BACKGROUND OF THE INVENTION:

Cytomegalovirus (CMV) is a member of the herpesvirus family which infects a wide range of animal species, including humans. Human CMV (HCMV) infects 50% to 80% of the population, ranging from mild or subclinical disease in immunocompetent adults, to severe morbidity in neonates and immunocompromised individuals such as transplant recipients and AIDS patients. In neonates, the infection may result in significant neurological defects, while in adults, severe mononucleosis, pneumonia, hepatitis, gastroenteritis, and sight-threatening chorioretinitis are common pathological symptoms. The virus is transmitted by repeated or prolonged intimate exposure, often through the ingestion of mother's milk or by sexual intercourse (Schooley in Harrison's Principles of Internal

Medicine (13th Ed.) (Isselbacher et al., eds.) McGraw-Hill, Inc., New York, 1994, pp. 794-796).

CMVs have the structure typical of herpesviruses, including a double- stranded DNA genome encapsulated by an icosohedral capsid surrounded by lipoprotein membrane. The virus replicates in the cell nucleus and causes either lytic and productive or latent infection. Once infected, an individual probably carries the virus for life in the latent form unless T lymphocyte- mediated immunity is compromised. CMV also has the oncogenic ability to transform human and nonhuman cells and to stimulate their growth.

Prophylactic measures for preventing CMV infection have included the use of transplant tissue or blood from seronegative donors or blood that was frozen, thawed, and deglycerolized to decrease transfusion-associated transmission. Interferon alpha has been demonstrated to prevent reactivation CMV syndromes and to delay CMV excretion in high risk kidney transplant recipients (Schooley in Harrison's Principles of Internal Medicine (13th Ed.) (Isselbacher et al., eds.) McGraw-Hill, Inc., New York, 1994, pp. 794-796). Prophylactic acyclovir, a

nucleoside analog, has been demonstrated to reduce CMV infection in seronegative renal transplant recipients.

Other attempts at preventative measures have included the development of anti-HCMV vaccines. However, vaccination did not protect fully against infection or reactivation of HCMV (EP 0 277 773; Elek et al. (1974) Lancet 1:1-5; Neff et al. (1979) Proc. Soc. Exp. Biol. Med. 160:32-37). U.S. 5,273,876 discloses another vaccine comprising an attenuated HCMV that includes a DNA sequence essential for the replication of HCMV and at least one foreign DNA sequence adapted for the expression of an antigenic polypeptide.

Therapeutic treatment of CMV has not yet proven to be very promising. Known antiviral drugs such as the nucleoside analogs acyclovir (acycloguanosine), and ara-A (adenine arabinoside) have had little effect on HCMV active infection. Gancicovir [9-( 1 ,2-dihydroxy-2-propoxymethyl guanine) has been found to be an inhibitor of CMV polymerase after intracellular conversion to its triphosphate form. In AIDS patients also having CMV, continuous use of gancicovir has controlled CMV infection. However, peripheral blood neutropenia and the development of gancicovir- resistant strains are common in patients treated for more than three months.

Foscamet (sodium phosphonoformate) has been used to treat HCMV infection (see, e.g., Azad et al. (1993) Antimicrob. Agents Chem ther. 37:1945- 1954). However, the disease recurs in treated individuals who are immunocompromised such as AIDS patients. In addition, foscamet administration requires the use of an infusion pump and close clinical monitoring. Furthermore, drug toxicity from long term use and the emergence of resistant viral strains associated with long term therapy have limited the effectiveness of this compound (see, e.g., Azad et al., ibid.). Thus, limitations such as toxicity and resistance to known drugs demonstrate the need for new treatment strategies for CMV.

Recently, new chemotherapeutic agents have been developed which are capable of modulating cellular and foreign gene expression. These agents, called antisense oligonucleotides, bind to target single-stranded nucleic acid molecules according to the Watson-Crick or the Hoogsteen rule of base pairing, and in doing so, disrupt the function of the target by one of several mechanisms: by preventing

the binding of factors required for normal transcription, splicing, or translation; by triggering the enzymatic destruction of mRNA by RNase H, or by destroying the target via reactive groups attached directly to the antisense oligonucleotide.

Antisense oligonucleotides have been used to inhibit the expression of a number of different viruses, including HIV-1, influenza, and other viruses (see, e.g., Agrawal et al., U.S. Patent No. 5,194,428; Pederson et al., U.S. Patent Nos. 5,149,797; Agrawal (1992) Trends Biotechnol. 10:152-158; Agrawal et al. in Gene Regulation: Biology of Antisense RNA and DNA (Erickson and Izant, eds.) Raven Press Ltd., New York (1992) pp. 273-283); Agrawal (1991) in Prospects for

Antisense Nucleic Acid Therapy for Cancer and AIDS, (Wickstrom, ed.) Liss, New York, pp. 145-148).

