SINGLE NUCLEOTIDE POLYMORPHISMS ON THE IRAK-M GENE, RELATED METHODS, USES AND KIT FOR THE DIAGNOSIS OF

ALLERGIC ASTHMA.

_* * _* The present invention concerns the identification of single nucleotide polymorphisms in IRAK-M gene, methods, uses and kit thereof for allergic Asthma diagnosis.

Asthma is a chronic inflammatory multifactorial disease of epithelium and bronchial sub-mucosa irreversibly leading to anatomical changes in bronchi resulting in permanent damage of the pulmonary function (Cohn L. et al., 2004). Prevalence of Asthma in developed countries is approximately 5 % with increasing incidence and associated mortality (Masoli M. et al., 2004) and this generated an profound interest in order to discover etiologic factors of this disease. Although the role of immune system and specific T-helper cell sub- populations in Asthma physiopathology has been clearly explained, the identification of genes involved in this disease is at an initial stage. Likewise in all the multifactorial diseases, it has been proposed that various genetic loci contribute to allergic Asthma and various gene variants have been recently identified (Ober C. et al., 2006; Allen M. et al., 2003; Laitinene T. et al., 2004; Nicolae D. et al., 2005; Noguchi and. et al., 2005; Van Eerdewegh P. et al., 2002). For many of these genes, however, up to now the connection with Asthma physiopathology is hypothetical and none appears to be directly involved in the activation of inflammatory processes of airways or allergy.

Results replication for independent populations up to now has been difficult because of Asthma heterogeneity, extreme variability in the disease expression, presence of phenocopies and large environmental factor variability. An approach in order to reduce the multifactorial feature heterogeneity in genetic researches is based on the study of founding populations, which from few initial members constituted large modern populations without appreciable immigration. Among these Sardinian

population is most promising (Terwilliger J. D et al., 1998; Kruglyak L.,

1999; Laitinen T., 2002; Heutink P. et al., 2002) and, in fact, monogenic diseases like D-Thalassemia, Wilson's disease and APECED, as well as complex diseases as Type I Diabetes show limited heterogeneity of pathogenetic alleles (Cao To. et al., 1989; Loudianos et al., 1999; Rosatelli M. C et al., 1998; Cucca F. et al., 1993). Moreover, the population of the island is largely subjected to same climate and alimentary habits resulting in a reduction of non genetic variability sources.

In the light of above it is apparent the importance to identify the genetic components involved in Asthma, in order a diagnosis and possibly specific therapy to be formulated.

For this purpose the authors have carried out linkage and association studies on Sardinian asthmatic families, focusing on the chromosome region 12q 13-24 previously involved in the Asthma aetiology in various populations (Malerba G. et al., 2000; Raby B.A et al., 2003). These studies allowed to establish that gene IRAK-M variants [already known as negative regulator of Toll-like/IL-1 receptor signal pathway and critical regulator of NF-kB and inflammation (Wesche H. et al., 1999; Kobayashi K. et al., 2002)] are associated with early onset persistent Asthma both in Sardinian founding population and independent population coming from continental Italy, which as other Caucasian populations is genetically different from Sardinian one. The authors of the invention have obtained data suggesting the existence of direct link between the immune system hyper-activation and allergic disease development and indicating that IRAK-M could represent a new target both for the development of therapies against Asthma and kit and diagnostic tests to define the predisposition to the allergic Asthma. This gene, being involved in the regulation of native immune system and consequent activation of type T helper Vi adaptive response, is directly connected with physiopathology of this chronic inflammatory disease.

Although previous studies carried out in a Japanese population have not demonstrated the involvement of this gene in Asthma (Nakashima K. et al., 2006), the study on Sardinian isolated population

together with sample stratification based on the disease onset age

(threshold 13 years) allowed the authors IRAK-M gene variants or predisposing and protecting haplotypes to be identified.

Finally the present study pointed out the presence of mutations potentially inactivating the function of IRAK-M protein in some of studied

Sardinian asthmatic subjects and the high expression of this gene in lung alveolar and bronchial epithelial cells, which result up to now has not been reported in literature.

In particular the authors of the present invention have identified single nucleotide polymorphism (SNP) at level of lnterleukin-1 receptor associated kinase-M (IRAK-M) gene correlated to Asthma predisposition, by characterising a risk haplotype (in the follow indicated as A haplotype) and a protecting haplotype (in the follow indicated B haplotype) defined by 6 SNP (see Table 1). Three of these SNPs proved sufficient to identify protecting and predisposing haplotypes (Table 2B). Risk haplotype is associated to early onset and persistent Asthma.

Further the authors have identified various mutations (mis-sense, nonsense, etc.) at level of the coding region of IRAK-M gene (see Table 4) resulting from nucleotide variations, at least two of which (c227G>A and IVS3+1G>T) are co-inherited with risk A haplotype and associated with early onset persistent Asthma.

Therefore isolated nucleotide sequences localised within a polymorphic region of IRAK-M (Gl: 6005791) (allelic variants) are specific objects of the present invention, wherein said variants comprise or consist of one o more single nucleotide polymorphisms (SNP) selected from rs1882200, rs11465955, rs2293657, rs1821777, rs1624395 and rs1370128, wherein rs1882200 is C or T, rs11465955 is C or T, rs2293657 A or T, rs1821777 is T or A, rs1624395 is G or A, rs1370128 is C or T; or complementary sequences thereto to be used in medical-diagnostic field of allergic Asthma, as claimed in claim 1.

