAAACAGGGTITACTTGATGTAGAAACTAACAAAATTGTGCACCCCGAAACCG GAGCTCAT TTGAGTATCAGCGAAGCTATTGTCTGTGATATTATCGATCCGCTCAGCACTCTAGTCGAA AAGTCTGG CGATGTATTGACTGTGAGCGAAGCGATCGAAACCGGTGTGATAGACGACGAGAAATCGAC AGTTCAAA CAAGTCACGGCAGCTTAGATATACAGGAAGCCGITAAAGACAAAATATTTGACAATACCG TCCACTCT GGACCTATAGAAATCCCACCTGCAGGCATGACATTCCCTGTAGCCGTGAAACGGGGTCTA GTCGATAC CGAGAAAAAGGAAATTATGAACCCTATTACTAAGGAAACCATACCGCTCAGTGAAGCTAT CGAACATA ACTTTATAATGTCGTTGCCGTTCCCCGCTAGTCCTGAATCGATTAGGATCGAAGATGCCT TGGAATCT CATCTAATCGACTCCGAAAAAGGGACTTTCACTGACCCTAAATCCGGAAAAATGTACCCC GTATCCGA GGCGGTTGAAAAAGGATTGCTGGTCATAAAGGAACCGCTTGAAGGGTTGTCTTTCGCCCA CTCAACTC

