Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
STEM CELL MICROPARTICLES
Document Type and Number:
WIPO Patent Application WO/2013/150303
Kind Code:
A1
Abstract:
This invention relates to stem cell microparticles, their use and production, in particular neural stem cell microparticles and their use in therapy. The stem cell microparticle is typically an exosome or microvesicle and may be derived from a neural stem cell line. The neural stem cell line may be a conditionally-immortalised stem cell line such as CTX0E03 (deposited at the ECACC with Accession No. 04091601).

Inventors:
SINDEN JOHN (GB)
STEVANATO LARA (GB)
CORTELING RANDOLPH (GB)
Application Number:
PCT/GB2013/050879
Publication Date:
October 10, 2013
Filing Date:
April 03, 2013
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
RENEURON LTD (GB)
International Classes:
A61K31/711; A61P9/00; A61P11/00; A61P25/28; C12N5/0797
Domestic Patent References:
WO2011062244A12011-05-26
WO2006087233A22006-08-24
WO2011069100A22011-06-09
WO2011149354A12011-12-01
WO2009105044A12009-08-27
WO2005121318A22005-12-22
WO2012004611A12012-01-12
Foreign References:
KR20100081003A2010-07-14
US5851832A1998-12-22
US6777233B22004-08-17
US6468794B12002-10-22
US5753506A1998-05-19
US7416888B22008-08-26
EP1645626B12007-09-12
US7514259B22009-04-07
Other References:
MARZESCO ANNE-MARIE ET AL: "Release of extracellular membrane particles carrying the stem cell marker prominin-1 (CD133) from neural progenitors and other epithelial cells", JOURNAL OF CELL SCIENCE, CAMBRIDGE UNIVERSITY PRESS, LONDON, GB, vol. 118, no. Pt 13, 1 July 2005 (2005-07-01), pages 2849 - 2858, XP002391919, ISSN: 0021-9533, DOI: 10.1242/JCS.02439
DUKJIN KANG ET AL: "Proteomic Analysis of Exosomes from Human Neural Stem Cells by Flow Field-Flow Fractionation and Nanoflow Liquid Chromatography-Tandem Mass Spectrometry", JOURNAL OF PROTEOME RESEARCH, vol. 7, no. 8, 1 August 2008 (2008-08-01), pages 3475 - 3480, XP055066064, ISSN: 1535-3893, DOI: 10.1021/pr800225z
POLLOCK K ET AL: "A conditionally immortal clonal stem cell line from human cortical neuroepithelium for the treatment of ischemic stroke", EXPERIMENTAL NEUROLOGY, ACADEMIC PRESS, NEW YORK, NY, US, vol. 199, no. 1, 1 May 2006 (2006-05-01), pages 143 - 155, XP024946020, ISSN: 0014-4886, [retrieved on 20060501], DOI: 10.1016/J.EXPNEUROL.2005.12.011
PARK DONG-HYUK ET AL: "Increased neuronal proliferation in the dentate gyrus of aged rats following neural stem cell implantation", STEM CELLS AND DEVELOPMENT, MARY ANN LIEBERT, INC, NEW ROCHELLE, NY, US, vol. 19, no. 2, 1 February 2010 (2010-02-01), pages 175 - 180, XP009152757, ISSN: 1557-8534
HASSANI; O'REILLY; PEARSE; STROEMER ET AL., PLOS ONE, vol. 7, no. 11, 2012
MILJAN ET AL., STEM CELLS DEV, 2009
GENNARO: "Remington: The Science and Practice of Pharmacy", 2000
AMBROS ET AL., RNA, vol. 9, 2003, pages 277 - 279
BANERJEE, S.; WILLIAMSON, D.; HABIB, N.; GORDON, M.; CHATAWAY, J., AGE AND AGEING, vol. 40, 2011, pages 7 - 13
CHUNG ET AL., CELL STEM CELL, vol. 2, 2008, pages 113 - 117
DING, D. C.; SHYU, W. C.; LIN S. Z., CELL TRANSPLANT, vol. 20, 2011, pages 5 - 14
EINSTEIN, O.; BEN-HUR, T., ARCH NEUROL, vol. 65, 2008, pages 452 - 456
HASSANI Z; O'REILLY J; PEARSE Y; STROEMER P; TANG E; SINDEN J; PRICE J; THURET S.: "Human neural progenitor cell engraftment increases neurogenesis and microglial recruitment in the brain of rats with stroke", PLOS ONE, vol. 7, no. 11, 2012, pages E50444
HODGES ET AL., CELL TRANSPLANT, vol. 16, no. 2, 2007, pages 101 - 15
HORIE, N.; PEREIRA, N.P.; NIIZUMA, K; SUN, G ET AL., STEM CELLS, vol. 29, 2011, pages 274 - 285
KATSUDA; KOSAKA; TAKESHITA; OCHIYA, PROTEOMICS, vol. 00, 2013, pages 1 - 17
KATSUDA; TSUCHIYA; KOSAKA; YOSHIOKA; TAKAGAKI; OKI; TAKESHITA; SAKAI; KURODA; OCHIYA, SCIENTIFIC REPORTS, vol. 3, no. 1197, 2013, pages 1 - 11
KLIMANSKAYA ET AL., NATURE, vol. 444, 2006, pages 481 - 485
KORNBLUM, STROKE, vol. 38, 2007, pages 810 - 816
LAI ET AL.: "Proteolytic Potential of the MSC Exosome Proteome: Implications for an Exosome-Mediated Delivery of Therapeutic Proteasome", INTERNATIONAL JOURNAL OF PROTEOMICS, 2012
LITTLEWOOD, T. D.; HANCOCK, D. C.; DANIELIAN, P. S. ET AL., NUCLEIC ACID RESEARCH, vol. 23, 1995, pages 1686 - 1690
MILJAN, E.A.; SINDEN, J.D., CURRENT OPINION IN MOLECULAR THERAPEUTICS, vol. 4, 2009, pages 394 - 403
MILJAN EA; HINES SJ; PANDE P; CORTELING RL; HICKS C; ZBARSKY V; UMACHANDRAN, M; SOWINSKI P; RICHARDSON S; TANG E: "Implantation of c-mycER TAM immortalized human mesencephalic-derived clonal cell lines ameliorates behavior dysfunction in a rat model of Parkinson's disease", STEM CELLS DEV., vol. 18, no. 2, March 2009 (2009-03-01), pages 307 - 19
MITCHELL ET AL., JOURNAL OF IMMUNOLOGICAL METHODS, vol. 335, 2008, pages 98 - 105
POLLOCK ET AL., EXP NEUROL., vol. 199, no. 1, May 2006 (2006-05-01), pages 143 - 55
MARK F PITTENGER; ALASTAIR M MACKAY; STEPHEN C BECK; RAMA K JAISWAL ET AL., SCIENCE, vol. 284, 2 April 1999 (1999-04-02), pages 5411
SMITH, E. J.; STROEMER, R.P.; GORENKOVA, N.; NAKAJIMA, M. ET AL., STEM CELLS, vol. 30, 2012, pages 785 - 796
STEVENATO, L.; CORTELING, R.; STROEMER, P.; HOPE, A. ET AL., BMC NEUROSCIENCE, vol. 10, 2009, pages 86
STROEMER, P.; PATEL, S.; HOPE, A.; OLIVEIRA, C.; POLLOCK, K.; SINDEN, J., NEUROREHABIL NEURAL REPAIR, vol. 23, 2009, pages 895 - 909
THÉRY, C.; OSTROWSKI, M.; SEGURA, E. ET AL., NATURE REVIEWS IMMUNOLOGY, vol. 9, 2009, pages 581 - 593
THEIR ET AL.: "Direct Conversion of Fibroblasts into Stably Expandable Neural Stem Cells", CELL STEM CELL, 20 March 2012 (2012-03-20)
TIMMERS, L.; LIM, S. K.; ARSLAN, F.; ARMSTRONG, J. S. ET AL., STEM CELL RES, vol. 1, 2007, pages 129 - 137
YUAN, S.J.; MARTIN, J; ELIA, J.; FLIPPIN, J. ET AL., PLOS ONE, vol. 6, 2011, pages E17540
Attorney, Agent or Firm:
GOODFELLOW, Hugh Robin et al. (One Southampton Row, London WC1B 5HA, GB)
Download PDF:
Claims:
CLAIMS

1. A neural stem cell microparticle.

2. The neural stem cell microparticle of claim 1 , wherein the microparticle is an exosome, microvesicle, membrane particle, membrane vesicle, exosome-like vesicle, ectosome- like vesicle, ectosome or exovesicle.

3. The neural stem cell microparticle of claims 1 or 2, wherein the microparticle is derived from a neural stem cell line.

4. The neural stem cell microparticle of claim 3, wherein the neural stem cell line is conditionally-immortalised and/or grown in serum free medium.

5. The neural stem cell microparticle of claim 4, wherein the neural stem cell line is

CTX0E03 having ECACC Accession No. 04091601 , STR0C05 having ECACC Accession No.041 10301 and HPC0A07 having ECACC Accession No.04092302.

6. The neural stem cell microparticle of any preceding claim, wherein the microparticle has:

(a) a size of between 30 nm and 1000 nm, or between 30 and 200 nm, or between 30 and 100 nm, as determined by electron microscopy; or

(b) a density in sucrose of 1.1 -1.2 g/ml.

7. The neural stem cell microparticle of any preceding claim, comprising RNA.

8. The neural stem cell microparticle of claim 7, wherein the RNA is mRNA and/or miRNA.

9. The neural stem cell microparticle of claim 8, wherein the microparticle comprises one, two, three or four of hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532.

10. The neural stem cell microparticle of any preceding claim, comprising one or more of:

(a) a lipid selected from ceramide, cholesterol, sphingomyelin, phosphatidylserine, phosphatidylinositol, and/or phosphatidylcholine;

(b) miRNA, optionally selected from hsa-let-7g, hsa-miR-101 , hsa-miR-10a, hsa-miR- 10b, hsa-miR-126, hsa-miR-128, hsa-miR-129-5p, hsa-miR-130a, hsa-miR-134, hsa- miR-137, hsa-miR-155, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR- 182, hsa-miR-183, hsa-miR-185, hsa-miR-18b, hsa-miR-192, hsa-miR-194, hsa-miR- 195, hsa-miR-20a, hsa-miR-20b, hsa-miR-210, hsa-miR-218, hsa-miR-301 a, hsa-miR- 302a, hsa-miR-302c, hsa-miR-345, hsa-miR-375, hsa-miR-378, hsa-miR-7, hsa-miR-9, hsa-miR-93, hsa-miR-96, and hsa-miR-99a;

(c) a tetraspanin, optionally selected from CD63, CD81.CD9, CD53, CD82 and/or CD37;

(d) TSG101 , Alix, CD109 and/or thy-1 ; and/or

(e) CD133.

1 1. The neural stem cell microparticle of any preceding claim, comprising at least 10 of the proteins present in Table 19 or Table 21.

12. The neural stem cell microparticle of any preceding claim, comprising at least one biological activity of a neural stem cell or a neural stem cell-conditioned medium.

13. The neural stem cell microparticle of claim 12, wherein the at least one biological activity is regenerative activity.

14. The neural stem cell microparticle of any preceding claim, for use in therapy.

15. The neural stem cell microparticle of claim 14, wherein the therapy is regenerative therapy.

16. The neural stem cell microparticle of claims 14 or 15, wherein the therapy is for a

(i) Neurological disorder, disease or deficit, such as Parkinson's, Alzheimer's, Stroke, or ALS;

(ii) Lysosomal storage disorder;

(iii) Cardiovascular disorder, such as Myocardial Infarction, congestive heart failure,

Peripheral Arterial Disease, diabetic ulcers, wound healing;

(iv) Diseases of the lung, including Idiopathic Pulmonary Fibrosis, Respiratory Distress Syndrome, Chronic Obstructive Pulmonary Disease, Idiopathic Pulmonary Hypertension, Cystic Fibrosis and Asthma

(v) Metabolic or inflammatory disorder, such as Diabetes (I or II), rheumatoid arthritis, osteoarthritis, lupus, Crohn's disease, Irritable Bowel Disease, or Graft versus Host Disease;

(vi) Psychiatric disorder, such as: Depression, Bipolar, Schizophrenia or an Autistic syndrome disorder such as Autism, Asperger's syndrome or Rett Syndrome;

(vii) Blindness-causing disease of the retina, such as Age-related macular degeneration, Stargardt disease, diabetic retinopathy, or retinitis pigmentosa; and (viii) Demyelinating disease, such as multiple sclerosis, central pontine myelinolysis, tabes dorsalis, transverse myelitis, Devic's disease, progressive multifocal leukoencephalopathy, optic neuritis, leukodystrophies, Guillain-Barre syndrome, Anti-MAG peripheral neuropathy and Charcot-Marie-Tooth disease.

17. The neural stem cell microparticle of claims 14-16, wherein the therapy improves functional and/or cognitive recovery.

18. The neural stem cell microparticle of claims 14-17, wherein the therapy is of stroke, peripheral arterial disease or blindness-causing diseases of the retina.

19. The neural stem cell microparticle of claims 14 to 17, wherein:

(i) the microparticle is an exosome and therapy is of a disease or condition requiring tissue replacement, regeneration or repair; or

(ii) the microparticle is a microvesicle and the therapy is of a disease requiring angiogenesis or a neurological disease, disorder or deficit.

20. Use of a neural stem cell microparticle according to any preceding claim, in the manufacture of a medicament for the treatment of a disease.

21. A method of producing a neural stem cell microparticle as defined in claims 1 -13, comprising isolating a microparticle from a neural stem cell-conditioned medium.

22. A method of producing a stem cell microparticle, comprising isolating a microparticle from a stem cell-conditioned medium wherein:

(i) the stem cell-conditioned medium comprises one or more components which induce the release of microparticles by the stem cells into the medium;

(ii) the stem cells were cultured under hypoxic conditions;

(iii) the stem cells were co-cultured with a different cell type;

(iv) the stem cells were cultured in a multi-compartment bioreactor; and/or

(v) the stem cells were partially-differentiated.

23. A method according to claim 22, wherein the stem cell is a neural stem cell, optionally as defined in any of claims 3 to 5.

24. A method according to claim 22(i) or claim 23 when dependent upon claim 22(i), wherein the one or more components are selected from: transforming growth factor-beta (TGF- β), interferon-gamma (INF-γ) and tumour necrosis factor-alpha (TNF-a).

25. A method according to claim 22(iii), claim 23 or 24 when dependent upon claim 22(iii), wherein the different cell type is an endothelial cell.

26. A microparticle obtainable by the method of any of claims 22-25.

27. A composition comprising a microparticle according to any of claims 1 -13 or 26 and a pharmaceutically acceptable excipient, carrier or diluent.

28. A kit for use in a method for producing the microparticle of any of claims 1 -13 or 26 comprising: (a) a medium; (b) a neural stem cell; (c) optionally the one or more components of claims 22 to 24; (d) optionally the microparticle of any of claims 1 -13 or 26 suitable for use as a control; (e) optionally a detection agent suitable for specific detection of the produced microparticles; and (f) instructions for producing the microparticle of any of claims 1 -13 or 26 using the kit.

29. A method of screening for an agent that alters the rate of production of a microparticle by a stem cell, comprising contacting a stem cell with a candidate agent and observing whether the rate production of microparticles by the contacted stem cell increases or decreases compared to a control.

30. A composition comprising two, three or all four of hsa-miR-1246, hsa-miR-4492, hsa- miR-4488 and hsa-miR-4532.

31. A composition according to claim 30, which is a pharmaceutical composition comprising a pharmaceutically acceptable carrier, diluent, vehicle and/or excipient.

32. A composition according to claim 30 or 31 , for use in therapy.

33. A composition for use in therapy according to claim 32, wherein the therapy is as defined in claim 16.

Description:
Stem Cell Microparticles

Field of the Invention

This invention relates to stem cell microparticles, their use and production thereof, in particular neural stem cell microparticles and their use in therapy.

Background of the Invention

Stem cells have the ability to self-renew and to differentiate into functionally different cell types. They have the potential to be a powerful tool in the growing field of Regenerative Medicine, in particular regenerative therapy requiring tissue replacement, regeneration or repair (Banerjee et al. 201 1 ). However, there are drawbacks to the use of stem cells in therapy: there is a need for a consistent and substantial supply of stem cells with functional and phenotypic stability and the associated high costs and time delay caused by cell generation, storage, transport and handling; there is a requirement for immunological compatibility to avoid rejection of the stem cells by the recipient; and there are complex regulatory issues related to potential safety risks of tumour or ectopic tissue formation. Further, despite the therapeutic efficacy of stem cell transplantation, there is no convincing evidence for a direct long-term effect of the transplanted stem cells, for example through engraftment and differentiation into reparative or replacement cells.

Neural stem cells (NSCs) are self-renewing, multipotent stem cells that generate neurons, astrocytes and oligodendrocytes (Kornblum, 2007). The medical potential of neural stem cells is well-documented. Damaged central nervous system (CNS) tissue has very limited regenerative capacity so that loss of neurological function is often chronic and progressive. Neural stem cells (NSCs) have shown promising results in stem cell-based therapy of neurological injury or disease (Einstein et al. 2008). Implanting neural stem cells (NSCs) into the brains of post-stroke animals has been shown to be followed by significant recovery in motor and cognitive tests (Stroemer et al. 2009). It is not completely understood how NSCs are able to restore function in damaged tissues but it is now becoming increasingly recognised that NSCs have multimodal repairing properties, including site-appropriate cell differentiation, pro- angiogenic and neurotrophic activity and immunomodulation promoting tissue repair by the native immune system and other host cells (Miljan & Sinden, 2009, Horie et al., 201 1 ). It is likely that many of these effects are dependent on transient signalling from implanted neural stem cells to the host milieu, for example NSCs transiently express proinflammatory markers when implanted in ischaemic muscle tissue damage which directs and amplifies the natural pro- angiogenic and regulatory immune response to promote healing and repair (Hicks et al., unpublished data). In chronic stroke brain, NSCs also have a substantial neurotrophic effect. For example, they promote the repopulation of the stoke-damaged striatal brain tissue with host brain derived doublecortin positive neroblasts (Hassani, O'Reilly, Pearse, Stroemer et al., PLoS One. 2012;7(1 1 )).

Furthermore, on the basis of a large body of NSC restorative effects in animal models with chronic stroke, a clinical trial using neural stem cells is being carried out by ReNeuron Limited (Surrey, UK), to trial the treatment of disabled stroke patients using its "CTX0E03" conditionally- immortalised cortex-derived neural stem cells (Clinicaltrials.gov Identifier: NCT01151 124).

Mesenchymal stem cells (MSCs) are lineage-restricted stem cells which have the potential to differentiate into mesenchymal cell types only, namely of the adipocytic, chondrocytic and osteocytic lineages (Pittenger et al 1999; Ding et al. 201 1 ). MSCs (also referred to as Mesenchymal Stromal Cells and Mesenchymal Progenitor Cells) are derived from a variety of sources including bone marrow, blood, adipose and other somatic tissues. The therapeutic potential of MSCs, however, is more directed towards the application of their pro-angiogenic and immune modulating properties as undifferentiated cells. Production of human MSCs is limited by the inability of these cells to expand in numbers stably beyond approximately 15-20 population doublings.

Mesenchymal stem cell-conditioned medium (MSC-CM) has a therapeutic efficacy similar to that of MSCs themselves, suggesting a paracrine mechanism of MSC-based therapy (Timmers et al. 2007). WO-A-2009/105044 discloses that particles known as exosomes, secreted by MSCs, comprise at least one biological property of the MSCs and suggests the use of these MSC particles in therapy, while Thery et al. 2011 provides a general review of exosomes and other similar secreted vesicles. Whereas some of the drawbacks of using stem cells directly as therapeutic agents are overcome by using the mesenchymal stem cell-derived exosomes (e.g. storage, transport and handling), the problem remains of providing a consistent and substantial supply of functionally and phenotypically stable stem cells to produce the exosomes. For therapeutic use, the exosomes preferably need to be produced on a large scale. In the absence of a stem cell line, replenishment of the cells through repeated derivation from a source of stem cells is required, which incurs recurring costs for testing and validation of each new batch. Furthermore, the diseases and disorders that can be treated by MSCs may be limited.

There remains a need for improved stem cell-based therapies.

Summary of the Invention

The present invention is based on the surprising finding that neural stem cells contain microparticles that are therapeutically useful. It has also been found that it is possible to alter the production of microparticles by stem cells by the addition of components to the culture medium, by culturing the stem cells under hypoxic conditions, or by co-culture with other cell types, thereby providing an improved method of producing stem cell microparticles.

A first aspect of the invention provides a neural stem cell microparticle. The microparticle may be an exosome, microvesicle, membrane particle, membrane vesicle, exosome-like vesicle, ectosome-like vesicle, ectosome or exovesicle. Typically, the microparticle is an exosome. The microparticle may be derived from a neural stem cell that has been cultured in an environment that allows stem cell differentiation. The microparticle may be isolated from partially-differentiated neural stem cells. In one embodiment, an environment that allows stem cell differentiation is a multi-compartment bioreactor, typically where the cells are cultured for more than seven days. The microparticle may be derived from a neural stem cell line. In some embodiments, the neural stem cell line may be the "CTX0E03" cell line, the "STR0C05" cell line, the "HPC0A07" cell line or the neural stem cell line disclosed in Miljan et al Stem Cells Dev. 2009. In some embodiments, the microparticle is derived from a stem cell line that does not require serum to be maintained in culture. The microparticle may have a size of between 30 nm and 1000 nm, or between 30 and 200 nm, or between 30 and 100 nm, as determined by electron microscopy; and/or a density in sucrose of 1.1 -1.2 g/ml. The microparticle may comprise RNA. The RNA may be mRNA, miRNA, and/or any other small RNA. The microparticle may comprise one, two, three or four of hsa-miR-1246, hsa-miR-4492, hsa-miR- 4488 and hsa-miR-4532. The microparticle may comprise one or more lipids, typically selected from ceramide, cholesterol, sphingomyelin, phosphatidylserine, phosphatidylinositol, phosphatidylcholine. The microparticle may comprise one or more tetraspanins, typically CD63, CD81 , CD9, CD53, CD82 and/or CD37. The microparticle may comprise one or more of TSG101 , Alix, CD109, thy-1 and CD133. The microparticle may comprise at least 10 of the proteins present in Table 19 or Table 21. The microparticle may comprise at least one biological activity of a neural stem cell or a neural stem cell-conditioned medium. At least one biological activity may be a tissue regenerative activity. The microparticle of the invention is typically isolated or purified.

A second aspect of the invention provides a neural stem cell microparticle for use in therapy. The therapy may be regenerative therapy requiring tissue replacement, regeneration or repair, for example where the therapy requires angiogenesis, neurogenesis and/or neuroprotection. The therapy may be for a neurological disease, disorder or deficit. The therapy may improve functional and/or cognitive recovery. The therapy may be of stroke, peripheral arterial disease, neuropathy or any other disease or disorder that requires tissue regeneration, revascularisation or local anti-inflammatory action, including:

(i) Neurological disorder, disease or deficit, such as Parkinson's disease, Alzheimer's disease, Stroke, or ALS;

(ii) Lysosomal storage disorders;

(iii) Cardiovascular disorders, such as Myocardial Infarction, congestive heart failure, Peripheral Arterial Disease, diabetic ulcers, wound healing;

(iv) Diseases of the lung, including Idiopathic Pulmonary Fibrosis, Respiratory Distress Syndrome, Chronic Obstructive Pulmonary Disease, Idiopathic Pulmonary Hypertension, Cystic Fibrosis and Asthma;

(v) Metabolic or inflammatory disorders, such as Diabetes (I or II), rheumatoid arthritis, osteoarthritis, lupus, Crohn's disease, Inflammatory Bowel Disease, or Graft versus Host Disease;

(vi) Psychiatric disorders, such as Depression, Bipolar disorder, Schizophrenia or an Autistic syndrome disorder such as Autism, Asperger's syndrome or Rett Syndrome;

(vii) Blindness-causing diseases of the retina, such as Age-related macular degeneration, Stargardt disease, diabetic retinopathy, retinitis pigmentosa; and

(viii) Demyelinating diseases, such as multiple sclerosis, cerebral palsy, central pontine myelinolysis, tabes dorsalis, transverse myelitis, Devic's disease, progressive multifocal leukoencephalopathy, optic neuritis, leukodystrophies, Guillain-Barre syndrome, Anti-MAG peripheral neuropathy and Charcot-Marie- Tooth disease.

In one embodiment, the microparticle is an exosome and therapy is of a disease or condition requiring tissue replacement, regeneration or repair. In another embodiment, the microparticle is a microvesicle and the therapy is of a disease requiring angiogenesis or a neurological disease, disorder or deficit. The therapy may also be a prophylactic therapy to induce tolerance, typically immunotolerance, in a host that is subsequently, concurrently or simultaneously to receive the stem cells from which the microparticle is derived. The administration of one or more doses of micro particles of the invention to a patient, prior to or concurrent with administration of a stem cell therapy, can be used to reduce the risk of an adverse immune response, i.e. "rejection", of the stem cell therapy.

A third aspect of the invention provides the use of a neural stem cell microparticle manufacture of a medicament for the treatment of a disease. A fourth aspect of the invention provides a method of producing a stem cell microparticle, typically a neural stem cell microparticle. The method may comprise culturing the stem cells in an environment that allows stem cell differentiation and collecting the micro particles that are produced by the cells. The microparticles may be isolated from partially-differentiated neural stem cells. The stem cells may be cultured under conditions that allow the efficient removal of metabolic waste. In one embodiment, an environment that allows stem cell differentiation is culture in a multi-compartment bioreactor, typically for a prolonged period of time (for example more than seven days). The method may comprise isolating a microparticle from a stem cell- conditioned medium. The stem cell-conditioned medium may comprise one or more additive components or agents which stimulate the release of microparticles by the stem cells into the medium. The one or more components may be selected from transforming growth factor-beta (TGF-β), interferon-gamma (IFN-γ) and/or tumour necrosis factor-alpha (TNF-a). The microparticles may be isolated from stem cell-conditioned medium wherein the stem cells were cultured under hypoxic conditions. The microparticles may be isolated from stem cell- conditioned medium produced by stem cells co-cultured with a different cell type, typically endothelial cells, in order to create the NSC niche environment.

A fifth aspect of the invention provides a microparticle obtainable by a method according to the fourth aspect of the invention.

A sixth aspect of the invention provides a composition comprising a neural stem cell microparticle and a pharmaceutically acceptable excipient, carrier or diluent. A seventh aspect of the invention provides a method of screening for an agent that alters the production of a microparticle by a stem cell, comprising contacting a stem cell with a candidate agent and observing whether the rate of production of microparticles by the contacted stem cell increases or decreases compared to a control. An eighth aspect of the invention provides a kit for use in a method for producing a stem cell microparticle, comprising: (a) a medium suitable for culturing stem cells; (b) a stem cell; (c) optionally the one or more components of the fourth aspect of the invention; (d) optionally a stem cell microparticle suitable for use as a control; (e) optionally a detection agent suitable for specific detection of the produced microparticles; and (f) instructions for producing the stem cell microparticle using the kit.

A ninth aspect of the invention provides a composition comprising two, three or all four of hsa- miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532. This composition is optionally a pharmaceutical composition, comprising a pharmaceutically-acceptable carrier, diluent, vehicle and/or excipient. The pharmaceutical composition is suitable for use in therapy, typically in the same therapies as the microparticles of the invention, as noted above. Brief Description of the Drawings

Figure 1 depicts electron micrographs of CTX0E03 conditionally-immortalised neural stem cells producing microparticles. Panels A-E show intracellular multivesicular bodies (MVBs) containing exosomes between 30nm and 50nm in diameter and Panel F shows microvesicles >100nm in diameter released from neural stem cells through a process of budding at the cell membrane.

Figure 2 is an outline protocol for the identification, characterisation and production of microparticles from stem cells. Figure 3 shows Human angiogenesis ELISA strip optical density read out performed on CTX0E03 conditioned and un-conditioned medium.

Figure 4A shows the amount of protein (measured by BCA assay) extracted from 15ml of media containing microparticles purified from the Integra system compared to normal culture conditions (3 days T175). Figure 4B shows the FACS detection (at 2ug/ml, 1 :250) of (i) CD63 in Integra cultured CTX0E03 exosomes (top left panel) and microvesicles (top right panel) and (ii) CD81 in Integra cultured CTX0E03 exosomes (bottom left panel) and microvesicles (bottom right panel). Figure 5 shows the amount of isolated total RNA measured at 260/280nm extracted from 15ml of media containing microparticles purified by filtration from the Integra system compared to normal culture conditions (3 days T175).

Figure 6A shows the results of a wound closure/scratch assay representing the migration activity of normal human dermal fibroblasts (NHDF) cultured in CTX0E03 conditioned media or upon the addition of purified CTX0E03 exosomes. Figure 6B shows the results of a scratch assay after 72 hours, comparing the effect of 10μg CTX0E03 exosomes to basal conditions (without exosomes). Figure 6C shows the % of healed areas for basal conditions, 2μg/ml exosomes, 6 μg/ml exosomes, 20 μg/ml exosomes and an LSGS (low serum growth supplement) positive control. The top panel of Figure 6C shows exosomes isolated from CTX0E03 cells cultured for 2 weeks in the Integra Celline system and the bottom panel of Figure 6C shows exosomes isolated from CTX0E03 cells cultured for 6 weeks in the Integra Celline system. Figure 6D compares CTX0E03 cells to a negative control (saline) in an in vivo injection wound healing assay.

Figure 7 shows the quantity of purified exosomes obtained per culture medium from standard CTX0E03 (T175) cultures vs the Integra CELLine system at the 3 week time point.

Figure 8A shows the concentration of exosomes harvested from two different flasks after 1 week, 2 weeks and 3 weeks of CTX0E03 Integra CELLine culture system. Figure 8B shows the concentration of exosomes harvested from a single Integra CELLine flask during a 6 week continuous culture of CTX0E03 cells.

Figure 9 shows the fold change of expression levels of various mRNA markers measured in CTX0E03 cells cultured for 3 weeks in the Integra CELLine system compared to standard ("control") CTX0E03 (T175) cultures.

Figure 10 shows the fold up and down regulation of various miRNAs in exosomes obtained from CTX0E03 cells cultured for 3 weeks in Integra bioreactor culture and microparticles obtained from standard CTX0E03 (T175) cultures, assessed against a baseline expression level in CTX0E03 cells in standard (T175) culture.

Figure 1 1 depicts the miRNA profiles obtained from deep sequencing of miRNA from CTX0E03 cells ("CTX"), microvesicles ("MV") and exosomes ("EXO") cultured under standard (T175) conditions. Figure 11 a and 1 1 b show results from two cultures. Figure 12 shows the effect of hNSC microvesicles on angiogenesis of HUVECs. Figure 12A is a photograph showing the clear increase in tube formation observed when microvesicles are added (right hand panels) compared to basal HUVECs. Figures 12B and 12C show the increase in total tube length provided by the hNSC microvesicles at various concentrations (0.05μg, 0.1 μg, 0^g - Figure 12B; and O^g/ml - Figure 12C).

Figure 13 shows the effect of hNSC microvesicles on neurite outgrowth in PC-12 cells.

Figure 14 is an electropherogram showing the total RNA content profile in CTX0E03 cells, exosomes and microvesicles as determined by Agilent RNA bioanalyser.

Figure 15 is a schematic presentation of the percentage of coding genes fully overlapping exon, and non-coding transcripts located with intron or intergenic sequences (produced by running NGS BAM files against GENCODE sequence data set). Figure 16 depicts the top ranking preferentially shuttled novel miRNAs in exosomes and MV compared to CTX0E03 producer cells. Figure 17 shows the results of NanoSight analysis undertaken to determine the particle size and concentration of CTX0E03 exosomes (Figure 17A) and microvesicles (Figure 17B) cultured in the Integra Celline system for 1 , 2, 3, 4, 5 and 6 weeks

Figure 18 shows Venn diagrams comparing the proteomic data from CTX0E03 exosomes and microvesicles (18A and 18B), and comparing neural stem cell exosomes with mesenchymal stem cell exosomes (18C and 18D). Figure 18A illustrates the number of unique proteins within CTX0E03 exosomes and microvesicles, isolated from week 2 Integra culture system. Figure 18B compares the biological processes associated with the identified proteins within the CTX0E03 exosomes and microvesicles. Figure 18C compares the CTX0E03 neural stem cell exosome proteome to a Mesenchymal Stem Cell exosome proteome, and Figure 18D compares the biological processes associated with the identified proteins in the MSC derived exosomes with the neural stem cell derived exosomes.

Figure 19 shows the 30 biological processes found to be associated with NSC derived exosomes and not mesenchymal stem cell exosomes.

Detailed Description of the Invention

The present inventors have surprisingly identified microparticles in neural stem cells. These microparticles retain some of the functions of the neural stem cells from which they are derived and are typically therapeutically useful for the same treatments as the neural stem cells. The microparticles are advantageous over the corresponding stem cells because they are smaller and less complex, thereby being easier to produce, maintain, store and transport, and have the potential to avoid some of the regulatory issues that surround stem cells. The microparticles can be produced continuously, by isolation from conditioned media, for example in a bioreactor such as a multi-compartment bioreactor, which allows for large scale production and the provision of an "off-the-shelf" therapy. The multi-compartment bioreactor is typically a two- compartment bioreactor.

It has further been found that, surprisingly, culturing stem cells (of any type, not limited to neural stem cells) in an environment that allows the stem cells to begin to differentiate, increases dramatically the yield of microparticles produced. The inventors have surprisingly observed that culturing stem cells (of any type, not limited to neural stem cells) in a multi-compartment bioreactor, results in partial differentiation of the stem cells, into stem cells in a more differentiated form. This differentiation in culture does not require the addition of an agent to induce differentiation. This differentiation typically requires a culture period of at least one week, at least two weeks or at least three weeks. The changes to the stem cells that occur in culture in a multi-compartment bioreactor are reflected by the microparticles produced by the cultured stem cells. Therefore, by culturing stem cells in a multicompartment bioreactor, it is possible to induce differentiation of the cells. Accordingly, microparticles from partially differentiated stem cells can be produced by harvesting microparticles from stem cells cultured in a multi-compartment bioreactor, typically for at least one week, at least two weeks, at least three weeks, at least four weeks, at least five weeks or at least six weeks. Optionally, the NSCs have been cultured for no more than ten weeks. In one embodiment, the invention provides a method of producing microparticles by isolating the microparticles from partially-differentiated neural stem cells.

The inventors have also found that it is possible to induce the secretion of microparticles from stem cells. This finding, which also is not limited to neural stem cells and can be used for the production of microparticles from any stem cell, allows for an improved yield of microparticles to be obtained from a stem cell culture. Several agents have been identified that enhance the secretion of microparticles to different degrees, which has the further advantage of being able to control the amount of microparticles that are secreted. Culturing stem cells under hypoxic conditions also improves microparticle production. Further, it has been found that co-culturing a stem cell with a different cell type, in particular an endothelial cell type can beneficially alter the microparticles that are produced by the stem cell.

In a further embodiment, the invention provides microparticles, typically exosomes, produced by serum-free stem cells. Serum is required for the successful culture of many cell lines, but contains many contaminants including its own exosomes. As described below, the inventors have produced microparticles from stem cells that do not require serum for successful culture.

Neural Stem Cell Microparticles

The invention provides, in one aspect, microparticles obtainable from a neural stem cell. A neural stem cell microparticle is a microparticle that is produced by a neural stem cell. Typically, the microparticle is secreted by the neural stem cell. More typically, the microparticle is an exosome or a microvesicle. Microparticles from other cells, such as mesenchymal stem cells, are known in the art. A "microparticle" is an extracellular vesicle of 30 to 1000 nm diameter that is released from a cell. It is limited by a lipid bilayer that encloses biological molecules. The term "microparticle" is known in the art and encompasses a number of different species of microparticle, including a membrane particle, membrane vesicle, microvesicle, exosome-like vesicle, exosome, ectosome-like vesicle, ectosome or exovesicle. The different types of microparticle are distinguished based on diameter, subcellular origin, their density in sucrose, shape, sedimentation rate, lipid composition, protein markers and mode of secretion (i.e. following a signal (inducible) or spontaneously (constitutive)). Four of the common microparticles and their distinguishing features are described in Table 1 , below.

