IMPROVED CANCER THERAPEUTICS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims the benefit of U.S. Provisional Application Number 61/034438, filed March 6, 2008, and to U.S. Provisional Application Number 61/090498, filed August 20, 2008, both of which are hereby expressly incorporated by reference in their entireties.

FIELD OF THE INVENTION

[0002] Aspects of this invention relate to the fields of molecular biology and medicine. More specifically, disclosed herein are several approaches to provide subjects suffering from cancer with an inhibitor of S 100 A6 and/or S 100A4 or S 100A6 and/or S 100 A4 in combination with other cancer therapies so as to improve the cancer therapy and/or more efficiently treat cancer, in particular forms of cancer that are resistant to other therapies. Also disclosed herein are approaches for using S100A6 and/or S100A4 as a biomarker for metastases and risk of metastases. Further, disclosed herein are approaches for using S100A6 and/or S100A4 as a biomarker for cancer therapies, in particular, as a biomarker to determine individual responses to cancer therapies.

BACKGROUND

[0003] Cancer is diagnosed in more than 1 million people every year in the United States alone. In spite of numerous advances in medical research, cancer remains the second leading cause of death in the United States, accounting for roughly 1 in every four deaths. Although numerous treatments are available for various cancers, many forms of cancer remain incurable, untreatable, and/or become resistant to standard therapies.

[0004] The aggressive cancer cell phenotype is the result of a variety of genetic and epigenetic alterations leading to deregulation of intracellular signaling pathways (Ponder, Nature 41 1 :336 (2001)). The lack of appropriate apoptosis due to defects in the normal apoptosis machinery is a hallmark of cancer (Lowe et al., Carcinogenesis 21:485 (2000)).

Most current cancer therapies, including chemotherapeutic agents, radiation, and immunotherapy, work by indirectly inducing apoptosis in cancer cells. The inability of cancer cells to execute an apoptotic program due to defects in the normal apoptotic machinery is thus often associated with an increase in resistance to chemotherapy, radiation, or immunotherapy-induced apoptosis. Primary or acquired resistance of human cancer of different origins to current treatment protocols due to apoptosis defects is a major problem in current cancer therapy (Lowe et al, Carcinogenesis 21 :485 (2000); Nicholson, Nature 407:810 (2000)).

[0005] Accordingly, many investigators seek to design and develop new molecular target-specific anticancer therapies so as to improve survival and the quality of life of cancer patients.

SUMMARY OF THE INVENTION

[0006] Embodiments disclosed herein relate to cancer therapies including an S100A6 and/or S100A4 inhibitor in combination with an additional therapy. The additional therapy can be, for example, a chemotherapeutic agent, an anti-cancer small molecule, hormonal therapy, radiation, an antibody, or a biological agent specific for a cancer cell. The chemotherapeutic agent can be, for example, an alkylating agent or any alkylating agent disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an antimetabolite. The antimetabolite can be 5-flurouracil, 6-mercaptopurin, cytosine- arabinoside, fludarabine, or methotrexate, or any antimetabolite disclosed herein or known in the art. The chemotherapeutic agent can be, for example, a Topo II inhibitor. The Topo II inhibitor can be doxorubicin or epirubicin, or any Topo II inhibitor disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an intercalating agent. The intercalating agent can be amekrin, or any intercalating agent disclosed herein or known in the art. The anti-cancer small molecule can be, for example, an EGFR kinase inhibitor, an IGF-IR inhibitor, a VEGFR inhibitor, an mTOR inhibitor, an Akt inhibitor, a Smad inhibitor or any anti-cancer small molecule (e.g., inhibitors of metastasis and/or cell proliferation) disclosed herein or known in the art. The hormonal therapy can be, for example, an aromatase inhibitor or any hormonal therapy disclosed herein or known in the art. The

S100A6 and/or S 100A4 inhibitor can be, for example, a nucleic acid (e.g., a small interfering RNA (e.g., a short hairpin or small hairpin RNA (shRNA)), or a small molecule.

[0007] Other embodiments relate to methods of inhibiting, ameliorating, or ablation of cancer cells and/or tumors including providing an S100A6 and/or S100A4 inhibitor in combination with cancer therapy. The cancer therapy can be, for example, a chemotherapeutic agent, an anti-cancer small molecule, hormonal therapy, radiation, an antibody, or a biological agent specific for a cancer cell. The chemotherapeutic agent can be, for example, an alkylating agent or any alkylating agent disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an antimetabolite. The antimetabolite can be 5-flurouracil, 6-mercaptopurin, cytosine-arabinoside, fludarabine, or methotrexate, or any antimetabolite disclosed herein or known in the art. The chemotherapeutic agent can be, for example, a Topo II inhibitor. The Topo II inhibitor can be doxorubicin or epirubicin, or any Topo II inhibitor disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an intercalating agent. The intercalating agent can be amekrin, or any intercalating agent disclosed herein or known in the art. The anti-cancer small molecule can be, for example, an EGFR kinase inhibitor, an IGF-IR inhibitor, a VEGFR inhibitor, an mTOR inhibitor, an Akt inhibitor, a Smad inhibitor or any anti-cancer small molecule (e.g., inhibitors of metastasis and/or cell proliferation) disclosed herein or known in the art. The hormonal therapy can be, for example, an aromatase inhibitor or any hormonal therapy disclosed herein or known in the art. The S100A6 and/or S100A4 inhibitor can be, for example, a nucleic acid (e.g., a small interfering RNA), or a small molecule. The tumors can be resistant to radiation, chemotherapy, and/or antibody therapy.

[0008] Some embodiments relate to an improved cancer therapy, wherein the improvement includes the addition of an S100A6 and/or S100A4 inhibitor to a cancer therapy. The S100A6 and/or S100A4 inhibitor can be, for example, a nucleic acid (e.g., a small interfering RNA), or a small molecule. The cancer therapy can include, for example, a chemotherapeutic agent, an anti-cancer small molecule, hormonal therapy, radiation, an antibody, or a biological agent specific for a cancer cell. The chemotherapeutic agent can be, for example, an alkylating agent or any alkylating agent disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an antimetabolite. The antimetabolite can

be 5-flurouracil, 6-mercaptopurin, cytosine-arabinoside, fludarabine, or methotrexate, or any antimetabolite disclosed herein or known in the art. The chemotherapeutic agent can be, for example, a Topo II inhibitor. The Topo II inhibitor can be doxorubicin or epirubicin, or any Topo II inhibitor disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an intercalating agent. The intercalating agent can be amekrin, or any intercalating agent disclosed herein or known in the art. The anti-cancer small molecule can be, for example, an EGFR kinase inhibitor, an IGF-IR inhibitor, a VEGFR inhibitor, an mTOR inhibitor, an Akt inhibitor, a Smad inhibitor or any anti-cancer small molecule (e.g., inhibitors of metastasis and/or cell proliferation) disclosed herein or known in the art. The hormonal therapy can be, for example, an aromatase inhibitor or any hormonal therapy disclosed herein or known in the art.

[0009] Other embodiments relate to an improved anti-cancer pharmaceutical, wherein the improvement includes the addition of an S100A6 and/or S100A4 inhibitor. The S100A6 and/or S100A4 inhibitor can be, for example, a nucleic acid (e.g., a small interfering RNA), or a small molecule.

[0010] Further embodiments relate to a composition including an agent that induces apoptosis and an S100A6 and/or S100A4 inhibitor. Additional embodiments relate to the use of an S100A6 and/or S100A4 inhibitor to sensitize a cancer cell to a cancer therapy. Some embodiments relate to the use of an S100A6 and/or S100A4 inhibitor in a medicament or therapy for cancer.

[0011] Some embodiments relate to methods of inhibiting the proliferation of cancer cells including providing a therapy that inhibits proliferation of cancer cells and providing an inhibitor of S100A6 and/or S100A4. The therapy can include, for example, a chemotherapeutic agent, an anti-cancer small molecule, hormonal therapy, radiation, an antibody, or a biological agent specific for a cancer cell. The chemotherapeutic agent can be, for example, an alkylating agent or any alkylating agent disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an antimetabolite. The antimetabolite can be 5-flurouracil, 6-mercaptopurin, cytosine-arabinoside, fludarabine, or methotrexate, or any antimetabolite disclosed herein or known in the art. The chemotherapeutic agent can be, for example, a Topo II inhibitor. The Topo II inhibitor can be doxorubicin or epirubicin, or any

Topo II inhibitor disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an intercalating agent. The intercalating agent can be amekrin, or any intercalating agent disclosed herein or known in the art. The anti-cancer small molecule can be, for example, an EGFR kinase inhibitor, an IGF-IR inhibitor, a VEGFR inhibitor, an mTOR inhibitor, an Akt inhibitor, a Smad inhibitor or any anti-cancer small molecule (e.g., inhibitors of metastasis and/or cell proliferation) disclosed herein or known in the art. The hormonal therapy can be, for example, an aromatase inhibitor or any hormonal therapy disclosed herein or known in the art. The S100A6 and/or S100A4 inhibitor can be, for example, a nucleic acid (e.g., a small interfering RNA), or a small molecule. The cancer cells can be resistant to radiation, chemotherapy, and/or antibody therapy. The S100A6 and/or S100A4 inhibitor and the therapy that inhibits proliferation of cancer cells can be mixed and provided to a subject, for example, in a bolus, intravenously, intraperitoneal^, by oral administration, or by instillation into the pleural cavity.

[0012] Some embodiments relate to an apoptotic modulating composition comprising an agent that induces apoptosis and an S100A6 and/or S100A4 inhibitor. The agent that induces apoptosis can include, for example, a chemotherapeutic agent, an anticancer small molecule, hormonal therapy, radiation, an antibody, or a biological agent specific for a cancer cell. The chemotherapeutic agent can be, for example, an alkylating agent or any alkylating agent disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an antimetabolite. The antimetabolite can be 5-flurouracil, 6- mercaptopurin, cytosine-arabinoside, fludarabine, or methotrexate, or any antimetabolite disclosed herein or known in the art. The chemotherapeutic agent can be, for example, a Topo II inhibitor. The Topo II inhibitor can be doxorubicin or epirubicin, or any Topo II inhibitor disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an intercalating agent. The intercalating agent can be amekrin, or any intercalating agent disclosed herein or known in the art. The anti-cancer small molecule can be, for example, an EGFR kinase inhibitor, an IGF-IR inhibitor, a VEGFR inhibitor, an mTOR inhibitor, an Akt inhibitor, a Smad inhibitor or any anti-cancer small molecule (e.g., inhibitors of metastasis and/or cell proliferation) disclosed herein or known in the art. The hormonal therapy can be, for example, an aromatase inhibitor or any hormonal therapy

disclosed herein or known in the art. The S100A6 and/or S100A4 inhibitor can be, for example, a nucleic acid (e.g., a small interfering RNA), or a small molecule.

[0013] Various embodiments relate to methods for diagnosing cancer in a subject, including identifying a patient at risk for cancer, determining the level of S100A6 and/or S100A4 expression in a biological sample from said patient, and assessing whether S100A6 and/or S100A4 is expressed at a level which is higher than a predetermined level. The level of S100A6 and/or S100A4 expression can be determined, for example, by contacting said biological sample with anti-S100A6 and/or anti-S100A4 antibodies, real-time PCR, or multiple reaction monitoring using mass spectrometry.

[0014] Other embodiments relate to methods for monitoring the progress of a cancer in a subject including identifying a subject with a cancer, providing the subject a cancer therapy, and determining a level of S100A6 and/or S100A4 expression in a biological sample in said subject, before a treatment with the cancer therapy and during or after a period of the treatment. The level of S100A6 and/or S100A4 expression can be determined, for example, by contacting said biological sample with anti-S100A6 and/or anti-S100A4 antibodies, real-time PCR, or multiple reaction monitoring using mass spectrometry.

[0015] Further embodiments related to methods for determining the response to a cancer therapy in a subject including identifying a subject with a cancer, providing the subject a cancer therapy, and determining the level of S100A6 and/or S 100 A4 exp ression in a biological sample in the subject, before a treatment with the cancer therapy and during or after a period of the treatment. The level of S100A6 and/or S100A4 expression can be determined, for example, by contacting said biological sample with anti-S100A6 and/or anti- Si 00A4 antibodies, real-time PCR, or multiple reaction monitoring using mass spectrometry.

[0016] Some embodiments relate to a cancer therapy including an S100A6 and/or S100A4 inhibitor. The S100A6 and/or S 100A4 inhibitor can be, for example, a nucleic acid (e.g., a small interfering RNA), or a small molecule.

[0017] Additional embodiments relate to methods for screening for an S100A6 and/or S100A4 inhibitor including providing S100A6 and/or S100A4 protein or an S100A6 and/or S100A4 peptide, or fragment thereof, providing a target protein or peptide that binds S100A6 and/or S100A4, providing a compound (e.g., a candidate S100A6 and/or S100A4

inhibitor (e.g., a protein, peptide, or chemical obtained from a library of such molecules)); and assaying the ability of the compound to inhibit the binding of the S100A6 and/or S100A4 protein or S100A6 and/or S100A4 peptide to the target molecule. The target protein can be, for example, ubiquilin-1 or β-actin.

[0018] Some embodiments relate to a process for identifying an S100A6 and/or S100A4 inhibitor that acts synergistically with a cancer therapy, comprising providing a cancer therapy and contacting cancer cells with a compound, wherein a first level of cancer inhibition is determined; providing the cancer therapy without the compound, wherein a second level of cancer inhibition is determined; comparing the first level of cancer inhibition with the second level of cancer inhibition, wherein the S100A6 and/or S100A4 inhibitor that acts synergistically with a cancer therapy is identified when said first level of cancer inhibition is greater than said second level of cancer inhibition. The first level of cancer inhibition and second level of cancer inhibition can be determined by measuring an inhibition of cell proliferation. The first level of cancer inhibition and second level of cancer inhibition can be determined by measuring the number of cancer cells killed. The process can include inputting the first and second levels of cancer inhibition into a computer configured to transform said first and second levels of cancer inhibition into a prognostic index using an algorithm. The process can include determining whether the solved prognostic index is associated with a synergistic effect by comparing the solved prognostic index to a database containing a plurality of prognostic indices, wherein some of the indices are associated with a synergistic effect.

[0019] Some embodiments relate to a computerized system for identifying

S100A6 and/or S100A4 inhibitors that acts synergistically with a cancer therapy comprising a first data base comprising a level of cancer inhibition determined by providing the cancer therapy and contacting cancer cells with a S100A6 and/or S100A4 inhibitor; a second data base comprising a level of cancer inhibition determined by providing the cancer therapy without contacting cancer cells with the S 100A6 and/or S 100 A4 inhibitor; a search program that compares the first data base with the second database; and a retrieval program that identifies the S100A6 and/or S100A4 inhibitors that act synergistically with the cancer therapy.

[0020] The cancer therapy of any of the embodiments disclosed herein can include, for example, a chemotherapeutic agent, an anti-cancer small molecule, hormonal therapy, radiation, an antibody, or a biological agent specific for a cancer cell. The chemotherapeutic agent can be, for example, an alkylating agent or any alkylating agent disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an antimetabolite. The antimetabolite can be 5-flurouracil, 6-mercaptopurin, cytosine- arabinoside, fludarabine, or methotrexate, or any antimetabolite disclosed herein or known in the art. The chemotherapeutic agent can be, for example, a Topo II inhibitor. The Topo II inhibitor can be doxorubicin or epirubicin, or any Topo II inhibitor disclosed herein or known in the art. The chemotherapeutic agent can be, for example, an intercalating agent. The intercalating agent can be amekrin, or any intercalating agent disclosed herein or known in the art. The anti-cancer small molecule can be, for example, an EGFR kinase inhibitor, an IGF-IR inhibitor, a VEGFR inhibitor, an mTOR inhibitor, an Akt inhibitor, a Smad inhibitor or any anti-cancer small molecule (e.g., inhibitors of metastasis and/or cell proliferation) disclosed herein or known in the art. The hormonal therapy can be, for example, an aromatase inhibitor or any hormonal therapy disclosed herein or known in the art. The S100A6 and/or S100A4 inhibitor can be, for example, a nucleic acid (e.g., a small interfering RNA), or a small molecule. The cancer cells can be resistant to radiation, chemotherapy, or antibody therapy.

[0021] Further embodiments relate to a method for determining a cancer therapy to provide to a subject comprising identifying a subject with cancer; determining a level of S100A6 and/or S100A4 expression in a biological sample from said subject; and selecting a cancer therapy by evaluating the level of S100A6 expression in said biological sample. Some embodiments include comparing said level of S100A6 and/or S100A4 expression in a biological sample from said subject with a predetermined level of S100A6 and/or S 100 A4 expression. Some embodiments include inputting the level of S 100A6 and/or S100A4 expression in a biological sample from said subject and the predetermined level of S100A6 and/or S100A4 expression into a computer configured to transform the level of S100A6 and/or S100A4 expression in a biological sample from said subject and the predetermined level of S 100A6 and/or S 100 A4 expression into a prognostic index using an

algorithm. Some embodiments include determining whether the solved prognostic index is associated with a particular cancer therapy by comparing the solved prognostic index to a database containing a plurality of prognostic indices, wherein some of the indices are associated with the particular cancer therapy.

[0022] Other embodiments relate to a method of identifying a molecule that inhibits binding of S100A6 or S100A4 to a binding partner or ligand comprising providing a first cell that expresses S100A6 and/or S100A4; providing a candidate S100A6 and/or S 100A4 inhibitory molecule; contacting said first cell with said molecule; and determining the level of binding of S100A6 or S100A4 to a ligand or binding partner; optionally, providing a second cell that expresses S100A6 and/or S100A4, which is not contacted with said candidate S100A6 and/or S100A4 inhibitory molecule; determining the level of binding of Sl 0OA 6 or S100A4 to a ligand or binding partner in said second cell; and comparing the level of binding of S100A6 or S100A4 to said ligand or binding partner in said first cell contacted with said candidate S100A6 and/or S100A4 inhibitory molecule to said second cell, which is not contacted with said candidate S 100A6 and/or S100A4 inhibitory molecule, whereby a molecule that inhibits binding of SlOO A6 or S100A4 to a binding partner or ligand is identified when the level of binding of SlOO A6 or S100A4 to a ligand or binding partner in said first cell is less than the level of binding of S100A6 or S100A4 to a ligand or binding partner in said second cell.