Further preferred embodiments are specified in subsequent dependent claims.

Particularly, according to a preferred embodiment of the present invention, said allelic variants comprise at least the following three single nucleotide (SNP) polymorphisms: rs11465955, rs1624395 and rs1370128 (Table 2B). In a preferred embodiment of the present invention, when rs11465955 is C, rs1624395 is G and rs1370128 is C, the allelic variant constitutes CGC protective haplotype (haplotype B) for allergic Asthma.

According to a further preferred embodiment of the invention, when rs11465955 is T, rs1624395 is A and rs 1370128 is T, the allelic variant is TAT risk haplotype (haplotype To) for allergic Asthma.

According to other embodiments of the invention when rs11465955 is C, rs1624395 is G and rs1370128 is T, the allelic variant is CGT haplotype (haplotype D) or when rs11465955 is C, rs1624395 is A and rs1370128 is T, the allelic variant is CAT haplotype (haplotype C), both defined as not allergic Asthma associated rare haplotypes.

In a further embodiment the nucleotide sequence of gene IRAK-M according to the invention comprises two mutations: a G>A substitution in 227 nucleotide position at level of gene exon 2, and a G>T substitution in position +1 of splicing donor site of gene 3 exon. In a particular embodiment of the invention the nucleotide sequences as above defined can be labelled with fluorescent substances, biotin, radioisotopes.

The invention refers to the use of at least one of the nucleotide sequences or a complementary sequence thereto as above defined, for the preparation of markers (i.e oligonucleotide probes) for the diagnosis and/or prognosis of allergic Asthma. Preferably, nucleotide sequences used to this purpose are sequences comprising risk A or protecting B haplotype, and/or respective mutated gene sequences (c227G>A and IVS3+1G>T), as above defined. The invention concerns a diagnostic kit comprising oligonucleotide probes and/or primer pairs suitable to hybridize to IRAK-M nucleotide sequence comprising one of allelic variants as above defined or portions thereof, (i.e., risk A, protecting B hapotype, c227G>A and IVS3+1G>T

mutated sequences). Primer pairs of kit according to the invention consist of the following oligonucleotide sequences:

SNP Forward primer Reverse primer

5TAATGTTGCATGGGAAT 5 'ATAAATG ATTATTGTGTTTATT rs11465955 GAAACT (SEQ ID NO:1) GGG (SEQ ID NO:2)

5'GAACATGGAGATACCTTGGA rs 1624395 5TTCTCCTCTTAGAATGTA G

CTATC(SEQ ID NO:3) (SEQ ID NO:4)

5'GAACATGGAGATACCTTGGA rs1370128 5TTCTCCTCTTAGAATGTA G

CTATC (SEQ ID NO:3) (SEQ ID NO:4)

SNP WT Probe Mutated probe

5'AAAGTGCCGGCAAATCC 5'AAAGTGCCAGCAAATCCAGC rs11465955 AGC (SEQ ID NO:5) (SEQ ID NO:6)

5'GCACAGAGGAGGGAAT 5'GCACAGAGGAGGAAATGATA rs1624395 GATAACT (SEQ ID NO:7) ACTT (SEQ ID NO:8) δ'GAACAAGGCACCCAGAA δTGAACAAGGCACTCAGAACAT rs1370128 CATTTG (SEQ ID NO: 9) TTG (SEQ ID NO: 10)

It is a further object of the present invention a kit for the detection of mutations in IRAK-M gene comprising the following primer pairs suitable to amplify 1-12 exons of said gene as below:

Exon Forward primer Reverse primer

5TAATGACACCGCTAGCCGT 5'AACAGCGCAGAGCTCTC C CGA

1a

(SEQ ID NO:11) (SEQ ID NO:12)

5'CAGGGGCATCTCGGGCGA 5'ATACCCAAAATTCTTTGA

1 b (SEQ ID NO:13) AAGAGA (SEQ ID NO: 14)

5TAATGACACCGCTAGCCGT 5'ATACCCAAAATTCTTTGA C AAGAGA (SEQ ID NO: 16)

(SEQ ID NO:15)

5'GAAAGTTAAAGTTATAAATA 5'ATATGTTGTATAAGTTAG 2 AGAGG (SEQ ID NO:17) GTGATAA(SEQ ID NO:18)

δ'TAATGTTGCATGGGAATGAA 5'ATAAATGATTATTGTGTTT 3,4 ACT (SEQ ID NO: 19) ATTGGG (SEQ ID NO:20)

5'AACTAGATCCAAGTAAATGT 5'TTTCAATGTTGATGAAAA GCA(SEQ ID NO:21) ATGACAT (SEQ ID NO:22)

6 δ'CATCTAATTTAGGGAGACTA δ'TTCGAAGTTCTAACATCC

TAG (SEQ ID NO:23) AACC (SEQ ID NO:24)

7 5'ATATTCCGCTTTAGGCCTAT 5'GAAATTAATCCAAGAAGT

TC (SEQ ID NO:25) ACTGC (SEQ ID NO:26)