GTTGCCGTTGTTAAAGACCTTCAGGTAGGTAAATTTAGATCGGTCGCGAGCGCTATTGAT GACAAACA

GCTAGACGTCGCGAAAACCGTCATATTCGATCCGACAACGGGCAAAGTAAAGTCATT AGTGGTCACGT

ACGATCAAGGTGTTATAATATACCTGAAGGAACCATCATCTTTCATTCAGGCTATCG AAAGTGGCCTT

CTAAATCTCGCTACGGGAAAATTCACAGTACCGCAATCCAACGAGGITTTGACCTTA AAAGAGTCC^

CGCGCTGGGTTTCATCGACCCGGACACTGCACTCATCAAAGATTTCAACAAAAAGAA ATTGATCAAAC

TTCCCGAAGGCTTCAGGAAGGGCCTGATAGACGCTGATAAAGGCAACGTCCTAGATA GCTCCACTTCC

AAGCTGTTCACTTTATCGGCAGCTTTAGAAACCGGTTTGCTCATCACCACCAACAAA AGCTTCACACT

GATGGAAACCGITACTTACGGCGTGTACAATCCTACTACAGGGCGTTTCACCGACCC GTTTGTCACCA

CAAATATAATCGACAGAAAGAAACTTACGCTAGCCGATGCTATCGCTGGGAACTTGA TAGATCCCAGT

AGTACGGTGATCAAAGATCCAGAGAGCGGTATTATAGAGCCTITGTTGTATCCTATC GACACCAATT^

GGTGGATGCGGTAGAAGGGAAGATCCACGACAAAAATGAAAATAAATACATTGATTT CGCCAAAGCCC

AAGAGAAGGGTTGGATCTTGCCAGCGGAACAAAGGCAAGCAGTCGAAGAAAAATACA AACTGTGCGAC

GACACITTGTCAAAACTCCTCAGCTGGATAGATGAAATAGAAGACCGGATCGCGAAC CAAGACGTCAT

CCACGAGGTGGAAGAGGAACTTCGCAATCAAATCAACACCATGAAACAGATCCGCGA TGACCTGGAAC

AACACTCCGGCCAGGTTTCCTACTGCGGAGACCAACAGGAGACTGAAATTTCTGCTC TAGAAAAGAGC

GGACGTAACCTCAAAACGCGTTATGACAAAGCTGGTGATCGCACTGAGAAACTTCTA AGAAGGTTGCT

CGCTGCTAGGGATCAACTGGCTAAGCTCAAAGGCGAGCTCAGCATTTTTTCGACATG GTTGAGCAAGG

CGAGGAGAGTTCTGGAAGACAAGGAGAGGTCTTTGAGCGATTTGCAGAATCTGGATT CTAGTACCGAT

AGTACCAAGGAGTTCGTCGGAGACGTGATAGCCCATCAAGCGGATCTGAGATTCATC ACTATGTCTGC

ACAGAAGTTCGTCGACGAAGGAAAGGAATATCTCAACATCCTCAACGACTTCCGTAC CACCCTTCCCT

CACGTCTGCCTCACATAGAACCCTACTCGTCCCAAGACTCGCCCGTACGCAGCGAAG TATCTTTGGTC

ACCCAGCAATACCGCGATCTCCTGCATCGTGCTAACAACCTTTCTGATCGCCTTTCT GGTGTGGGTGG

ACGCCAAAGAGAGTATTCAGACGCTCTAGACAAGGCCAAGGCTTGGCTCAGAGACGC GGAACCAAGAG

CGAAACAGCTGCTGAACGACCCGATCGCCGGAGATCCGAAAGCGGTTGAGGATCAGC TACAGAGCGCC

AAGGCTCTGAACAACGAGITCGTCGCTAATGGAAGGCTGGTTGACAACGCCAAACAG GCCACCAGTTC

TCTCCTCATATCTCTTGAGGGCCAGATATCTCCATCGGAAATAGCTCGCCTAGAGGA ACCGATCAAAA

CITTGGAAAACAAATATACCCAACTGAGCAGCGCCATCGCGAATCGCTGCCAGGATC TCGAAACAGCC

CTCGTCCAATCGCAAGGCGTCCAAGACGCCCTAGACGGCATCATCGACTGGTTAAAT CAGGCCGAGAA

CCAGITCAAGAACATGCAGAAACCGGCGTCGCTAATCAAAGAACGCCTGGAAGAACA ACTGAGAGA^

ATCGCGCATTCCAAGCCGACGTAGACATCCACATATCCTCCATCGACTCTATATACT TATCCGCCAAC

GAGCTGATAGTGTCGACTAGCAACGCGAGAGTTGCCAAGAAAATAGAAGGAAAACTA AACGATGTCAA

GGTGAGATTCGAGAAACTTTTCGACCGCGCTCAGAATCGCGGGGTGTTTCTGGAAGA AACCAACCAAG

ACCTGAGAGTGITTGGTAATCAAGCAGTCAAGITCGGAGAITGGTACACCAGCGTAA TGGATATCATA

GAGTCGAAAGACATGAGCAAGCTACCCGCAGACGAGTTTGTCAACCAGATGAAGAAA ATCGCCGCTAA

TCGGGACGAAAACCGACACATGTACGAAGAGACCGTAAAGATCGGCAAAGAACTCCT CAACAAGAGAG

ACGTCACCGATACGGCCAGCGTGAGAGACCGCGTCAAGTTGCTTGAAACCCAGTGGA AGGAACTGGAG

CATTTACTCGAAGAAAAAGCCAGGCTATCAAGTCTACGCGCAGAGCATAACAAGTCG TACGAAACA

GAGGACCCAAGTCAACGAGIXMCTCAACAAAAIX-CAATTGAAAGTCACGCGACIXM

TGCATCTGGAAACTCTAAAGAAGCAAAACGAAGAGCTCAAACCGATTGTCAAGGAGTATA AAGAATAC

TCCTCTACCATCGACAAAATCAACGACATCGGCACCATATACGATAACTTAATGAGG GCCGATAGGCC

AGAGTCGCCTACCAGGCGAAAGGCGTACAGCCCGACTAAGCGTACCTCTCCAGCTCC TGGAAAATTGC

CATCTAGAAACGGTCGGTCACCATCACCTACAAAAGTACTATCACCGCTATCTCCAG GAGGTTCTAGT

GGCTTCTCCTCGCGCAGATCCAGCCAGGACGGCTTCCATCTCGAAGAGTTGTCACCG GTTCAACAACA

AATCTCTGAAATAAACAACAGGTATTCTTTGCTAGGCGCTAAAATCAACGACAGGCA GTCCGAAATCG

ACTCGGTACGCGACGAAGTCAAGAAGCAATTGGATAACCTCAGGATCCTCAGCGGTT TTCTCGATAAA

GTCCAAAGACAGCTTCCCAAAGACACAGTACCCAGCACCAAAGACGAAGCTGACAAA CTTAACAAACA

AATTAAAC^CGTGTTGGAAGAAATGTACGAAAAGCAGTCGTTGCTGGATTCCACCAA GATCCAAATAA

AAGACCTGCTCAGGCGAAAGCCTGGTGCGATTGGTTCGGATAAITTGAACGACGAAC TTGAAGACGTT

GTTTCGCATTGGAAGAGCTTAAACGACCACTTGAAGAACCGCATCAAATTCATGGAA GACATGAA

GTTCCACGATATCCATGAITCTTTGACCTCGTGGTTGGGTCCTAAGGATAGGATCCT AACCGTTTTAG

GACCAATTTCCAGTGACTCTCGCATGGTGCAGTCACAGGTACAGCAGGTGCAAGTGC TTC

>>TCCAAGTGCTTCGCGAGGAGTTCCGCACTCAACAGCCTCAGITGCAGCATCT C^

ATGACGTCTTAGGATACCTGGACCTCAAATCTCCTGATCACCAGAGGATTAACTCGAAGC TTGCCGCC

GTTCAACAAAAGTGGGCGGACCTACTAGGCAAATTGGAGGAACGTGCAGATTCACTC GGCGCGGCAGC

AGACACCAGCAGAGAATTCGACGCTCAACTCACGCGACTAAGAGACGCGTTACAAGG AATATCCGACA

ACTTGGATGAACTACCATTAGACAAAGACCCCGAAGAACAACTACGTAAAGTGGAGA ATCTCGAACGA

CAGCTGGAGGGACAACGCCCTCTGTTAACCGATTTGGAAGCTAACGGAGCACAGCTC TGCGACGTGCT

GAGTGATCCTGCTTCCAGAGCCGATAITCAAGCCAAACTGGTATCGGTTGGAAGACA ATACAATGCTC

TGCAAAGAAAACTGGACCACAAGAAGGCCGAGATTGAAGGATCTATCAGAGATGGGC GCCAGTTCGAA

GAGTCTTGCGCCAAGACACTAGGATGGTTATCGGACGAGCTTGGATCATTATCAGAA AAATTCCTAAT

ATCAGCCAACAGAGATGTACTGGAACAACAAGTCGCGCAGCACGAACCCATCTACAG GGACGTGCTCG

CTAGAGAACACGAAGTCATCATGCTTCTGAACAAGGGCAGAGATGTTCTAAGTAGGA ATAATAGAGCC

GATACGAGATCTCTGCAGAGAGACCTGGACAAGATCAACCAGAACTGGGAGAAGCTG CGCAAAGAAAC TITGGAGAGGCACACCAGGTTGCAAACCTGCAAAGAGCACTGCCGCAAGTACTACAAGGC TTTGGAAA