[0023] More embodiments relate to a method of identifying a molecule that modulates S100A6 or S100A4 activity comprising providing a first cell that expresses S100A6 and/or S 100A4; providing a candidate S100A6 and/or S 100 A4 modulatory molecule; contacting said first cell with said molecule; and determining the level of a marker of S100A6 or S100A4 activity selected from the group consisting of p53, p21, I kappaB alpha, AKAP12/GRAVIN, beta-catenin, ALDHlAl, AHNAK, Filimin A, Filimin B, Vimentin, HSPBl(Hsp27) Galectinl, Akap 12, and HspA2; optionally, providing a second cell that expresses S100A6 and/or S100A4, which is not contacted with said candidate S100A6 and/or S100A4 modulatory molecule; determining the level of said marker in said second cell; and comparing the level of said marker in said first cell contacted with said candidate S100A6 and/or S100A4 imodulatory molecule to said second cell, which is not

contacted with said candidate S 100A6 and/or S 100 A4 modulatory molecule, whereby a molecule that modulates S100A6 or S100A4 activity is identified when the level of said marker in said first cell is above or below the level of said marker in said second cell.

[0024] Additional embodiments relate to a method of identifying a molecule that increases sensitivity of a cancer cell to ionizing radiation comprising providing a first cancer cell that expresses S100A6 and/or S100A4; providing a candidate S100A6 and/or S100A4 inhibitory molecule; contacting said first cancer cell with said molecule; contacting said first cancer cell with ionizing radiation; and determining the level of sensitivity of said first cancer cell to said ionizing radiation; optionally, providing a second cancer cell that expresses S100A6 and/or S100A4, which is not contacted with said candidate S100A6 and/or S100A4 inhibitory molecule; determining the level of sensitivity of said second cell to ionizing radiation; and comparing the level of sensitivity of said first cell contacted with said candidate S100A6 and/or S100A4 inhibitory molecule to the level of sensitivity of said second cell, which is not contacted with said candidate S100A6 and/or S100A4 inhibitory molecule, whereby a molecule that increases sensitivity of a cancer cell to ionizing radiation is identified when the level of sensitivity of said first cell is less than the level of sensitivity of said second cell.

[0025] Some embodiments relate to a method of identifying a molecule that reduces cancer cell proliferation or cell migration comprising providing a first cancer cell that expresses S100A6 and/or S 100A4; providing a candidate S100A6 and/or S100A4 inhibitory molecule;

[0026] contacting said first cancer cell with said molecule; and determining the level of cell proliferation or cell migration of said first cancer cell; optionally, providing a second cancer cell that expresses S100A6 and/or S100A4, which is not contacted with said candidate S100A6 and/or S100A4 inhibitory molecule; determining the level of cell proliferation or cell migration of said second cell ; and comparing the level of cell migration or cell proliferation of said first cell contacted with said candidate S100A6 and/or S100A4 inhibitory molecule to the level of cell migration or cell proliferation of said second cell, which is not contacted with said candidate S100A6 and/or S100A4 inhibitory molecule, whereby a molecule that reduces cancer cell proliferation or cell migration is identified when

the level of cell proliferation or cell migration of said first cell is less than the level of sensitivity of said second cell.

BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1. S100A6 interacts with Ubiquilin-1. a, Four S100A6 peptides were detected in immunoprecipitates from control and irradiated (IR) A549 cells using LC- MS/MS. Relative quantification using iTRAQ ^® showed antigen specificity for the S100A6 antibody (S100A6) compared to isotype matched control antibody (IgY), and an irradiation dependent increase in S100A6 protein level, b, Five Ubiquilin-1 peptides were detected in immunoprecipitates and iTRAQ ^® quantification showed higher Ubiquilin-1 level in S100A6 precipitates, c, Western blot validation of the interaction between S100A6 and ubiquilin-1 showed strong signal for Ubiquilin-1 in S100A6 precipitate and undetectable Ubiquilin-1 in control precipitate, d, Immunoprecipitation using an antibody against Ubiquilin-1 further validated the interaction as S100A6 was detected in the Ubiquilin-1 precipitate but not in control precipitate.

[0028] Figure 2. S100A6 downregulation alters protein stability of p53, IκBα and β-catenin. a, S100A6 mRNA and protein level in A549 cells in response to siRNA treatment, b, p53 and p21 protein level in response to S100A6 downregulation. c, p53 protein levels in response to ionizing radiation and S100A6 downregulation d, IκBα protein level in response to S100A6 downregulation. e, IκBα protein level in response to ionizing radiation and S100A6 downregulation. f, Ubiquilin-1 protein level in response to ionizing radiation and S 100A6 downregulation. g, β-catenin protein level in response to S100A6 downregulation. h, p53, IκBα and β-catenin mRNA levels in response to S100A6 downregulation determined by quantitative RT-PCR.

[0029] Figure 3. Proteomic profiling revealed NFkB2 plOO as upregulated in response to S100A6 downregulation. a, Overview of LC-MS/MS proteomic profiling output, b, Relative quantity of NFkB2 pi 00 peptides, c, Validation of NFkB2 pi 00 protein level using western blot, d, NFkB2 mRNA level determined using RT-PCR.

[0030] Figure 4. S100A6 downregulation sensitises cells to ionizing radiation induced cell death, a. Effect of SlOO A6 downregulation on cell growth, b. Effect of SlOO A6

downregulation on IR induced cell death, c. p53, p21 and S100A6 protein levels in response to IR. d. Suggested model to explain the effects of DNA damage (e.g. IR or doxorubicin) induced S100A6 expression. In boxes are indicated suggested S100A6 target proteins for specific S100A6 actions.

[0031] Figure 5. Immunoprecipitation experiment overview. A combination of immunoprecipitation and quantitative proteomics with isobaric labelling was used to perform a proteome wide search to find new S100A6 interacting proteins.

[0032] Figure 6. Doxorubicin treatment results in upregulation of S100A6. The level of S100A6 increased post exposure to the DNA damaging agent doxorubicin.

[0033] Figure 7. S100A6 siRNA proteomic experiment overview. Proteomics experiment was performed to find additional proteins affected by S100A6. Irradiated and untreated S100A6 siRNA-containing cells were compared to empty vector control cells.

[0034] Figure 8. shRNA mediated silencing of S100A6 reduces cell migration as measured by scratch wound healing assay. Three separate wound healing experiments (WH1-WH3) all showed decreased migration in S100A6 shRNA expressing cells compared to empty vector cells.

[0035] Figure 9. Example of selection of an S100A6-specific time slot from chromatographic elution run. The peak corresponds to an S100A6 peptide (LMEDLDR) elution between 35-40 minutes.

[0036] Figure 10. Time scheduled MRM detection and quantification of S100A6 using two specific peptides (LQDAIEAR and LMEDLDR).

[0037] Figure 11. SlOO proteins that have increased protein level in response to ionizing radiation.

[0038] Figure 12. Cell lines with shRNA manipulated levels of S100A6 and S100A4 in A549 lung cancer cells and HCT116 colon cancer cells with either wt p53 or - /- p53.

DETAILEDDESCRIPTION OF THE PREFERRED EMBODIMENT [0039] S100A6, also known as calcyclin, is a small calcium binding protein that has been shown to be overexpressed in a wide spectrum of human cancers (Brown, L.M. et

al. 2006 MoI Carcinog 45(8):613-26; Cross, S.S. et al. 2005 Histopathology 46(3):256-69; Komatsu, K. et al. 2000 Br J Cancer 83(6):769-74; Luu, H.H. et al. 2005 Cancer Lett 229(1): 135-48; Maelandsmo, G.M. et al. 1997 Int J Cancer 1997 74(4):464-9; Ohuchida, K. et al. 2005 Clin Cancer Res 1 1(21):7785-93; Vimalachandran, D. et al. 2005 Cancer Res 65(8):3218-25). The biological function of S100A6 however has remained largely unknown, but the protein may be involved in cell proliferation (Breen, E.C. et al. 2003 J Cell Biochem 88(4):848-54), cytoskeleton arrangement (Golitsina, N.L. et al. 1996 Biochem Biophys Res Commun 220(2):360-5) and protein degradation (Nowotny, M. et al. 2003 J Biol Chem 278(29):26923-8). A p53 dependent upregulation of S100A6 in response to DNA damage has been shown (Orre, L.M., et al. 2007 MoI Cell Proteomics 6(12):2122-31).

[0040] It has been discovered that S 100A6 also acts as an anti-apoptotic protein interfering with several distinct pathways known to regulate proliferation and apoptosis. Using a proteomics approach, Ubiquilin-1 was found to be an S100A6 interacting protein. Ubiquilin-1 has previously been shown to regulate proteosomal degradation of p53 and IκBα (Kleijnen, M.F. et al. 2003 MoI Biol Cell 14(9):3868-75; Kleijnen, M.F. et al. 2000 MoI Cell 6(2):409-19). Further, S100A6 siRNA treatment of cells was shown to stabilize p53 and IκBα. In a second set of experiments, the downregulation of S100A6 stabilized NFκB2 pi 00. Calcyclin binding protein (CacyBP) is a previously known S100A6 interacting protein that is involved in degradation of β-catenin (Ning, X. et al. 2007 MoI Cancer Res 5(12): 1254-62). The downregulation of S 100A6 also increased β-catenin degradation.

[0041] Disclosed herein is the unexpected discovery that S100A6 and/or S100A4 siRNA treated cells are more sensitive to treatment with ionizing radiation. Experiments described herein show that overexpression of S100A6 in a cancer cell promotes survival through inhibition of p53 dependent apoptosis and stimulation of prosurvival signaling through both NFKB and β-catenin pathways.

[0042] Also disclosed herein are approaches for using S100A6 and/or S100A4 as a biomarker for metastases. In addition, disclosed herein are approaches for using S100A6 and/or S100A4 as a biomarker for cancer therapies, in particular, as a biomarker to determine individual responses to cancer therapies. Hence, the data provide evidence that S100A6 and/or S100A4 is a robust oncoprotein, which should be targeted by therapeutic modalities.

[0043] As described herein, it is intended that where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the embodiments. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges is also encompassed within the embodiments, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either both of those included limits are also included in the embodiments.

[0044] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the embodiments belong. Although any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the embodiments, the preferred methods and materials are now described. AU publications mentioned herein are expressly incorporated by reference in their entireties.

[0045] As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes a plurality of such methods and reference to "a dose" includes reference to one or more doses and equivalents thereof known to those skilled in the art, and so forth.

[0046] In some contexts, the terms "individual," "host," "subject," and "patient" are used interchangeably to refer to an animal that is the object of treatment, observation and/or experiment. "Animal" includes vertebrates and invertebrates, such as fish, shellfish, reptiles, birds, and, in particular, mammals. "Mammal" includes, without limitation, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates, such as monkeys, chimpanzees, and apes, and, in particular, humans.

[0047] In some contexts, the terms "ameliorating," "treating," "treatment," "therapeutic," or "therapy" do not necessarily mean total cure or abolition of the disease or condition. Any alleviation of any undesired signs or symptoms of a disease or condition, to any extent, can be considered amelioration, and in some respects a treatment and/or therapy.

[0048] The term "therapeutically effective amount/dose" or "inhibitory amount" is used to indicate an amount of an active compound, or pharmaceutical agent, that elicits a biological or medicinal response. This response may occur in a tissue, system, animal or human and includes alleviation of the symptoms of the disease being treated. For example, with respect to the treatment of cancer, a therapeutically effective amount preferably refers to the amount of a therapeutic agent that decreases the rate of tumor growth, decreases tumor mass, decreases the number of metastases, increases time to tumor progression, or increases survival time by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%.

[0049] The term "nucleic acids", as used herein, may be DNA or RNA or modified versions thereof. Nucleic acids may also include modified nucleotides that permit correct read through by a polymerase and do not alter expression of a polypeptide encoded by that nucleic acid. The terms "nucleic acid" and "oligonucleotide" are used interchangeably to refer to a molecule comprising multiple nucleotides. As used herein, the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides. The terms shall also include polynucleosides (e.g., a polynucleotide minus the phosphate) and any other organic base containing polymer. Nucleic acids include vectors, e.g., plasmids, as well as oligonucleotides. Nucleic acid molecules can be obtained from existing nucleic acid sources, but are preferably synthetic (e.g., produced by oligonucleotide synthesis).

[0050] The phrase "nucleotide sequence" includes both the sense and antisense strands as either individual single strands or in the duplex.

[0051] The phrase "nucleic acid sequence encoding" refers to a nucleic acid which directs the expression of a specific protein or peptide. The nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein. The nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length sequences. It being further understood that the sequence includes the degenerate codons of the native

sequence or sequences which may be introduced to provide codon preference in a specific host cell.

[0052] By "DNA" is meant a polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in double-stranded or single-stranded form, either relaxed or supercoiled. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes single- and double- stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (e.g., the strand having the sequence homologous to the mRNA). The term captures molecules that include the four bases adenine, guanine, thymine, or cytosine, as well as molecules that include base analogues, which are known in the art.

[0053] A "gene" or "coding sequence" or a sequence, which "encodes" a particular protein, is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory or control sequences. The boundaries of the gene are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A gene can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the gene sequence.

[0054] The term "control elements" refers collectively to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control elements need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.

[0055] The term "promoter region" is used herein in its ordinary sense to refer to a nucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding RNA polymerase and initiating transcription of a downstream (3'-direction) coding sequence.

[0056] The term "operably linked" refers to an arrangement of elements, wherein the components so described are configured so as to perform their usual function. Thus, control elements operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.

[0057] For the purpose of describing the relative position of nucleotide sequences in a particular nucleic acid molecule throughout the instant application, such as when a particular nucleotide sequence is described as being situated "upstream," "downstream," "5'," or "3"' relative to another sequence, it is to be understood that it is the position of the sequences in the non-transcribed strand of a DNA molecule that is being referred to as is conventional in the art.

[0058] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an analog or mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Polypeptides can be modified, e.g., by the addition of carbohydrate residues to form glycoproteins. The terms "polypeptide," "peptide" and "protein" include glycoproteins, as well as non- glycoproteins. Polypeptide products can be biochemically synthesized such as by employing standard solid phase techniques. Such methods include but are not limited to exclusive solid phase synthesis, partial solid phase synthesis methods, fragment condensation, classical solution synthesis. These methods are preferably used when the peptide is relatively short (e.g., 10 kDa) and/or when it cannot be produced by recombinant techniques (e.g., not encoded by a nucleic acid sequence) and therefore involves different chemistry. Solid phase

polypeptide synthesis procedures are well known in the art and further described by John Morrow Stewart and Janis Dillaha Young, Solid Phase Peptide Syntheses (2nd Ed., Pierce Chemical Company, 1984). Synthetic polypeptides can optionally be purified by preparative high performance liquid chromatography [Creighton T. (1983) Proteins, structures and molecular principles. WH Freeman and Co. N.Y.], after which their composition can be confirmed via amino acid sequencing. In cases where large amounts of a polypeptide are desired, it can be generated using recombinant techniques such as described by Bitter et al., (1987) Methods in Enzymol. 153:516-544, Studier et al. (1990) Methods in Enzymol. 185:60-89, Brisson et al. (1984) Nature 310:51 1-514, Takamatsu et al. (1987) EMBO J. 6:307-31 1 , Coruzzi et al. (1984) EMBO J. 3: 1671-1680 and Brogli et al., (1984) Science 224:838-843, Gurley et al. (1986) MoI. Cell. Biol. 6:559-565 and Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463.

[0059] The term "homology" refers to the percent of identity between two polynucleotide or two polypeptide moieties. The correspondence between the sequence from one moiety to another can be determined by techniques known in the art. For example, homology can be determined by a direct comparison of the sequence information between two polypeptide molecules by aligning the sequence information and using readily available computer programs. Alternatively, homology can be determined by hybridization of polynucleotides under conditions, which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. Two DNA, or two polypeptide sequences are "substantially homologous" to each other when at least about 80%, preferably at least about 90%, and most preferably at least about 95% of the nucleotides or amino acids match over a defined length of the molecules, as determined using the methods above.

[0060] By "isolated" when referring to a nucleotide sequence, is meant that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type. Thus, an "isolated nucleic acid molecule, which encodes a particular polypeptide," refers to a nucleic acid molecule, which is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may

include some additional bases or moieties, which do not deleteriously affect the basic characteristics of the composition.

[0061] The terms "vector", "cloning vector", "expression vector", and "helper vector" mean the vehicle by which a DNA or RNA sequence (e.g., a foreign gene) can be introduced into a host cell, so as to promote expression (e.g., transcription and/or translation) of the introduced sequence. Vectors include plasmids, phages, viruses, pseudoviruses, etc.

[0062] The phrase "gene transfer" or "gene delivery" refers to methods or systems for reliably inserting foreign DNA into host cells.

[0063] As used herein, the term "transfection" is understood to include any means, such as, but not limited to, adsorption, microinjection, electroporation, lipofection and the like for introducing an exogenous nucleic acid molecule into a host cell. The term "transfected" or "transformed", when used to describe a cell, means a cell containing an exogenously introduced nucleic acid molecule and/or a cell whose genetic composition has been altered by the introduction of an exogenous nucleic acid molecule.

[0064] The term "hyperproliferative disease," as used herein, refers to any condition in which a localized population of proliferating cells in an animal is not governed by the usual limitations of normal growth. Examples of hyperproliferative disorders include tumors, neoplasms, lymphomas and the like. A neoplasm is said to be benign if it does not undergo invasion or metastasis and malignant if it does either of these. A "metastatic" cell means that the cell can invade and destroy neighboring body structures. Hyperplasia is a form of cell proliferation involving an increase in cell number in a tissue or organ without significant alteration in structure or function. Metaplasia is a form of controlled cell growth in which one type of fully differentiated cell substitutes for another type of differentiated cell.

[0065] The term "neoplastic disease," as used herein, refers to any abnormal growth of cells being either benign (non-cancerous) or malignant (cancerous).

[0066] The term "anti-neoplastic agent," as used herein, refers to any compound that retards the proliferation, growth, or spread of a targeted (e.g., malignant) neoplasm.