8 5'GTATTGAGTATTTTCGTTGT 5'CTTTTTGGCAACATACAT

CTAT (SEQ ID NO:27) ATAGC (SEQ ID NO:28) δ'GAAGAAGGTGAGTTTATAGT δ'AAATGACCTCTAACAGAG

9, 10, 11 ATG (SEQ ID NO:29) TACC (SEQ ID NO:30)

5'AGAGCATGCCGTAGCTA

12 5'CTCAAAATAAAGGGCGTTAG AGG

CT (SEQ ID NO:31) (SEQ ID NO:32)

WT Probe Mutated Probe

5'AAAGTGCCGGCAAATCCAGC 5'AAAGTGCCAGCAAATCCAGC

(SEQ ID NO:5) (SEQ ID NO:6) δ'GCACAGAGGAGGGAATGATAA δ'GCACAGAGGAGGAAATGATAAC

CT TT

(SEQ ID NO:7) (SEQ ID NO:8) δ'GAACAAGGCACCCAGAACATTT δ'TGAACAAGGCACTCAGAACATTT

G G

(SEQ ID NO:9) (SEQ ID NO:10)

As previously mentioned, according to said inventive diagnostic kit, the primer pairs can labelled by choice with fluorescent substances, biotin, radioisotopes.

Further the present invention refers to a method for the determination of the identity of IRAK-M gene allelic variant in a nucleic acid sample. According to the method of the invention, the determination of the allelic variant identity is carried out by means PCR amplification using primer pairs and successive hybridisation with oligonucleotide specific probes (Dot Blot, Reverse Dot Blot; see above reported Table for primer pairs).

Amino acid sequences encoded by nucleotide sequences comprising identified mutations: c227G>A and IVS3+1G>T are a further object of the present invention. These amino acid sequences correspond to truncated forms of IRAK-M protein lacking C-terminal domain. The invention refers also to the use of these amino acid sequences for the production of monoclonal or polyclonal antibodies to be used for the diagnosis of allergic Asthma and particularly the production of a monoclonal or polyclonal antibody or fragments thereof suitable to recognise and bind selectively the N-terminal domain of IRAK-M encoded protein, optionally conjugated to an agent selected from the group consisting of fluorochrome, radioisotope.

Further the invention refers to a monoclonal or polyclonal antibody or fragment thereof suitable to recognise and bind selectively an epitope comprising or consisting of amino acid sequence IEKYVDQGKSTRE (SEQ ID NO: 33) belonging to N-terminal domain of IRAK-M protein. Being currently available only antibody recognising the C-terminal portion of the molecule these antibodies offers the advantage to allow the identification for diagnostic purposes of possible truncated forms of IRAK-M protein in cells from asthma suffering patients. These antibodies optionally can be conjugated to a selected agent from the group consisting of fluorochrome, radioisotope.

The authors of the present invention have selected an epitope belonging to an N-terminal domain of IRAK-M protein (conserved in human and rat) comprising or consisting of the following amino acid sequence: IEKYVDQGKSTRE (SEQ ID NO: 33). This epitope can be used as a marker for the diagnosis and/or prognosis of allergic Asthma or the preparation of markers for the diagnosis and/or prognosis of allergic Asthma, i.e polyclonal or monoclonal antibodies.

Further the invention refers to a diagnostic marker comprising or consisting of an epitope belonging to N-terminal domain of IRAK-M protein (conserved in human and rat) comprising or consisting of the following amino acid sequence: IEKYVDQGKSTRE (SEQ ID NO: 33).

Another object of the present invention is the production of prokaryotic or eukaryotic expression vectors comprising the full length nucleotide sequence of IRAK-M gene or portions thereof (as above defined). The object of this invention is the transfection using said vectors of both eukaryiotic and prokaryiotic host cells. Finally, the invention contemplates also the generation of murine transgenic animals containing heterologous form of at least one of IRAK-M functional or not alleles herein described. These transgenic animals can be used both as experimental model for studying the effect of specific allele variations of IRAK-M, including mutations (as those listed in Table 8, characterised in the present study) and screening of drugs for allergic Asthma treatment.

The present invention now will be described by an illustrative but not limitative way, according to preferred embodiments thereof, with particular reference to enclosed drawings, wherein: figure 1 shows the identification of IRAK-M as Asthma susceptibility gene; panel A shows plots for "linkage multipoint" analysis of chromosome 12q13-24 for families with Sardinian asthmatic sibling pairs; values of LOD score are shown for whole sample (O) ₁ for early onset age concordant affected siblings (13 < years) (■), and affected siblings with at least a patient with onset age > 13 years (A); panel B shows the genomic region within confidence range (I. C.) of 95 % gene localisation; moreover Asthma candidate genes, for which the mutational analysis has been

carried out, and microsatellite markers present in this region and used in linkage analysis, are reported; panel B shows disequilibrium linkage (LD) within IRAK-M and flanking genomic region; moreover are indicated D' values for marker pairs depending on LD value (from dark = D' > 0,8 to light = D'< 0,3) and SNPs used in TDT analysis among which those in block letters (rs1821777, rs2293657, rs1882200, rs1168770, rs1177578, rs10878378) keep significance also after correction for multiple tests; figure 2 shows the alignment of IRAKI , IRAK4, IRAK-M, IRAK2 human sequences used for the selection of IEKYVDQGKSGTRE epitope (SEQ ID NO: 33) conserved in human and rat; figure 3 shows the alignment of IRAK4, IRAK-M, IRAKI , IRAK2 murine sequences used for the selection of IEKYVDQGKSGTRE epitope (SEQ ID NO: 33) conserved in human and rat. EXAMPLE 1 : Study on relationship between IRAK-M gene and allergic Asthma pathogenesis RESULTS Linkage analysis on 12q 13-24 chromosome