Antisense oligodeoxynucleotides have also been designed to treat various herpesvirus infections. For example, oligonucleotides complementary to the EBNA- 1 gene of Epstein-Barr virus (EBV) have been reported to inhibit EBV infection (U.S. Patent No. 5,242,906). U.S. Patent No. 5,248,670 discloses antisense oligonucleotides complementary to Herpes simplex virus type I genes UL13, UL39, and UL40 for the purpose of inhibiting the replication of virus in cultured HeLa cells.

In addition, antisense oligodeoxynucleotides have been designed to specifically treat CMV infection. For example, a phosphorothioate oligonucleotide complementary to the RNA of the HCMV major immediate-early region (IE2) has been shown to reduce the production of infectious virus in cultured human foreskin fibroblasts (Azad et al. (1993) Antimicrob. Agents Chemother. 37:1945-1954). (The nucleotide sequence coordinates (i.e., nomenclature) are from the published DNA sequence data of Chee et al. (Curr. Top. Microbiol. Immunol. (1990) 154:125-169). The IE2 region encodes several proteins which regulate viral gene expression.

PCT US91/05815 discloses oligonucleotides which are complementary to portions of CMV mRNAs which code for the IE1, IE2, or DNA polymerase (UL54) proteins, including at least a portion of the mRNA cap site, the AUG region, the conserved amino acid region, the CMV insertion regions between particular bases of the DNA polymerase gene, an intron/exon junction region of the IE1 or IE2 gene, or a nuclear location signal region of the IE2 gene.

WO 95/32213 discloses thai treatment of cells with oligonucleotides directed to specific regions of the HCMV genome results in the inhibition of HCMV DNA replication. In particular, oligonucleotides complementary to transcripts or DNA of the UL36/37, UL84, ULlOlx- 102, and ULl 12-113 genes are able to inhibit HCMV DNA replication in infected cells. These targeted genes encode early temporal class nucleus- associated proteins, some of which having unknown function (UL84, ULl 12-113). All of these genes are among those known to be required for transient complementation of HCMV oriLyt-dependent DNA replication, an artificial system set up for a cotransfection-replication assay. Unexpectedly, it was discovered that the UL36/37, UL84, and UL101x-102 genes are also required for HCMV DNA replication. Thus, WO 95/32213 discloses oligonucleotides targeted to these genes including oligonucleotides targeted to the intron-exon boundary of UL36/37, an immediate early protein present at all times during the infectious cycle.

As a result of an intensive drug optimization effort, the present invention provides novel chemically modified oligonucleotides, such chemical modifications resulting in oligonucleotides which are optimized for treatment of HCMV. Such optimized oligonucleotides for use as a human therapeutic have not been previously disclosed or comtemplated.

DESCRIPTION OF THE DRAWINGS:

The foregoing and other objects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which:

FIG. 1 is an autoradiogram of a Southern blot showing the relative amount of

HCMV replication in cells treated with varying concentrations of the oligonucleotides indicated before viral infection of MOI = 0.4, wherein the probed used was HCMV EcoRI fragment M;

FIG. 2 is a representation of a Southern blot showing the relative amount of HCMV replication in cells treated with varying amounts of oligonucleotides indicated;

FIG. 3 is a representation of a dot blot showing the relative amount of

HCMV replication in cells treated with varying concentrations of the oligonucleotides indicated;

FIG. 4 is a representation of a dot blot comparing the relative amount of HCMV replication in cells treated with various concentration of the oligonucleotides of the invention and cells treated with the parent all phosphorothioate oligonucleotide of identical base sequence and length.

FIG. 5 shows the comparitive inhibition of HCMV DNA replication in human fibroblasts dose/response curves between an oligonucleotide of the invention, an all phosphorothioate oligonucleotide directed to the IE2 gene of CMV and Gancicovir, a CMV polymerase inhibitor.

DETAILED DESCRIPTION OF THE INVENTION:

The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. The issued U.S. patents, allowed applications, and other publications cited herein are hereby incorporated by reference.

The present invention provides novel modified oligonucleotides targeted to the UL36/37 gene which have been chemically modified as part of a drug development scheme to provide an optimized drug product for therapeutic treatment of CMV. Such chemically modified oligonucleotides possess certain characteristics which render them particularly suitable for the treatment of CMV and may be referred to herein as "optimized" oligonucleotides.