Table 1: Various Microparticles

Microparticles are thought to play a role in intercellular communication by acting as vehicles between a donor and recipient cell through direct and indirect mechanisms. Direct mechanisms include the uptake of the microparticle and its donor cell-derived components (such as proteins, lipids or nucleic acids) by the recipient cell, the components having a biological activity in the recipient cell. Indirect mechanisms include microvesicle-recipient cell surface interaction, and causing modulation of intracellular signalling of the recipient cell. Hence, microparticles may mediate the acquisition of one or more donor cell-derived properties by the recipient cell. It has been observed that, despite the efficacy of stem cell therapies in animal models, the stem cells do not appear to engraft into the host. Accordingly, the mechanism by which stem cell therapies are effective is not clear. Without wishing to be bound by theory, the inventors believe that the microparticles secreted by neural stem cells play a role in the therapeutic utility of these cells and are therefore therapeutically useful themselves. The microparticles and stem cells of the invention are isolated. The term "isolated" indicates that the microparticle, microparticle population, cell or cell population to which it refers is not within its natural environment. The microparticle, microparticle population, cell or cell population has been substantially separated from surrounding tissue. In some embodiments, the microparticle, microparticle population, cell or cell population is substantially separated from surrounding tissue if the sample contains at least about 75%, in some embodiments at least about 85%, in some embodiments at least about 90%, and in some embodiments at least about 95% microparticles and/or stem cells. In other words, the sample is substantially separated from the surrounding tissue if the sample contains less than about 25%, in some embodiments less than about 15%, and in some embodiments less than about 5% of materials other than the microparticles and/or stem cells. Such percentage values refer to percentage by weight. The term encompasses cells or microparticles which have been removed from the organism from which they originated, and exist in culture. The term also encompasses cells or microparticles which have been removed from the organism from which they originated, and subsequently re- inserted into an organism. The organism which contains the re-inserted cells may be the same organism from which the cells were removed, or it may be a different organism.

Neural stem cells naturally produce microparticles by a variety of mechanisms, including budding of the plasma membrane (to form membrane vesicles and microvesicles) and as a result of the fusion of intracellular multivesicular bodies (which contain microparticles) with the cell membrane and the release of the microparticles into the extracellular compartment (to secrete exosomes and exosome-like vesicles).

The neural stem cell that produces the microparticles of the invention can be a fetal, an embryonic, or an adult neural stem cell, such as has been described in US5851832, US6777233, US6468794, US5753506 and WO-A-2005121318. The fetal tissue may be human fetal cortex tissue. The cells can be selected as neural stem cells from the differentiation of induced pluripotent stem (iPS) cells, as has been described by Yuan et al. (2011) or a directly induced neural stem cell produced from somatic cells such as fibroblasts (for example by constitutively inducing Sox2, Klf4, and c-Myc while strictly limiting Oct4 activity to the initial phase of reprogramming as recently by Their et al, 2012). Human embryonic stem cells may be obtained by methods that preserve the viability of the donor embryo, as is known in the art (e.g. Klimanskaya et al., 2006, and Chung et al. 2008). Such non-destructive methods of obtaining human embryonic stem cell may be used to provide embryonic stem cells from which microparticles of the invention can be obtained. Alternatively, microparticles of the invention can be obtained from adult stem cells, iPS cells or directly-induced neural stem cells. Accordingly, microparticles of the invention can be produced by multiple methods that do not require the destruction of a human embryo or the use of a human embryo as a base material. Typically, the neural stem cell population from which the microparticles are produced, is substantially pure. The term "substantially pure" as used herein, refers to a population of stem cells that is at least about 75%, in some embodiments at least about 85%, in some embodiments at least about 90%, and in some embodiments at least about 95% pure, with respect to other cells that make up a total cell population. For example, with respect to neural stem cell populations, this term means that there are at least about 75%, in some embodiments at least about 85%, in some embodiments at least about 90%, and in some embodiments at least about 95% pure, neural stem cells compared to other cells that make up a total cell population. In other words, the term "substantially pure" refers to a population of stem cells of the present invention that contain fewer than about 25%, in some embodiments fewer than about 15%, and in some embodiments fewer than about 5%, of lineage committed cells in the original unamplified and isolated population prior to subsequent culturing and amplification. A neural stem cell microparticle comprises at least one lipid bilayer which typically encloses a milieu comprising lipids, proteins and nucleic acids. The nucleic acids may be deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA). RNA may be messenger RNA (mRNA), micro RNA (miRNA) or any miRNA precursors, such as pri-miRNA, pre-miRNA, and/or small nuclear RNA (snRNA).

A neural stem cell microparticle retains at least one biological function of the stem cell from which it is derived. Biological functions that may be retained include the ability to promote angiogenesis and/or neurogenesis, the ability to effect cognitive improvement in the brain of a patient that has suffered a stroke, or the ability to accelerate blood flow recovery in peripheral arterial disease. For example, CTX0E03 cells are known to inhibit T cell activation in a PBMC assay and, in one embodiment, the microparticles of the invention retain this ability to inhibit T cell activation in a PBMC assay. PBMC assays are well-known to the skilled person and kits for performing the assay are commercially available. Example 8, Table 2 and Figure 6 demonstrate that CTX0E03 stem cell exosomes retain the ability to close a wound in a "scratch" model of wound healing. The results in Figure 6A show that the migration activity of normal human dermal fibroblasts (NHDF) cultured in CTX0E03 conditioned media is almost the same as the migration activity observed on the addition of purified exosomes. Accordingly, one biological function that microparticles of the invention may retain is the ability to stimulate migration activity of normal human dermal fibroblasts (NHDF).

Example 8 also shows that microvesicles of the invention are able to stimulate angiogenesis of primary HUVECs and to stimulate neurite outgrowth of PC-12 cells. Accordingly, a biological function that microparticles of the invention may retain is the ability to stimulate angiogenesis of primary HUVECs and/or to stimulate neurite outgrowth of PC-12 cells.

The proteomic analysis in Example 13 indicates that neural stem cell exosomes comprise biological functions associated with the production, packaging, function and degradation of genetic material. Accordingly, in one embodiment, exosomes of the invention retain these functions, typically one or more of RNA polymerase function, RNA degradation function, ribosome function and spliceosome function. The microparticle obtained from the neural stem cell has a diameter of 1000nm or less. Typically, the microparticle of the invention will have a diameter of 200nm or less, for example 100nm or less. As noted in Table 1 above, microvesicles have a diameter of 100nm to lOOOnm. Exosomes are typically defined as having a diameter of 30-1 OOnm, but more recent studies confirm that exosomes can also have a diameter between 100nm and 200nm, (e.g. Katsuda et a/, Proteomics 2013 and Katsuda et al, Scientific Reports 2013). Accordingly, exosomes typically have a diameter between 30nm and 150nm. Membrane particles have a diameter of 50nm to 80nm and exosome-like particles have a diameter of 20nm-50nm. The diameter can be determined by any suitable technique, for example electron microscopy or dynamic light scattering. The term microparticle includes, but is not limited to: membrane particle, membrane vesicle, microvesicle, exosome-like vesicle, exosome, ectosome-like vesicle, ectosome or exovesicle.

Figure 1 panels A-E show the presence in neural stem cells of MVB's containing exosomes between 30-50nm in diameter, while panel F shows microvesicles >100nm in diameter. Table 20 and Figure 17 (below) show that typical neural stem cell exosomes were measured to have a diameter ranging from approximately 70nm to approximately 150nm, which is consistent with the size of exosomes (from mesenchymal stem cells) described in the art. Accordingly, exosomes of the invention typically have a diameter between 30nm and 200nm, more typically between 50nm and 150nm. As noted above, exosomes are typically positive for the Alix marker (UNIPROT Accession No. Q8WUM4).

Figure 1 F and Table 20 shows the observed size of typical neural stem cell microvesicles, with a mode diameter of approximately 150nm - 200nm, or a median diameter of approximately 180nm - 350nm. Accordingly, microvesicles of the invention typically have a diameter between 100 and 1000nm, more typically between 150nm and 350nm.

Some microparticles of the invention express the CD 133 surface marker. Other microparticles of the invention do not express the CD133 surface marker. "Marker" refers to a biological molecule whose presence, concentration, activity, or phosphorylation state may be detected and used to identify the phenotype of a cell. Exosomes are endosome-derived lipid microparticles of typically 30-1 OOnm diameter and sometimes between 100nm and 200nm diameter, that are released from the cell by exocytosis. Exosome release occurs constitutively or upon induction, in a regulated and functionally relevant manner. During their biogenesis, exosomes incorporate a wide range of cytosolic proteins (including chaperone proteins, integrins, cytoskeletal proteins and the tetraspanins) and genetic material. Consequently, exosomes are considered to be inter-cellular communication devices for the transfer of proteins, lipids and genetic material between cells, in the parent cell microenvironment and over considerable distance. Although the invention is not bound by this theory, it is possible that the exosomes are responsible for the efficacy of the neural stem cells. Therefore, exosomes from neural stem cells are themselves expected to be therapeutically efficacious.

Microparticles designed to have desired functions

Microparticles retain at least some of the functions of the stem cells that produce them. Therefore, it is possible to design microparticles by manipulating the stem cell (which can be any stem cell type and is not limited to neural stem cells, although the neural stem cell microparticles of the invention are expressly included as an embodiment) to possess one or more desired functions, typically protein or miRNA. The manipulation will typically be genetic engineering, to introduce one or more exogenous coding, non-coding or regulatory nucleic acid sequences into the stem cell. For example, if an exosome containing VEGF and/or bFGF is desired, then the exosome-producing stem cell can be transformed or transfected to express (high levels of) VEGF and/or bFGF, which would then be incorporated into the microparticles produced by that stem cell. Similarly, iPS cells can be used to produce microparticles, and these cells can be designed to produce the proteins and nucleic acids (e.g. miRNA) that are required in the microparticles produced by the iPS cells. The invention therefore provides ad hoc microparticles, from any stem cell type, that contain a function that is not naturally present in the stem cell from which is produced, i.e. the microparticles (e.g. exosomes) contain one or more exogenous protein or nucleic acid sequences, are not naturally-occurring and are engineered. In one embodiment, isolated or purified microparticles are loaded with one or more exogenous nucleic acids, lipids, proteins, drugs or prodrugs which are intended to perform a desired function in a target cell. This does not require manipulation of the stem cell and the exogenous material can optionally be directly added to the microparticles. For example, exogenous nucleic acids can be introduced into the microparticles by electroporation. The microparticles can then be used as vehicles or carriers for the exogenous material. In one embodiment, microparticles that have been isolated from the cells that produced them are loaded with exogenous siRNA, typically by electroporation, to produce microparticles that can be deployed to silence one or more pathological genes. In this way, microparticles can be used as vehicles to deliver one or more agents, typically therapeutic or diagnostic agents, to a target cell. An example of this is a neural stem cell exosome comprising exogenous siRNA capable of silencing one or more pathological genes.

Microparticle Marker

The invention provides a population of isolated neural stem cell microparticles, wherein the population essentially comprises only microparticles of the invention, i.e. the microparticle population is pure. In many aspects, the microparticle population comprises at least about 80% (in other aspects at least 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100%) of the microparticles of the invention.

The isolated neural stem cell microparticle of the invention is characterised in that it has a distinctive expression profile for certain markers and is distinguished from microparticles from other cell types. When a marker is described herein, its presence or absence may be used to distinguish the microparticle. For example, the term "may comprise" or "may express" also discloses the contrary embodiment wherein that marker is not present, e.g. the phrase "the microparticle may comprise one or more tetraspanins, typically CD63, CD81 , CD9, CD53, CD82 and/or CD37" also describes the contrary embodiment wherein the microparticle may not comprise one or more tetraspanins, typically CD63, CD81 , CD9, CD53, CD82 and/or CD37.

The neural stem cell microparticle of the invention is typically considered to carry a marker if at least about 70% of the microparticles of the population, e.g. 70% of the membrane particles, membrane vesicles, microvesicles, exosome-like vesicles, exosomes, ectosome-like vesicles, ectosomes or exovesicles show a detectable level of the marker. In other aspects, at least about 80%, at least about 90% or at least about 95% or at least about 97% or at least about 98% or more of the population show a detectable level of the marker. In certain aspects, at least about 99% or 100% of the population show detectable level of the markers. Quantification of the marker may be detected through the use of a quantitative RT-PCR (qRT-PCR) or through fluorescence activated cell sorting (FACS). It should be appreciated that this list is provided by way of example only, and is not intended to be limiting. Typically, a neural stem cell microparticle of the invention is considered to carry a marker if at least about 90% of the microparticles of the population show a detectable level of the marker as detected by FACS. The markers described herein are considered to be expressed by a cell of the population of the invention, if its expression level, measured by qRT-PCR has a crossing point (Cp) value below or equal to 35 (standard cut off on a qRT-PCR array). The Cp represents the point where the amplification curve crosses the detection threshold, and can also be reported as crossing threshold (ct).

In one embodiment, the invention relates to microparticles produced by a neural stem cell population characterised in that the cells of the population express one or more of the markers Nestin, Sox2, GFAP, βΙΙ Ι tubulin, DCX, GALC, TUBB3, GDNF and IDO. In another embodiment, the microparticle is an exosome and the population of exosomes expresses one or more of DCX (doublecortin - an early neuronal marker), GFAP (Glial fibrillary acidic protein - an astrocyte marker), GALC, TUBB3, GDNF and I DO.

The neural stem cell microparticles of the invention may express one or more protein markers at a level which is lower or higher than the level of expression of that marker in a mesenchymal stem cell microparticle of the same species. Protein markers that are expressed by the CTX0E03 cell microparticles are identified herein and below. In some embodiments, the microparticles may express a protein marker at a level relative to a tubulin or other such control protein(s). In some embodiments, the microparticles of the invention may express that protein at a level of at least +/-1.2 fold change relative to the control protein, typically at least +/-1.5 fold change relative to the control protein, at least +1-2 fold change relative to the control protein or at least +/-3 fold change relative to the control protein. In some embodiments, the microparticles may express a protein marker at a level of between 10 "2 and 10 "6 copies per cell relative to a tubulin or other control protein. In some embodiments, the microparticles of the invention may express that protein at a level of between 10 "2 and 10 "3 copies per cell relative to a tubulin or other control protein.

The neural stem cell microparticles of the invention may express one or more miRNAs (including miRNA precursors) at a level which is lower or higher than the level of expression of that miRNA (including miRNA precursors) in a mesenchymal stem cell microparticle of the same species. miRNA markers that are expressed by the CTX0E03 cell microparticles are identified below. In some embodiments, the microparticles of the invention may express the marker miRNA at a level of least +/- 1 .5 fold change, typically at least +/- 2 fold change or at least +/- 3 fold change (calculated according to the AAct method, which is well-known) relative to U6B or 15a, or any other miRNA reference gene, also referred to as an internal control gene.

The neural stem cell microparticles of the invention may express one or more mRNAs at a level which is lower or higher than the level of expression of that mRNA in a mesenchymal stem cell microparticle of the same species. In some embodiments, the microparticles of the invention may express the marker mRNA at a level of least +/- 1.5 fold change, typically at least +/- 2 fold change or at least +/- 3 fold change (calculated according to the AAct method) relative to ATP5B or YWHAZ, or any other reference gene, also referred to as an internal control gene.

Exosomes of the invention typically express specific integrins, tetraspanins, MHC Class I and/or Class II antigens, CD antigens and cell-adhesion molecules on their surfaces, which may facilitate their uptake by specific cell types. Exosomes contain a variety of cytoskeletal proteins, GTPases, clathrin, chaperones, and metabolic enzymes (but mitochondrial, lysosomal and ER proteins are excluded, so the overall profile does not resemble the cytoplasm). They also contain mRNA splicing and translation factors. Finally, exosomes generally contain several proteins such as HSP70, HSP90, and annexins that are known to play signalling roles yet are not secreted by classical (ER-Golgi) mechanisms. The lipid bilayer of an exosome is typically enriched with cholesterol, sphingomyelin and ceramide. Exosomes also express one or more tetraspanin marker proteins. Tetraspanins include CD81 , CD63, CD9, CD53, CD82 and CD37. Exosomes can also include growth factors, cytokines and RNA, in particular miRNA. Exosomes typically express one or more of the markers TSG101 , Alix, CD109, thy-1 and CD133. Alix (Uniprot accession No. Q8WUM4), TSG101 (Uniprot accession No. Q99816) and the tetraspanin proteins CD81 (Uniprot accession No. P60033) and CD9 (Uniprot accession No. P21926) are characteristic exosome markers.

Alix is an endosomal pathway marker. Exosomes are endosomal-derived and, accordingly, a microparticle positive for this marker is characterised as an exosome. Exosomes of the invention are typically positive for Alix. Microvesicles of the invention are typically negative for Alix.

Microparticle proteome

Tables 18 and 20 list all proteins detected by mass spectrometry in exosomes and microvesicles, respectively, isolated from CTX0E03 cells cultured for two weeks in an Integra Celline multicompartment bioreactor. In one embodiment, exosomes of the invention comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% of the proteins listed in Table 18. Similarly, microvesicles of the invention typically comprise at least 70% at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% of the proteins listed in Table 20. In a further embodiment, the proteome of a microvesicle or exosome of the invention is least 70%, at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% identical to the proteome provided in Table 18 (exosome) or Table 20 (microvesicle). When determining the protein content of a microparticle or exosome, mass spectrometry is typically used, for example the LC/MS/MS method described in Example 13.

Tables 19 and 21 show the 100 most abundant proteins detected by mass spectrometry in exosomes and microvesicles, respectively, isolated from CTX0E03 cells cultured for two weeks in an Integra Celline multicompartment bioreactor. Typically, an exosome of the invention comprises the first ten proteins listed in Table 19, more typically the first 20, the first 30, the first 40 or the first 50 proteins listed in Table 19. Similarly, a microparticle of the invention typically comprises the first ten proteins listed in Table 21 , more typically the first 20, the first 30, the first 40 or the first 50 proteins listed in Table 21. In one embodiment, an exosome of the invention comprises all 100 proteins listed in Table 19. In one embodiment, a microvesicle of the invention comprises all 100 proteins listed in Table 21 . Typically, the 100 most abundant proteins in an exosome or microvesicle of the invention contain at least 70 of the proteins identified in Table 19 (exosome) or Table 21 (microparticle). More typically, the 100 most abundant proteins in an exosome or microvesicle of the invention contain at least 80, at least 90, at least 95, 96, 97, 98 or 99, or all 100 of the proteins identified in Table 19 (exosome) or Table 21 (microparticle).

Microparticle miRNA content

Example 12 (and the related Figure 1 1) shows the results of deep sequencing of miRNA present in CTX0E03 cells, microvesicles and exosomes produced by these cells. This Example shows that, surprisingly, the number of different miRNA species present in the microparticles is greatly reduced compared to the number of different miRNA species present in the cells; the microparticles contain fewer than 120 different miRNAs whereas the cells contain between 450 and 700 miRNA species. The microparticles contain a majority of hsa-miR-1246.

The data in Example 12 also show that the microparticles are characterised by four main miRNA species, namely hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532. These four miRNAs are the only miRNAs present at a read count of greater than 1000 in the microparticles; these four miRNAs are present in massive excess compared to the other miRNAs in the microparticles. This is in contrast to the profile in the cells, which contain a much greater number of miRNAs present at high (read count greater than 1000) or very high (read count greater than 10,000) levels. Although not bound by theory, the inventors propose that hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532 are selectively trafficked (or otherwise incorporated) into the microparticles and are thought to play a role in the function of the microparticles. Typically, in one embodiment microparticles, e.g. exosomes, of the invention contain one, two, three or all four of hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532. Each of these miRNA markers is typically present at a read count (optionally determined using the deep sequence technique described in Example 12) of at least 1000 per microparticle. hsa-miR-1246 may optionally have a read count of at least 2000, 5000, 10,000, 20,000, or 25,000 per microparticle. Hsa-miR-4492 may optionally have a read count of at least 2000, 3000, 4000 or 5000 per microparticle. Hsa-miR-4532 may optionally have a read count of at least 2000 or 3000 per microparticle. In one embodiment, each of hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and/or hsa-miR-4532 is present in the microparticle, e.g. exosome, at a higher read count than is present in the cell that produced the microparticle. In particular, miR-1246 typically has a read count in the microparticle at least twice the read count in the cell, more typically at least 4, 5, 6, 7, or 8 times the read count in the cell, and optionally 10, 15 or 20 times the read count in the cell.

In one embodiment, microparticles of the invention contain hsa-let-7a-5p, has-miR-92b-3p, hsa- miR-21 -5p, hsa-miR-92a-3p, hsa-miR-10a-5p, hsa-100-5p and/or hsa-99b-5p at a lower read count than is present in the cell that produced the microparticle. Typically, each of these miRNAs has a read count of less than 1000 in the microparticles of the invention, more typically less than 100, for example less than 50. Optionally, microparticles of the invention contain hsa- let-7a-5p at a read count of less than 50 or less than 25.

In one embodiment, microparticles of the invention contain fewer than 150 types of miRNA (i.e. different miRNA species) when analysed by deep sequencing, typically fewer than 120 types of miRNA.

In one embodiment, hsa-miR-1246 is the most abundant miRNA in the microparticles of the invention (optionally determined using the deep sequence technique described in Example 12). Typically, at least 40% of the total count of miRNA in microparticles (e.g. microvesicles and exosomes) of the invention is hsa-miR-1246. Typically, at least 50% of the total count of miRNA in exosomes of the invention is hsa-miR-1246. hsa-miR-4492 is typically the second-most abundant miRNA in the microparticles of the invention. Typically, at least 3% of the total count of miRNA in microparticles (e.g. microvesicles and exosomes) of the invention is hsa-miR-4492. More typically, at least 4% of the total count of miRNA in microparticles (e.g. microvesicles and exosomes) of the invention is hsa-miR-4492. Typically, at least 2% of the total count of miRNA in microparticles (e.g. microvesicles and exosomes) of the invention is hsa-miR-4532.

Typically, at least 1 % of the total count of miRNA in microparticles (e.g. microvesicles and exosomes) of the invention is hsa-miR-4488.

In one embodiment microparticles of the invention contain one or both of hsa-miR-4508, hsa- miR-4516 at a level at least 0.1 % of the total miRNA content of the particle. One or more of hsa-miR-3676-5p, hsa-miR-4485, hsa-miR-4497, hsa-miR-21 -5p, hsa-miR- 3195, hsa-miR-3648, hsa-miR-663b, hsa-miR-3656, hsa-miR-3687, hsa-miR-4466, hsa-miR- 4792, hsa-miR-99b-5p and hsa-miR-1973 may be present in the microparticles of the invention.

Typically, each of hsa-let-7a-5p and hsa-100-5p is present at less than 1 %, more typically less than 0.1 % or less than 0.05% of the total miRNA count in microparticles of the invention.

In a typical exosome of the invention, at least 50% of the total count of miRNA is hsa-miR-1246, and less than 0.1 % of the total miRNA count is hsa-let-7a-5p. In one embodiment, at least 90% of the total count of miRNA in microparticles of the invention comprises hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532. Typically, at least 95% or 96% of the total count of miRNA in microparticles of the invention comprises hsa-miR- 1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532. Less than 10% of the total miRNA content of these microparticles is an miRNA that is not hsa-miR-1246, hsa-miR-4492, hsa-miR- 4488 and hsa-miR-4532.

Combinations of the miRNA embodiments discussed above are provided. For example, a microparticle of the invention typically contains each of hsa-miR-1246, hsa-miR-4492, hsa-miR- 4488 and hsa-miR-4532 at a read count of at least 1000 and contains each of hsa-let-7a-5p, hsa-miR-92b-3p, hsa-miR-21 -5p, hsa-miR-92a-3p, hsa-miR-10a-5p, hsa-100-5p and hsa-99b- 5p at a read count of less than 100. Typically, at least 90% or at least 95% of the total miRNA in these microparticles is hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532.

A microparticle (e.g. microveside or exosome) of the invention typically has hsa-miR-1246 as the most abundant miRNA and hsa-miR-4492 is the second-most abundant miRNA. In this embodiment, at least 40% of the total count of miRNA in microparticles (e.g. microvesicles and exosomes) of the invention is hsa-miR-1246 and at least 3% of the total count of miRNA in the microparticle is hsa-miR-4492. At least 2% of the total count of miRNA in these microparticles is hsa-miR-4532 and at least 1 % of the total count of miRNA in these microparticles is hsa-miR- 4488. Each of hsa-let-7a-5p and hsa-100-5p is present at less than 0.1 % of the total miRNA count in these microparticles. Plotting the deep sequencing results in the exosomes and microvesicles as relative fold change compared to the cells confirms that hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR- 4532 are significantly upregulated in the exosomes and microvesicles compared to the cells. This comparison also shows that miRNA hsa-miR-3195 is the miRNA that is most upregulated, in both exosomes and microvesicles. Although the absolute reads of hsa-miR-3195 are in the range of -40 for exosomes and microvesicles, there is no hsa-miR-3195 detected in the cells. Accordingly, hsa-miR-3195 is uniquely found in the exosomes and microvesicles of the invention and, in one embodiment, an exosome or microvesicle of the invention comprises hsa- miR-3195. In one embodiment, microparticles of the invention comprise one or more of the following miRNA precursors:

AC079949.1 (SEQ ID NO:738)

GGCCGCGCCCCGTTTCCCAGGACAAAGGGCACTCCGCACCGGACCCTGGTCCCAGCG;

AP000318.1 (SEQ ID NO: 739)

CCCACTCCCTGGCGCCGCTTGTGGAGGGCCCAAGTCCTTCTGATTGAGGCCCAACCCGTG GAAG;

AL161626.1 (SEQ ID NO:740)

CGCCGGGACCGGGGTCCGGGGCGGAGTGCCCTTCCTCCTGGGAAACGGGGTGCGGC ;

AC004943.1 (SEQ ID NO:741)

GCTTCACGTCCCCACCGGCGGCGGCGGCGGTGGCAGTGGCGGCGGCGGCGGCGGTGGCGG CGGCGGCGGCGGCGGCG GCTC ; and

AL121897.1 (SEQ ID NO:742)

GCCGCCCCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCCGCTTTCGGCTCGGG CCTCAGGTGAGTCGGAG GGGCCGGGCGCC In one embodiment, microparticles of the invention comprise one, two or three of the following mature miRNAs derived from the precursors listed above (as detailed in part D of Example 12): ggcggagugcccuucuuccugg (derived from AL161626.1 -201) (SEQ ID NO:743)

ggagggcccaaguccuucugau (derived from AP000318.1 -201) (SEQ ID NO:744)

gaccaggguccggugcggagug (derived from AC079949.1 -201) (SEQ ID NO:745)

These 5 miRNA precursors and 3 mature miRNAs have not previously been isolated and each sequence is therefore also provided as a new sequence per se. Accordingly, in one aspect, the invention provides a composition comprising one or more of the miRNA precursors AC079949.1 , AP000318.1 , AL161626.1 , AC004943.1 and AL121897.1. In another embodiment, the invention provides a composition comprising one or more of the mature miRNAs ggcggagugcccuucuuccugg (derived from AL161626.1 -201), ggagggcccaaguccuucugau (derived from AP000318.1 -201) and gaccaggguccggugcggagug (derived from AC079949.1 - 201). Optionally, the composition is a pharmaceutical composition comprising one or more of the miRNA precursors and/or one or more of the mature miRNAs and a pharmaceutically- acceptable carrier or diluent. As noted in Example 12, these miRNAs and precursors appear to be selectively shuttled into the exosomes and microvesicles and so may be at least partially responsible for the function of the microparticles.

Example 12 also shows that neural stem cell microparticles comprise a variety of non-coding RNA species. In one embodiment, microparticles of the invention comprise one or more of ribosomal RNA, small nucleolar RNA, small nuclear RNA, microRNA, large intergenic non-coding RNA and miscellaneous other RNA (e.g. RMRP, vault RNA, metazoan SRP and/or RNY).

Example 4 shows miRNAs present in microparticles produced by the CTX0E03 cells and having a Cp below 35 as determined by a qRT-PCR array. Typically, in one embodiment microparticles of the invention contain 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 or more, or all, of the following miRNAs (identified according by name according to Ambros et al and accessible at www.mirbase.org): hsa-let-7a

hsa-let-7b

hsa-let-7c

hsa-let-7d

hsa-let-7e

hsa-let-7f

hsa-let-7g

hsa-let-7i

hsa-miR-100

hsa-miR-101

hsa-miR-103a

hsa-miR-106b

hsa-miR-10a

hsa-miR-10b

hsa-miR-124

hsa-miR-125a-5p

hsa-miR-125b hsa-miR-126 hsa-miR-127-5p sa-miR-128 hsa-miR-129-5p hsa-miR-130a hsa-miR-132 hsa-miR-134 hsa-miR-137 hsa-miR-141 hsa-miR-146b-5p hsa-miR-150 hsa-miR-155 hsa-miR-15a hsa-miR-15b hsa-miR-16 hsa-miR-17 hsa-miR-181 a hsa-miR-182 hsa-miR-183 hsa-miR-185 hsa-miR-18a hsa-miR-18b hsa-miR-192 hsa-miR-194 hsa-miR-195 hsa-miR-196a hsa-miR-205 hsa-miR-20a hsa-miR-20b hsa-miR-21 hsa-miR-210 hsa-miR-214 hsa-miR-218 hsa-miR-219-5p hsa-miR-22 hsa-miR-222 hsa-miR-23b hsa-miR-24 hsa-miR-26a hsa-miR-301 a hsa-miR-302a hsa-miR-302c

hsa-miR-33a

hsa-miR-345

hsa-miR-375

hsa-miR-378

hsa-miR-424

hsa-miR-7

hsa-miR-9

hsa-miR-92a

hsa-miR-93

hsa-miR-96

hsa-miR-99a ne embodiment, the CTX0E03 microparticles contain 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or more of the following miRNAs (which are selected from the list above):

Proteins detected by a dot-blot

Example 5 shows proteins present in microparticles produced by the CTX0E03 cells, as detected by a dot-blot. Typically, microparticles of the invention contain 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or all of the following proteins:

EDA-A2

Galectin-3

IGFBP-2

IGFBP-rp1/IGFBP-7

IL-1 a

LECT2

MCP-1

SPARC

TIMP-1

Thrombospondin-1

VEGF

Galectin-3 and Thrombospondin-1 are also identified as present in exosomes and microvesicles in Example 13. TIMP-1 is identified in Example 13 as being present in exosomes.

Example 5 also shows that the microparticles produced by the CTX0E03 cells may also express 1 , 2, 3, 4 or 5 of the following proteins:

EGF-R/ErbB1

MDC

Endostatin

Follistatin

Csk

EGF-R and Csk are also identified as present in exosomes and microvesicles in Example 13.

Galectin-3, SPARC, TIMP-1 , Thrombospondin-1 , VEGF, MDC and Endostatin are known to be modulate angiogenesis. Accordingly, microparticles containing one or more of these proteins are useful in treating diseases or disorders requiring modulation of angiogenesis. IL-1 a, LECT2, MCP-1 and Csk are known to modulate inflammation. Accordingly, microparticles containing one or more of these proteins are useful in treating diseases or disorders requiring modulation of inflammation. Microparticles containing one or more of (i) Galectin-3, SPARC, TIMP-1 , Thrombospondin-1 , VEGF, MDC and Endostatin, and one or more of (ii) IL-1 a, LECT2, MCP-1 and Csk, may be useful for treating diseases or disorders requiring modulation of angiogenesis and inflammation.

Neural Stem cells in multi-compartment bioreactor culture

As shown in Example 10 and Figure 9 below, after multi-compartment bioreactor culture for three weeks, neural stem cells express a number of markers at significantly higher levels than neural stem cells cultured according to standard procedure in a standard single-compartment T175 flask. In one embodiment, microparticles of the invention are isolated from NSCs that have been cultured, typically in a multi-compartment bioreactor, for at least two weeks, typically at least three weeks, at least four weeks, at least five weeks or at least six weeks. Optionally, the NSCs have been cultured for no more than ten weeks, e.g. between 2 and 10 weeks, between 3 and 10 weeks, between 4 and 10 weeks, between 5 and 10 weeks or between 6 and 10 weeks. CTX0E03 neural stem cells cultured for three weeks in a multi-compartment bioreactor express DCX, GALC, GFAP, TUBB3, GDNF and IDO at a higher level than neural stem cells cultured in a standard single-compartment T175 cell culture. Accordingly neural stem cells that have been cultured in a multi-compartment bioreactor, typically for a week or more, ten days or more, two weeks or more, or at least three weeks, four weeks, five weeks or more, may express one or more of DCX, GALC, GFAP, TUBB3, GDNF and IDO. Cells cultured in a two-compartment bioreactor typically show increased expression of one or more of DCX, GALC, GFAP, TUBB3, GDNF and IDO compared to the stem cells cultured under standard conditions. The expression level of these markers in the multi-compartment bioreactor-cultured cells is typically significantly higher than in the cells cultured in a standard single-compartment T175 culture flask. Typically, a stem cell cultured in a multi-compartment bioreactor expresses one or more of DCX1 , GALC, GFAP, TUBB3, GDNF or IDO at a level least 2 fold higher than in CTX0E03 cells cultured in a T-175 flask according to standard culture procedure. In one embodiment, microparticles, typically exosomes, are obtained from neural stem cells that show increased expression of one or more of DCX, GALC, GFAP, TUBB3, GDNF and IDO compared to the stem cells cultured under standard conditions. For example, microparticles can be obtained from freshly filtered conditioned medium collected from Integra CeLLine bioreactor cultured neural stem cells. The upregulated markers include DCX (doublecortin - an early neuronal marker), GFAP (Glial fibrillary acidic protein - an astrocyte marker), GALC, TUBB3, GDNF and IDO. CTX0E03 cells are able to differentiate into 3 different cell types: neurons, astrocytes and oligodendrocytes. The high levels of DCX and GFAP after three weeks in a multi-compartment bioreactor indicates that the cultured stem cells have partially differentiated and have entered the neuronal (DCX+ cells) and/or astrocytic (GFAP+ cells) lineage. Accordingly, in one embodiment the invention provides a microparticle produced by a neural stem cell population that expresses (i) one or more markers associated with a neuronal lineage, typically DCX and/or (ii) one or more markers associated with an astrocytic lineage, typically GFAP. In another embodiment, the invention provides neural stem cell microparticles, typically exosomes, that express (i) one or more markers associated with a neuronal lineage, typically DCX and/or (ii) one or more markers associated with an astrocytic lineage, typically GFAP. These cells, or the microparticles (typically exosomes) derived from these cells, express DCX and/or GFAP at a higher level than the corresponding stem cells in standard (T-175) culture. Typically, these cells or microparticles express DCX and/or GFAP at a level at least 2 fold more than the stem cells, more typically at least 2.5 fold more than the corresponding stem cells in standard culture, at least 5 fold more than the corresponding stem cells in standard culture, at least 7.5 fold more than the corresponding stem cells in standard culture or at least 10 fold more than the corresponding stem cells in standard culture. For expression of DCX, the fold change in the cells or microparticles compared to the corresponding stem cells in standard (T-175) culture can optionally be at least 20 fold, at least 50 fold, at least 100 fold, at least 500 fold or at least 1000 fold more than the standard stem cells.

The term "bioreactor" is to be given its usual meaning in the art, i.e. an apparatus used to carry out a bioprocess. The bioreactors described herein are suitable for use in stem cell culture. Simple bioreactors for cell culture are single compartment flasks, such as the commonly-used T-175 flask (e.g. the BD Falcon™ 175 cm 2 Cell Culture Flask, 750 ml, tissue-culture treated polystyrene, straight neck, blue plug-seal screw cap, BD product code 353028). Bioreactors can have multiple compartments, as is known in the art. These multi-compartment bioreactors typically contain at least two compartments separated by one or more membranes or barriers that separate the compartment containing the cells from one or more compartments containing gas and/or culture medium. Multi-compartment bioreactors are well-known in the art. An example of a multi-compartment bioreactor is the Integra CeLLine bioreactor, which contains a medium compartment and a cell compartment separated by means of a 10 kDa semi-permeable membrane; this membrane allows a continuous diffusion of nutrients into the cell compartment with a concurrent removal of any inhibitory waste product. The individual accessibility of the compartments allows to supply cells with fresh medium without mechanically interfering with the culture. A silicone membrane forms the cell compartment base and provides an optimal oxygen supply and control of carbon dioxide levels by providing a short diffusion pathway to the cell compartment. Any multi-compartment bioreactor may be used according to the invention.

Example 1 1 , Table 3 and Figure 10 show that the miRNA content of exosomes produced by neural stem cells that have been cultured in a multi-compartment bioreactor, for three weeks, is different from the miRNA content of stem cells cultured in standard T-175 flasks and from microparticles produced by the neural stem cells cultured in a single-compartment T175 culture flask for three weeks. In one embodiment, the invention provides a microparticle, typically an exosome, wherein at least two, three, four, five, six or seven miRNAs are up or down regulated compared to in the corresponding stem cells cultured in standard T-175 flasks, as calculated by Fold Regulation (see Example 1 1). The Fold Regulation of each miRNA is optionally at least two-fold up or down.

It can be seen from Figure 6C and Example 8 that exosomes isolated from NSCs show particularly surprising efficacy when the NSCs have been cultured for several weeks. Accordingly, in one embodiment, exosomes of the invention are isolated from NSCs that have been cultured, typically in a multi-compartment bioreactor, for at least two weeks, typically at least three weeks, at least four weeks, at least five weeks or at least six weeks. Optionally, the NSCs have been cultured for no more than ten weeks, e.g. between 2 and 10 weeks, between 3 and 10 weeks, between 4 and 10 weeks, between 5 and 10 weeks or between 6 and 10 weeks.