Initial analysis in order to find Asthma susceptibility genes within candidate region of 12q 13-24 chromosome was carried out on 121 affected sibling pairs (sib-pairs: sibs) belonging to 100 families from entire Island provinces. Figure 1 shows, using not parametric linkage analysis, a linkage suggestive evidence in correspondence of D12S75 marker. In order to reduce not genetic possible variation causes and increase statistical power to identify the linkage, we repeated the analysis after sample stratification based on asthma onset age, using a 13 year threshold value. The linkage analysis in this sample proved that the 12q13-q24 region is significantly associated to Asthma in a family subgroup comprising exclusively early onset cases, with LOD score of 3.56 (p = 5,2 x 10 ^"5 ) in the region between D12S75 and D12S335 markers. On the contrary, we did not find linkage evidence in families comprising at least a patient with >13 year onset age (Figure 1A). The analysis with GeneFinder program incorporating onset age as a co-variate, indicated that the region, wherein presumably asthma predisposition gene(s) is

localised, is comprised in 10,5 cM range distal from D12S75 marker (p =

0.001) (Figure 1A). Stratification reliability has been also demonstrated from the trend of plot of maximum LOD scores as cumulative function of various onset age ranges, considering concordant affected siblings (from 1 to 57 years). Highest LOD value was observed with the inclusion of patients with 13 year onset age and high values are maintained until the addition of cases with 21 year onset age (not shown results). These observations indicate that the families mainly contributing to the linkage in this region are Asthma and early onset concordant. IRAK-M as candidate gene within maximum LOD score region.

10,5 cM region corresponding to 95 % confidence range contains various candidate genes previously involved in Asthma, among which Interferon-γ, lnterleukin-22 and lnterleukin-26 cytokine genes (Figure 1 B) (Goris A. et al _M 2001 ; Whittington H.A et al., 2004). Sequence analyses of all exons and adjacent intron regions of these genes in linkage more informative patients proved no associated variation (result not shown). Based on function and possible importance for asthma, therefore we focused our attention on IRAK-M, the other known gene localised within linkage peak. In order to estimate the association of this gene with Asthma we studied our sample with Transmission Disequilibrium Test (TDT) using 22 SNPs distributed within the chromosome region around IRAK-M gene in 294 asthmatic families. Using the whole sample we noticed that three intra-gene SNPs demonstrated a remarkable association with Asthma, which on the other hand became weak after the correction for multiple tests. In order to increase the test statistical power we repeated the analysis after the stratification of the families based on Asthma onset age, as previously described. Thus we noticed high association only in a patient subgroup with persistent early onset Asthma and we identified 7 significant SNPs also after correction for multiple tests (Figure 1C). Four of these SNPs are localised within IRAK-M gene, while 3 are in upstream region. Apparent association of these three SNPs with Asthma is however consequence of linkage disequilibrium (LD) and in fact in this region we

found D' > 0,70, defining a single 138 kb haplotype block containing full- length IRAK-M gene. (Figure 1C). In this range we also identified 4 shared haplotypes with frequency >5%, defined from 6 SNPs, so-called tag SNPs, capturing the most gene variations in this genome area as shown in the following Table 1.

Table 1 : Frequency of haplotypes and TDT for families with persistent early onset Asthma. Four haplotypes (A, B, C, D) with frequency > 0,05 are identify from 6 SNPs. T:U, number of minor alleles inherited/not inherited. P value has been calculated using "likelihood ratio test". Empirical P value has been calculated after 10 ⁵ permutations.

Among these, haplotype A preferably is inherited to persistent early Asthma patients (predisposing haplotype), while haplotype B preferentially is not inherited (protecting haplotype). The association of IRAK-M with Asthma has been also confirmed through a case-control analysis using as cases a subgroup comprising 139 subjects with persistent early onset asthma and 460 healthy controls. Six SNPs within IRAK-M gene and including 4 previously described SNPs maintain significant association values after Bonferroni correction as shown in Table 2A. Three SNPs proved to be sufficient in order to identify protecting and predisposing haplotypes as shown in Table 2B. Table 2: A. SNPs case-control analysis within IRAK-M gene in Sardinian population. Only significant SNPs after Bonferroni correction are shown. Cases: 139 persistent early onset Asthma subjects; controls: 460 healthy subjects. P, p values obtained using logistic regression. B. Association analysis of haplotypes in case-control study. The frequency of the

haplotypes defined from 3 SNP tags (rs11465955, rs1624395 and rs1370128) is indicated. A

B

OR, odds ratio corrected for sex and age. I. C, confidence range. * reference haplotype.

TAT risk haplotype is associated to persistent early onset Asthma, while wild-type CGC haplotype is statistically less frequent in cases than controls.