The development of an optimized oligonucleotide is an intensive effort which takes into account many factors including the ability of the oligonucleotide to down regulate or eliminate the function of the targeted gene, the physical and chemical stability of a given chemically modified oligonucleotide in vivo as well as the assessment of the bioavailability of the chemically modified oligonucleotide. Chemically modified oligonucleotides of the invention should possess the following characteristics which may warrant the designation of the oligonucleotide as "optimized". First, an optimized oligonucleotide of the invention should possess antiviral activity against the CMV vims and preferably enhanced antiviral activity as compared to other CMV antisense oligonucleotides or other classes of anti-CMV drug therapies (e.g. GCV) Second, the optimized oligonucleotide should possess enhanced stability in vivo as compared to other chemically modified CMV antisense oligonucleotides. Third, the optimized oligonucleotide should be bioavailable to the target organs and tissues of the body. And fourth, the optimized oligonucleotide should not be toxic and preferably exhibit reduced toxicity as compared to other types of modified oligonucleotides.

Modified oligonucleotides which have been determined to be "optimized" oligonucleotides of the invention include: UL36/37 4x4 OMe; UL36/37 3x4 OMe; UL36/37 2x4 OMe; UL36/37 1x4 OMe; UL36/37 0x4 OMe; UL36/37 4x0 OMe; UL36/37 4x4 OMe (I); UL36/37 2x4 OMe (I); UL36/374x0 OMe 3'-Chol; UL36/37 2x4 OMe 3' Choi; UL36/37 4Rx0; UL36/37 4x4 3'-Chol, all as shown in Table 1 Preferred optimized oligonucleotides include: UL36/37 4x4 OMe; UL36/37 3x4 OMe; UL36/37 2x4 OMe; UL36/37 1x4 Ome and UL36/37 4x4 3'-Chol; and most the most preferred oligonucleotides include: UL36/37 4x4 OMe; and UL36/37 2x4 OMe. All of these oligonucleotides are targeted to to the UL 36/37 gene of CMV, a gene which has been shown to be required for viral DNA replication. The oligonucleotides of the invention possess a "hybrid" configuration as described in WO 94/02498, having at least one region of 2'O-substituted ribonucleotides and at

least one DNA region, and are preferably linked by phosphorothioate intemucleotide linkages or other preferred intemucleotide linkages such as phosphodiester, methyll phosphonate, phosphotriester, thino triester, phosphoramidate. Optimized oligonucleotide UL36/37 4x4 3'chol bears a cholesteryl substituent as indicated in Table 1.

T BLE_1

Sequence

SEQ ID

Qligo _HQi

UL36/37 I/X 1 TGGGGCTTACCTTGCGAACA 1 UL36/37 4x4 OMe UGGGGCTTACCTTGCGAACA 2 UL36/37 3x4 OMe UGGGGCTTACCTTGCGAACA 2 UL36/37 2x4 OMe UGGGGCTTACCTTGCGAACA 2 UL36/37 1x4 OMe UGGGGCTTACCTTGCGAACA 2 UL36/37 0x4 OMe TGGGGCTTACCTTGCGAACA 1 UL36/37 4x0 OMe UGGGGCTTACCTTGCGAACA 2 UL36/37 4x4 OMe (I) UGGGICTTACCTTGCGAACA 2 UL36/37 2x4 OMe (I) UGGIGCTTACCTTGCGAACA 2 UL36/37 4x0 OMe 3 ^■ -Choi UGGGGCTTACCTTGCGAAC#*A 2 UL36/37 2x4 OMe 3' -Choi UGGGGCTTACCTTGCGAAC#*A 2 UL36/37 4RxO UGGGGCTTACCTTGCGAACA 2 UL36/37 4x4 3 '-Choi UGGGGCTTACCTTGCGAACA 2

ISIS 2922 GCGTTTGCTCTTCTTCTTGCG 3

underscoring thiono triester (S-triester) intemucleotide linkage; holding 2*-0-methyl (OMe)-substituted ribonucleotides;

I inosine

* phosphoramidate intemucleotide linkage; # location of cholesteryl

The optimized oligonucleotides of the invention are chemically modified derivitaves of UL36/37 1/x 1 ("parent"), which have been modified for the purpose of finding an "optimized" oligonucleotide which fits the characteristics of possessing antiviral activity, enhanced stability, bioavailability and reduced toxicity.