CCTTCCTGCCTTGGCTAAGACAGGCCGAGGATAAGCTGGACACTCTCAAGCCTTCCT CGTTCCAACGT

AAACACATCGAGAAGCAGCTGAAGGAGCTGCAAACTTTCCGAAACGAAGTGTGGAAG AAGTCCGGAGA

TTACGAAAACACCAAGTCTCTAGGGGATTCCTTCTTGAGCGCTTGCGATATAGACAA AGATGACGTCA

AGAACGAACTCGCTGATCTTAAAGATAGATGGGATAGGCTTAACAATGACTTGATTC TGAGAACCCAA

GCTCTCGAAGACCAATCAAGAAAACTAGCAAACTTTGGCGAGAATTTGAGAGACCTT CAACAC^

GGAGCGGTGCGAAGACAAATTGGCGTCACACGACGCACTTGGAGGAGCAGCCCGAGA TCCAAAGTTGC

TCGAGAGGATAAAAGCACTCAGAGAAGAGACGGCCAAGCTGAAGAAACCGCTGCAAG TCGTTCGTCAA

CAGGCTGACGATCTGTGCAATGAAGCTGGAGAGAACGGCATCGACGCGGTACACCTT AAAGATGAAGT

TGACGGTTTGGGAGATCGTATTGACGAGCTAGCCAGCAAACTCGATGACCGTTGCTC GGACTTACAAT

CAGCTGCTACTGCGGTGACTCAGTTCAATGATCAAGTGAAGGGCATITCCCAAGACC TTTCTGCTTTG

GAGTCTGAGTTGGACAACATCAGACCACCCGGTAGAGACGITAAGACTGTACGTGGA CAAATTGATGA

CGTCAACAAATTCATCGGAAAAATCAACAAAGCCACTGACGACTTGACTGATGCCAT TCAATCCGGCG

AGAGGCTTGTAGACAGCGGATTTGCTCCGGATACGGCCCAAACAAGACAACAGGTAG ACACGCTCAAG

AAATTACTTGGTAAGTTAGATGACCGTGCACTCAATAGAGAAAAAGAACTCGATGGA GCTTTGAAGAA

GCTAGAAGGGTTTTACATTACCCACGCAAACGCTATAGATGGCATACAAAATGCCGC ATCAGAACTTC

GTAAACTCAAGCCAGTCGCITCCGAGGTCGACACTATTAGAGCACAACAAAAAGACT TTAAGAAGTTT

ACTGCCGGCTTCATTGAACCTTTGGGTAGACAAATCGATGAGGTCAACAAAGTGGGT CAGGGACTCAT

CCAGTCTGCAGCCCCAGGCATCAACACTACCGCTCTCGAGAAGGACCTGGAGAAAAT GAACGGGCTGT

GGAACGATCTGAAAGAAAAAATTAATGACAGAGAGAGAAGGCTAGATATCGGCTTGC TGCAGTCAGGC

AAGTTCCAAGAAGCTCTGGACGGTCTAGCCAAAIXMTTAACTGACACTCAAGAGITG GTTGCGAATCA

AAAACCACCATCAGCAGACTACAAGGTGGTCAAGGCCCAACTGCAAGAGCAGAAGTT CTTGAAGAAGA

TGITACTCGACAGGCAAAACTCTATGACATCGCTATITAACAIX-^C^CGATATTGC TAAAGAAGCA

GAACCTGCAGAACGTAAAGCCATCGAAAAACAACTGAAGGACCTAATAGGTCGCTTC GATGCACTCAC

AGAAGGGGCACAGCAACGTACCTTGGACTTGGAACAAGCCATGCGGGTTGCCAAAGA GTTCCAGGACA

AGTTGATTCCCTTACAGGATTGGCTGGACCGCTCAGAGAAAAAAGTCAAGGACATGG AGCTCGTACCA

ACAGATGAAGAAAAGAT

>>ACAGATGAAGAAAAGATTCAACAAAGAATACGGGAACACGACGCTCTACACA ACGACATATTGGAT

AAGAAACCAGACITCAAAGAACTCACCGAAATCGCGTCAAATCTGATGTCTCTAGTC GGAGATGATGA

AGCCGCAGGGCTAGCCGACAAGCTACAAGAAGCCACCGACAGGTATGGCATCCTAGT GGAAGCCAGCG

AGAACATAGGTCAGCTGCTAACAGCCTCTAGGCAAGGTCTTAGACATCTCGTCTTGA CCTACCAAGAT

TTGGCCGTCTGGATGGATCAGATGGAGCAAAGGCTTGCGAGATACAAGATTCTAGCT GTGCACAACGA

GAAGCTACTTGAGCAGATGGACGACITGACAAACTTGTCCGAAGACATAGCTGGTCG ACAAACTGACA

TAGACGGCACCGTAGATGCTGGGGTTCAACTTATGAGACACATITCCTCGGACGAGG CTTTGCAGCTT

AAAGATAAGCTGGATTCCTTGCAGCGCAGATACAACGACCTCACGACTAAAGCGGCA GAGCTGCTCAA

ACAAGCAGAAACGATGCTACCGCTGGTTCAGAAGTTCCACGTCAACCACAACCGATT AGTAGATTGGA

TGCAGGGCGCGGAGTCGATTCTGCAGTCCGCCGAACCGTACGAAGGAGATATCGCCC GACTAGAAGTA

GATCITCAGGAACTGAGACCTGTACIX-CAGTCCGTAAACAITCTGGGACCGCAGTT GTGCCAAGCTAG

CCCGGGAGAGGGCGCTGCGACAATCGAAGGCCTGGTTACGAGAGACAACAGGCGCTT TGACGCCATCG

CTGAGCAAATACAAAGGCGGGCCGAAAGAATCCACCTGGGTAAGCAGAGAGCGCTTG AAGTCACGGGA

GATATCGACGAGCTACTGGAATGGTTCAGGGAAGTCGACGGTCAGCTAAGAGACGCC GAAAAACCCTC

TGCGGAGCCAGATCTGATCAGGATTCAACTAAAAGAGCACAAAGCGCTCAACGACGA CATCTCCAGCC

AAAAAGGCAGGGTGCGTGACGTGCTCTCAACTGCCAAGAAAGTCTTGCGGGAGACCC CGCCAAGCGAC

GATACTTCATTCATCCGCGAGAAAATGGATGACCTTCGTGAAGCCATGGACATCGTT TCTGGTTTGAG

CTCGGACAGATTGGGAGTGTTGGAACAAGCCCTGCCACTAGCTGAACATTTCCACGA AACGCACAACG

TGCTAGCCACAIX-CTTGGCAGACATGGAGGAGCAGGTGTCCATGCTCACCATGCCG GCGTTGAGGCCT

GACATCATAGCGCAGCAGCAGGACCGAAACGAGATGTTCCTCCAGTCAATCAACGAG CACAAACCTCT

CGTCGACAAGCTCAATAAAACGGGAGAGGCACTCATCAGGCTATGCAATGAAGACGA CGGAAGCAAAG

TGCAGGAGTTGCTAGATAGCGACAACGCCAGGTATGGAGCGCTCAGGTTAGAACTCC GTGAGCGACAA

CAGGCCCTGGAGCAAGCCCTACAAGAGAGCTCCAAGTTTTCAGATAAGCTCGAGGGG ATGTTACGAGC

CCTTTCCAACACAGCTGATCAAGTTAACCACCTAGAACCTGTTTCCGCTCACGTTCC TAAAATTAAGG

ATCAGATAGAGGACAACGACAACCTTGCTGGTGATCTGGATAAGAGGAAGGAAGCGT ACGCGGCTGTT

AAACGTGCTGCAGACGACGTCATCAGCAAAGCGGGCAACAAAGCCGATCCCGCCATC AAAGATATCAA

ACGAAAGCTCGACAAACTGAAAAATCTCTGGGATGATGTACAGAAAGCTACTCAGGA TCGCGGAAGGT

CCTTGGACGATGCGTTGGATGCCGCCCAGAAATTCTGGAAGGAGCTCCACGCCATTA TGGTCACTCTC

AAGGATCTTGAAGATTCTTTGGTATCGCAGGAACCTCCGGCTGTCGAGCCGAAAGCG ATACAAGAACA

GCAGGTGGCTCTGCAGGAGATCAGGCAAGAAATAGATCAAACCAAGCCGGATGTGGA TAAAGTGAGGA

GTTCCGGAGAAAAACTAATGAAACTATCCGGAGAGCCTGACAAGCCTGAAGTCAAAA AGCATATTGAA

GATTTGGACAATGCCTGGGATAACATTACTGCTCTGTATGCGAAGCGCGAGGAGAAC CTCA

>>AGCGCGAGGAGAACCTCATTGATGCCATGGAAAAAGCAATGGAATTCCACGA AACCTTAGAGAATC

TTCTCGAGTTCTTGGATAAAGCTGAAAGAAAATTCGAAAAATTGGGTCCACTCGGAA CTGATATTGAT

GCTGTGAAGAAACAGATCAACCAACTCAAGAACTTCAAGGATGAAGTTGATCCTCAT ATGGTAAAGGT TGAGGCTCTCAACAGACAAGCTCAAGAACTCACGGAACGCACATCGGCCGATCAGGCAGC CTCGATCA AAGAACCGCTGTCAGCTGTCAACAA

>>GCTGTCAGCTGTCAACAAACGATGGGACGACCTACTGCGAGGCATTGTGGAG AGACAACGGTCTCT GGAAAATGCCCTCCTGCGTCTCGGACAATTCCAACATGCTCTCAACGAGCTACTGGTTTG GATTGGTA AGACCGATAAAACATTGGACGAGTTGAAACCCGTGGCTGGCGATCCTCAGATTCTGGAAG TCGAGTTG GCTAAATTGAAGGTACTCATCAATGACATACAAGCTCACCAAACTAGCGTCGATACGCTC AACGACGC TGGTAGGCAGATAATAGAGAGTGGAGCTGACGAAGCGAGCGCCACCCAAGAAAAACTAAA CACCTTGA ACGTCCAATGGCGCTCCCTTATGCAAAAGGCTGCGGACCGGCAGCGAGAACTCGAAGATG CTCTGAAC GACGCCCAAAGATTCAACGCCGAAATCCAAGACCTCCTCTCCTGGTTGGGAGATGTAGAC AGCATCAT CACGGCCAGCAAACCGGTCGGCGGCCTTCCAGAAACCGCCTCTGAACAACTAGAACGCTT CATGGAAA TATACAACGAAATCGAGGACAACAGACCTAAAGTTGAGACCATCCTCTCTCAGGGACAAG AATATTTG AAGAAGGCCACCACGCCAGCTTCAAACTTACAGCATAATCTCCGCATGCTCA^