In order to estimate whether linkage peak on 12q13-24 chromosome could be explained due to the presence of risk haplotype of

IRAK-M gene we carried out an independent linkage analysis on a sample consisting of 132 asthma affected families, using markers localised in the initial linkage peak. This analysis showed that the maximum LOD score value of this sample decreases dramatically when families comprising affected sibling pairs sharing risk haplotype are eliminated, thus confirming that linkage signal depends on risk haplotype within IRAK-M (not shown). Result duplication in Italian independent population.

In order to confirm the association of IRAK-M with Asthma, we carried out a case-control analysis in population coming from continental Italy wherein linkage on 12q chromosome has been previously evidenced (Malerba G. et al., 2000). This population, like other Caucasian ones, is genetically distant from Sardinian (Lampis R. et al., 2000). 6 SNPs defining A predisposing and B protecting haplotypes in 67 asthmatic 18 year older subjects and 278 healthy controls have been evaluated. Results showed remarkable association for 2 SNPs within IRAK-M also after Bonferroni correction, while for third SNP a positive association trend, as shown in following Table 3, was observed.

Table 3: Analysis of association in an Italian sample using 6 SNP tags within LD region (see Figure 1C). Cases, 67 asthmatic subjects; controls, 278 healthy subjects. P, p value using exact Fisher test. Values in block letter maintain significance after Bonferroni correction.

OR, odds ratio. I.C, confidence range

Genotype analysis allowed these results to be validated which are compatible with an association recessive model with markers within IRAK-

M (not shown results).

Mutational analysis of IRAK-M gene

IRAK-M gene consists of 12 exons distributed over a 60 Kb region in 12q14.3 and encodes a 596 amino acid protein containing a "death" domain at N-terminal, followed by a central kinase domain and unique sequence at C-terminal (Janssens S. et al., 2003).

In order to verify whether mutations in the gene encoding sequence were involved in Sardinian population Asthma, we sequenced all exons and adjacent intron regions of IRAK-M in 121 probands belonging to 294 families under study. We identified 7 nucleotide variations in 10 different families (A-L) as shown in following Table 4. Table 4: Mutations identified in IRAK-M gene encoding sequence in Sardinian asthmatic subjects. +/+ predisposing haplotype (TAT) in omozygosis; +/- predisposing haplotype in eterozygosis; -/- absence of predisposing haplotype; presence + or absence -. Asthma onset age is indicated as <13 years (ID A, B, C, F, G, I Families) or >13 years (ID D, E, H, L Families).

Mut.: mutation type; Ns: nonsense; sp. site: splicing site; Ms: mis-sense; Ex.: exon; Aa subst: Amino acid substitution; Nucleot. Posit.: nucleotide position; ID: family identification.

Among these, two interesting mutations have been found in A and B families and give origin, respectively, to a stop codon (W76X) in death domain 76 position resulting in "nonsense-mediated mRNA decay (NMD)" (Mendell JT. et al., 2001), and G-> T substitution in +1 position of splicing donor site which can generate aberrant truncated protein. Both these mutations are co-inherited together with risk (TAT) haplotype and associated with early onset Asthma. Further 5 mis-sense mutations would result in certain amino acid substitutions severely modifying the structure of the protein encoded by IRAK-M, although the effect on the function is unknown. None of described mutations has been found in remaining asthmatics families neither in healthy controls. Expression studies

IRAK-M gene is highly expressed in monocytic cells while low expression levels have been found in other tissues (Wesche H. et al., 1999). We verified the expression of IRAK-M in lung biopsies from healthy donors by means of immunohistochemical analysis and observed that both alveolar macrophages and lung epithelial cells, among which alveolar type Il pneumocytes express high amounts of this protein (data not

shown). Type Il alveolar pneumocytes are mainly involved in surfactant protein production in lungs and play a key role in pulmonary function and immune defences of this organ and could be involved in allergen induced changes of airways. The expression of this protein in these cellular types make the same a good candidate for extended role in lung functionality. MATERIALS AND METHODS Sample collection

In order to collect a large number of asthmatic patients necessary for this study, a consortium consisting of more than 30 groups distributed through all the Sardinia was formed. The patients have been recruited using archive information and during clinical assessments. Families comprising two or three affected siblings have been collected during a period of 4 years (1996-99), mainly in paediatric and pneumological Sardinia institutions. All collected patients satisfy the following criteria: Sardinian origin from at least three generations; > six year old in order to avoid phenocopies due to frequent viral infections and related stenosis of respiratory tract in small children. During the collection any subject has been interviewed, the disease has been assessed through medical examination, the authorisation to acquire personal medical data for research purposes has been required and finally a blood sample has been drawn. Every study participant signed an informed consent and all the used methods have been approved by an ethical committee.