[0067] The term "apoptosis modulating agents," as used herein, refers to agents which are involved in modulating (e.g., inhibiting, decreasing, increasing, promoting) apoptosis. Examples of apoptosis modulating agents include proteins and nucleic acids,

which comprise a death domain or encode a death domain such as, but not limited to, Fas/CD95, TRAMP, TNF RI, DRl , DR2, DR3, DR4, DR5, DR6, FADD, and RIP. Small RNAs such as MIR RNAs can also be apoptosis modulating agents (e.g., MIR-34a). Other examples of apoptotic modulating agents include, but are not limited to, TNF-alpha, Fas ligand, antibodies to Fas/CD95 and other TNF family receptors, TRAIL, antibodies to TRAILRl or TRAILR2, Bcl-2, p53, BAX, BAD, Akt, CAD, PI3 kinase, PPl, and caspase proteins. Modulating agents broadly include agonists and antagonists of TNF family receptors and TNF family ligands. Apoptosis modulating agents may be soluble or membrane bound (e.g. ligand or receptor). Preferred apoptosis modulating agents are inducers of apoptosis, such as TNF or a TNF-related ligand, particularly a TRAMP ligand, a Fas/CD95 ligand, a TNFR-I ligand, or TRAIL.

[0068] The term "overexpression of S100A6 and/or S100A4," as used herein, refers to an elevated level (e.g., aberrant level) of mRNAs encoding for S100A6 and/or S100A4 protein, and/or to elevated levels of S100A6 and/or S100A4 protein in cells as compared to similar corresponding non-pathological cells expressing basal levels of mRNAs encoding S100A6 and/or S100A4 protein or having basal levels of S100A6 and/or S100A4 protein. Methods for detecting the levels of mRNAs encoding S100A6 and/or S100A4 protein or levels of S100A6 and/or S100A4 protein in a cell include, but are not limited to, Western blotting using S100A6 and/or S100A4 protein antibodies, immunohistochemical methods, and methods of nucleic acid amplification or direct RNA detection. As important as the absolute level of S100A6 and/or S100A4 protein in cells is to determining that they overexpress S100A6 and/or S100A4 protein, so also is the relative level of S100A6 and/or S100A4 protein to other pro-apoptotic signaling molecules within such cells. When the balance of these two are such that, were it not for the levels of the S100A6 and/or S100A4 protein, the pro-apoptotic signaling molecules would be sufficient to cause the cells to execute the apoptosis program and die, said cells would be dependent on the S 100A6 and/or S100A4 protein for their survival. In such cells, exposure to an inhibiting effective amount of an S100A6 and/or S100A4 protein inhibitor will be sufficient to cause the cells to execute the apoptosis program and die. Thus, the term "overexpression of an S100A6 and/or S100A4 protein" also refers to cells that, due to the relative levels of pro-apoptotic signals and anti-

apoptotic signals, undergo apoptosis in response to inhibiting effective amounts of compounds that inhibit the function of SlOO A6 and/or S100A4 protein.

[0069] The terms "anticancer agent" and "anticancer drug," as used herein, refer to any therapeutic agents (e.g., chemotherapeutic compounds and/or molecular therapeutic compounds), radiation therapies, or surgical interventions, used in the treatment of hyperproliferative diseases such as cancer (e.g., in mammals).

[0070] The terms "sensitize" and "sensitizing," as used herein, refer to making, through the administration of a first agent (e.g., an siRNA), an animal or a cell within an animal more susceptible, or more responsive, to the biological effects (e.g., promotion or retardation of an aspect of cellular function including, but not limited to, cell growth, proliferation, invasion, angiogenesis, or apoptosis) of a second agent. The sensitizing effect of a first agent on a target cell can be measured as the difference in the intended biological effect (e.g., promotion or retardation of an aspect of cellular function including, but not limited to, cell growth, proliferation, invasion, angiogenesis, or apoptosis) observed upon the administration of a second agent with and without administration of the first agent. The response of the sensitized cell can be increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, or at least 500% over the response in the absence of the first agent.

[0071] The term "dysregulation of apoptosis," as used herein, refers to any aberration in the ability of (e.g., predisposition) a cell to undergo cell death via apoptosis. Dysregulation of apoptosis is associated with or induced by a variety of conditions, including for example, autoimmune disorders (e.g., systemic lupus erythematosus, rheumatoid arthritis, graft-versus-host disease, myasthenia gravis, or Sjogren's syndrome), chronic inflammatory conditions (e.g., psoriasis, asthma or Crohn's disease), hyperproliferative disorders (e.g., breast cancer, lung cancer), viral infections (e.g., herpes, papilloma, or HIV), and other conditions, such as osteoarthritis and atherosclerosis. It should be noted that when the dysregulation is induced by or associated with a viral infection, the viral infection may or may not be detectable at the time dysregulation occurs or is observed. That is, viral-induced dysregulation can occur even after the disappearance of symptoms of viral infection.

[0072] The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviations, per the practice in the art. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term "about" meaning within an acceptable error range for the particular value should be assumed.

[0073] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[0074] The phrase "pharmaceutically-acceptable" or "pharmacologically- acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human. The preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.

[0075] As used herein, the term "heterologous sequence or gene" means a nucleic acid (RNA or DNA) sequence, which is not naturally found in association with the nucleic acid sequences of the specified molecule. The section below provides greater detail on some approaches that can be used to prepare inhibitors of S100A6 and/or S100A4. Inhibitors of S 100A6 and/or S 100 A4

[0076] Embodiments disclosed herein relate to compounds, which inhibit an S100A6 and/or S100A4 activity. While not being bound to any particular theory, it is believed that by inhibiting an S100A6 and/or S100A4 activity, cells become sensitized to apoptosis and, in some instances, these compounds themselves induce apoptosis. Therefore, embodiments disclosed herein relate to methods of sensitizing cells to apoptosis and methods of inducing apoptosis in cells, comprising contacting cells with an inhibitor of S100A6 and/or S100A4 alone or in combination with an agent that induces apoptosis. Embodiments disclosed herein further relate to methods of treating, ameliorating, or preventing disorders in an animal that are responsive to an induction of apoptosis comprising providing to the animal (e.g., a human) an inhibitor of S100A6 and/or S100A4 and an agent that induces apoptosis. Such disorders include those characterized by a dysregulation of apoptosis and those characterized by overexpression of S100A6 and/or S100A4.

[0077] Embodiments disclosed herein concern methods of reducing the proliferation of cancer cell, methods of ameliorating cancer or a disorder associated with cancer, methods of killing cancer cells, and methods of treating a patient suffering from cancer, by providing to a patient identified as one in need of a reduction in the proliferation of cancer dells, an amelioration of cancer or a disorder associated with cancer, a killing of cancer cells or a cancer treatment a composition that comprises an amount of an S100A6 and/or S100A4 inhibitor sufficient to reduce the proliferation of cancer cells, ameliorate cancer or a disorder associated with cancer, kill cancer cells or treat the cancer. The identification of patients for such treatments can be accomplished by diagnostic or clinical approaches as known in the art. The inhibitor can be an siRNA molecule, an antisense molecule, a small RNA (e.g., a micro RNA) or modified nucleic acid, a ribozyme, an antibody (such as a neutralizing antibody), a polypeptide (e.g., a dominant negative peptide). Additionally, the S100A6 and/or S100A4 inhibitor may be a chemical inhibitor such as a small molecule, e.g., chemical molecules with a low molecular weight (e.g. a molecular weight below 2000 daltons). siRNA

[0078] A "small interfering RNA" (siRNA) refers to an RNA molecule which decreases or silences (prevents) the expression of a gene/mRNA of its endogenous cellular

counterpart. The term is understood to encompass "RNA interference" (RNAi). RNA interference (RNAi) refers to the process of sequence-specific post transcriptional gene silencing in mammals mediated by small interfering RNAs (siRNAs, e g , short hairpin RNAs (shRNAs)) (Fire et al, 1998, Nature 391, 806). The corresponding process in plants is commonly referred to as specific post transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. The RNA interference response may feature an endonuclease complex containing an siRNA, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA may take place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al 2001, Genes Dev., 15, 188). For recent information on these terms and proposed mechanisms, see Bernstein E., Denli A M., Hannon G J: The rest is silence. RNA. 2001 November; 7(1 1): 1509-21; and Nishikura K.: A short primer on RNAi: RNA-directed RNA polymerase acts as a key catalyst. Cell. 2001 November 16; 107(4):415- 8. Examples of siRNA molecules which may be used in the embodiments disclosed herein are given in Table 1 :

Table 1

Example sequence Hairpin sequence for shRNA/RNAi

SEQ ID NO 5 CCGGGAGGTGAACTTCCAGGAGTATCTCGAGλrλCrCCroGλλGTTCλCCrCTTT TTG

SEQ ID NO 149 CCGGGAGGUGAACUUCCAGGAGUAUCUCGAGλUACUCCϋGGAλGUUCACCUCUUUUU G

SEQ ID NO 6 CCGGCCTGAGCAAGAAGGAGCTGAACTCGAGrrCλGCrCC7TCrrGCrCλGGTTTTTG

SEQ ID NO 150 CCGGCCUGAGCAAGAAGGAGCUGAACUCGAGt/t/CλGCt/CCl/t/Ct/t/GCt/Cλ GGUUUUUG

SEQ ID NO 7 CCGGCGTGGCCATCTTCCACAAGTAC ϊTACTTGTGGAAGATGGCCACGTTTUG

SEQ ID NO 151 CCGGCGUGGCCAUCUUCCACAAGUACUCGAGUACWGtyGGAAGAtyGGCCACGUUUUUG

SEQ ID NO 8 CCGGCTTCCAGGAGTATGTCACCTTC DAAGGTGACA TACTCCTGGAAGΎΎΎJTG

SEQ ID NO 152 CCGGCUUCCAGGAGUAUGUCACCUUCyCGAGAAGGt/GACAUACtyCCUGGAAGUUUUUG

SEQ ID NO 9 CCGGTGCAAGGCTGATGGAAGACπCTCGAGAAGrcrrCCArCAGCC7TGCATTTTTG

SEQ ID NO 153 CCGGUGCAAGGCUGAUGGAAGACUUC 3AAGl/Ctλ/CCλUCAGCCi;t/GCAUUUUUG

Codes sense loop anϋsense

[0079] During recent years, RNAi has emerged as one of the most efficient methods for inactivation of genes (Nature Reviews, 2002, v. 3, p. 737-47; Nature, 2002, v. 418, p. 244-51). As a method, it is based on the ability of dsRNA species to enter a specific protein complex, where it is then targeted to the complementary cellular RNA and

specifically degrades it. In more detail, dsRNAs are digested into short (17-29 bp) inhibitory RNAs (siRNAs) by type III RNAses (DICER, Drosha, etc) (Nature, 2001, v. 409, p. 363-6; Nature, 2003, 425, p. 415-9). These fragments and complementary mRNA are recognized by the specific RISC protein complex. The whole process is culminated by endonuclease cleavage of target mRNA (Nature Reviews, 2002, v. 3, p. 737-47; Curr Opin MoI. Ther. 2003 June; 5(3):217-24).

[0080] For disclosure on how to design and prepare siRNA to known genes see for example Chalk A M, Wahlestedt C, Sonnhammer E L. Improved and automated prediction of effective siRNA Biochem. Biophys. Res. Commun. 2004 Jun. 18; 319(1):264- 74; Sioud M, Leirdal M., Potential design rules and enzymatic synthesis of siRNAs, Methods MoI. Biol. 2004; 252:457-69; Levenkova N, Gu Q, Rux J J.: Gene specific siRNA selector Bioinformatics. 2004 Feb. 12; 20(3):430-2. and Ui-Tei K, Naito Y, Takahashi F, Haraguchi T, Ohki-Hamazaki H, Juni A, Ueda R, Saigo K., Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference Nucleic Acids Res. 2004 Feb. 9; 32(3):936-48. See also Liu Y, Braasch D A, NuIfC J, Corey D R. Efficient and isoform-selective inhibition of cellular gene expression by peptide nucleic acids Biochemistry, 2004 Feb. 24; 43(7): 1921-7. See also PCT publications WO 2004/015107 (Atugen) and WO 02/44321 (Tuschl et al), and also Chiu Y L, Rana T M. siRNA function in RNAi: a chemical modification analysis, RNA 2003 September; 9(9): 1034-48 and U.S. Pat. Nos. 5,898,031 and 6,107,094 (Crooke) for production of modified/more stable siRNAs.

[0081] DNA-based vectors capable of generating siRNA within cells have been developed. The method generally involves transcription of short hairpin RNAs that are efficiently processed to form siRNAs within cells. Paddison et al. PNAS 2002, 99:1443- 1448; Paddison et al. Genes & Dev 2002, 16:948-958; Sui et al. PNAS 2002, 8:5515-5520; and Brummelkamp et al. Science 2002, 296:550-553. These reports describe methods to generate siRNAs capable of specifically targeting numerous endogenously and exogenously expressed genes.

[0082] For methods related to the delivery of siRNAs, see, for example, Shen et al (FEBS letters 539: 1 1 1-1 14 (2003)), Xia et al., Nature Biotechnology 20: 1006-1010 (2002), Reich et al., Molecular Vision 9: 210-216 (2003), Sorensen et al. (J. MoI. Biol. 327: 761-766

(2003), Lewis et al., Nature Genetics 32: 107-108 (2002) and Simeoni et al., Nucleic Acids Research 31 , 1 1 : 2717-2724 (2003). siRNA has recently been successfully used for inhibition in primates; for further details, see, for example, Tolentino et al., Retina 24(1) February 2004 pp 132-138.

[0083] In some embodiments the oligoribonucleotide according to embodiments disclosed herein comprises modified siRNA. In various embodiments the siRNA comprises an RNA duplex comprising a first strand and a second strand, whereby the first strand comprises a ribonucleotide sequence at least partially complementary to about 18 to about 40 consecutive nucleotides of a target nucleic acid, and the second strand comprises ribonucleotide sequence at least partially complementary to the first strand and wherein said first strand and/or said second strand comprises a plurality of groups of modified ribonucleotides having a modification at the 2'-position of the sugar moiety whereby within each strand each group of modified ribonucleotides is flanked on one or both sides by a group of flanking ribonucleotides whereby each ribonucleotide forming the group of flanking ribonucleotides is selected from an unmodified ribonucleotide or a ribonucleotide having a modification different from the modification of the groups of modified ribonucleotides. Antisense Molecules

[0084] In some embodiments, the S100A6 and/or S100A4 inhibitor can be an antisense molecule. The term "antisense" (AS) or "antisense fragment" refers to a polynucleotide fragment (comprising either deoxyribonucleotides, ribonucleotides or a mixture of both) having inhibitory antisense activity, which causes a decrease in the expression of the endogenous genomic copy of the corresponding gene. An AS polynucleotide refers to a polynucleotide which comprises consecutive nucleotides having a sequence of sufficient length and homology to a sequence present within the sequence of the target gene to permit hybridization of the AS to the gene. Many reviews have covered the main aspects of antisense (AS) technology and its enormous therapeutic potential (see, for example, Aboul-Fadl T., Curr Med. Chem. 2005; 12(19):2193-214; Crooke S T, Curr MoI. Med. 2004 August; 4(5):465-87; Crooke S T, Annu Rev Med. 2004; 55:61-95; Vacek M et al., Cell MoI Life Sci. 2003 May; 60(5):825-33; Cho-Chung Y S, Arch Pharm Res. 2003 March; 26(3): 183-91 ; Moreira J N et al., Rev Recent Clin Trials 2006 Sep; l(3):217-35).

There are further reviews on the chemical (Crooke, 1995; Uhlmann et al, 1990), cellular (Wagner, 1994) and therapeutic (Hanania, et al, 1995; Scanlon, et al, 1995; Gewirtz, 1993) aspects of this technology. Antisense intervention in the expression of specific genes can be achieved by the use of synthetic AS oligonucleotide sequences (for recent reports see Lefebvre-d'Hellencourt et al, 1995; Agrawal, 1996; LevLehman et al, 1997).

[0085] AS oligonucleotide sequences may be short sequences of DNA, typically a 15-mer to a 30-mer but may be as small as a 7-mer (Wagner et al, 1996), designed to complement a target mRNA of interest and form an RNA:AS duplex. This duplex formation can prevent processing, splicing, transport or translation of the relevant mRNA. Moreover, certain AS nucleotide sequences can elicit cellular RNase H activity when hybridized with their target mRNA, resulting in mRNA degradation (Calabretta et al, 1996 Semin Oncol. 23(l):78-87). In that case, RNase H will cleave the RNA component of the duplex and can potentially release the AS to further hybridize with additional molecules of the target RNA. An additional mode of action results from the interaction of AS with genomic DNA to form a triple helix, which can be transcriptionally inactive.

[0086] The sequence target segment for the antisense oligonucleotide is selected such that the sequence exhibits suitable energy related characteristics important for oligonucleotide duplex formation with their complementary templates, and shows a low potential for self-dimerization or self-complementation (Anazodo et al., 1996). For example, the computer program OLIGO ^® (Primer Analysis Software, Version 3.4), can be used to determine antisense sequence melting temperature, free energy properties, and to estimate potential self-dimer formation and self-complimentary properties. The program allows the determination of a qualitative estimation of these two parameters (potential self-dimer formation and self-complimentary) and provides an indication of "no potential" or "some potential" or "essentially complete potential". Using this program target segments are generally selected that have estimates of no potential in these parameters. However, segments can be used that have "some potential" in one of the categories. A balance of the parameters is used in the selection as is known in the art. Further, the oligonucleotides are also selected as needed so that analogue substitutions do not substantially affect function.

[0087] Phosphorothioate antisense oligonucleotides do not normally show significant toxicity at concentrations that are effective and exhibit sufficient pharmacodynamic half-lives in animals (Agarwal et al., 1996) and are nuclease resistant. Antisense induced loss-of-function phenotypes related with cellular development were shown for the glial fibrillary acidic protein (GFAP), for the establishment of tectal plate formation in chick (Galileo et al., 1991) and for the N-myc protein, responsible for the maintenance of cellular heterogeneity in neuroectodermal cultures (ephithelial vs. neuroblastic cells, which differ in their colony forming abilities, tumorigenicity and adherence) (Rosolen et al., 1990; Whitesell et al, 1991). Antisense oligonucleotide inhibition of basic fibroblast growth factor (bFgF), having mitogenic and angiogenic properties, suppressed 80% of growth in glioma cells (Morrison, 1991) in a saturable and specific manner. Being hydrophobic, antisense oligonucleotides interact well with phospholipid membranes (Akhter et al., 1991). Following their interaction with the cellular plasma membrane, they are actively (or passively) transported into living cells (Loke et al., 1989), in a saturable mechanism predicted to involve specific receptors (Yakubov et al., 1989). Ribozymes

[0088] In some embodiments, the S100A6 and/or S100A4 inhibitor can be a ribozyme. The term "ribozyme" refers to an RNA molecule that possesses RNA catalytic ability and cleaves a specific site in a target RNA. In accordance with the embodiments disclosed herein, ribozymes which cleave mRNA may be utilized as inhibitors. This may be necessary in cases where antisense therapy is limited by stoichiometric considerations (Sarver et al., 1990, Gene Regulation and Aids, pp. 305-325). Ribozymes can then be used that will target the a gene associated with a bone marrow disease. The number of RNA molecules that are cleaved by a ribozyme is greater than the number predicted by stochiochemistry. (Hampel and Tritz, 1989; Uhlenbeck, 1987).

