RSV VACCINES

FIELD OF INVENTION

The present invention relates, inter alia, to modified respiratory syncytial virus (RSV) polypeptides, nucleic acids and vectors that encode them, related immunogenic compositions and RSV vaccines.

ACCOMPANYING SEQUENCE LISTING

The contents of the text file (Name: "Sequence_Listing.txt", Size: 54,962 bytes; Date of Creation: March 12, 2014) submitted electronically herewith is incorporated herein by reference in its entirety. BACKGROUND OF THE INVENTION

Disease caused by respiratory syncytial virus (RSV) infection is a serious issue not only for infants but for children up to about age 5 and for the elderly. The scientific community has been trying to develop a safe effective RSV vaccine over the last fifty years, but there is still no RSV vaccine that has been approved. In fact, one RSV vaccine predisposed children to an enhanced RSV disease after a subsequent infection with RSV.

RSV contains an F protein at the surface of the viral particles which mediates fusion of the viral membrane and cellular membrane. Expression of the F protein by RSV infected cells causes the F protein to be expressed at the surface of the infected cells where it induces fusion between the cellular membranes of adjacent cells, giving rise to syncytia.

RSV fusion (F) protein is initially synthesized as an inactive precursor (F0), which undergoes oligomerization before transport through the secretory pathway. F0 is processed by proteolytic cleavage into the disulphide-linked Fl and F2 subunits producing the mature and active form of the fusion protein (F2s-sFl). The available evidence suggests that this cleavage occurs during transport in the trans-Golgi by a host cell protease. A polybasic amino acid sequence (Lys-Lys-Arg-Lys-Arg-Arg) is located between those sequences in F0 that eventually form the Fl and F2 domains in the mature protein. This sequence constitutes a furin cleavage site. The protease cleavage site is located immediately proximal to a stretch of hydrophobic residues which constitute the N-terminal 26 amino acid residues of the Fl domain. The proteolytic cleavage of F0 thus creates the hydrophobic N terminus of the Fl subunit which is presumed to be inserted into the target membrane during virus-mediated fusion. The proteolytic activation of the F protein is an essential feature of this process. A humanized antibody against RSV F protein is given as a prophylaxis against RSV infection or for reducing serious disease in infants, but the costs for monthly administration are relatively high. Therefore, there is a strong need for an effective RSV vaccine.

Citation or discussion of a reference herein shall not be construed as an admission that such is prior art to the present invention.

SUMMARY OF THE INVENTION

The present invention relates to, inter alia, respiratory syncytial virus (RSV) proteins, modified RSV proteins and nucleic acids and vectors that encode one or more of them. The invention also provides compositions, including immunogenic compositions, pharmaceutical compositions and vaccines. The compositions, nucleic acids, vectors, and polypeptides of the invention can be used to induce an immune response to RSV or an RSV protein(s) and/or to treat or inhibit an RSV infection in an animal.

Some embodiments of the invention include a modified respiratory syncytial virus (RSV) F protein, wherein the F protein is modified to reduce fusion activity. Some embodiments of the invention include a modified RSV attachment G-protein, e.g., a. fragment thereof.

In some embodiments, an RSV F protein has been modified to reduce fusion activity as compared to a native RSV F protein. A modified RSV F protein may comprise a deletion of at least a portion of the fusion peptide domain. In some embodiments, a deletion of the fusion peptide domain comprises a deletion corresponding to amino acids 137-145, 137-146 or 137-155 of SEQ ID NO:l 1. In some embodiments, a modified RSV F protein comprises a deletion of at least a portion of the cytoplasmic domain, transmembrane domain or both, which may be with or without a deletion of at least a portion of the fusion peptide domain. In some embodiments, a deletion of the cytoplasmic domain and transmembrane domain may comprise a deletion corresponding to amino acids 525-573 of SEQ ID NO:l 1.

Some embodiments of the invention provide nucleic acids and vectors comprising a coding region for a modified RSV F protein. In some embodiments, a coding region for the modified RSV F protein is operatively linked to a vaccinia H5 promoter or a vaccinia p7.5 promoter.

The invention also includes nucleic acids and vectors comprising a coding region for at least a portion of an RSV attachment G-protein and in some embodiments this nucleic acid or vector further comprises a coding region for a modified RSV F protein. Some embodiments of the invention utilize at least a portion of an RSV attachment G-protein comprising a sequence corresponding to amino acids 2-101, 10-77 or 45-58 of SEQ ID NO:6.

The invention also includes immunogenic compositions and pharmaceutical compositions, for example, comprising a nucleic acid, vector, protein (e.g., a modified RSV protein) and/or composition of the invention.

Additionally, the invention includes methods for inducing an immune response to an RSV protein and/or RSV viral particles and methods of inhibiting RSV disease in an animal comprising administering to an animal a nucleic acid, vector, protein and/or composition of the invention. In some embodiments, administration is by a route selected from the group consisting of intravenous, subcutaneous, intradermal, intramuscular, inhalation or intranasal route. In some embodiments, administration is to a mouse, primate or human.

The invention also includes cells comprising a nucleic acid or a vector of the invention, such as a viral vector.

This summary of the invention does not necessarily describe all features or necessary features of the invention. The invention may also reside in a sub-combination of the described features.

BRIEF DESCRIPTION OF THE FIGURES

For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise

arrangements and instrumentalities of embodiments depicted in the drawings.

Figures 1 A and IB depict various coding regions that were constructed for expressing RSV proteins. H5 is a relatively strong promoter and p7.5 is a relatively weak promoter, both from vaccinia virus. TM is the transmembrane domain of an RSV F protein. CT is the cytoplasmic tail/domain of an RSV F protein. FP is an RSV F protein fusion peptide. G2NA is an RSV-A G protein conserved domain (e.g., amino acids 130-230). Fl and F2 are their respective domains in an RSV F protein.

Figures 2A, 2B and 2C are schematic representations of vectors vEM132, vEM134, and vEM138, respectively. Flank 1/2 Del3 = 3 ' and 5' flanking sequences of the modified vaccinia virus Ankara (MVA) deletion III insertion site; Azami-Green (MBL International, Massachusetts) is a green fluorescent protein coding region used for detection of recombinant MVA; BsdR is a blasticidine resistance gene for selection of recombinant MVA; F protein is a F-protein coding gene, Fla...at is a repeat of the 3' end of Flank 1 for deletion of selection and reporter cassette after isolation of the recombinant MVA. Figure 3 shows expression analysis by Western Blot for the mEM60, mEM61, mEM62, mEM63, mEM64, mEM66, mEM85, mEM86, mEM87 and mEM88 based MVA viral vectors from the cell lysate (Figure 3 A) and supernatants (Figure 3B), respectively.

Figure 4 shows expression analysis by ELISA for the mEM60, niEM61, mEM62, mEM63, mEM64, mEM65, mEM66, mEM67, mEM85, mEM86, mEM87 and mEM88 based MVA viral vectors from the cell lysates (Figure 4A) and supernatants (Figure 4B), respectively.

Figure 5 shows the verification of the preservation of the antigenic structure of the F protein with several different F protein antibodies by ELISA. Only data for constructs mEM60, mEM62, mEM85 and mEM87 are shown.

Figure 6 shows the analysis of the growth of mEM60, mEM61 , mEM62, mEM63, mEM64, mEM66, mEM85, mEM86, mEM87 and mEM88 based MVA viral vectors in the production cell line AGEl .CR.pIX.

Figure 7 shows the analysis of an anti-F antibody titer from a mouse study. Panels A and B bar graphs are the same except they show the results of different statistical analyses.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO: l nucleotide sequence of a modified F protein with Δ137-145 fusion peptide and includes transmembrane domain (TM) and cytoplasmic domain (CT) (mEM85 and mEM87)

SEQ ID NO:2 amino acid sequence of a modified F protein with Δ137-145 fusion peptide and includes transmembrane domain (TM) and cytoplasmic domain (CT) (mEM85 and mEM87)

SEQ ID NO:3 nucleotide sequence of a modified F protein with Δ137-145 fusion peptide and no TM-CT (mEM86 and mEM88)

SEQ ID NO:4 amino acid sequence of a modified F protein with Δ137-145 fusion peptide and no TM-CT (mEM86 and mEM88)

SEQ ID NO:5 nucleotide sequence of a conserved RSV attachment G-protein (RAGP) w/N-Met (mEM64, mEM66, mEM87 and mEM88)

SEQ ID NO: 6 amino acid sequence of a conserved RSV attachment G-protein (RAGP) w/N-Met (mEM64, mEM66, mEM87 and mEM88)

SEQ ID NO: 7 nucleotide sequence of a p7.5 promoter

SEQ ID NO:8 nucleotide sequence of a H5 promoter

SEQ ID NO:9 nucleotide sequence of Fwd primer SEQ ID NO: 10 nucleotide sequence of Rev primer

SEQ ID NO: l 1 amino acid sequence of an RSV F protein.

SEQ ID NO: 12 nucleotide sequence of an RSV F protein (mEM60)

SEQ ID NO: 13 amino acid sequence of an RSV F protein (mEM60)

SEQ ID NO: 14 nucleotide sequence of a modified F protein with deletion of the TM and CT (mEM61)

SEQ ID NO: 15 amino acid sequence of a modified F protein with deletion of the TM and CT (mEM61)

SEQ ID NO: 16 nucleotide sequence of a modified F protein with deletion of the fusion peptide (mEM62, mEM65 & mEM66)

SEQ ID NO: 17 amino acid sequence of a modified F protein with deletion of the fusion peptide (mEM62, mEM65 & mEM66)

SEQ ID NO: 18 nucleotide sequence of a modified F protein with deletion of the fusion peptide region and deletion of the TM and CT (mEM63, mEM64 & mEM67)

SEQ ID NO: 19 amino sequence of a modified F protein with deletion of the fusion peptide region and deletion of the TM and CT (mEM63, mEM64 & mEM67)

SEQ ID NOs:20-28 amino acid sequences of 2A sequences, 2A like sequences, 2A homologue sequences and variant 2A sequences derived from Foot-and-Mouth Disease Virus (FMDV)

SEQ ID NOs:29-34 amino acid sequences of proteolytic cleavage sites

DETAILED DESCRIPTION

As used herein the transitional term "comprising" is open-ended. A claim utilizing this term can contain elements in addition to those recited in such claim. Thus, for example, the claims can read on methods that also include other steps not specifically recited therein, as long as the recited elements or their equivalent are present. Wherever embodiments or aspects are described with the language "comprising," otherwise analogous embodiments described in terms of "consisting of and/or "consisting essentially of are also provided.

A list of elements joined by "and/or" means that anyone of those elements may be included, all of those elements may be included or any subset of the elements may be included, e.g., it is not limited to one or all of the elements. For example, a list of 3 elements joined by and/or would include 1, 3 or any of the combinations of two elements.

It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein. The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

The term "corresponds" or "corresponding" when referring to an amino acid(s) or sequence in a particular protein refers to the particular amino acid(s) in that particular protein and also to an amino acid(s) in a related or similar protein that may provide a similar function as the particular protein and/or is located in a similar position. For example, an amino acid(s) in an RSV F protein from an RSV A type virus may be found to correspond with an amino acid(s) in an RSV F protein from an RSV B type virus, for example, determined by aligning the amino acid sequences. For example, one skilled in the art can align two or more related sequences to determine corresponding amino acids, e.g., using a BLAST program. Also, corresponding amino acids can be determined, e.g., by aligning motifs (e.g., a fusion peptide motif, transmembrane domain or cytoplasmic domain) within related or unrelated proteins. Such an alignment may also be used to derive a consensus sequence(s) or particular domain/region. An example of alignments showing corresponding regions and amino acid sequences in similar proteins is shown in Figure SI of Swanson et al. (PNAS (2011)

108(23):9619-24).