Asthma has been diagnosed by a pneumologist according to the American Thoracic Society criteria defining the same as "a variable obstruction of aerial flow proved through variations of FEV1 or peak of the spontaneous expiratory flow to >20% or >15% after drug assumption" and requires the presence of chronic symptoms like dyspnoea (WHO, 1995). The pulmonary functionality has been studied through spirometry: forced expiratory volume during the first second was expressed in litre/min (FEV1): bronchial hyperactivity (BHR) was measured in a patient subgroup through metacoline reactivity as previously shown. A physician administered a questionnaire in order to acquire the clinical history and classify the Asthma in severity levels according to WHO guidelines (Global

Initiative for Asthma). The questionnaire contained various questions about birth place and date of family every member for three generations; detailed allergological anamnesis with particular reference to symptoms, disease onset age, genetic or chronic presence of other syndromes or diseases, ages and death cause of the family members, smoking habits or, polluting or passive smoking exposure, environmental prophylaxis for dust acari. The use of drugs against Asthma and other medicines has been also recorded. In our study we included only atopic asthmatic patients while asthmatics without atopy evidence were excluded. Atopy has been determined using prick tests for common inhalant allergens (Dermatophagoides Pteronissinus, D. Farinae, graminacee, European Olea, Parietaria Officinalis, Compositae, Candida Albicans, Cladosporium Herbarum, Aspergillus Fumigatus, Penicillium Notatum, dog hair, cat hair) as previously described. In order to verify the Asthma persistence, patients with early onset and age lower than 18 years at time of first visit and/or 18 year old at December 2003, were contacted by telephone and interviewed by a doctor about symptoms persistence and severity and drug use against Asthma during previous year. Replication sample has been previously described (Malerba G. et al., 2000) and includes atopic asthmatic subjects for which Asthma has been diagnosed after 18 year age. Genomic DNA extraction

The genomic DNA was extracted from a peripheral blood leucocytes samples in EDTA using so-called salting-out method. DNA has been precipitated using iso-propanol, 70 % ethanol washed, re-suspended in TE buffer and conserved at -20°C until the analysis time. Following the concentration determination, DNA has been diluted (final concentration 10 ng/μl) in order to carry out PCR. Optimisation of DNA amplification PCR reaction was carried out in 13 Dl volume using 25 Dg of genomic DNA. PCR conditions have been optimised as below: 10 mM Tris-HCI (pH 8.3), 50 mM KCI, 1.5-3 mM MgCI ₂ , 200 μM dNTP, 0,4 μM of each primer and final concentration of 0.5 units AmpliTaq Gold or Taq

DNA polymerase (Perkin-Elmer/Applied Biosystems). PCR reactions have been carried out by means of 96 or 384 well plates using a GeneAmp PCR System 9700 thermocycler (Cycler (Perkin Elmer/Applied Biosystems). Amplification conditions were as below: 10 min. initial denaturation at 94 ⁰ C, followed by 30 sec 35 cycles at 94°C, 30 sec at 55- 62 ⁰ C (depending on the primer), and 45 sec at 72°C; final elongation 10 min. at 72°C. Negative control (no DNA) was included in all the reactions in order to verify the contaminant presence. Amplification products have been evaluated using 2 % agarose gel. Genotyping

Total genomic DNA is used for both microsatellites and Single nucleotide polymorphism (SNP) genotyping. Microsatellite Markers were selected from Marshfield Center for Medical Genetics (http://research.marshfieldclinic.org/genetics/), Genome Database (http://gdb.mirror.edu.cn), Ensembl Genome Browser

(http://www.ensembl.org) o using analysis of interest clones. Genotyping of microsatellite markers has been carried out using fluorescence based methodologies with the use of the MegaBACE 1000 (Amersham Bioscience) and genotypes have been evaluated using MegaBACE™ Genetic Profiler v1.5 software program. Each primer of every pair has been labelled at 5' with TET, HEX or 6-FAM fluorescent dyes. Alleles have been measured in comparison to GENESCANθ400 HD [ROX] internal marker (Perkin-Elmer/Applied Biosystems Division).

SNP markers have been selected from dbSNP (www.ncbi.nlm.nih.gov), TSC-the SNP website Consortium (http://snp.cshl.org) and Ensembl Genome Browser. SNP genotyping has been carried out using dot-blot analysis of amplified DNA by means of sequence-specific oligonucleotide probes. All the genotypes were checked in order to confirm mendelian inheritance compatibility. Analysis of mutations and sequence

All the sequence reactions, including those of all the exons and regions between intron/exon, have been carried out and checked bidirectionally using ABI PRISM® BigDye® methodology, BigDye®

Terminator v3.1 Cycle sequence kit (Applied Biosystems Division, Perkin-

Elmer) according to supplier instructions, using automated sequencer (ABI PRISM 3100 Sequencer). Reactions have been visualised using DNA Genetic Analyser software program (ABI PRISM®3100 Genetic Analyser Data Collection Software Biosystems, Foster City, CA). Sequences have been aligned and compared to consensus sequence obtained from human genome database (http://genome.ucsc.edu; http://www.ncbi.nlm.nih.gov; reference sequence: NC_OOOO12.1O, Gl: 8916119). Statistical Analysis Allele sizes of microsatellite markers have been transformed in numbered alleles using GAS program (ver. 2.0) (http://users.ox.ac.uk/~ayoung/gas.html). "Linkage multipoint" analysis of Asthma phenotype has been carried out using maximum-likelihood estimate of descendent allele sharing (IBD) (by inheritance), carried out by means of GENEHUNTER (ver. 2.1) (Kruglyak L. et al., 1996) software program; LOD score values have been calculated using possible triangle method and no assumption has been made with reference to inheritance model. More than two siblings have been considered all "independent pairs". LOD score values have been transformed in P-values, as reported by Nyholt D. R. et al., 2000. Microsatellite order and genetic distance between markers used in linkage multipoint analysis have been obtained using CRIMAP (version 2.4), after physical position checking carried out by means of Ensembl genome browser (http://www.ensembl.org). In order to increase the localisation accuracy of susceptibility genes and obtain the confidence range (I. C.) for gene(s) position on chromosome 12 we used Genefinder software program (Liang K.Y et al., 2001 ; Glidden D.V et al., 2003), http://www.biostat.jhsph.edu/biostat/ research/genefinder.shtml, Biostatistics Department, Johns Hopkins University). This program applies generalised estimate equations (GEE) in order to estimate the position of susceptibility genes based on IBD sharing of multiple markers in affected sibling pairs and can incorporate co-variate information as onset age for affected sibling pairs.