CGTCACCTCTAGAGCTAACGATAAGAAAATCAAACTGGAAATTGCCCTCAAGGAAGCCAC GGAGTTCC

ACGAGTCTTTGGAGGCATTCGTGGACTGGCTGACGAACGCGGAGAAGATTCTTACCA ACTTGAAGCCG

GTGTCCAGGGTCATGGAAACGATCCAGGGTCAGATAGAGGAGCACAAGGTGTTCCAG AAAGACGTCAG

CGCTCACCGCGAGATAATGCTCGCCCTGGACAAGAAAGGAACGCATCTGAAGTACTT CAGTCAAAAAC

AAGACGTTATTCTCATCAAGAATCTGITGATCAGCGTCCAGCACAGGTCGGAGCGTG TTGCCTCGAAA

TCGGCAGAGCGTACGCGTGCTCTGGATCTAGGTTTCAAGGAAGCTAGGGAGTTCCAC GACG

>>GGAGTTCCACGACGCTTGGGCCGGACTGATGACTT∞CTAGACGACACAGA ACACGCGTTGGATGA

ATTCCTAGCCGAGGCGATTGGCAACGATCCCGATAAGATCAAGAGTAGGCTAACGAA ACACCAAGACT

TCCAGAAAGCTCTATCCGGCAAACAGGGTACCTACGACGGCGTGATGAAAGCCGGGA AACAATTGAAA

GACAAAGCACCCAAAGCGGACGAGCCTACTTTGAAAAACATGCTGTCAGAACTGAAG AGCAAGTGGAA

TTCAGTCTGCCACAAGAGCGTCGAGAGGCAGAGAAAGCTAGAAGAGGCCTTGCTGTA TTCTGGGCAAT

TCAAAGACGCCATCGCGGCTCTGGTGCAATGGCTGCAAAAGGCAGAAAAGGAGCTAG CAGAAG

»AAAAGGAGCTAGCAGAAGACAATCTAGTTCACGGCGATCTTGATACGGTGACTCACCT AGTGGACT

TGCACCGGCAGTTCGAGAAGGAATTGGAAAAACGTAATGATCAAATGGAATCGGTCA TGCGTAATGGA

CAAGAATTGGAACGCACAGCCAACAAAGCTGACTCGATACAAATACGAGCGGAATTG AACGAGCTCAC

CGAGCTCTGGGAAACCGTCACTAGCCTGACCAGGGCGAAGTCTGACAGACTCCGAGA AGCTTTGAAAG

AAGCAGAGCGGCTACACCGTTCCGTCAATATGATCCTAGACTGGCTGTCAGAAGCCG AGATGAAGCTT

CGTTTCGTTGGTAACACCCCTGAAGACGAAGCGACAGCCTACGAACAGCTACGCGCC CTGGACGAATT

CAGAGCCCAACTCGGCGAGAAAGAAATCGAGAAGGATCAAACTCTACTACTGGCACA GAATATCCTGG

CCAAGGCCCATCACGACTCCATCAACGTCATCAAGAGCTGGATCAAGGTGATTCAGA CCAGGTGGGAA

GAGGITTCCCAGIX^CTTTGCAGAGGCATCAGAAGCTATCGCLAGCACATGCA

GGATGAATCTCTGGAAGAGCTCATCCAGTGGTTGCTGGGATTGGAGAATACGCTGATCGC CCTCAAGC

GAGAAGAGCTGCCAATGGATATTCCAGGBACGGAACAGC^

AATACGCAAAAGAGGCAGATTGAGGTCGACAGGGTATGTAAAGCGAAACAAGTCAAGACT GTCCAAGC CGTC AAAGAC C C C AAG AAGTTTG C CAAAGG AAAGGG C CAAATG LDEC012182 -RA, FBgn0003651 , svp

>>ATGACGTCATCTCTGAGCAACCACACGTACCTTAGTAGTTACATATCTCTAC TTCTGAGAGCAGAA CCATACCCCACTAGCAGATACGGACAATGCATCCAAACCAACAACATAATGGGTATCGAT AATATCTG CGAGTTGGCGGCCAGGTTACTCTTCTCTGCCGTAGAATGGGCGAGGAATATTCCGTTTTT TCCCGATC TCCAGGTTACTGATCAGGTCXSCACTACTTAGAITAGTTT^

CAGTGTTCCATGCCGCTTCATGTGGCGCCCCTAATAGCAGCCGCAGGACTACATGCGTCA CCTATGTG CGCAGATAGGGTGGTACAATTTATGGATCACATTAGGATATTTCAAGAACAAGTAGAAAA ACTGAAGG CGTTACATGTTGACTCTGCCGAGTACTCCTGTCTAAAAGCCATAGTTCTCTTCACGACT LDEC001843 -RA, FBgn0262483 , Rbp

>>ATGTCACATACTACACCTAGTATATATCCTGCTCTGAATACCAATATCGGGC ACAATTCGTACCAA GGTATCCAAAGTGGTACTACTAATATATCTGGTACATATATGTCACAAAATCCAGTTGGC GTTGGCTA TAATCCAAACCATAGTCAGTACAACAGCTTGGGCCACCAATATACGAACAAAAATATGAT GGGGAGTA CTCTGAATAGTTTAACACATCATCCAGTTGGAAIXMGATCGAGTTTGGGACAGTCAGGAG TACTAGGA CTACAACAATCAACTTTCAATAATCCAACGTTCAACAATCCTGTTAGCAGTACTCTCACC CAATACAG CITGCCTTACACCAATCCCATGAATTCCGTAGTT^

CCAATCCGCTTAGTTCTCAGTTCAATAGTTTACCTCTTACCGGAGGACCAATGAGTATTA AGTTGAAA CAAATAGACGACGTAGATTTGGGTACCCGTCGCGTTGCBACCCCTGTAACACCCCATCCG CCCCCATG GGGTGGTACCGTGATGTCTGGTATATGAGATTTGAGACCGAGGATGCTTACAGATGGAAT CGATTCAG ACTCGAGCGGTTTACATGGTGGCACTGATAGGAACTTCTTGAAIXMACLACAACCCTGTC AATACCGAG GGCCAGGTTGACATGCTAGATATTCCTGGAAAAGGAAGATGCTCGGTATATATAGCAAGA TTCTCTTA CGATCCTGAACCCGAAGTAGAAGAGGAACTGAACATTCBAGCAGGAGATTACTTATTAGT TTGGGGCG AACCAGTTGGACGAGGAGGATACTTGGATGCTGAATTGTTAGATGGAAGAAGAGGCTTAG TACCTTCT CATTTTGTTCAACGTCTCATAGGTGATGATCTTCTAGAGT1TCACCAGGCAGTGTTGAGT ACTTTGCG GGAAGAGGAAATCAACCAAGAAAATTTTGCGGCAGATGTTCAGCGACTCAACGAACTAGC TGAGATGG CTGAAGCACACGAAGATGAAGGGCCCGAAGGTGAGACAGCTGACCTTTTATTCTCGGTGT TAGTGCCG GCCCCCAGGCAACTGACTTTGGAGAGGCAGC >>TGACTTTGGAGAGGCAGCTCAACAAGAGTGTTCTTATTTCGTGGACGGCGCC AGATGGAATTGGTC