[0089] Ribozymes catalyze the phosphodiester bond cleavage of RNA. Several ribozyme structural families have been identified including Group I introns, RNase P, the hepatitis delta virus ribozyme, hammerhead ribozymes and the hairpin ribozyme originally derived from the negative strand of the tobacco ringspot virus satellite RNA (sTRSV) (Sullivan, 1994; U.S. Pat. No. 5,225,347). The latter two families are derived from viroids

and virusoids, in which the ribozyme is believed to separate monomers from oligomers created during rolling circle replication (Symons, 1989 and 1992). Hammerhead and hairpin ribozyme motifs are most commonly adapted for trans-cleavage of mRNAs for gene therapy (Sullivan, 1994). In general the ribozyme has a length of from about 30-100 nucleotides. Delivery of ribozymes is similar to that of AS fragments and/or siRNA molecules.

[0090] Polynucleotides to be used according to embodiments disclosed herein may undergo modifications so as to possess improved therapeutic properties. Modifications or analogs of nucleotides can be introduced to improve the therapeutic properties of polynucleotides. Improved properties include increased nuclease resistance and/or increased ability to permeate cell membranes. Nuclease resistance, where needed, is provided by any method known in the art that does not interfere with biological activity of the AS polynucleotide, siRNA, cDNA and/or ribozymes as needed for the method of use and delivery (Iyer et al., 1990; Eckstein, 1985; Spitzer and Eckstein, 1988; Woolf et al., 1990; Shaw et al., 1991). Modifications that can be made to oligonucleotides in order to enhance nuclease resistance include modifying the phosphorous or oxygen heteroatom in the phosphate backbone. These include preparing methyl phosphonates, phosphorothioates, phosphorodithioates and morpholino oligomers. In one embodiment it is provided by having phosphorothioate bonds linking between the four to six 3'-terminus nucleotide bases. Alternatively, phosphorothioate bonds link all the nucleotide bases. Other modifications known in the art may be used where the biological activity is retained, but the stability to nucleases is substantially increased.

[0091] All analogues of, or modifications to, a polynucleotide may be employed with the embodiments disclosed herein, provided that said analogue or modification does not substantially affect the function of the polynucleotide. The nucleotides can be selected from naturally occurring or synthetic modified bases. Naturally occurring bases include adenine, guanine, cytosine, thymine and uracil. Modified bases of nucleotides include inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza cytosine and 6-aza thymine, psuedo uracil, 4-thiuracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8-amino guanine, 8-thiol guanine, 8-thioalkyl

guanines, 8-hydroxyl guanine and other substituted guanines, other aza and deaza adenines, other aza and deaza guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine.

[0092] In addition, analogues of polynucleotides can be prepared wherein the structure of the nucleotide is fundamentally altered and that are better suited as therapeutic or experimental reagents. An example of a nucleotide analogue is a peptide nucleic acid (PNA) wherein the deoxyribose (or ribose) phosphate backbone in DNA (or RNA is replaced with a polyamide backbone which is similar to that found in peptides. PNA analogues have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro. Further, PNAs have been shown to bind stronger to a complementary DNA sequence than a DNA molecule. This observation is attributed to the lack of charge repulsion between the PNA strand and the DNA strand. Other modifications that can be made to oligonucleotides include polymer backbones, cyclic backbones, or acyclic backbones, as well as LNA ("locked nucleic acid").

[0093] Embodiments disclosed herein also include nucleic acids (e.g., siRNA) that can have the following degrees of homology or identity to an S100A6 and/or S100A4 inhibitory nucleic acid: 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. Candidate S100A6 and/or S100A4 inhibitory nucleic acids having greater than or equal to 35% homology or identity can be identified by methods known in the art and can be subsequently examined using functional assays, for example, the assays described herein and those known in the art. Preparation of Peptides and Polypeptides

[0094] In some embodiments, the S100A6 and/or S100A4 inhibitor can be a polypeptide (e.g., a dominant negative peptide, an antibody, or an affibody). Polypeptides may be produced via several methods known in the art (e.g., synthetically or via recombinant methods).

[0095] In some embodiments, the method of making the polypeptides or fragments thereof is to clone a polynucleotide comprising the cDNA of the gene into an

expression vector and culture the cell harboring the vector so as to express the encoded polypeptide, and then purify the resulting polypeptide, all performed using methods known in the art as described in, for example, Marshak et al., "Strategies for Protein Purification and Characterization. A laboratory course manual." CSHL Press (1996). (in addition, see Bibl Haematol. 1965; 23:1165-74 Appl Microbiol. 1967 July; 15(4):851-6; Can J. Biochem. 1968 May; 46(5):441-4; Biochemistry. 1968 July; 7(7):2574-80; Arch Biochem Biophys. 1968 Sep. 10; 126(3):746-72; Biochem Biophys Res Commun. 1970 Feb. 20; 38(4):825-30).).

[0096] The expression vector can include a promoter for controlling transcription of the heterologous material and can be either a constitutive or inducible promoter to allow selective transcription. Enhancers that can be required to obtain necessary transcription levels can optionally be included. The expression vehicle can also include a selection gene.

[0097] Vectors can be introduced into cells or tissues by any one of a variety of methods known within the art. Such methods can be found generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Vega et al., Gene Targeting, CRC Press, Ann Arbor, Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et al. (1986). Preparation of Anti-S 100A6 and/or Anti-S100A4 Antibodies

[0098] Antibodies that bind to S100A6 and/or S100A4 or a fragment derived therefrom may be prepared using an intact polypeptide or fragments containing smaller polypeptides as the immunizing antigen. For example, it may be desirable to produce antibodies that specifically bind to the N- or C-terminal or any other suitable domains of the S100A6 and/or S100A4. The polypeptide used to immunize an animal can be derived from translated cDNA or chemical synthesis and can be conjugated to a carrier protein, if desired. Such commonly used carriers which are chemically coupled to the polypeptide include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA) and tetanus toxoid. The coupled polypeptide is then used to immunize the animal.

[0099] If desired, polyclonal or monoclonal antibodies can be further purified, for example by binding to and elution from a matrix to which the polypeptide or a peptide to

which the antibodies were raised is bound. Those skilled in the art know various techniques common in immunology for purification and/or concentration of polyclonal as well as monoclonal antibodies (Coligan et al, Unit 9, Current Protocols in Immunology, Wiley Interscience, 1994).

[0100] Methods for making antibodies of all types, including fragments, are known in the art (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1988)). Methods of immunization, including all necessary steps of preparing the immunogen in a suitable adjuvant, determining antibody binding, isolation of antibodies, methods for obtaining monoclonal antibodies, and humanization of monoclonal antibodies are all known to the skilled artisan

[0101] The antibodies may be humanized antibodies or human antibodies. Antibodies can be humanized using a variety of techniques known in the art including CDR- grafting (EP239,400: PCT publication WO0.91/09967; U.S. Pat. Nos. 5,225,539; 5,530, 101 ; and 5,585,089, veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska et al., PNAS 91 :969-973 (1994)), and chain shuffling (U.S. Pat. No. 5,565,332).

[0102] The monoclonal antibodies as defined include antibodies derived from one species (such as murine, rabbit, goat, rat, human, etc.) as well as antibodies derived from two (or more) species, such as chimeric and humanized antibodies.

[0103] Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art including phage display methods using antibody libraries derived from human immunoglobulin sequences. See also U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741 , each of which is incorporated herein by reference in its entirety.

[0104] Additional information regarding all types of antibodies, including humanized antibodies, human antibodies and antibody fragments can be found in WO 01/05998, which is incorporated herein by reference in its entirety.

[0105] Neutralizing antibodies can be prepared by the methods discussed above, possibly with an additional step of screening for neutralizing activity by, for example, a survival assay.

[0106] Embodiments disclosed herein also relate to the preparation and use of affibodies, binding proteins of non-Ig origin developed by combinatorial protein engineering principles, as described, for example, in Nygren PA 2008 FEBS Journal 275:2668-2676.

[0107] The polypeptides employed in embodiments disclosed herein may also be modified, optionally chemically modified, in order to improve their therapeutic activity. "Chemically modified"— when referring to the polypeptides, refers to a polypeptide where at least one of its amino acid residues is modified either by natural processes, such as processing or other post-translational modifications, or by chemical modification techniques which are well known in the art. Among the numerous known modifications typical, but not exclusive examples include: acetylation, acylation, amidation, ADP-ribosylation, glycosylation, GPI anchor formation, covalent attachment of a lipid or lipid derivative, methylation, myristylation, pegylation, prenylation, phosphorylation, ubiqutination, or any similar process.

[0108] Additional possible polypeptide modifications (such as those resulting from nucleic acid sequence alteration) include substitutions, deletions, and insertions.

[0109] A "conservative substitution" refers to the substitution of an amino acid in one class by an amino acid of the same class, where a class is defined by common physicochemical amino acid side chain properties and high substitution frequencies in homologous polypeptides found in nature, as determined, for example, by a standard Dayhoff frequency exchange matrix or BLOSUM matrix.

[0110] A "non-conservative substitution" refers to the substitution of an amino acid in one class with an amino acid from another class; for example, substitution of an Ala, a class II residue, with a class III residue such as Asp, Asn, GIu, or GIn.

[0111] A "deletion" refers to a change in either nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues, respectively, are absent.

[0112] An "insertion" or "addition" refers to a change in a nucleotide or amino acid sequence which has resulted in the addition of one or more nucleotides or amino acid residues, respectively, as compared to the naturally occurring sequence.

[0113] A "substitution" refers to the replacement of one or more nucleotides or amino acids by different nucleotides or amino acids, respectively. As regards amino acid sequences the substitution may be conservative or non-conservative.

[0114] Embodiments disclosed herein also include polypeptides (e.g., dominant negative polypeptides or antibodies) that can have the following degrees of homology or identity to an S100A6 and/or S100A4 inhibitory polypeptide: 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. Candidate S100A6 and/or S100A4 inhibitory polypeptides having greater than or equal to 35% homology or identity can be identified by methods known in the art and can be subsequently examined using functional assays, for example, the assays described herein and those known in the art. Small Molecule Inhibitors

[0115] Small molecule inhibitors can be used to inhibit and/or modulate S100A6 and/or S100A4 as disclosed herein. Any type of small molecule inhibitor that is known to one of skill in the art may be used. Many methods are known to identify small molecule inhibitors and commercial laboratories are available to screen for small molecule inhibitors. For example, chemicals can be obtained from the compound collection at Merck ^® Research Laboratories (Rahway, NJ.) or a like company. The compounds can be screened for inhibition of S100A6 and/or S100A4 by automated robotic screening in a 96-well plate format. In summary, the compounds can be dissolved at an initial concentration of about 50 μM in DMSO and dispensed into the 96-well plate. The 96-well plate assay may contain an appropriate number of units of S100A6 and/or S100A4 and target (a substrate). Compounds that cause greater than a 50% inhibition of S100A6 and/or S100A4 activity can be further diluted and tested to establish the concentration necessary for a 50% inhibition of activity. In some embodiments, the screen will include S100A6 and/or S100A4 protein and one or more

of their binding proteins and inhibitors. The inhibitory effect of screened compound to disrupt S100A6 and/or S100A4 target binding can be monitored using, for example, an ELISA-type test with S100A6 or S100A4 or the target immobilized on the surface and residual binding will be detected using antibodies of S100A6 target (binding)-molecule or S 100A4 target (binding)-molecule conjugated to a reporter (e.g., alkaline phosphate). Binding assays can also be performed using surface plasmon resonance (SPR) based interaction screening including S100A6 and it's binding target and inhibitor or any other assay screening protein interaction (eg. yeast two hybrid systems, immunoprecipitation, immunocapture experiments coupled to enymatic or FACS detection etc.).

[0116] Aspects of the invention also concern methods of identification of molecules that inhibit the binding S100A6 and/or S100A4 proteins to a target protein or peptide or that inhibit an S100A6 and/or S100A4 cellular response. By some approaches, cells expressing S100A6 and/or S100A4 are contacted with a candidate inhibitory molecule and the ability or level or amount of S100A6 and/or S100A4 in said contacted cells to interact with a target protein or peptide (e.g., ubiquilin 1 or a fragment thereof or a ligand or binding partner) is determined. Optionally, the ability or level or amount of S100A6 and/or S100A4 to interact with said target protein in the absence of said candidate inhibitory molecule is determined and compared with the ability or level or amount of SlOO A6 and/or S100A4 in said contacted cells that interacts with said target protein or peptide. Inhibitors of the S100A6 and/or Sl 00A4 are then identified when the ability or level or amount of S100A6 and/or S100A4 to interact with a target protein or peptide in said contacted cells is reduced compared to the ability or level or amount of S100A6 and/or S100A4 to interact with a target protein or peptide in cells that have not been contacted with the candidate inhibitory molecule. In some embodiments the ability or level or amount of SlOO A6 and/or S100A4 to interact with a target protein or peptide in said cells that have been contacted with the candidate inhibitory molecule and that have not been contacted with the candidate inhibitory molecule are recorded into a database, hard drive, computer or a memory and the recorded values representing the ability, level or amount of binding S 100A6 and/or S100A4 to said target protein or a plurality of different target proteins in the presence and absence of a

plurality of candidate inhibitory molecules for different candidate inhibitory molecules can be evaluated and compared.

[0117] More embodiments concern methods of identifying molecules that inhibit S100A6 and/or S100A4, wherein a library of chemical compounds are provided; each compound in said library is then individually analyzed by contacting cells that express S100A6 and/or S100A4 with a single compound from said chemical library and analyzing the ability or level or amount of S100A6 and/or S100A4 in said contacted cells to interact with a target protein or peptide and/or the analyzing the ability or level or amount of a marker for S100A6 and/or S100A4 activity (e.g., increasing the level of p53, p21, I kappaB alpha, or AKAP 12/GRA VIN or decreasing the level of beta-catenin, ALDHlAl, AHNAK, Filimin A, Filimin B, Vimentin, HSPBl(Hsp27) Galectinl, Akap 12, or HspA2 or increasing the sensitivity to ionizing radiation). Such analysis can be performed in microtiter plate format and the data can be recorded into a database, hard drive, computer or a memory and the recorded values from a plurality of such experiments can be evaluated and compared.

[0118] More embodiments concern methods of identifying molecules that promote greater inhibition of cancer cell proliferation or cell migration. By some approaches these methods are practiced by providing cancer cells (e.g., A549 cells) that express S100A6 and/or S100A4; contacting said cells with a candidate S100A6 and/or S100A4 inhibitor; and analyzing, measuring or detecting the amount, level, or ability of the candidate molecule to inhibit cancer cell proliferation and/or cell migration. Preferably, the cells are provided in a microtitre plate format and the candidate inhibitors are obtained from a chemical library. The data can be recorded into a database, hard drive, computer or a memory and the recorded values from a plurality of such experiments can be evaluated and compared. Methods of Treatment and Amelioration of Disease or Conditions Associated with Disease

[0119] In some embodiments, the compositions (e.g., an S100A6 inhibitor with or without a cancer therapy) and methods disclosed herein are used to treat diseased cells, tissues, organs, or pathological conditions and/or disease states in an animal (e.g., a mammalian subject including, but not limited to, humans and veterinary animals). In this regard, various diseases and pathologies are amenable to treatment or prophylaxis using the present methods and compositions. A non-limiting exemplary list of these diseases and

conditions includes, but is not limited to, breast cancer, prostate cancer, lymphoma, skin cancer, pancreatic cancer, colon cancer, melanoma, malignant melanoma, ovarian cancer, brain cancer, primary brain carcinoma, head-neck cancer, glioma, glioblastoma, liver cancer, bladder cancer, non-small cell lung cancer, head or neck carcinoma, breast carcinoma, ovarian carcinoma, lung carcinoma, small-cell lung carcinoma, Wilms ¹ tumor, cervical carcinoma, testicular carcinoma, bladder carcinoma, pancreatic carcinoma, stomach carcinoma, colon carcinoma, prostatic carcinoma, genitourinary carcinoma, thyroid carcinoma, esophageal carcinoma, myeloma, multiple myeloma, adrenal carcinoma, renal cell carcinoma, endometrial carcinoma, adrenal cortex carcinoma, malignant pancreatic insulinoma, malignant carcinoid carcinoma, choriocarcinoma, mycosis fungoides, malignant hypercalcemia, cervical hyperplasia, leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myelogenous leukemia, chronic myelogenous leukemia, chronic granulocytic leukemia, acute granulocytic leukemia, hairy cell leukemia, neuroblastoma, rhabdomyosarcoma, Kaposi's sarcoma, polycythemia vera, essential thrombocytosis, Hodgkin's disease, non-Hodgkin's lymphoma, soft-tissue sarcoma, osteogenic sarcoma, primary macroglobulinemia, and retinoblastoma, and the like, T and B cell mediated autoimmune diseases; inflammatory diseases; infections; hyperproliferative diseases; AIDS; degenerative conditions, vascular diseases, and the like. In some embodiments, the cancer cells being treated are metastatic. In other embodiments, the cancer cells being treated are resistant to anticancer agents.

[0120] In some embodiments, infections suitable for treatment with the compositions and methods disclosed herein include, but are not limited to, infections caused by viruses, bacteria, fungi, mycoplasma, prions, and the like.

[0121] Some embodiments disclosed herein concern improved therapeutic approaches, wherein an effective amount of an S100A6 and/or S100A4 inhibitor is combined or co-administered with at least one additional therapeutic agent (including, but not limited to, chemotherapeutic antineoplastics, apoptosis modulating agents, immunotherapeutics, antimicrobials, antivirals, antifungals, and anti-inflammatory agents) and/or therapeutic technique (e.g., surgical intervention, and/or radiotherapies).