In one embodiment, neural stem cell exosomes of the invention express one, two, three, four, five, six or seven of the following miRNAs at a higher level than is expressed in the corresponding stem cells cultured in standard T-175 flasks, as calculated by Fold Regulation (where an asterisk indicates an miRNA where at least a two-fold regulation increase is preferred):

hsa-miR-146b-5p*

hsa-let-7c*

hsa-miR-99a*

hsa-miR-132*

hsa-miR-378*

hsa-miR-181 a*

hsa-let-7b*

In one embodiment, neural stem cell exosomes of the invention express one, two, three, four, five, six, seven, eight, nine, ten or more of the following miRNAs at a lower level than is expressed in the corresponding stem cells cultured in standard T-175 flasks, as calculated by Fold Regulation (where an asterisk indicates an miRNA where at least a two-fold regulation decrease is preferred):

In a further embodiment, NSC exosomes of the invention comprise (i) an increased level of at least one, two, three, four, five, six or seven of the miRNAs indicated above as being increased in exosomes compared to the corresponding cells in standard culture and (ii) a decreased level of at least one, two, three, four, five, six, seven, eight, nine, ten or more or more of the miRNAs indicated above as being decreased in exosomes compared to the corresponding cells in standard culture. For example, a neural stem cell exosome may contain a fold-regulation increase in three or more or more of the miRNAs indicated above as being increased in exosomes compared to the corresponding cells in standard culture and a fold-regulation decrease in three or more of the miRNAs indicated above as being decreased in exosomes compared to the corresponding cells in standard culture. In another exemplary embodiment, a neural stem cell exosome may contain a fold-regulation increase in five or more of the miRNAs indicated above as being increased in exosomes compared to the corresponding cells in standard culture and a fold-regulation decrease in five or more of the miRNAs indicated above as being decreased in exosomes compared to the corresponding cells in standard culture.

The term "expressed" is used to describe the presence of a marker within a cell or microparticle. In order to be considered as being expressed, a marker must be present at a detectable level. By "detectable level" is meant that the marker can be detected using one of the standard laboratory methodologies such as qRT-PCR, or qPCR, blotting, Mass Spectrometry or FACS analysis. A gene is considered to be expressed by a cell or microparticle of the population of the invention if expression can be reasonably detected at a crossing point (cp) values below or equal 35. The terms "express" and "expression" have corresponding meanings. At an expression level below this cp value, a marker is considered not to be expressed. The comparison between the expression level of a marker in a stem cell or microparticle of the invention, and the expression level of the same marker in another cell or microparticle, such as for example an mesenchymal stem cell, may preferably be conducted by comparing the two eel l/micro particle types that have been isolated from the same species. Preferably this species is a mammal, and more preferably this species is human. Such comparison may conveniently be conducted using a reverse transcriptase polymerase chain reaction (RT-PCR) experiment.

As used herein, the term "significant expression" or its equivalent terms "positive" and "+" when used in regard to a marker shall be taken to mean that, in a cell or microparticle population, more than 20%, preferably more than, 30%, 40%, 50%, 60%, 70%, 80%, 90% 95%, 98%, 99% or even all of the cells of the cells/microparticles express said marker.

As used herein, "negative" or "-" as used with respect to markers shall be taken to mean that, in a cell or microparticle population, less than 20%, 10%, preferably less than 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 % or none of the cells/microparticles express said marker.

Expression of microparticle surface markers may be determined, for example, by means of flow cytometry and/or FACS for a specific cell surface marker using conventional methods and apparatus (for example a Beckman Coulter Epics XL FACS system used with commercially available antibodies and standard protocols known in the art) to determine whether the signal for a specific microparticle surface marker is greater than a background signal. The background signal is defined as the signal intensity generated by a non-specific antibody of the same isotype as the specific antibody used to detect each surface marker. For a marker to be considered positive the specific signal observed is typically more than 20%, preferably stronger than 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 500%, 1000%, 5000%, 10000% or above, greater relative to the background signal intensity. Alternative methods for analysing expression of microparticle surface markers of interest include visual analysis by electron microscopy using antibodies against cell-surface markers of interest.

"Fluorescence activated cell sorting (FACS)" is a method of cell purification based on the use of fluorescent labelled antibodies. The antibodies are directed to a marker on the cell surface, and therefore bind to the cells of interest. The cells are then separated based upon the fluorescent emission peak of the cells.

Microparticle markers (including surface and intracellular proteins) can also be analysed by various methods known to one skilled in the art to assay protein expression, including but not limited to gel electrophoresis followed by western blotting with suitable antibodies, immunoprecipitation followed by electrophoretic analysis, and/or electron microscopy as described above, with microparticle permeabilisation for intraparticle markers. For example, expression of one or more tetraspanins may be assayed using one or more of the above methods or any other method known to one skilled in the art. RNA levels may also be analysed to assess marker expression, for example qRT-PCR. Microparticle Function

As noted above, a neural stem cell microparticle retains at least one biological function of the stem cell from which it is derived. Biological functions that may be retained include the ability to promote angiogenesis, tissue regeneration, tissue repair, and/or neurogenesis, the ability to effect cognitive improvement in the brain of a patient that has suffered a stroke, or the ability to accelerate blood flow recovery in peripheral arterial disease.

For example, CTX0E03 cells are known to inhibit T cell activation in a PBMC assay and, in one embodiment, the microparticles of the invention retain this ability to inhibit T cell activation in a PBMC assay. PBMC assays are well-known to the skilled person and kits for performing the assay are commercially available.

Example 8, Table 2 and Figure 6 demonstrate that CTX0E03 stem cell exosomes retain the ability to close a wound in a "scratch" model of wound healing. The results show that the migration activity of normal human dermal fibroblasts (NHDF) cultured in CTX0E03 conditioned media is almost the same as the migration activity observed on the addition of purified exosomes. Accordingly, one biological function that microparticles of the invention may retain is the ability to stimulate migration activity of normal human dermal fibroblasts (NHDF). NHDF migration assays are known in the art. Stimulation of NHDF migration may be determined using an in vitro scratch (wound closure) assay, for example the assay of Example 8(A). Wound closure is calculated as the area covered by NHDF cells in relation to the initial wound area as determined at 0 hours. Stimulation of NHDF migration in this assay is typically defined as an increase in wound closure, typically a wound closure at least 1.2x greater, more typically at least 1.5x greater, than the wound closure under basal conditions (without the microparticles) after 24 hours. After 48 hours, the wound closure is typically at least 1.2x greater or 1.5x greater, more typically at least 2x greater, than the wound closure under basal conditions (without the microparticles). Stimulation of NHDF migration may also be defined as causing a wound closure of 100%, as determined by the scratch assay, at least 24 hours before 100% wound closure is observed under basal conditions.

Example 8 also shows that microvesicles of the invention are able to stimulate angiogenesis of primary HUVECs and to stimulate neurite outgrowth of PC-12 cells. Accordingly, a biological function that microparticles of the invention may retain is the ability to stimulate angiogenesis of primary HUVECs and/or to stimulate neurite outgrowth of PC-12 cells. Angiogenesis and neurite outgrowth assays are known in the art. Stimulation of angiogenesis of primary HUVECs may be determined using a 24 hour angiogenesis assay using an ibidi μ-slide and Wimtube detection and analysis of tube length and bifurcation points, for example the assay of Example 8(B). Stimulation of angiogenesis in this assay is typically defined as an increase compared to basal angiogenesis, e.g. >100% basal angiogenesis, typically at least 1 10%, at least 120% or at least 140% basal angiogenesis (i.e. at least 1.1x, at least 1.2x or at least 1.4x the basal level of angiogenesis). Stimulation of neurite outgrowth may be determined by detecting outgrowth of PC-12 cells through a 1 μηι insert, for example the assay of Example 8(C). Stimulation of neurite outgrowth in this assay is typically defined as an increase in neurite outgrowth compared to basal conditions (without microparticles), or an increase in neurite outgrowth when the microparticle is combined with NGF compared to the addition of NGF alone, as quantified by a spectrophotometer.

The proteomic analysis in Example 13 indicates that neural stem cell exosomes comprise biological functions associated with the production, packaging, function and degradation of genetic material. Accordingly, in one embodiment, exosomes of the invention retain these functions, typically one or more of RNA polymerase function, RNA degradation function, ribosome function and spliceosome function.

Immunogenicity

The (allogeneic) neural stem cell microparticles of the invention typically either do not trigger an immune response in vitro or in vivo or trigger an immune response which is substantially weaker than that which would be expected to be triggered upon injection of an allogeneic stem cell population into a patient. In certain aspects of the invention, the neural stem cell microparticles are considered not to trigger an immune response if at least about 70% of the microparticles do not trigger an immune response. In some embodiments, at least about 80%, at least about 90% or at least about 95%, 99% or more of the microparticles do not trigger an immune response. Preferably the microparticles of the invention do not trigger an antibody mediated immune response or do not trigger a humoral immune response. More preferably the microparticles of the invention do not trigger either an antibody mediated response or a humoral immune response in vitro. More preferably still, the microparticles of the invention do not trigger a mixed lymphocyte immune response. It will be understood by one skilled in the art that the ability of the cells of the invention to trigger an immune response can be tested in a variety of ways.

CTX0E03 cells transplanted in a rodent model of limb ischemia have been previously demonstrated a faster and transient up-regulation of host genes involved in angiogenesis, such as CCL1 1 , CCL2, CXCL1 , CXCL5, IGF1 , ΙΙ_1 β, IL6, HGF, HIFIot, bFGF, VEGFA, and VEGFC, compared to vehicle treated controls. hNSC treatment transiently elevates host innate immune and angiogenic responses and accelerates tissue regeneration. The CTX0E03 cell line has been previously demonstrated, using a human PBMC assay, not to be immunogenic. Accordingly, microparticles produced by CTX0E03 cells are also expected to be non-immunogenic. The lack of immunogenicity allows the microparticles to avoid clearance by the host/patient immune system and thereby exert their therapeutic effect without a deleterious immune and inflammatory response.

Neural Stem Cells

The neural stem cell that produces the microparticle may be a stem cell line, i.e. a culture of stably dividing stem cells. A stem cell line can to be grown in large quantities using a single, defined source. Immortalisation may arise from a spontaneous event or may be achieved by introducing exogenous genetic information into the stem cell which encodes immortalisation factors, resulting in unlimited cell growth of the stem cell under suitable culture conditions. Such exogenous genetic factors may include the gene "myc", which encodes the transcription factor Myc. The exogenous genetic information may be introduced into the stem cell through a variety of suitable means, such as transfection or transduction. For transduction, a genetically engineered viral vehicle may be used, such as one derived from retroviruses, for example lentivirus.

Additional advantages can be gained by using a conditionally immortalised stem cell line, in which the expression of the immortalisation factor can be regulated without adversely affecting the production of therapeutically effective microparticles. This may be achieved by introducing an immortalisation factor which is inactive unless the cell is supplied with an activating agent. Such an immortalisation factor may be a gene such as c-mycER. The c-MycER gene product is a fusion protein comprising a c-Myc variant fused to the ligand-binding domain of a mutant estrogen receptor. C-MycER only drives cell proliferation in the presence of the synthetic steroid 4-hydroxytamoxifen (4-OHT) (Littlewood et al.1995). This approach allows for controlled expansion of neural stem cells in vitro, while avoiding undesired in vivo effects on host cell proliferation (e.g. tumour formation) due to the presence of c-Myc or the gene encoding it in microparticles derived from the neural stem cell line. A suitable c-mycER conditionally immortalized neural stem cell is described in United States Patent 7416888. The use of a conditionally immortalised neural stem cell line therefore provides an improvement over existing stem cell microparticle isolation and production.

Preferred conditionally-immortalised cell lines include the CTX0E03, STR0C05 and HPC0A07 neural stem cell lines, which have been deposited at the European Collection of Animal Cultures (ECACC), Vaccine Research and Production laboratories, Public Health Laboratory Services, Porton Down, Salisbury, Wiltshire, SP4 0JG, with Accession No. 04091601 (CTX0E03); Accession No.041 10301 (STR0C05); and Accession No.04092302 (HPC0A07). The derivation and provenance of these cells is described in EP1645626 B1 . The advantages of these cells are retained by microparticles produced by these cells.

The cells of the CTX0E03 cell line may be cultured in the following culture conditions:

· Human Serum Albumin 0.03%

• Transferrin, Human 5 g/ml

• Putrescine Dihydrochloride 16.2 ig/m\

• Insulin Human recombinant 5 μ/ml

• Progesterone 60 ng/ml

· L-Glutamine 2 mM

• Sodium Selenite (selenium) 40 ng/ml

Plus basic Fibroblast Growth Factor (10 ng/ml), epidermal growth factor (20 ng/ml) and 4- hydroxytamoxifen 100nM for cell expansion. The cells can be differentiated by removal of the 4- hydroxytamoxifen. Typically, the cells can either be cultured at 5% C0 2 /37°C or under hypoxic conditions of 5%, 4%, 3%, 2% or 1 % 0 2 . These cell lines do not require serum to be cultured successfully. Serum is required for the successful culture of many cell lines, but contains many contaminants including its own exosomes. A further advantage of the CTX0E03, STR0C05 or HPC0A07 neural stem cell lines, or any other cell line that does not require serum, is that the contamination by serum is avoided.

The cells of the CTX0E03 cell line (and microparticles derived from these cells) are multipotent cells originally derived from 12 week human fetal cortex. The isolation, manufacture and protocols for the CTX0E03 cell line is described in detail by Sinden, et al. (U.S. Pat. 7,416,888 and EP1645626 B1 ). The CTX0E03 cells are not "embryonic stem cells", i.e. they are not pluripotent cells derived from the inner cell mass of a blastocyst; isolation of the original cells did not result in the destruction of an embryo.

The CTX0E03 cells (and microparticles derived from these cells) are angiogenic and so are useful in treating diseases requiring angiogenesis, such as Peripheral Arterial Disease. The cells (and microparticles derived from these cells) are also neurogenic and are therefore useful in treating diseases requiring neurogenesis, such as the ischaemia (stroke) damaged brain. CTX0E03 is a clonal cell line that contains a single copy of the c-mycER transgene that was delivered by retroviral infection and is conditionally regulated by 4-OHT (4-hydroxytamoxifen). The C-mycER transgene expresses a fusion protein that stimulates cell proliferation in the presence of 4-OHT and therefore allows controlled expansion when cultured in the presence of 4-OHT. This cell line is clonal, expands rapidly in culture (doubling time 50-60 hours) and has a normal human karyotype (46 XY). It is genetically stable and can be grown in large numbers. The cells are safe and non-tumorigenic. In the absence of growth factors and 4-OHT, the cells undergo growth arrest and differentiate into neurons and astrocytes. Once implanted into an ischemia-damaged brain, these cells migrate only to areas of tissue damage. The development of the CTX0E03 cell line has allowed the scale-up of a consistent product for clinical use. Production of cells from banked materials allows for the generation of cells in quantities for commercial application (Hodges et al, 2007).

Pollock et al 2006 describes that transplantation of CTX0E03 in a rat model of stroke (MCAo) caused statistically significant improvements in both sensorimotor function and gross motor asymmetry at 6-12 weeks post-grafting. These data indicate that CTX0E03has the appropriate biological and manufacturing characteristics necessary for development as a therapeutic cell line. Stevanato et al 2009 confirms that CTX0E03 cells downregulated c-mycERTAM transgene expression both in vitro following EGF, bFGF and 4-OHT withdrawal and in vivo following implantation in MCAo rat brain. The silencing of the c-mycERTAM transgene in vivo provides an additional safety feature of CTX0E03 cells for potential clinical application. Smith et al 2012 describe preclinical efficacy testing of CTX0E03 in a rat model of stroke (transient middle cerebral artery occlusion). The results indicate that CTX0E03 implants robustly recover behavioral dysfunction over a 3 month time frame and that this effect is specific to their site of implantation. Lesion topology is potentially an important factor in the recovery, with a stroke confined to the striatum showing a better outcome compared to a larger area of damage.

Neural retinal stem cell lines (for example as described in US 7514259) may also be used according to the invention. The term "culture medium" or "medium" is recognized in the art, and refers generally to any substance or preparation used for the cultivation of living cells. The term "medium", as used in reference to a cell culture, includes the components of the environment surrounding the cells. Media may be solid, liquid, gaseous or a mixture of phases and materials. Media include liquid growth media as well as liquid media that do not sustain cell growth. Media also include gelatinous media such as agar, agarose, gelatin and collagen matrices. Exemplary gaseous media include the gaseous phase to which cells growing on a petri dish or other solid or semisolid support are exposed. The term "medium" also refers to material that is intended for use in a cell culture, even if it has not yet been contacted with cells. In other words, a nutrient rich liquid prepared for bacterial culture is a medium. Similarly, a powder mixture that when mixed with water or other liquid becomes suitable for cell culture may be termed a "powdered medium". "Defined medium" refers to media that are made of chemically defined (usually purified) components. "Defined media" do not contain poorly characterized biological extracts such as yeast extract and beef broth. "Rich medium" includes media that are designed to support growth of most or all viable forms of a particular species. Rich media often include complex biological extracts. A "medium suitable for growth of a high density culture" is any medium that allows a cell culture to reach an OD600 of 3 or greater when other conditions (such as temperature and oxygen transfer rate) permit such growth. The term "basal medium" refers to a medium which promotes the growth of many types of microorganisms which do not require any special nutrient supplements. Most basal media generally comprise of four basic chemical groups: amino acids, carbohydrates, inorganic salts, and vitamins. A basal medium generally serves as the basis for a more complex medium, to which supplements such as serum, buffers, growth factors, lipids, and the like are added. In one aspect, the growth medium may be a complex medium with the necessary growth factors to support the growth and expansion of the cells of the invention while maintaining their self-renewal capability. Examples of basal media include, but are not limited to, Eagles Basal Medium, Minimum Essential Medium, Dulbecco's Modified Eagle's Medium, Medium 199, Nutrient Mixtures Ham's F-10 and Ham's F-12, McCoy's 5A, Dulbecco's MEM/F-I 2, RPMI 1640, and Iscove's Modified Dulbecco's Medium (IMDM).

Pharmaceutical Compositions

The neural stem cell microparticle of the invention is useful in therapy and can therefore be formulated as a pharmaceutical composition. A pharmaceutically acceptable composition typically includes at least one pharmaceutically acceptable carrier, diluent, vehicle and/or excipient in addition to the microparticles of the invention. An example of a suitable carrier is Ringer's Lactate solution. A thorough discussion of such components is provided in Gennaro (2000) Remington: The Science and Practice of Pharmacy. 20th edition, ISBN: 0683306472. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

The composition, if desired, can also contain minor amounts of pH buffering agents. The carrier may comprise storage media such as Hypothermosol®, commercially available from BioLife Solutions Inc., USA. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E W Martin. Such compositions will contain a prophylactically or therapeutically effective amount of a prophylactic or therapeutic microparticle preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject. The formulation should suit the mode of administration. In a preferred embodiment, the pharmaceutical compositions are sterile and in suitable form for administration to a subject, preferably an animal subject, more preferably a mammalian subject, and most preferably a human subject.

The pharmaceutical composition of the invention may be in a variety of forms. These include, for example, semi-solid, and liquid dosage forms, such as lyophilized preparations, liquid solutions or suspensions, injectable and infusible solutions. The pharmaceutical composition is preferably injectable. A particular advantage of the micro particles of the invention is their improved robustness compared to the stem cells from which they are obtained; the microparticles can therefore be subjected to formulation, such as lyophilisation, that would not be suitable for stem cells.

It is preferred that the methods, medicaments and compositions of the invention are used for treating or repairing damaged tissue, and/or for the treatment, modulation, prophylaxis, and/or amelioration of one or more symptoms associated with tissue disorders. Particularly preferred is the use of the methods, medicaments, compositions and microparticles of the invention in regenerative therapy, typically the treatment of stroke, peripheral arterial disease or blindness- causing diseases of the retina.

Pharmaceutical compositions will generally be in aqueous form. Compositions may include a preservative and/or an antioxidant.

To control tonicity, the pharmaceutical composition can comprise a physiological salt, such as a sodium salt. Sodium chloride (NaCI) is preferred, which may be present at between 1 and 20 mg/ml. Other salts that may be present include potassium chloride, potassium dihydrogen phosphate, disodium phosphate dehydrate, magnesium chloride and calcium chloride.

Compositions may include one or more buffers. Typical buffers include: a phosphate buffer; a Tris buffer; a borate buffer; a succinate buffer; a histidine buffer; or a citrate buffer. Buffers will typically be included at a concentration in the 5-20mM range. The pH of a composition will generally be between 5 and 8, and more typically between 6 and 8 e.g. between 6.5 and 7.5, or between 7.0 and 7.8. The composition is preferably sterile. The composition is preferably gluten free. The composition is preferably non-pyrogenic.

In a typical embodiment, the microparticles are suspended in a composition comprising 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox®), Na + , K + , Ca 2+ , Mg 2+ , CI " , H 2 P0 4 " , HEPES, lactobionate, sucrose, mannitol, glucose, dextron-40, adenosine and glutathione. Typically, the composition will not include a dipolar aprotic solvent, e.g. DMSO. Suitable compositions are available commercially, e.g. HypoThermasol ® -FRS. Such compositions are advantageous as they allow the microparticles to be stored at 4°C to 25°C for extended periods (hours to days) or preserved at cryothermic temperatures, i.e. temperatures below -20 ° C. The microparticles may then be administered in this composition after thawing.

The pharmaceutical composition can be administered by any appropriate route, which will be apparent to the skilled person depending on the disease or condition to be treated. Typical routes of administration include intravenous, intra-arterial, intramuscular, subcutaneous, intracranial, intranasal or intraperitoneal. For treatment of a disorder of the brain, one option is to administer the microparticles intra-cerebrally, typically to the site of damage or disease.

The microparticles will be administered at a therapeutically or prophylactically-effective dose, which will be apparent to the skilled person. Due to the low or non-existent immunogenicity of the microparticles, it is possible to administer repeat doses without inducing a deleterious immune response.

Therapeutic uses

The microparticles of the invention are useful in the treatment or prophylaxis of disease. Accordingly, the invention includes a method of treating or preventing a disease or disorder in a patient using a microparticle of the invention. The term "patient" includes human and other mammalian subjects that receive either prophylactic or therapeutic treatment. As noted above, the compositions comprising miRNAs of the invention are also useful in these therapies, and references to therapeutic uses of microparticles herein therefore applies equally to the compositions comprising miRNAs.

Therapeutically useful microparticles of the invention have regenerative activity. A microparticle having regenerative activity is a microparticle that is capable of activating or enhancing regenerative processes, or inhibiting or reducing degenerative processes. Regenerative processes lead to renewal, restoration, repair and/or growth of cells and tissues. Degenerative processes lead to a loss of cell or tissue integrity and/or function. This may be particularly useful in treating damaged or disturbed cells or tissues, such as those resulting from Stroke, psychiatric disorders, myocardial infarction, Amyotrophic lateral sclerosis and Peripheral arterial disease. The micro particles of the invention are useful in tissue regeneration. "Tissue regeneration" is the process of increasing the number of cells in a tissue following a trauma. The trauma can be anything which causes the cell number to diminish. For example, an accident, an autoimmune disorder or a disease state could constitute trauma. Tissue regeneration increases the cell number within the tissue and enables connections between cells of the tissue to be re- established, and the functionality of the tissue to be regained.

The therapy may be regenerative therapy requiring tissue replacement, regeneration or repair. The therapy may be for a neurological disease, disorder or deficit. The therapy may improve functional and/or cognitive recovery. The therapy may be of stroke, peripheral arterial disease, neuropathy or any other disease or disorder that requires tissue regeneration, revascularisation or local anti-inflammatory action, including:

(i) Neurological disorder, disease or deficit, such as Parkinson's disease, Alzheimer's disease, Stroke, or ALS;

(ii) Lysosomal storage disorders;

(iii) Cardiovascular disorders, such as Myocardial Infarction, congestive heart failure,

Peripheral Arterial Disease, diabetic ulcers, wound healing;

(iv) Diseases of the lung, including Idiopathic Pulmonary Fibrosis, Respiratory

Distress Syndrome, Chronic Obstructive Pulmonary Disease, Idiopathic

Pulmonary Hypertension, Cystic Fibrosis and Asthma;

(v) Metabolic or inflammatory disorders, such as Diabetes (I or II), rheumatoid arthritis, osteoarthritis, lupus, Crohn's disease, Inflammatory Bowel Disease, or

Graft versus Host Disease;

(vi) Psychiatric disorders, such as Depression, Bipolar disorder, Schizophrenia or an Autistic syndrome disorder such as Autism, Asperger's syndrome or Rett Syndrome;

(vii) Blindness-causing diseases of the retina, such as Age-related macular degeneration, Stargardt disease, diabetic retinopathy, retinitis pigmentosa; and

(viii) Demyelinating diseases, such as multiple sclerosis, cerebral palsy, central pontine myelinolysis, tabes dorsalis, transverse myelitis, Devic's disease, progressive multifocal leukoencephalopathy, optic neuritis, leukodystrophies,

Guillain-Barre syndrome, Anti-MAG peripheral neuropathy and Charcot-Marie- Tooth disease. In one embodiment, the microparticle and compositions containing them are not used for immune modulation. In one embodiment, the therapy is not related to immunomodulation.

The invention also provides a method for treating or preventing a disease or condition comprising administering an effective amount of the microparticle of the invention, thereby treating or preventing the disease. Typically, the disease or condition is as identified above.

The microparticles of the invention can be used to treat the same diseases as the stem cells from which they are obtained. Neural stem cells are known to be useful in the treatment of diseases including: Stroke, brain damage such as motor, sensory and/or cognitive deficit, psychiatric disorders, myocardial infarction, Amyotrophic lateral sclerosis, limb ischaemia, peripheral arterial disease. Accordingly, the microparticles of the invention are also useful in the treatment of Stroke, brain damage such as motor, sensory and/or cognitive deficit, psychiatric disorders, myocardial infarction, Amyotrophic lateral sclerosis, limb ischaemia, peripheral arterial disease.

Figure 6 and Example 8 demonstrate that exosomes obtained from neural stem cells stimulate wound healing. Accordingly, in one embodiment, exosomes of the invention are used to treat a disease or condition requiring tissue replacement, regeneration or repair. Such conditions include diabetic ulcers and wound healing. Figure 6C shows that exosomes isolated from NSCs cultured for 6 weeks are more efficacious than exosomes isolated from NSCs cultured for 2 weeks. Accordingly, in one embodiment, exosomes isolated from NSCs (typically CTX0E03 cells) that have been cultured (typically in a multi-compartment bioreactor) for at least 2 weeks, more typically at least 4 weeks or at least 6 weeks, are used to treat a disease or condition requiring tissue replacement, regeneration or repair. Optionally, the NSCs have been cultured for no more than ten weeks, e.g. between 2 and 10 weeks, between 3 and 10 weeks, between 4 and 10 weeks, between 5 and 10 weeks or between 6 and 10 weeks.

The observed increased efficacy of exosomes isolated from NSCs (CTX0E03 cells) that have been cultured (in a multi-compartment bioreactor) for 6 weeks correlates with the observed reduction in size of the exosomes to around 70nm diameter, which also occurred after culturing the cells for 6 weeks. Accordingly, in one embodiment, exosomes isolated from NSCs (typically CTX0E03 cells) that have been cultured (typically in a multi-compartment bioreactor) for at least 6 weeks are used to treat a disease or condition requiring tissue replacement, regeneration or repair. As noted above, optionally the NSCs have been cultured for no more than ten weeks, e.g. between 6 and 10 weeks. In another embodiment, exosomes isolated from NSCs (typically CTX0E03 cells) having a diameter less than 100nm, typically less than 80nm, for example around 70nm diameter, are used to treat a disease or condition requiring tissue replacement, regeneration or repair.

As shown in Figure 12 and discussed in Example 8, microvesicles obtained from neural stem cells stimulate angiogenesis. Accordingly, in one embodiment, microvesicles of the invention are used to treat a disease or condition requiring angiogenesis, typically a disease or disorder that is treated by tissue regeneration and/or revascularisation. Microvesicles of the invention can be used in the treatment of cardiovascular disorders, such as Myocardial Infarction, congestive heart failure, Peripheral Arterial Disease, diabetic ulcers and wound healing. The stimulation of angiogenesis is also therapeutically useful in the treatment of ischaemia, in particular cardiac ischaemia and limb ischaemia. Figure 12 shows that microvesicles harvested from NSCs cultured for at least 3 weeks are more efficacious than microvesicles isolated from NSCs cultured for 1 or 2 weeks. Accordingly, in one embodiment, microvesicles isolated from NSCs (typically CTX0E03 cells) that have been cultured (typically in a multi-compartment bioreactor) for at least 3 weeks, more typically at least 4 weeks or at least 6 weeks, are used to treat a disease or condition requiring angiogenesis. Optionally, the NSCs have been cultured for no more than ten weeks, e.g. between 3 and 10 weeks, between 4 and 10 weeks, between 5 and 10 weeks or between 6 and 10 weeks. As shown in Figure 13 and discussed in Example 8, microvesicles obtained from neural stem cells stimulate neurite outgrowth. Accordingly, in one embodiment, microvesicles of the invention are used to treat a neurological disease, disorder or deficit, such as Parkinson's disease, Alzheimer's disease, Stroke, neuropathy or ALS. In prophylactic applications, pharmaceutical compositions or medicaments are administered to a patient susceptible to, or otherwise at risk of, a particular disease in an amount sufficient to eliminate or reduce the risk or delay the outset of the disease. In therapeutic applications, compositions or medicaments are administered to a patient suspected of, or already suffering from such a disease in an amount sufficient to cure, or at least partially arrest, the symptoms of the disease and its complications. An amount adequate to accomplish this is defined as a therapeutically-or pharmaceutically-effective dose. In both prophylactic and therapeutic regimes, agents are typically administered in several dosages until a sufficient response has been achieved. Typically, the response is monitored and repeated dosages are given if the response starts to fade.

The micro particles of the invention may optionally be combined with a stem cell to provide a combination therapy. The stem cell is optionally the stem cell from which the microparticle is derived, e.g. if the microparticle is an exosome from a CTX0E03 cell, then the stem cell for use in combination therapy may be a CTX0E03 cell. A stem cell and microparticle can optionally be (i) administered together in a single pharmaceutical composition, (ii) administered contemporaneously or simultaneously but separately, or (iii) administered separately and sequentially, e.g. stem cell followed by microparticle, or microparticle followed by stem cell. When the stem cell and microparticle are administered separately and sequentially, the duration between the administration of the cell and microparticle may be one hour, one day, one week, two weeks or more.

In one embodiment, a prophylactic therapy induces tolerance, typically immunotolerance, in a host that is to receive the stem cells from which the microparticle is derived. In one embodiment, the administration of one or more doses of microparticles of the invention to a patient, prior to administration of a stem cell therapy, can be used to reduce the risk of an adverse immune response, i.e. "rejection", of the stem cell therapy. In another embodiment, tolerance to the stem cells can be increased by administering stem cells together with microparticles of the invention, as discussed above.

Effective doses of the compositions of the present invention, for the treatment of the above described conditions vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic. Usually, the patient is a human.

The CTX0E03 cell line has been shown to be effective in treating stroke, peripheral arterial disease, brain damage such as motor, sensory and/or cognitive deficit, and psychiatric disorders. The cells are currently being tested in a clinical trial for treatment of disabled stroke patients (Clinicaltrials.gov Identifier: NCT01151124). WO-A-2012/004611 describes the use of the CTX0E03 cells in treating psychiatric disorders including unipolar and bipolar depression, schizophrenia, obsessive compulsive disorder, autism and autistic syndrome disorders. Accordingly, microparticles produced by CTX0E03 cells are also able to treat stroke, peripheral arterial disease, blindness-causing diseases of the retina (such as retinitis pigmentosa), brain damage such as motor, sensory and/or cognitive deficit, and psychiatric disorders.

As used herein, the terms "treat", "treatment", "treating" and "therapy" when used directly in reference to a patient or subject shall be taken to mean the amelioration of one or more symptoms associated with a disorder, or the prevention or prophylaxis of a disorder or one or more symptoms associated with a disorder. The disorders to be treated include, but are not limited to, a degenerative disorder, a disorder involving tissue destruction, a neoplastic disorder, an inflammatory disorder, an autoimmune disease or an immunologically mediated disease including rejection of transplanted organs and tissues. Amelioration or prevention of symptoms results from the administration of the microparticles of the invention, or of a pharmaceutical composition comprising these microparticles, to a subject in need of said treatment. Tracing administered cells and microparticles in vivo

The present invention provides a distinct marker profile for microparticles produced by neural stem cells. It is therefore possible to detect the presence of these microparticles in vivo, by testing a sample obtained from a patient and determining whether the marker profile in the sample matches that of the microparticles. If the sample profile matches the profile of the microparticles described herein, then this confirms the presence of the microparticles. This can be used to detect not only the presence and/or biodistribution of the microparticles themselves, but also the presence of stem cells producing the microparticles. This is particularly useful when detecting whether a stem cell administered in vivo has engrafted into the host tissue, and/or has migrated, for example in ADME(T) studies.

Detection of the microparticles in vivo can be used to monitor the course of a treatment wherein microparticles or stem cells are administered to a patient. Determining the presence, absence or amount of microparticles or cells producing microparticles of the invention in a patient allows the dosage regime to be altered accordingly, e.g. to increase or decrease the dose as required to provide an effective amount of microparticles or stem cells in vivo.

Methods of producing microparticles

Microparticles are isolated from stem cell conditioned media. The "conditioned medium" (CM) may be a growth medium for stem cells, which has been used to culture a mass culture of stem cells for at least about 12 hours, at least about 24 hours, at least about 48 hours or least about 72 hours, typically up to 168 hours (7 days), removed and sterilized by any suitable means, preferably by filtration, prior to use, if required.

Alternatively, microparticles may be harvested from a two-compartment bioreactor which allows the cell culture, and hence the conditioned media, to be maintained for longer periods of time, for example at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks or more. The system maintains the cells and secreted microparticles within a small cell compartment (approximately 15ml) which is separated from a larger reservoir of medium by a 10kDa semi-permeable membrane. This allows the efficient removal of metabolic waste products while effectively maintaining an extremely high cell density to maximize microparticle production. Example 9, and Figures 7 and 8, demonstrate that use of a two-compartment bioreactor results in a much higher yield of microparticles than is obtained when a standard cell culture flask (T175 flask) is used. The microparticles may be separated from other media components based on molecular weight, size, shape, hydrodynamic radius, composition, charge, substrate-ligand interaction, absorbance or scattering of electromagnetic waves, or biological activity. In one embodiment, the conditioned media is filtered using a filter of appropriate size to separate the desired microparticle, for example a 100K MWCO filter. Optionally, the stem cell-conditioned medium is concentrated prior to the isolation of the microparticles by subjecting the concentrated NSC- conditioned medium to size exclusion chromatography. The UV absorbant fractions can then be selected for isolation of the microparticles of interest.

Different microparticles can be isolated from the media by using different isolation techniques and parameters. For example, exosomes have a vesicle density of 1.13-1.19 g/mL and can be isolated by differential centrifugation and sucrose gradient ultracentrifugation at 100,000- 200,000g. Microvesicles can be isolated by filtration (100K MWCO) and differential centrifugation at 18, 000-20, OOOg. Membrane particles have a density of 1.04-01.07 g/ml and Exosome-like vesicles have a density of 1.1 g/ml.

A typical production method comprises: culturing stem cells to produce conditioned media; removing cell debris by centrifugation at 1500 rpm; isolating microvesicles (<1000kDa) by ultrafiltration through a 100K MWCO filter or isolating exosomes (30-1 OOnm) by ultracentrifugation at 120, OOOg; followed by quantification using a BCA protein assay.

Conditionally immortalised stem cells as producer cells for microparticles

In one aspect of the invention, conditionally immortalised stem cells are used to produce microparticles such as microvesicles and/or exosomes. These conditionally immortalised stem cells are typically neural stem cells, but may be a stem cell of any type, for example a haematopoietic stem cell or a mesenchymal stem cell. A method of producing stem cell microparticles is therefore provided, comprising the steps of culturing conditionally-immortalised stem cells and harvesting the microparticles that are produced by the cells. Conditional immortalisation of stem cells is known in the art, as described above. For the avoidance of doubt, this method is not limited to the use of neural stem cells.

When the stem cell used to produce microparticles is a neural stem cell, it may be any of the neural stem cells described herein, for example the CTX0E03 conditionally-immortalised cell line which is clonal, standardised, shows clear safety in vitro and in vivo and can be manufactured to scale thereby providing a unique resource for stable exosome production. Alternatively, the neural stem cells may be neural retinal stem cell lines, optionally as described in US 7514259. When the stem cell used to produce microparticles is a mesenchymal stem cell, it may optionally be a conditionally-immortalised adipose-derived stem cell ("ADSC") or a conditionally- immortalised version of the mesenchymal stem cells described in WO-A-2009/105044; these cells are CD29+, CD44+, CD49a+/e+, CD105+, CD166+, CD34-, CD45-.

Methods of inducing microparticle secretion

The inventors have found that it is possible to increase the production of microparticles by stem cells. This finding, which is not limited to neural stem cells and can be used for the production of microparticles from any stem cell, allows for an improved yield of microparticles to be obtained from a stem cell culture.

A first technique to increase the production of microparticles by the stem cells is to treat the stem cells with one or more of TGF-β, IFN-γ or TNF-a, typically at between 1 and 25ng/ml e.g. 10ng/ml, for between 12 to 96 hours prior to the removal of conditioned media.