CAGGAAATCAAATAGAAAGTTACCACGTTTACGTTGATGGTGTATTGAAGGCCACTA TTAAAGCTACG

GAAAGAACAAGAGCATTAGTGGAAGGAGTGGATAGCAACAGGCCCCATCGTATAAGC GTGAGATCTGT

TACTGCAAATCGTAGAACATCTAGAGATGCAGCTTGCACCATGATAATCGGTAGAGA TACGCACTCTT

TAGGACCCAGTGCGGTGCGTGCATCGAATATTAGATCAACATCAGCTGTAATGAGTT GGTTGCCTGCC

AATTCTAACCATC^GCACGTTGTTTGTGTGAACAATGTTGAAGTCAGAACCGTCAAA CCAGGAGTGTA

TAGACATACGATAACTGGTCTGGCACCCAATACTCAGTATAGGGTAACAGTGAGGGC GAAACATCATA

GAGCTGCTCAGAACGTCGCTAACTTAGCTGAGGAACTGCCAATGCCAGCAGCTGCTC ATACAGATTTT

AGAACGTTGCCAAAGGGTCTTCCTGATCCTCCGAGCGATATCTTAGTGGAACCAGGT CCACAGGATGG

AACGCTTCTAGTTACTTGGCATCCTATACTCACCCCGCATCACCCAGGTTCTTCTAT AACCGGTTACG

CCGTATTTGCAGATGGTAAAAAACCCCATCGTATAAGCGTGAGATCTGTTACTGCAA ATCGTAGAACA

TCTAGAGATGCAGCTTGCACCATGATAATCGGTAGAGATACGCACTCTTTAGGACCC AGTGCGGTGCG

TGCATCGAATAITACATCAACATCAGCTGTAATCAGTTGGITGCCTGCCAATTCTAA CCATCAGCACG

TTGTTTGTGTGAACAATGTTGAAGTCAGAACCGTCAAACCAGGAGTGTATAGACATA CGATAACTGGT

CTGGCACCCAATACTCAGTATAGGGTAACAGTGAGGGCGAAACATCATAGAGCTGCT CAGAACGTCGC

TAACTTAGCTGAGGAACTGCCAATGCCAGCAGCTGCTCATACAGATTTTAGAACGTT GCCAAAGGGTC

TTCCTCATCCTCCGAGCGATATCTTAGTGGAACCAGGTCCACAGGAIX-CAACGCIT CTAGITACTTGG

CATCCTATACTCACCCCGCATCACCCAGGTTCTTCTATAACTGGTTACGCCGTATTT GCAGATGGTAA

AAAAGTAACAGATGTGGATAGTCCCACCGGAGATCACGCTTTGATTGATATAAGCAA ACTTCTGGGGT

TGAATCCTAAACACGTGACGGTTCGTACGAAAGCTAGAGACAGCCAATCTGCTGATA GCGTTCCTACT

CCGATTCCACTCAGC

LDEC012456 -RA, FBgn0000659 , fkh

»ATGTTGACGCAGAAACTCTACCCCGACGTGAACTCCATGTCGACGAGCACGAATGCTA TGTCCCCC ATGACCCCGACATACTCCATGAATTCGATGGCGATGGCCCAGATGAACTGCTCGCCGCAG ACTCCCAT GTTCGGCTCCAGCATGCTGAACTCGGGCATGTCGGGTCCGATGCCCATGAACAGGATGGC CCCGAGGA TAGACCAGACTATGAACGACACCTCGCAGCTGGGGTACACCACGATCGGCTCTCCGATAT CAAACATG AACGCAGCITGCATGGGCGCCACCATGTCGAACATCAACAACTACACGATAGGTAGGGGA GACCTGGG GGGCGGTGATACCTCCCCAAACAGCGCCCTGCAAAGGGCCAGAGCCGATAAAACCTACCG AAGGTCCT ACACCCACGCTAAGCCGCCCTACTCGTACA

>>TTCCGTTCTAGAGGCAGAACCAGCAGCGATGGCAGAATTCCATCAGACACTC GCTGTCTTTCAATG ACTGCTTCATCAAAGTTCCTCGCACTCCGGACAAGCCGGGAAAAGGTTCCTTTTGGAGTC TGCACCCG GAGTCTGGAAACATGTTTGAGAACGGCTGCTACCTTCGGCGCCAGAAGCGGTTCAAAGAT GAGAAGAA GGAGGTCATTCGCTCTTCGCACAAGAGTCCTTCTCACAGCGTTGACAGCAGGAGCAGCTC GGGGAAAA AGACCCCTCTGCAGCACGGGGATGACAAGGCTCACCACTTGGACAAGGTGAACGACAACC TGGGGAAC ATGCTOVGCATCOVCCCCGGGAAGTTGGATGTTGATCAGATGAACATGTTGAACGCGAAT GAGTTGCA TAACATGCAGCAGCACCATCAT

>>AGCAGCACCATCATCATCAGGGGATGACGCACGAAGAGCTCTCGGCGATGAT CAACAGGAACAACC ATCTGGCTTTGTCTAGCGAGCACCAGGCGATGCTACACCATGCTCCCATGGGGCACCACC TGAAGCAG GAGCCGACGGGGTACACGCCCTCGAATGATCCCTTTTCCATTACGAGGTTGCTGCCGACG GAAAGTAA GTCCGATATCAAAATGTACGACATGCAATACGCAGGGTATAATACTCTCAGCCCTTTGCC GAATTCTA TACATTCTCACGCGTCTATAGGGAATGATTATTACAACAGTCCGTCGCTGTATCACACGT CGGGGACG ACGTCGTTG

LDEC004820 -RA, FBgn0261552 , ps

>>ATGTGTTTGTGTCGCGGACTAAGTATTTGTGGAGATGGAACCTTTCAITTCA AATTATTGGTACCT AGTGTTGCCGCCGGTGCCATCATTGGCAAAGGCGGCGAAACAATTGCTCAGCTACAGAAA GAGACTGG GGCACGCGTCAAAATGTCCAAATCACACGATTTTTATCCAGGCATAGAACCACAGAACAT AAAAGTAC AAGCATCACTGCGAACTCATTCTTCATTTGTTCCAGGCACGACGGAACGAGTATGCCTAA TCACGGGC AGCGTGGAAGCCATCATAAACGTCCTGAATTTCATAATCGAAAAGATCAGAGAGAAGCCC GACCTGAC GAAGGCGGGCGATACCGAGAGCAAGATGCACGAGCGTGACAGGCAAGTGAAGATTCTCGT GCCGAATT CGACGGCGGGCATGATCATCGGCAAGGCGGGCAACTACATCAAGCAGATCAAGGAGTCGA GCGGGTCG TACGTGCAGATATCGCAGAAGGCGAAAGACGTCAGCCTGCAGGAGAGGTGCATCACCGTA ATCGGCGA TAAGGAGCAGAACAAACAGGCCTGTCTCATGATAATAAGCATAGGCAGTACCCATCCAGG TGCTCTGC CTGTTTCGAATTATCTCAGCGTGATGGACCAGACGGGCGCGACAAATGCGAGTACAGGTG TTTTCGGG GCONTGGGCAAGTTAGTTTGGGGGAATGTTTAGGTC

GAGGTACGATTCTGCATTCGATCCGTTCAGGCACCAAATGTCTGCTGCGACGGCCCC CATTTCTTTGA ACAACAACAGTTTCGGTTTGGGTACGGGACAACAGATGGCTGTGCTTAGTAAAAGTCCCA CTCCCGCA GAACTGGGCAGCAGCAAAGACACCAAAAACGTCGAAATAGCCGAGGTTATAGTCGGTGCA ATTTTAGG TCCAGGTGGGCGTTCACTTGTTGAAATCCAGCAGATA

>>GTTGAAATCCAGCAGATAAGCGGTGCCAACATCCAAATATCAAAAAAGGGTA TTTTCGCTCCCGGC ACCCGTAACCGCATCGTAACGATCACGGGCAACCGACAAGCCATCACGACTGCGCATTAC CTAATCGA GCAACGCATCAGCGAGGAAGAGATGAAAAGAGCCCGGAACAACGGCCTTGGCACTCTGGC GATGCAG

LDEC000193 -RA, FBgn0032987 , RpL21

CAAGGCAGCTTTGGTCGACGAGAGGCCCAAATCTTTTGAAGACTGTATCGCCTGGGCCCG CAACCACT GGCAGGAGCAGTACTCGAACCAGATTAGGCAGTTGTTGTTCAACTTTCCTCCGGATCAGC TCACAACC ACCGGCCAGTTGTTCTGGTCGGGGCCAAAACGTTGCCCGGAAGCGCTCACTTTCGATATC AATAATCC TCTCCATTTGGAITACGTCCTTGCGGCAGCTAAITTGAA^