A "modified protein" or "modified RSV protein" is one that is not normally found in nature or is different from the wild-type version of the protein. For example, a modified protein, as compared to the natural or wild-type protein could have a carboxy terminal (C- terminal) truncation, an amino terminal (N-terminal) truncation, an internal deletion of one or more amino acids, substitution of one or more amino acids, insertion of one or more amino acids, or any combination thereof. Modified proteins include those with deletions of portions or entire domains/regions, such as transmembrane, cytoplasmic or fusion peptide

domains/regions.

Some embodiments of the invention generally relate to modified RSV polypeptides including nucleic acids and vectors coding for a modified RSV polypeptide(s). The modified RSV proteins can be used, for example, to elicit an immune response to RSV viral particles and/or to RSV proteins. Modified RSV protein candidates can also be used to study the function, characteristics, structure, interactions, etc., of the native protein. In some embodiments, the immune response can be B-cell mediated, T-cell mediated, or a combination thereof. In some embodiments, the modified RSV proteins and/or vectors expressing them can be used, e.g., in a vaccine, to elicit a protective immune response that lessens RSV disease or completely prevents disease. Nucleic acids, vectors, proteins, compositions and methods of the invention can be used, in some embodiments, to inhibit RSV disease.

It is understood that when the use of a protein is discussed herein, in some cases the same or similar use may be performed with a nucleic acid or vector that codes for the protein. For example, where a protein is administered to an animal to induce an immune response, a nucleic acid or vector coding for the protein may be administered so as the protein is expressed in vivo and an immune response is induced.

One or more modified RSV polypeptides or vectors coding for the polypeptides can be used in combination to elicit an immune response, for example, administered

simultaneously, within 24 hours of each other or at different times such as one being given initially and the same modified protein or another modified protein at a later date, e.g., as a booster. Different modified proteins may be derived from completely different RSV proteins, such as RSV F and G-protein, or from modified RSV proteins derived from the same RSV protein such as two differently modified RSV F proteins. In some embodiments, a modified RSV polypeptide(s) can be administered directly to an animal, or a nucleic acid or vector coding for a modified RSV polypeptide(s) may be administered or both.

In some embodiments, a nucleic acid codes for more than one RSV protein. In some embodiments, at least one of the RSV proteins is modified.

A modified RSV protein can be a modified version of any protein coded by an RSV viral genome. In some embodiments, a modified RSV protein is a modified RSV F protein or a modified RSV attachment G-protein. In some embodiments, a modified RSV F protein or a modified RSV attachment G-protein can be modified by a carboxy terminal (C-terminal) truncation, an amino terminal (N-terminal) truncation, an internal deletion of one or more amino acids, substitution of one or more amino acids, insertion of one or more amino acids, or any combination thereof. This includes those with deletions of entire domains/regions, such as transmembrane, cytoplasmic and/or fusion peptide domains/regions, or portions thereof.

In some embodiments, an RSV modified protein comprises at least one, two, three or more modifications selected from the group consisting of deletion of at least a portion of the fusion peptide, transmembrane domain, and/or cytoplasmic domain (also known as cytoplasmic tail). In some embodiments, a deletion of the entire fusion peptide,

transmembrane domain, and/or cytoplasmic domain is used.

An example of an RSV F protein is shown in SEQ ID NO:l 1. The invention is not limited to the RSV F protein of SEQ ID NO: 11 or modifications thereof. RSV F proteins from other strains of RSV and modified proteins thereof can be used in accordance with the invention. While particular exemplary sequences are described herein, the invention also includes corresponding modifications made in similar sequences, for example, in the same RSV protein from another strain, isolate or a synthetic analog.

In some embodiments, an F protein is modified to reduce fusion activity. The fusion activity may be reduced by deleting at least a portion of the fusion peptide, substituting one or more amino acids within the fusion peptide, inserting one or more amino acids into the fusion peptide domain, and/or by a modification outside of the fusion peptide domain. For example, screening a library of RSV F proteins, e.g., a mutagenized library, for those with reduced or eliminated fusion activity, some of which could have modifications not within the fusion peptide domain, but that still reduce fusion activity as compared to the non- modified/non-mutated RSV F protein.

In some embodiments of the invention, an RSF F protein comprises a deletion of at least a portion of the peptide fusion domain of the RSV F protein. The RSV F protein fusion domain is known in the art, e.g., see Swanson et al. (PNAS (201 1) 108(23):9619-24) and Martin et al. (J General Virology (2006) 87: 1649-1658). The fusion peptide domain of RSV F protein corresponds to amino acids 137-155 of SEQ ID NO: l 1. Fusion peptides from other RSV F proteins, e.g., from other strains or isolates, are described in the art and/or can be determined, e.g., by aligning their amino acid sequence with SEQ ID NO: l 1 (e.g., using BLAST) and identifying the amino acids corresponding to amino acids 137-155 of SEQ ID NO: l l .

In some embodiments, a modified RSV F protein comprises or consists of a deletion corresponding to amino acids 137-155, 137-154, 137-153, 137-152, 137-151, 137- 150, 137-149, 137-148, 137-147, 137-146, 137-145, 137-144, 137-143, 137-142, 137-141, 137-140, 137-139, 138-155, 138-154, 138-153, 138-152, 138-151 , 138-150, 138-149, 138- 148, 138-147, 138-146, 138-145, 138-144, 138-143, 138-142, 138-141 , 138-140, 138-139 or 145-155 of SEQ ID NO: 1 1. In some embodiments, a modified RSV F protein is not comprised of or does not include at least one of the amino acid sequences of amino acids 137-145, 137-146 or 137-155 of SEQ ID NO:l l . In some embodiments, a modified RSV F protein comprises or consists of a deletion of 5-10, 5-15, 5-20, 10-15, 10-20, 15-20 contiguous or non-contiguous amino acids from the fusion peptide, e.g., amino acids corresponding to amino acids 137-155 of SEQ ID NO.l l . In some embodiments, a deletion comprises or consists of amino acids 137-145 or 137-146. Some embodiments of the invention include a modification to an RSV F protein that decreases or eliminates detectable fusion activity, e.g., as seen under a microscope or by flow cytometry with cells that are expressing the modified RSV F protein as compared to the same type of cells expressing similar amounts of the unmodified RSV F protein.

In some embodiments, an RSV F protein comprises a deletion of at least a portion of a transmembrane domain and/or cytoplasmic domain. This can be with or without a deletion in the peptide fusion domain. The transmembrane and cytoplasmic domain of RSV F protein corresponds to amino acids 525-573 of SEQ ID NO: l 1. Transmembrane and cytoplasmic domain of other RSV F proteins, e.g., from other strains or isolates, are described in the art and/or can be determined, e.g., by aligning their amino acid sequence with SEQ ID NO:l 1 (e.g., using BLAST) and identifying the amino acids corresponding to amino acids 525-573 of SEQ ID NO: 1 1. In some embodiments of the invention, an RSV F protein does not comprise amino acids corresponding to 525-573, 525-565, 525-555, 525-545, 525-545 or 525-555 of SEQ ID NO: l 1 or not more than 5, 10, 15, 20, 25 or 30 contiguous amino acids from amino acids 525-573 of SEQ ID NO: l 1.

In some embodiments, a modified RSV protein of the invention comprises or consists of an amino acid sequence selected from the group consisting amino acids 23-564 of SEQ ID NO:2; 23-515 of SEQ ID NO:4; 23-573 of SEQ ID NO: 13; 23-524 of SEQ ID NO: 15; 23- 554 of SEQ ID NO: 17; and 23-505 of SEQ ID NO: 19. In some embodiments, a modified RSV protein of the invention comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NOs:2, 4, 13, 15, 17 and 19. The first 23 amino acids of SEQ ID NOs:2, 4, 13, 15, 17 and 19 are a signal sequence. Essentially any signal sequence can be used that is functional in a particular cell. In some embodiments, nucleic acids of the invention comprise SEQ ID NOs: 1, 3, 12, 14, 16 and/or 18. In some embodiments, nucleic acids of the invention comprise SEQ ID NOs: 1, 3, 12, 14, 16 and/or 18, but without the first 69 nucleotides which code for the signal sequence.

Some embodiments of the invention utilize an RSV attachment G-protein (RAGP) or a modified form thereof. In some embodiments, an RAGP comprises or consists of amino acids 2-101 of SEQ ID NO: 6 sometimes also referred to as an RAGP conserved domain, e.g., see Nguyen et al. (PLoS One (2012) 7(3):e34331). In some embodiments, an RAGP comprises or consists of the amino acids 56-70 of SEQ ID NO:6. In some embodiments, an RAGP comprises or consists of an amino acid sequence corresponding to amino acids 2-101, 10-101 , 20-101 , 30-101 , 40-101 , 50-101 , 60-101, 70-101 , 10-90, 10-80, 10-70, 10-60, 10-50, 10-40, 10-77, 45-58, 40-60, 40-65, 40-70, 40-58, 35-58, 30-58, 50-75 or 35-65 of SEQ ID NO:6. In some embodiments, a modified RAGP comprises or consists of at least a portion of an RSV attachment G-protein, e.g., corresponding to amino acids 2-101, 10-77 or 45-58 of SEQ ID NO:6. In some embodiments, the RAGP is an RSV attachment G-protein from an RSV-A or RSV-B type virus.

In some embodiments, a coding region for RAGP or portion of a RAGP is operatively linked to a vaccinia H5 promoter or a vaccinia p7.5 promoter. In some embodiments, both a coding region for a modified RSV F protein and a coding region for an RAGP, or portion thereof, are each linked to a vaccinia H5 promoter or a vaccinia p7.5 promoter.

The invention also includes proteins with amino acid sequences that have at least about 80% , at least about 83%, at least about 85%, at least about 88%, at least about 90%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity or homology to those disclosed herein, for example, 23-564 of SEQ ID NO:2; 23-515 of SEQ ID NO:4; 23-573 of SEQ ID NO: 13; 23-524 of SEQ ID NO: 15; 23-554 of SEQ ID NO: 17; 23-505 of SEQ ID NO: 19 and amino acids 2-101, 10-77 or 45-58 of SEQ ID NO:6. The invention also includes nucleic acids with nucleotide sequences that have at least about 70% , at least about 75% , at least about 80% , at least about 83%, at least about 85%, at least about 88%, at least about 90%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity or homology to those disclosed herein, for example,

As used herein, the term "sequence identity" refers to a relationship between two or more polynucleotide sequences or between two or more polypeptide sequences. When a position in one sequence is occupied by the same nucleic acid base or amino acid residue in the corresponding position of the comparator sequence, the sequences are said to be

"identical" at that position. The percentage "sequence identity" is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of "identical" positions. The number of "identical" positions is then divided by the total number of positions in the comparison window and multiplied by 100 to yield the percentage of "sequence identity." Percentage of "sequence identity" is determined by comparing two optimally aligned sequences over a comparison window. In order to optimally align sequences for comparison, the portion of a

polynucleotide or polypeptide sequence in the comparison window can comprise additions or deletions termed gaps while the reference sequence is kept constant. An optimal alignment is that alignment which, even with gaps, produces the greatest possible number of "identical" positions between the reference and comparator sequences. Percentage "sequence identity" between two sequences can be determined using the BLAST program available online from the National Center for Biotechnology Information, which program incorporates the programs BLASTN (for nucleotide sequence comparison) and BLASTP (for polypeptide sequence comparison) and are based on the algorithm of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90(12):5873-5877, 1993). The default parameters for proteins can be used, e.g., word size (3), open gap cost (11), extension gap cost (1) and expect threshold (10). The default parameters for nucleic acids can be used, e.g., word size (28), open gap cost (Linear), Match/Mismatch scores (1,-2) and expect threshold (10). Two nucleotide or amino acid sequences are considered to have "substantially similar sequence identity" or "substantial sequence identity" if the two sequences have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity relative to each other.