In accordance with the first characteristic, those oligonucleotides which downregulate the function of an essential target gene of CMV, thereby having an adverse effect on the ability of the CMV to remain viable in a host cell, are deemed to have antiviral activity. Without being limited to any theory or mechanism, it is generally believed that the activity of optimized oligonucleotides used in accordance with this invention depends on the binding of the oligonucleotide to the target nucleic acid (e.g. at least a portion of a genomic region, gene, pre-mRNA or mRNA transcript thereof,) thus disrupting the function of the target gene by hybridization arrest, destruction of target RNA by Rnase H (the ability to activite RNAse H when hybridized to RNA), or inhibition of splicing. Therefore an optimized oligonucleotide should preferably form a highly stable duplex with the target molecule and exhibit enhanced affinity for the target and particularly for target mRNA so as to enable RNase H activation. An oligonucleotide' s ability to form a stable duplex with the target molecule may be assessed using Thermal Melting (Tm) data.

Such hybridization under physiological conditions may also be measured as a practical matter by observing interference of the oligonucleotide with the function of the targeted nucleic acid sequence. For example, as the UL36/37 gene encodes a protein that has been shown to be required for HCMV DNA replication, a Southern or dot blot assay may be used in order to determine whether HCMV DNA synthesis has been inhibited by the oligonucleotides of the invention. In these assays, dot blots of D A were prepared from cells pretreated with oligonucleotides and then infected with HCMV. These were probed using an HCMV EcoRI fragment M probe (Figs 1,2, 3 and 4).

The results of these assays performed on the oligonucleotides of the invention reveal that HCMV DNA replication is reduced to negligable amounts when cells are treated with chemically modified oligonucleotides of the invention at concentrations as low as 0.08 uM. Complete inhibition of the infectious vims was found using the UL 36/37 2x4 OMe and UL36/37 4x4 OMe oligonucleotides (SEQ ID NO:2) at 0. luM, and greater than 90% inhibition of the infectious vims using the UL36/37 2x4 OMe and UL36/37 4x4 OMe oligonucleotides at 0.03uM (Fig 1). As shown in Fig 2, the UL36/37 4x4 3'-chol oligonucleotide inhibited HCMV DNA replication greater than 90% compared to a control at a concentration of 0.08 uM. Plaque assays as described in Example 2 were also performed to confirm the Southern blot results described above. As shown in Fig. 3, the UL36/37 4x4 3'-chol oligonucleotide inhibited HCMV DNA replication approximately 90% compared to a control at a concentration of 0.05 uM. This level of inhibition is comparable to the UL36/37 4x4 OMe compound.

In a separate study, a Southern blot was used to compare chemically modified oligonucleotides of the invention UL36/37 OMe 4x4 and UL36/37 OMe 2x4 to the parent PS oligonucleotide The results shown in Fig 4 indicate that at lower concentrations, the chemically modified oligonucleotides of the invention were capable of inhibiting HCMV DNA replication to a greater extent than the parent all-phosphorothioate oligonucleotide.

Additional in vitro studies were also used to compare UL36/37 OMe 2x4 with an all-phosphorothioate oligonucleotide ISIS 2922 (SEQ ID #3) directed to the IE2 gene of CMV (Azad et al. (1993) Antimicrobial Agents and Chemother. 37:1945-1954), as shown in Table 1, and Gangcicovir (GCV), a CMV polymerase inhibitor. In these studies the inhibition of HCMV DNA replication in human fibroblasts treated with UL36/37 OMe 2x4, ISIS 2922, GCV and a reverse sequence control (a control which contains the same bases as UL36/37 OMe 2x4, but in

reverse order), show that UL36/37 OMe 2x4 is approximately 1,000 fold more potent than ganciclovir and about 50 times more potent than the ISIS 2922 sequence, with inhbition of 90% of vims at 100 nano-molar concentrations (Fig. 5).

The results described above confirm that the chemically modified oligonucleotides of the invention have antiviral activity, and based on comparative studies with UL36/37 OMe 2x4 have, or are expected to have, extremely potent antiviral activity.

Other assays which may be used to assess antiviral activity of the optimized oligonucleotides of the invention include an ELISA assay which measures HCMV replication in an indirect manner by determining the relative level various HCMV proteins present in infected cells. When certain protein levels are lower than normal after treatment of the HCMV infected cells with proteins of the invention, this is an indication that HCMV replication is suppressed as a result of the presence of oligonucleotides of the invention. Northern blot assays may also be used to determine the effect of the oligonucletides of the invention on HCMV RNA transcription. Reduced or undetectable UL36/37 transcript derived from RNA extracted HCMV infected cells treated with oligonucleotides of the invention is another indication of antiviral activity.