GGGACAGGGCATATATTGCTGAAGTGGTCAGCAAGGTTGAGGTACCAGAGTTTGTGCCGA AGTCTGGC

GTCAAAATAGCTGTTACAGACTCCCAAATGGCCATGAACGGTAACAACGTCGACTTG GATCGAGTAAC

TCAAATTAAAGAGGAGCTACCCTCCGTCGAAGAACTGAACGGGCTCTGTCTTACTCC GCTAGAATTCG

AAAAGGACGACGACACCAATITCCACATGGATTTCATTGITGCTGCITCTAACCTCC

TATAAAATACCTCCCGCAGACAGACAGAAGTCTAAGCTCATTGCAGGTAAAATCATC CCGGCTATTGC

TACCACGACATCCGTCGTAGGGGGGCTCGTCTGCTTCGAGCTGTACAAACTGACACG AAGCATGAAGA

GTTTAGAACCATTCAAAAACGGCTTTGTCAACCTCGCGCTGCCTTTCTTTGGCTTCT CCGAGCCGATC

GCGGCCCCCAAGATGGAGTACTGTGGCAACGAGIX-GAGACTTTGGGATCGCTTCGA GGTCCAAGGAGA

GATGACGCTCAGCGAGTTCTTAACGTACTTCAAAGAGAAGCACAACCTCGAGATCAC AATGCTCTCCC

AGGGCGTTTGCATGCTTTACTCGTTTTTCATGGCAAA

LDEC005928-RA,FBgn0028969,deltaCOP

>>ATGGTGCTTATAGCTGCAGCAGTCTGCACAAAAGCAGGGAAAACCATTGTGT CTCGACAGTTTGTT GAAATCACCAAATCGCGAAITGAAGGATTACTGGCTGCTTTTCCTAAACTCGTACCCACA GGAACCCA GCATACTTTCGTTGAGACGGACTCAGTTCGTTATGTCTATCAACCTCTTGAAAGGCTTTA CATGTTAC TTATAACAACAAGAGCTAGTAATATTTTGGAGGATCTAGAAACITT^

CGTACATTCGTCGAGATGGATTCACATGAAGAGAAGGTTTATCAAGCAGTAAGACAGACT CAAGAACG AGAAGCCAAAATCAAAATGAGAGAAAAGGCAAAAGAATTGCAGAGGCAGAGAATGGAAGC TAAAAAAG GTACCAAATCATCATCTACTAACAGCGGAGGTTTTGGCAATTCAGGAAGCTATACACCTA CGCCATTC GTCGTCGATCCTTCCAATGTTTCTAATGATGTGAAACCACCTTCATACGCAGCTCCTATT CAAAAACC AAAAGGTATGAAGTTAGGTGGAAAAGGCCGTGATGTGGAATCTTTCGTAGATCAGCTGAA ATCTGAAG GTGAGAATGTCATCATTCCAGCCAAGAACAGTAITTCTCAACCAGGATCCAAAGCTCCAG CCATCAAA ACCGAGATTGATGACGTTCACTTGAGATTAGAAGAAAAATTAGTA

>>TAGAAGAAAAATTAGTAGTTAGGTTGGGCCGTGATGGAGGGGTTCAACAGTT TGAAGTGTTAGGAC

TTGCAACTTTACATATTGGCGATGAGAGGTGGGGAAGAATTCGTGTGCATCTTGAAA ATCAGAATTCT

CATGGAGTTCAGCTTCAAACACATCCCAATGTGGATAAGGAACTCTTCAAATTACGT TCTCAGGTAGG

AATTCACTACGTTGGTGTACTCAAATGGAGATTGCAAAGTACGGAAGAGACCCTGGT ACCACTTCTCA

TAAATTGTTGGCCCTCAGAAGCCGGAGATGGAAGTTGTGATGTTAATATAGAATATG AACTTGCCCAC

AGTAATTTAGAACTTATCGACGTCAATATTACCATTCCGTTGCCAATCGGTTGTTCC CCCGTAGTCGG

GGAATGTGACGGCACATACTCGCACGAATCCAGAAGAAACCAACTTGITTGGAATTT GCCTGTTGTCG

ACTTTAGCAACAAGAGCGGATCTTTAGAGTTTAGCGCTCCGAAAGCTATTCCTAATG ATTTCTTTCCG

CITTCTGTGGCTTTCACGTCTAAATCTTCATACGCAAGTATCAAGGTTACCGAAGTT ACTCTCATAGA

TGACGATTCTCCTGTTAAATATTCGGTAGAAACTGTGTTGTATCCTGATAAATATGA AATAGTG

LDEC007421-RA,FBgn0038925,Cchl

>>TTGITTGATATAATGGGAAACACGGTTTCAGCTGCAGAGATTGCTGCAGCAC AAATACTCCGCCCA

AATCATCCCATTGAAAAACATCGTCATATAGATATCCATAAAITTGAGGGAGAAATT CCCCCA

TCCGATGCATCAGAAGTCCAAATCGAAGACATTTAGITCGGAATCTCCTGTTGGAGG AATGAGCGATG

AGTTAAATCCTTTGAATATGATGGGTCCTGCCAATCAAAGTCCTTCTCCAGGTCAAC CTTTTCCATTA

TCAACCCATAGGGAAGTTTCTACAATTCCGAAGGCTATAGTCAAGGAAGGAGAAAGT CAATTCTGGAC

ATATCCAAGCCCGCAGATGTTCTGGAATGCTATGCTGAGAAAAGGTTGGCGATGGAA GGAAGAGGACA

TTAAACAAAAAGATA

>>ACATTAAACAAAAAGATATGGATAATATCATTAAAATCCACAATGCTAATAA TGAACAAGCATGGC

AAGAAGTATTGAAATGGGAAGCACTTCATTACAATGAGTGTAAAGATCCCAGACTGA AAAGTTTTGGA

GGAAAAGCAACAGATTATAGTCCTCGAGCAAGAATGAGACAACTTATGGGGTACGAA CTACCATTCGA

CAGACATGATTGGATAGTTGACAGATGTGGGAAAGAAGTTCGATATGTTATCGATTA TTATGATGGAG

GATCAGTAGATGATAAATATAAATTCGCCCTTTTAGATCCTTGTTTGGGATATACTG CC

LDEC010816 -RA, FBgn0083975 , Nlg4

>>ATGTCTATCACAAAACTTGAAGTriTCATAAATGATCTGATTGTCATCGTGA TATCCCACT AITGAGTTTTTGCTGACATTTTGGGTACATTCCLACAGGTTTCCTC

CAAAGCTCGCGTCGCAAACTACGGGCTCATGGACCAAATAGCAGCGCTCCATTGGAT TCAGCAGAACA TAGCITTATTCGGCGGTGATCCAGACAACGTCACCATGGCTGGAGATGGGTCTGGAGCTG CTTGTATA AATTTTCTTATGATATCACGAACGGTGATGCCTGGTCTCTTCCATAGAACGATTCTCTTG TCGGGATC AGCTCTTTCATCTTGGGCATTGGTTGAAGATCCGGTCAACTATGCCGTCAAACTAGCCAA AGAAGTCA ATTGCTCCATTCCAGAAGACGTCGGAAAAGACCATGAAGCCATTGTGGACTGCCTTCGCG ACACACCT CTGGAAGAACTCCTCCAAGCCGACGTCATAGCCCCAGCGTACCTCAGCGCATTCGGTCCC AGCGTAGA CGGAGTCGTCATGAAAACGGACTTTGCCAAAGAACTGGTAACGTACTTCAAACCACAAGA CCTGCAGA ACTTCGTAGGACCGGTCAACGCCAACATGAAGAGAAGTGAGACCACTCTGACCCCGAAGG GCAACAAT CCCTACGACTTGCTTTTCGGCGTAGTGACTAGTGAGGCGCTGTGGAGGTTTTCGAACACC GATGTGTC TGCCGGGTTCGAGGGGGAACGCAGAGACAAAATAATTAGGACTTACGTGCGGAACGCTTA CACTTATC ATTTGAGTGAAATATTTTTGACGGTAGTGAATGAATATACGGATTGGGAGAGGACGGTGC AACACCCT GTGAATACGCGGGACTCTGCCATTGCTGCGCTTAGCGACGCGCAGTTCGTAGCTCCGTTG GTGCAAAC TGGGGATTTGTTGAGTGCTAAGCCTCCACAGCCCGGTCAGGAAGCGACTGGCCCCAAGAC TT^ ACGTATTCGATTATCAAACGAAAGATGGAGATTATC CTCAA LDEC014165 -RA, FBgn0002622 , RpS3