As explained in Example 2 below, the frequency of the occurrence of multivesicular bodies (MVBs) was observed to be altered by the presence of TGF-β, IFN-γ or TNF-a (10ng/ml). The frequency was highest in the presence of TGF-β, followed by IFN-γ, followed by TNF-a. Therefore, adding one or more of TGF-β, IFN-γ or TNF-a to the stem cell culture medium will stimulate the production of microparticles by the cells. The microparticles can then be harvested, by separating the microparticles from other components as described above.

A second technique to increase the production of microparticles by the stem cells is to culture the cells under hypoxic conditions. Culturing cells under hypoxic conditions is well-known to the skilled person, and involves culturing the cells in an atmosphere that has less than atmospheric level of 0 2 , i.e. less than 21 % 0 2. This is typically achieved by placing the cells in an incubator that allows oxygen levels to be changed. Hypoxic culture typically involves culturing in an atmosphere containing less than 10% 0 2, more typically 5% or less 0 2, for example 4% or less, 3% or less, 2% or less, or 1 % or less 0 2.

The inventors have also realised that co-culturing a stem cell with a different cell type can alter the production of microparticles by the stem cell. The different cell type may be a non-stem cell, i.e. a terminally differentiated cell type. Typically, the different cell type is one with which the stem cell would interact in vivo. In one embodiment, neural stem cells are co-cultured with epithelial cells such as endothelial cells, typically Human Umbilical Vein Endothelial Cells (HUVEC). It has been observed that in vivo, NSCs and the vasculature interact, with proliferating NSCs being localized in close proximity or adjacent to blood vessels. Receptor tyrosine kinase activation and signal protein secretion has also been observed to be upregulated when NSCs are co-cultured with endothelial cells, again indicating that the vasculature modulates the proliferation capacity of NSCs. Without wishing to be bound by theory, the inventors believe that in vivo, there is a pivotal interplay between NSCs and microvessels (i.e. endothelial cells) in the process of tissue regeneration, through amplification of cytokine expression. Microparticles, e.g. exosomes, derived from NSCs (for example CTX0E03 cells) co-cultured with endothelial cells (for example HUVEC) are therefore primed for therapeutic use, because they have been produced in an environment that mimics the in vivo environment in which the stem cells and microparticles are active.

Therefore, culturing a stem cell with a different cell type may improve the amount of microparticles produced and/or may refine the content of the microparticles, typically so that the microparticles produced by the stem cells are biased towards an activated state of tissue repair. Accordingly, microparticles produced by stem cells that have been co-cultured with other cells, e.g. NSCs co-cultured with endothelial cells, are advantageous. These microparticles may be obtained by isolation from the co-cultured stem-cell conditioned media, as described herein.

Surprisingly, the present inventors have realised that the amount of microparticles produced by stem cells can be increased greatly simply by culturing stem cells in a multi-compartment bioreactor. This finding is not limited to neural stem cells and applies generally to the culture of all stem cells. Accordingly, one aspect of the invention provides a method of producing microparticles from stem cells that have been cultured in a multi-compartment bioreactor. The cells from which the microparticles are harvested have typically been cultured for at least one week, typically at least 8, 9, 10, 1 1 , 12, 13 or 14 days, for example 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days or more, for example at least three weeks, four weeks, five weeks, six weeks or more. It can be seen from Figure 8 that the increase in microparticle production, week on week, is not merely additive but is exponential. The prolonged culture typically has been observed in the Integra Celline system two-compartment bioreactor (commercially available from Integra Biosciences AG, Zizers, Switzerland) but the findings are not limited to this specific multi-compartment bioreactor; any multi-compartment bioreactor can be used. This culture method can be used to produce microparticles from any stem cell type, including but not limited to neural stem cells and mesenchymal stem cells.

Method of screening for an agent that alters microparticle production

The invention provides a method of screening for an agent that alters the production of a microparticle by a stem cell. This method comprises contacting a stem cell with a candidate agent, typically under conditions suitable for microparticle production, and observing whether (i) the rate of production of microparticles by the contacted stem cell increases or decreases, or (ii) the characteristics (e.g. size, protein, mRNA or miRNA content) of the microparticles changes, compared to a control stem cell that is not contacted with the agent.

Method for screening total RNA composition of conditioned medium

Following centrifugation (5 min at 1500 rpm), microparticles are collected from conditioned medium through filtration (0.02-0.2μηι, or 100K MWCO). Total RNA is obtained using trizol based extraction followed by purification using Qiagen RNaesy mini kit. The extract in water has a 260:280 nm absorbance suggesting that it may be RNA. Total RNA is retro-transcribed with either a protocol suitable for mRNA (Superscript II RT, Invitrogen) or miRNA (mScript RT kit, Qiagen). Validation of mRNA and miRNA presence is proven by qRT-PCR using primers for ATP5B and YWHAZ for mRNA, and U6B and 15a for miRNA housekeeping genes respectively. The RNA may be assessed by a generic gene expression analysis assay such as an array (micro array or PCR based array), and sequencing. Kits

The invention provides a kit for use in a method for producing the microparticle of the invention. The kit comprises a neural stem cell culture medium, a neural stem cell and instructions for producing the microparticle of any of claims 1 -16 or 23 using the kit. Optionally, the kit comprises one or more components of claims 19 or 21 . The kit may also comprise a microparticle according to the invention, for use as a control. The control microparticle is optionally lypohilised. The kit may also contain optionally a detection agent suitable for detection of the produced microparticles, for example an antibody that binds specifically to a marker protein that can be used to identify the microparticle. The invention is further described with reference to the following non-limiting examples.

Examples

Example 1 : Preparation of neural stem cells and neural stem cell microparticles for visualisation by electron microscopy.

Method

Embedding CTX0E03 cells for electron microscopy

• 5 x 70% CTX0E03 cultures

· Treat with +/-40HT, IFNy, TNFa and TGFp (all at 10ng for 24hrs)

• Detach cells and fix overnight in 2.5% Gluteraldehyde in 0.1 M Cacodylate pH7.4

• Cells spun down 300g

• Buffered osmium 2%, 1.5hrs • Spin, wash water, overnight

• Uranium acetate 2%, 2hrs

• Spin, wash water, 30mins

• Ethanol gradient 20, 35, 50, 70, 80, 90, 100%, over weekend.

· 100% propylene oxide (PO), 1 hr

• Spin, 50% Agar LV resin in PO, 1 hr

• 75% LV resin/PO 5hrs

• 100% resin overnight at 60°C

• Cool to RT before cutting (60-80nm), Imaged TEM at 200Kv.

Results

Figure 1A-E shows the electron micrographs of the multivesicular bodies (MVBs) containing exosomes of approximately 30nm - 50nm in diameter. Figure 1 F shows microvesicles >100nm in diameter.

Example 2: Production of neural stem cell microparticles from a neural stem cell line. Method

5 Sub-confluent flasks containing the same culture of CTX0E03 cells were individually treated with either 10ng/ml TGF-β, 10ng/ml IFNy, or 10ng/ml TNFa alongside full growth media controls with or without the addition of 40HT. 72 hours after treatment, the cells were collected using trypzean/EDTA, washed and fixed overnight in 2.5% Gluteraldehyde in 0.1 M Cacodylate pH7.4 ready for electron microscopy evaluation. Results

The frequency of the occurrence of multivesicular bodies (MVBs) was observed to be altered by the presence of TGF-β, IFN-γ or TNF-a. The frequency was highest in the presence of TGF-β, followed by IFN-γ, followed by TNF-a. Conclusion

The production of microparticles from neural stem cells can be stimulated by the addition of the factors TGF-β, IFN-γ or TNF-a. This has the potential for more efficient production of microparticles.

Example 3: Purification, quantification and characterisation of neural stem cell microparticles. Method

An outline protocol for producing large quantities of microparticles is provided in Figure 2. The main steps are purification, quantification, characterisation, efficacy testing and manufacture.

(1) Purification

Microparticles can be purified from stem cell-conditioned medium by ultracentrifugation, e.g. at 100000 x g for 1-2 hours. Alternative or additional methods for purification of may be used, such as antibody-based methods, e.g. immunoprecipitation, magnetic bead purification, resin-based purification, using specific antibodies.

(2) Quantification

Purified microparticles can be quantified by quantification of total nucleic acid or protein levels, e.g. various PCR or colorimetric protein quantification methods such as such as the BCA assay. Other quantification techniques may alternatively be used, including an electron microscopy grid or an immune-assay using antibodies or antibody fragments that specifically bind to microparticle-specific markers (e.g. ELISA, immunoblotting). (3) Characterisation

The microparticles can be functionally or structurally characterised. RNA/mRNA/miRNA and protein profiling can be used using methods well known in the art (SDS-PAGE, mass spectrometry, PCR). Constitutively secreted microparticles can be tested and compared to microparticles that have been induced by addition of an inducing agent such as transforming growth factor-beta (TGF-β), interferon-gamma (INF-γ) and/or tumour necrosis factor-alpha (TNF-a).

(4) Therapeutic Efficacy

The efficacy of the microparticles can be tested by in vitro and in vivo assays. For in vitro evaluation, neural stem cell microparticles can be added to cultures of monocytes, PBMCs, endothelial cells and/or fibroblasts and the effect of the microparticles on these cells evaluated. Administration of neural stem cell microparticles to suitable animal models can be used to evaluate the in vivo efficacy. Clinical trials can be performed to evaluate safety and outcome of neural stem cell microparticles in human subjects.

(5) Manufacture/Scale-Up

Bioreactors, such as the Integra disposable T1000, can be used for the large-scale manufacture of neural stem cell microparticles. The purified microparticles are then formulated as a therapeutic product.

Example 4: miRNA characterization in CTX0E03 microparticles

Methods

• 3 conditions: CTX0E03 cells in standard culture; microparticles obtained from CTX0E03 cells in standard culture; and purified exosomes derived from CTX0E03 cells in Integra CELLine system (see Examples 7 to 11 , below) • Investigation of miRNA array using qRT-PCR panel (Qiagen) according to manufacturer's instruction. This assay provides high precision and high sensitivity, with data normalization sensitive to method/choice of reference genes. It does not provide genome wide sequencing.

Results: A) List of miRNAs with a cp≤ 35 found in (i) standard CTX0E03 cells, (ii) filtered conditioned medium (0.02-0.2μηι filter) i.e. microparticles and (iii) exosomes derived from Integra CELLine system (preliminary miRNA qRT-PCR miscript array (Qiagen) results).

B) Arithmetic and geometric mean of the reference (housekeeping) genes

CTX0E03 CM

CM

std

microparticles exosome

Mature miRNA culture Integra hsa-miR-21-5p 19.52 20.9 20.72 hsa-let-7a-5p 22.64 23.11 22.36 hsa-miR-125b-5p 21 .64 23.25 21.74 hsa-miR-9-5p 22.58 23.64 22.94 hsa-miR-92a-3p 23.2 23.94 24.01 hsa-miR-24-3p 23.73 24.24 23.83 hsa-miR-20a-5p 23.45 24.43 25.06 hsa-miR-16-5p 23.14 24.72 24.32 hsa-miR-100-5p 23.28 24.74 23.04 hsa-let-7b-5p 24.67 24.75 23.7 hsa-let-7f-5p 23.93 25.09 23.86 hsa-miR-17-5p 24.56 25.24 26.13 hsa-miR-23b-3p 24.3 25.3 24.13 hsa-miR-106b-5p 24.4 25.41 26.16 hsa-miR-222-3p 23.25 25.49 23.17 hsa-let-7e-5p 24.57 25.58 24.16 hsa-miR-26a-5p 23.4 25.63 24.2 hsa-miR-181a-5p 25.16 25.7 24.32 hsa-miR-125a-5p 23.56 25.75 24.88 hsa-miR-103a-3p 24.65 25.8 25.77 hsa-let-7i-5p 24.37 25.98 24.23 hsa-miR-99a-5p 24.44 26.05 23.44 hsa-let-7c 25.76 26.12 24.07 hsa-let-7g 25.2 26.15 25.17 hsa-miR-195-5p 24.72 26.34 25.67 hsa-miR-93-5p 25.15 26.48 26.06 hsa-miR-22-3p 25.03 26.49 25.66 hsa-miR-20b-5p 26.03 26.86 27.42 hsa-miR-18a-5p 26.71 26.87 29.06 hsa-miR-15b-5p 25.1 26.92 26.43 hsa-let-7d-5p 26.84 26.96 26.52 hsa-miR-424-5p 25.56 27.72 26.66 hsa-miR-15a-5p 26.88 27.89 29.3 hsa-miR-130a-3p 27.23 28.26 28.49 hsa-miR-33a-5p 30.34 28.54 34.18 hsa-miR-128- 26.94 28.64 27.66 hsa-miR-218-5p 27.79 28.68 28.03 hsa-miR-301a-3p 29.53 28.69 31.57 hsa-miR-134 28.3 28.76 28.76 hsa-miR-101-3p 28.44 28.82 31.64 hsa-miR-7-5p 29.71 28.82 30.22 hsa-miR-18b-5p 28.83 28.85 35.47 hsa-miR-185-5p 28.34 28.99 28.13 hsa-miR-378-3p 29.76 29.25 28.97 hsa-miR-132-3p 28.65 29.32 27.72 hsa-miR-345-5p 28.49 29.52 29.66 hsa-miR-219-5p 30.58 29.52 32.7 hsa-miR-127-5p 30.05 29.95 31.11 hsa-miR-146b-5p 30.53 30.54 28.07 hsa-miR-10a-5p 27.1 30.69 28.32 hsa-miR-210 29.85 30.83 30.65 hsa-miR-129-5p 32.51 30.98 31.69 hsa-miR-137 31 .46 31.13 30.95 hsa-miR-182-5p 28.34 31.64 31.27 hsa-miR-124-3p 33.38 31.71 33.07 hsa-miR-96-5p 29.77 32.27 34.67 hsa-miR-192-5p 31 .42 32.42 32.52 hsa-miR-126-3p 31 .73 32.44 32.05 hsa-miR-194-5p 31 .1 1 32.49 31.72 hsa-miR-375 33.77 32.94 30.94 hsa-miR-205-5p 35 33.01 32.72 hsa-miR-183-5p 29.88 33.21 31.74 hsa-miR-10b-5p 29.6 33.22 30.79 hsa-miR-302a-3p 29.67 33.6 31.69 hsa-miR-214-3p 34.19 33.76 32.11 hsa-miR-141-3p 35 33.96 34.51 hsa-miR-302c-3p 31 .6 34.29 33.93 hsa-miR-196a-5p 35 34.65 35.75 hsa-miR-150-5p 34.59 34.76 34.59 hsa-miR-155-p 32.04 35.75 32.76 B

Example 5: CTX0E03 conditioned medium analysis using a protein dot blot

Methods

• Conditioned 24hr and 72 hrs conditioned medium (RMM and ITS medium)

• The collected media has been 'concentrated' by dialysis and the proteins biotinylated (typical total protein concentration appears to be 0.5 mg/ml). The media is then incubated with the Raybiotech L507 human protein arrays (total protein concentration 0.1 mg/ml). Following washing and incubation of the array with HRP-conjugated streptavidin, the presence of proteins is detected by chemiluminescence. The array provides qualitative data (i.e. the protein is present, but no indication of its level of expression compared to other proteins). Results

Cytokine Name Cytokine Full Name Function

EDA-A2 ectodysplasin-A2 May be involved in proper formation of skin appendages

Galectin-3* Galectin-3 Galactose-specific lectin which binds IgE. May mediate with the alpha-3, beta-1 integrin the stimulation by CSPG4 of endothelial cells migration.

IGFBP-2 Insulin-like growth factor binding IGF-binding proteins prolong the proteins 2 half-life of the IGFs and have been shown to either inhibit or stimulate the growth promoting effects of the IGFs on cell culture.

IGFBP-rp1/IGFBP-7 Insulin-like Growth Factor soluble proteins that bind IGFs

Binding Protein Related Protein- with high affinity.

1 Insulin-like Growth Factor

Binding Protein-7

IL-1 a† Interleukin 1 alpha potent mediator of inflammation and immunity

LECT2† Leukocyte cell-derived Has a neutrophil chemotactic chemotaxin-2 activity. Also a positive regulator of chondrocyte proliferation.

MCP-1† Monocyte chemoattractant plays a role in the recruitment of protein 1 monocytes to sites of injury and infection.

SPARC* Secreted Protein, Acidic matricellular protein that

Cysteine-rich-related modular modulates cell adhesion and calcium-binding protein 1 proliferation and is thought to [Precursor] function in tissue remodeling and angiogenesis

ΤΊΜΡ-1 * Tissue inhibitor of Complexes with metalloproteinasess-2 metalloproteinases (such as collagenases) and irreversibly inactivates them. Also mediates erythropoiesis in vitro; but, unlike IL-3, it is species-specific, stimulating the growth and differentiation of only human and murine erythroid progenitors.

Thrombospondin-1* Thrombospondin-1 multimodular secreted protein that associates with the extracellular matrix and possesses a variety of biologic functions, including a potent angiogenic activity.

VEGF* Vascular endothelial growth Growth factor active in factor angiogenesis, vasculogenesis and endothelial cell growth.

These proteins show expression in some instances -though may also be present in media.

EGF R/ErbB1 Epidermal growth factor receptor Receptor for EGF, but also for other members of the EGF family, as TGF-alpha, amphiregulin, betacellulin, heparin-binding EGF-like growth factor MDC * A disintegrin and Probable ligand for integrin in metalloproteinase domain 1 1 the brain. This is a non catalytic

Metalloproteinase-like, metalloprotease-like protein. disintegrin-like, and cysteine-rich

protein

MDC

Endostatin* Endostatin Angiogenesis inhibitor; inhibits endothelial cell migration but may not effect proliferation. May work in balance with VEGF to maintain level of angiogenesis.

Follistatin Follistatin Regulates stem cell renewal versus differentiation by inhibiting pro-differentiation proteins

Csk† cytoplasmic tyrosine kinase Activity is required for interleukin 6 (IL-6) induced differentiation. May play a role in the growth and differentiation of hematopoietic cells. May be involved in signal transduction in endocardial and arterial endothelial cells.

angiogenesis

inflammation

Example 6: Conditioned medium analysis using Human angiogenesis ELISA strips (Signosis) Method

Human angiogenesis ELISA strips (Signosis) were utilized according to manufacturer's instruction. Fresh RMM medium and 24 hour conditioned CTX0E03 RMM medium were analyzed for 8 angiogenesis cytokines; tumor necrosis factor a (TNFa), insulin-like growth factor 1 (IGF-1), VEGFA, interleukin-6 (IL-6), bFGF, transforming growth factor p i (TGFpi), EGF, and leptin. Individual wells of the strip, coated with each of the primary antibodies directed against the specific angiogenesis cytokines were loaded with test samples. Absorbance was measured by a spectrophotometer at 450 nm. The concentrations of the angiogenesis cytokines were directly proportional to the color intensity of the test sample. The results are shown in Figure 3. Example 7: Integra CELLINE - Disposable Bioreactor for the production of Micro particles from CTX0E03 cells. Efficient micro particle production and harvest from a cell line relies upon maintaining optimal culture conditions for the greatest density of cells. Any restriction in the oxygen or nutrients supplied to the cells or an accumulation of waste metabolic products will limit the life span of the culture, and hence the micro particle production. The two-compartment CELLine AD 1000 is designed to accommodate adherent cells attached to a matrix inlay within a small cell compartment, separated from a larger media reservoir by means of a 10kDa semi-permeable membrane. This membrane allows a continuous diffusion of nutrients and removal of waste products, while concentrating any micro particles produced by the cell within the smaller cell compartment. Due to the large volume capacity (1 litre) of the media compartment, the system has the potential to maintain high density cultures for longer periods of time without the need for a media change. The production of exosomes from mesothelioma tumour cell cultures is described in Mitchell et al, 2008.

Method

In order to obtain optimal performance of the CELLine AD1000, place 25ml of complete growth medium (RMM with growth factors and 40HT) into the medium compartment of the flask to pre- wet the semi-permeable membrane. Allow the flask to sit for 5 minutes at room temperature before coating the matrix inlay with mouse Laminin by adding 15ml of laminin solution (20 g/ml in DMEM/F12) to the cell compartment for a minimum of 1 hour at 37°C. Remove the laminin solution and add 15ml of warm DMEM/F12 to the cell compartment to remove any excess laminin. Avoiding the matrix inlay drying, slowly introduce approximately 15x10 6 CTX0E03 cells in a total of 15ml of complete growth medium. Take care to remove any air bubbles from the cell compartment. Carefully add a further 460ml of complete growth medium to the cell compartment before incubating the flask overnight in 5% C0 2 at 37°C. The next day remove the medium from the cell compartment and replace with 15ml of pre warmed growth medium.

Every 7 days harvest the microparticles/medium from the cell compartment. Centrifuge the medium at 1500rpm for 5 minutes to remove any cell debris and store at -80°C. Carefully add another 15ml of pre-warmed complete growth medium in to the cell compartment and 485ml of complete growth medium to the medium compartment and incubate for another 7 days. Microparticles were isolated by 100K MWCO filtration. Repeat as necessary. Figure 4A shows the amount of protein extracted from 15ml of media containing microparticles purified using the Integra system compared to normal culture conditions (3 days T175). Milligrams of protein measured by BCA assay. Figure 5 shows the corresponding quantity of isolated total RNA measured at 260/280nm.

Marker characterisations indicated that both purified populations (microvesicles and exosomes) express CD63 and CD81 (determined by FACS - Figure 4B). Only the exosomes express the endosomal marker Alix (determined by Western blot, data not shown).

Example 8: Efficacy Assays

(A) Comparison of the function of CTX0E03 conditioned media with the function of purified exosomes from CTX0E03 cells in a wound healing assay. Method - Wound closure/ scratch assay

Seed 0.25x10 6 NHDF (normal human dermal fibroblasts) per well of a 12 well plate and allow to become confluent (24 hours)

Remove growth factors for 24hrs

Remove cells (scratch) and incubate with exosomes/conditioned media

· Image effected area over 48hrs

Estimate area using Image J

Results

Table 2 - Wound closure/scratch assay representing the migration activity of normal human dermal fibroblasts (NHDF) cultured in CTX0E03 conditioned media or upon the addition of purified exosomes.

Wound closure was calculated as the area covered by cells in relation to the initial wound area, as determined at Oh. Wound closure is expressed as the percentage of the initial wound area at time Oh. These data are also shown, photographically, in Figure 6A. Figure 6B shows that 1C^g CTX0E03 exosomes significantly increase wound closure (as determined in the HDNF scratch/migration assay) after 72 hours, compared to basal conditions (without exosomes). Further experiments confirmed that exosomes purified (by ultracentrifugation; quantified by BCA protein assay; characterised as >99% positive for CD63 and CD81 and having a greater expression level of Alix compared to the corresponding microparticle fraction) from all time points (weeks 2-6) during continuous culture (using Integra CELLine bioreactors in the presence of growth factors and 40HT) significantly enhanced fibroblast migration and wound healing, with a peak response between 5-1( g/ml compared to basal conditions. Figure 6C shows the % healed areas for basal conditions, 2μg/ml exosomes, 6 μg/ml exosomes, 20 μg/ml exosomes and an LSGS (low serum growth supplement) positive control. The top panel of Figure 6C shows exosomes isolated from CTX0E03 cells cultured for 2 weeks in the Integra Celline system and the bottom panel of Figure 6C shows exosomes isolated from CTX0E03 cells cultured for 6 weeks in the Integra Celline system. These data show that all doses of all tested NSC exosomes provide increased healing compared to basal conditions, with % healing approaching the positive control (LSGS) after 72 hours.

The data in Figure 6C also show that the exosomes isolated from NSCs cultured for 6 weeks cause faster healing (than 2 week exosomes), with the % healed approaching 100% after only 48 hours, for all doses.

Figure 6D shows the results of an in vivo injection wound assay in a mouse, confirming that CTX0E03 cells stimulated wound healing to a statistically-significant degree in vivo. This is a simple in vivo bioassay which can be used to confirm the efficacy of microparticles in vivo.

Conclusion Exosomes released from the human neural stem cell line CTX0E03 enhance fibroblast migration in an in vitro model of wound healing, suggesting that exosomes may contribute to the mechanisms by which hNSCs promote repair. Exosomes isolated from cells cultured for 6 weeks show improved wound healing efficacy in vitro, compared to exosomes isolated from cells cultured for 2 weeks.

(B) Stimulation ofAngiogenesis A 24 hour assay to detect angiogenesis on primary HUVECs was carried out using an Ibidi μ-slide and automated Wimtube detection and analysis (of tube length and bifurcation points). Microvesicles harvested from Integra flasks at 1 , 2, 3, 4 and 6 weeks were added to HUVECs and angiogenesis compared to basal HUVECs (without addition). LSGS (low serum growth supplement) was used as a positive control. The results, depicted in Figure 12, show that neural stem cell microvesicles increase angiogenesis. Further, these data show that a larger increase in angiogenesis is provided by microvesicles harvested after at least 3 weeks of culture (i.e. after 3 weeks, 4 weeks and 6 weeks culture in an Integra celline bioreactor), than is provided by microvesicles cultured for 1 or 2 weeks. Microvesicles cultured for at least 3 weeks stimulated angiogenesis to a statistically significant level, and a level that approaches that of the positive control. The largest increase in angiogenesis is shown to be provided by microvesicles harvested after 4 weeks; these microvesicles stimulated angiogenesis by the same amount as the positive control.

These data indicate that hNSC microvesicles stimulate angiogenesis. (C) Stimulation of Neurite Outgrowth Neurite outgrowth was determined using PC-12 cells though a 1 μιη insert. After 72 hours, the PC-12 cell bodies were removed and the neurites stained on the underside of the insert. The stain was then extracted and quantified on a spectrophotometer. Microvesicles harvested from Integra flasks at 2 weeks were added to the cells at 0.03μg, O^g and 3μg, each with 100ng/ml NGF (nerve growth factor). Neurite outgrowth was compared to basal cells (without addition). 100ng/ml NGF was used as a control. As shown in Figure 13, the addition of 3μg hNSC microvesicles caused a noticeable increase in neurite outgrowth, compared to the addition of NGF alone.

These data indicate that hNSC microvesicles stimulate neurite outgrowth.

Example 9: Production of exosomes using the Integra CELLine system.

CTX0E03 cells were cultured using the Integra CELLine system and exosomes were purified as described in Example 7. The concentration of exosomes purified from the medium using the CELLine system at the 3 week time point, and as a control a standard T175 system as routinely used in the art, was quantified (using a BCA assay to estimate protein content). Figure 7 shows that the production of exosomes using the Integra CELLine system is increased several fold, compared to using conventional culture (T175 flasks). Using the Integra CELLine system, CTX0E03 cells were cultured over a 3-week period and medium was harvested at week 1 , 2 and 3 for purification and quantification of exosomes, as described in Example 7. Figure 8A shows that the production of microparticles increases exponentially over the 3-week culture period, enabling efficient and large-scale production of microparticles. The concentration of exosomes harvested from a single Integra CELLine flask was then monitored over 1 -6 weeks of continuous CTX0E03 culture, with the results shown below and depicted in Figure 8B:

These results show that exosome production is surprisingly enhanced when stem cells are cultured in a multi-compartment bioreactor for weeks, typically at least three weeks. Example 10: Characterisation of phenotype of cells obtained from the Integra CELLine and the standard (T175) culture system.

CTX0E03 cells were cultured using the Integra CELLine bioreactor and standard culture, as described in Example 7. Expression of DCX and GFAP protein markers was confirmed using marker-specific antibodies and fluorescence microscopy.

Expression of DCX, GALC, GFAP, TUBB3, GDNF and IDO markers was detected by qRT-PCR in samples obtained from the cells. Marker expression was compared between microparticles obtained from standard (T175) culture and exosomes obtained from the 3 week cultured Integra CELLine system, assessed against a baseline of the expression level in CTX0E03 cells in standard (T175) culture.

The inventors observed a striking difference in marker expression of cells obtained from the Integra CELLine system as compared to control cells obtained from standard. Markers of partially-differentiated cells were increased several fold in cells cultured in the Integra CELLine system, compared to control cells obtained from standard cultures (Figure 9). Particularly striking changes are increased expression of the markers DCX1 (doublecortin - a marker for entry into the neural lineage), GFAP (glial fibrillary acidic protein - a marker for entry into the astrocytic lineage), GDNF (glial cell-derived neurotrophic factor) and IDO (indoleamine 2,3- dioxygenase). This indicates that in neural stem cells cultured in a two-compartment bioreactor partially differentiate into cells of neural (DCX+) or astrocytic (GFAP+) lineage. The expression of DCX and GFAP in the Integra-cultured cells was confirmed by fluorescence microscopy, demonstrating that CTX0E03 cells cultured using the Integra CELLine bioreactor have a more differentiated neuronal phenotype than standard CTX0E03 cells. Example 11 : Characterisation of miRNA expression profiles of exosomes obtained from Integra CELLine cultures and microparticles obtained from standard (T175) cultures.

CTX0E03 cells were cultured for three weeks using the Integra CELLine culture and in the standard culture in single-compartment T-175 flasks. Exosomes were purified from the Integra culture and microparticles were purified from the standard T-175 culture as described in Example 7. The relative expression levels of various miRNAs expressed in the exosomes and microparticles obtained from either the standard culture or the Integra CELLine system were determined with an miRNA array using qRT-PCR panel (Qiagen) according to manufacturer's instruction, and converted into fold up and down regulation levels as compared to a standard CTX0E03 cell line control group (see Table 3 and Figure 10). These data show a differential miRNA expression profile between exosomes obtained from the Integra CELLine culture system for 3 weeks, microparticles, and cells obtained from the standard single-flask culture.

Table 3: Fold-regulation of miRNAs in microparticles obtained from standard culture or exosomes from the Integra CELLine system, relative to control (CTX0E03 cells).

hsa-miR-134 -1.6567 1.1783 hsa-miR-128 -3.5842 1.0743 hsa-miR-155-5p -8.8458 1.0425 hsa-miR-22-3p -3.4782 -1.0023 hsa-miR-26a-5p -5.3579 -1.0187 hsa-miR-210 -2.3107 -1.0449 hsa-miR-92a-3p -1.9885 -1.0693 hsa-miR-93-5p -3.056 -1.1701 hsa-miR-424-5p -4.9189 -1.2086 hsa-miR-195-5p -3.8951 -1.2541 hsa-miR-127-5p -1.1316 -1.2953 hsa-miR-21-5p -2.8845 -1.3044 hsa-miR-103a-3p -2.6482 -1.3287 hsa-miR-16-5p -3.5267 -1.3692 hsa-miR-125a-5p -5.1159 -1.434 hsa-miR-10a-5p -14.4701 -1.434 hsa-miR-10b-5p -15.1194 -1.4373 hsa-miR-345-5p -2.5521 -1.4406 hsa-miR-130a-3p -2.6178 -1.5728 hsa-miR-15b-5p -4.4025 -1.6058 hsa-miR-20b -2.1312 -1.6096 hsa-miR-20a-5p -2.3107 -1.8319 hsa-miR-17-5p -1.9296 -1.8319 hsa-miR-7-5p -1.5105 -2.042 hsa-miR-106b-5p -2.4708 -2.1287 hsa-miR-101-3p 1.4794 -2.4453 hsa-miR-302a-3p -18.0634 -2.4623 hsa-miR-301a-3p 1.4931 -2.5257 hsa-miR-183-5p -13.9772 -2.5847 hsa-miR-219-5p 1.6994 -2.7321 hsa-miR-18a-5p -1.4028 -3.2792 hsa-miR-15a-5p -2.4766 -3.3714 hsa-miR-182-5p -12.5099 -4.9588 hsa-miR-33a-5p 2.7927 -9.1472 hsa-miR-96-5p -7.0047 -18.9396 hsa-miR-18b-5p -1.3519 -49.18

Values were calculated from raw data using the following equati

ACT (sample/control) = Average CT (GOV)— Average CT (HKG) Fold expression (sample/control) = 2 ~ ( AverageACT )

Fold expression (sample)

Fold change =

Fold expression (control) If (fold change) > 1 then (fold regulation) = (fold change)

If (fold change) < 1 then (fold regulation) = — ( )

fold change Wherein:

CT = cycle threshold

GOI = gene of interest (investigated miRNA)

HKG = housekeeping genes (reference miRNAs used to normalize the data)

Example 12: Total miRNA analysis

Cells can shuttle RNA into microparticles determined for release into the extracellular space. This allows the conveyance of genetically encoded messages between cells. We here collectively refer to extracellular RNA as 'shuttle RNA'. We aimed to analyze comprehensively non coding RNA species released by CTX0E03 neural stem cells (NSCs) using Next Generation Sequencing. Non coding RNAs are divided in two categories (small and long). Small non coding RNA biotypes include ribosomal RNA (rRNA), small nucleolar (snoRNA), small nuclear RNA (snRNA), microRNA (miRNA), miscellaneous other RNA (misc_RNA, e.g. RMRP, vault RNA, metazoa SRP, and RNY), and long non coding RNA biotypes includes long non-coding RNAs (IncRNAs) and large intergenic non-coding RNAs (lincRNAs).

Here, we characterized shuttle RNAs, including small and long non coding RNAs, released from NSC derived exosomes and microvesicles (MV) and compared with the RNA contents of the producer NSCs. A) Total RNA contents in cells, exosomes and microvesicles identified by Agilent RNA bioanalyser

The RNA in both exosomes and microvesicles mainly consists of small RNA species as shown in Fig. 14. The majority of the nucleotides (nt) was≤200 as shown against the molecular ladder.

B) RNA composition

Small RNA sequencing libraries were generated to investigate the composition of shuttle and cellular RNA by deep sequencing (Next Generation Sequencing). The results are shown in Figure 15.

C) Deep sequencing of CTX0E03 cell, microvesicle and exosome miRNA expression from standard (T175) cultures. Deep sequencing is based on the preparation of a cDNA library following by sequencing and provides information regarding the total sequence read out of different miRNAs in the microvesicles and exosomes. These deep sequence data complement the qRT-PCR array data shown above and provide a comprehensive analysis of the miRNA profile of the cells and microparticles. Unlike the qRT-PCR array analysis, deep sequencing is not restricted to identification of sequences present in the probe array and so the sequences to be identified do not need to be known in advance. Deep sequencing also provides direct read-out and the ability to sequence very short sequences. However, deep sequencing is not suitable for detection of transcripts with low expression.

Method

The presence of a variety of miRNAs in parental cells and their exosomes (30-100μηι) and microvesicles (100-1000 μηι), purified by differential centrifugation, was identified by deep sequencing, following construction of 1 tagged miRNA library for each sample.

Additionally, specific primers for highly shuttled miRNAs (e.g. hsa-miR-1246) were designed and used in real-time reverse transcription PCR (qRT-PCR) to trace exosomes/microvesicles following in vivo implantation.

Deep sequencing was performed by GATC Biotech (Germany) and required the preparation of a tagged miRNA library for each samples followed by sequencing, and miRBase scanning:

• Construction of tagged miRNA libraries (22 to 30 nt)

o Sequencing libraries were generated by ligation of specific RNA adapter to both

3' and 5' ends for each sample followed by reverse transcription, amplification, and purification of smallRNA libraries (size range of contained smallRNA fraction 22 - 30 nt). · Sequencing on an lllumina HiSeq 2000 (single read)

o Sequencing was performed using lllumina HiSeq 2000 (single read). Analysis of one pool could include up to 45,000,000 single read, and each read length is up to 50 bases. Sequencing was quality controlled by using FastQ Files (sequences and quality scores).

• Identification of known miRNAs was performed as followed: o RNA adapters were trimmed from resulting sequences and raw data cleaned. Raw data were clustered and for each cluster a number of reads was provided. MiRNAs were identified by miRBase scanning (Ssearch). Results

Many microvesicle and exosome miRNAs were enriched relative to the cells, indicating that cells specially sort miRNAs for extracellular release. Furthermore, miRNA contents were similar in both exosomes and microvesicles, indicating a common apparatus of selective miRNA uptake in excreted microvesicles. Without wishing to be bound by theory, this may indicate that miRNA content in secreted microvesicles and exosomes can be used as a fingerprint to identify hNSC subtypes.

The deep sequencing analysis therefore identified a unique set of miRNAs in both hNSC exosomes and microvesicles not previously reported. MiRNA content in excreted vesicles is similar, but showed a preferential miRNA uptake compared with hNSC. These findings could support biological effects mediated by shuttle miRNA not previously described for hNSC.

The results are detailed in Tables 4 to 9, below. The data are also depicted in Figure 1 1 , which clearly shows the significantly different miRNA profiles present in the microvesicles and exosomes, compared to the cells. In summary, these data show a massive increase in the amount (read counts) of hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532 in microvesicles and exosomes compared to the cells. Large increases are also seen in hsa-miR- 4508, hsa-miR-4516, has-miR-3676-5p and hsa-miR-4485. Massive decreases are seen in the amounts (read counts) of certain miRNAs, including hsa-let-7a-5p, has-miR-92b-3p, has-miR- 21 -5p. hsa-miR-92a-3p, hsa-miR-10a-5p, hsa-100-5p and hsa-99b-5p.