The second characteristic for an optimized oligonucleotide of the invention is "enhanced stability". Enhanced stability is the ability of the oligonucleotide to resist the degradative influences of intrinsic enzymatic activity in vivo. In vivo degradation of oligonucleotides produced oligonucleotide breakdown products of reduced length. Such breakdown products are less likely to be therapeutically effective relative to their full length counterparts. As it is known that nucleases in serum readily degrade phosphodiester-linked (PO) oligonucleotides, replacement of the phosphodiester internulceotide linkage with at least one or more internal artificial linkages such as phosphorothioates (PS), methylphosphonates,

phosphorami dates or combinations thereof, has been shown to stabilize oligonucleotides in cells, cell extracts, serum and other nuclease containing solutions as well as in vivo. Replacement of PO linkages with PS linkages is the most widely used chemical modification of the oligonucleotide backbone to enhance stability of the oligonucleotide backbone. The optimized oligonucleotides of the invention have been modified relative to the all-phosphorothiate parent so that at least one of the 5' or 3' most deoxy ribose groups have been modified at the 2' position with -0-CH ₃ , forming a 2' -O-methyl ribonucleotide region. For example optimized oligonucleotide UL36/37 4x4 OMe comprises a 5' -O-Me substituted ribonucleotide region of 4 nucleotides and a 3' substituted-ribonucleotide flanking region of 4 nucleotides with a core DNA region of 12 nucleotides, UL36/37 2x4 OMe comprises a 5' substituted ribonucleotide region of 2 nucleotides and a 3' substituted ribonucleotide flanking region of nucleotides with a core DNA region of 14 nucleotides, and so on for each of the oligonucleotides of the invention. These substituted RNA chemical modifications appear to impart exceptional stability to these optimized oligonucleotides as described below and are believed to play a role in the exceptional antiviral activity as desribed earlier.

Enhanced stability of an optimized oligonucleotide provides a number of benefits including a longer retention time in vivo ( also expressed as in vivo half life) which ultimately results in lower and less frequent dosing of the oligonucleotide therapeutic as well as greater, and prolonged, bioavailability in vivo at the target site of the oligonucleotide. For example in vivo studies using 3 dose levels of UL36/37 2x4 OMe injected intravitreally into rabbit eyes show that intact oligonucleotide concentrations in the retina, even after the administration of the lowest dose, were well above the concentration that inhibits 90% of the vims in tissue culture after 4 months (Example 4). This is an extraordinary retention time for an oligonucleotide therapeutic, and when combined with suitable antiviral activity, bioavailability profile and low toxicity would warrant the designation of this oligonucleotide and

the other similarly chemically modified oligonucleotides of the invention as "optimized".

Other studies for determining the stability of the chemically modified oligonucleotides of the invention include studies indicating the rate of elimination in urine. In these studies the elimination of radiolabeled oligonucleotide via the urine is expressed as a percentage of the total radiolabeled dose administered to rats in vivo. In these studies only 9% of the total radiolabeled dose of UL36/37 2x4 OMe was eliminated within 0-72 hours after dosing as compared to 44% in the first 72 hours after dosing of the parent all-phosphorothioate compound, therefore indicating that UL36/37 2x4 OMe of tiV invention has significantly enhanced stability in vivo as compared to the parent all-phosphorothioate counterpart therof. Similar results would be expected with the other, closely related, oligonucleotides of the invention as shown in Table I.

The third criteria for an optimized oligonucleotide of the invention is bioavailability. This criteria goes hand-in-hand with the stability criteria. The distribution of oligonucleotide to various tissues in the body may be studied using radiolabeled dosages of oligonucleotide. Bioavailability is determined by administering radiolabeled oligonucleotide in vivo followed by homogenization of organs and measurement of radioactivity therein. Once again in a study comparing UL36/37 2x4 OMe radiolabled oligonucleotide to the parent all-phosphorothioate oligonucleotide in rats, UL36/37 2x4 OMe showed a much higher level of tissue distribution in liver, spleen, heart, small intestine, and stomach. It is expected that the other similarly modified oligonucleotides of the invention would possess the same bioavailable characteristics.

The fourth criteria for an optimized oligonucleotide is that it is not toxic and preferably exhibits reduced toxicity as compared to other types of modified oligonucleotides. It is known that some PS olignucleotides have been found to

exhibit an immunostimulatory response which in certain cases may be undesirable. For example Galbraith et al. (Antisense Res. & Dev. (1994) 4:201-206) disclose complement activiation by some PS oligonucleotides. Henry et al. (Pharm. Res. (1994) 11 :PPDM8082) discloses that some PS oligonucelotides may potentially interfere with blood clotting. Optimized oligonucleotides should ideally provide reduced mitogenicity, reduced activiation of complement and reduced side effects relative to conventional oligonucleotides.