SNP association analysis with Asthma phenotype has been performed with GENEHUNTER software program (ver. 2.1) (Kruglyak et al., supra), implementing classical Transmission Disequilibrium Test (TDT) (Spielman R. S et al., 1993). In order to verify the significance of TDT results, we applied a permutation test using same given genotypes of our sample and each group of permuted data has been generated by randomly assigning transmitted and not transmitted alleles.

In order to verify the structure of LD blocks and identify tag SNPs and haplotypes distribution within IRAK-M gene and flanking genomic region, we used Haploview (Barrett J. C et al., 2005, http://www.broad.mit.edu/personal/jcbarret/haploviewWhitehea d/MIT Centre for Genome Research).

To verify the transmission frequency of haplotypes from the parents to affected children we used UNPHASED program (Dudbridge F., 2003), using ruotine TDTPHASE (http://www.mrc- bsu.cam.ac.uk/personal/frank/software/unphased/, MRC Biostatistics

Unit).

In case-control studies of Sardinian subjects, it has been used a logistic regression analysis to calculate "odd ratios", 95 % confidence ranges and corresponding P values for all analysed SNPs, controlling for age and sex. P values were corrected for multiple tests using Bonferroni correction, thus maintaining 0.05 total error threshold.

Moreover an analysis using THESIAS program (Tregouet D.A et al., 2004) to estimate the effects on disease of the haplotypes adjusted based on covariates and test if these effects are significantly different than zero, has been carried out. THESIAS has been used also in order to test the deviation from risk haplotype additive effect through a test based on the probability relationship.

For Italian subjects the different distribution between cases and controls of the genotype and allele frequencies has been estimated by means of Fisher exact test.

All the markers have been tested for Hardy-Weinberg equilibrium using χ ² test.

lmmunohistochemistry

10 % PBS buffered formalin fixed and paraffin included lung biopsies have been cut at 5 Dm thickness and treated for immunohistochemical analysis according to standard techniques using following antibodies: anti-l RAK-M polyclonal rabbit serum (Cell Signaling); anti-TTF1 monoclonal antibody (Dako). Peroxidase staining has been carried out with biotin/streptavidin system (Dako). For nuclei contra- staining hematoxylin has been used. Leica digital camera has been used to photography. EXAMPLE 2: Construction of kit diagnostic to test the Asthma susceptibility and identify mutations

The first step for the development of the diagnostic assay which is the object of the present invention comprises the identification of the relationship between given genetic alteration and Asthma phenotype. As previously described the authors have defined TAT risk and CGC protecting haplotypes, respectively, showing highly significant relationship with pathology under investigation. These results have been also proved for another independent population.

The selection of the method to be used for the production of diagnostic kit is based on currently used various techniques for SNP analysis.

The most part are based on biochemical reactions using various methods for the test execution and mainly for the allelic variant detection. The assay to be used is based on Reverse Dot Blot technique. This technique comprises a multiple polymer chain reaction (PCR) suitable to amplify the genomic regions containing three SNPs characterising said haplotypes for each subject. Then an allele-specific hybridization among PCR products and molecular oligonucleotide probes complementary to normal and mutated sequences is carried out. AIIeIe- specific probes bearing 5 ¹ amino group are blotted stably on negatively charged nylon membrane. After hybridization of probes and dUTP biotin labelled amplified DNA, a colorimetric, using biotin-streptavidin-alkaline phosphatase type reaction or chemiluminescent detection is carried out.

Kit contains three primer pairs necessary in order to amplify the genomic regions comprising haplotype constituting SNPs and three oligonucleotide molecular probe pairs complementary to normal or mutated sequences bearing a 5' amino group.