The presence of each of hsa-miR-1246, hsa-miR-4488, hsa-miR-4492, hsa-miR-4508, hsa-miR- 4516 and hsa-miR-4532 in the exosomes was validated by qRT-PCR (data not shown).

Plotting the deep sequencing results in the exosomes and microvesicles as relative fold change compared to the cells confirms that hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR- 4532 are significantly upregulated in the exosomes and microvesicles compared to the cells. This comparison also shows that miRNA hsa-miR-3195 is the miRNA that is most upregulated, in both exosomes and microvesicles. Although the absolute reads of hsa-miR-3195 are in the range of -40 for exosomes and microvesicles, there is no hsa-miR-3195 present in the cells. As noted in Example 1 1 above, miRNA contents in exosomes, microparticles, and parental cells were also tested and validated using PCR array analysis. The following miRNAs were found present by qRT-PCR: hsa-let-7g-5p, hsa-miR-101 -3p, hsa-miR-10a-5p, hsa-miR-10b-5p, hsa- miR-125b-5p, hsa-miR-128, hsa-miR-130a-3p, hsa-miR-134, hsa-miR-137, hsa-miR-146b-5p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181 a-5p,hsa-miR- 182-5p, hsa-miR-185-5p, hsa-miR-18b-5p, hsa-miR-192-5p, hsa-miR-194-5p, hsa-miR-195-5p, hsa-miR-20a-5p, hsa-miR-20b-5p, hsa-miR-210, hsa-miR-21 -5p, hsa-miR-218-5p,hsa-miR-219- 5p,hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23b-3p, hsa-miR-24-3p,hsa-miR-26a-5p, hsa- miR-301 a-3p, hsa-miR-302a-3p,hsa-miR-302c-3p,hsa-miR-345-5p, hsa-miR-378a-3p, hsa-miR- 7-5p, hsa-miR-92a-3p,hsa-miR-93-5p,hsa-miR-9-5p,hsa-miR-96-5p, and hsa-miR-99a-5p.

Table 4: Cells EH

Cells: CTX0E03 07EH

SEQ ID MIRNA READ

MIRNA MIRNA.SEQUENCE NO: LENGTH COUNTS hsa-let-7a-5p UGAGGUAGUAGGUUGUAUAGUU 1 22 75110 hsa-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUG 2 23 52927 hsa-miR-100-5p AACCCGUAGAUCCGAACUUGUG 3 22 52451 hsa-miR-99b-5p CACCCGUAGAACCGACCUUGCG 4 22 39457 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG 5 22 20310 hsa-miR-27b-3p UUCACAGUGGCUAAGUUCUGC 6 21 16900 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU 7 22 14359 hsa-miR-191-5p CA ACG G AA U CCC AA A AG C AG C U G 8 23 12591 hsa-miR-21-5p UAGCUUAUCAGACUGAUGUUGA 9 22 11943 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU 10 22 11760 hsa-let-7f-5p UGAGGUAGUAGAUUGUAUAGUU 11 22 10349 hsa-miR-26a-5p UUCAAGUAAUCCAGGAUAGGCU 12 22 9900 hsa-miR-92b-3p UAUUGCACUCGUCCCGGCCUCC 13 22 9794 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU 14 22 7064 hsa-miR-181a-5p AACAUUCAACGCUGUCGGUGAGU 15 23 6956 hsa-miR-182-5p UUUGGCAAUGGUAGAACUCACACU 16 24 5531 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU 17 22 5103 hsa-miR-379-5p UGGUAGACUAUGGAACGUAGG 18 21 4746 hsa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 19 22 4552 hsa-miR-21-3p CA AC ACCAG UCGAUGGGCUGU 20 21 4089 hsa-miR-1246 AAUGGAUUUUUGGAGCAGG 21 19 3973 hsa-let-7i-5p UGAGGUAGUAGUUUGUGCUGUU 22 22 3015 hsa-miR-4532 CCCCG G G G AG CCCG G CG 23 17 2847 hsa-miR-183-5p UAUGGCACUGGUAGAAUUCACU 24 22 2695 hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG 25 21 2681 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU 26 22 2649 hsa-let-7e-5p UGAGGUAGGAGGUUGUAUAGUU 27 22 2449 hsa-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU 28 22 2435 hsa-miR-16-5p UAGCAGCACGUAAAUAUUGGCG 29 22 2173 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG 30 22 2001 hsa-miR-30d-5p UGUAAACAUCCCCGACUGGAAG 31 22 1977 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU 32 23 1871 hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU 33 22 1826 hsa-miR-4492 GGGGCUGGGCGCGCGCC 34 17 1754 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 35 24 1451 hsa-miR-222-3p AGCUACAUCUGGCUACUGGGU 36 21 1422 hsa-miR-151a-5p UCGAGGAGCUCACAGUCUAGU 37 21 1386 hsa-miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU 38 23 1382 hsa-miR-221-5p ACCUGGCAUACAAUGUAGAUUU 39 22 1363 hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU 40 22 1225 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 41 23 1080 hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 42 22 1002 hsa-let-7g-5p UGAGGUAGUAGUUUGUACAGUU 43 22 959 hsa-miR-500a-3p AUGCACCUGGGCAAGGAUUCUG 44 22 923 hsa-miR-30e-5p UGUAAACAUCCUUGACUGGAAG 45 22 911 hsa-miR-27a-3p UUCACAGUGGCUAAGUUCCGC 46 21 867 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU 47 22 865 hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU 48 22 856 hsa-miR-125b-l-3p ACGGGUUAGGCUCUUGGGAGCU 49 22 851 hsa-miR-410 AAUAUAACACAGAUGGCCUGU 50 21 848 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU 51 22 842 hsa-miR-99a-5p AACCCGUAGAUCCGAUCUUGUG 52 22 773 hsa-let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 53 22 765 hsa-miR-148a-3p UCAGUGCACUACAGAACUUUGU 54 22 702 hsa-miR-23a-3p AUCACAUUGCCAGGGAUUUCC 55 21 654 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA 56 22 593 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU 57 23 557 hsa-miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA 58 23 518 hsa-miR-23b-3p AUCACAUUGCCAGGGAUUACC 59 21 508 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC 60 23 492 hsa-miR-4488 AGGGGGCGGGCUCCGGCG 61 18 485 hsa-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA 62 23 459 hsa-miR-25-3p CAUUGCACUUGUCUCGGUCUGA 63 22 436 hsa-miR-889 UUAAUAUCGGACAACCAUUGU 64 21 411 hsa-miR-378a-3p ACUGGACUUGGAGUCAGAAGG 65 21 410 hsa-miR-30c-5p UGUAAACAUCCUACACUCUCAGC 66 23 378 hsa-miR-4485 UAACGGCCGCGGUACCCUAA 67 20 358 hsa-miR-125b-2-3p UCACAAGUCAGGCUCUUGGGAC 68 22 352 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC 69 21 350 hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC 70 22 337 hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC 71 22 294 hsa-miR-1271-5p CUUGGCACCUAGCAAGCACUCA 72 22 288 hsa-miR-589-5p UGAGAACCACGUCUGCUCUGAG 73 22 282 hsa-miR-374a-5p UUAUAAUACAACCUGAUAAGUG 74 22 275 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU 75 22 263 hsa-miR-345-5p GCUGACUCCUAGUCCAGGGCUC 76 22 249 hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC 77 22 236 hsa-miR-15b-5p UAGCAGCACAUCAUGGUUUACA 78 22 229 hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 79 23 225 hsa-miR-31-5p AGGCAAGAUGCUGGCAUAGCU 80 21 213 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU 81 23 205 hsa-miR-136-3p CAUCAUCGUCUCAAAUGAGUCU 82 22 203 hsa-miR-493-3p UGAAGGUCUACUGUGUGCCAGG 83 22 192 hsa-miR-720 UCUCGCUGGGGCCUCCA 84 17 154 hsa-miR-7-5p UGGAAGACUAGUGAUUUUGUUGU 85 23 154 hsa-miR-130b-3p CAGUGCAAUGAUGAAAGGGCAU 86 22 150 hsa-miR-192-5p CUGACCUAUGAAUUGACAGCC 87 21 138 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU 88 22 115 hsa-miR-204-5p UUCCCUUUGUCAUCCUAUGCCU 89 22 113 hsa-miR-26b-5p UUCAAGUAAUUCAGGAUAGGU 90 21 107 hsa-miR-1307-5p UCGACCGGACCUCGACCGGCU 91 21 105 hsa-let-7d-3p CUAUACGACCUGCUGCCUUUCU 92 22 103 hsa-miR-340-5p UUAUAAAGCAAUGAGACUGAUU 93 22 100 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG 94 22 99 hsa-miR-432-5p UCUUGGAGUAGGUCAUUGGGUGG 95 23 97 hsa-miR-30b-5p UGUAAACAUCCUACACUCAGCU 96 22 96 hsa-miR-320a AAAAGCUGGGUUGAGAGGGCGA 97 22 95 hsa-miR-100-3p CAAGCUUGUAUCUAUAGGUAUG 98 22 94 hsa-miR-744-5p UGCGGGGCUAGGGCUAACAGCA 99 22 89 hsa-miR-181a-3p ACCAUCGACCGUUGAUUGUACC 100 22 86 hsa-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU 101 22 85 hsa-miR-181a-2-3p ACCACUGACCGUUGACUGUACC 102 22 81 hsa-miR-190a UGAUAUGUUUGAUAUAUUAGGU 103 22 79 hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG 104 22 78 hsa-miR-181c-5p AACAUUCAACCUGUCGGUGAGU 105 22 76 hsa-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA 106 22 75 hsa-miR-301a-3p CAGUGCAAUAGUAUUGUCAAAGC 107 23 75 hsa-miR-411-5p U AG U AG ACCG U AU AGCG UACG 108 21 75 hsa-miR-128 UCACAG UGAACCGG U CU CU U U 109 21 74 hsa-miR-4516 GGGAGAAGGGUCGGGGC 110 17 74 hsa-miR-425-5p AAUGACACGAUCACUCCCGUUGA 111 23 72 hsa-miR-130b-5p ACUCUUUCCCUGUUGCACUAC 112 21 71 hsa-miR-130a-3p CAGUGCAAUGUUAAAAGGGCAU 113 22 67 hsa-miR-30d-3p CUUUCAGUCAGAUGUUUGCUGC 114 22 65 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC 115 22 65 hsa-miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG 116 23 65 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU 117 22 63 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU 118 22 62 hsa-miR-24-3p U G G C U C AG U U CAG CAG G AACAG 119 22 61 hsa-miR-4677-3p UCUGUGAGACCAAAGAACUACU 120 22 61 hsa-miR-149-5p UCUGGCUCCGUGUCUUCACUCCC 121 23 56 hsa-miR-197-3p U U CACCACCU U CU CCACCCAGC 122 22 56 hsa-miR-96-5p UUUGGCACUAGCACAUUUUUGCU 123 23 56 hsa-miR-1307-3p ACUCGGCGUGGCGUCGGUCGUG 124 22 55 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 125 23 53 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU 126 22 52 hsa-miR-148b-5p AAGUUCUGUUAUACACUCAGGC 127 22 51 hsa-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU 128 23 51 hsa-miR-4461 GAUUGAGACUAGUAGGGCUAGGC 129 23 50 hsa-miR-27a-5p AGGGCUUAGCUGCUUGUGAGCA 130 22 49 hsa-miR-363-3p AAUUGCACGGUAUCCAUCUGUA 131 22 47 hsa-miR-431-5p UGUCUUGCAGGCCGUCAUGCA 132 21 47 hsa-miR-877-5p GUAGAGGAGAUGGCGCAGGG 133 20 46 hsa-miR-550a-5p AGUGCCUGAGGGAGUAAGAGCCC 134 23 45 hsa-miR-4508 GCGGGGCUGGGCGCGCG 135 17 44 hsa-miR-541-3p UGGUGGGCACAGAAUCUGGACU 136 22 42 hsa-miR-135b-5p UAUGGCUUUUCAUUCCUAUGUGA 137 23 40 hsa-miR-140-3p UACCACAGGGUAGAACCACGG 138 21 39 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU 139 24 37 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC 140 21 37 hsa-miR-758 UUUGUGACCUGGUCCACUAACC 141 22 37 hsa-miR-101-3p UACAGUACUGUGAUAACUGAA 142 21 36 hsa-miR-374b-5p AUAUAAUACAACCUGCUAAGUG 143 22 36 hsa-miR-148a-5p AAAGUUCUGAGACACUCCGACU 144 22 35 hsa-miR-17-5p CA AAG UGCUUACAGUGCAGGUAG 145 23 35 hsa-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG 146 23 35 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA 147 22 35 hsa-miR-193b-3p AACUGGCCCUCAAAGUCCCGCU 148 22 34 hsa-miR-548ah-3p CAAAAACUGCAGUUACUUUUGC 149 22 34 hsa-miR-539-3p AUCAUACAAGGACAAUUUCUUU 150 22 33 hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC 151 23 31 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG 152 22 30 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU 153 22 29 hsa-miR-2467-5p UGAGGCUCUGUUAGCCUUGGCUC 154 23 26 hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCA 155 22 26 hsa-miR-24-2-5p UGCCUACUGAGCUGAAACACAG 156 22 25 hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU 157 23 24 hsa-miR-323a-3p CACAUUACACGGUCGACCUCU 158 21 24 hsa-miR-106b-3p CCGCACUGUGGGUACUUGCUGC 159 22 23 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 160 22 23 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC 161 22 23 hsa-miR-1275 GUGGGGGAGAGGCUGUC 162 17 22 hsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA 163 23 22 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC 164 23 21 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC 165 22 21 hsa-miR-29b-3p UAGCACCAUUUGAAAUCAGUGUU 166 23 20 hsa-miR-3158-3p AAGGGCUUCCUCUCUGCAGGAC 167 22 20 hsa-miR-431-3p CAGGUCGUCUUGCAGGGCUUCU 168 22 20 hsa-miR-454-3p UAGUGCAAUAUUGCUUAUAGGGU 169 23 20 hsa-miR-106b-5p UAAAGUGCUGACAGUGCAGAU 170 21 19 hsa-miR-1973 ACCGUGCAAAGGUAGCAUA 171 19 19 hsa-miR-31-3p UGCUAUGCCAACAUAUUGCCAU 172 22 19 hsa-miR-374a-3p CUUAUCAGAUUGUAUUGUAAUU 173 22 19 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU 174 22 19 hsa-miR-4417 GGUGGGCUUCCCGGAGGG 175 18 19 hsa-miR-143-3p UGAGAUGAAGCACUGUAGCUC 176 21 18 hsa-miR-19a-3p UGUGCAAAUCUAUGCAAAACUGA 177 23 18 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU 178 22 18 hsa-miR-561-5p AUCAAGGAUCUUAAACUUUGCC 179 22 18 hsa-miR-663b GGUGGCCCGGCCGUGCCUGAGG 180 22 18 hsa-miR-1301 UUGCAGCUGCCUGGGAGUGACUUC 181 24 17 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU 182 22 17 hsa-miR-9-3p AUAAAGCUAGAUAACCGAAAGU 183 22 17 hsa-miR-17-3p ACUGCAGUGAAGGCACUUGUAG 184 22 15 hsa-miR-376c AACAUAGAGGAAAUUCCACGU 185 21 15 hsa-miR-424-5p CAGCAGCAAUUCAUGUUUUGAA 186 22 15 hsa-miR-660-5p UACCCAUUGCAUAUCGGAGUUG 187 22 15 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC 188 22 14 hsa-miR-3605-5p UGAGGAUGGAUAGCAAGGAAGCC 189 23 14 hsa-miR-3687 CCCGGACAGGCGUUCGUGCGACGU 190 24 14 hsa-miR-4284 GGGCUCACAUCACCCCAU 191 18 14 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG 192 22 14 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU 193 22 14 hsa-miR-1276 UAAAGAGCCCUGUGGAGACA 194 20 13 hsa-miR-330-3p G CA AAG CACACG G CCU G CAG AG A 195 23 13 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU 196 21 13 hsa-miR-4786-5p UGAGACCAGGACUGGAUGCACC 197 22 13 hsa-miR-548k AAAAGUACUUGCGGAUUUUGCU 198 22 13 hsa-miR-1226-3p UCACCAGCCCUGUGUUCCCUAG 199 22 12 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA 200 21 12 hsa-miR-27b-5p AGAGCUUAGCUGAUUGGUGAAC 201 22 12 hsa-miR-377-5p AGAGGUUGCCCUUGGUGAAUUC 202 22 12 hsa-miR-487a AAUCAUACAGGGACAUCCAGUU 203 22 12 hsa-miR-92a-l-5p AGGUUGGGAUCGGUUGCAAUGCU 204 23 12 hsa-miR-135b-3p AUGUAGGGCUAAAAGCCAUGGG 205 22 11 hsa-miR-218-5p UUGUGCUUGAUCUAACCAUGU 206 21 11 hsa-miR-3943 UAGCCCCCAGGCUUCACUUGGCG 207 23 11 hsa-miR-92b-5p AGGGACGGGACGCGGUGCAGUG 208 22 11 hsa-miR-1185-l-3p AUAUACAGGGGGAGACUCUUAU 209 22 10 hsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAG 210 21 10 hsa-miR-2355-5p AUCCCCAGAUACAAUGGACAA 211 21 10 hsa-miR-23a-5p GGGGUUCCUGGGGAUGGGAUUU 212 22 10 hsa-miR-30c-l-3p CUGGGAGAGGGUUGUUUACUCC 213 22 10 hsa-miR-329 AACACACCUGGUUAACCUCUUU 214 22 10 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC 215 22 10 hsa-miR-3609 CAAAGUGAUGAGUAAUACUGGCUG 216 24 10 hsa-miR-378a-5p CUCCUGACUCCAGGUCCUGUGU 217 22 10 hsa-miR-3929 GAGGCUGAUGUGAGUAGACCACU 218 23 10 hsa-miR-4745-5p UGAGUGGGGCUCCCGGGACGGCG 219 23 10 hsa-miR-5096 GUUUCACCAUGUUGGUCAGGC 220 21 10 hsa-miR-656 AAUAUUAUACAGUCAACCUCU 221 21 10 hsa-let-7a-3p CUAUACAAUCUACUGUCUUUC 222 21 9 hsa-miR-15a-5p UAGCAGCACAUAAUGGUUUGUG 223 22 9 hsa-miR-185-5p UGGAGAGAAAGGCAGUUCCUGA 224 22 9 hsa-miR-25-5p AGGCGGAGACUUGGGCAAUUG 225 21 9 hsa-miR-3065-5p UCAACAAAAUCACUGAUGCUGGA 226 23 9 hsa-miR-3176 ACUGGCCUGGGACUACCGG 227 19 9 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG 228 23 9 hsa-miR-374b-3p CUUAGCAGGUUGUAUUAUCAUU 229 22 9 hsa-miR-4435 AUGGCCAGAGCUCACACAGAGG 230 22 9 hsa-miR-4448 GGCUCCUUGGUCUAGGGGUA 231 20 9 hsa-miR-4497 CUCCGGGACGGCUGGGC 232 17 9 hsa-miR-4521 GCUAAGGAAGUCCUGUGCUCAG 233 22 9 hsa-miR-539-5p GGAGAAAUUAUCCUUGGUGUGU 234 22 9 hsa-miR-548ah-5p AAAAGUGAUUGCAGUGUUUG 235 20 9 hsa-miR-1910 CCAGUCCUGUGCCUGCCGCCU 236 21 8 hsa-miR-376a-3p AUCAUAGAGGAAAAUCCACGU 237 21 8 hsa-miR-382-5p GAAGUUGUUCGUGGUGGAUUCG 238 22 8 hsa-miR-3940-3p CAGCCCGG AUCCCAGCCCACU U 239 22 8 hsa-miR-494 UGAAACAUACACGGGAAACCUC 240 22 8 hsa-miR-495 AAACAAACAUGGUGCACUUCUU 241 22 8 hsa-miR-545-3p UCAGCAAACAUUUAUUGUGUGC 242 22 8 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 243 22 8 hsa-miR-1197 UAGGACACAUGGUCUACUUCU 244 21 7 hsa-miR-181b-3p CUCACUGAACAAUGAAUGCAA 245 21 7 hsa-miR-212-5p ACCUUGGCUCUAGACUGCUUACU 246 23 7 hsa-miR-3200-3p CACCUUGCGCUACUCAGGUCUG 247 22 7 hsa-miR-340-3p UCCGUCUCAGUUACUUUAUAGC 248 22 7 hsa-miR-3607-5p GCAUGUGAUGAAGCAAAUCAGU 249 22 7 hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU 250 23 7 hsa-miR-3656 GGCGGGUGCGGGGGUGG 251 17 7 hsa-miR-532-3p CCUCCCACACCCAAGGCUUGCA 252 22 7 hsa-miR-574-3p CACGCUCAUGCACACACCCACA 253 22 7 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA 254 23 6 hsa-miR-127-5p CUGAAGCUCAGAGGGCUCUGAU 255 22 6 hsa-miR-18a-5p UAAGGUGCAUCUAGUGCAGAUAG 256 23 6 hsa-miR-26a-2-3p CCUAUUCUUGAUUACUUGUUUC 257 22 6 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU 258 21 6 hsa-miR-3648 AGCCGCGGGGAUCGCCGAGGG 259 21 6 hsa-miR-382-3p AAUCAUUCACGGACAACACUU 260 21 6 hsa-miR-3939 UACGCGCAGACCACAGGAUGUC 261 22 6 hsa-miR-432-3p CUGGAUGGCUCCUCCAUGUCU 262 21 6 hsa-miR-4423-5p AGUUGCCUUUUUGUUCCCAUGC 263 22 6 hsa-miR-4466 GGGUGCGGGCCGGCGGGG 264 18 6 hsa-miR-454-5p ACCCUAUCAAUAUUGUCUCUGC 265 22 6 hsa-miR-4746-5p CCGGUCCCAGGAGAACCUGCAGA 266 23 6 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC 267 22 6 hsa-miR-548o-3p CCAAAACUGCAGUUACUUUUGC 268 22 6 hsa-miR-1248 ACCUUCUUGUAUAAGCACUGUGCUAAA 269 27 5 hsa-miR-1254 AGCCUGGAAGCUGGAGCCUGCAGU 270 24 5 hsa-miR-1296 UUAGGGCCCUGGCUCCAUCUCC 271 22 5 hsa-miR-136-5p ACUCCAUUUGUUUUGAUGAUGGA 272 23 5 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC 273 23 5 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC 274 22 5 hsa-miR-3177-3p UGCACGGCACUGGGGACACGU 275 21 5 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG 276 20 5 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU 277 21 5 hsa-miR-342-5p AGGGGUGCUAUCUGUGAUUGA 278 21 5 hsa-miR-365b-3p UAAUGCCCCUAAAAAUCCUUAU 279 22 5 hsa-miR-3676-5p AGGAGAUCCUGGGUU 280 15 5 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA 281 22 5 hsa-miR-505-3p CGUCAACACUUGCUGGUUUCCU 282 22 5 hsa-miR-550a-3p UGUCUUACUCCCUCAGGCACAU 283 22 5 hsa-miR-5587-3p GCCCCGGGCAGUGUGAUCAUC 284 21 5 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC 285 24 5 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU 286 22 5 hsa-miR-664-3p UAUUCAUUUAUCCCCAGCCUACA 287 23 5 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG 288 23 5 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA 289 20 5 hsa-let-7e-3p CUAUACGGCCUCCUAGCUUUCC 290 22 4 hsa-miR-1268a CGGGCGUGGUGGUGGGGG 291 18 4 hsa-miR-1273f GGAGAUGGAGGUUGCAGUG 292 19 4 hsa-miR-1286 UGCAGGACCAAGAUGAGCCCU 293 21 4 hsa-miR-1291 UGGCCCUGACUGAAGACCAGCAGU 294 24 4 hsa-miR-141-3p UAACACUGUCUGGUAAAGAUGG 295 22 4 hsa-miR-1468 CUCCGUUUGCCUGUUUCGCUG 296 21 4 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU 297 22 4 hsa-miR-424-3p CAAAACGUGAGGCGCUGCUAU 298 21 4 hsa-miR-4454 GGAUCCGAGUCACGGCACCA 299 20 4 hsa-miR-4463 GAGACUGGGGUGGGGCC 300 17 4 hsa-miR-4671-3p UUAGUGCAUAGUCUUUGGUCU 301 21 4 hsa-miR-4775 UUAAUUUUUUGUUUCGGUCACU 302 22 4 hsa-miR-500a-5p UAAUCCUUGCUACCUGGGUGAGA 303 23 4 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC 304 22 4 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG 305 24 4 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU 306 22 4 hsa-miR-625-3p GACUAUAGAACUUUCCCCCUCA 307 22 4 hsa-miR-652-3p AAUGGCGCCACUAGGGUUGUG 308 21 4 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU 309 20 4 hsa-miR-766-3p ACUCCAGCCCCACAGCCUCAGC 310 22 4 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC 311 23 4 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC 312 22 4 hsa-miR-1180 UUUCCGGCUCGCGUGGGUGUGU 313 22 3 hsa-miR-1185-2-3p AUAUACAGGGGGAGACUCUCAU 314 22 3 hsa-miR-132-5p ACCGUGGCUUUCGAUUGUUACU 315 22 3 hsa-miR-16-2-3p CCAAUAUUACUGUGCUGCUUUA 316 22 3 hsa-miR-20b-5p CAAAGUGCUCAUAGUGCAGGUAG 317 23 3 hsa-miR-2116-3p CCUCCCAUGCCAAGAACUCCC 318 21 3 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU 319 22 3 hsa-miR-30b-3p CUGGGAGGUGGAUGUUUACUUC 320 22 3 hsa-miR-30c-2-3p CUGGGAGAAGGCUGUUUACUCU 321 22 3 hsa-miR-3187-3p UUGGCCAUGGGGCUGCGCGG 322 20 3 hsa-miR-3615 UCUCUCGGCUCCUCGCGGCUC 323 21 3 hsa-miR-3620 UCACCCUGCAUCCCGCACCCAG 324 22 3 hsa-miR-3654 GACUGGACAAGCUGAGGAA 325 19 3 hsa-miR-3662 GAAAAUGAUGAGUAGUGACUGAUG 326 24 3 hsa-miR-3681-5p UAGUGGAUGAUGCACUCUGUGC 327 22 3 hsa-miR-4286 ACCCCACUCCUGGUACC 328 17 3 hsa-miR-4640-3p CACCCCCUGUUUCCUGGCCCAC 329 22 3 hsa-miR-4717-3p ACACAUGGGUGGCUGUGGCCU 330 21 3 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA 331 22 3 hsa-miR-5584-5p CAGGGAAAUGGGAAGAACUAGA 332 22 3 hsa-miR-570-3p CGAAAACAGCAAUUACCUUUGC 333 22 3 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU 334 23 3 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA 335 21 3 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU 336 22 3 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU 337 23 3 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG 338 21 3 hsa-let-7b-3p CU AU ACAACCU ACUGCCU UCCC 339 22 2 hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU 340 26 2 hsa-miR-1255a AGGAUGAGCAAAGAAAGUAGAUU 341 23 2 hsa-miR-1273e UUGCUUGAACCCAGGAAGUGGA 342 22 2 hsa-miR-1289 UGGAGUCCAGGAAUCUGCAUUUU 343 23 2 hsa-miR-152 UCAGUGCAUGACAGAACUUGG 344 21 2 hsa-miR-194-5p UGUAACAGCAACUCCAUGUGGA 345 22 2 hsa-miR-195-5p U AGCAGCACAG AAAU AU UGGC 346 21 2 hsa-miR-200c-3p UAAUACUGCCGGGUAAUGAUGGA 347 23 2 hsa-miR-212-3p UAACAGUCUCCAGUCACGGCC 348 21 2 hsa-miR-222-5p CUCAGUAGCCAGUGUAGAUCCU 349 22 2 hsa-miR-3065-3p UCAGCACCAGGAUAUUGUUGGAG 350 23 2 hsa-miR-3115 AUAUGGGUU UACUAGU UGGU 351 20 2 hsa-miR-3126-5p UGAGGGACAGAUGCCAGAAGCA 352 22 2 hsa-miR-3174 UAGUGAGUUAGAGAUGCAGAGCC 353 23 2 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU 354 23 2 hsa-miR-33a-5p GUGCAU UGUAGUUGCAUUGCA 355 21 2 hsa-miR-3677-3p CUCGUGGGCUCUGGCCACGGCC 356 22 2 hsa-miR-369-5p AGAUCGACCGUGU UAUAUUCGC 357 22 2 hsa-miR-425-3p AUCGGGAAUGUCGUGUCCGCCC 358 22 2 hsa-miR-4426 GAAGAUGGACGUACU UU 359 17 2 hsa-miR-4467 UGGCGGCGGUAGUUAUGGGCUU 360 22 2 hsa-miR-4482-3p UU UCUAUU UCUCAGUGGGGCUC 361 22 2 hsa-miR-4515 AGGACUGGACUCCCGGCAGCCC 362 22 2 hsa-miR-4792 CGGUGAGCGCUCGCUGGC 363 18 2 hsa-miR-659-5p AGGACCUUCCCUGAACCAAGGA 364 22 2 hsa-miR-663a AGGCGGGGCGCCGCGGGACCGC 365 22 2 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC 366 21 2 hsa-miR-99a-3p CAAGCUCGCU UCUAUGGGUCUG 367 22 2 hsa-miR-1185-5p AGAGGAUACCCUU UGUAUGUU 368 21 1 hsa-miR-1225-3p UGAGCCCCUGUGCCGCCCCCAG 369 22 1 hsa-miR-1237 UCCU UCUGCUCCGUCCCCCAG 370 21 1 hsa-miR-1252 AGAAGGAAAUUGAAUUCAUU UA 371 22 1 hsa-miR-1257 AGUGAAUGAUGGGU UCUGACC 372 21 1 hsa-miR-1260b AUCCCACCACUGCCACCAU 373 19 1 hsa-miR-1273d GAACCCAUGAGGU UGAGGCUGCAGU 374 25 1 hsa-miR-1290 UGGAUU UU UGGAUCAGGGA 375 19 1 hsa-miR-1306-3p ACGUUGGCUCUGGUGGUG 376 18 1 hsa-miR-1321 CAGGGAGGUGAAUGUGAU 377 18 1 hsa-miR-1343 CUCCUGGGGCCCGCACUCUCGC 378 22 1 hsa-miR-138-5p AGCUGGUGUUGUGAAUCAGGCCG 379 23 1 hsa-miR-140-5p CAGUGGU UUUACCCUAUGGUAG 380 22 1 hsa-miR-146b-3p UGCCCUGUGGACUCAGU UCUGG 381 22 1 hsa-miR-186-3p GCCCAAAGGUGAAU UU UU UGGG 382 22 1 hsa-miR-1908 CGGCGGGGACGGCGAUUGGUC 383 21 1 hsa-miR-1915-3p CCCC AG GGCGACGCGGCGGG 384 20 1 hsa-miR-1915-5p ACCU UGCCUUGCUGCCCGGGCC 385 22 1 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU 386 22 1 hsa-miR-19b-l-5p AGU UU UGCAGGUU UGCAUCCAGC 387 23 1 hsa-miR-208b AUAAGACGAACAAAAGGUU UGU 388 22 1 hsa-miR-2110 UUGGGGAAACGGCCGCUGAGUG 389 22 1 hsa-miR-219-l-3p AGAGU UGAGUCUGGACGUCCCG 390 22 1 hsa-miR-26b-3p CCUGU UCUCCAU UACU UGGCUC 391 22 1 hsa-miR-2964a-3p AGAAU UGCGUUUGGACAAUCAGU 392 23 1 hsa-miR-29a-5p ACUGAUU UCUU UUGGUGU UCAG 393 22 1 hsa-miR-3126-3p CAUCUGGCAUCCGUCACACAGA 394 22 1 hsa-miR-3130-3p GCUGCACCGGAGACUGGGUAA 395 21 1 hsa-miR-3130-5p UACCCAGUCUCCGGUGCAGCC 396 21 1 hsa-miR-3140-5p ACCUGAAUUACCAAAAGCUUU 397 21 1 hsa-miR-3155a CCAGGCUCUGCAGUGGGAACU 398 21 1 hsa-miR-3157-3p CUGCCCUAGUCUAGCUGAAGCU 399 22 1 hsa-miR-3180-3p UGGGGCGGAGCUUCCGGAGGCC 400 22 1 hsa-miR-323b-5p AGGUUGUCCGUGGUGAGUUCGCA 401 23 1 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG 402 23 1 hsa-miR-34a-3p CAAUCAGCAAGUAUACUGCCCU 403 22 1 hsa-miR-34b-3p CAAUCACUAACUCCACUGCCAU 404 22 1 hsa-miR-34c-3p AA U C ACU A ACC AC ACG G CCAG G 405 22 1 hsa-miR-3658 UUUAAGAAAACACCAUGGAGAU 406 22 1 hsa-miR-365a-5p AGGGACUUUUGGGGGCAGAUGUG 407 23 1 hsa-miR-3676-3p CCGUGUUUCCCCCACGCUUU 408 20 1 hsa-miR-3691-5p AGUGGAUGAUGGAGACUCGGUAC 409 23 1 hsa-miR-376a-5p GUAGAUUCUCCUUCUAUGAGUA 410 22 1 hsa-miR-378g ACUGGGCUUGGAGUCAGAAG 411 20 1 hsa-miR-3909 UGUCCUCUAGGGCCUGCAGUCU 412 22 1 hsa-miR-3928 GGAGGAACCUUGGAGCUUCGGC 413 22 1 hsa-miR-3942-3p UUUCAGAUAACAGUAUUACAU 414 21 1 hsa-miR-3944-5p UGUGCAGCAGGCCAACCGAGA 415 21 1 hsa-miR-3960 GGCGGCGGCGGAGGCGGGGG 416 20 1 hsa-miR-4326 UGUUCCUCUGUCUCCCAGAC 417 20 1 hsa-miR-4444 CUCGAGUUGGAAGAGGCG 418 18 1 hsa-miR-4450 UGGGGAUUUGGAGAAGUGGUGA 419 22 1 hsa-miR-4642 AUGGCAUCGUCCCCUGGUGGCU 420 22 1 hsa-miR-4668-5p AGGGAAAAAAAAAAGGAUUUGUC 421 23 1 hsa-miR-4673 UCCAGGCAGGAGCCGGACUGGA 422 22 1 hsa-miR-4688 UAGGGGCAGCAGAGGACCUGGG 423 22 1 hsa-miR-4700-3p CACAGGACUGACUCCUCACCCCAGUG 424 26 1 hsa-miR-4731-3p CACACAAGUGGCCCCCAACACU 425 22 1 hsa-miR-4749-3p CGCCCCUCCUGCCCCCACAG 426 20 1 hsa-miR-4769-5p GGUGGGAUGGAGAGAAGGUAUGAG 427 24 1 hsa-miR-4800-5p AGUGGACCGAGGAAGGAAGGA 428 21 1 hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG 429 22 1 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA 430 22 1 hsa-miR-5092 AAUCCACGCUGAGCUUGGCAUC 431 22 1 hsa-miR-541-5p AAAGGAUUCUGCUGUCGGUCCCACU 432 25 1 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA 433 23 1 hsa-miR-551b-3p GCGACCCAUACUUGGUUUCAG 434 21 1 hsa-miR-5690 UCAGCUACUACCUCUAUUAGG 435 21 1 hsa-miR-577 UAGAUAAAAUAUUGGUACCUG 436 21 1 hsa-miR-584-3p UCAGUUCCAGGCCAACCAGGCU 437 22 1 hsa-miR-589-3p UCAGAACAAAUGCCGGUUCCCAGA 438 24 1 hsa-miR-616-5p ACUCAAAACCCUUCAGUGACUU 439 22 1 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG 440 22 1 hsa-miR-629-5p UGGGUUUACGUUGGGAGAACU 441 21 1 hsa-miR-644b-3p UUCAUUUGCCUCCCAGCCUACA 442 22 1 hsa-miR-664-5p ACUGGCUAGGGAAAAUGAUUGGAU 443 24 1 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC 444 23 1