[0122] A number of suitable anticancer agents are contemplated for combination or co-administration with an S100A6 and/or S100A4 inhibitor to treat, prevent, or ameliorate any of the aforementioned diseases, maladies, or disorders. Indeed, some embodiments contemplate, but are not limited to, administration of an S 100A6 and/or S 100 A4 inhibitor in combination or co-administered with numerous anticancer agents such as: agents that induce apoptosis; polynucleotides (e.g., anti-sense, ribozymes, siRNA); polypeptides (e.g., enzymes and antibodies); biological mimetics (e.g., gossypol or BH3 mimetics); agents that bind (e.g., oligomerize or complex) with S100A6 and/or S100A4; alkaloids; alkylating agents; antitumor antibiotics; antimetabolites; hormones; platinum compounds; monoclonal or polyclonal antibodies (e.g., antibodies conjugated with anticancer drugs, toxins, defensins), toxins; radionuclides; biological response modifiers (e.g., interferons (e.g., IFN-.alpha.) and interleukins (e.g., IL-2)); adoptive immunotherapy agents; hematopoietic growth factors; agents that induce tumor cell differentiation (e.g., all-trans-retinoic acid); gene therapy reagents (e.g., antisense therapy reagents and nucleotides); tumor vaccines; angiogenesis inhibitors; proteasome inhibitors: NF-KB modulators; anti-CDK compounds; HDAC inhibitors; and the like. Numerous other examples of chemotherapeutic compounds and anticancer therapies suitable for mixture or co-administration with the disclosed inhibitors of S100A6 and/or S100A4 are known to those skilled in the art.

[0123] In more embodiments, the S100A6 and/or S100A4 inhibitors described herein and used in the methods disclosed are mixed or combined or co-administered with anticancer agents that induce or stimulate apoptosis. Agents that induce apoptosis which are suitable in such compositions, mixtures, therapies and methods include, but are not limited to, radiation (e.g., X-rays, gamma rays, UV); tumor necrosis factor (TNF)-related factors (e.g., TNF family receptor proteins, TNF family ligands, TRAIL, antibodies to TRAILRl or TRAILR2); kinase inhibitors (e.g., epidermal growth factor receptor (EGFR) kinase inhibitor, vascular growth factor receptor (VGFR) kinase inhibitor, fibroblast growth factor receptor (FGFR) kinase inhibitor, platelet-derived growth factor receptor (PDGFR) kinase inhibitor, and Bcr-Abl kinase inhibitors (such as GLEEVEC ^® )); antisense molecules; antibodies (e.g., HERCEPTIN ^® , RITUXAN ^® , ZEVALIN ^® , and AVASTIN ^® ); anti-estrogens (e.g., raloxifene and tamoxifen); anti-androgens (e.g., flutamide, bicalutamide, finasteride,

aminoglutethamide, ketoconazole, and corticosteroids); cyclooxygenase 2 (COX-2) inhibitors (e.g., celecoxib, meloxicam, NS-398, and non-steroidal anti-inflammatory drugs (NSAIDs)); anti-inflammatory drugs (e.g., butazolidin, DECADRON ^® , DELTASONE ^® , dexamethasone, dexamethasone intensol, DEXONE ^® , HEXADROL ^® , hydroxychloroquine, METICORTEN ^® , oradexon, ORASONE ^® , oxyphenbutazone, PEDIAPRED ^® , phenylbutazone, PLAQUENIL ^® , prednisolone, prednisone, PRELONE ^® , and TANDEARIL ^® ); and cancer chemotherapeutic drugs (e.g., irinotecan (CAMPTOSAR ^® ), CPT-I l, fludarabine (FLUD ARA ^® ), dacarbazine (DTIC ^® ), dexamethasone, mitoxantrone, MYLOTARG ^® , VP- 16 ^® , cisplatin, carboplatin, oxaliplatin, 5-FU ^® , doxorubicin, gemcitabine, bortezomib, gefitinib, bevacizumab, TAXOTERE ^® or TAXOL ^® ); cellular signaling molecules; ceramides and cytokines; staurosporine, and the like.

[0124] In still other embodiments, compositions and methods described provide an S100A6 and/or S100A4 inhibitor and at least one anti-hyperproliferative or antineoplastic agent selected from alkylating agents, antimetabolites, and natural products (e.g., herbs and other plant and/or animal derived compounds).

[0125] Alkylating agents suitable for use in the present compositions, mixtures, therapies, and methods include, but are not limited to: 1) nitrogen mustards (e.g., mechlorethamine, cyclophosphamide, ifosfamide, melphalan (L-sarcolysin); and chlorambucil); 2) ethylenimines and methylmelamines (e.g., hexamethylmelamine and thiotepa); 3) alkyl sulfonates (e.g., busulfan); 4) nitrosoureas (e.g., carmustine (BCNU); lomustine (CCNU); semustine (methyl-CCNU); and streptozocin (streptozotocin)); and 5) triazenes (e.g., dacarbazine (DTIC ^® ; dimethyltriazenoimid-azolecarboxamide).

[0126] In some embodiments, antimetabolites suitable for use in the present compositions, mixtures, therapies, and methods include, but are not limited to: 1) folic acid analogs (e.g., methotrexate (amethopterin)); 2) pyrimidine analogs (e.g., fluorouracil (5- fluorouracil; 5-FU ^® ), floxuridine (fluorode-oxyuridine; FudR), and cytarabine (cytosine arabinoside)); and 3) purine analogs (e.g., mercaptopurine (6-mercaptopurine; 6-MP), thioguanine (6-thioguanine; TG), and pentostatin (2'-deoxycoformycin)).

[0127] In still further embodiments, chemotherapeutic agents suitable for use with the compositions, mixtures, therapies, and methods described herein include, but are not

limited to: 1) vinca alkaloids (e.g., vinblastine (VLB), vincristine); 2) epipodophyllotoxins (e.g., etoposide and teniposide); 3) antibiotics (e.g., dactinomycin (actinomycin D), daunorubicin (daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin (mithramycin), and mitomycin (mitomycin C)); 4) enzymes (e.g., L-asparaginase); 5) biological response modifiers (e.g., interferon-alfa); 6) platinum coordinating complexes (e.g., cisplatin (cis-DDP) and carboplatin); 7) anthracenediones (e.g., mitoxantrone); 8) substituted ureas (e.g., hydroxyurea); 9) methylhydrazine derivatives (e.g., procarbazine (N- methylhydrazine; MIH)); 10) adrenocortical suppressants (e.g., mitotane (o,p'-DDD) and aminoglutethimide); 1 1) adrenocorticosteroids (e.g., prednisone); 12) progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate); 13) estrogens (e.g., diethylstilbestrol and ethinyl estradiol); 14) antiestrogens (e.g., tamoxifen); 15) androgens (e.g., testosterone propionate and fluoxymesterone); 16) antiandrogens (e.g., flutamide): and 17) gonadotropin-releasing hormone analogs (e.g., leuprolide).

[0128] Any oncolytic agent that is routinely used in a cancer therapy context finds use in the compositions and methods disclosed herein. For example, the U.S. Food and Drug Administration maintains a formulary of oncolytic agents approved for use in the United States. International counterpart agencies to the U.S.F.D.A. maintain similar formularies.

[0129] In some embodiments, conventional anticancer agents for use in administration with the present compounds include, but are not limited to, adriamycin, 5- fluorouracil, etoposide, camptothecin, actinomycin D, mitomycin C, cisplatin, docetaxel, gemcitabine, carboplatin, oxaliplatin, bortezomib, gefitinib, bevacizumab, demethylating agents, inhibitors of her-2, inhibitors of IGF-IR, VEGF, inhibitors of VEGFR, mTOR inhibitors, mitotic inhibitors, Smad inhibitors and taxanes. These agents can be prepared and used singularly, in combined therapeutic compositions, in kits, or in combination with immunotherapeutic agents, and the like.

[0130] For a more detailed description of anticancer agents and other therapeutic agents, those skilled in the art are referred to any number of instructive manuals including, but not limited to, the Physician's Desk Reference and to Goodman and Gilman's "Pharmaceutical Basis of Therapeutics" tenth edition, Eds. Hardman et al., 2002.

[0131] Some embodiments disclosed herein relate to an improved radiation therapy, wherein an S100A6 and/or S100A4 inhibitor is provided before, during, or after a radiation therapy. Embodiments disclosed herein are not limited by the types, amounts, or delivery and administration systems used to deliver the therapeutic dose of radiation to an animal. For example, the animal may receive photon radiotherapy, particle beam radiation therapy, other types of radiotherapies, and combinations thereof. In some embodiments, the radiation is delivered to the animal using a linear accelerator. In still other embodiments, the radiation is delivered using a gamma knife, and in others, the radiation administered in the form of a radioactive implantable pellet.

[0132] The source of radiation can be external or internal to the animal. External radiation therapy is most common and involves directing a beam of high-energy radiation to a tumor site through the skin using, for instance, a linear accelerator. While the beam of radiation is localized to the tumor site, it is nearly impossible to avoid exposure of normal, healthy tissue. However, external radiation is usually well tolerated by patients. Internal radiation therapy involves implanting a radiation-emitting source, such as beads, wires, pellets, capsules, particles, and the like, inside the body at or near the tumor site including the use of delivery systems that specifically target cancer cells (e.g., using particles attached to cancer cell binding ligands). Such implants can be removed following treatment, or left in the body inactive. Types of internal radiation therapy include, but are not limited to, brachytherapy, interstitial irradiation, intracavity irradiation, radioimmunotherapy, and the like.

[0133] The animal may optionally receive radiosensitizers in addition to the S100A6 and/or S100A4 inhibitor and radiation (e.g., metronidazole, misonidazole, intraarterial Budr, intravenous iododeoxyuridine (ludR), nitroimidazole, 5-substituted-4- nitroimidazoles, 2H-isoindolediones, [[(2-bromoethyl)-amino]methyl]-nitro-lH-imidazole-l- ethanol, nitroaniline derivatives, DNA-affinic hypoxia selective cytotoxins, halogenated DNA ligand, 1,2,4 benzotriazine oxides, 2-nitroimidazole derivatives, fluorine-containing nitroazole derivatives, benzamide, nicotinamide, acridine-intercalator, 5-thiotretrazole derivative, 3-nitro-l,2,4-triazole, 4,5-dinitroimidazole derivative, hydroxylated texaphrins, cisplatin, mitomycin, tiripazamine, nitrosourea, mercaptopurine, methotrexate, fluorouracil,

bleomycin, vincristine, carboplatin, epirubicin, doxorubicin, cyclophosphamide, vindesine, etoposide, paclitaxel, heat (hyperthermia), and the like), radioprotectors (e.g., cysteamine, aminoalkyl dihydrogen phosphorothioates, amifostine (WR 2721), IL-I, IL-6, and the like). Radiosensitizers enhance the killing of tumor cells. Radioprotectors protect healthy tissue from the harmful effects of radiation.

[0134] Any type of radiation can be administered to a patient, so long as the dose of radiation is tolerated by the patient without unacceptable negative side-effects. Suitable types of radiotherapy include, for example, ionizing (electromagnetic) radiotherapy (e.g., X- rays or gamma rays) or particle beam radiation therapy (e.g., high linear energy radiation). Ionizing radiation refers to radiation comprising particles or photons that have sufficient energy to produce ionization, e.g., gain or loss of electrons (as described in, for example, U.S. Pat. No. 5,770,581 incorporated herein by reference in its entirety). The effects of radiation can be at least partially controlled by the clinician. The dose of radiation can be fractionated for maximal target cell exposure and reduced toxicity.

[0135] The total dose of radiation administered to an animal preferably is about 0.01 Gray (Gy) to about 100 Gy. More preferably, about 10 Gy to about 65 Gy (e.g., about 15 Gy, 20 Gy, 25 Gy, 30 Gy, 35 Gy, 40 Gy, 45 Gy, 50 Gy, 55 Gy, or 60 Gy) are administered over the course of treatment. While in some embodiments a complete dose of radiation can be administered over the course of one day, the total dose is ideally fractionated and administered over several days. Desirably, radiotherapy is administered over the course of at least about 3 days, e.g., at least 5, 7, 10, 14, 17, 21, 25, 28, 32, 35, 38, 42, 46, 52, or 56 days (about 1-8 weeks). Accordingly, a daily dose of radiation will comprise approximately 1 -5 Gy (e.g., about 1 Gy, 1.5 Gy, 1.8 Gy, 2 Gy, 2.5 Gy, 2.8 Gy, 3 Gy, 3.2 Gy, 3.5 Gy, 3.8 Gy, 4 Gy, 4.2 Gy, or 4.5 Gy), preferably 1-2 Gy (e.g., 1.5-2 Gy). The daily dose of radiation should be sufficient to induce destruction of the targeted cells. If stretched over a period, radiation preferably is not administered every day, thereby allowing the animal to rest and the effects of the therapy to be realized. For example, radiation desirably is administered on 5 consecutive days, and not administered on 2 days, for each week of treatment, thereby allowing 2 days of rest per week. However, radiation can be administered 1 day/week, 2 days/week, 3 days/week, 4 days/week, 5 days/week, 6 days/week, or all 7 days/week,

depending on the animal's responsiveness and any potential side effects. Radiation therapy can be initiated at any time in the therapeutic period. Preferably, radiation is initiated in week 1 or week 2, and is administered for the remaining duration of the therapeutic period. For example, radiation is administered in weeks 1 -6 or in weeks 2-6 of a therapeutic period comprising 6 weeks for treating, for instance, a solid tumor. Alternatively, radiation is administered in weeks 1-5 or weeks 2-5 of a therapeutic period comprising 5 weeks. These exemplary radiotherapy administration schedules are not intended, however, to limit the embodiments disclosed herein.

[0136] In some embodiments, antimicrobial therapeutic agents may also be provided in addition to the S100A6 and/or S100A4 inhibitor. Any agent that can kill, inhibit, or otherwise attenuate the function of microbial organisms may be used, as well as any agent contemplated to have such activities. Antimicrobial agents include, but are not limited to, natural and synthetic antibiotics, antibodies, inhibitory proteins (e.g., defensins), antisense nucleic acids, membrane disruptive agents and the like, used alone or in combination. Indeed, any type of antibiotic may be used including, but not limited to, antibacterial agents, antiviral agents, antifungal agents, and the like. Pharmaceutical Compositions and Formulations

[0137] In some embodiments disclosed herein, an S100A6 and/or S100A4 inhibitor and one or more therapeutic agents, antibiotics, or anticancer agents are provided to an animal under one or more of the following conditions: at different periodicities, at different durations, at different concentrations, by different administration routes, etc. In some embodiments, the S100A6 and/or S100A4 inhibitor is administered prior to the therapeutic or anticancer agent, e.g., 0.5, 1, 2 3, 4, 5, 10, 12, or 18 hours, 1, 2, 3, 4, 5, or 6 days, 1, 2, 3, or 4 weeks prior to the administration of the therapeutic or anticancer agent. In some embodiments, the S100A6 and/or S100A4 inhibitor is administered after the therapeutic or anticancer agent, e.g., 0.5, 1, 2 3, 4, 5, 10, 12, or 18 hours, 1, 2, 3, 4, 5, or 6 days, 1, 2, 3, or 4 weeks after the administration of the anticancer agent. In some embodiments, the S100A6 and/or S100A4 inhibitor and the therapeutic or anticancer agent are administered concurrently but on different schedules, e.g., the S100A6 and/or S100A4 inhibitor is administered daily while the therapeutic or anticancer agent is administered once

a week, once every two weeks, once every three weeks, or once every four weeks. In other embodiments, the S100A6 and/or S100A4 inhibitor is administered once a week while the therapeutic or anticancer agent is administered daily, once a week, once every two weeks, once every three weeks, or once every four weeks.

[0138] Embodiments disclosed herein also relate to methods of administering an S100A6 and/or S100A4 inhibitor to a subject in order to contact cancer cells with an S100A6 and/or S100A4 inhibitor. The routes of administration can vary with the location and nature of the tumor, and include, e.g., intravascular, intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, regional, percutaneous, intratracheal, intraperitoneal, intraarterial, intravesical, intratumoral, inhalation, perfusion, lavage, direct injection, instillation into the pleural cavity, in a bolus, and oral administration and formulation.

[0139] The term "intravascular" is understood to refer to delivery into the vasculature of a patient, meaning into, within, or in a vessel or vessels of the patient. In certain embodiments, the administration can be into a vessel considered to be a vein (intravenous), while in others administration can be into a vessel considered to be an artery. Veins include, but are not limited to, the internal jugular vein, a peripheral vein, a coronary vein, a hepatic vein, the portal vein, great saphenous vein, the pulmonary vein, superior vena cava, inferior vena cava, a gastric vein, a splenic vein, inferior mesenteric vein, superior mesenteric vein, cephalic vein, and/or femoral vein. Arteries include, but are not limited to, coronary artery, pulmonary artery, brachial artery, internal carotid artery, aortic arch, femoral artery, peripheral artery, and/or ciliary artery. It is contemplated that delivery may be through or to an arteriole or capillary.

[0140] Injection into the tumor vasculature is specifically contemplated for discrete, solid, accessible tumors. Local, regional or systemic administration also may be appropriate. For tumors of greater than about 4 cm, the volume to be administered can be about 4-10 ml (preferably 10 ml), while for tumors of less than about 4 cm, a volume of about 1-3 ml can be used (preferably 3 ml). Multiple injections delivered as single dose comprise about 0.1 to about 0.5 ml volumes. The S100A6 and/or S100A4 inhibitor may

advantageously be contacted by administering multiple injections to the tumor, spaced at approximately 1 cm intervals.

[0141] In the case of surgical intervention, an S100A6 and/or S100A4 inhibitor can be administered preoperatively, to render an inoperable tumor subject to resection. Alternatively, an S100A6 and/or S100A4 inhibitor can be administered at the time of surgery, and/or thereafter, to treat residual or metastatic disease. For example, a resected tumor bed may be injected or perfused with a formulation comprising an S100A6 and/or S100A4 inhibitor that renders the S100A6 and/or S100A4 inhibitor advantageous for treatment of tumors. The perfusion may be continued post-resection, for example, by leaving a catheter implanted at the site of the surgery. Periodic post-surgical treatment can be carried out.

[0142] Continuous administration also may be applied where appropriate, for example, where a tumor is excised and the tumor bed is treated to eliminate residual, microscopic disease. Such continuous perfusion may take place for a period from about 1-2 hours, to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs.

[0143] Treatment regimens may vary as well, and often depend on cancer type, cancer location, disease progression, and health and age of the patient. Obviously, certain types of cancer will require more aggressive treatment, while at the same time, certain patients cannot tolerate more taxing protocols. The clinician will be best suited to make such decisions based on the known efficacy and toxicity (if any) of the therapeutic formulations.

[0144] In certain embodiments, the tumor being treated may not, at least initially, be resectable. Treatments with an S100A6 and/or S100A4 inhibitor may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection can serve to eliminate microscopic residual disease at the tumor site.