In some embodiments, a coding region for a modified RSV F protein is fused in frame with a coding region for at least a portion of the RSV G-protein. The modified RSV F protein may be N-terminal or C-terminal to the at least a portion of the RSV G-protein.

Essentially any promoter can be operatively linked to an RSV protein coding region(s). In some embodiments, a promoter is selected from an H5, p7.5, pCAE or PI 1 promoter.

Two RSV proteins, such as a modified RSV F protein and an RSV G-protein, or fragment thereof, may be expressed from separate promoters or the same promoter using, for example, any of the techniques described herein, including fusing the coding regions of the two proteins or inserting a protease site coding region, 2A like sequence or IRES sequence between the coding regions for the two proteins. In some embodiments, a modified RSV F protein coding region and an RSV G-protein coding region are contained in the same nucleic acid or vector and are each operatively linked to a different copy of the same promoter. In some of these embodiments, the coding regions are in opposite orientations or directions, e.g., see the vEM155/mEM87 and vEM155/mEM87 constructs of Figure 1A. This includes a double stranded nucleic acid where one coding region codes from 5' to 3' on one strand and the other coding region codes from 5' to 3' on the other strand. In these embodiments, the two coding regions may be operatively linked to different copies of the same promoter or to two different promoters.

In some embodiments, two coding regions are orientated in the same direction, on the same strand and each coding region can be operatively linked to one copy of the same promoter, to different copies of the same promoter or to two different promoters. In some embodiments of the invention, a coding region for a modified RSV F protein (as described herein) is operatively linked to a first promoter and a coding region for at least a portion of an RAGP (as described herein) is linked to a second promoter. In other

embodiments, a coding region for a modified RSV F protein and a coding region for a at least a portion of an RAGP are in opposite orientation compared to each other. In some

embodiments, a coding region for a modified RSV F protein and a coding region for at least a portion of a RAGP are both operatively linked to the same promoter. This may be carried out in a number of ways including, but not limited to, wherein (i) a coding region for the modified RSV F protein is fused in frame with a coding region for the portion of the RSV G- protein and (ii) the coding region for a modified RSV F protein and a coding region for at least a portion of a RAGP are operatively linked by a coding region for a 2A peptide, a coding region for a protease site or an internal ribosome entry site.

In some embodiments, a linker peptide is fused in frame between the coding region for the modified RSV F protein and the coding region for the portion of the RSV G-protein. A linker sequence/peptide typically is relatively short (e.g., 3-5, 3-10, 3-15, 7-15, 10-20 or 3- 20 amino acid sequence) and allows the two or more polypeptides to be expressed as one fusion protein.

The invention also includes nucleic acids and vectors containing nucleic acid sequences that code for any of the RSV proteins (e.g., modified) as described herein. Where a nucleic acid is described herein, the invention also includes vectors containing the described nucleic acid(s).

RSV proteins can be expressed with and operatively linked to any promoter that will result in the desired level of protein in the applicable type(s) of cells and/or for the vector type being used. In some embodiments, a promoter is a mammalian promoter or a viral promoter. In some embodiments a promoter functions in the nucleus of a mammalian cell. In some embodiments a promoter functions in the cytoplasm of a mammalian cell. In some embodiments, a promoter is a vaccinia H5 promoter or a vaccinia p7.5 promoter. These promoters may comprise a sequence that is upstream of a vaccinia H5 or p7.5 gene such as those comprising or consisting of SEQ ID NOs:8 or 7, respectively. In some embodiments, a relatively strong promoter may be utilized while in other embodiments, a relatively weak promoter may be used. For example, a vaccinia H5 promoter is generally a stronger promoter leading to higher levels transcription and expression of an operatively linked coding region, whereas a p7.5 promoter generally leads to lower levels of transcription and expression. In some embodiments of the invention, a promoter may be a tissue specific promoter, a cell specific promoter, an inducible promoter, a repressible promoter, a constitutive promoter, a synthetic promoter or a hybrid promoter.

Regulatory (expression/control) sequences and promoters are operatively linked to a nucleic acid coding sequence when they regulate the transcription and, as appropriate, translation of the nucleic acid sequence. Expression/control sequences that can be included in the nucleic acids and vectors of the invention include, but are not limited to, promoters, enhancers, transcription terminators, a start codon (/ ^' . e. , ATG) in front of a coding sequence, splicing signals for introns and stop codons.

Where a nucleic acid codes for two or more polypeptides, one copy of a promoter may be operatively linked to the two or more coding regions. Multiple polypeptides, including those derived from RSV, can be expressed from one promoter by, for example, inserting between the coding regions an internal ribosome entry site (IRES), a 2A like sequence or a protease cleavage sequence fused in frame. Additionally, the two or more coding regions may be fused in frame with or without inserting between them a linker coding sequence for a linker peptide. In other words, the two or more polypeptides are expressed as one fused polypeptide, at least before any post translational modifications.

IRES sequences can be used to facilitate translation/expression of a second, third, fourth coding sequence, etc., from one promoter. Examples of IRESs that can be used in accordance with the present invention include, but are not limited to, those from or derived from Picornavirus e.g., HAV (Glass et al. 1993. Virol 193:842-852), encephalomyocarditis virus (EMCV) (Duke et al. (1992) J. Virol 66(3): 1602-9; Jang & Wimmer, 1990 Gene Dev 4: 1560-1572), and Poliovirus (Borman et al, 1994. EMBO J 13:3149-3157); HCV

(Tsukiyama-Kohara et al., 1992. J Virol 66:1476- 1483), BVDV (Frolov et al., 1998. RNA. 4: 1418-1435); leishmania virus, e.g., LRV-1 (Maga et al., 1995. Mol Cell Biol 15:4884- 4889); retroviruses e.g., MoMLV (Torrent et al, 1996. Hum Gene Ther 7:603-612), VL30 (Harvey murine sarcoma virus), REV (Lopez-Lastra et al, 1997. Hum Gene Ther 8: 1855- 1865); and eukaryotic mRNA e.g. immunoglobulin heavy-chain binding protein (BiP) (Macejak & Sarnow, 1991. Nature 353:90- 94), antennapedia mRNA (Oh et al., 1992. Gene & Dev 6: 1643-1653), fibroblast growth factor 2 (FGF-2) (Vagner et al., 1995. Mol Cell Biol 15:35-44), PDGF-B (Bernstein et al., 1997. J Biol Chem 272:9356-9362), IGFII (Teerink et al., 1995. Biochim Biophys Acta 1264:403-408), translational initiation factor eIF4G (Gan & Rhoads, 1996. J Biol Chem 271 :623-626), insulin-like growth factor (IGF), yeast transcription factors TFIID and HAP4, and the vascular endothelial growth factor (VEGF) (Stein et al., 1998. Mol Cell Biol 18:31 12-31 19; Huez et al, 1998. Mol Cell Biol 18:6178- 6190) as well as those described in U.S. Patent 6,692,736. IRESs that could also be used have been reported in different viruses such as cardiovirus, rhinovirus, aphthovirus, HCV, Friend murine leukemia virus (FrMLV) and Moloney murine leukemia virus (MoMLV). As used herein, the term "IRES" encompasses functional variations of IRES sequences as long as the variation is able to promote direct internal ribosome entry to the initiation codon of a downstream cistron, leading to cap-independent translation. An IRES utilized in the present invention may be mammalian, viral or protozoan.

Foot and Mouth Disease viruses (FMDV) are a group within the picornaviridae which express a single, long open reading frame encoding a polyprotein of approximately 225 kD. The full length translation product undergoes rapid intramolecular (cis) cleavage at the C- terminus of a self-processing cleavage site, for example, a 2A site or region, located between the capsid protein precursor (PI -2 A) and replicative domains of the polyprotein 2BC and P3, with the cleavage mediated by proteinase-like activity of the 2A region itself (Ryan et al., J. Gen. Virol. 72:2727-2732, 1991); Vakharia et al, J. Virol. 61 :3199-3207, 1987). Similar domains have also been characterized from aphthoviridea and cardioviridae of the picornavirus family (Donnelly et al , J. Gen. Virol. 78: 13-21, 1997).

It has been reported that a 2A site, sequence or domain demonstrates a translational effect by modifying the activity of the ribosome to promote hydrolysis of an ester linkage, thereby releasing the polypeptide from the translational complex in a manner that allows the synthesis of a discrete downstream translation product to proceed (Donnelly et al. J. Gen. Virol. (2001) 82:1013-1025). Alternatively, a 2A site, sequence or domain demonstrates auto-proteolysis or cleavage by cleaving its own C-terminus in cis to produce primary cleavage products (Palmenberg, Ann. Rev. Microbiol. 44:603-623 (1990)).

For the present invention, the DNA sequence encoding a 2A sequence or 2A like sequence is exemplified by viral sequences derived from a picornavirus, including but not limited to an entero-, rhino-, cardio-, aphtho- or Foot-and-Mouth Disease Virus (FMDV). In some embodiments, a 2A like coding sequence is derived from a FMDV. Examples of 2A and 2A-like sites, sequences or domains are described in Donnelly et al., J. Gen. Virol. 82: 1027-1041 (2001).

FMDV 2A is a polyprotein region which functions in the FMDV genome to direct a single cleavage at its own C-terminus, thus functioning in cis. The FMDV 2A domain is typically reported to be about nineteen amino acids in length (LLNFDLLKLAGDVESNPGP (SEQ ID NO:20) or TLNFDLLKLAGDVESNPGP (SEQ ID NO:21) (Ryan et al, J. Gen. Virol. 72:2727-2732 (1991)), however oligopeptides of as few as fourteen amino acid residues (LLKLAGDVESNPGP (SEQ ID NO:22)) have also been shown to mediate cleavage at the 2A C-terminus in a fashion similar to its role in the native FMDV polyprotein processing.

Variations of the 2A sequence have been studied for their ability to mediate efficient processing of polyproteins (Donnelly et al. J. Gen. Virol. 82: 1027-1041 (2001)). Homologues and variant 2A sequences are included within the scope of the invention and include but are not limited to: LLNFDLLKLAGDVESNPGP (SEQ ID NO:20);

TLNFDLLKLAGDVESNPGP (SEQ ID NO:21); LLKLAGDVESNPGP (SEQ ID NO:22); NFDLLKLAGDVESNPGP (SEQ ID NO:23); QLLNFDLLKLAGDVESNPGP (SEQ ID NO:24); APVKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:25);.

VTELLYRMKPvAETYCPRPLLAIHPTEARHKQKIVAPVKQTLNFDLLKLA

GDVESNPGP (SEQ ID NO:26); EARHKQKIV APVKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:27); and LLAIHPTEARHKQKIV APVKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:28).

As discussed herein, two polypeptides can be expressed from one promoter operatively linked to a coding region for a first polypeptide which is linked in frame to a coding sequence for a protease site which is linked in frame to a coding sequence for a second coding region. More than two polypeptides can be expressed in this manner by inserting protease site coding regions between each of the polypeptide coding regions or by using a combination of IRES, protease site, and/or 2A like sequences.