Table 5: Cells El

CELLS - CTX0E03 07EI

SEQ ID MIRNA READ

MIRNA MIRNA.SEQUENCE NO: LENGTH COUNTS hsa-let-7a-5p UGAGGUAGUAGGUUGUAUAGUU 1 22 305060 hsa-miR-92b-3p UAUUGCACUCGUCCCGGCCUCC 13 22 242715 hsa-miR-21-5p UAGCUUAUCAGACUGAUGUUGA 9 22 154626 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU 7 22 137412 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU 14 22 110806 hsa-miR-100-5p AACCCGUAGAUCCGAACUUGUG 3 22 109290 hsa-miR-27b-3p UUCACAGUGGCUAAGUUCUGC 6 21 91902 hsa-miR-191-5p CA ACG G AA U CCC AA A AG C AG C U G 8 23 89150 hsa-miR-26a-5p UUCAAGUAAUCCAGGAUAGGCU 12 22 88724 hsa-miR-99b-5p CACCCGUAGAACCGACCUUGCG 4 22 87399 hsa-let-7f-5p UGAGGUAGUAGAUUGUAUAGUU 11 22 78395 hsa-miR-181a-5p AACAUUCAACGCUGUCGGUGAGU 15 23 47686 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG 5 22 41639 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG 30 22 35465 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU 10 22 30440 hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG 25 21 29047 hsa-miR-21-3p CA AC ACCAG UCGAUGGGCUGU 20 21 27733 hsa-miR-30d-5p UGUAAACAUCCCCGACUGGAAG 31 22 27307 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU 17 22 27224 hsa-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUG 2 23 26908 hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU 33 22 26456 hsa-miR-182-5p UUUGGCAAUGGUAGAACUCACACU 16 24 25885 hsa-miR-222-3p AGCUACAUCUGGCUACUGGGU 36 21 22187 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 35 24 20960 hsa-miR-16-5p UAGCAGCACGUAAAUAUUGGCG 29 22 19856 hsa-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU 28 22 19774 hsa-miR-151a-5p UCGAGGAGCUCACAGUCUAGU 37 21 19773 hsa-let-7e-5p UGAGGUAGGAGGUUGUAUAGUU 27 22 19035 hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 42 22 17965 hsa-let-7i-5p UGAGGUAGUAGUUUGUGCUGUU 22 22 17802 hsa-let-7g-5p UGAGGUAGUAGUUUGUACAGUU 43 22 15467 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU 47 22 14133 hsa-miR-30e-5p UGUAAACAUCCUUGACUGGAAG 45 22 13889 hsa-miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU 38 23 12606 hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU 40 22 12441 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU 51 22 9851 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 41 23 8893 hsa-miR-30c-5p UGUAAACAUCCUACACUCUCAGC 66 23 8737 hsa-miR-410 AAUAUAACACAGAUGGCCUGU 50 21 8509 hsa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 19 22 8434 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU 336 22 8392 hsa-miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA 58 23 7957 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA 56 22 7767 hsa-miR-148a-3p UCAGUGCACUACAGAACUUUGU 54 22 6599 hsa-miR-379-5p UGGUAGACUAUGGAACGUAGG 18 21 6135 hsa-let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 53 22 5972 hsa-miR-183-5p UAUGGCACUGGUAGAAUUCACU 24 22 5477 hsa-miR-25-3p CAUUGCACUUGUCUCGGUCUGA 63 22 5303 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU 57 23 5225 hsa-miR-889 UUAAUAUCGGACAACCAUUGU 64 21 4597 hsa-miR-221-5p ACCUGGCAUACAAUGUAGAUUU 39 22 4379 hsa-miR-125b-l-3p ACGGGUUAGGCUCUUGGGAGCU 49 22 4192 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU 32 23 3970 hsa-miR-4492 GGGGCUGGGCGCGCGCC 34 17 3864 hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU 48 22 3593 hsa-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA 62 23 3518 hsa-miR-1271-5p CUUGGCACCUAGCAAGCACUCA 72 22 3477 hsa-miR-136-3p CAUCAUCGUCUCAAAUGAGUCU 82 22 3373 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU 75 22 2957 hsa-miR-4532 CCCCG G G G AG CCCG G CG 23 17 2915 hsa-miR-378a-3p ACUGGACUUGGAGUCAGAAGG 65 21 2895 hsa-miR-99a-5p AACCCGUAGAUCCGAUCUUGUG 52 22 2767 hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 79 23 2764 hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC 71 22 2441 hsa-miR-26b-5p UUCAAGUAAUUCAGGAUAGGU 90 21 2432 hsa-miR-4488 AGGGGGCGGGCUCCGGCG 61 18 2391 hsa-miR-27a-3p UUCACAGUGGCUAAGUUCCGC 46 21 2385 hsa-miR-23b-3p AUCACAUUGCCAGGGAUUACC 59 21 2316 hsa-miR-500a-3p AUGCACCUGGGCAAGGAUUCUG 44 22 2144 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC 60 23 2114 hsa-miR-23a-3p AUCACAUUGCCAGGGAUUUCC 55 21 2086 hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC 77 22 2045 hsa-miR-30b-5p UGUAAACAUCCUACACUCAGCU 96 22 1936 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU 26 22 1895 hsa-miR-130b-3p CAGUGCAAUGAUGAAAGGGCAU 86 22 1862 hsa-miR-1246 AAUGGAUUUUUGGAGCAGG 21 19 1783 hsa-miR-140-3p UACCACAGGGUAGAACCACGG 138 21 1735 hsa-miR-31-5p AGGCAAGAUGCUGGCAUAGCU 80 21 1705 hsa-miR-493-3p UGAAGGUCUACUGUGUGCCAGG 83 22 1698 hsa-miR-181c-5p AACAUUCAACCUGUCGGUGAGU 105 22 1554 hsa-miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG 116 23 1492 hsa-miR-181a-2-3p ACCACUGACCGUUGACUGUACC 102 22 1491 hsa-miR-15b-5p UAGCAGCACAUCAUGGUUUACA 78 22 1465 hsa-miR-7-5p UGGAAGACUAGUGAUUUUGUUGU 85 23 1460 hsa-miR-192-5p CUGACCUAUGAAUUGACAGCC 87 21 1453 hsa-miR-425-5p AAUGACACGAUCACUCCCGUUGA 111 23 1432 hsa-miR-204-5p UUCCCUUUGUCAUCCUAUGCCU 89 22 1378 hsa-miR-340-5p UUAUAAAGCAAUGAGACUGAUU 93 22 1360 hsa-miR-190a UGAUAUGUUUGAUAUAUUAGGU 103 22 1305 hsa-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU 101 22 1283 hsa-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG 146 23 1257 hsa-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA 106 22 1206 hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC 70 22 1173 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC 69 21 1166 hsa-miR-411-5p U AG U AG ACCG U AU AGCG UACG 108 21 1130 hsa-miR-589-5p UGAGAACCACGUCUGCUCUGAG 73 22 1067 hsa-miR-130a-3p CAGUGCAAUGUUAAAAGGGCAU 113 22 1020 hsa-miR-320a AAAAGCUGGGUUGAGAGGGCGA 97 22 994 hsa-miR-149-5p UCUGGCUCCGUGUCUUCACUCCC 121 23 948 hsa-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU 128 23 945 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG 94 22 941 hsa-miR-17-5p CA AAG UGCUUACAGUGCAGGUAG 145 23 939 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU 88 22 876 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 125 23 846 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU 118 22 835 hsa-miR-181a-3p ACCAUCGACCGUUGAUUGUACC 100 22 803 hsa-miR-24-3p U G G C U C AG U U CAG CAG G AACAG 119 22 740 hsa-miR-128 UCACAG UGAACCGG U CU CU U U 109 21 707 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU 81 23 698 hsa-miR-454-3p UAGUGCAAUAUUGCUUAUAGGGU 169 23 690 hsa-miR-1307-5p UCGACCGGACCUCGACCGGCU 91 21 616 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU 117 22 590 hsa-miR-130b-5p ACUCUUUCCCUGUUGCACUAC 112 21 568 hsa-miR-197-3p U U CACCACCU U CU CCACCCAGC 122 22 544 hsa-miR-432-5p UCUUGGAGUAGGUCAUUGGGUGG 95 23 542 hsa-miR-374a-5p UUAUAAUACAACCUGAUAAGUG 74 22 537 hsa-miR-345-5p GCUGACUCCUAGUCCAGGGCUC 76 22 527 hsa-miR-744-5p UGCGGGGCUAGGGCUAACAGCA 99 22 515 hsa-miR-376c AACAUAGAGGAAAUUCCACGU 185 21 506 hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU 157 23 497 hsa-miR-363-3p AAUUGCACGGUAUCCAUCUGUA 131 22 493 hsa-miR-539-3p AUCAUACAAGGACAAUUUCUUU 150 22 493 hsa-miR-758 UUUGUGACCUGGUCCACUAACC 141 22 477 hsa-miR-323a-3p CACAUUACACGGUCGACCUCU 158 21 443 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA 254 23 431 hsa-miR-720 UCUCGCUGGGGCCUCCA 84 17 427 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC 115 22 409 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU 126 22 406 hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC 151 23 399 hsa-miR-30d-3p CUUUCAGUCAGAUGUUUGCUGC 114 22 358 hsa-miR-148b-5p AAGUUCUGUUAUACACUCAGGC 127 22 354 hsa-miR-1301 UUGCAGCUGCCUGGGAGUGACUUC 181 24 346 hsa-miR-374b-5p AUAUAAUACAACCUGCUAAGUG 143 22 339 hsa-miR-125b-2-3p UCACAAGUCAGGCUCUUGGGAC 68 22 333 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG 152 22 332 hsa-miR-495 AAACAAACAUGGUGCACUUCUU 241 22 321 hsa-miR-15a-5p UAGCAGCACAUAAUGGUUUGUG 223 22 320 hsa-miR-100-3p CAAGCUUGUAUCUAUAGGUAUG 98 22 314 hsa-miR-193b-3p AACUGGCCCUCAAAGUCCCGCU 148 22 305 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC 161 22 303 hsa-miR-376a-3p AUCAUAGAGGAAAAUCCACGU 237 21 298 hsa-miR-135b-5p UAUGGCUUUUCAUUCCUAUGUGA 137 23 289 hsa-miR-301a-3p CAGUGCAAUAGUAUUGUCAAAGC 107 23 280 hsa-miR-218-5p UUGUGCUUGAUCUAACCAUGU 206 21 276 hsa-miR-143-3p UGAGAUGAAGCACUGUAGCUC 176 21 256 hsa-miR-27b-5p AGAGCUUAGCUGAUUGGUGAAC 201 22 255 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU 196 21 255 hsa-miR-877-5p GUAGAGGAGAUGGCGCAGGG 133 20 249 hsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA 163 23 246 hsa-miR-424-5p CAGCAGCAAUUCAUGUUUUGAA 186 22 245 hsa-miR-660-5p UACCCAUUGCAUAUCGGAGUUG 187 22 244 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU 178 22 238 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU 182 22 235 hsa-miR-431-3p CAGGUCGUCUUGCAGGGCUUCU 168 22 231 hsa-miR-374a-3p CUUAUCAGAUUGUAUUGUAAUU 173 22 220 hsa-miR-148a-5p AAAGUUCUGAGACACUCCGACU 144 22 214 hsa-miR-4516 GGGAGAAGGGUCGGGGC 110 17 207 hsa-miR-92b-5p AGGGACGGGACGCGGUGCAGUG 208 22 206 hsa-miR-16-2-3p CCAAUAUUACUGUGCUGCUUUA 316 22 202 hsa-miR-101-3p UACAGUACUGUGAUAACUGAA 142 21 201 hsa-let-7a-3p CUAUACAAUCUACUGUCUUUC 222 21 199 hsa-miR-4485 UAACGGCCGCGGUACCCUAA 67 20 195 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC 140 21 192 hsa-miR-185-5p UGGAGAGAAAGGCAGUUCCUGA 224 22 188 hsa-miR-1185-l-3p AUAUACAGGGGGAGACUCUUAU 209 22 187 hsa-miR-1197 UAGGACACAUGGUCUACUUCU 244 21 185 hsa-miR-106b-3p CCGCACUGUGGGUACUUGCUGC 159 22 178 hsa-miR-24-2-5p UGCCUACUGAGCUGAAACACAG 156 22 178 hsa-miR-4677-3p UCUGUGAGACCAAAGAACUACU 120 22 177 hsa-miR-380-3p UAUGUAAUAUGGUCCACAUCUU 445 22 174 hsa-miR-548k AAAAGUACUUGCGGAUUUUGCU 198 22 171 hsa-miR-1307-3p ACUCGGCGUGGCGUCGGUCGUG 124 22 169 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU 153 22 168 hsa-miR-494 UGAAACAUACACGGGAAACCUC 240 22 165 hsa-miR-17-3p ACUGCAGUGAAGGCACUUGUAG 184 22 163 hsa-miR-561-5p AUCAAGGAUCUUAAACUUUGCC 179 22 160 hsa-miR-27a-5p AGGGCUUAGCUGCUUGUGAGCA 130 22 158 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA 147 22 151 hsa-miR-9-3p AUAAAGCUAGAUAACCGAAAGU 183 22 151 hsa-miR-96-5p UUUGGCACUAGCACAUUUUUGCU 123 23 151 hsa-miR-656 AAUAUUAUACAGUCAACCUCU 221 21 147 hsa-miR-379-3p UAUGUAACAUGGUCCACUAACU 446 22 145 hsa-miR-382-5p GAAGUUGUUCGUGGUGGAUUCG 238 22 144 hsa-miR-541-3p UGGUGGGCACAGAAUCUGGACU 136 22 141 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC 215 22 139 hsa-miR-15b-3p CGAAUCAUUAUUUGCUGCUCUA 447 22 137 hsa-miR-20b-5p CAAAGUGCUCAUAGUGCAGGUAG 317 23 136 hsa-miR-329 AACACACCUGGUUAACCUCUUU 214 22 136 hsa-miR-3676-5p AGGAGAUCCUGGGUU 280 15 134 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU 193 22 134 hsa-miR-365b-3p UAAUGCCCCUAAAAAUCCUUAU 279 22 133 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 160 22 131 hsa-miR-3065-5p UCAACAAAAUCACUGAUGCUGGA 226 23 130 hsa-miR-1296 UUAGGGCCCUGGCUCCAUCUCC 271 22 126 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC 311 23 118 hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG 104 22 116 hsa-miR-4284 GGGCUCACAUCACCCCAU 191 18 116 hsa-miR-487a AAUCAUACAGGGACAUCCAGUU 203 22 113 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU 334 23 113 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC 164 23 111 hsa-miR-548o-3p CCAAAACUGCAGUUACUUUUGC 268 22 105 hsa-miR-18a-5p UAAGGUGCAUCUAGUGCAGAUAG 256 23 104 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC 165 22 104 hsa-miR-548ah-5p AAAAGUGAUUGCAGUGUUUG 235 20 103 hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU 250 23 101 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU 174 22 101 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU 277 21 100 hsa-miR-1276 UAAAGAGCCCUGUGGAGACA 194 20 99 hsa-miR-30c-l-3p CUGGGAGAGGGUUGUUUACUCC 213 22 99 hsa-miR-31-3p UGCUAUGCCAACAUAUUGCCAU 172 22 96 hsa-miR-424-3p CAAAACGUGAGGCGCUGCUAU 298 21 96 hsa-miR-550a-5p AGUGCCUGAGGGAGUAAGAGCCC 134 23 95 hsa-miR-4454 GGAUCCGAGUCACGGCACCA 299 20 94 hsa-miR-541-5p AAAGGAUUCUGCUGUCGGUCCCACU 432 25 92 hsa-miR-106b-5p UAAAGUGCUGACAGUGCAGAU 170 21 89 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC 188 22 88 hsa-miR-135b-3p AUGUAGGGCUAAAAGCCAUGGG 205 22 87 hsa-miR-574-3p CACGCUCAUGCACACACCCACA 253 22 87 hsa-miR-1226-3p UCACCAGCCCUGUGUUCCCUAG 199 22 85 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU 306 22 84 hsa-miR-127-5p CUGAAGCUCAGAGGGCUCUGAU 255 22 83 hsa-miR-155-5p UUAAUGCUAAUCGUGAUAGGGGU 448 23 83 hsa-miR-3176 ACUGGCCUGGGACUACCGG 227 19 83 hsa-miR-382-3p AAUCAUUCACGGACAACACUU 260 21 83 hsa-miR-1275 GUGGGGGAGAGGCUGUC 162 17 82 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG 288 23 82 hsa-miR-23a-5p GGGGUUCCUGGGGAUGGGAUUU 212 22 81 hsa-miR-25-5p AGGCGGAGACUUGGGCAAUUG 225 21 80 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC 285 24 80 hsa-miR-19a-3p UGUGCAAAUCUAUGCAAAACUGA 177 23 79 hsa-miR-377-3p AUCACACAAAGGCAACUUUUGU 449 22 78 hsa-miR-454-5p ACCCUAUCAAUAUUGUCUCUGC 265 22 78 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC 267 22 78 hsa-miR-29b-3p UAGCACCAUUUGAAAUCAGUGUU 166 23 77 hsa-miR-26a-2-3p CCUAUUCUUGAUUACUUGUUUC 257 22 76 hsa-miR-1260b AUCCCACCACUGCCACCAU 373 19 74 hsa-miR-2467-5p UGAGGCUCUGUUAGCCUUGGCUC 154 23 74 hsa-miR-377-5p AGAGGUUGCCCUUGGUGAAUUC 202 22 74 hsa-miR-330-3p G CA AAG CACACG G CCU G CAG AG A 195 23 73 hsa-miR-1180 UUUCCGGCUCGCGUGGGUGUGU 313 22 71 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 243 22 71 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU 319 22 69 hsa-miR-374b-3p CUUAGCAGGUUGUAUUAUCAUU 229 22 69 hsa-miR-4746-5p CCGGUCCCAGGAGAACCUGCAGA 266 23 69 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA 450 21 68 hsa-miR-340-3p UCCGUCUCAGUUACUUUAUAGC 248 22 68 hsa-miR-92a-l-5p AGGUUGGGAUCGGUUGCAAUGCU 204 23 68 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA 331 22 66 hsa-miR-431-5p UGUCUUGCAGGCCGUCAUGCA 132 21 65 hsa-miR-1254 AGCCUGGAAGCUGGAGCCUGCAGU 270 24 61 hsa-miR-3158-3p AAGGGCUUCCUCUCUGCAGGAC 167 22 61 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU 139 24 61 hsa-miR-30c-2-3p CUGGGAGAAGGCUGUUUACUCU 321 22 59 hsa-miR-4461 GAUUGAGACUAGUAGGGCUAGGC 129 23 59 hsa-miR-3200-3p CACCUUGCGCUACUCAGGUCUG 247 22 57 hsa-miR-215 AUGACCUAUGAAUUGACAGAC 451 21 56 hsa-miR-1185-5p AGAGGAUACCCUUUGUAUGUU 368 21 55 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU 297 22 55 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU 286 22 55 hsa-miR-181b-3p CUCACUGAACAAUGAAUGCAA 245 21 54 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU 452 22 54 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU 453 21 54 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA 289 20 54 hsa-miR-3909 UGUCCUCUAGGGCCUGCAGUCU 412 22 53 hsa-miR-4508 GCGGGGCUGGGCGCGCG 135 17 53 hsa-miR-4521 GCUAAGGAAGUCCUGUGCUCAG 233 22 53 hsa-let-7e-3p CUAUACGGCCUCCUAGCUUUCC 290 22 52 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG 192 22 52 hsa-miR-93-3p ACUGCUGAGCUAGCACUUCCCG 454 22 51 hsa-miR-151b UCGAGGAGCUCACAGUCU 455 18 49 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG 456 22 49 hsa-miR-152 UCAGUGCAUGACAGAACUUGG 344 21 48 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG 276 20 48 hsa-miR-1266 CCUCAGGGCUGUAGAACAGGGCU 457 23 47 hsa-miR-302b-3p UAAGUGCUUCCAUGUUUUAGUAG 458 23 47 hsa-miR-548e AAAAACUGAGACUACUUUUGCA 459 22 47 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA 281 22 46 hsa-miR-302d-3p UAAGUGCUUCCAUGUUUGAGUGU 460 23 45 hsa-miR-3943 UAGCCCCCAGGCUUCACUUGGCG 207 23 45 hsa-miR-1286 UGCAGGACCAAGAUGAGCCCU 293 21 44 hsa-miR-3605-5p UGAGGAUGGAUAGCAAGGAAGCC 189 23 44 hsa-miR-505-3p CGUCAACACUUGCUGGUUUCCU 282 22 44 hsa-miR-3615 UCUCUCGGCUCCUCGCGGCUC 323 21 43 hsa-miR-4435 AUGGCCAGAGCUCACACAGAGG 230 22 43 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA 461 22 43 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 462 21 42 hsa-miR-4671-3p UUAGUGCAUAGUCUUUGGUCU 301 21 41 hsa-miR-652-3p AAUGGCGCCACUAGGGUUGUG 442 21 41 hsa-miR-3687 CCCGGACAGGCGUUCGUGCGACGU 190 24 40 hsa-miR-4286 ACCCCACUCCUGGUACC 328 17 40 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU 463 21 40 hsa-miR-1285-3p UCUGGGCAACAAAGUGAGACCU 464 22 39 hsa-miR-2355-5p AUCCCCAGAUACAAUGGACAA 593 21 38 hsa-miR-550a-3p UGUCUUACUCCCUCAGGCACAU 283 22 38 hsa-let-7d-3p CUAUACGACCUGCUGCCUUUCU 92 22 37 hsa-miR-136-5p ACUCCAUUUGUUUUGAUGAUGGA 272 23 37 hsa-miR-1468 CUCCGUUUGCCUGUUUCGCUG 296 21 37 hsa-miR-3609 CAAAGUGAUGAGUAAUACUGGCUG 216 24 37 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC 304 22 37 hsa-miR-664-3p UAUUCAUUUAUCCCCAGCCUACA 287 23 37 hsa-miR-99a-3p CAAGCUCGCUUCUAUGGGUCUG 367 22 37 hsa-miR-532-3p CCUCCCACACCCAAGGCUUGCA 252 22 36 hsa-miR-10b-5p UACCCUGUAGAACCGAAUUUGUG 465 23 33 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC 357 22 33 hsa-miR-3161 CUGAUAAGAACAGAGGCCCAGAU 466 23 32 hsa-miR-3940-3p CAGCCCGG AUCCCAGCCCACU U 239 22 32 hsa-miR-663b GGUGGCCCGGCCGUGCCUGAGG 180 22 32 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU 467 22 31 hsa-miR-2277-5p AGCGCGGGCUGAGCGCUGCCAGUC 735 24 31 hsa-miR-4448 GGCUCCUUGGUCUAGGGGUA 231 20 31 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG 402 23 30 hsa-miR-3613-5p UGUUGUACUUUUUUUUUUGUUC 469 22 30 hsa-miR-4775 UUAAUUUUUUGUUUCGGUCACU 302 22 30 hsa-miR-212-5p ACCUUGGCUCUAGACUGCUUACU 246 23 29 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU 354 23 27 hsa-miR-4326 UGU UCCUCUGUCUCCCAGAC 417 20 27 hsa-miR-582-3p UAACUGGU UGAACAACUGAACC 470 22 27 hsa-miR-34a-3p CAAUCAGCAAGUAUACUGCCCU 403 22 26 hsa-miR-106a-5p AAAAGUGCU UACAGUGCAGGUAG 471 23 25 hsa-miR-4745-5p UGAGUGGGGCUCCCGGGACGGCG 219 23 25 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU 337 23 25 hsa-miR-1268a CGGGCGUGGUGGUGGGGG 291 18 24 hsa-miR-154-3p AAUCAUACACGGU UGACCUAUU 472 22 24 hsa-miR-188-3p CUCCCACAUGCAGGGU UUGCA 200 21 24 hsa-miR-29c-3p UAGCACCAU UUGAAAUCGGU UA 473 22 24 hsa-miR-539-5p GGAGAAAUUAUCCUUGGUGUGU 234 22 24 hsa-miR-766-3p ACUCCAGCCCCACAGCCUCAGC 310 22 24 hsa-miR-30b-3p CUGGGAGGUGGAUGUU UACU UC 320 22 23 hsa-miR-3177-3p UGCACGGCACUGGGGACACGU 275 21 23 hsa-miR-191-3p GCUGCGCU UGGAUUUCGUCCCC 474 22 22 hsa-miR-296-3p GAGGGU UGGGUGGAGGCUCUCC 274 22 22 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU 258 21 22 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG 228 23 22 hsa-miR-501-5p AAUCCU UUGUCCCUGGGUGAGA 430 22 22 hsa-miR-200b-3p UAAUACUGCCUGGUAAUGAUGA 475 22 21 hsa-miR-212-3p UAACAGUCUCCAGUCACGGCC 348 21 21 hsa-miR-26b-3p CCUGU UCUCCAU UACU UGGCUC 391 22 21 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU 309 20 21 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC 476 23 21 hsa-miR-146a-5p UGAGAACUGAAUUCCAUGGGUU 477 22 20 hsa-miR-1973 ACCGUGCAAAGGUAGCAUA 171 19 20 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA 478 22 20 hsa-miR-3607-5p GCAUGUGAUGAAGCAAAUCAGU 249 22 20 hsa-miR-378a-5p CUCCUGACUCCAGGUCCUGUGU 217 22 20 hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCA 155 22 20 hsa-miR-138-5p AGCUGGUGUUGUGAAUCAGGCCG 379 23 19 hsa-miR-146b-3p UGCCCUGUGGACUCAGU UCUGG 381 22 18 hsa-miR-3065-3p UCAGCACCAGGAUAUUGUUGGAG 350 23 18 hsa-miR-4417 GGUGGGCUUCCCGGAGGG 175 18 18 hsa-miR-497-5p CAGCAGCACACUGUGGUU UGU 479 21 18 hsa-miR-500a-5p UAAUCCUUGCUACCUGGGUGAGA 303 23 18 hsa-miR-625-3p GACUAUAGAACU UUCCCCCUCA 307 22 18 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA 335 21 18 hsa-miR-1343 CUCCUGGGGCCCGCACUCUCGC 378 22 17 hsa-miR-3648 AGCCGCGGGGAUCGCCGAGGG 259 21 17 hsa-miR-432-3p CUGGAUGGCUCCUCCAUGUCU 262 21 17 hsa-miR-4482-3p UU UCUAUU UCUCAGUGGGGCUC 361 22 17 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA 433 23 17 hsa-miR-551b-3p GCGACCCAUACUUGGU UUCAG 434 21 17 hsa-miR-7-l-3p CAACAAAUCACAGUCUGCCAUA 480 22 17 hsa-miR-219-l-3p AGAGU UGAGUCUGGACGUCCCG 390 22 16 hsa-miR-3656 GGCGGGUGCGGGGGUGG 251 17 16 hsa-miR-3661 UGACCUGGGACUCGGACAGCUG 481 22 16 hsa-miR-411-3p UAUGUAACACGGUCCACUAACC 482 22 16 hsa-miR-5096 GUUUCACCAUGUUGGUCAGGC 220 21 16 hsa-miR-577 UAGAUAAAAUAUUGGUACCUG 436 21 16 hsa-let-7i-3p CUGCGCAAGCUACUGCCUUGCU 483 22 15 hsa-miR-132-5p ACCGUGGCUUUCGAUUGUUACU 315 22 15 hsa-miR-140-5p CAGUGGUUUUACCCUAUGGUAG 380 22 15 hsa-miR-195-5p U AGCAGCACAG AAAU AU UGGC 346 21 15 hsa-miR-3187-3p UUGGCCAUGGGGCUGCGCGG 322 20 15 hsa-miR-342-5p AGGGGUGCUAUCUGUGAUUGA 278 21 15 hsa-miR-34b-3p CAAUCACUAACUCCACUGCCAU 404 22 15 hsa-miR-4661-5p AACUAGCUCUGUGGAUCCUGAC 484 22 15 hsa-miR-584-5p UUAUGGUUUGCCUGGGACUGAG 485 22 15 hsa-miR-744-3p CUGUUGCCACUAACCUCAACCU 486 22 15 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA 487 23 15 hsa-miR-3677-3p CUCGUGGGCUCUGGCCACGGCC 356 22 14 hsa-miR-425-3p AUCGGGAAUGUCGUGUCCGCCC 358 22 14 hsa-miR-548ah-3p CAAAAACUGCAGUUACUUUUGC 149 22 14 hsa-miR-5699 UCCUGUCUUUCCUUGUUGGAGC 488 22 14 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU 489 23 14 hsa-miR-1185-2-3p AUAUACAGGGGGAGACUCUCAU 314 22 13 hsa-miR-1249 ACGCCCU UCCCCCCCU UCU UCA 490 22 13 hsa-miR-1255a AGGAUGAGCAAAGAAAGUAGAUU 341 23 13 hsa-miR-1910 CCAGUCCUGUGCCUGCCGCCU 236 21 13 hsa-miR-301a-5p GCUCUGACUUUAUUGCACUACU 491 22 13 hsa-miR-5001-3p UUCUGCCUCUGUCCAGGUCCUU 492 22 13 hsa-miR-5094 AAUCAGUGAAUGCCUUGAACCU 493 22 13 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG 440 22 13 hsa-miR-629-5p UGGGUUUACGUUGGGAGAACU 441 21 13 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC 312 22 13 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC 366 21 13 hsa-miR-1248 ACCUUCUUGUAUAAGCACUGUGCUAAA 269 27 12 hsa-miR-194-5p UGUAACAGCAACUCCAUGUGGA 345 22 12 hsa-miR-199b-3p ACAGUAGUCUGCACAUUGGUUA 494 22 12 hsa-miR-22-5p AGUUCUUCAGUGGCAAGCUUUA 495 22 12 hsa-miR-3605-3p CCUCCGUGUUACCUGUCCUCUAG 496 23 12 hsa-miR-3654 GACUGGACAAGCUGAGGAA 325 19 12 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC 497 22 12 hsa-miR-1291 UGGCCCUGACUGAAGACCAGCAGU 294 24 11 hsa-miR-1299 UUCUGGAAUUCUGUGUGAGGGA 498 22 11 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG 499 21 11 hsa-miR-222-5p CUCAGUAGCCAGUGUAGAUCCU 349 22 11 hsa-miR-331-5p CUAGGUAUGGUCCCAGGGAUCC 500 22 11 hsa-miR-3939 UACGCGCAGACCACAGGAUGUC 261 22 11 hsa-miR-154-5p UAGGUUAUCCGUGUUGCCUUCG 501 22 10 hsa-miR-18a-3p ACUGCCCUAAGUGCUCCUUCUGG 502 23 10 hsa-miR-1908 CGGCGGGGACGGCGAUUGGUC 383 21 10 hsa-miR-200c-3p UAAUACUGCCGGGUAAUGAUGGA 347 23 10 hsa-miR-2116-3p CCUCCCAUGCCAAGAACUCCC 318 21 10 hsa-miR-302a-3p UAAGUGCUUCCAUGUUUUGGUGA 503 23 10 hsa-miR-3174 UAGUGAGUUAGAGAUGCAGAGCC 353 23 10 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG 504 20 10 hsa-let-7g-3p CUGUACAGGCCACUGCCUUGC 505 21 9 hsa-miR-141-3p UAACACUGUCUGGUAAAGAUGG 295 22 9 hsa-miR-24-l-5p UGCCUACUGAGCUGAUAUCAGU 506 22 9 hsa-miR-3115 AUAUGGGUUUACUAGUUGGU 351 20 9 hsa-miR-3180-3p UGGGGCGGAGCUUCCGGAGGCC 400 22 9 hsa-miR-33a-5p GUGCAUUGUAGUUGCAUUGCA 355 21 9 hsa-miR-34c-3p AA U C ACU A ACC AC ACG G CCAG G 405 22 9 hsa-miR-3929 GAGGCUGAUGUGAGUAGACCACU 218 23 9 hsa-miR-4517 AAAUAUGAUGAAACUCACAGCUGAG 507 25 9 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC 508 22 9 hsa-miR-1229 CUCUCACCACUGCCCUCCCACAG 509 23 8 hsa-miR-1289 UGGAGUCCAGGAAUCUGCAUUUU 343 23 8 hsa-miR-1915-5p ACCUUGCCUUGCUGCCCGGGCC 385 22 8 hsa-miR-23b-5p UGGGUUCCUGGCAUGCUGAUUU 510 22 8 hsa-miR-302a-5p ACUUAAACGUGGAUGUACUUGCU 511 23 8 hsa-miR-3938 AAU UCCCU UG U AG AU AACCCGG 512 22 8 hsa-miR-4466 GGGUGCGGGCCGGCGGGG 264 18 8 hsa-miR-4786-5p UGAGACCAGGACUGGAUGCACC 197 22 8 hsa-miR-589-3p UCAGAACAAAUGCCGGUUCCCAGA 438 24 8 hsa-miR-616-5p ACUCAAAACCCUUCAGUGACUU 439 22 8 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG 338 21 8 hsa-miR-1237 UCCUUCUGCUCCGUCCCCCAG 370 21 7 hsa-miR-1915-3p CCCC AG GGCGACGCGGCGGG 384 20 7 hsa-miR-3620 UCACCCUGCAUCCCGCACCCAG 324 22 7 hsa-miR-3691-5p AGUGGAUGAUGGAGACUCGGUAC 409 23 7 hsa-miR-4426 GAAGAUGGACGUACUUU 359 17 7 hsa-let-7a-2-3p CUGUACAGCCUCCUAGCUUUCC 513 22 6 hsa-miR-10a-3p CAAAUUCGUAUCUAGGGGAAUA 514 22 6 hsa-miR-1287 UGCUGGAUCAGUGGUUCGAGUC 515 22 6 hsa-miR-145-5p GUCCAGUUUUCCCAGGAAUCCCU 516 23 6 hsa-miR-29b-l-5p GCUGGUUUCAUAUGGUGGUUUAGA 517 24 6 hsa-miR-3128 UCUGGCAAGUAAAAAACUCUCAU 518 23 6 hsa-miR-33b-5p GUGCAUUGCUGUUGCAUUGC 519 20 6 hsa-miR-3681-5p UAGUGGAUGAUGCACUCUGUGC 327 22 6 hsa-miR-3685 UUUCCUACCCUACCUGAAGACU 520 22 6 hsa-miR-3918 ACAGGGCCGCAGAUGGAGACU 521 21 6 hsa-miR-551b-5p GAAAUCAAGCGUGGGUGAGACC 522 22 6 hsa-miR-1273f GGAGAUGGAGGUUGCAGUG 292 19 5 hsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAG 210 21 5 hsa-miR-1304-5p UUUGAGGCUACAGUGAGAUGUG 523 22 5 hsa-miR-1538 CGGCCCGGGCUGCUGCUGUUCCU 524 23 5 hsa-miR-181c-3p AACCAU CG ACCG U U G AG U GG AC 525 22 5 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA 526 22 5 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU 388 22 5 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU 527 21 5 hsa-miR-3159 UAGGAUUACAAGUGUCGGCCAC 528 22 5 hsa-miR-3173-5p UGCCCUGCCUGUUUUCUCCUUU 529 22 5 hsa-miR-3175 CGGGGAGAGAACGCAGUGACGU 530 22 5 hsa-miR-3200-5p AAUCUGAGAAGGCGCACAAGGU 531 22 5 hsa-miR-3662 GAAAAUGAUGAGUAGUGACUGAUG 326 24 5 hsa-miR-3928 GGAGGAACCUUGGAGCUUCGGC 413 22 5 hsa-miR-4709-3p UUGAAGAGGAGGUGCUCUGUAGC 532 23 5 hsa-miR-4787-3p GAUGCGCCGCCCACUGCCCCGCGC 533 24 5 hsa-miR-499a-5p UUAAGACUUGCAGUGAUGUUU 534 21 5 hsa-miR-545-3p UCAGCAAACAUUUAUUGUGUGC 242 22 5 hsa-miR-548u CAAAGACUGCAAUUACUUUUGCG 535 23 5 hsa-miR-659-5p AGGACCUUCCCUGAACCAAGGA 364 22 5 hsa-miR-1257 AGUGAAUGAUGGGUUCUGACC 372 21 4 hsa-miR-1292 UGGGAACGGGUUCCGGCAGACGCUG 536 25 4 hsa-miR-1914-5p CCCUGUGCCCGGCCCACUUCUG 537 22 4 hsa-miR-195-3p CCAAUAUUGGCUGUGCUGCUCC 538 22 4 hsa-miR-2110 UUGGGGAAACGGCCGCUGAGUG 389 22 4 hsa-miR-302c-5p UUUAACAUGGGGGUACCUGCUG 539 22 4 hsa-miR-3126-3p CAUCUGGCAUCCGUCACACAGA 394 22 4 hsa-miR-3126-5p UGAGGGACAGAUGCCAGAAGCA 352 22 4 hsa-miR-3150a-5p CAACCUCGACGAUCUCCUCAGC 540 22 4 hsa-miR-3157-3p CUGCCCUAGUCUAGCUGAAGCU 399 22 4 hsa-miR-323b-3p CCCAAUACACGGUCGACCUCUU 541 22 4 hsa-miR-335-3p UUUUUCAUUAUUGCUCCUGACC 542 22 4 hsa-miR-3607-3p ACUGUAAACGCUUUCUGAUG 543 20 4 hsa-miR-3653 CUAAGAAGUUGACUGAAG 544 18 4 hsa-miR-3663-3p U G AG CACC AC AC AG G CCG G G CG C 545 23 4 hsa-miR-376a-5p GUAGAUUCUCCUUCUAUGAGUA 410 22 4 hsa-miR-4423-3p AU AG G C ACCA AA AAG CA ACA A 662 21 4 hsa-miR-4423-5p AGUUGCCUUUUUGUUCCCAUGC 263 22 4 hsa-miR-4463 GAGACUGGGGUGGGGCC 300 17 4 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU 547 22 4 hsa-miR-4511 GAAGAACUGUUGCAUUUGCCCU 548 22 4 hsa-miR-4640-3p CACCCCCUGUUUCCUGGCCCAC 329 22 4 hsa-miR-4800-3p CAUCCGUCCGUCUGUCCAC 549 19 4 hsa-miR-505-5p GGGAGCCAGGAAGUAUUGAUGU 550 22 4 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC 551 22 4 hsa-miR-570-3p CGAAAACAGCAAUUACCUUUGC 333 22 4 hsa-miR-663a AGGCGGGGCGCCGCGGGACCGC 365 22 4 hsa-miR-877-3p UCCUCUUCUCCCUCCUCCCAG 552 21 4 hsa-miR-103a-2-5p AGCUUCUUUACAGUGCUGCCUUG 553 23 3 hsa-miR-1268b CGGGCGUGGUGGUGGGGGUG 554 20 3 hsa-miR-1270 CUGGAGAUAUGGAAGAGCUGUGU 555 23 3 hsa-miR-1293 UGGGUGGUCUGGAGAUUUGUGC 556 22 3 hsa-miR-1322 GAUGAUGCUGCUGAUGCUG 557 19 3 hsa-miR-150-5p UCUCCCAACCCUUGUACCAGUG 558 22 3 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU 559 21 3 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU 386 22 3 hsa-miR-193b-5p CGGGGUUUUGAGGGCGAGAUGA 560 22 3 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC 273 23 3 hsa-miR-20a-3p ACUGCAU U AUG AGCACU UAAAG 561 22 3 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA 562 22 3 hsa-miR-2682-5p CAGGCAGUGACUGUUCAGACGUC 563 23 3 hsa-miR-2964a-5p AGAUGUCCAGCCACAAUUCUCG 564 22 3 hsa-miR-3177-5p UGUGUACACACGUGCCAGGCGCU 565 23 3 hsa-miR-320c AAAAGCUGGGUUGAGAGGGU 566 20 3 hsa-miR-323a-5p AGGUGGUCCGUGGCGCGUUCGC 567 22 3 hsa-miR-3622a-5p CAGGCACGGGAGCUCAGGUGAG 568 22 3 hsa-miR-3912 UAACGCAUAAUAUGGACAUGU 569 21 3 hsa-miR-3934 UCAGGUGUGGAAACUGAGGCAG 570 22 3 hsa-miR-3942-3p UUUCAGAUAACAGUAUUACAU 414 21 3 hsa-miR-3942-5p AAGCAAUACUGUUACCUGAAAU 571 22 3 hsa-miR-4523 GACCGAGAGGGCCUCGGCUGU 572 21 3 hsa-miR-4640-5p UGGGCCAGGGAGCAGCUGGUGGG 573 23 3 hsa-miR-4671-5p ACCGAAGACUGUGCGCUAAUCU 574 22 3 hsa-miR-4709-5p ACAACAGUGACUUGCUCUCCAA 575 22 3 hsa-miR-4731-3p CACACAAGUGGCCCCCAACACU 425 22 3 hsa-miR-4731-5p UGCUGGGGGCCACAUGAGUGUG 576 22 3 hsa-miR-4762-5p CCAAAUCUUGAUCAGAAGCCU 577 21 3 hsa-miR-5010-5p AGGGGGAUGGCAGAGCAAAAUU 578 22 3 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA 579 21 3 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC 580 22 3 hsa-miR-548i AAAAGUAAUUGCGGAUUUUGCC 581 22 3 hsa-miR-548j AAAAGUAAUUGCGGUCUUUGGU 582 22 3 hsa-miR-5587-3p GCCCCGGGCAGUGUGAUCAUC 284 21 3 hsa-miR-1225-3p UGAGCCCCUGUGCCGCCCCCAG 369 22 2 hsa-miR-1227 CGUGCCACCCUUUUCCCCAG 583 20 2 hsa-miR-1252 AGAAGGAAAUUGAAUUCAUUUA 371 22 2 hsa-miR-1280 UCCCACCGCUGCCACCC 584 17 2 hsa-miR-1288 UGGACUGCCCUGAUCUGGAGA 585 21 2 hsa-miR-1303 UUUAGAGACGGGGUCUUGCUCU 586 22 2 hsa-miR-1306-3p ACGUUGGCUCUGGUGGUG 376 18 2 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG 587 22 2 hsa-miR-149-3p AGGGAGGGACGGGGGCUGUGC 588 21 2 hsa-miR-16-l-3p CCAGUAUUAACUGUGCUGCUGA 589 22 2 hsa-miR-1909-5p UGAGUGCCGGUGCCUGCCCUG 590 21 2 hsa-miR-224-5p CAAGUCACUAGUGGUUCCGUU 591 21 2 hsa-miR-2276 UCUGCAAGUGUCAGAGGCGAGG 592 22 2 hsa-miR-2355-3p AUUGUCCUUGCUGUUUGGAGAU 468 22 2 hsa-miR-2964a-3p AGAAUUGCGUUUGGACAAUCAGU 392 23 2 hsa-miR-29c-5p UGACCGAUUUCUCCUGGUGUUC 594 22 2 hsa-miR-3074-3p GAUAUCAGCUCAGUAGGCACCG 595 22 2 hsa-miR-3120-3p CACAGCAAGUGUAGACAGGCA 596 21 2 hsa-miR-3130-5p UACCCAGUCUCCGGUGCAGCC 396 21 2 hsa-miR-3140-3p AGCUUUUGGGAAUUCAGGUAGU 597 22 2 hsa-miR-3155a CCAGGCUCUGCAGUGGGAACU 398 21 2 hsa-miR-3163 UAUAAAAUGAGGGCAGUAAGAC 598 22 2 hsa-miR-3167 AGGAUUUCAGAAAUACUGGUGU 599 22 2 hsa-miR-363-5p CGGGUGGAUCACGAUGCAAUUU 600 22 2 hsa-miR-3676-3p CCGUGUUUCCCCCACGCUUU 408 20 2 hsa-miR-378g ACUGGGCUUGGAGUCAGAAG 411 20 2 hsa-miR-4467 UGGCGGCGGUAGUUAUGGGCUU 360 22 2 hsa-miR-4498 UGGGCUGGCAGGGCAAGUGCUG 601 22 2 hsa-miR-4654 UGUGGGAUCUGGAGGCAUCUGG 420 22 2 hsa-miR-4659a-3p UUUCUUCUUAGACAUGGCAACG 603 22 2 hsa-miR-4662a-5p UUAGCCAAUUGUCCAUCUUUAG 604 22 2 hsa-miR-4683 UGGAGAUCCAGUGCUCGCCCGAU 605 23 2 hsa-miR-4738-3p UGAAACUGGAGCGCCUGGAGGA 606 22 2 hsa-miR-4746-3p AGCGGUGCUCCUGCGGGCCGA 607 21 2 hsa-miR-4748 GAGGUUUGGGGAGGAUUUGCU 608 21 2 hsa-miR-4792 CGGUGAGCGCUCGCUGGC 363 18 2 hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG 429 22 2 hsa-miR-5000-3p UCAGG ACACU UCUG AACU UGG A 609 22 2 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG 610 23 2 hsa-miR-5189 UCUGGGCACAGGCGGAUGGACAGG 611 24 2 hsa-miR-548aq-3p CAAAAACUGCAAU U ACU U U UGC 612 22 2 hsa-miR-548av-3p AAAACUGCAGUUACUUUUGC 613 20 2 hsa-miR-5584-5p CAGGGAAAUGGGAAGAACUAGA 332 22 2 hsa-miR-5690 UCAGCUACUACCUCUAUUAGG 435 21 2 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG 305 24 2 hsa-miR-597 UGUGUCACUCGAUGACCACUGU 614 22 2 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC 615 21 2 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA 616 23 2 hsa-miR-1193 GGGAUGGUAGACCGGUGACGUGC 617 23 1 hsa-miR-1224-3p CCCCACCUCCUCUCUCCUCAG 618 21 1 hsa-miR-122-5p UGGAGUGUGACAAUGGUGUUUG 720 22 1 hsa-miR-1228-5p GUGGGCGGGGGCAGGUGUGUG 620 21 1 hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU 340 26 1 hsa-miR-1247-5p ACCCGUCCCGUUCGUCCCCGGA 621 22 1 hsa-miR-1255b-5p CGGAUGAGCAAAGAAAGUGGUU 622 22 1 hsa-miR-1269b CUGGACUGAGCCAUGCUACUGG 623 22 1 hsa-miR-1272 GAUGAUGAUGGCAGCAAAUUCUGAAA 624 26 1 hsa-miR-1273c GGCGACAAAACGAGACCCUGUC 625 22 1 hsa-miR-1273e UUGCU UGAACCCAGGAAGUGGA 342 22 1 hsa-miR-1282 UCGUU UGCCUU UU UCUGCUU 626 20 1 hsa-miR-1290 UGGAUU UU UGGAUCAGGGA 375 19 1 hsa-miR-1294 UGUGAGGUUGGCAUUGU UGUCU 627 22 1 hsa-miR-1306-5p CCACCUCCCCUGCAAACGUCCA 628 22 1 hsa-miR-1321 CAGGGAGGUGAAUGUGAU 377 18 1 hsa-miR-135a-5p UAUGGCUU UUUAUUCCUAUGUGA 629 23 1 hsa-miR-137 UUAU UGCUUAAGAAUACGCGUAG 630 23 1 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU 631 21 1 hsa-miR-143-5p GGUGCAGUGCUGCAUCUCUGGU 632 22 1 hsa-miR-15a-3p CAGGCCAUAU UGUGCUGCCUCA 633 22 1 hsa-miR-186-3p GCCCAAAGGUGAAU UU UU UGGG 382 22 1 hsa-miR-192-3p CUGCCAAUUCCAUAGGUCACAG 634 22 1 hsa-miR-19b-l-5p AGU UU UGCAGGUU UGCAUCCAGC 387 23 1 hsa-miR-200a-3p UAACACUGUCUGGUAACGAUGU 635 22 1 hsa-miR-204-3p GCUGGGAAGGCAAAGGGACGU 636 21 1 hsa-miR-214-3p ACAGCAGGCACAGACAGGCAGU 637 22 1 hsa-miR-29a-5p ACUGAUU UCUU UUGGUGU UCAG 393 22 1 hsa-miR-3064-5p UCUGGCUGUUGUGGUGUGCAA 638 21 1 hsa-miR-3116 UGCCUGGAACAUAGUAGGGACU 639 22 1 hsa-miR-3125 UAGAGGAAGCUGUGGAGAGA 640 20 1 hsa-miR-3127-3p UCCCCU UCUGCAGGCCUGCUGG 641 22 1 hsa-miR-3130-3p GCUGCACCGGAGACUGGGUAA 395 21 1 hsa-miR-3140-5p ACCUGAAUUACCAAAAGCU UU 397 21 1 hsa-miR-3157-5p UUCAGCCAGGCUAGUGCAGUCU 642 22 1 hsa-miR-3179 AGAAGGGGUGAAAUU UAAACGU 643 22 1 hsa-miR-3181 AUCGGGCCCUCGGCGCCGG 644 19 1 hsa-miR-3187-5p CCUGGGCAGCGUGUGGCUGAAGG 645 23 1 hsa-miR-3190-5p UCUGGCCAGCUACGUCCCCA 646 20 1 hsa-miR-3198 GUGGAGUCCUGGGGAAUGGAGA 647 22 1 hsa-miR-320b AAAAGCUGGGUUGAGAGGGCAA 648 22 1 hsa-miR-323b-5p AGGU UGUCCGUGGUGAGU UCGCA 401 23 1 hsa-miR-3591-5p UU UAGUGUGAUAAUGGCGUU UGA 649 23 1 hsa-miR-3619-5p UCAGCAGGCAGGCUGGUGCAGC 650 22 1 hsa-miR-3659 UGAGUGU UGUCUACGAGGGCA 651 21 1 hsa-miR-3674 AU UGUAGAACCUAAGAUUGGCC 652 22 1 hsa-miR-3679-3p CU UCCCCCCAGUAAUCUUCAUC 653 22 1 hsa-miR-375 UU UGU UCGUUCGGCUCGCGUGA 654 22 1 hsa-miR-378b ACUGG ACU UGG AGGCAG AA 655 19 1 hsa-miR-3908 GAGCAAUGUAGGUAGACUGU UU 656 22 1 hsa-miR-3911 UGUGUGGAUCCUGGAGGAGGCA 657 22 1 hsa-miR-3913-5p UU UGGGACUGAUCUUGAUGUCU 658 22 1 hsa-miR-3917 GCUCGGACUGAGCAGGUGGG 659 20 1 hsa-miR-3944-3p UUCGGGCUGGCCUGCUGCUCCGG 660 23 1 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU 661 22 1 hsa-miR-4421 ACCUGUCUGUGGAAAGGAGCUA 718 22 1 hsa-miR-4443 UUGGAGGCGUGGGUUUU 663 17 1 hsa-miR-4459 CCAGGAGGCGGAGGAGGUGGAG 664 22 1 hsa-miR-4473 CUAGUGCUCUCCGUUACAAGUA 665 22 1 hsa-miR-4479 CGCGCGGCCGUGCUCGGAGCAG 666 22 1 hsa-miR-4497 CUCCGGGACGGCUGGGC 232 17 1 hsa-miR-4504 UGUGACAAUAGAGAUGAACAUG 667 22 1 hsa-miR-4520b-3p UUUGGACAGAAAACACGCAGGU 668 22 1 hsa-miR-452-5p AACUGUUUGCAGAGGAAACUGA 669 22 1 hsa-miR-4636 AACU CG U G U U CAAAGCCU U U AG 670 22 1 hsa-miR-4659b-3p UUUCUUCUUAGACAUGGCAGCU 671 22 1 hsa-miR-4664-3p CUUCCGGUCUGUGAGCCCCGUC 672 22 1 hsa-miR-4665-5p CUGGGGGACGCGUGAGCGCGAGC 673 23 1 hsa-miR-4666a-5p AUACAUGUCAGAUUGUAUGCC 674 21 1 hsa-miR-4673 UCCAGGCAGGAGCCGGACUGGA 422 22 1 hsa-miR-4681 AACGGGAAUGCAGGCUGUAUCU 675 22 1 hsa-miR-4682 UCUGAGUUCCUGGAGCCUGGUCU 676 23 1 hsa-miR-4690-5p GAGCAGGCGAGGCUGGGCUGAA 677 22 1 hsa-miR-4699-5p AGAAGAUUGCAGAGUAAGUUCC 678 22 1 hsa-miR-4700-3p CACAGGACUGACUCCUCACCCCAGUG 424 26 1 hsa-miR-4706 AGCGGGGAGGAAGUGGGCGCUGCUU 679 25 1 hsa-miR-4721 UGAGGGCUCCAGGUGACGGUGG 680 22 1 hsa-miR-4728-3p CAUGCUGACCUCCCUCCUGCCCCAG 681 25 1 hsa-miR-4742-5p UCAGGCAAAGGGAUAUUUACAGA 682 23 1 hsa-miR-4747-3p AAGGCCCGGGCUUUCCUCCCAG 683 22 1 hsa-miR-4749-5p UGCGGGGACAGGCCAGGGCAUC 684 22 1 hsa-miR-4755-3p AGCCAGGCUCUGAAGGGAAAGU 685 22 1 hsa-miR-4763-5p CGCCUGCCCAGCCCUCCUGCU 686 21 1 hsa-miR-4766-3p AUAGCAAUUGCUCUUUUGGAA 687 21 1 hsa-miR-4781-3p AAUGUUGGAAUCCUCGCUAGAG 688 22 1 hsa-miR-4793-3p UCUGCACUGUGAGUUGGCUGGCU 689 23 1 hsa-miR-488-3p UUGAAAGGCUAUUUCUUGGUC 690 21 1 hsa-miR-4999-5p UGCUGUAUUGUCAGGUAGUGA 691 21 1 hsa-miR-5001-5p AGGGCUGGACUCAGCGGCGGAGCU 692 24 1 hsa-miR-5002-5p AAUUUGGUUUCUGAGGCACUUAGU 693 24 1 hsa-miR-5004-5p UGAGGACAGGGCAAAUUCACGA 694 22 1 hsa-miR-5006-3p UUUCCCUUUCCAUCCUGGCAG 695 21 1 hsa-miR-5088 CAGGGCUCAGGGAUUGGAUGGAG 696 23 1 hsa-miR-544a AUUCUGCAUUUUUAGCAAGUUC 697 22 1 hsa-miR-548al AACGGCAAUGACUUUUGUACCA 698 22 1 hsa-miR-548aq-5p GAAAGUAAUUGCUGUUUUUGCC 699 22 1 hsa-miR-548at-5p AAAAGUUAUUGCGGUUUUGGCU 700 22 1 hsa-miR-548au-5p AAAAGUAAUUGCGGUUUUUGC 701 21 1 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU 702 22 1 hsa-miR-556-3p AU AU U ACCAU U AGCUCAUCU U U 703 22 1 hsa-miR-5582-3p UAAAACUUUAAGUGUGCCUAGG 704 22 1 hsa-miR-5586-3p CAGAGUGACAAGCUGGUUAAAG 705 22 1 hsa-miR-5588-5p ACUGGCAUUAGUGGGACUUUU 706 21 1 hsa-miR-5683 U ACAG AUGCAG AU UCUCUG ACU UC 707 24 1 hsa-miR-5696 CUCAUUUAAGUAGUCUGAUGCC 708 22 1 hsa-miR-5701 UUAUUGUCACGUUCUGAUU 709 19 1 hsa-miR-5706 UUCUGGAUAACAUGCUGAAGCU 710 22 1 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU 711 22 1 hsa-miR-603 CACACACUGCAAU U ACU U U UGC 712 22 1 hsa-miR-624-3p CACAAGGUAUUGGUAUUACCU 713 21 1 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU 714 22 1 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC 715 22 1