In vitro, for example, cytotoxicity of oligonucleotides may be measured by coventional means as described in Example 3. In vivo, a number of toxicity studies may be used to determine the safety of an optimized oligonucleotide of the invention. Oligonucleotide UL36/37 2x4 OMe was tested in vivo in such a toxicity regimen and the results indiated that this oligonucleotide may be used safely in treating CMV either intravitreally for eye indications or intravenously for systemic indications.

Studies in humans were also conducted using UL36/372x4 OMe. In initial safety and pharmokinetic studies (Protocol 132-004) UL36/37 2x4 OMe was given by 2 hour intravenous infusions to 6 normal volunteers each in single doses of 0.125, 0.250 and 0.500 mg/kg. The drug was well tolerated at all doses.

Therefore, chemically modified oligonucleotide, UL36/37 2x4 OMe, possesses each of the four characteristics outlined above, indicating that this oligonucleotide, and likely, those oligonucleotide possessing closely related chemical modifications, i.e. UL36/37 4x4 OMe; UL36/37 3x4 OMe; UL36/37 1x4 OMe; UL36/37 0x4 OMe; UL36/37 4x0 OMe; UL36/37 4x4 OMe (I); UL36/37 2x4 OMe (I); UL36/37 4x0 OMe 3'-Chol; UL36/37 2x4 OMe 3' Choi; UL36/37 4RxO; and UL36/37 4x4 3' Choi, and preferably UL36/37 4x4 OMe; UL36/37 3x4 OMe; UL36/37 2x4 OMe; UL36/37 1x4 Ome; and UL36/37 4x4 3' Choi, are particulary suitable as a potent therapeutic drug for the treatment of HCMV infection.

Moreover, the combination of antiviral activity and surprising and exceptional persistance of the oligonucleotide in tissue as unchanged d g render the optimized oligonucleotides of the invention unlike any other chemically modified oligonucleotide for treatment of CMV.

The modified oligonucleotides of the invention can be prepared by art recognized methods. Oligonucleotides with phosphorothioate linkages can be prepared manually or by an automated synthesizer and then processed using methods well known in the field such as phosphoramidite (reviewed in Agrawal et al. (1992) Trends Biotechnol. 10:152-158, see, e.g., Agrawal et al. (1988) Proc. Natl. Acad. Sci. USA 85:7079-7083) or H-phosphonate (see, e.g., Froelhler (1986) Tetrahedron Lett 27: 5575-5578) chemistry. The synthetic methods described in Bergot et al. (J.Chromatog. (1992) 559:35-42 can also be used. Oligonucleotides with other chemical groups including 2'-O- methyls can be prepared according to known methods (see e.g., Goodchild (1990) Bioconjugate Chem. 2:165-187; Agrawal et al. (Proc. Natl. Acad. Sci. USA (1988) 85:7079-7083); Uhlmann et al. (Chem Rev. (1990) 90:534-583; and Agrawal et al. (Trends Biotechnol. (1992) 10:152-158)).

The present invention further provides therapeutic compositions for treating HCMV infection. The composition includes at least one oligonucleotide of the present invention, along with a physiologically or pharmaceutically acceptable carrier.

As used herein, a "pharmaceutically or physiologically acceptable carrier" includes any and all solvents (including but limited to lactose), dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic

compositions of the invention is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

The oligonucleotides of the invention may also be used to treat HCMV infection in humans. In this method, the pharmaceutical composition is administered once in a therapeutically effective amount or repeatedly in less than therapeutic amounts.

As used herein, the term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical formulation or method that is sufficient to show a meaningful subject or patient benefit, i.e., a reduction in CMV infection, a reduction the symptoms of CMV- related disorders such as pneumonia, hepatitis, gastroenteritis, chorioretinitis, or severe mononucleosis, or a reduction in the expression of proteins which cause or characterize a CMV infection. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.

A "therapeutically effective manner" refers to a route, duration, and frequency of administration of the pharmaceutical formulation which ultimately results in meaningful patient benefit, as described above.

It is contemplated that for systemic administration (e.g. LV. SC, oral, rectal) the dosages of the pharmaceutical compositions administered in the method of the present invention should provide a total dose of about 0.1 to 10.0 mg/kg, preferably about 0.1 to 5.0 mg/kg body weight, and preferably 0.5 to 2.0 mg/kg body weight. When administered systemically, the therapeutic composition is preferably administered at a sufficient dosage to attain a blood level of oligonucleotide from about 0.01 μM to about 10 μM. Preferably, the concentration of oligonucleotide at

the site of aberrant gene expression should be from about 0.01 μM to about 10 μM, and most preferably from about 0.05 μM to about 5 μM.