A protease site should be one that will be cleaved by a protease expressed in the cell of interest. This can be a protease naturally expressed by the cell or a protease that the cell has been engineered to express. Examples of proteolytic cleavage sites that can be used in the invention are furin cleavage sites, e.g., with the consensus sequence RXK/RR (SEQ ID NO: 29), such as RAKR (SEQ ID NO:30), which can be cleaved by endogenous subtilisin- like proteases, such as furin and other serine proteases. Other proteolytic cleavage sites can be employed in practicing the invention. Exemplary additional proteolytic cleavage sites which can be inserted between a polypeptide or protein coding sequence include, but are not limited to a Factor Xa cleavage sequence such as IEGR (SEQ ID NO:31); IDGR (SEQ ID NO:32); a signal peptidase I cleavage sequence such as LAGFATVAQA (SEQ ID NO:33); and a thrombin cleavage sequence such as LVPRGS (SEQ ID NO:34). It is understood, that due to the degeneracy of codons for translation of amino acids, that any amino acid sequence could be coded for using different nucleic acid sequences and different combinations of codons and a coding sequence is not limited to one coding sequence. In some embodiments, a nucleic acid coding sequence (e.g., that codes for an RSV protein or modified RSV protein) is recoded.

The term "recoded" means that at least one native codon is changed to a different codon that encodes for the same amino acid as the native codon. In some embodiments, a recoded coding region has at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the codons recoded. In some embodiments, a recoded codon is replaced with a codon that is more prevalently used in a particular species, such as humans. In some embodiments, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or at least 50% of the codons have been replaced with a codon that is more prevalently used in humans.

Recoding can include codon-optimization which comprises modifying/changing the codons of a coding sequence in a nucleic acid sequence for enhanced expression in a specified host cell or species of host cell by replacing at least one, more than one, or a significant number of codons of the native sequence with codons that are more frequently or most frequently used in the genes of that host. Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing polypeptide chain. Codon preference or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The

predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.

In some embodiments, a recoded sequence has between about 60-65%, about 65-70%, about 70-75%, about 75-80%, about 80-85%, about 85-90%, about 90-95%, about 70-90%, about 75-85%), about 90-95% or about 95-98% sequence identity with the corresponding native coding sequence.

Recoding can also be used to change the chemical make-up of a DNA and/or an RNA coding sequence such as the guanine/cytosine (GC) percentage. Depending on the particular situation or vector it may advantageous to increase or decrease the GC percentage in the recoded sequence.

Recoding can be used to remove/modify or add particular motifs or secondary structure to a coding sequence or nucleic acid molecule such as procarya inhibitory motifs, consensus splice donor sites, cryptic splice donor sites or a combination thereof. In some embodiments, a recoded coding sequence has less procarya inhibitory motifs, consensus splice donor sites, cryptic splice donor sites or a combination thereof than the native sequence. In some embodiments, a recoded coding sequence contains no procarya inhibitory motifs, consensus splice donor sites and/or cryptic splice donor sites. Recoding can also be used to change stretches/ sections of sequences that are identical or have significant homology/identity (e.g., > 80%) to other sequences in the vector or polynucleotide, for example to reduce recombination events. Additionally, recoding can be done to change sections of sequences that have poly-guanine/cytosine sequences, because in some settings getting rid of poly-guanine/cytosine sequences and converting them to sequences without or with lower amounts of poly-guanine/cytosine sequences can lead to better characteristics for the nucleic acid or vector, such as in some cases higher expression levels.

Hoover et al. (Nucleic Acids Res. (2002) 30:e43, ppl-7); U.S. Patent Application 20070141557; Fath er al. (PLoS ONE (2011) 6:el7596 ppl-14); Graf et al. (J Virol (2000) 74: 10822-10826); and U.S. Patent No. 8,224,578 describe examples of recoding coding regions.

To ensure local and/or long term expression of a nucleic acid of interest, some embodiments of the invention contemplate transducing a cell with a nucleic acid or vector of the invention. The instant invention is not to be construed as limited to any one particular nucleic acid delivery method, and any available nucleic acid delivery vehicle and/or method with either an in vivo or in vitro nucleic acid delivery strategy, or the use of manipulated cells (such as the technology of Neurotech, Lincoln, RI, e.g., see U.S. Patent Nos. 6,231 ,879; 6,262,034; 6,264,941 ; 6,303,136; 6,322,804; 6,436,427; 6,878,544) as well as nucleic acids of the invention (e.g. , "naked DNA"), can be used in the practice of the invention. Various delivery vehicles, such as vectors, can be used with the present invention. For example, viral vectors, amphitrophic lipids, cationic polymers, such as polyethylenimine (PEI) and polylysine, dendrimers, such as combburst molecules and starburst molecules, nonionic lipids, anionic lipids, vesicles, liposomes and other synthetic nucleic acid means of gene delivery (e.g. , see U.S. Pat. Nos. 6,958,325 and 7,098,030; Langer, Science 249: 1527-1533 (1990); Treat et al, in "Liposomes" in "The Therapy of Infectious Disease and Cancer"; and Lopez-Berestein & Fidler (eds.), Liss, New York, pp. 317-327 and 353-365 (1989)); "naked" nucleic acids and so on can be used in the practice of the instant invention.

In some embodiments, a vector or nucleic acid of the invention comprises an intron, operatively linked to a coding sequence. Heterologous introns are known and non-limiting examples include a human β-globin gene intron and a beta-actin intron. An intron can be a heterologous intron.

The present invention contemplates the use of any vector for introduction of one or more genes or nucleic acid into cells, e.g., mammalian cells. Exemplary vectors include but are not limited to, viral and non-viral vectors, such as vaccinia virus vectors (e.g., modified vaccinia Ankara (MVA)), retrovirus vectors (including lentiviruses), adenovirus (Ad) vectors including replication competent, replication deficient and gutless forms thereof, adeno associated virus (AAV) vectors, simian virus 40 (SV40) vectors, bovine papilloma virus vectors, Epstein Barr virus vectors, herpes virus vectors, vaccinia virus vectors, Moloney murine leukemia virus vectors, Harvey murine sarcoma virus vectors, murine mammary tumor virus vectors, Rous sarcoma virus vectors, Venezuelan equine encephalitis vector (e.g., replicon), respiratory syncytial virus vectors and nonviral plasmid vectors. Viruses can efficiently transduce cells and introduce their genetic information into a host cell. In some embodiments using viral vectors, a non-essential viral gene(s) is replaced with a gene or coding sequence for a heterologous (or non-native) protein such as a modified RSV protein. In some embodiments, a coding region is inserted between two viral genes.

Adenoviral vectors are described, e.g., in Hitt et al. Adv in Virus Res 55:479-505 (2000); U.S. Patent Nos. 5,872,005, 5,994,106, 6,133,028 and 6,127,175. AAV vectors are described, e.g., in Davidson et al. (2000), PNAS 97(7)3428-32; Passini et al. (2003), J. Virol 77(12):7034-40; Gao et al. (2002), PNAS 99(18):1 1854-6; Gao et al. (2003), PNAS

100(10):6081-6; Bossis and Chiorini (2003) J. Virol. 77(12):6799-810; McCarty et al, Gene Ther. 2001 Aug;8(16): 1248-54; U.S. Patent Nos. 5,436,146, 5,753,500, 6,040,183, 6,093,570 and 6,548,286. Examples of retroviral vectors are described in Miller (1992) Nature 357: 455-460. Examples of lentiviral vectors are described in Picanco-Castro et al. Recent Pat DNA Gene Seq. (2012) 6(2):82-90 and U.S. Patent Nos. 8,236,558 and 8,183,356.

In some embodiments, a viral vector is a poxvirus vector, e.g., a vaccinia virus, e.g., a modified vaccinia virus Ankara (MVA). MVA is a highly attenuated vaccinia virus strain. In certain aspects the MVA is the MVATOR™ virus. Poxviruses include four genera of poxviruses, i.e., orthopox, parapox, yatapox, and molluscipox viruses. Vaccinia viruses can be engineered for heterologous gene expression and/or for use as recombinant vaccines (Mackett et al. (1982) PNAS USA 79:7415-7419; Smith et al, (1984) Biotech Genet Engin Rev 2:383-407).

In some embodiments, a recombinant vaccinia virus (e.g., MVA) of the invention is used for the prophylaxis of infectious RSV diseases. In some embodiments, a vaccinia virus is a highly attenuated modified vaccinia virus Ankara, e.g., see Mayr et al. (1975) Infection 3:6-14; and Swiss Patent No. 568,392. MVA viruses are publicly available, e.g., from the American Type Culture Collection as ATCC No. VR-1508. MVA is distinguished by its attenuation, e.g., diminished virulence and limited ability to reproduce infectious virions in certain mammalian cells, while maintaining the capacity to replicate and produce infectious virions in certain avian cells. MVA vectors may undergo limited replication in human cells as its replication is blocked in the late stage of infection preventing the assembly to mature infectious virions.

In some embodiments of the invention, a polynucleotide sequence coding for a modified RSV polypeptide(s) is inserted between MVA flanking sequences, e.g., adjacent to a naturally occurring deletion, e.g., deletion I, deletion II, deletion III, deletion IV, deletion, V, or deletion VI, or other non-essential sites present in the MVA genome. In certain aspects, the polynucleotide sequence coding for the modified RSV polypeptide(s) is situated in deletion III. Nonessential regions of the MVA genome include, but are not limited to, intergenic regions and naturally occurring deletion regions as well as other non-essential genes, e.g., the tk gene.

The present invention also provides methods for producing a vector, e.g., an MVA vector, comprising introducing into a host cell a vector and an isolated polynucleotide (DNA) construct comprising a polynucleotide encoding a modified RSV protein to allow insertion into the vector nucleic acid, e.g., by homologous recombination. PCT Publication No.

WO201 1 120045 describes exemplary methods for constructing vaccinia viral vectors and the methods can be utilized for construction of other types of viral vectors.

An MVA vector may still have a limited capacity to replicate in certain mammalian cells, e.g., BS-C-1 and CV-1 cells (Carroll and Moss (1997) Virology 238:198-211). While being replication incompetent in some or most mammalian cells, an MVA vector may still have the capacity to replicate in other mammalian cells (e.g., BHK-21 cells) as well as some avian cells, for example, primary or immortalized chick or duck cells, e.g., AGE1.CR, AGEl .CR.pIX, or EB66™ cells. Examples of vaccinia virus vectors, and in some cases MVA vectors, and methods of making them are described in Carroll and Moss (Virology (1997) 238: 198-211 ; Moroziewicz et al. Curr. Opin. Mol. Ther. (2005) 7:317-325; US Patent Nos. 5,110,587; 5,185,146;

6,440,422; 6,682,743; 7,094,412; 7,198,934; 7,550,147; and 7,816,508; US Patent

Publication No. 20120028336; and PCT Publications WO2010/072365 and

WO201 1/120045).