>>TTGTGTTCACCTCGTGTCTCTTCCTTTGCTGCTGGAACCC^

AAGAAGCGCAAATTCGTAGCCGATGGAGTCTTTAAGGCTGAAITGAATGAATTTCTGACT CGGGAACT TTCCGAAGATGGATATTCTGGAGTGGAAGTACGTGTTACCCCAACGCGTACTGAAATTAT CATTATGG CAACGAGAACAGACAGAGTCTTGGGCGAGAAGAACAGAAGAATCCGCGAGTTAACTTC^G ITGTGCAA AAGAGATTCCGTTTCCCCGAGAACTCCGTTGTTTTGTACGGAGAAAAAGTAGCAAACCGT GGTTTGTG TGCTATCGCCCAGGCAGAATCCTTGAGGTTCAAGCTTATTGGAGGTCTTGCTGTAAGAAG AGCATGCT ATGGTGTCTTGAGGTATATCATGGAATGTGGAGCTAAAGGGTGTGAAGTAGTTGTATCTG GAAAACTA CGTGGTCAGAGAGCAAAATCTATGAAATTCGTAGATGGTCTCATGAITCATTCAGGAGAT CCATGCAA TGACTATGTAGACACTGCCACCCGCCACGTATTGCTGCGACAGGGAGTGCTGGGAATAAA AGTTAAGA TCATGTTGCCTTATGATGCCACAGGCAAAATTGGTCC

GCTCAACCTAAGGATGAGGTTTTACCTTTATACCCCAGCAGCGAGGTGAAGACAGTG AAGCCTGATGC

ACCTGTTCTTCCGGTTCCTGTT

LDEC007118 -RA, FBgn0015756 , RpL9

>>ATGAAGCAGATTGTAACAAACCAAATCGTCAAAATCCCTGAGGGGATCACGG TCACTGCCAAATCC

CGTACTATCACAGTAAAAGGACCTAGAGGCACCCTGAAACGCTCTTTCAAACATTTG GCTTTGGATAT

TCGTATGGTTAACCCCAGAACCTTGAGAGTAGAAAAATGGTTCGGTACGAAAAAGGA ATTGGCTGCTG

TCAGGACAGTG1X3TTCCCACGTAGAAAATATGTTGAAAGGTGTAACGAAAGGTTAC CAATACAAAATG

AGGGCCGTATATGCTCATITTCCCATCAATTGTGTAACCACAGAAAACAATTCCATT A

GAATTTCTTGGGTGAAAAGTATATCAGGAGAGTCAAAATGGCTCCAGGTGTAACGGT CACCAACTCCC

AGAAGCAGAAGGATGAACTAATCATTGAAGGAAACTCTTTGGAAGACGTATCCCGAT CTGCTGCACTC

ATCCAACAGTCTACAACCGTCAAAAATAAGGATATCCGTAAATTTTTAGATGGGITG TATGTTTCTGA

GAAAACGACTGTTGTTCAAGACGAA

LDEC015353 -RA, FBgn0001942 , eIF- 4a

>>TTGGAACCAGTAATCCTACAGTCCTTTCCGTTTAGTGAAACGTTGAGAATAG ACATGTCGTTGCAA GATAGACGTGAAGAGTGGGACAAGAAIXMCCCTACCAATGATGAAAAAGAATCACAAGGA TACGATGG CCCTCGAGGGATGGACCCTGATGGTGTCATCGAATCAAACTGGGAAGAGGTTACTGACAA CTTCGACG ATATGAACCTAAAGGAGGAACTTCTCAGAGGTATCTATGCATAIX-GTTTTGAAAAACCC TCAGCTATT CAACAAAGAGCCATTATCCCTTGCGTGAAAGGTCATGACGTTATTGCTCAGGCCCAGTCT GGTACTGG AAAGACAGCCACATTTTCGATATCAATCTTGCAGCAAATTGACACTTCCGTTAGAGAATG CCAAGCCT TGATTTTGGCCCCCACACGTGAATTGGCTCAGCAGATCCAAAAAGTAGTAATCGGATTAG GAGATTTC ATGTCTGCACAGTGTCATGCTTGTATTGGTGGTACGAATGTCAGAGAAGATATGAGGAAA CTCGAAAC AGGTGTTCATGTTGTTGTTGGTACACCTGGTAGGGTATATGATATGATCACTCGGCGAGC TTTGAGAA CAAGTCATATTAAGATGTTTGTACTGGATG

>>TTATATTACTATCTGCTACCATGCCCAACGATCTCCTAGACGTTACAAAATC TTTCATGAGAAGTC CTATCAGAATCTTAGTAAAAAAGGAAGAGCTTACACTCGAAGGTATCAAGCAATTCTITG TATATC GAACGTGAAGACTGGAAATTGGAGACTTTATGCGACITATATGATACCCITTCAATTACG CAGGCTGT AATCTTTTGTAATACACGTCGCAAGGTGGACTGGCT

TCTCTGCTATGCACGGAGATATGGAGCAGAGGGAACGAGATGTCATTATGAGGCAAT TCAGGACTGGG TCTTCAAGAGTACTCATTACCACTGATCTATTGGCCCGT^

TATAAATTATGAT1TGCCTTCAAATAGGGAGAACTACATTCATAGGATTGGTCGTGGTGG TAGATTCG GTCGTAAGGGTGTAGCCATAAATTTCGTGACGGAAGAAGACAAACGTACACTTAAGGATA LDEC017151 -RA, FBgn0262475 , bru- 2

>>ACCTGTTTATCTACCACCTGCCCCAAGAATTCACTGACACGGACCTGGCGTC GACTTTCCTACCTT TCGGTCCTGTTATTTCTGCCAAGGTGTTCATAGACAAACAGACGAACCTGTCCAAGTGTT TCGGGTTT GTGTCGTTTGATAACGCCCAATCCGCTCAACAAGCCATATCTGCGATGAATGGGTTCCAA ATCGGTAC CAAAAGGCTGAAGGTC CAACTGAA LDEC022744 -RA, FBgn0004403 , RpS14a

>>ATGGCTCCCAGAAAAGGAAAAGTACAGAAAGAAGAAGTACAGCTTTCACTTG GACCTCAAGTCCGA

GAAGGCGAAATAGTTTTTGGAGTTGCTCACATTTTTGCAAGTTTCAATGATACTTTC GTCCA

TGATTTGTCTGGAAGAGAAACCATCTCCAGAGTTACTGGTGGTATGAAAGTAAAAGC CGACAGAGATG

AAGCTTCTCCTTATGCCGCTATGTTAGCAGCTCAAGATGTAGCTGAAAAATGCAAAA CATTAGGTATT

ACTGCACTCCACATCAAGTTGCGAGCAACCGGTGGTAACAAGACAAAAACTCCTGGA CCAGGAGCTCA

GAGTGCCCTCAGAGCTTTGGCTCGTTCCAACATGAAGATTGGACGCATTGAAGACGT TACACCAATCC

CCTCAGATTCCACTCGTAGGAAGGGAGGTCGTCGTGGACGTAGGTTG

LDEC018094 -RA, FBgn0004656 , fs ( l ) h

>>ACCAGTTTGCATGGCCT1TTCAACAACCAGTCGATGCAAAGAAA

GAATAATAAAACAACCCATGGACCTGGGAACAATAAAGAAACGTTTAGATAACAATTACT ATTTGTCG GGTAAAGAGTGCATTCAAGATTTTAATACAATGTITACGAATTGTTACGTITACAATAAA CCGGGAGA AGATGTTGTCGTAATGGCAGAAACTTTAGAAAAAGTGTTCTTGACTAAAGTAGCGGACAT GCCCAAAG