However, for localized administration, particularly intravitreal injection, much lower concentrations are preferred. The preferrred dosage for intravitreal injection is a total dosage of under 5ug per eye and perferably 0.5-2 ug per eye and preferably 1 -2 ug per eye.

Ultimately, the attending physician will decide the amount of oligonucleotide dmg with which to treat each individual patient. Initially, the attending physician may choose to administer low doses of the oligonucleotide and observe the patient's response. Larger doses of oligonucleotide may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. Alternatively, a single high dose may be administered at the initiation of therapy, followed by maintenance doses containing much lower total dosages. Given the exceptional half life of the optimized oligonucleotide drugs of the invention, low and infrequent maintenance doses are likely all that will be required.

Furthermore, it may be desirable to administer simultaneously or sequentially a therapeutically effective amount of one or more of the therapeutic compositions of the invention as a single treatment episode.

Administration of pharmaceutical compositions in accordance with invention or to practice the method of the present invention can be carried out in a variety of conventional ways, such as by oral ingestion, enteral, rectal, or transdermal administration, inhalation, sublingual administration, or cutaneous, subcutaneous, intramuscular, intraocular, intraperitoneal, or intravenous injection, or any other route of administration known in the art for administrating therapeutic agents, and may be followed by intermittent regimens.

When the composition is to be administered orally, sublingually, or by any non-injectable route, the therapeutic formulation will preferably include a physiologically acceptable carrier, such as an inert diluent or an assimilable edible carrier with which the composition is administered. Suitable formulations that include pharmaceutically acceptable excipients for introducing compounds to the bloodstream by other than injection routes can be found in Remington's Pharmaceutical Sciences (18th ed.) (Genarro, ed. (1990) Mack Publishing Co., Easton, PA). The oligonucleotide and other ingredients may be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the diet of the individual. The therapeutic compositions may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. When the therapeutic composition is administered orally, it may be mixed with other food forms and pharmaceutical ly acceptable flavor enhancers. When the therapeutic composition is administered enterally, they may be introduced in a solid, semi-solid, suspension, or emulsion form and may be compounded with any number of well-known, pharmaceutically acceptable additives. Sustained release oral delivery systems and/or enteric coatings for orally administered dosage forms are also contemplated such as those described in U.S. Patent Nos. 4,704,295, 4,556,552, 4,309,404, and 4,309,406.

When a therapeutically effective amount of composition of the invention is administered by injection, the synthetic oligonucleotide will preferably be in the form of a pyrogen-free, parenterally-acceptable, aqueous solution. The preparation of such parenterally-acceptable solutions, having due regard to ph, isotonicity, stability, and the like, is within the skill in the art. A preferred pharmaceutical composition for injection should contain, in addition to the synthetic oligonucleotide, an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated

Ringer's Injection, or other vehicle as known in the art. The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile. It must be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms, such as bacterial and fungi. The carrier can be a solvent or dispersion medium. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents Prolonged absorption of the injectable therapeutic agents can be brought about by the use of the compositions of agents delaying absorption. Sterile injectable solutions are prepared by incorporating the oligonucleotide in the required amount in the appropriate solvent, followed by filtered sterilization.

The pharmaceutical formulation can be administered in bolus, continuous, or intermittent dosages, or in a combination of continuous and intermittent dosages, as determined by the physician and the degree and/or stage of illness of the patient. The duration of therapy using the pharmaceutical composition of the present invention ill \ a y, depending on the unique characteristics of the oligonucleotide and the particular therapeutic effect to be achieved, the limitations inherent in the art of preparing such a therapeutic formulation for the treatment of humans, the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention, as, for example, described in Goodman and Gilman's The Pharmacological Basis of Therapeutics (8th Ed.) McGraw-Hill, Inc., New York (1993) pp. 62-83.

The oligonucleotides of the invention are also useful as diagnostic probes. Because these oligonucleotides are capable of inhibiting viral replication, they are useful in a diagnostic assay that confirms the presence of HCMV in clinical or experimental samples. The samples are incubated with untreated or oligonucleotide- pretreated cells. The inhibition of growth of HCMV in the treated versus the untreated confirms the presence of HCMV in the sample. Such an assay is useful for detecting CMV contamination as well as infection of individuals.

The following examples illustrate the preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.

EXAMPLE 1 DOT BLOT ASSAY FOR HCMV DNA REPLICATION

HFF cells were seeded in 6 cm dishes at a density of 2 x 10 cells per dish.