In some embodiments, a modified RSV protein is expressed from a respiratory syncytial virus. For example, the coding region for RSV F protein in an RSV genome is replaced with one encoding a modified RSV F protein of the invention. In some

embodiments, the RSV is attenuated. In some embodiments, replacement of the coding region for RSV F protein with the modified version results in an attenuated RSV. In some embodiments, an RSV does not itself express an RSV F protein or code for an RSV F protein in its viral genome, but an RSV F protein coding sequence is provided in trans and expressed for propagation of the RSV. In this case, the RSV protein expressed from the coding sequence provided in trans is incorporated into the RSV viral particles. In some

embodiments, the native RSV coding region or gene in an RSV viral genome is mutated, deleted, inactivated, etc., so a functional RSV F protein capable of incorporating into an RSV viral particle is not expressed from the RSV viral genome. In some of these cases, an RSV F protein deleted RSV is prepared from cells by providing a modified RSV F protein coding sequence to the cells. In some cases, an RSV containing a particular modified F protein and no native RSV F protein may replicate less efficiently or not all. In these cases, the RSV F deleted RSV may be multiplied by providing a native or functional RSV F protein and then the last round of propagation is performed by providing a modified RSV F coding region of the invention and no native RSV F protein coding region. The resulting RSV then would contain no native RSV F protein, but contains the modified RSV F protein. In some embodiments, the last round can be performed by providing both a native and a modified RSV F coding region. In some embodiments, the RSV F coding region provided in trans can be introduced in the cell so it is present at the time of infection or shortly thereafter to allow incorporation into newly produced RSV viral particles. In some embodiments, a cell line is created and/or used that stably expresses the RSV F coding region (modified and/or native) and that replicates RSV. An RSV F protein modified to reduce the fusion capability may be less toxic to a cell when expressed as compared to a native RSV F protein. In some embodiments, an RSV coding region (modified or native) may be expressed from an inducible promoter. The invention also includes host cells (e.g., in vitro) that comprise a vector and/or nucleic acid of the invention. In some embodiments, a host cell expresses a modified RSV protein and/or comprises a viral vector of the invention. The invention also includes administering to an animal, cells that express a modified RSV protein(s) of the invention. In some embodiments, these cells are a cell line or a cell isolated from an animal that has been manipulated to contain a nucleic acid or vector of the invention and/or to express a

polypeptide of the invention. The invention also includes cells containing a replicating vector of the invention. Cells administered to an animal can be, for example, autologous,

allogeneic, syngeneic or xenogeneic.

Some embodiments of the invention provide a recombinant MVA virus, e.g., a recombinant MVATOR™ virus, comprising a nucleic acid or vector, wherein the nucleic acid or vector is comprised of a coding region that codes for a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO:2, 4, 13, 15, 17 or 19; or amino acids 23-564 of SEQ ID NO:2; 23-515 of SEQ ID NO:4; 23-573 of SEQ ID NO: 13; 23-524 of SEQ ID NO: 15; 23-554 of SEQ ID NO: 17; and 23-505 of SEQ ID NO: 19. In certain aspects the MVATOR™-derived virus is mEM60, mEM61, mEM62, niEM63, mEM64, mEM66, mEM85, mEM86, mEM87, or mEM88.

Some embodiments of the invention provide a cell comprising a nucleic acid, vector, or recombinant MVA virus, e.g., a recombinant MVATOR™ virus, wherein the nucleic acid, vector or recombinant MVA virus is comprised of a coding region that codes for a

polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO:2, 4, 13, 15, 17 or 19; or amino acids 23-564 of SEQ ID NO:2; 23-515 of SEQ ID NO:4; 23-573 of SEQ ID NO: 13; 23-524 of SEQ ID NO: 15; 23-554 of SEQ ID NO: 17; and 23-505 of SEQ ID NO: 19. In certain aspects the cell is a chicken embryo fibroblast (CEF) cell, an AGE1.CR cell, an AGE1.CR.pIX cell, or an EB66™ cell. In certain aspects the cell is a chicken embryo fibroblast (CEF) cell, an AGE1.CR cell, an AGE1. CR.pIX cell, or an EB66™ cell comprising the MVATOR™-derived virus mEM60, mEM61, mEM62, mEM63, mEM64, mEM66, mEM85, mEM86, mEM87, or mEM88.

The invention also includes compositions, immunogenic compositions and

pharmaceutical compositions or preparations containing a nucleic acid(s), vector(s) and/or protein(s) as described herein. Compositions, e.g., pharmaceutical or vaccine compositions, that contain an immunologically effective amount of an isolated polynucleotide, polypeptide, or vector are further embodiments of the invention. The compositions can be pharmaceutical, antigenic, immunogenic, and/or vaccine compositions. Compositions, e.g., vaccine compositions, of the present invention can be formulated, e.g., according to the known methods. Suitable preparation methods are described, for example, in Remington's Pharmaceutical Sciences, 16th Edition, A. Osol, ed., Mack

Publishing Co., Easton, P A (1980), and Remington's Pharmaceutical Sciences, 19th Edition, A.R. Gennaro, ed., Mack Publishing Co., Easton, PA (1995). Although a composition may be formulated as an aqueous solution, it may also be formulated as an emulsion, gel, solution, suspension, lyophilized form or other form known in the art. In some embodiments, a composition contains one or more pharmaceutically acceptable additives including, for example, diluents, binders, stabilizers, and preservatives. Compositions or formulations may also include other carriers, adjuvants, or nontoxic, nontherapeutic, stabilizers and the like.

Suitable formulations for a desired mode of administration can generally be found in Remington's Pharmaceutical Sciences, latest edition, Mack Publishing Co., Easton, Pa.

In general, water, a suitable oil, saline, aqueous dextrose (e.g., glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycols can be suitable carriers, e.g., for parenteral solutions. In some embodiments, solutions for parenteral administration contain a water soluble salt of the active ingredient, suitable stabilizing agents, and/or if desired or necessary, buffer substances. Some embodiments may utilize

antioxidizing agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, as suitable stabilizing agents. Citric acid and its salts and sodium EDTA may also be used. In addition, solutions (e.g., for parenteral administration) can contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.

Compositions, nucleic acids, vectors and/or proteins of the invention may be formulated into a vaccine. A vaccine may be administered to an animal, e.g., as described herein.

In some embodiments, a composition (e.g., immunogenic) of the invention further contains a pharmaceutically acceptable adjuvant. The term "immunogenic composition" as used herein refers to any type of biological agent in an administrable form capable of stimulating an immune response in an animal (which includes human) inoculated with the immunogenic composition. This includes compositions comprising a polypeptide/protein/ peptide that will directly stimulate an immune response and nucleic acids and vectors that can be administered to an animal and which will express the polypeptide/protein/peptide to which an immune response is elicited. In some embodiments, an immune response may include induction of antibodies and/or induction of a T-cell response. In some embodiments, an immune response ameliorates (either partially or completely) any one or more of the symptoms associated with the disease, condition or infection in question, e.g., RSV infection or disease.

In certain embodiments, immunogenic compositions are used in the immunization of an animal (e.g., a mouse, primate or human) by methods and routes of immunization known to those of skill in the art (e.g., intranasal, parenteral, intramuscular, oral, rectal, vaginal, transdermal, intraperitoneal, intravenous, subcutaneous, inhalation, etc.).

In some embodiments, a composition of the invention comprises one or more adjuvants. A number of materials have been shown to have adjuvant activity through a variety of mechanisms. In some embodiments, one or more adjuvants that are used with a nucleic acid, vector, polypeptide or composition includes, but is not limited to: inert carriers, such as alum, bentonite, latex, and acrylic particles; pluronic block polymers, such as

TITERMAX® (block copolymer CRL-8941), squalene (a metabolizable oil) and a microparticulate silica stabilizer), depot formers, such as Freund's adjuvant, surface active materials, such as saponin, lysolecithin, retinal, Quil A, liposomes, and pluronic polymer formulations; macrophage stimulators, such as bacterial lipopolysaccharide; polycationic polymers such as chitosan; alternate pathway complement activators, such as insulin, zymosan, endotoxin, and levamisole; and non-wmc surfactants, such as poloxamers, poly(oxyethylene)poly( oxypropylene) tri-block copolymers, cytokines and growth factors; bacterial components (e.g., endotoxins, in particular superantigens, exotoxins and cell wall components); aluminum-based salts such as aluminum hydroxide; calcium-based salts; silica; polynucleotides; toxoids; serum proteins, viruses and virally-derived materials, poisons, venoms, imidazoquiniline compounds, poloxamers, mLT, cationic lipids, toll-like receptors (TLRs) stimulating adjuvants (See e.g., Science 312: 184-187 (2006)). TLR adjuvants include compounds that stimulate the TLRs (e.g., TLR1 - TLR17), resulting in an increased immune system response to a composition of the present invention. TLR adjuvants include, but are not limited to, CpG (e.g., Coley Pharmaceutical Group Inc.) and MPL (e.g., Corixa). One example of a CpG adjuvant is CpG7909, described in US Patent Applic. Publication No. 2002/0164341 A, US Patent No. 6,727,230, and International Publication Nos. W098/32462 and WO98/018810.

In certain adjuvant containing compositions, the adjuvant is a cytokine. Some embodiments of the invention comprise one or more cytokines, chemokines, or compounds that induce the production of cytokines and chemokines, or a polynucleotide encoding one or more cytokines, chemokines, or polypeptides that induce the production of cytokines and chemokines. Examples of cytokines include, but are not limited to granulocyte macrophage colony stimulating factor (GM-CSF; see, e.g., U.S. Pat. No. 5,078,996 and ATCC Accession No. 39900), granulocyte colony stimulating factor (G-CSF), macrophage colony stimulating factor (M-CSF), colony stimulating factor (CSF), erythropoietin (EPO), interleukin 2 (IL-2), IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 , IL-12 (see, e.g., U.S. Pat. No.

5,723,127), IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, interferon alpha (IFN-a), IFN-beta, IFN-gamma, IFN-omega, IFN-tau, interferon gamma inducing factor I (IGIF), transforming growth factor beta (TGF-β), RANTES, macrophage inflammatory proteins (e.g., MIP-1 alpha and MIP-1 beta), Leishmania elongation initiating factor (LEIF) and Flt-3 ligand.

In some embodiments, an adjuvant is an aluminum salt adjuvant, an alum-precipitated vaccine or an alum-adsorbed vaccine. Examples of aluminum-salt adjuvants are described, for example, in Harlow and Lane (1988; Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory) and Nicklas (1992; Aluminum salts. Research in Immunology 143:489- 493). In some embodiments, an aluminum salt is a hydrated alumina, an alumina hydrate an alumina trihydrate (ATH), an aluminum hydrate, an aluminum trihydrate, an

ALHYDROGEL™ (a sterilized aluminum hydroxide wet gel suspension), an aluminum (III) hydroxide, an amorphous alumina, trihydrated alumina or a trihydroxyaluminum. In some embodiments, an aluminum containing compound, such as aluminum hydroxide, is used to adsorb proteins, e.g., in a ratio of 50-200 g protein/mg aluminum hydroxide.

In some embodiments, an adjuvant is a carrier polypeptide. Carrier polypeptide refers to a protein or immunogenic fragment thereof that can be conjugated or joined with an RSV polypeptide of the invention (e.g., RSV modified F protein) to enhance immunogenicity of the polypeptide. Examples of carrier proteins include, but are not limited to, keyhole limpet hemocyanin, albumin, cholera toxin, heat labile enterotoxin, and the like. In some embodiments, the two components are prepared as a chimeric construct for expression as a fusion polypeptide.

In some embodiments, the ability of an adjuvant to increase an immune response to an antigen can be manifested by a significant increase in an immune-mediated reaction(s) and/or reduction in disease symptoms. For example, an increase in humoral immunity may be manifested by a significant increase in the titer of antibodies raised to the antigen. An increase in T-cell activity may be manifested by increased cell proliferation, cellular cytotoxicity and/or cytokine secretion. An adjuvant may alter an immune response, for example, by changing a primarily humoral or Th2 response into a primarily cellular or Thl response or vice versa. Immune responses to a given antigen may be tested by various immunoassays and/or as described herein.

In some embodiments, an adjuvant comprises any combination of adjuvants e.g., those disclosed herein. Compositions of the invention can be formulated with or without an adjuvant.