Table 6: Microvesicles El

hsa-let-7f-5p UGAGGUAGUAGAUUGUAUAGUU 11 22 4 hsa-miR-100-5p AACCCGUAGAUCCGAACUUGUG 3 22 4 hsa-miR-1248 ACCUUCUUGUAUAAGCACUGUGCUAAA 269 27 4 hsa-miR-1973 ACCGUGCAAAGGUAGCAUA 171 19 4 hsa-miR-21-3p CA AC ACCAG UCGAUGGGCUGU 20 21 4 hsa-miR-3654 GACUGGACAAGCUGAGGAA 325 19 4 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU 7 22 4 hsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAG 210 21 3 hsa-miR-23b-3p AUCACAUUGCCAGGGAUUACC 59 21 3 hsa-miR-3609 CAAAGUGAUGAGUAAUACUGGCUG 216 24 3 hsa-miR-3615 UCUCUCGGCUCCUCGCGGCUC 323 21 3 hsa-miR-3653 CUAAGAAGUUGACUGAAG 544 18 3 hsa-miR-3960 GGCGGCGGCGGAGGCGGGGG 416 20 3 hsa-miR-4448 GGCUCCUUGGUCUAGGGGUA 231 20 3 hsa-let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 92 22 2 hsa-miR-16-5p UAGCAGCACGUAAAUAUUGGCG 29 22 2 hsa-miR-181a-5p AACAUUCAACGCUGUCGGUGAGU 15 23 2 hsa-miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU 38 23 2 hsa-miR-222-3p AGCUACAUCUGGCUACUGGGU 36 21 2 hsa-miR-24-3p U G G C U C AG U U CAG CAG G AACAG 119 22 2 hsa-miR-3196 CGGGGCGGCAGGGGCCUC 717 18 2 hsa-miR-4419b GAGGCUGAAGGAAGAUGG 718 18 2 hsa-miR-4461 GAUUGAGACUAGUAGGGCUAGGC 129 23 2 hsa-miR-4486 GCUGGGCGAGGCUGGCA 719 17 2 hsa-miR-663a AGGCGGGGCGCCGCGGGACCGC 365 22 2 hsa-miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA 58 23 2 hsa-let-7i-3p CUGCGCAAGCUACUGCCUUGCU 483 22 1 hsa-let-7i-5p UGAGGUAGUAGUUUGUGCUGUU 22 22 1 hsa-miR-1225-5p GUGGGUACGGCCCAGUGGGGGG 720 22 1 hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU 340 26 1 hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 42 22 1 hsa-miR-1275 GUGGGGGAGAGGCUGUC 162 17 1 hsa-miR-1280 UCCCACCGCUGCCACCC 584 17 1 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG 94 22 1 hsa-miR-149-5p UCUGGCUCCGUGUCUUCACUCCC 121 23 1 hsa-miR-191-5p CA ACG G AA U CCC AA A AG CAG C U G 8 23 1 hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 79 23 1 hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU 33 22 1 hsa-miR-26b-5p UUCAAGUAAUUCAGGAUAGGU 90 21 1 hsa-miR-30c-5p UGUAAACAUCCUACACUCUCAGC 66 23 1 hsa-miR-30d-5p UGUAAACAUCCCCGACUGGAAG 31 22 1 hsa-miR-3182 GCUUCUGUAGUGUAGUC 721 17 1 hsa-miR-320a AAAAGCUGGGUUGAGAGGGCGA 97 22 1 hsa-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU 101 22 1 hsa-miR-3607-3p ACUGUAAACGCUUUCUGAUG 543 20 1 hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC 70 22 1 hsa-miR-3652 CGGCUGGAGGUGUGAGGA 722 18 1 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU 47 22 1 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU 57 23 1 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 41 23 1 hsa-miR-432-5p UCUUGGAGUAGGUCAUUGGGUGG 95 23 1 hsa-miR-4417 GGUGGGCUUCCCGGAGGG 175 18 1 hsa-miR-4426 GAAGAUGGACGUACUUU 359 17 1 hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCA 155 22 1 hsa-miR-4800-3p CAUCCGUCCGUCUGUCCAC 549 19 1 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU 118 22 1 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG 5 22 1 hsa-miR-493-3p UGAAGGUCUACUGUGUGCCAGG 83 22 1 hsa-miR-5095 U U AC AG G CG U G A ACCACCG CG 723 21 1 hsa-miR-556-3p AU AU U ACCAU U AGCUCAUCU U U 703 22 1 hsa-miR-644b-5p UGGGCUAAGGGAGAUGAUUGGGUA 724 24 1 hsa-miR-664-5p ACUGGCUAGGGAAAAUGAUUGGAU 443 24 1 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA 289 20 1 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC 60 23 1 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU 10 22 1 hsa-miR-99a-5p AACCCGUAGAUCCGAUCUUGUG 52 22 1

Table 7: Exosomes El

hsa-miR-3648 AGCCGCGGGGAUCGCCGAGGG 259 21 13 hsa-miR-3654 GACUGGACAAGCUGAGGAA 325 19 13 hsa-miR-4466 GGGUGCGGGCCGGCGGGG 264 18 12 hsa-miR-3687 CCCGGACAGGCGUUCGUGCGACGU 190 24 11 hsa-miR-4284 GGGCUCACAUCACCCCAU 191 18 11 hsa-miR-3656 GGCGGGUGCGGGGGUGG 251 17 10 hsa-miR-3609 CAAAGUGAUGAGUAAUACUGGCUG 216 24 8 hsa-miR-644b-5p UGGGCUAAGGGAGAUGAUUGGGUA 724 24 8 hsa-miR-664-5p ACUGGCUAGGGAAAAUGAUUGGAU 443 24 8 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU 7 22 7 hsa-miR-92b-3p UAUUGCACUCGUCCCGGCCUCC 13 22 7 hsa-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU 28 22 6 hsa-let-7f-5p UGAGGUAGUAGAUUGUAUAGUU 11 22 6 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU 14 22 6 hsa-miR-1290 UGGAUUUUUGGAUCAGGGA 375 19 6 hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCA 155 22 6 hsa-miR-4461 GAUUGAGACUAGUAGGGCUAGGC 129 23 6 hsa-miR-100-5p AACCCGUAGAUCCGAACUUGUG 3 22 5 hsa-miR-1248 ACCUUCUUGUAUAAGCACUGUGCUAAA 269 27 5 hsa-miR-1973 ACCGUGCAAAGGUAGCAUA 171 19 5 hsa-miR-3653 CUAAGAAGUUGACUGAAG 544 18 5 hsa-miR-4417 GGUGGGCUUCCCGGAGGG 175 18 5 hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 42 22 4 hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG 25 21 4 hsa-miR-16-5p UAGCAGCACGUAAAUAUUGGCG 29 22 4 hsa-miR-21-3p CA AC ACCAG UCGAUGGGCUGU 20 21 4 hsa-miR-23a-3p AUCACAUUGCCAGGGAUUUCC 55 21 4 hsa-miR-4419b GAGGCUGAAGGAAGAUGG 718 18 4 hsa-miR-1273f GGAGAUGGAGGUUGCAGUG 292 19 3 hsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAG 210 21 3 hsa-miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU 38 23 3 hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 79 23 3 hsa-miR-3615 UCUCUCGGCUCCUCGCGGCUC 323 21 3 hsa-miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA 58 23 3 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU 17 22 2 hsa-let-7e-5p UGAGGUAGGAGGUUGUAUAGUU 27 22 2 hsa-let-7i-5p UGAGGUAGUAGUUUGUGCUGUU 22 22 2 hsa-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA 62 23 2 hsa-miR-106b-5p UAAAGUGCUGACAGUGCAGAU 170 21 2 hsa-miR-1273e UUGCUUGAACCCAGGAAGUGGA 342 22 2 hsa-miR-221-5p ACCUGGCAUACAAUGUAGAUUU 39 22 2 hsa-miR-222-3p AGCUACAUCUGGCUACUGGGU 36 21 2 hsa-miR-30d-5p UGUAAACAUCCCCGACUGGAAG 31 22 2 hsa-miR-3960 GGCGGCGGCGGAGGCGGGGG 416 20 2 hsa-let-7d-3p CUAUACGACCUGCUGCCUUUCU 92 22 1 hsa-let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 53 22 1 hsa-let-7g-5p UGAGGUAGUAGUUUGUACAGUU 43 22 1 hsa-let-7i-3p CUGCGCAAGCUACUGCCUUGCU 483 22 1 hsa-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUG 2 23 1 hsa-miR-1181 CCGUCGCCGCCACCCGAGCCG 725 21 1 hsa-miR-1225-3p UGAGCCCCUGUGCCGCCCCCAG 369 22 1 hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU 340 26 1 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 35 24 1 hsa-miR-1296 UUAGGGCCCUGGCUCCAUCUCC 271 22 1 hsa-miR-1307-5p UCGACCGGACCUCGACCGGCU 91 21 1 hsa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 19 22 1 hsa-miR-149-5p UCUGGCUCCGUGUCUUCACUCCC 121 23 1 hsa-miR-151a-5p UCGAGGAGCUCACAGUCUAGU 37 21 1 hsa-miR-15b-5p UAGCAGCACAUCAUGGUUUACA 78 22 1 hsa-miR-181a-2-3p ACCACUGACCGUUGACUGUACC 102 22 1 hsa-miR-181a-5p AACAUUCAACGCUGUCGGUGAGU 15 23 1 hsa-miR-191-5p CA ACG G AA U CCC AA A AG C AG C U G 8 23 1 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC 726 22 1 hsa-miR-204-5p UUCCCUUUGUCAUCCUAUGCCU 89 22 1 hsa-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG 146 23 1 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU 527 21 1 hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU 33 22 1 hsa-miR-23b-3p AUCACAUUGCCAGGGAUUACC 59 21 1 hsa-miR-26b-3p CCUGUUCUCCAUUACUUGGCUC 391 22 1 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU 319 22 1 hsa-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA 106 22 1 hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC 71 22 1 hsa-miR-31-3p UGCUAUGCCAACAUAUUGCCAU 172 22 1 hsa-miR-3198 GUGGAGUCCUGGGGAAUGGAGA 647 22 1 hsa-miR-323a-3p CACAUUACACGGUCGACCUCU 158 21 1 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU 81 23 1 hsa-miR-3607-3p ACUGUAAACGCUUUCUGAUG 543 20 1 hsa-miR-3651 CAUAGCCCGGUCGCUGGUACAUGA 727 24 1 hsa-miR-378a-3p ACUGGACUUGGAGUCAGAAGG 65 21 1 hsa-miR-379-5p UGGUAGACUAUGGAACGUAGG 18 21 1 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU 57 23 1 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 41 23 1 hsa-miR-425-5p AAUGACACGAUCACUCCCGUUGA 111 23 1 hsa-miR-4258 CCCCGCCACCGCCUUGG 728 17 1 hsa-miR-4426 GAAGAUGGACGUACUUU 359 17 1 hsa-miR-4443 UUGGAGGCGUGGGUUUU 663 17 1 hsa-miR-4448 GGCUCCUUGGUCUAGGGGUA 231 20 1 hsa-miR-4697-3p UGUCAGUGACUCCUGCCCCUUGGU 729 24 1 hsa-miR-4700-3p CACAGGACUGACUCCUCACCCCAGUG 424 26 1 hsa-miR-4700-5p UCUGGGGAUGAGGACAGUGUGU 730 22 1 hsa-miR-4797-3p UCUCAGUAAGUGGCACUCUGU 731 21 1 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU 118 22 1 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG 5 22 1 hsa-miR-494 UGAAACAUACACGGGAAACCUC 240 22 1 hsa-miR-500a-5p UAAUCCUUGCUACCUGGGUGAGA 303 23 1 hsa-miR-644b-3p UUCAUU UGCCUCCCAGCCUACA 442 22 1 hsa-miR-663a AGGCGGGGCGCCGCGGGACCGC 365 22 1

Table 8: Microvesicles EH

hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU 59 26 3 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU 14 22 3 hsa-miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU 38 23 3 hsa-miR-21-3p CA AC ACCAG UCGAUGGGCUGU 20 21 3 hsa-miR-26a-5p UUCAAGUAAUCCAGGAUAGGCU 12 22 3 hsa-miR-30c-5p UGUAAACAUCCUACACUCUCAGC 66 23 3 hsa-miR-3960 GGCGGCGGCGGAGGCGGGGG 416 20 3 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU 153 22 3 hsa-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU 28 22 2 hsa-let-7g-5p UGAGGUAGUAGUUUGUACAGUU 43 22 2 hsa-miR-1273f GGAGAUGGAGGUUGCAGUG 292 19 2 hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG 25 21 2 hsa-miR-182-5p UUUGGCAAUGGUAGAACUCACACU 16 24 2 hsa-miR-191-5p CA ACG G AA U CCC AA A AG C AG C U G 8 23 2 hsa-miR-197-3p U U CACCACCU U CU CCACCCAGC 122 22 2 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 41 23 2 hsa-miR-4468 AGAGCAGAAGGAUGAGAU 732 18 2 hsa-miR-644b-5p UGGGCUAAGGGAGAUGAUUGGGUA 724 24 2 hsa-miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG 116 23 2 hsa-let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 92 22 1 hsa-miR-1225-3p UGAGCCCCUGUGCCGCCCCCAG 369 22 1 hsa-miR-1254 AGCCUGGAAGCUGGAGCCUGCAGU 270 24 1 hsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAG 210 21 1 hsa-miR-1275 GUGGGGGAGAGGCUGUC 162 17 1 hsa-miR-1296 UUAGGGCCCUGGCUCCAUCUCC 271 22 1 hsa-miR-1307-5p UCGACCGGACCUCGACCGGCU 91 21 1 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG 94 22 1 hsa-miR-15b-5p UAGCAGCACAUCAUGGUUUACA 78 22 1 hsa-miR-17-5p CA AAG UGCUUACAGUGCAGGUAG 145 23 1 hsa-miR-1972 UCAGGCCAGGCACAGUGGCUCA 733 22 1 hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU 33 22 1 hsa-miR-25-3p CAUUGCACUUGUCUCGGUCUGA 63 22 1 hsa-miR-27b-3p UUCACAGUGGCUAAGUUCUGC 6 21 1 hsa-miR-3065-5p UCAACAAAAUCACUGAUGCUGGA 226 23 1 hsa-miR-30d-5p UGUAAACAUCCCCGACUGGAAG 31 22 1 hsa-miR-320a AAAAGCUGGGUUGAGAGGGCGA 97 22 1 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU 81 23 1 hsa-miR-3648 AGCCGCGGGGAUCGCCGAGGG 259 21 1 hsa-miR-3652 CGGCUGGAGGUGUGAGGA 722 18 1 hsa-miR-376c AACAUAGAGGAAAUUCCACGU 185 21 1 hsa-miR-378a-3p ACUGGACUUGGAGUCAGAAGG 65 21 1 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU 47 22 1 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU 174 22 1 hsa-miR-4417 GGUGGGCUUCCCGGAGGG 175 18 1 hsa-miR-4448 GGCUCCUUGGUCUAGGGGUA 231 20 1 hsa-miR-4454 GGAUCCGAGUCACGGCACCA 299 20 1 hsa-miR-454-3p UAGUGCAAUAUUGCUUAUAGGGU 169 23 1 hsa-miR-4800-3p CAUCCGUCCGUCUGUCCAC 549 19 1 hsa-miR-493-3p UGAAGGUCUACUGUGUGCCAGG 83 22 1 hsa-miR-5095 U U AC AG G CG U G A ACCACCG CG 723 21 1 hsa-miR-574-3p CACGCUCAUGCACACACCCACA 253 22 1 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU 309 20 1 hsa-miR-720 UCUCGCUGGGGCCUCCA 84 17 1 hsa-miR-99a-5p AACCCGUAGAUCCGAUCUUGUG 52 22 1 hsa-miR-99b-5p CACCCGUAGAACCGACCUUGCG 4 22 1

Table 9: Exosomes EH

hsa-miR-1290 UGGAUUUUUGGAUCAGGGA 375 19 5 hsa-miR-4426 GAAGAUGGACGUACUUU 359 17 5 hsa-miR-5096 GUUUCACCAUGUUGGUCAGGC 220 21 5 hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 42 22 4 hsa-miR-1273f GGAGAUGGAGGUUGCAGUG 292 19 4 hsa-miR-191-5p CA ACG G AA U CCC AA A AG C AG C U G 8 23 4 hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU 33 22 4 hsa-miR-3609 CAAAGUGAUGAGUAAUACUGGCUG 216 24 4 hsa-miR-3687 CCCGGACAGGCGUUCGUGCGACGU 190 24 4 hsa-miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG 116 23 4 hsa-miR-1248 ACCUUCUUGUAUAAGCACUGUGCUAAA 269 27 3 hsa-miR-1273g-3p ACCACUGCACUCCAGCCUGAG 210 21 3 hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG 25 21 3 hsa-miR-182-5p UUUGGCAAUGGUAGAACUCACACU 16 24 3 hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 79 23 3 hsa-miR-222-3p AGCUACAUCUGGCUACUGGGU 36 21 3 hsa-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA 106 22 3 hsa-miR-4461 GAUUGAGACUAGUAGGGCUAGGC 129 23 3 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG 5 22 3 hsa-miR-92b-3p UAUUGCACUCGUCCCGGCCUCC 13 22 3 hsa-miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA 58 23 3 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU 10 22 3 hsa-let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 53 22 2 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG 94 22 2 hsa-miR-151a-5p UCGAGGAGCUCACAGUCUAGU 37 21 2 hsa-miR-15b-5p UAGCAGCACAUCAUGGUUUACA 78 22 2 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG 30 22 2 hsa-miR-3124-3p ACUUUCCUCACUCCCGUGAAGU 734 22 2 hsa-miR-3653 CUAAGAAGUUGACUGAAG 544 18 2 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU 17 22 1 hsa-let-7d-3p CUAUACGACCUGCUGCCUUUCU 92 22 1 hsa-let-7g-5p UGAGGUAGUAGUUUGUACAGUU 43 22 1 hsa-let-7i-5p UGAGGUAGUAGUUUGUGCUGUU 22 22 1 hsa-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA 62 23 1 hsa-miR-106b-5p UAAAGUGCUGACAGUGCAGAU 170 21 1 hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU 340 26 1 hsa-miR-128 UCACAG UGAACCGG U CU CU U U 109 21 1 hsa-miR-1285-3p UCUGGGCAACAAAGUGAGACCU 464 22 1 hsa-miR-1307-3p ACUCGGCGUGGCGUCGGUCGUG 124 22 1 hsa-miR-140-3p UACCACAGGGUAGAACCACGG 138 21 1 hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU 48 22 1 hsa-miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU 38 23 1 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU 386 22 1 hsa-miR-1972 UCAGGCCAGGCACAGUGGCUCA 733 22 1 hsa-miR-21-3p CA AC ACCAG UCGAUGGGCUGU 20 21 1 hsa-miR-2277-3p UGACAGCGCCCUGCCUGGCUC 735 21 1 hsa-miR-23a-3p AUCACAUUGCCAGGGAUUUCC 55 21 1 hsa-miR-23b-3p AUCACAUUGCCAGGGAUUACC 59 21 1

hsa-miR-24-3p U G G C U C AG U U CAG CAG G AACAG 119 22 1

hsa-miR-27a-3p UUCACAGUGGCUAAGUUCCGC 46 21 1

hsa-miR-27b-3p UUCACAGUGGCUAAGUUCUGC 6 21 1

hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU 182 22 1

hsa-miR-30b-5p UGUAAACAUCCUACACUCAGCU 96 22 1

hsa-miR-30c-5p UGUAAACAUCCUACACUCUCAGC 66 23 1

hsa-miR-31-3p UGCUAUGCCAACAUAUUGCCAU 172 22 1

hsa-miR-3196 CGGGGCGGCAGGGGCCUC 717 18 1

hsa-miR-3198 GUGGAGUCCUGGGGAAUGGAGA 647 22 1

hsa-miR-320a AAAAGCUGGGUUGAGAGGGCGA 97 22 1

hsa-miR-329 AACACACCUGGUUAACCUCUUU 214 22 1

hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG 402 23 1

hsa-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU 101 22 1

hsa-miR-3607-5p GCAUGUGAUGAAGCAAAUCAGU 249 22 1

hsa-miR-3648 AGCCGCGGGGAUCGCCGAGGG 259 21 1

hsa-miR-376c AACAUAGAGGAAAUUCCACGU 185 21 1

hsa-miR-3960 GGCGGCGGCGGAGGCGGGGG 416 20 1

hsa-miR-411-3p UAUGUAACACGGUCCACUAACC 482 22 1

hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU 57 23 1

hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 41 23 1

hsa-miR-4417 GGUGGGCUUCCCGGAGGG 175 18 1

hsa-miR-4444 CUCGAGUUGGAAGAGGCG 418 18 1

hsa-miR-4499 AAGACUGAGAGGAGGGA 736 17 1

hsa-miR-4521 GCUAAGGAAGUCCUGUGCUCAG 233 22 1

hsa-miR-4680-5p AGAACUCUUGCAGUCUUAGAUGU 737 23 1

hsa-miR-4709-5p ACAACAGUGACUUGCUCUCCAA 575 22 1

hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU 26 22 1

hsa-miR-644b-3p UUCAUUUGCCUCCCAGCCUACA 442 22 1

hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU 336 22 1

hsa-miR-9-3p AUAAAGCUAGAUAACCGAAAGU 183 22 1

hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC 366 21 1

hsa-miR-99a-5p AACCCGUAGAUCCGAUCUUGUG 52 22 1

D) Identification of top ranking coding and non-coding RNAs by GENCODE analysis performed in exosomes, MV and producer cells

CTX0E0307EH CTX0E0307EH CTX0E0307E CTX0E0307EI CTX0E0307EIE CTX0E0307EI cel ls EXO H MV cel ls XO MV

18741941 12678688 10876797 221 161 10 1631 1289 835970,

Table 10: Total number of sequence reads identified by using GENCODE in each tested samples Using GENCODE database analysis of the sequence results, seven putative novel miRNA sequences were identified in exosomes (EXO), microvesicles (MV) and producer cells, as shown in Table 11 . (nb CTX0E03 07EI MV reads are misrepresented due to the lower amount of starting material - see Table 10). These data are shown graphically in Figure 16, which shows that these sequences are preferentially shuttled into exosomes and microvesicles compared to the cells.