On the other hand in order to detect frequent mutations we will use a kit comprising primer pairs amplifying genomic regions comprising subject mutations and oligonucleotides complementary to normal and mutated sequences to be labelled using radioisotopes or specific fluorochromes. According to this method polymerase reaction products of each subject are denatured, blotted on nylon membrane or solid miniaturised supports, and hybridised using labelled oligonucleotides. Primer to be used

To analyse gene IRAK-M polymorphisms primers reported in the following Table 5 have been used, each being able to amplify one of 12 gene exons and therefore suitable for diagnostic kit to detect mutation type (see Table 4 for the mutations). Table 5

Primers used to carry out PCR for SNP intra-gene analysis are reported in the following Table 6. Table 6

Probes for hybridisation analyses to detect B protecting (wt probe) and A risk (mutated probe) haplotypes are reported in the following Table 7. Table 7

In order to carry out a real-Time PCR (TaqMan analysis) for IRAK- M expression the following primers and TaqMan probe reported in Table 8 can be used. This analysis is applied in tissue studies as a result of stimulation with allergenes, type LPS, activating signal cascade involving IRAK-M. Table 8

TaqMan probe

Preparation of antibodies for immunodiagnostic kit

The authors of the invention selected immunogenic epitope belonging to IRAK-M N-terminal domain conserved in human and rat.

Starting from this epitope highly interesting polyclonal (i.e. rabbit polyclonal serum) and monoclonal antibodies for diagnostic uses, being able to recognise truncated forms of IRAK-M protein are produced, being commercially available only antibodies recognising C-terminal but not N- terminal end of the molecule

Selected epitope has following amino acidic sequence IEKYVDQGKSGTRE (aa 58-71) (SEQ ID NO: 33) and is the best immunogenic peptide. This peptide has been selected since the absence of latter sequence in other members of both human and murine IRAK protein family (IRAK-1, 2 and 4) (see Figures 2 and 3) has been proved.

This peptide, belonging to IRAK-M protein conserved domain (death- domain), has a beta-turn structure suggesting that it is found on molecule surface and thus is highly immunogenic.

BIBLIOGRAPHY - L. Cohn, J. A. Elias, G. L. Chupp, Annu. Rev. Immunol., 22, 789 (2004).

- M. Masoli, D. Fabian, S. Holt, R. Beasley, global initiative for Asthma,

Allergy, 59, 469 (2004).

- C. Ober, S. Hoffjan, Genes Immun., 7, 95 (2006).

- M. Allen et al., Nat. Genet, 35, 258 (2003). - T. Laitinen et al., Science, 304, 300 (2004).

- D. Nicolae et al., Am J Hum Genet, 76, 349 (2005).

- E. Noguchi et al., Am. J. Respir. Grit. Care Med., 172, 183 (2005).

- P. Van Eerdewegh et al., Nature, 418, 426 (2002). - Y. Zhang et al., Nat Genet, 34, 181 (2003). - J. D. Terwilliger, S. Zollner, M. Laan, S. Paabo, Hum. Hered. 48, 154 (1998).

- L. Kruglyak, Nat. Genetics, 22, 139 (1999).

- T. Laitinen, Curr. Opin. Allergy Clin. Immunol., 2, 379 (2002).

- P. Heutink, B. A. Oostra, Hum. MoI. Genet, 11 , 2507 (2002). - A. Cao, M. Gossens, M. Pirastu, Br. J. Haematol., 71 , 309 (1989).

- G. Loudianos et al., Hum. Mutat, 14, 294 (1999).

- M. C. Rosatelli et al., Hum. Genet, 103, 428 (1998).

- F. Cucca et al., Hum. Immunol., 37, 85 (1993).

- G. Malerba et al., A. J. Respr. Crit Care Med., 162, 1587 (2000). - B. A. Raby et al., Hum. MoI. Genet, 12, 1973. (2003)

- H. Wesche et al., J. Biol. Chem., 274, 19403 (1999).

- K. Kobayashi et al., Cell, 110, 191 (2002).

- A. Goris, M. G. Marrosu, K. Vandenbroeck, Genes Immun., 2, 284 (2001). - H. A. Whittington, L. Armstrong, K. M. Uppington, A. B. Millar, Am. J. Respir. Cell. MoI. Biol., 31 , 220 (2004).

- S. Janssens, R. Beyaert, MoI. Cell., 11 , 293 (2003).

- R. Lampis, L. Morelli, S. De Virgiliis, M. Congia, F. Cucca, Tissue Antigens., 56, 515 (2000). - J. T. Mendell, H. C. Dietz, Cell, 107, 411 (2001).

- K. Nakashima et al., J. Hum. Genet. 51 , 284 (2006).

- National Institutes of Health/National, Heart, Lung, and Blood

Institute/World Health Organization. Global Initiative for Asthma., Publication Number 95-3659 (1995).

- Kruglyak L., Daly MJ. , Reeve-Daly M. P., Lander E.S., Am. J. Hum. Genet. 58:1347-1363 (1996).

- Nyholt D.R., Am J Hum Genet 67:282-288 (2000).

- Lander E., Green P., PNAS 84, 2363-2367 (1987).

- Liang K.Y., Chiu Y.F., Beaty T.H., Hum Hered 51 :64-78 (2001).

- Glidden D.V., Liang K.Y., Chiu Y.F., Pulver A.E., Genet Epidemiol 24:107-117 (2003).

- Spielman, R. S., McGinnis R. E., and Ewens W.J., Am J Hum Genet 52:506-516 (1993).

- Barrett J. C ₁ Fry B., Mailer J., Daly M.J., Bioinformatics. 21 (2), 263-265 (2005). - Dudbridge F., Genet Epidemiol 25:115-21 (2003).

- Tregouet D.A., Escolano S., Tiret L., Mallet A., Golmard J. L., Ann Hum Genet, 68: 165-177 (2004).