Some embodiments of the invention provide methods to treat or inhibit RSV infection and/or a condition associated with RSV infection in a subject. Some methods comprise administering to a subject a composition containing a polynucleotide(s), polypeptide(s), or vector(s) of the present invention. In certain embodiments, the subject is a vertebrate, e.g., a mammal, a primate or a human. In some embodiments, the invention is directed to a method of inducing an immune response against an RSV in an animal comprising administering an effective amount of a composition containing any one or more of the compositions, polynucleotides, polypeptides, and/or vectors of the present invention. In some

embodiments, an animal can be treated prophylactically with the polynucleotides, polypeptides, vectors or compositions of the invention, e.g., as a prophylactic vaccine to establish or enhance immunity to one or more types of RSV virus (e.g., RSV-A and/or RSV- B), for example, in a healthy animal prior to exposure to an RSV or prior to exhibiting a symptom related to RSV infection. Therefore, some embodiments of the invention prevent RSV related disease symptoms or reduce the severity of disease symptoms. One or more polynucleotides, polypeptides, vectors or compositions of the invention can also be used to treat an animal already exposed to an RSV or already suffering from an RSV-related symptom(s) by stimulating the immune system of the animal, thereby reducing or eliminating the symptoms associated with that exposure.

"Treatment" refers to the use of one or more polynucleotides, polypeptides, vectors, or compositions of the invention to prevent, cure, retard, ameliorate, inhibit or reduce the severity of the symptoms caused by an RSV infection and/or result in inhibiting any worsening of the symptoms over a specified period of time. It is not required that any polynucleotides, polypeptides, vectors or compositions of the present invention provide total protection, e.g., against an RSV infection or totally cure or eliminate all symptoms.

Treatment with compositions comprising a polynucleotide(s), polypeptide(s), or vector(s) of the invention can occur separately or in conjunction with other treatments, as appropriate, for example while a patient is being concurrently treated with an antibody that binds an RSV protein, such as palivizumab or motavizumab. In some embodiments, a composition of the invention is administered with or on the same day as an antibody that binds an RSV protein, such as palivizumab or motavizumab.

Some embodiments of the invention provide methods for generating or inducing in an animal antibodies and/or immune responses against RSV or against RSV proteins. Some embodiments of the invention provide methods for vaccinating an animal against RSV or RSV proteins, such as RSV F protein and/or RAGP. Some embodiments are methods of producing an immune response to an RSV F protein and/or RAGP comprising administering to an animal a viral vector, immunogenic composition or pharmaceutical composition of the invention. In some embodiments, a RAGP of the invention is utilized, without an RSV F protein, e.g., to induce an immune response or in an immunogenic composition. In some embodiments, a nucleic acid or vector (e.g., MY A vector) coding for a RAGP of the invention does not code for an RSV F protein.

In some embodiments related to generating or inducing in an animal antibodies and/or immune responses or vaccinating against RSV or against RSV proteins, the animal is a human. In some embodiments, the human is elderly (e.g., > 65, > 70, or > 75 years old) or is an infant or child (e.g.,≤ 6 months, < 12 months, < 18 months, < 2 years, < 3 years, < 4 years, < 5 years, or < 6 years old). In some embodiments, the human has a chronic respiratory disease, for example that increases their sensitivity and/or susceptibility to RSV

infection/disease. In some embodiments, a human is pregnant, e.g., to maternally immunize for the benefit of the infant/fetus.

In some embodiments, a modified RSV protein of the invention is utilized to screen and/or select antibodies that bind to the modified RSV protein. In some embodiments, these antibodies are further screened and/or selected for those that bind the modified RSV protein and the corresponding native protein.

In some embodiments of the invention, a polynucleotide(s), polypeptide(s), vector(s) and/or composition(s) of the invention is administered to a patient in an amount sufficient to elicit an effective cytotoxic T-lymphocyte (CTL) response to an RSV polypeptide.

In some embodiments, ranges for administration and/or immunization of viral vectors, including vaccinia and MVA vectors, is from about 100 to about 1 x 10 ¹⁵ or about 10 ⁵ to about 10 ⁹ plaque forming units (pfu) or transducing units. In some embodiments, a boosting dosage of from about 10 ³ pfu to about 10 ⁸ pfu or about 10 ⁶ pfu to about 10 ⁹ pfu of vector is given, for example, pursuant to a boosting regimen over weeks to months. This may depend upon the patient's response and condition, e.g., by measuring specific CTL activity in the patient's blood. In some embodiments for human administration a dose range for the initial 2 immunization (e.g., for therapeutic or prophylactic administration) is from about 10 to

20

aboutlO pfu or transducing units for a 70 kg patient. In some embodiments about 1000, 5xl0 ⁴ , 10 ⁵ , 5xl0 ⁵ , 10 ⁶ , 5xl0 ⁶ , 10 ⁷ , 5xl0 ⁷ , 10 ⁸ , 5xl0 ⁸ , 10 ⁹ , or 10 ¹⁰ pfu or transducing units is used as an initial dosage amount and/or as a boosting dosage amount and in some cases pursuant to a boosting regimen over weeks to months, e.g., depending upon the patient's response and condition. In some embodiments, an effective amount of a nucleic acid, vector, polypeptide or composition of the invention produces an elevation of antibody titer to at least two or three times the antibody titer prior to administration.

In some embodiments of the invention, nucleic acids, vectors, polypeptides or compositions of the invention are administered by mucosal delivery, transdermal delivery, subcutaneous injection, intravenous injection, oral administration, pulmonary administration, intramuscular administration or via intradural injection. In some embodiments, they are transdermally delivered including, but not limited to intradermal (e.g., into the dermis or epidermis), transdermal (e.g., percutaneous) and transmucosal administration (e.g., into or through skin or mucosal tissue).

In some embodiments, polynucleotides, polypeptides, vectors, or compositions of the invention stimulate a cell-mediated immune response sufficient, e.g., for protection of an animal against an RSV viral infection or to mitigate, alleviate, reduce, and/or inhibit symptoms of RSV infection. In other embodiments, polynucleotides, polypeptides, vectors or compositions of the invention induce a humoral immune response. In certain

embodiments, polynucleotides, polypeptides, or vectors of the invention stimulate both a humoral and a cell-mediated response, wherein in some cases, the combination of which is sufficient for protection against or reduction/inhibition of an RSV infection.

Administration can be repeated as necessary or desired. In some embodiments, a priming dose can be followed by one, two, three or more booster doses. In some

embodiments, a booster dose may be given 4 to 8 weeks after the first related immunization and optionally a second booster can be given at 8 to 12 weeks, e.g., using the same formulation. When multiple immune enhancing doses (e.g., vaccines) are given, the multiple doses can (i) all be the same nucleic acid, vector, protein or composition of the invention, (ii) different nucleic acids, vectors, proteins or compositions of the invention; or (iii) can be a combination of a nucleic acid(s), vector(s), protein(s) or composition(s) of the invention and may include other compounds or agents, e.g., those that induce an immune response to RSV or an RSV protein(s). Subjects amenable to treatment include individuals at risk of RSV related disease but not showing symptoms, as well as patients presently showing symptoms. Therefore, the compositions can be administered prophylactically to the general population. In

asymptomatic subjects, treatment can begin at any age. Treatment can be monitored, for example, by assaying antibody levels over time and/or RSV specific T-cell responses. If the immune response or antibody level falls, a booster dosage can be indicated.

All publications, patents and patent applications mentioned in this specification are herein incorporated by reference in their entirety into the specification to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. Also incorporated by reference is any supplemental information that was published along with any of the aforementioned publications, patents and patent applications. For example, some journal articles are published with supplemental information that is typically available online.

EXAMPLES

The invention is now described with reference to the following examples. These examples are provided for the purpose of illustration only and the invention should in no way be construed as being limited to these examples but rather should be construed to encompass any and all variations which become evident as a result of the teachings provided herein.

Whereas, particular embodiments of the invention have been described herein for purposes of description, it will be appreciated by those skilled in the art that numerous variations of the details may be made without departing from the invention, e.g., as described in the appended claims.

Example 1 - Construction of mEM60-mEM67

Constructs mEM60-mEM67 contain coding regions for different versions of an RSV F protein with or without a coding region for a conserved domain/region of an RSV attachment G-protein.

Construction of constructs mEM60-mEM67 was performed using standard techniques. The DNA sequence encoding the RSV F protein or modified RSV F protein for constructs mEM60-mEM67 is as follows: mEM60=SEQ ID NO: 12; mEM61=SEQ ID NO: 14; mEM62=SEQ ID NO: 16; mEM63=SEQ ID NO: 18; mEM64=SEQ ID NO: 18; mEM65=SEQ ID NO: 16; mEM66-SEQ ID NO: 16; and mEM67=SEQ ID NO: 18. The mEM60-mEM67 DNA constructs were used for the construction of recombinant MVA vectors as described in Example 2.

Table 1 and Figure IB summarizes the characteristics of each of these

constructs/inserts . Table 1 - characteristics of mEM60-mEM67

Promoters H5 and p7.5 are from the H5 and p7.5 vaccinia virus genes and the particular sequence used in these constructs and are depicted in SEQ ID NO:7 (p7.5) and SEQ ID NO:8 (H5), respectively. Fusion peptide refers to the fusion peptide within an RSV F protein where a positive (+) sign refers to an RSV F protein with no deletion of the fusion peptide sequence, while a negative sign (-), in this case, refers to an RSV F protein with a deletion in the fusion peptide sequence corresponding to amino acids 137-155 of an RSV F protein (SEQ ID NO: l 1). TM/CT refers to the transmembrane (TM) and cytoplasmic tail (CT) domains of an RSV F protein where a positive (+) sign refers to an RSV F protein with no deletion in these domain and a negative sign (-), in this case, refers to an RSV F protein with a deletion corresponding to amino acids 525-573 of an RSV F protein (SEQ ID NO:l 1), carboxy-terminal 49 amino acids. Conserved G domain refers to the presence (+) or absence (-) of amino acids 2 to 102 of SEQ ID NO:6, a conserved domain of an RSV attachment G- protein.

Example 2 - Construction of vEM153. vEM154. vEM155 and vEM156 Four different constructs were made to contain a coding region for a modified RSF F protein having a deletion in the fusion peptide. The constructs differed by whether the modified RSF F protein coding region coded for a transmembrane domain and cytoplasmic tail/domain of an RSV F protein and by whether the constructs contained a coding region for an RSV A G protein conserved region. See Figure 1A. vEM132 and vEM134 (Figures 2A and 2B, respectively) were used as template for an in vitro mutagenesis for the deletion of amino acid 137 - 145 of the F protein, which are part of the fusion peptide. (This is in contrast to constructs in Example 1 which had a larger deletion of amino acids 137-155.) The primers used for the in vitro mutagenesis were:

Fwd:

AAGCGGCGGAGCGCCATTGCCAGCGGAATCGCCGTGTCTAAG (SEQ ID NO:9) Rev:

AATGGCGCTCCGCCGCTTCCGCTTCTTGCTCAGGGTCACG (SEQ ID NO: 10)

For the in vitro mutagenesis two different polymerases were used:

A) PFU from the Quick change site directed mutagenesis kit: 5 \xL template DNA (10 ng/μΐν) were mixed with 5 μΕ lOx buffer, 2.5 μΕ per primer working stock, 1 μΐ, dNTPs and 1.0 μΐ PFU polymerase and filled with H ₂ 0 up to 50 μΕ.

The subsequent PCR reaction was performed using the following settings:

95°C 5 min, 20 cycles of 95°C 1 min then 72°C 15 min, 67°C 1 min, 72°C 30 min, 4°C until stop.