AGTAGGAGTTCCCATTCTAGCTCTCACAAGAAGCGCAGTAGGGATGATAGTAAGGATCGA CATCATTC AAAGAAATCCAAAAAG

LDEC020367 -RA, FBgn0016978 , snRNP-Ul - 70K

>>ATGACAC_AGITTTTACCACCAAAITTGT^

CCTCCTGTGGCGAAATTACCACACGAAAAAAAGAACAGGGGATATTTAGGACTGGGGCAG TTTCTAAG

TGAATTTGAGGATCCAAAAGACACACCTCCACCAACCAGAGTCGAAACTAGAGAAGA AAGACTAGAGA

GGAGGCGCCGAGAAAGAGCTGAACAAGTAGCTTATAAGTTAGAACAAGAAATCGCTA TATGGGACCCT

GCCTCAGCAGCAAATATTACAGTCGACCCATTTAAAACTTTGTTTAITGCTAGAAT^

CTCAGAGTCGAAGCTACGAAGAGAATTTGAAGTTTATGGACCGATTAAAAAGATTGTGCT GATTCACA

ACAGTGTCAACGGGAAACCAAGAGGGTATGCTTTTATAGAATATGAAC^CGAAAGAG ACATGCATTCT

GCTTACAAACATGCTGATGGCAAGAAAATAGATGGCAGGCGGGTTTTAGTAGATGTG GAACGGGCAAG

AACAGTCAAAGGATGGCTTCCACGAAGATTGGGITTTTTTGCT

LDEC012869 -RA, FBgn0085383 , CG34354

>>CATATGCTTTTGTTGAATTCACAAACCACCAGTCAGCATCCACAGCTTTGGC TGCCA

GGITGTITTTAGATAAAGAAATGAAAGTGAATTGGGCGACAAGTCCAGGCAATCAACCCA AACAAGAC

ACATCCAATCACCATCACATTTTTGTTGGTGATTTATCCCCCGAAATAGAGACTGAC ACATTG

GGCCITCGCTCCTTTCGGAGAAATATCGAATTGCAGAATAGTGAGAGATCCACAAAC ACTCAAATCCA

AAGGTTATGCTTTCGTATCATTTGTTAAAAAAGCTGAAGCA^

CAATGGCTAGGATCCCGGTCCATCCGTACAAACTGGTCTACGAGAAAACCACCACCGCCA AGAACAGA AAAGCCACAGCAGCGTGCTAAACAACCTACCTTTGATGAAGTTTATAACCAGACATCTCC GACCAATA CGACTCffATATTGTGGTGGCTTTACAAACGGTTTGACG^

TATGGAGCCATTCACGATATTCGTGTGTTCAAGGATAAGGGGTATGCATTTATAAAATIT GTAACAAA AGAAAGTGCTACACATGCAATTGAGAATGTCCATAATACAGAAATAAATGGTCAGAATGT GAAATGTT TTTGGGGAAAAG

>>AATCTTTTTGGGGAAAAGAGAATGGAGGCTTAGGACCTCAGTCTGGTTCACT ACCCCCIX-¾3TGCAG

GGGTTCCTCAATCTGCTGGTCCACCGTACTCATATGGATATGGGGGGTATTGGGGCT ATCCTCAGGGG

TATAGTGGAGGTGGATATGTACAAGGTTACCAGCCGTACCAACAATATCAGCAGTAT CCTGGAGGTCA

GCAATATTGCGTCATGCCGCAGCAGGGACAGTGGTCAGGACAGCCAGGTCAGCAACC AAATGTACCAG

TAATGTATAGTAATGTTCAGAAATATCCATCTCAG

LDEC009257 -RA, FBgn0020445 , E23

>>GAACCTTTATGTAAAAGATGGAAGAGGAAGATCTGCTACGTCCTCCAGCAAG ATATCTTCTTCCCT GACCTAACGTTAAGGCAAACCTTAGAGTATAGCGCGCGACTAAGATTACCTGACACATTG AGCCATTC GCAAAAAATGCAGTACGTTGACCACATAATCGATCTATTAGAGCTCGGTAACTGCCAAGA GACCATCA TAGGAGACAACCTCAACAGAGGCCTCAGCGGTGGAGAGAAGAAGAGGGCCAATATAGCTT GTGAATTG TTGACTAATCCTTCGTTAATGTTATTGGATGTGATGGAACAAATAAAAGGAACTTCCGAC ACACGAAA AAGACTTTTGGCTGCGGCCAAAGAACTAAGGAAAAGGAAGGATTACCCTATAGAACTACA GCACGATT GTTACGTTAATGAAAAATATGATAAITCGAATAAAATGTTGCTGCCITCTC^TGGACC^T ACTCAAGT TTGGAACTCAGITCAGAAACTAGCGACGCAGAITGTTATTTCACCTGGCCTACTAGTTAT TGGACGCA AITCACTGITCTCTCCCAAAGAAACTTCCAAGAAGCGATGCC

TGCAAACTGTACTATTGGGGATAATGGCAGGTTTTCITTGGTTCCAGTTGGATAGGA CGGAAGAGTCG CTGCATGATATACAGGGTTGGATGTTCTTCTCTACCACCTACTGGATGCTGTI^ITCACA ITITGGAGC TCTCATTCCTCCAGAACGTGAAGTGATCAATAAAGAGAGACTTTCTGGTGCATACAGACT GTCAGCGT ACTATTTGGCAAAAATGGTTGGCGAACTACCTCTGATTGTAACTCTTCCAGGTGTATATI TCCTTATT TCCTATCCCATGATGGGAATTCATTCTATCATGGTGITTT^

CTCCCTCGTTGCTCAGAGTATCGGCTTCTTCATTGGGGCGTGTTGTATGGATATGGAGAC CAGCGTCA CTATCAGCGCCCTCTATACACTCGCAACGCAACITTTCAGCGGTTTCCTGGCGACAAACA TACCGTGG TGGCTTACGTGGATGCGATATTTGTCGATGGTCCATTATGCTTATCAGAACATGCAGATT GTTGAATT CGGAGAAGGAATGGAAATCAAGTGCGGATCCCAATCCAAGTTCGAAATATGTTCAAAAGG TGCCGAAA CCATACCAGTGAGTGCCATACTAGAGGCTCAGGGATCATATCTTCCGCTTTGGGCAAACA CTCTCATT CTGTTCTGCTTCITCGTCGTCCTGCGTCTCAGIXMTTACGCTGTTCITCGTTACTTGAAG ACGGCAAA G

LDEC006484 -RA r FBgn0051004 , mesh

>>ATGGATGTTTGTTGGTTGGTTGATTGGTTGGTTGATCCTATGACTTCCGATA TTGCTCCACCGGAT

AGTGATCAGAGAGGATATTCAGGAGTACCATATGTCTTGACGGAAACCAGACTGCAA CAGATCCGCCA

AAATTTCATGTATCCCTACTACAACAGAGGCGGTAATGCAGATGACGAAGGAGACTA CCAGAAAGAAA

TTCAATCATCTATTCCGCAAGTGTACAAGAACCTCAACTTCCAACTCCCITTCTTCG GATO

AATTACACGAGGGTCTCCTTGAACGGTTATTTGGAATTCAGCGATCCTCCTCCAAAT TACGACTATCC

TTTGGTCTTTCCAGTAAAGGAATGGCCTAAAAAGAACGATC^

AATGTAGAATCGGTAACCTGAGGGACGGAGATATTGATCAAAGAGACCCTGGAGTGTACT TTAGGATG GAAAGGGATCTCAGAAATAGGCAGGACAGGATGGGAGTGGAGATCAGAGAACGACTGAAA TGGGATAT AAGGGAAGGGGTGATAGGGTCAGAAACATTCAATCCGAAACACGCCATTATCGTCACATG GAAAAATA TCTCTTTC