[0145] A typical course of treatment, for a primary tumor or a post-excision tumor bed, can involve multiple doses. Typical primary tumor treatment can involve a 6 dose

application over a two-week period. The two-week regimen may be repeated one, two, three, four, five, six or more times. During a course of treatment, the need to complete the planned dosings may be re-evaluated.

[0146] The treatments may include various "unit doses." Unit dose refers to a dose containing a predetermined-quantity of the therapeutic composition. The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. Injectable Compositions and Formulations

[0147] Injection of an S100A6 and/or S100A4 inhibitor can be delivered by syringe or any other method used for injection of a solution, as long as the S100A6 and/or S100A4 inhibitor can pass through the particular gauge of needle required for injection. A novel needleless injection system has recently been described (U.S. Pat. No. 5,846,233) having a nozzle defining an ampule chamber for holding the solution and an energy device for pushing the solution out of the nozzle to the site of delivery. A syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Pat. No. 5,846,225).

[0148] Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene

glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0149] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.

[0150] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-

drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0151] The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. Diagnostic and Prognostic Applications

[0152] Some embodiments disclosed herein concern diagnostic and prognostic methods for the detection of cancer and/or progression of cancer or metastasis. The detection of the expression (or lack thereof) of S100A6 and/or S100A4 provides a means of determining whether or not cells or tissue samples are cancerous. S100A6 and/or S100A4 levels may also be used to determine the sensitivity of certain cancers to different forms of cancer treatment. Such detection methods may be used, for example, for early diagnosis of the disease, to monitor the progress of the disease or the progress of treatment protocols, or to assess the grade of the cancer. The detection can occur in vitro or in vivo. Useful assays include, for example, an enzyme immune assay (EIA) such as enzyme-linked immunosorbent assay (ELISA), a radioimmune assay (RIA), a Western blot assay, an immunohistochemical assay, or a slot blot assay see, e.g., U.S. Pat. Nos. 4,366,241; 4,376,1 10; 4,517,288; and 4,837,168).

[0153] The detection of the expression profile of S100A6 and/or S100A4 in cells may be carried out by any of several means well known to those of skill in the art. Some embodiments disclosed herein relate to methods of detecting S100A6 and/or S100A4 that is immunological in nature. "Immunological" refers to the use of antibodies (e.g., polyclonal or

monoclonal antibodies) specific for S100A6 and/or S100A4. Quantification assays for S100A6 and/or S100A4 and detection of S100A6 and/or S100A4 can use binding molecules specific for S100A6 and/or S100A4 other than antibodies, including but not limited to, affibodies, aptamers or other specific binding molecules known in the art.

[0154] As used herein, the term "level" refers to expression levels of RNA and/or protein or to DNA copy number of a marker. Typically the level of the marker in a biological sample obtained from the subject is different (i.e., increased or decreased) from the level of the same variant in a similar sample obtained from a healthy individual (examples of biological samples are described herein).

[0155] As used herein, "predetermined level" refers to the level of expression of a cancer marker (e.g., S100A6 and/or S100A4) in normal, non-cancerous tissue. In some embodiments, cancer (e.g., breast cancer or lung cancer) can be diagnosed by assessing whether S100A6 and/or S100A4 expression varies from a predetermined level by greater than or equal to 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0156] Numerous well known tissue or fluid collection methods can be utilized to collect the biological sample from the subject in order to determine the level of DNA, RNA and/or polypeptide of the variant of interest in the subject. Examples include, but are not limited to, fine needle biopsy, needle biopsy, core needle biopsy and surgical biopsy (e.g., brain biopsy), lavage, and any known method in the art. Regardless of the procedure employed, once a biopsy /sample is obtained the level of the variant can be determined and a diagnosis can thus be made. For example, tissue sample may be obtained by biopsy. The sample of cells or tissue can then be prepared and exposed to an antibody or a mixture of antibodies according to means which are known to those of skill in the art. Samples can then be prepared for immunohistochemical analysis of gene expression, for example, using tissue microarrays or quantitative mass spectrometry using multiple reaction monitoring (MRM). Additional methods that can be used to detect S 100 A6 and/or S 100 A4 include, but are not limited to, two dimensional electrophoresis (2DE) and mass spectrometry based quantification methods. Mass spectrometry based quantification methods include, but are not limited to, matrix-assisted laser desorption/ionization (MALDI), surface-enhanced laser

desorption/ionization (SELDI), and electrospray ionization (ESI) coupled to mass analysis. These methods could be coupled, for example, time-of-flight (TOF), linear ion trap, orbitrap and/or furrier transfer mass spectrometry (FT-MS) and/or quadrupole analyses. Quantification can be made, for example, label free, using isotopes (for example, SlLAC, ICAT, and/or O ¹ ^labelling), using iTRAQ ^® , and with other methodologies known in the art.

[0157] Other means of detecting the expression profile of S 100 A6 and/or S 100 A4 include, but are not limited to, for example, detection of mRNA encoding the protein. Those of skill in the art are well acquainted with methods of mRNA detection, e.g., via the use of complementary hybridizing primers (e.g., labeled with radioactivity or fluorescent dyes) with or without polymerase chain reaction (PCR) amplification of the detected products, followed by visualization of the detected mRNA via, for example, electrophoresis (e.g., gel or capillary); by mass spectroscopy; etc. Any means of detecting the presence of the mRNA in an amount lower than normal or baseline control (or to detect the absence of the mRNA). For example, an immunoassay can measure the level of gene expression (e.g., S100A6 and/or S 100A4) or activity by measuring the level of mRNA. The level of mRNA may also be measured, for example, using ethidium bromide staining of a standard RNA gel, Northern blotting, primer extension, or nuclease protection assay. Other means of detecting the expression profile of S100A6 and/or S100A4 (e.g., detection of S100A6 and/or S100A4 mRNA) include, but are not limited to, PCR-based methods (e.g., quantitative real time PCR), microarray based methods, and ribonuclease protection assays (RPA).

[0158] Additional means of detecting the expression of S100A6 and/or S100A4 include, but are not limited to, detecting the level of promoter modification (e.g., methylation) and detecting the level of histone modification. For example, promoter methylation has been shown to correlate with mRNA expression (see, e.g., Lindsey et al. 2007 JuI 16; 97(2):267-74).

[0159] Further means of detecting the expression of S100A6 and/or S 100A4 include, but are not limited to, determining the level of SlOO A6 and/or SlOO A4 DNA. These methods include, but are not limited to, various approaches for DNA sequencing (to find, e.g. mutations or deletions) and other approaches known in the art.

[0160] Information disclosed herein (e.g., polypeptide or nucleic acid sequences, data from assays, etc.) can be stored, recorded, and manipulated on any medium that can be read and accessed by a computer. As used herein, the words "recorded" and "stored" refer to a process for storing information on computer readable medium. A skilled artisan can readily adopt any of the presently known methods for recording information on a computer readable medium to generate manufactures comprising the nucleotide or polypeptide sequence information of this embodiment. A variety of data storage structures are available to a skilled artisan for creating a computer readable medium having recorded thereon a nucleotide or polypeptide sequence. The choice of the data storage structure will generally be based on the component chosen to access the stored information. Computer readable media include magnetically readable media, optically readable media, or electronically readable media. For example, the computer readable media can be a hard disc, a floppy disc, a magnetic tape, zip disk, CD-ROM, DVD-ROM, RAM, or ROM as well as other types of other media known to those skilled in the art. The computer readable media on which the sequence information is stored can be in a personal computer, a network, a server or other computer systems known to those skilled in the art.

[0161] Embodiments of the invention utilize computer-based systems that contain the information described herein and convert this information into other types of usable information (e.g., models for rational drug design). The term "a computer-based system" refers to the hardware, software, and any database used to analyze information (e.g., an S100A6 and/or S100A4 candidate inhibitor or binding partner), or fragments of these biomolecules so as to construct models or to conduct rational drug design. The computer- based system preferably includes the storage media described above, and a processor for accessing and manipulating the sequence data. The hardware of the computer-based systems of this embodiment comprise a central processing unit (CPU) and a database. A skilled artisan can readily appreciate that any one of the currently available computer-based systems are suitable.

[0162] In some embodiments, the computer system includes a processor connected to a bus that is connected to a main memory (preferably implemented as RAM) and a variety of secondary storage devices, such as a hard drive and removable medium

storage device. The removable medium storage device can represent, for example, a floppy disk drive, a DVD drive, an optical disk drive, a compact disk drive, a magnetic tape drive, etc. A removable storage medium, such as a floppy disk, a compact disk, a magnetic tape, etc. containing control logic and/or data recorded therein can be inserted into the removable storage device. The computer system includes appropriate software for reading the control logic and/or the data from the removable medium storage device once inserted in the removable medium storage device. Information described herein can be stored in a well known manner in the main memory, any of the secondary storage devices, and/or a removable storage medium. Software for accessing and processing these sequences (such as search tools, compare tools, and modeling tools etc.) reside in main memory during execution.

[0163] As used herein, "a database" refers to memory that can store an information described herein (e.g., levels of cancer inhibiton, and values, levels or results from functional assays). Additionally, a "database" refers to a memory access component that can access manufactures having recorded thereon information described herein. In other embodiments, a database stores an "S100A6 inhibitor functional profile" comprising the values or levels and results (e.g., ability to act synergistically with a cancer therapy) from one or more functional assays, as described herein or known in the art, and relationships between these values or results. The data and values or results from functional assays can be stored and manipulated in a variety of data processor programs in a variety of formats. For example, the sequence data can be stored as text in a word processing file, a html file, or a pdf file in a variety of database programs familiar to those of skill in the art.

[0164] A "search program" refers to one or more programs that are implemented on the computer-based system to compare information (e.g., levels of cancer inhibition). A search program also refers to one or more programs that compare one or more protein models to several protein models that exist in a database and one or more protein models to several peptides, peptidomimetics, and chemicals that exist in a database. A search program is used, for example, to compare levels of cancer inhibition by providing a cancer therapy to cancer cells with or without a compound (e.g., an S100A6 and/or S100A4 inhibitor) that are present in one or more databases. Still further, a search program can be used to compare values,

levels or results from functional assays and S100A6 and/or S100A4 inhibitors that act synergistically with a cancer therapy.

[0165] A "retrieval program" refers to one or more programs that can be implemented on the computer-based system to identify a homologous nucleic acid sequence, a homologous protein sequence, or a homologous protein model. A retrieval program can also used to identify, for example, S100A6 and/or S100A4 inhibitors. Further, a retrieval program can be used to identify an S100A6 and/or S100A4 inhibitor that modulates binding of S100A6 and/or S100A4 to a target S100A6 and/or S100A4 binding protein. That is, a retrieval program can also be used to obtain a functional profile. Further, a functional profile can have one or more symbols that represent these molecules and/or models, an identifier that represents one or more inhibitors including, but not limited to values, levels, or results from a functional assay.

[0166] Other immune assays which may be utilized include, but are not limited to agglutination methods, precipitation methods, immunodiffusion methods, Immunoelectrophoresis methods, nephelometry, gel electrophoresis followed by Western blot, dot blots, affinity chromatography, immune-fluorescence, and the like. Other assays that can be used to detect S100A6 and/or S100A4 include, but are not limited to, ELISA and other immunobased assays as well as assays based on proteins and/or organic components with binding specificity towards S100A6 and/or S100A4. In addition, other methods of detection of peptides (e.g., S100A6 and/or S100A4) known to those of skill in the art may be used, such as gas chromatography/mass spectrometry, HPLC, and gel electrophoresis followed by sequencing. Other methods can include liquid chromatography coupled to, for example but not limited to, UV or mass spectrometry based detection (e.g., LC-MS, LC- MS/MS or MRM).

[0167] Other methods include but are not limited to, positron emission tomography (PET) single photon emission computed tomography (SPECT). Both of these techniques are non-invasive, and can be used to detect and/or measure a wide variety of tissue events and/or functions, such as detecting cancerous cells for example. Unlike PET, SPECT can optionally be used with two labels simultaneously. SPECT has some other advantages as well, for example with regard to cost and the types of labels that can be used. For example,

U.S. Pat. No. 6,696,686 describes the use of SPECT for detection of breast cancer, and is hereby incorporated by reference in its entirety.

Monitoring Cancer Therapy

[0168] The phrase "monitoring cancer therapy" refers to determining the relative amount of cancer cells in the body of a patient before, during and/or after anti-cancer therapy.

[0169] Some embodiments disclosed herein relate to methods for monitoring the progress or efficacy of cancer therapy in a subject. Subjects identified as having cancer and undergoing cancer therapy can be administered labeled S100A6 and/or Sl 00A4 antibodies.

[0170] Subjects can be administered a labeled antibody before the onset of treatment or during treatment. Cells containing the label can be assayed for and this measurement can be compared to one obtained at a subsequent time during the therapy and/or after therapy has been completed. In this way, it is possible to evaluate the inhibition of cancer cell proliferation, and the effectiveness of the therapy. For example, since only living cancer cells will be detected via the labeled antibody, the therapy can continue until a minimal amount of label is detected.

[0171] Some embodiments disclosed herein also relate to methods for determining the amount of cancer cells present in a subject. By detecting the label or detecting the absence of the label, one can determine whether cancer cells are present within the subject and the amount of label measured may be proportional or inversely related to the amount of cancer cells present in the subject. Kits

[0172] Some embodiments disclosed herein provide for a kit for detecting cancer comprising an agent which binds specifically to S100A6 and/or S100A4 and instructions for use.

[0173] In one embodiment, the kit may comprise a reference sample, e.g., a negative and/or positive control. In that embodiment, the negative control would be indicative of a normal cell type and the positive control would be indicative of cancer. Such a kit may also be used for identifying potential candidate therapeutic agents for treating cancer.

In one embodiment, the first binding moiety is labeled. In one embodiment, the kit further comprises a second binding moiety which binds specifically to the first binding moiety.

[0174] The above mentioned kit can be used for the detection of any cell- proliferative cancer including, without limitation, breast cancer, ovarian cervical cancer, prostate cancer, colon cancer, lung cancer, skin cancer, leukemia, lymphoma, melanoma or any other type of cancer. The kit may also be used to determine the aggressiveness or grade of cancer.

[0175] In one embodiment, the binding moiety in the kit can be an antibody or fragment thereof which specifically binds to S100A6 and/or S100A4. Antibodies and binding fragments thereof can be lyophilized or in solution. Additionally, the preparations can contain stabilizers to increase the shelf-life of the kits, e.g., bovine serum albumin (BSA). Wherein the antibodies and antigen binding fragments thereof are lyophilized, the kit can contain further preparations of solutions to reconstitute the preparations. Acceptable solutions are well known in the art, e.g., PBS. In one embodiment, the antibody is a polyclonal antibody, a monoclonal antibody, a humanized antibody, a chimeric antibody, a recombinant antibody, or fragment thereof.

[0176] In some embodiments, the kits can further include the components for an immunohistochemical assay for measuring S100A6 and/or S100A4 and/or fragments thereof. Samples to be tested in this application include, for example, blood, serum, plasma, urine, lymph, tissue and products thereof.

[0177] Alternatively, the kits can be used in immunoassays, such as immunohistochemistry to test subject tissue biopsy sections. The kits may also be used to detect the presence of S100A6 and/or S100A4 in a biological sample obtained from a subject using immunohistocytochemistry.

[0178] The compositions of the kit can be formulated in single or multiple units for either a single test or multiple tests.

[0179] Embodiments disclosed herein further provide for a kit for use in, for example, the screening, diagnosis or monitoring of cancer or cancer treatment. Such a kit may comprise an antibody to S100A6 and/or S100A4, a reaction container, various buffers, secondary antibodies, directions for use, and the like. In these kits, antibodies may be

provided with means for binding to detectable marker moieties or substrate surfaces. Alternatively, the kits may include antibodies already bound to marker moieties or substrates. The kits may further include positive and/or negative control reagents as well as other reagents for carrying out diagnostic techniques. For example, kits containing antibody bound to multiwell microtiter plates can be provided. The kit may include a standard or multiple standard solutions containing a known concentration of S100A6 and/or S100A4 or other proteins for calibration of the assays. A large number of control samples is assayed to establish the threshold, mode and width of the distribution of S100A6 and/or S100A4 in normal cells and tissues against which test samples are compared. These data is provided to users of the kit.

[0180] The following examples provide illustrations of some of the embodiments described herein but are not intended to limit invention.

EXAMPLE 1

[0181] S100A6 is a member of the SlOO protein family of small Ca ²⁺ binding proteins and it has been reported to be upregulated in a wide spectrum of human cancers such as, colorectal adenocarcinoma (Komatsu, K. et al. 2000 Br J Cancer 83(6):769-74), malignant melanoma (Maelandsmo, G.M. et al. 1997 Im J Cancer 1997 74(4):464-9), pancreatic cancer (Ohuchida, K. et al. 2005 Clin Cancer Res l l(21):7785-93; Vimalachandran, D. et al. 2005 Cancer Res 65(8):3218-25), breast cancer (Cross, S.S. et al. 2005 Histopathology 46(3):256-69), thyroid carcinoma (Brown, L.M. et al. 2006 MoI Carcinog 45(8):613-26) and osteosarcoma (Luu, H.H. et al. 2005 Cancer Lett 229(1): 135-48) and in some cases correlated with increased cell proliferation and poor clinical outcome (pancreatic cancer and melanoma). The biological function of S100A6 however remains obscure, but the lack of a proper catalytic domain provides evidence that the activity is mainly mediated via protein-protein interactions. Recently, it has been shown that S100A6 is upregulated in response to ionizing radiation in p53 wt cells and that S100A6 translocates from the nucleus to the cytoplasm post irradiation (Orre, L. M., et al. 2007 MoI Cell Proteomics 6( 12):2122-31. Identification of Ubiquilin-1 as an S 100 A6-Interacting Protein

[0182] A combination of immunoprecipitation and quantitative proteomics with isobaric labelling was used to perform a proteome wide search to find new S100A6 interacting proteins (Fig. 5). Mass spectrometry analysis of proteins captured using anti- Si 00A6 antibody or isotype matched control antibody resulted in the identification of 177 proteins (>95% conf.). Out of the 177 proteins, only three proteins with more than one confident peptide showed significantly higher levels in S100A6 precipitate compared to control precipitate; S100A6 (Fig. Ia), Ubiquilin-1 (Fig. Ib) and b-actin. The interaction between S100A6 and Ubiquilin-1 was validated using western blotting (Fig. Ic and Id).