B) PHUSION™ polymerase (New England Biolabs): 5 μΕ template DNA (10 were mixed with 10 μΕ 5x HF buffer, 2.5 μΕ per primer working stock, 1 μΕ dNTPs and 0.5 μL· PFU polymerase and filled with H ₂ 0 up to 50 μΕ.

The subsequent PCR reaction was performed using the following settings:

98°C 3 min, 20 cycles of 98°C 45 sec then 72°C 8 min, 72°C 10 min, 4°C until stop.

3 μΐ, of the resulting PCR products were analyzed on a 1% agarose gel and the remaining material was digested with Dpnl. The digested samples were used for a gel extraction of the required product by using the Macherey-Nagel PCR purification kit. The DNA was eluted in 15 μί elution buffer and the purified DNA was used for the

transformation of DH5a™ (MAX EFFICIENCY™ DH5a™ competent cells, Life

Technologies) and XL-1 blue competent cells (QuikChange™ site-directed mutagenesis kit, Stratagene Cloning Systems) according to standard protocols. Figures 2A and 2B show schematic representations of vectors vEM132 and vEM134, respectively.

Bacteria containing the modified shuttle vectors vEM153 and 154 were amplified and DNA was extracted using standard Plasmid Midi preparation protocols. The DNA was then used for the construction of a recombinant MVA.

For the generation of recombinant MVA expressing the RSV F protein variants, CEF cells were infected with an MVA (MVATOR™ vector) at MOI 0.5 and after 1 hour of incubation transfected with the recombination vectors. 1.75 μg of plasmid DNA and 6 μΐ ^, of X-TREMEGENE™ HD transfection reagent (Roche) were used for transfection performed according to the manufacturer's instructions. After incubation the cells were screened visually for fluorescing cells that indicate the presence of the recombination vector (vEM153 or vEM154) and MVA within the cells. To separate recombinant MVAs (with RSV F protein) from parental MVA, several plaque purification rounds were performed under selective conditions using blasticidine. For this purpose, the infected (and transfected) cells were harvested and virus was released by three freeze/thaw cycles between liquid nitrogen and 37°C water bath and subsequent ultrasound treatment. CEF cells were infected with serial virus dilutions and after incubation for 48 to 72 hours screened for fluorescing foci. Several single foci were isolated and screened after each round of plaque purification. The virus was passaged and plaque purified until there was no parental MVA detectable. For the subsequent deletion of the selection cassette containing an Azami-Green and a blasticidine resistance (BsdR) coding region, the clonally pure recombinant viruses were passaged without blasticidine. Without blasticidine selection the cassette will be deleted through recombination between the Fla...at and the 3' end of Flank 1, see Figure 2A-C. Plaques without fluorescence were isolated by several rounds of plaque purification. Finally, a crude virus stock was amplified on CEF cells. The resulting recombinant MVA crude virus stocks were characterized by sequencing of the insert region, PCR analysis for residual empty vector, titering, expression analysis (Example 4), stability after 6 passages on AGEl .CR.pIX cells with next generation sequencing (Example 5) and growth analysis on production cell line AGEl .CR.pIX (Example 6). For all MVA-RSV crude virus stocks the sequence of the insert region was shown to be as expected and the absence of residual empty vector was proven.

Example 3 - Construction of vEM155 and vEM156

For the construction of the shuttle vectors vEM155 and vEM156 the truncated fusion peptide and flanking sequences were amplified by PCR from vector vEM153 and vEM154 and inserted in vEM138 (Figure 2C) to replace the existing F protein in the recombination vector by the PCR amplified F protein with truncated fusion peptide.

For the PCR amplification of the F protein with truncated fusion peptide, vEM153 and vEMl 54 were used as template using oligonucleotide primers SEQ ID NO: 1 1/ SEQ ID NO: 12 (for vEM153) or SEQ ID NO:l 1/ SEQ ID NO: 13 (for vEM154). The SEQ ID NO:l 1 primer (forward primer) adds the restriction endonuclease site for Kpnl to the 5' end of the H5 promoter. At the 3' end of the coding region the existing restriction endonuclease site for

Pad was used.

SEQ ID NO: 1 1 , H5 promoter & Kpnl fwd:

gcgcggtaccgtaccAAAAAATGAAAATAAATACAAAGGTTC

SEQ ID NO: 12 F protein rev: CAAGCTTAATTAATCAGCTGAAG

SEQ ID NO: 13 F protein ΔΤΜ rev: CAAGCTTAATTAATCAATTGGTGG

Lower case characters indicate sequences that do not bind to template sequence. Underlined sequences indicate restriction endonuclease sites used for further cloning.

For the PCR 5 μΐ, template DNA (10 ng/μί) were mixed with 10 μί 5x HF buffer, 2.5 μί of forward and reverse primer (10 mmol/fiL), 1 μΐ, dNTPs and 0.5 μΕ PHUSION™ polymerase (New England Biolabs) and filled with H ₂ 0 up to 50 μΐ _^ .

The subsequent PCR reaction was performed using the following settings:

98°C 3 min, 35 cycles of 98°C 20 sec then 63°C 30 sec then 72°C 90 sec, 72°C 10 min, 4°C until stop

The resulting PCR products were analyzed on a 1 % agarose gel and the remaining

PCR product was purified by using the Macherey-Nagel PCR purification kit. The purified DNA and the vector vEM138 were digested with Kpnl and Pad and the fragments with the correct size were purified from a 1% agarose gel (PCR products -1.8 kb and vEM138 ~5.5 kb). A ligation was performed with a T4 DNA ligase and a vector to insert ratio of 1 :3. 1 μΕ of the ligation mix was used for the transformation of DH5ct™ (MAX EFFICIENCY™ DH5a™ competent cells) bacteria according to standard protocols.

Bacteria containing plasmids vEM155 and 156 were amplified and DNA was extracted using standard Plasmid Midi preparation protocols. The DNA was then used for the construction of recombinant MVA vectors as described in Example 2. Example 4 - Testing Expression of Constructs

The RSV expression constructs and/or MVA vectors expressing the constructs were tested for expression of the modified RSV F proteins and as applicable expression of the RSV G protein conserved region. Expression can be analyzed, for example, by Western blot, ELISA and/or Immunofluorescence.

For this purpose A549 or HeLa cells were seeded in cell culture plates (e.g., 6-well plates) with an appropriate cell number to reach ~90% confluency within 24 hours (e.g., HeLa cells and A549 cells at approximately 8xl 0 ⁵ cells/well or 4xl0 ⁵ cells/well, respectively, in 6-well plates). The next day the cells of one well were counted. Based on the count, wells were infected with an MOI 5 by replacing the medium with the infection mix in medium w/o FBS. The plate was shaken at room temperature (R/T) for 30 min and then placed in an incubator for 30 min. The infection mix was then replaced by an appropriate volume of medium w/o FBS (e.g., 1 mL/well for 6-well plates) and incubated for 18-48 hrs.

The total protein extracts and the supernatant were then harvested. The 1 Ox RIPA

(Thermo Scientific) plus lOOx HALT™ protease inhibitor (Thermo Scientific) and l OOx EDTA in PBS to lx final concentrations are mixed (e.g., for 1 mL Lysis buffer: 100 Ι Οχ RIPA + 10 μL l OOx HALT™ protease inhibitor + 10 l OOx EDTA + 880 μΤ PBS). 100- 200 μΐ, of this lysis buffer was added to pelleted and PBS-washed cells for each well of a 6- well plate. Cells were incubated for 30 min to 1 hour on ice, shock-frozen in liquid N ₂ and thawed on ice. The tubes were vortexed and cellular debris is pelleted (e.g., 1 lOOOx g, 5 min, 4°C). Supernatant was transferred to fresh tubes, vortexed and aliquoted in appropriate volumes (e.g., 200 μΤ in 0.5 mL tubes). The protein concentration of the protein lysate was determined by BCA assay (Pierce BCA Protein Assay Kit) according to the manufacturer's instructions.

For the detection by Western Blot of the F protein, 30 - 60 μg protein lysate from Hela cells was resolved by PAGE under reducing conditions, and transferred onto

nitrocellulose membranes by Western blotting. For the detection of the F protein in the cell supernatant, 20 μΐ. of supernatant was resolved by PAGE under reducing conditions, and transferred onto nitrocellulose membranes by Western blotting. After saturating unspecific binding areas on the membrane with PBS containing 3% FBS (either 1 hour at R/T or overnight at 4°C), the membrane was stained with an appropriate dilution of an anti-RSV F protein antibody [2F7] in PBS-T (PBS containing 0.05% Tween 20) for 1 hour at R/T. After primary staining, the antibody solution was removed; the nitrocellulose membranes were washed three times for 5 min with PBS-T and incubated for 1 hour at R/T in PBS-T with an appropriate dilution of an anti-mouse HRP-coupled secondary antibody. After three washing steps with PBS-T for 15 min, protein bands were visualized by enhanced chemiluminescence using SUPERSIGNAL® West Pico Chemiluminescent Substrate (Pierce) according to the manufacturer's instructions. Protein bands were detected using VERSADOC™ Imaging system (BioRad).

The results of the Western Blot are shown in Figure 3. RSV F proteins were expressed from all recombinant MVA-RSV vectors. In constructs containing a deletion of the fusion peptide, only the F0 form of the F protein was detected. Additionally these constructs were not detected by Western blot analysis in the supernatant from infected cells, even if the transmembrane and cytoplasmic domains were deleted (mEM63 and mEM64). In contrast, MVA-RSV constructs comprising the full length or truncated fusion peptide combined with a deletion of the TM/CT domain (mEM61, mEM86 and mEM88) were secreted to the cell supernatant efficiently.

For the ELISA, dilute samples & standards in lx PBS to an appropriate concentration

(e.g., use only PBS or equivalent buffers, as other proteins from BSA or FBS may impair the assay by limiting available binding sites on the plastic surface). In a 96-well plate (Pierce REACTI-BIND™) add 100 μΐ,/well of the sample and standard dilutions, cover the plate and incubate for 2 hours at 37°C or overnight at 4°C. In the meanwhile, prepare Blocking Buffer (PBS-TWEEN™ 0.05% + 2% BSA) and Dilution buffer (PBS- TWEEN™ 0.05% + 0.5% BSA).

After the incubation time shake the plate at R/T for 10-15 min to allow additional binding. To remove the coating solution, wash 5 times with 250 PBS-T 0.05%. Then add 250 - 300 μΕ/well of Blocking Buffer and incubate for 1 hour at R/T with moderate shaking. Dilute the primary antibody to an appropriate concentration in Dilution Buffer.

Remove Blocking Buffer and add 100 μίΛνεΙΙ of primary antibody dilution and incubate for 1 hour at R/T with moderate shaking. Remove the primary antibody solution and wash 5 times with 250 μΕ PBS-T 0.05%. Dilute the secondary antibody in Dilution Buffer, add ΙΟΟμΕΛνεΙΙ and incubate for 1 hour at R/T with moderate shaking. In the meanwhile pre- warm an aliquot of TMB substrate to R/T in the dark (11 mL per plate). Remove secondary antibody solution and wash plate 5 times with 250 μΐ PBS-T 0.05%. Next add 100 μΕ/well of TMB substrate and incubate at R/T with heavy shaking (e.g. 600 rpm) until desired color develops (1-30 min). Stop reaction by adding 100 μΕ/well of a H ₂ S0 ₄ solution and measure absorbance at 450 nm (e.g., in a Tecan Infinite F200Pro plate reader). The data can be analyzed using Microsoft Excel and the OD values that correspond to RSV F protein steady- state levels can be compared.