Cells were pre-treated with antisense oligonucleotides at the various indicated concentrations in Opti-MEM medium (BRL, Gaithesburg, MD) for up to 15 hr. Growth medium was then removed and cells were washed three times with Dulbecco's phosphate buffered saline to remove any residual oligonucleotide. Cells were incubated with HCMV strain AD 169 (American Type Culture Collection, Rockville, MD Ac. No. ATCC VR-538) or clinical isolates, at an MOI of 0.1 for 1 hr. at 37°C. Cells were washed again and reefed in fresh growth medium containing serial dilutions of antisense oligonucleotide at the same concentrations as preincubation. Infection ws carried out using an MOI of 0.4. At 5-6 days, PI cells were lysed directly on the plate with lysis buffer (0.1 N NaOH, 10 mM EDTA), heated to 95 °C for 10 min, and transferred to ZETA-probe nylon membrane (Bio- Rad, Hercules. CA) by using a dot blot apparatus, hybridized with a P random- primer labelled plasmid containing HCMV EcoRI M fragment according to manufactures instructions. Blots were then exposed to X-ray film for 4-6 hours at

room temperature. Relative band intensities for Southern blots can be calculated using Scan Analysis software (Biosoft, Ferguson, MO).

EXAMPLE 2 INFECTIOUS VIRUS YIELD REDUCTION (PLAQUE) ASSAY

HFF cells were treated with oligonucleotide as previously described for Southern analysis. At 7 days PI supernatants were harvested, serially diluted and used to infect fresh fibroblasts seeded in six well plates at a density of 1 x 10 cells per well. After a 1 hr. incubation, virus was removed and cells were overlaid with 0.4% agarose made in DMEM plus 10% FCS. 14 days PI cells were fixed with 10% formalin and stained with 0.2% methylene blue and vims plaques were counted. Reductions in plaques are reported as the lowest oligonucleotide concentration needed to reduce plaques to 99% of untreated-infected control cells.

EXAMPLE 3 CYTOTOXICITY ASSAYS

Cytotoxicity of oligonucleotides under antiviral assay conditions is evaluated with modified MTT or neutral red assays (Azad et al. (1993) Antimicrob. Ag. and Chemother. 37:1945-1954; Babich et al. (1991) Appl. Environ, Microbiol. 57:2101- 2103; Denzoit et al. (1986) J. Immunol. 89:271-277). HFF cells are treated exactly as described above for the 96-well ELISA immunoassay, including the oligonucleotide pretreatment. Instead of vims infection, cells are mock inoculated with sterile medium only. At the end of the incubation period (4 days of oligonucleotide treatment), 10 μl of MTT (5 mg/ml in PBS) is added directly to the culture medium of each well (100 μl) and cells are incubated for an additional 2 hours. Medium is then removed from each well, and insoluble blue formAzan product is dissolved in acidified isopropanol. The optical density at 540 nm is determined with a BioTex model EL312c microplate reader. Means of triplicate assays are expressed as the percentage of signal resulting from sham-treated cells. A minimal background from wells containing no cells is subtracted prior to any calculations.

Cytotoxicity of the oligonucleotides can also be determined by comparing the incorporation of ^J H-thymidine into cells that have been pretreated with the

oligonucleotides of the invention for 24 hours with those cells that have been untreated. The cells are then pulsed with 1 μCi of H- thymidine (NEN/DuPont) for 4 hours at 37°C After brief cell lysis with 0.4 M NaOH, the lysates are placed on fiberglass filtermats and washed extensively. The dried filters are transferred to scintillation vuils containing 3 ml of scintillant and counted.

EXAMPLE 4 RETINAL UPTAKE OF C-GEM ^® 132 AND MICRO AUTORADIOGRAPHY IN MALE DUTCH BELTED RABBITS AFTER A SINGLE INTRAVITREAL INJUCTION OF C-GEM ^® 132 AT THREE DOSE LEVELS

Methods: Single intravitreal injections were administered to both eyes of rabbits (12/dose at doses of 3.6, 14 and 76 μg of C-GElVi 132. After dosing, two animals per dose per timepoint were anesthetized followed by exsanguination at study weeks 1, 2, 4, 8, 12 and 22). The right eye of one rabbit/group was fixed and stored pending further processing for microautoradiography after the in-life portion of the study has been completed. All remaining eyes from sacrificed animals were dissected, vitreous fluid, retina and the remaining ocular tissues were collected and total radioactix ity measured in the dissected tissues.

The results showed that all dose levels, radioactivity in the vitreous declined gradually from day 8 to day 150.

Equivalents Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention, and are covered by the following claims.

21 SUBSTTTUTE SHEET (RULE 26)