[0183] Ubiquilin-1 and its homologue Ubiquilin-2 are proteins thought to be involved in the degradation of polyubiquitinated proteins. Ubiquilin-1 has a c-terminal ubiquitin associated domain (UBA) that interacts with ubiquitinated proteins and an n- terminal ubiquitin like domain (UBL) that interacts with proteasome subunits. Based on these domains it was suggested that Ubiquilin-1 acts as a shuttle to transport ubiquitinated proteins to the proteasome for degradation (Kleijnen, M.F. et al. 2003 MoI Biol Cell 14(9):3868-75; Kleijnen, M.F. et al. 2000 MoI Cell 6(2):409-19). Surprisingly it was found that overexpression of Ubiquilin-1 or 2 stabilised two proteins known to be ubiquitinated and degraded by the proteasome, namely p53 and IκBα, which provided evidence that Ubiquilin through its interaction with ubiquitinated proteins competes for binding at the proteasome and thereby stabilizes ubiquitinated proteins.

Effect ofS100A6 onp53 andlicBa Degradation

[0184] To study the effect of S100A6 on p53 and IκBα degradation in detail,

A549 cells were infected with stabile S100A6 siRNA expressing lentivirus vectors (Fig. 2a). A549 cells infected with the two most effective S100A6 siRNAs were selected for further analysis and both showed increased p53 and p21 protein levels compared to empty vector treated cells indicating accumulation of transcriptionally active p53 in response to S100A6 downregulation (Fig. 2b). In empty vector cells p53 and p21 protein levels increased until 48h post irradiation after which protein levels decreased (Fig. 2c). These findings are consistent with the theory of a post stress recovery phase under which a relief in proapoptotic and cell cycle arrest signaling allows cells with repaired DNA to re-enter the cell cycle

(Brooks, CL. et al. 2006 MoI Cell 21(3):307-15; Shirangi, T.R. et al. 2002 Faseb J 16(3):420-2). An increase in S100A6 level 48h post irradiation in colon cancer cells has previously been shown (Orre, L.M., et al. 2007 MoI Cell Proteomics 6(12):2122-31). The level of S100A6 increased in A549 lung cancer cells post irradiation (Fig. 2c), or post exposure to the DNA damaging agent doxorubicin (Fig. 6). The higher S 100A6 level at later timepoints post irradiation correlated with a decrease in p53 level, which provided evidence that S100A6 plays a physiological role in post stress recovery by stimulating p53 degradation. In S100A6 siRNA treated cells the p53 protein level remained high throughout the experiment indicating that S100A6 promotes p53 degradation.

[0185] In close analogy, a significantly higher level of IκBα in S100A6 siRNA treated cells was also observed (Fig. 2d). In response to various stimuli (e.g. TNFa, Doxorubicin and IR (Pahl, H.L. 1999 Oncogene 18(49):6853-66)) IκBα is phosphorylated by IKK and ubiquitinated by SCF ubiquitin ligase complex, resulting in degradation of IκBα and release of NFκB/p65 transcription factor that enters the nucleus and transcribe target genes. Over 200 NFKB target genes have been discovered, but the general consensus is that NFKB activation impairs apoptosis through upregulation of potent anti-apoptotic proteins such as bcl-2 and IAPs (Kucharczak, J. et al. 2003 Oncogene 22(56):8961-82). Interestingly it has been shown that NFκB/p65 is also a transcription factor for S100A6 (Joo, J. H. et al. 2003 Biochem Biophys Res Commun 307(2) :274-80). In control cells, a decrease in IκBα level 48h post irradiation was observed and this decrease correlated with an increase in S 100A6 level (Fig. 2e) indicating that the upregulation of S100A6 in response to irradiation is a consequence of NFκB/p65 activation. These results indicate the presence of a positive feedback loop as NFKB activation results in S100A6 upregulation which in turn increases IκBα degradation. Such a feedback loop once again provides evidence that S100A6 has a physiological role in pro survival signaling in the post stress recovery phase. Neither S 100 A6 downregulation, nor irradiation affected Ubiquilin-1 protein level (Fig. 2f).

[0186] The interaction between S100A6 and Ubiquilin-1 presents a possible mechanism for the effects of S100A6 on p53 and IκBα degradation. Overexpression of Ubiquilin-1 has been shown to stabilize p53 and IκBα and data disclosed herein show that S100A6 interferes with this stabilisation through a direct interaction with Ubiquilin-1.

[0187] Downregulation of S100A6 was found to increase the degradation of β- catenin (Fig. 2g). β-catenin is involved in prosurvival signaling through the Wnt signaling pathway (Giles, R.H. et al. 2003 Biochim Biophys Acta 1653(1): 1-24), and the results of this experiment indicate that S100A6 induces this pathway by inhibition of β-catenin degradation. In order to confirm that the alterations in protein level of p53, IκBα and β-catenin was not an effect of altered transcription quantitative, RT-PCR was used to measure mRNA levels. A small but significant increase in p53 mRNA was seen in response to S100A6 downregulation (Fig. 2h). This could be an effect of p53 autoregulation in response to increased p53 protein stability as reported previously (Wang, S. et al. 2006 Cancer Res 66(14):6982-9). No differences in the mRNA levels of IκBα or β-catenin in response to S100A6 downregulation was detected (Fig. 2h).

Additional Proteins Affected by S100A6

[0188] To find additional proteins affected by S100A6, a second proteomics experiment was performed, wherein irradiated and untreated S100A6 siRNA-containing cells were compared to empty vector control cells (Fig. 7). As in the first proteomic experiment isobaric labeling was used for direct relative quantification of the identified peptides. In addition, peptide isoelectric focusing was used as a first line fractionation, as developed previously (Lengqvist, J., K. et al. 2007 Proteomics 7(11): 1746-52). The experiment was run in biological triplicates and between 1000 and 1500 proteins were identified in each experiment (Fig. 3a). The highest ranking S100A6 dependent change present in all three replicates was an upregulation of NFκB2/pl00 in S100A6 downregulated cells (Fig. 3b), which was validated by western blot (Fig. 3c). Quantitative RT-PCR showed no differences in NFκB2 mRNA level in response to S100A6 downregulation (Fig. 3d). NFκB2 is a member of the NFKB family of transcription factors, and it is activated through processing of the full length protein (NFκB2/pl00) into the active transcription factor NFκB2/p52 (Kucharczak, J. et al. 2003 Oncogene 22(56):8961-82). The processing of NFκB2/pl00 depends on phosphorylation, ubiquitination and partial degradation by the proteasome. Full length NFκB2/pl00, like IκBα, is an inhibitor of NFKB transcription factors (Basak, S. et al. 2007 Cell 128(2):369-81), but an additional role of the full length protein in apoptosis has been

shown as NFκB2/pl00 can activate caspase-8 and promote apoptosis (Wang, Y. et al. 2002 Nat Cell Biol 4(11):888-93). Once processed, NFκB2/p52 transactivates target genes in analogy to NFκB/p65.

S100A6 Downregulation Sensitizes Cells to Ionizing Radiation Induced Cell Death

[0189] The combined effects of S100A6 downregulation through stimulation of proapoptotic p53 and NFκB2/pl00 signaling and through inhibition of pro survival pathways via β-catenin, NFκB/p65 and NFκB2/p52 is contemplated to increase the sensitivity to DNA damaging treatment. To test this hypothesis, S100A6 siRNA and empty vector cells were treated with ionizing radiation. S100A6 siRNA treated cells proved to be significantly more sensitive to ionizing radiation (fig 4a, b and c).

[0190] In conclusion, these experiments provide evidence that S100A6 promotes cell survival in the post stress recovery phase, so as to allow cells with repaired DNA damage to escape apoptosis and re-enter the cell cycle (Fig. 4d). Upregulated in response to NFKB activation, S100A6 further stimulates NFKB signaling through the involvement in IκBα degradation. The role of SlOO A6 as an anti-apoptotic protein is further supported by the data here showing that S100A6 downregulation results in stabilisation of the tumor suppressor p53, well known to promote apoptosis and cell cycle arrest. S100A6 appears to have an anti-apoptotic effect through degradation of proapoptotic NFκB2/pl00 into the anti-apoptotic transcription factor NFκB/p52. In contrast to decreased degradation of p53, IκBα and NFκB2/pl00 in S100A6 siRNA treated cells, suggestively through Ubiquilin-1 dependent stabilisation, increased degradation of β-catenin was observed. CacyBP is a well documented S100A6 interacting protein that is a part of the ubiquitin ligase complex that ubiquitinates β-catenin for degradation. Overexpression of CacyBP has been shown to increase β-catenin degradation and inhibit proliferation in cell lines and tumorigenicity in vivo (Ning, X. et al. 2007 MoI Cancer Res 5(12): 1254-62). The experiment herein shows that the interaction between S 100A6 and CacyBP may inhibit the ubiquitination of β-catenin, and thereby its degradation. Stabilisation of β-catenin presents yet another way for S100A6 to protect cells as signaling through β-catenin leads to increased cell survival.

[0191] S100A6 has previously been shown to interact with components of the cytoskeleton (Tropomyosin (Golitsina, N. L. et al. 1996 Biochem Biophys Res Commun 220(2):360-5)), and the immunoprecipitation experiment herein also indicates that the protein interacts with actin. One possible explanation of S100A6 inhibitory effects on Ubiquilin-1 and CacyBP could be through sequestration of these proteins to the cytoskeleton, thereby impairing their possibility (i) to protect ubiquitinated p53, IκBα and NFκB2/pl00 from degradation (Ubiquilin-1) or (ii) to promote β-catenin ubiquitination and degradation (CacyBP). Another explanation could be that S100A6 compete with other proteins in binding to Ubiquilin-1 and CacyBP.

[0192] The fact that S100A6 is upregulated in many cancers further supports a role of SlOO A6 in prosurvival/anti-apoptotic signaling. These experiments indicate a potent survival benefit for cells expressing high levels of S100A6. p53 is mutated in 50% of human cancers (Hainaut, P. et al. 2000 Adv Cancer Res 77:81-137; Kirsch, D.G. et al. 1998 J Clin Oncol 16(9):3158-68) and its function in the remaining cancers are most likely impaired through other mechanisms like MDM2 overexpression or ARP suppression (Eymin, B. et al. 2002 Oncogene 21(17):2750-61; Momand, J. et al. 1998 Nucleic Acids Res 26(15):3453-9). The present findings indicate that overexpression of S 100 A6 can be an additional approach that cancer cells use to overcome p53 dependent apoptosis.

[0193] The example below describes in greater detail some of the materials and methods used in Example 1.

EXAMPLE 2

[0194] Cell culture, treatment, cell growth and cell death: Lung cancer cell line A549 was cultured in McCoy's 5A medium with L-glutamine, 10% calf serum and 1% Penicillin/Streptomycin. Culture medium and supplements were commercially available. Twenty-four hours after seeding, monolayer cultures of cells were treated with doxorubicin (1 μg/ml medium). Twenty-four hours after seeding, monolayer cultures of cells were exposed to γ-radiation (10 Gy) using a ⁶⁰ Co source at a dose rate of 1.5 Gy/min. Cells were irradiated at room temperature. Cells were then lysed using repeated freeze-thaw cycles and soluble proteins were extracted in a pH 7.5 lysis buffer including 0.1% Triton X-100, 1% CHAPS and Complete mini EDTA free protease inhibitors. Cell growth was calculated through cell

counting as the increase in cell number compared to the number of seeded cells. The percentage of cell death was estimated by counting (under a microscope) the number of Trypan blue-stained cells and expressing it as the percentage of the total number of cells. Three replicate experiments were performed and t-test (unpaired, two-sided) was used to calculate p-values.

[0195] Immunoprecipitation: In the proteome wide search for S100A6 interacting proteins, a kit was used for the immunoprecipitation and, slightly modified to exclude the use of buffers containing primary amines that would interfere with the iTRAQ ^® labelling (see below). Briefly anti-S100A6 antibody (IgY) or isotype matched control antibody was covalently coupled to the coupling gel. After incubation, washing and blocking, diluted A549 cell lysate was added to the antibody coupled gel. After incubation and washing the precipitated proteins were eluted with a low pH buffer, leaving the covalently coupled antibody on the gel. Precipitates were used in proteomic experiments as described below, and for validation of precipitated Ubiquilin in western blot experiment. To further validate the interaction anti-Ubiquilin or isotype matched control antibody was coupled to protein G agarose gel. After blocking, incubation with A549 cell lysate and washing, the presence of S 100A6 in the immunoprecipitate was confirmed using western blot.

[0196] Western blotting: Total cell extracts (50 μg) were resolved by a 10% SDS- PAGE and blotted onto a nitrocellulose-membrane. After blocking with milk, the membranes were probed with the following antibodies against: Ubiquilin, S100A6, p53, p21, IκBα, NFκB2 p 100 and β-catenin, followed by appropriate HRP-conjugated secondary antibodies. Anti-Tubulin antibody was used as loading control and showed equal total protein loading in all western blot experiments. Quantification of the signal was made using densitometry analysis of three independent replicates and t-test (unpaired, two-sided) was used to calculate p-values.

[0197] siRNA treatment: A set of five different putative shRNAs for S100A6 in plasmid pLKO.l was commercially obtained. The pLKO.l plasmid without shRNA insert was also purchased and used as empty vector control. Viral vector plasmids pG32231 (HIV packaging construct) and pMD2.G (VSV-G construct) were a kind gift from Prof. Didier Trono at the School of Life Sciences, EPFL, Lausanne, Switzerland. HEK-293T and A549

cell lines were commercially obtained. Cells were cultivated in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and Antibiotic- Antimycotic solution and kept in 5% CO ₂ at 37°C. HEK-293T cells were also supplemented with 1% non-essential amino acids. HEK-293T cells were transfected by the calcium- phosphate method. In brief, plasmids were mixed with 124 mM CaCl ₂ in HBS (140 mM NaCl, 5OmM HEPES, 1 mM Na ₂ HPO ₄ , pH 7.1) and added to 40% confluent HEK-293T cells in IMDM medium supplemented with 10% FBS. After 16h, medium was replaced with normal HEK-293T medium supplemented with 10 mM HEPES and replication incompetent viruses were harvested 5Oh post transfection. Infected A549 cells were selected using 1 μg/mL puromycin in the medium.

[0198] Real-time quantitative PCR: After infection and selection, RNA was isolated including an optional on column DNA digestion step. 5 μg of total RNA was converted to cDNA by a Reverse Transcriptase kit (Invitrogen, USA). Oligonucleotides to be used in real-time PCR amplification were designed with software. The oligonucleotides were: S100A6-f (5'-CTCACCATTGGCTCGAAGCT-S') (SEQ ID NO: 1) and S100A6-r (5'- GGAAGTTCACCTCCTGGTCCTT-3') (SEQ ID NO: 2), giving an 88 bp junction spanning amplicon. For normalization, the amount of β-actin was also analyzed using rtBAct-f (5'- CGCGAGAAGATGACCCAGAT-3') (SEQ ID NO: 3) and rtBAct-r (5'- ACAGCCTGG ATAGCAACGTAC A-3') (SEQ ID NO: 4), giving a 71 bp junction spanning amplicon. Samples were analyzed with 100 nM of primer and iQ SYBR Green supermix in a total volume of 50 μl on an iCycler ^® . AU samples were analyzed in triplicates with the following program: 95 °C, 3 min, followed by 40 cycles of amplification (95 ⁰ C, 10s; 58 ⁰ C, 30s; 72°C, 30s). Data were collected during the 58 ⁰ C extension step and relative quantification of S100A6 gene expression was performed using the 2 ^"AACτ method (Livak, K.J. et al. 2001 Methods 25(4):402-8).

[0199] Proteomics: 100 ug of protein from each sample was precipitated using a chlorofom-methanol method (Wessel, D. et al. 1984 Anal Biochem 138(1): 141-3), digested with trypsin and iTRAQ ^® -labelled (114-1 17 reagents) according to the manufacturers recommendations. After labelling and pooling samples, excess reagent was removed using SCX-cartridges (strata-X-C, 1 mL bed volume) before drying the samples using SpeedVac.

Samples were re-dissolved in 8 M urea for peptide IPG-IEF. Focusing was done using 24 cm IPG-strips (pH-gradient 3,7-4,9, prototype strips kindly provided by Bengt Bjellqvist) on an IPGphor isoelectric focusing system. Focusing was carried out until reaching 100 kVh and each strip was subsequently sectioned manually to provide 45-50 fractions. Peptides were extracted by passive elution from each gel-piece by three one hour incubations in MiIIiQ grade water. Extracts were dried and reconstituted (0.05 % heptafluorobutyric acid in water) and a select number of fractions (13) were analyzed by LC-MS/MS. Peptide separation for LC-MS/MS analysis was performed using commercial monolithic columns (200 μm x 5 mm PS-DVB monolithic trap cartridge, analytical monolithic column PS-DVB 200 μm) on a Ultimate3000 LC-system fitted with a Probot-spotter. The column flow-rate was 1.5 μL/min and matrix (7 mg/mL CHCA in 70 % acetonitrile) was mixed in at a ratio of 1 : 1. Spots were collected every 6 seconds. MALDI-MS/MS analysis was done using a 4800 MALDI TOF/TOF system operated in data-dependent acquisition mode. The Paragon algorithm (Shilov, I. V. et al. 2007 MoI Cell Proteomics 6(9): 1638-1655) of the Protein Pilot 2.0 software was used for protein identification by searching a concatenated version (including forward and reversed sequences of all entries) of the IPI database (version 3.36 downloaded on 20071113, human taxonomy). False-discovery rates (calculated as; [2 x number of hits in reversed database / total number of hits]* 100) were below 1.3 % for all protein identification database searches. Quantitative analysis was preformed using software and curated manually.

EXAMPLE 3

[0200] The role of S100A6 in the regulation of the cytoskeleton and migration was investigated. Short hairpin (sh)RNA mediated silencing of SlOO A6 resulted in an altered protein expression of several different proteins, which are known to be involved in cytoskeleton regulation and cell migration (Table 2). Proteins affected by shRNA mediated silencing of S100A6 were detected using MS-based proteomics.

Table 2

SI 00A6 shRNA

Name control p-value Ftole in migration/invasion

ALDH 1 A1 0.69 1.93E-22 Over expr. in LC, induce migration

AHNAK 0.64 2.23E-18 Unknown funct.

Filam in A 0.70 7.87E-18 Actin bind, cytoskel. regul.

Vim entin 0.61 8.04E-1 1 Mes. marker induce migration

Filam in B 0.66 2.25E-07 Actin bind, cytoskel. regul.