Using these methods, expression of RSV F protein from different MVA vector constructs was evaluated by ELISA using the various anti-RSV F protein antibodies as the primary antibody. Expression of RSV F protein was analyzed in total-cell lysate (0.5 μg) or supernatant (100 μΕ) of infected cells. Direct ELISA was performed using mouse

monoclonal anti-RSV F protein antibody (131-2A) for detection, see Figure 4. The expression analysis revealed striking differences in the expression level that appeared dependent on the presence of the fusion peptide and possibly on the promoter used (Figure 4). The constructs including the whole fusion peptide or the truncated fusion peptide showed very high expression within the cells as well as in the supernatant (Figure 4: mEM60, mEM61, mEM85, mEM86, mEM87 and mEM88) whereas the constructs devoid of the fusion peptide did show reduced or even very low steady-state levels (Figure 4: mEM62 - 67). As expected, the constructs with transmembrane domain can be detected predominantly in the cell lysate of infected cells (Figure 4: mEM60, mEM85 and mEM87 with high steady state level and mEM62, mEM65 and mEM66 with low steady state level) whereas variants without transmembrane domain are secreted to the supernatant (Figure 4: mEM61, mEM86 and mEM88 with high expression and mEM63, mEM64 and mEM67 with low expression.

Additionally, the fusion peptide did not result in the fusion of cells or insufficient titers due to fusion of virus particles.

For the results in Figure 5, the direct ELISA was performed using the indicated anti-F protein antibodies for detection. These results showed that F proteins in recombinant MVA- RSV vectors can be detected with various anti-F protein antibodies recognizing different epitopes of the F protein. This indicates that the modifications in the F protein do not interfere with the correct folding and that the antigenic structure of the F protein is preserved.

While this Example refers to using an MVA vector to express the constructs, similar expression studies can be performed using other methods to express the encoded antigens, such as transfection of DNA encoding the antigens or using other viral vectors to express the particular antigen construct. Example 5 - Determining Stability of Viral Vectors Containing Constructs

Genetic stability of the RSV constructs is evaluated by serial passaging of the virus on cells, e.g., avian cells such as CEF cells or AGEl .CR.pIX cells (ProBioGen).

For this purpose, 20 mL of AGEl .CR.pIX cells are adjusted to lxl 0 ⁶ cells/mL and cultivated at 37°C with shaking. After 3 - 4 days cells are counted, infected with MVA RSV variants at an MOI of 0.1 with addition of 20 mL CD-VP4 medium (ProBioGen

AG/Biochrom AG) and incubated at 37°C with shaking for 3 days. Next, cells are harvested and MVA is released from infected cells by three cycles of freezing/thawing and/or sonication. To decrease the time of the stability study, the titer of the released virus is estimated for further infection rounds dependent on the starting amount of infected cells (e.g., virus titer on AGEl .CR.pIX cells lxlO ⁷ TCID ₅₀ /mL). This estimated titer is used for all following infection rounds. The RSV constructs are passaged 6 times on AGEl .CR.pIX cells. After passage 3 and passage 6, the integrity of the insert is verified by sequencing. For sequencing, DNA of infected cells is isolated with the NUCLEOSPIN™ Blood quick pure DNA kit (Macherey-Nagel) according to the manufacturer's protocol. PCR can be performed for amplification of the insertion site plus flanking regions within the MVA genome and the insert sequence can be determined by Sanger sequencing.

PCR fragments of the insert region were analyzed on agarose gels to confirm correct size and exclude deletions or insertions, (data not shown) All recombinant MVA-RSV vectors except for mEM61 show correct insert size after 6 passages on AGEl .CR.pIX cells. In mEM61 a faster migrating band is appearing after passage 6 (P6), which indicates that a part of the gene coding for the F protein is deleted. Further, passaging of mEM61 resulted in a point mutations in the F gene that resulted in the exchange from an amino acid coding codon to a stop codon. These nucleotide exchanges could only be detected by next- generation sequencing (method described below). All other constructs were stable.

Therefore it seems that the expression level and/or presence of the complete fusion peptide, but not the TM domain or absence of a coding region for a conserved region/domain of an RSV attachment G-protein, may have an impact on the stability of the constructs.

To analyze the genetic stability of the recombinant MVA-RSV variants, NextGen sequencing (Illumina technology) was performed for crude virus stocks and after passage 6 on AGE1.CR.pIX cells. Therefore, the harvested virus from passaging on AGE1.CR.pIX cells +P6 was titered using a TCID ₅₀ assay in a 96-well format. Then seven T175 flasks of CEF cells were infected with MVA-RSV variants at an MOI of 0.1 and incubated for 3 days. The infected cells were harvested by scraping into the medium, transferred to 2 x 225 mL Falcon tubes and centrifuged at 500x g for 5 min at 4°C. The medium was aspirated and the pellet was resuspended in 10 mL precooled lx PBS, combined and centrifuged again at 500x g for 5 min at 4°C. The resulting pellet was resuspended in 5 mL precooled RLN buffer (50 mM Tris-HCl pH 8.0, 140 mM NaCl, 1.5 mM MgCl ₂ , 0.5% Nonidet P-40), incubated for 5 min on ice and centrifuged at 300x g for 5 min at 4°C. The supernatant (cytoplasmic fraction) was transferred to a 15 mL Falcon tube and for removal of cellular DNA and RNA the samples were digested with 60 units TURBO™ DNase (30 μΕ) and 10 units RNase (5 μί) for 30 min at 37°C. The samples were incubated for 10 min at 75°C to inactivate the DNase and RNAse, cooled for 5 min on ice and incubated with 55 μΐ, Proteinase K (20 mg/mL), 150 Tween-20 (final concentration 5 %) and 15 μΐ, Triton X-100 (final concentration 0.5 %) for 1 hr at 50°C. After addition of -600 μ\. 5 Μ NaCl (final concentration 750 mM) to adjust binding conditions, the DNA was isolated according to the manufacturer's protocol (Qiagen genomic-tip20/G protocol). The precipitated and washed DNA pellet was resolved in 20 \L sterile water at 40°C for 1 hr with slight shaking. The DNA was quantified using an Eppendorf Biophotometer. 1 μΐ, of the DNA was analyzed on a 1% agarose gel (150 V, 90 min) in TAE buffer (40 n M Tris, 20 mM Acetate, 1 mM EDTA). After staining with ethidium bromide the DNA was visualized on a UV screen, 5 - 10 μg of the DNA was used for NextGen sequencing.

The NextGen sequencing was performed using an Illumina Genome Analyzer. The resulting data were analyzed by using MS office standard programs as well as the open source program Integrative Genomics Viewer (IGV version 2.1) for visualization of the alignments and SNP analysis. An optimally stabile recombinant MVA would have a sequence 100% as expected, but those with minimal changes may be of value. In the case of instabilities the ratio of intact/defect genomes can be determined. Defective genomes up to 5% of the total amount of genomes can be acceptable.

The sequences of the recombinant MVA-RSV genomes were verified by next- generation sequencing with a coverage of at least 240. The results are shown in Table 2. All recombinant MVA-RSV vectors except for mEM61 (see above) show the same sequence as the corresponding virus before passaging which demonstrates the high genetic stability of the MVA-RSV vectors upon tissue culture passages. This further demonstrates that Illumina sequencing is an appropriate technology for confirmation of genetic stability of recombinant MVA vectors.

Table 2 - Summary of next- eneration se uencin statistics

Example 6 - Testing growth of constructs

To compare the growth rate of the MVA-RSV constructs, a low-multiplicity growth analysis was performed in AGE1.CR.pIX cells. For this purpose, 10 mL of AGE1.CR.pIX cells were adjusted to lxl 0 ⁶ cells/mL and incubated for 3-4 days at 37°C with shaking. The cells were counted, transferred to 50 mL CULTIFLASKS™, centrifuged at 500x g for 5 min and resuspended in 5 mL CD-U2 medium. Cells were infected at MOI 0.05 and 5 mL CD- VP4 medium was added to cells. After one hour incubation at 37°C with shaking, cells were centrifuged at 500x g for 3 min and resuspended in 20 mL equally mixed CD-U2/CD-VP4 medium. Cells were transferred to 125 mL Erlenmeyer flasks and incubated at 37°C with shaking for 96 hrs. After incubation cells were transferred to 50 mL Flacon tubes and centrifuged at 500x g for 5 min. Cell pellet was resuspended in 5 mL equally mixed CD- U2/CD-VP4 medium. The harvested cells were freeze/thawed three times, sonicated to release cell-associated MVA and the titer was determined by a TCID ₅ 0 assay. The results are shown in Figure 6.

Example 7 - Testing Constructs in Animal Studies

The constructs or the resulting proteins/antigens are tested in animal models to evaluate immunogenicity, protective efficacy, safety, long term immunogenicity, durability of protection.

The constructs are administered to rodents (e.g., mice and/or rats) and/or cotton rats. The constructs can be tested at different dosage amounts and/or regimens. Various parameters can be assessed such as IgA response (e.g., Cusi et al. Vaccine (2002) 20:3436- 42), amount of anti-RSV antibodies and/or neutralizing antibodies, (e.g., see Nguyen et al. PLOS One (2012) 7(3):e34331 : l -l 1), B-cell and T-cell responses, (e.g., see Zhan et al. Vaccine (2007) 25 :8782-8793), in vitro neutralization (e.g., PRNT) assays. When tested in a challenge model, where the animals are vaccinated and later given live RSV virus, parameters can be assessed such as reduction of clinical symptoms, survival, reduction of RSV titer in the lungs, etc.

Administration can be tested by any route or combination of routes, for example, intra-nasal, intramuscular, subcutaneous, intradermal, inhalation and/or intravenous.

For one study mice are immunized and challenged according to Table 3. The read outs of the study can be one or more of the following:

^• Reduction in lung virus titer

^• Induction of anti-RSV antibodies

• Induction of anti-F antibodies

• Induction of neutralizing antibodies

^• Induction of cell mediated immune response

^• Body weight Figure 7 shows the induction of anti RSV-F antibodies in the immunized mice, as measured by ELISA. Panels A and B bar graphs are the same except they show the results of different statistical analyses.

Example 8 - Immunogenicity and Protection Study

MVA vectors expressing RSV antigens are inoculated intranasally and/or

intramuscularly to cotton rats or mice (e.g., BALB/C mice). One dosage amount (e.g., 5x10 infectious units) of MVA is administered, e.g., in 0.1 ml intranasally. The MVA vectors are delivered once, twice or more times, e.g., at day 0 and day 28. The anti-RSV antibodies are measures during the study, e.g., by ELISA. For challenge/protection studies RSV is administered at a later time (e.g., 60 days after the first dosing with MVA), e.g., lxlO ⁶ infectious units of RSV is administered intranasally. Mice are sacrificed later and titers of challenge virus are determined, e.g., in the nasal turbinates and/or lungs, e.g., see Whitehead et al. (1998) Virology 247:232-239. Titers of virus from the lungs of animals receiving MVA vectors expressing RSV antigens are compared to each other if different dosage amounts and/or scheduled are tested and are compared to those from animals not receiving the MVA vectors expressing RSV antigens or those receiving a MVA that does not express an RSV antigen.

An exemplary study design for the evaluation in mice and/or cotton rats is shown in

Table 4. Potential read outs of these studies are as follows

• Reduction in lung viral titer

• Histopathology for proof of reduced enhanced respiratory disease (Peribronchioloitis, Perivasculatis, Interstital Pneumonia, Alveolitis)

· Induction of anti-RSV, anti-F antibodies

• Induction of neutralizing antibodies

• Cytokine/chemokine induction

^• Body weight

• Lung infiltrating cells

· Characterization of immune response (antibody isotype, Thl , Th2 and others)

Table 4 - Example of efficacy study