HSPB1 (HSP27) 0.76 2.13E-04 Actin bind, cytoskel. regul

Galectin-1 0.75 9.71 E-03 involved in reg. of motility

AKAP12 1 .51 0.028 inhibitor of metastasis HSPA2 1 .62 0.050 unknown

Proteins downregulated in S100λ6 shRNA cells

[0201] As illustrated in Table 2, the following proteins were downregulated in S100A6 shRNA treated cells: vimentin, galectin-1, aldehyde dehydrogenase (ALDH)IAl, filamin, A, filamin B, and heat shock protein (HSP)Bl/ HSP27.

[0202] Vimentin is an intermediate filament that is strongly upregulated during epithelial-mesenchymal transition (EMT), a cellular program which is characterized by loss of cell adhesion and increased cell mobility. EMT is essential for numerous developmental processes. This process has also been shown to be closely connected to cancer cell invasion and metastasis. Additionally, EMT is known to affect drug response in cancer cells. It has also been demonstrated that antisense mediated downregulation of vimentin results in abolishment of the invasive capacity of prostate cancer cells measured by invasion assay (Singh et al 2003).

[0203] Galectin-1 has been shown to be involved in regulation of cell migration. In vitro addition of purified galectin-1 to U87 human glioblastoma cells enhances tumor cell motility and conversely, knocking down galectin-1 expression by stable transfection with antisense galectin-1 mRNA in this cell line, impairs motility and delays mortality after intracranial grafting to nude mice (Camby et al. 2002).

[0204] Aldehyde dehydrogenase (ALDH)IAl silencing using shRNA also resulted in decreased cell migration in A549 lung cancer cells as measured by scratch wound healing assay (Moreb et al. 2008).

[0205] Filamins A and B are F-actin interacting proteins that are involved in crossl inking actin filaments to generate stiff cytoskeletal structures, which are required for the production of internal propulsive forces for cell migration (Sato et al. 2005).

[0206] Heat shock protein (HSP)Bl/ HSP27 is an actin polymerization modulator, and it has been shown that siRNA mediated downregulation of HSPBl reduces migration and invasion in glioma cells (Golembieski et al. 2008).

Proteins upregulated in S100λ6 shRNA cells

[0207] AKAP12/Gravin was upregulated in S100A6 shRNA treated cells. AKAP12/Gravin is suggested to be a tumor suppressor as it is downregulated by several oncogenes and is strongly suppressed in various cancers, including prostate, ovary, and breast. It has been shown that expression of AKAP 12 reduces the matrigel invasiveness of mouse fibroblast cells (Gelman et al. 2006).

Migration

[0208] Interestingly, Keshamouni et al. 2006 have reported in a proteomics study that induction of EMT by TGF-β treatment results in a significant upregulation of several of the proteins that we now have demonstrated to be downregulated by S100A6 shRNA treatment (AHNAK, Filamin A, Vimentin, Filamin B and HSPBl). This finding indicates that S 100A6 could be involved in induction of EMT and therefore also that S100A6 could increase cell migration and possibly also the formation of metastases in vivo.

[0209] Taken together, the data described above suggests that shRNA mediated silencing of Sl 0OA 6 would decrease cell migration. To address this question cell migration in A549 empty vector cells was compared with S100A6 shRNA treated cells using a scratch wound healing assay (Figure 8). Three separate experiments were performed where the cell migration into a scratch wound in a confluent cell layer, was measured 24h after wound induction. Each experiment included at least 12 separate measurements per cell line. Interestingly, shRNA mediated silencing of S100A6 resulted in decreased cell migration.

[0210] In conclusion, these results demonstrate that S100A6 is involved in regulation of cell migration, which could be mediated through regulation of the EMT switch.

Overexpression of S100A6 in cancer could therefore also result in an increased risk of metastasis development in cancer patients. The data suggests that inhibition of S100A6 could be a therapeutical option for anti-metastasis treatment, and that S100A6 expression could be used as a marker of increased risk of metastasis or in general, an EMT related phenotype.

EXAMPLE 4 S100λ6 and drug sensitivity

[0211] Cell lines with suppressed S100A6 and wild type were evaluated using an in vitro drug sensitivity assay described in detail in by Markasz et al. 2009. In brief, cell lines were cultured on microtiter plates and tested for drugs (n=41), each at four different concentrations in triplicates on 384-well plates. After 4 days of incubation, live and dead cells were differentially stained using fluorescent dye. The precise number of living and dead cells was determined using a custom-made laser confocal fluorescent microscope at the Karolinska Institute visualization core facility (KIVIF) and programs QuantCapture 4.0 and Quant- Count 3.0 both developed at KIVIF (Markasz et al. 2006).

[0212] S100A6 shRNA treated cell lines showed a different drug sensitivity pattern compared with their wild type counterpart (Table 3) for a certain number of drugs. For the drugs presented in Table 3, S100A6 is involved as a putative resistance marker and interaction with S100A6, or the pathway(s) to which it belong, may be targeted to increase the sensitivity to the drugs. Table 3 indicates drugs that displayed increased sensitivity in cell lines treated with shRNA S100A6 compared to cell lines with empty vector/wild type. Response to treatment is indicated by "+" signs where more "+" signs means more sensitive and R means resistant.

Table 3

EXAMPLE 5

Detection and quantification method for S100A6 and other SlOO proteins using mass spectrometry based on Multiple Reaction Monitoring (MRM)

[0213] A combined detection and quantification method for SlOO proteins was developed, visualized here by specific detection and quantification of two S100A6 peptides (Figures 9 and 10). The method is based on total tryptic digestion of a complex sample, followed by liquid chromatography (HPLC or UPLC) and analysis with mass spectrometer, multiple reaction monitoring (triple quadrupole instrument or similar). The specific detection and quantification was performed by selecting 2-3 peptides from SlOO proteins, generated by enzymatic digestion or other fragmentation means. The selection of peptides was based upon 1) time slot in liquid chromatography elution, 2) mass on quadrupole 1, and 3) fragment mass in quadrupole 3. The list of peptides for MRM-based quantification of S 100-protein family members as well as S100A6 binding partners and internal control proteins are listed in Table 4.

Table 4

SEQ ID NO Protein Peptide to be detected and quantified

SEQ ID NO: 25 SlOOAl MGSELETAMETLINVFHAHSGK

SEQ ID NO: 26 SlOOAl ELLQTELSGFLDAQK

SEQ ID NO: 27 S100A2 YSCQEGDK

SEQ ID NO: 28 S100A2 CSSLEQALAVLVTTFHK

SEQ ID NO: 29 S100A2 ELPSFVGEK

SEQ ID NO: 30 S 100 A3 PLEQAVAAIVCTFQEYAGR

SEQ ID NO: 31 S100A3 ELATWTPTEFR

SEQ ED NO: 32 S 100 A3 DCEVDFVEYVR

SEQ ID NO: 33 S100A4 ALDVMVSTFHK

SEQ ID NO: 34 S100A4 EGDKFK

SEQ ID NO: 35 S100A4 ELPSFLGK

SEQ ID NO: 36 S100A4 RTDEAAFQK

SEQ ID NO: 37 S100A4 TDEAAFQK

SEQ ID NO: 38 S100A5 EYSVFLTMLCMAYNDFFLEDNK

SEQ ID NO: 39 S100A5 ALTTMVTTFHK

SEQ ID NO: 40 S100A6 EGDKHTLSK

SEQ ID NO: 41 S100A6 ELTIGSK

SEQ ID NO: 42 S100A6 LMEDLDR

SEQ ID NO: 43 S100A6 LQDAEIAR

SEQ ID NO: 44 S100A7 IDFSEFLSLLGDIATDYHK

SEQ ID NO: 45 S100A7 SIIGMIDMFHK

SEQ DD NO: 46 S100A7 GTNYLADVFEK

SEQ ID NO: 47 S100A7 ENFPNFLSACDK

SEQ ID NO: 48 S100A8 LLETECPQYIR

SEQ ID NO: 49 S100A8 ALNSIIDVYHK

SEQ ID NO: 50 S100A8 GNFHAVYR

SEQ ID NO: 51 S100A8 GADVWFK

SEQ ID NO: 52 S100A8 LNSHDVYHK

SEQ ID NO: 53 S100A9 NIETIINTFHQYSVK

SEQ ID NO: 54 S100A9 VIEHIMEDLDTNADK

SEQ ID NO: 55 S100A9 LGHPDTLNQGEFK

SEQ ID NO: 56 S100A9 QLSFEEFIMLMAR

SEQ ID NO: 57 S100A9 LTWASHEK

SEQ ID NO: 58 SlOOAlO EFPGFLENQKDPLAVDK

SEQ ID NO: 59 SlOOAlO PSQMEHAMETMMFTFHK

SEQ ID NO: 60 SlOOAlO DPLAVDK

SEQ ID NO: 61 SlOOAlO EFPGFLENQK

SEQ ID NO: 62 SlOOAlO FAGDKGYLTK

SEQ ID NO: 63 SlOOAI l CIESLIAVFQK

SEQ ID NO: 64 SlOOAI l TEFLSFMNTELAAFTK

SEQ ID NO: 65 SlOOAI l ISSPTETERCIESLIAVFQK

SEQ ID NO: 66 SlOOAI l DGYNYTLSK

SEQ ID NO: 67 SlOOAI l ISSPTETER

SEQ ID NO: 68 SlOOAI l AVPSQK

SEQ ID NO: 69 SlOOAI l DPGVLDR

SEQ ID NO: 70 S100A12 LEEHLEGIVNIFHQYSVR

SEQ BD NO: 71 S100A12 GHFDTLSK

SEQ ID NO: 72 S100A13 ELVTQQLPHLLK

SEQ ID NO: 73 S100A13 SLDVNQDSELK

SEQ ID NO: 74 S100A14 SFWELIGEAAK

SEQ ID NO: 75 S100A14 SANAEDAQEFSDVER

SEQ BD NO: 76 Sl 0OA 14 NFHQYSVEGGK

SEQ ID NO: 77 S100A14 IANLGSCNDSK

SEQ ID NO: 78 S100A14 DLVTQQLPH

SEQ ID NO: 79 S 100A16 ISFDEYWTLIGGITGPIAK

SEQ ID NO: 80 S100A16 ELNHMLSDTGNR

SEQ ID NO: 81 S100A16 AVIVLVENFYK

SEQ ID NO: 82 S100A16 LIQNLDANHDGR

SEQ ID NO: 83 Tubulins EIVHIQIGQCGNQIGAK

SEQ ID NO: 84 Tubulins INVYYNEAAGNK

SEQ ID NO: 85 Tubulins AILVDLEPGTMDSVR

SEQ ED NO: 86 Tubulins TAVCDIPPR

SEQ ID NO: 87 Tubulins FPGQLNADLR

SEQ ID NO: 88 Tubulins EDAANNYAR

SEQ ID NO: 89 Tubulins VREEYPDR

SEQ ID NO: 90 Tubulins EIIDPVLDR

SEQ ID NO: 91 Tubulins DVN AAIATK

SEQ ID NO: 92 Tubulins IREEYPDR

SEQ ID NO: 93 Tubulins EDMAALEK

SEQ ID NO: 94 Tubulins ISVYYNEATGGK

SEQ ID NO: 95 Tubulins AVFVDLEPTVIDEVR

SEQ ID NO: 96 Tubulins AVLVDLEPGTMDSVR

SEQ ID NO: 97 Tubulins TIQFVDWCPTGFK

SEQ ID NO: 98 Tubulins EVDEQMLNVQNK

SEQ ID NO: 99 Tubulins GHYTEGAELVDSVLDVVR

SEQ ID NO: 100 Tubulins VGINYQPPTVVPGGDLAK

SEQ ID NO: 101 Tubulins ALTVPELTQQVFDAK

SEQ ID NO: 102 Tubulins TIGGGDDSFNTFFSETGAGK

SEQ ID NO: 103 GAPDH VPTANVSVVDLTCR

SEQ ID NO: 104 GAPDH IISNASCTTNCLAPLAK

SEQ ID NO: 105 GAPDH GALQNIIPASTGAAK

SEQ ID NO: 106 GAPDH WGDAGAEYVVESTGVFTTMEK

SEQ ID NO: 107 GAPDH LVINGNPITIFQER

SEQ ID NO: 108 GAPDH VVDLMAHMASK

SEQ ID NO: 109 GAPDH LISWYDNEFGYSNR

SEQ ID NO: 1 10 GAPDH VIISAPSADAPMFVMGVNHEK

SEQ ID NO: 1 1 1 GAPDH VIHDNFGIVEGLMTTVHAγγATQK

SEQ ID NO: 112 GAPDH AGAHLQGGAK

SEQ ID NO: 113 GAPDH LTGMAFR

SEQ ID NO: 114 GAPDH VGVNGFGR

SEQ ID NO: 1 15 GAPDH QASEGPLK

SEQ ID NO: 1 16 GAPDH MFQYDSTHGK

SEQ ID NO: 1 17 GAPDH TVDGPSGK

SEQ ID NO: 118 GAPDH WYDNEFGYSNR

SEQ ID NO: 1 19 G6PD EPFGTEGR

SEQ ID NO: 120 G6PD FREDQIYR

SEQ ID NO: 121 G6PD GYLDDPTVPR

SEQ ID NO: 122 G6PD DGLLPENTFIVGYAR

SEQ ID NO: 123 G6PD GGYFDEFGIIR

SEQ DD NO: 124 G6PD GPTEADELMK

SEQ ID NO: 125 G6PD LEDFFAR

SEQ ID NO: 126 G6PD LPDAYER

SEQ ID NO: 127 G6PD NSYVAGQYDDAASYQR

SEQ ID NO: 128 G6PD VGFQYEGTYK

SEQ ID NO: 129 G6PD VQPNEAVYTK

SEQ ID NO: 130 G6PD LILDVFCGSQMHFVR

SEQ ID NO: 131 G6PD IFTPLLHQIELEKPK

SEQ ID NO: 132 Ubiquilin NPEISHMLNNPDIMR

SEQ ID NO: 133 Ubiquilin SHTDQLVLIFAGK

SEQ ID NO: 134 Ubiquilin FQQQLEQLSAMGFLNR

SEQ ID NO: 135 Ubiquilin EKEEFAVPENSSVQQFK

SEQ ID NO: 136 Ubiquilin ALSNLESIPGGYNALR

SEQ ID NO: 137 Ubiquilin EANLQALIATGGDIN AAER

SEQ ID NO: 138 Ubiquilin NPAMMQEMMR

SEQ ID NO: 139 Ubiquilin QTLELAR

SEQ ID NO: 140 beta-Actin AGFAGDDAPR

SEQ ID NO: 141 beta-Actin CDVDIR

SEQ ID NO: 142 beta-Actin DLYANTVLSGGTTMYPGIADR

SEQ ID NO: 143 beta-Actin GYSFTTTAER

SEQ ID NO: 144 beta-Actin IWHHTFYNELR

SEQ ID NO: 145 SlOOB AMVALIDVFHQYSGR

SEQ ID NO: 146 SlOOB ELINNELSHFLEEIK

SEQ ID NO: 147 SlOOP MTELETAMGMIIDVFSR

SEQ ID NO: 148 SlOOP YSGSEGSTQTLTK

EXAMPLE 6 SlOO proteins and ionizing radiation

[0214] Using mass spectrometry based proteomics methods, increased levels of a number of different SlOO proteins in response to exposure to ionizing radiation were detected (Figure 1 1). The data show that several of the SlOO proteins are involved in the processes related to cytotoxic treatment. These results demonstrate that inhibiting one or more S lOO proteins in combination with conventional cytotoxic treatment (e.g. irradiation or cytotoxic drugs) could be effective in treating cancer or sensitizing cancer cells to a cancer therapy.

EXAMPLE 7 Cell lines with manipulated level of Sl 00A6 and S100A4

[0215] In order to perform extended screening of drugs and small molecules where the response is dependent on S100A6 and S100A4 expression levels, a panel of cell lines with manipulated levels of these two proteins (figure 12) were constructed. Cell lines with manipulated levels of other SlOO proteins (using shRNA and overexpression vectors) are constructed. These cell lines are used as tools to determine synergistic effects of SlOO protein inhibition and cytotoxic treatment.

EXAMPLE 8 Screening of synergistic effects of SlOO inhibition and cytotoxic drugs

[0216] Synergistic effects of SlOO inhibition and treatment with several cytotoxic drugs and ionizing radiation have been shown herein. Several additional cytotoxic drugs in clinical use, and also drugs in clinical trials and small molecules are also screened. Cell based

cytotoxicity assays are used as a method and the effect of inhibiting different SlOO proteins in relation to sensitivity to cytotoxic treatment are systematically determined to find synergistic effects between SlOO inhibition and cytotoxic treatment. The methods include all kinds of cell based cytotoxicity assays, exemplified below by two different methods.

[0217] In the first method, cell lines with suppressed S100A6 and wild type are evaluated using an in vitro drug sensitivity assay, as described in detail in by Markasz et al. 2009. In brief, cell lines are cultured on microtiter plates and tested for drugs (n=41), each at four different concentrations in triplicates on 384-well plates. After 4 days of incubation, live and dead cells are differentially stained using fluorescent dye. The precise number of living and dead cells are determined using a custom-made laser confocal fluorescent microscope at the Karolinska Institute visualization core facility (KIVIF) and programs QuantCapture 4.0 and Quant- Count 3.0 both developed at KIVIF (Markasz et al. 2006).

[0218] The second method uses a fluorometric microculture cytotoxicity assay (FMCA). FMCA is based on the measurement of fluorescence generated from hydrolysis of FDA to fluorescent fluorescein by cells with intact plasma membranes as described in detail previously (Hassan et al. 2005. Cancer Chemother Pharmacol 55 (2005) 47-54). 45 ml of cell suspension containing the cell number of 5 x 103 are seeded into 384 well plates using Precision 2000 automated microplate pipetting system (Bio-Tek Instrument Inc., USA). In each plate, two columns with cells without drugs are used as control, and two columns containing only culture medium re used as blank. After 72h incubation (37°C, 5% C02), the cells are washed, incubated in 10 μg/ml FDA for 30 min. and the fluorescence is measured. The fluorescence generated is proportional to the number of intact cells in the well. Quality criteria for a successful analysis include a fluorescence signal in the control wells of more than ten times the mean blank value, a mean coefficient of variation (CV) in the control wells of less than 30% and the CVs for duplicate experimental wells of less than 8%. Cell survival is presented as a survival index (SI), defined as the fluorescence in the experimental wells expressed as a percentage of that in the control wells, with values in the blank wells subtracted. Three independent experiments with both cell lines in duplicates are performed.