Gene Symbol Transcript ID Length Type of RNA H cells HEXO H MV I cells IEX0 MV

Table 11 : Identification of putative novel miRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. CTX0E03 07EI MV reads are misrepresented due to the lower amount of starting material (table 1). The transcript IDs are taken from the Ensembl database (www.ensembl.org).

Validation and of novel miRNAs

AC079949.1 -201 (SEQ ID NO:738)

Gene: AC079949.1 ENSG00000239776

>12 dna : chromosome chromosome : GRCh37 : 12 : 127650616 : 127650672 : 1

GGCCGCGCCCCGTTTCCCAGGACAAAGGGCACTCCGCACCGGACCCTGGTCCCAGCG

For AC079949.1 -201 putative mature miRNA, gaccaggguccggugcggagug (SEQ ID NO:745) was identified as the possible 5' stem mature miRNA using http://mirna.imbb.forth.gr/MatureBayes.html, a tool for finding mature miRNA within a miRNA precursor sequence using a Naive Bays classifier. Its presence validation was performed using AGGGTCCGGTGCGGAGT (SEQ ID NO:746) primer sequence. This sequence was entered in mirbase (http://www.mirbase.org/) and the following miRNA was found with similar sequence: Bos taurus miR-2887-1 (Accession No. MIMAT0013845). bta-miR-2887 : 9-20 (SEQ ID NO:747)

AC079949 (5) 2 ggguccggugcg 13

I I I I I I I I I I I I

bta-miR-2887 9 ggguccggugcg 20 The presence of this novel miRNA was tested by qRT-PCR on purified exosomes retro transcribed miRNA.

The same analysis was performed using the 3' stem of AC079949, sequence TGCGGAGTGCCCTTTGTCCT (SEQ ID NO:748), but in this case no similar miRNA was identified in mirbase.

AP000318.1 -201 (SEQ ID NO:739) Gene: AP000318.1 ENSG00000266007

>21 dna: chromosome chromosome : GRCh37 : 21 : 35677430 : 35677493 : 1

CCCACTCCCTGGCGCCGCTTGTGGAGGGCCCAAGTCCTTCTGATTGAGGCCCAACCCGTG GAAG

For AP000318.1 -201 putative mature miRNA, ggagggcccaaguccuucugau (SEQ ID NO:744) was identified as the possible 5' stem mature miRNA. Its presence validation was performed using GGAGGGCCCAAGTCCTTCTGAT (SEQ ID NO:749) primer sequence. Caenorhabditis remanei miR-55 stem-loop was identified as similar miRNA. Primer validation was again carried out by qRT-PCR.

crm-miR-55-5p : 4-1 7 (SEQ ID NO:750)

AP000318.1 20 cccaaguccuucug 7

I I I I I I I I I I I I I

crm-miR-55-5p 4 cccaagugcuucug 17

AL161626.1 -201 (SEQ ID NO:740)

Gene: AL161626.1 ENSG00000241781

>9 dna: chromosome chromosome : GRCh37 : 9 : 79186731 : 79186787 : 1

CGCCGGGACCGGGGTCCGGGGCGGAGTGCCCTTCCTCCTGGGAAACGGGGTGCGGC

For AL161626.1 -201 putative mature miRNA, ggcggagugcccuucuuccugg (SEQ ID NO:743) was identified as the possible 5' stem mature miRNA. Its presence validation was performed using CGGAGTGCCCTTCTTCCT (SEQ ID NO:751) primer sequence. Zea mays miR164c stem-loop and Achypodium distachyon miR164f stem-loop were identified as similar miRNA. Primer validation was again carried out by qRT-PCR. zma-miR164c-3p : 4-15 (SEQ ID NO:752)

AL161626.1 5 gugcccuucuuc 16

I I I I I I I I I I I I

zma-miR164c-3p 4 gugcccuucuuc 15 AC004943.1 (SEQ ID NO:741 )

Gene: AC004943.1 ENSG00000265573

>16 dna : chromosome chromosome : GRCh37 : 16 : 72821592 : 72821672 : -1

GCTTCACGTCCCCACCGGCGGCGGCGGCGGTGGCAGTGGCGGCGGCGGCGGCGGTGGCGG CGGCGGCGGCGGCGGCGGCTC

AL121897.1 (SEQ ID NO:742)

Gene: AL121897.1 ENSG00000264308

>20 dna: chromosome chromosome : GRCh37 : 20 : 30865503 : 30865591 : 1

GCCGCCCCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCCGCTTTCGGCTCGGG CCTCAGGTGAGTCGGAGGGGCCGGGCGCC

Miscellaneous RNA (misc_RNA), including novel putative

Misc_RNA is short for miscellaneous RNA, a general term for a series of miscellaneous small RNA. Miscellaneous transcript feature are not defined by other RNA keys.

List of top ranking previously known and novel misc_RNAs identified using GENCODE sequence data set:

Table 12: Identification of misc_RNA, including putative novel misc_RNA, sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. (CTX0E03 07EI MV reads are misrepresented due to the lower amount of starting material - Table 10). The transcript IDs are taken from the Ensembl database (www.ensembl.org).

Among the misc_RNA the following sequences were found preferentially down or up shuttled in exosomes and MV: RPHI, RMRP, and VTRNA1 -1 up shuttled and Y_RNA.725-201 , and Y_RNA.125-201 down respectively. RPHI is a ribonuclease P RNA component H 1. RMRP gene encodes the RNA component of mitochondrial RNA processing endoribonuclease, which cleaves mitochondrial RNA at a priming site of mitochondrial DNA replication. This RNA also interacts with the telomerase reverse transcriptase catalytic subunit to form a distinct ribonucleoprotein complex that has RNA-dependent RNA polymerase activity and produces double-stranded RNAs that can be processed into small interfering RNA. VTRNA1 -1 is vault RNA component 1. Vaults are large cytoplasmic ribonucleoproteins and they are composed of a major vault protein, MVP, 2 minor vault proteins, TEP1 and PARP4, and a non-translated RNA component, VTRNA1 -1. Y_RNA.725-201 , and Y_RNA.125-201 are novel misc_RNAs and their function is not defined.

Metazoa miscellaneous RNA

The signal recognition particle RNA, also known as 7SL, 6S, ffs, or 4.5S RNA, is the RNA component of the signal recognition particle (SRP) ribonucleoprotein complex. SRP is a universally conserved ribonucleoprotein that directs the traffic of proteins within the cell and allows them to be secreted. The SRP RNA, together with one or more SRP proteins contributes to the binding and release of the signal peptide. The RNA and protein components of this complex are highly conserved but do vary between the different kingdoms of life. List of top ranking Metazoa misc_RNAs identified using GENCODE sequence data set:

QXOl E0307EH a C IE0307EH aX0E( )307EH CTXOEO 307EI CTX 0E0307EI aXOEI §111

Gene Syri ibol Transcrip t ID length Type of RNA cells EXO MV cells EXC MV Metazoa_ _SRP i Metazoa_ _SRP.791-20i 288 i Metazoan signal recogni 679: 2324 2058: 771: 2698: 465:

Metazoa_ SRP.561-201 294 Metazoan signal recogn 634 2006 1683 744 2147 432

Metazoa_ _SRP i Metazoa_ _SRP.864-20i 297 i Metazoan signal recogni 252: 1884 1544: 78: 170i 148:

Metazoaj SRP Metazoa_ RP.824-201 297 Metazoan signal recogn 438 881 958 505 1860 342 Metazoa_ _SRP : Metazoa_ _SRP.72-201 i 278 i Metazoan signal recogn: 441: 630 631: 494: 2184Ϊ 349i

Metazoaj SRP Metazoa_ SRP.151-201 307 Metazoan signal recogn 377 464 470 432 1431 2S5 Metazoa_ _SRP : Metazoa_ _SRP.208-201 277 i Metazoan signal recogn: 382: 410 431: 422: 1104! 242

Metazoaj _SRP Metazoa. _SRP.501-201 280 Metazoan signal recogn 265 272 266 236 434 44 Metazoa SRP : Metazoa SRP.682-201 298 i Metazoan signal recogn: 12: 52 21: 10: 13!

Table 13: Identification signal recognition particle RNA (misc_RNA) sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. The transcript IDs are taken from the Ensembl database (www.ensembl.org).

RRNA (ribosomal RNA)

Ribosomal RNA (rRNA) forms part of the protein-synthesizing organelle known as a ribosome and that is exported to the cytoplasm to help translate the information in messenger RNA (mRNA) into protein. Eukaryotic ribosome (80S) rRNA components are: large unit (rRNA 5S, 5.8S, and 28S) small unit (rRNA 18S). Both rRNA 28S and 5.8S are selectively up-shuttled in exosomes and MV. List of top ranking rRNA identified using GENCODE sequence data set:

CTX0E0307EH CTi (0E0307EH CTX01 Ξ0307ΕΗ CTXOE .03Q7EI a X0E0307EI CTXOf .030/.:

Gene Symbol Transcript ID Length Type of RNA cells EX< D MV cells EX 0 MV RNA5-8SP6 ; RNA5-8SP6-201 152 irRNA 205008 1148190 706558: 213187; 135909; 14732

RNA28S5 RNA28S5-001 432 rRNA 86111 458585 516754 62829 390237 liilll RNA18S5 ; RNA18S5-001 599 i rRNA 74634 52055 61639; 116874; 138484; 14616

RNA5-8SP2 RNA5-8SP2-201 152 rRNA 6488 1719 1540 9231 3112 149 RNA5-8SP5 5-8 5-201 152 irRNA 2794 7393 3924; 7314 3579; 232. Table 14: Identification rRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. The transcript IDs are taken from the Ensembl database (www.ensembl.org).

Small nucleolar RNA: snoRNA

Small nucleolar RNAs (snoRNAs) are a class of small RNA molecules that primarily guides chemical modifications of other RNAs, mainly ribosomal RNAs, transfer RNAs and small nuclear RNAs. There are two main classes of snoRNA, the C/D box snoRNAs which are associated with methylation, and the H/ACA box snoRNAs which are associated with pseudouridylation.

List of top ranking snoRNA identified using GENCODE sequence data set:

CTXOE0307EH CTXC IE0307EH CTXOEt B07EH CTXOE' Q307EI CTX 0E0307EI CTXOEt §1111

Gene Symbol Transcript ID Type of RNA cells E O iiiiiieii cells iiiiiiliii

SNORD3A ;SNORD3A-201 216 SnoRNA 2085; 162i; 906; 120

SNORD3C SNORD3C-201 216 snoRNA 1169 1702 1220 639 1176 ¾¾:¾8¾

SNORD29 ;SNORD29-201 65 SnoRNA 281 O 1633 36677; 1752 45

SNORD83B SNORD83B 93 1835 675 487 638 575

SNORD30 ;SNORD30-201 70 SnoRNA 29743; 254 244; 2907i; 283 24,

Table 15: Identification of snoRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. The transcript IDs are taken from the Ensembl database (www.ensembl.org). Small nuclear RNA (snRNA)

Small nuclear ribonucleic acid (snRNA), also commonly referred to as U-RNA, is a class of small RNA molecules that make up the major spliceosome are named U1 , U2, U4, U5, and U6, and participate in several RNA-RNA and RNA-protein interactions. Their primary function is in the processing of pre-mRNA (hnRNA) in the nucleus. They have also been shown to aide in the regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintaining the telomeres.

List of top ranking snRNA identified using GENCODE sequence data set:

Table 16A: Identification of snRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. The transcript IDs are taken from the EnsembI database (www.ensembl.org).

LincRNA and novel lincRNA

Large intergenic non-coding RNAs (lincRNAs) are emerging as key regulators of diverse cellular processes. Determining the function of individual lincRNAs remains a challenge. Long non- coding RNAs (long ncRNAs, IncRNA) are non-protein coding transcripts longer than 200 nucleotides.

List of top ranking previously known and novel lincRNAs identified using GENCODE sequence data set:

Gene Symbol Transcript ID Length Type of RNA cells EXO MV cells EXO MV;

RP11-108M9.3 : RP11-108M9.3-0C 1761 Novel lincRNA 244 159; 240: 539: 45:

RP11-329L6.1 RP11-329L6.1-00: 507 Novel lincRNA 19 70 41 29 84 111111

RP11-160E2.6 : RP11-160E2.6-00: 637 Novel lincRNA 228 67 i 115! 489i 6;

AC004528.3 AC004528.3-001 107 Novel lincRNA 16 58 46 11111111111 55 !!!!i

MALATl 1-201 4585 lincRNA 150 308: 234: 26; 182:

GAS5 GAS5-007 2743 lincRNA 12024 215 120 46501 875 111111

Table 16B: Identification of lincRNA and putative novel lincRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. The transcript IDs are taken from the EnsembI database (www.ensembl.org).

GAS5 lincRNA is highly expressed in cell producer compared to in exosomes and microvesicles (down shuttled in both exosomes and MV). mRNA

Coding sequencing mRNA were also identified.

Table 17: Identification of mRNA sequences using GENCODE in exosomes (EXO), microvesicles (MV) and producer cells. The transcript IDs are taken from the EnsembI database (www.ensembl.org). Example 12: Conclusion

The main scope of the deep sequence analysis was to identify their miRNA components in neural stem cell-derived vesicles (exosomes and microvesicles). This analysis identified a new set of known and novel miRNAs that are preferentially shuttled into both exosomes and MV. Among the identified miRNAs already included in mirbase database were hsa-miR-1246, hsa- miR-4488, hsa-miR-4492, hsa-miR-4508, hsa-miR-4516, hsa-miR-4532, and among the novel miRNAs were AC079949.1 , AP000318.1 , AL161626.1 , AC004943.1 , AL121897.1. Top ranking shuttled miRNAs, including novel ones were validated by qRT-PCR in exosomes.

The size distribution of shuttle RNA, as shown here, is mostly in the range of 20 to 200 nt and other RNA species are released by cells into the extracellular space. By deep sequencing and GENCODE sequence set analysis we found a greater complexity and diversity of non-coding RNA transcripts. We extended this analysis with detailed evaluation and this led to the discovery of preferentially up (defined as log2 fold change≥ 2) and down (defined as log2 fold change≤ - 2) shuttle of other non-coding RNAs in both exosomes and microvesicles. Differentially shuttled non coding RNA were found in almost all the non-coding RNA subtypes, ribosomal RNA (rRNA), small nucleolar (snoRNA), small nuclear RNA (snRNA ), microRNA (miRNA), miscellaneous other RNA (misc_RNA, e.g. RMRP, vault RNA, metazoa SRP, and RNY), and large intergenic non-coding RNAs (lincRNAs).

The unequal distribution of the detected RNA species over cellular and shuttle RNA, combined with increasing evidence for their role in gene regulation strongly suggest that cells specifically release these RNAs to modify the function of target cells.

Example 13: Proteomic analysis

Methods

Exosomes and microvesicle fractions were prepared from a CTX0E03 cell Integra culture (week 2), using differential ultracentrifugation. Exosomes and microvesicles were disrupted in modified RIPA buffer (50mM Tris HCI, pH 8.0, 150mM NaCI, 1 % SDS, 0.1 % Triton X100, 10mM DTT, 1x Complete protease inhibitor (Roche) and 1x PhosStop phosphatase inhibitor (Roche)) and subjected to manual shearing using a 1 ml_ tuberculin syringe and 25 gauge needle. Samples were re- quantitated post disruption using the Qubit fluorometer (Invitrogen). 20μg of each sample was loaded onto a 4-12% SDS-PAGE gel (Novex, Invitrogen). The gel was excised into forty segments per lane and gel slices were processed using a robot (ProGest, DigiLab) with the following protocol: a) wash with 25mM ammonium bicarbonate followed by acetonitrile; b) reduce with 10mM dithiothreitol at 60°C followed by alkylation with 50mM iodoacetamide at room temperature;

c) digest with trypsin (Promega) at 37°C for 4h;

d) quench with formic acid;

e) the supernatant was analysed by mass spectrometry directly without further processing.

Mass Spectrometry Each gel digest was analysed by nano LC/MS/MS with a Waters NanoAcquity HPLC system interfaced to a ThermoFisher Q Exactive. Peptides were loaded on a trapping column and eluted over a 75μηπ analytical column at 350nL/min; both columns were packed with Jupiter Proteo resin (Phenomenex). The mass spectrometer was operated in data-dependent mode, with MS and MS/MS performed in the Orbitrap at 70,000 FWHM and 17,500 FWHM resolution, respectively.

Exosomes

2572 proteins were identified by Mass spectrometry in exosomes purified by ultracentrifugation. The exosomes were isolated from the initial stages of an Integra culture (week 2). The gene names and corresponding SWISSPROT accession numbers (in brackets) of all 2572 proteins are listed in Table 18 (in alphabetical order of gene name) and the 100 most abundant proteins are listed in Table 19, in order of decreasing abundance. The characteristic exosome markers CD9, CD81 and Alix (also known as PDCD6IP) are present in the most abundant 100 proteins.

A1 BG (P04217), A2M (P01023), AACS (Q86V21), AAMP (Q13685), AARS (P49588), AARSD1 (Q9BTE6), AASDHPPT (Q9NRN7), ABCA3 (Q99758), ABCE1 (P61221), ABCF1 (Q8NE71), ABCF3 (Q9NUQ8), ABHD10 (Q9NUJ1), ABHD14B (Q96IU4), ABI 1 (Q8IZP0), ABR (Q12979), ACAA2 (P42765), ACACA (Q13085), ACADVL (P49748), ACAP2 (Q15057), ACAT1 (P24752), ACAT2 (Q9BWD1), ACBD7 (Q8N6N7), ACLY (P53396), AC01 (P21399), AC02 (Q99798), ACOT1 (Q86TX2), ACOT13 (Q9NPJ3), ACOT7 (000154), ACP1 (P24666), ACSL1 (P33121), ACSL3 (095573), ACSL4 (060488), ACSS2 (Q9NR19), ACTC1 (P68032), ACTG1 (P63261), ACTL6A (096019), ACTN1 (P12814), ACTN4 (043707), ACTR10 (Q9NZ32), ACTR1A

(P61 163), ACTR1 B (P42025), ACTR2 (P61160), ACTR3 (P61 158), ADAM 10 (014672), ADAM 12 (043184), ADAMTS15 (Q8TE58), ADAMTS16 (Q8TE57), ADAR (P55265), ADAT2 (Q7Z6V5), ADH5 (P1 1766), ADI 1 (Q9BV57), ADK (P55263), ADRBK1 (P25098), ADRM1 (Q16186), ADSL (P30566), ADSS (P30520), AEBP1 (Q8IUX7), AFM (P43652), AGL (P35573), AGRN (000468), AGT (P01019), AHCY (P23526), AHCYL1 (043865), AHNAK (Q09666), AHSA1 (095433), AHSG (P02765), AIDA (Q96BJ3), AIFM1 (095831), AIMP1 (Q12904), AIMP2 (Q13155), AIP (000170), AK1 (P00568), AK3 (Q9UIJ7), AK4 (P27144), AKAP12 (Q02952), AKAP9 (Q99996), AKR1A1 (P14550), AKR1 B1 (P15121), AKR1C1 (Q04828), AKR7A2 (043488), AKR7A3 (095154), AKT1 (P31749), ALCAM (Q13740), ALDH16A1

(Q8IZ83), ALDH3A1 (P30838), ALDH7A1 (P49419), ALDH9A1 (P49189), ALDOA (P04075), ALDOC (P09972), ALKBH2 (Q6NS38), ALKBH4 (Q9NXW9), AMBP (P02760), AMDHD2 (Q9Y303), AMPD2 (Q01433), AMZ2 (Q86W34), ANAPC1 (Q9H1A4), ANAPC4 (Q9UJX5), ANAPC5 (Q9UJX4), ANAPC7 (Q9UJX3), ANKFY1 (Q9P2R3), ANKRD28 (015084), ANP32A (P39687), ANP32B (Q92688), ANP32E (Q9BTT0), ANXA1 (P04083), ANXA2 (P07355), ANXA4 (P09525), ANXA5 (P08758), ANXA6 (P08133), ANXA7 (P20073), AP1 B1 (Q10567), AP1 G1 (043747), AP1 M1 (Q9BXS5), AP1S1 (P61966), AP1 S2 (P56377), AP2A1 (095782), AP2A2 (094973), AP2B1 (P63010), AP2M1 (Q96CW1), AP2S1 (P53680), AP3B1 (000203), AP3D1 (014617), AP3M1 (Q9Y2T2), AP3S1 (Q92572), AP3S2 (P59780), AP4S1 (Q9Y587), APEH (P13798), APEX1 (P27695), API5 (Q9BZZ5), APIP (Q96GX9), APOA1 (P02647), APOA1 BP (Q8NCW5), APOA2 (P02652), APOBEC3C (Q9NRW3), APOC2 (P02655), APOD (P05090), APOH (P02749), APOM (095445), APPL1 (Q9UKG1), APRT (P07741), AQR (060306), ARCN1 (P48444), ARF1 (P84077), ARF4 (P18085), ARF5 (P84085), ARF6 (P62330), ARFIP1 (P53367), ARFIP2 (P53365), ARHGAP1 (Q07960), ARHGAP12 (Q8IWW6), ARHGDIA

(P52565), ARHGEF1 (Q92888), ARHGEF10 (015013), ARHGEF7 (Q14155), ARIH1 (Q9Y4X5), ARIH2 (095376), ARL1 (P40616), ARL2 (P36404), ARL3 (P36405), ARL6IP1 (Q15041), ARL8B (Q9NVJ2), ARMC10 (Q8N2F6), ARMC6 (Q6NXE6), ARMC8 (Q8IUR7), ARMC9

(Q7Z3E5), ARMCX3 (Q9UH62), ARPC1A (Q92747), ARPC1 B (015143), ARPC2 (015144), ARPC3 (015145), ARPC4 (P59998), ARPC5 (01551 1), ARPC5L (Q9BPX5), ARRDC1

(Q8N5I2), ASB6 (Q9NWX5), ASCC1 (Q8N9N2), ASCC2 (Q9H1 I8), ASCC3 (Q8N3C0), ASF1A (Q9Y294), ASH2L (Q9UBL3), ASMTL (095671), ASNA1 (043681), ASNS (P08243), ASS1 (P00966), ATG16L1 (Q676U5), ATG3 (Q9NT62), ATG4B (Q9Y4P1), ATG7 (095352), ATIC (P31939), ATL3 (Q6DD88), ATM (Q13315), AT0X1 (000244), ATP1A1 (P05023), ATP1 B1 (P05026), ATP1 B3 (P54709), ATP2B1 (P20020), ATP2B4 (P23634), ATP5B (P06576), ATP5E (P56381), ATP5I (P56385), ATP6AP2 (075787), ATP6V0D1 (P61421), ATP6V1A (P38606), ATP6V1 B2 (P21281), ATP6V1C1 (P21283), ATP6V1 D (Q9Y5K8), ATP6V1 E1 (P36543), ATP6V1 G1 (075348), ATP6V1 H (Q9UI 12), ATR (Q13535), ATRN (075882), ATXN10

(Q9UBB4), B2M (P61769), B3GAT3 (094766), B3GNT1 (043505), B4GALT7 (Q9UBV7), BAG2 (095816), BAIAP2 (Q9UQB8), BANF1 (075531), BAT1 (Q13838), BAT3 (P46379), BB0X1 (075936), BCAS2 (075934), BCAT1 (P54687), BCCIP (Q9P287), BCL2L13 (Q9BXK5), BCLAF1 (Q9NYF8), BDH2 (Q9BUT1), BICD2 (Q8TD16), BL0C1 S1 (P78537), BLVRA

(P53004), BLVRB (P30043), BMP1 (P13497), B0LA2 (Q9H3K6), BPGM (P07738), BPHL (Q86WA6), BPNT1 (095861), BRCC3 (P46736), BRE (Q9NXR7), BROX (Q5VW32), BRP16L (P0CB43), BSG (P35613), BST1 (Q10588), BTAF1 (014981), BUB3 (043684), BUD31

(P41223), BYSL (Q13895), BZW1 (Q7L1Q6), BZW2 (Q9Y6E2), C10orf1 19 (Q9BTE3), C10orf58 (Q9BRX8), C10orf76 (Q5T2E6), C11orf54 (Q9H0W9), C11orf68 (Q9H3H3), C12orf10

(Q9HB07), C14orf149 (Q96EM0), C14orf166 (Q9Y224), C15orf58 (Q6ZNW5), C16orf13

(Q96S19), C16orf80 (Q9Y6A4), C1 D (Q13901), C1orf123 (Q9NWV4), C1orf50 (Q9BV19), C1orf57 (Q9BSD7), C1 RL (Q9NZP8), C20orf11 (Q9NWU2), C20orf27 (Q9GZN8), C20orf4 (Q9Y312), C21orf59 (P57076), C22orf25 (Q6ICL3), C22orf28 (Q9Y3I0), C2orf29 (Q9UKZ1), C2orf79 (Q6GMV3), C3orf10 (Q8WUW1), C3orf26 (Q9BQ75), C3orf75 (Q0PNE2), C4orf27 (Q9NWY4), C4orf41 (Q7Z392), C5orf32 (Q9H1C7), C6orf130 (Q9Y530), C6orf211 (Q9H993), C7orf25 (Q9BPX7), C7orf28B (P86790), C7orf41 (Q8N3F0), C7orf59 (Q0VGL1), C9orf142 (Q9BUH6), C9orf23 (Q8N5L8), C9orf41 (Q8N4J0), C9orf64 (Q5T6V5), CA11 (075493), CAB39 (Q9Y376), CACNA2D1 (P54289), CACYBP (Q9HB71), CAD (P27708), CADM1 (Q9BY67), CADM4 (Q8NFZ8), CALB1 (P05937), CALD1 (Q05682), CALM1 (P62158), CAMK2D (Q13557), CAND1 (Q86VP6), CAP1 (Q01518), CAPN1 (P07384), CAPN2 (P17655), CAPN5 (015484), CAPNS1 (P04632), CAPS (Q13938), CAPZA1 (P52907), CAPZA2 (P47755), CAPZB (P47756), CARHSP1 (Q9Y2V2), CARKD (Q8IW45), CARM1 (Q86X55), CARS (P49589), CASK

(014936), CASP3 (P42574), CASP6 (P55212), CAT (P04040), CBFB (Q13951), CBR1

(P16152), CBR3 (075828), CBS (P35520), CBWD2 (Q8IUF1), CBX1 (P83916), CBX3

(Q13185), CBX5 (P45973), CC2D1A (Q6P1 N0), CC2D1 B (Q5T0F9), CCAR1 (Q8IX12), CCBL1 (Q16773), CCBL2 (Q6YP21), CCDC22 (060826), CCDC25 (Q86WR0), CCDC53 (Q9Y3C0), CCDC56 (Q9Y2R0), CCDC93 (Q567U6), CCNC (P24863), CCND2 (P30279), CCNH (P51946), CCT2 (P78371), CCT3 (P49368), CCT4 (P50991), CCT5 (P48643), CCT6A (P40227), CCT7 (Q99832), CCT8 (P50990), CD109 (Q6YHK3), CD151 (P48509), CD276 (Q5ZPR3), CD44 (P16070), CD47 (Q08722), CD59 (P13987), CD63 (P08962), CD81 (P60033), CD9 (P21926), CD99 (P14209), CDC16 (Q13042), CDC23 (Q9UJX2), CDC27 (P30260), CDC34 (P49427), CDC37 (Q16543), CDC40 (060508), CDC42 (P60953), CDC5L (Q99459), CDCP1 (Q9H5V8), CDH2 (P19022), CDK1 (P06493), CDK2 (P24941), CDK2AP2 (075956), CDK4 (P11802), CDK5 (Q00535), CDK5RAP3 (Q96JB5), CDK7 (P50613), CDKN2A (P42771), CDKN2AIP (Q9NXV6), CELSR1 (Q9NYQ6), CELSR2 (Q9HCU4), CEP57 (Q86XR8), CFL1 (P23528), CFL2 (Q9Y281), CHAC2 (Q8WUX2), CHAF1 B (Q13112), CHD4 (Q14839), CHEK2 (096017), CHERP (Q8IWX8), CHID1 (Q9BWS9), CHML (P26374), CHMP1 B (Q7LBR1), CHMP2A

(043633), CHMP4A (Q9BY43), CHMP4B (Q9H444), CHMP6 (Q96FZ7), CH0RDC1 (Q9UHD1), CHP (Q99653), CHRAC1 (Q9NRG0), CHST14 (Q8NCH0), CHST3 (Q7LGC8), CHURC1 (Q8WUH1), CIA01 (076071), CIAPIN1 (Q6FI81), CIRH1A (Q969X6), CKAP5 (Q14008), CKB (P12277), CLASP1 (Q7Z460), CLDN3 (015551), CLEC18B (Q6UXF7), CLIC1 (000299), CLIC4 (Q9Y696), CLLD6 (Q5W111), CLNS1A (P54105), CLP1 (Q92989), CLPB (Q9H078), CLTA (P09496), CLTC (Q00610), CLU (P10909), CMAS (Q8NFW8), CMBL (Q96DG6), CMPK1 (P30085), CNBP (P62633), CNDP2 (Q96KP4), CNN2 (Q99439), CNN3 (Q15417), CN0T1 (A5YKK6), CNOT10 (Q9H9A5), CN0T6L (Q96LI5), CN0T7 (Q9UIV1), CNP (P09543), COASY (Q13057), COBRA 1 (Q8WX92), C0G1 (Q8WTW3), C0G2 (Q14746), C0G3 (Q96JB2), C0G4 (Q9H9E3), COG5 (Q9UP83), COG6 (Q9Y2V7), COG7 (P83436), COG8 (Q96MW5), COL11A1 (P12107), COL14A1 (Q05707), COL6A1 (P12109), COMMD1 (Q8N668), COMMD10

(Q9Y6G5), COMMD2 (Q86X83), COMMD3 (Q9UBI1), COMMD4 (Q9H0A8), COMMD5

(Q9GZQ3), COMMD6 (Q7Z4G1), COMMD7 (Q86VX2), COMMD8 (Q9NX08), COMMD9 (Q9P000), COMT (P21964), COPA (P53621), COPB1 (P53618), COPB2 (P35606), COPE (014579), COPG (Q9Y678), COPG2 (Q9UBF2), COPS2 (P61201), COPS3 (Q9UNS2), COPS4 (Q9BT78), COPS5 (Q92905), COPS6 (Q7L5N1), COPS7A (Q9UBW8), COPS7B (Q9H9Q2), COPS8 (Q99627), COPZ1 (P61923), COR01A (P31146), COR01 B (Q9BR76), COR01C (Q9ULV4), COR02B (Q9UQ03), COR07 (P57737), COTL1 (Q14019), COX5A (P20674), COX5B (P10606), COX6C (P09669), COX7A2 (P14406), CP (P00450), CPD (075976), CPN2 (P22792), CPNE1 (Q99829), CPNE3 (075131), CPNE7 (Q9UBL6), CPSF1 (Q10570), CPSF2 (Q9P2I0), CPSF3 (Q9UKF6), CPSF7 (Q8N684), CPXM1 (Q96SM3), CRIP2 (P52943), CRK (P46108), CRLF3 (Q8IUI8), CRTAP (075718), CRYAB (P02511), CRYM (Q14894), CRYZ (Q08257), CRYZL1 (095825), CS (075390), CSDE1 (075534), CSE1 L (P55060), CSK (P41240), CSNK1A1 (P48729), CSNK2A1 (P68400), CSNK2B (P67870), CSRP1 (P21291), CSRP2 (Q16527), CSTB (P04080), CSTF1 (Q05048), CSTF2T (Q9H0L4), CSTF3 (Q12996), CTBP1 (Q13363), CTBP2 (P56545), CTNNA1 (P35221), CTNNB1 (P35222), CTNNBL1 (Q8WYA6), CTNND1 (060716), CTPS (P17812), CTPS2 (Q9NRF8), CTR9 (Q6PD62), CTSC (P53634), CTSD (P07339), CTSF (Q9UBX1), CTSL2 (060911), CTU1 (Q7Z7A3), CTU2 (Q2VPK5), CUL1 (Q13616), CUL2 (Q13617), CUL3 (Q13618), CUL4A (Q13619), CUL4B (Q13620), CUL5 (Q93034), CWF19L1 (Q69YN2), CXADR (P78310), CXorf26 (Q9BVG4), CYB5A (P00167), CYCS (P99999), CYFIP1 (Q7L576), CYFIP2 (Q96F07), CYR61 (000622), DAG1 (Q14118), DAK (Q3LXA3), DARS (P14868), DAZAP1 (Q96EP5), DBI (P07108), DBN1 (Q16643), DBNL (Q9UJU6), DBR1 (Q9UK59), DCAF7 (P61962), DCAF8 (Q5TAQ9), DCD (P81605), DCK (P27707), DCLK1 (015075), DCPS (Q96C86), DCTD (P32321), DCTN1 (Q14203), DCTN2 (Q13561), DCTN3 (075935), DCTN4 (Q9UJW0), DCTN5 (Q9BTE1), DCTN6 (000399), DCUN1 D1 (Q96GG9), DCUN1 D5 (Q9BTE7), DCXR (Q7Z4W1), DDA1 (Q9BW61), DDAH2 (095865), DDB1 (Q16531 ), DDB2 (Q92466), DDI2 (Q5TDH0), DDR1 (Q08345), DDT (P30046), DDX1 (Q92499), DDX17 (Q92841), DDX19A (Q9NUU7), DDX21 (Q9NR30), DDX23 (Q9BUQ8), DDX39 (000148), DDX3X (000571), DDX5 (P17844), DDX51 (Q8N8A6), DDX6 (P26196), DECR1 (Q16698), DEF (Q68CQ4), DEFA1 (P59665), DENR (043583), DERA (Q9Y315), DFFA (000273), DHFR (P00374), DHPS (P49366), DHRS1 (Q96LJ7), DHRS11 (Q6UWP2), DHRS4 (Q9BTZ2), DHX15 (043143), DHX16 (060231), DHX29 (Q7Z478), DHX36 (Q9H2U1), DHX9 (Q08211), DIAPH1 (060610), DIAPH2 (060879), DIMT1 L (Q9UNQ2), DIP2B (Q9P265), DIP2C (Q9Y2E4), DIS3 (Q9Y2L1), DIS3L2 (Q8IYB7), DKC1 (060832), DLG1 (Q12959), DNAH17 (Q9UFH2), DNAJA1 (P31689), DNAJA2 (060884), DNAJB1 (P25685), DNAJB4 (Q9UDY4), DNAJC13 (075165), DNAJC3 (Q13217), DNAJC7 (Q99615), DNASE1 L1 (P49184), DNM1 (Q05193), DNM1 L (000429), DNM2 (P50570), DNPEP (Q9ULA0), D0CK1 (Q14185), DOCK4 (Q8N1 I0), DOCK5 (Q9H7D0), DOCK7 (Q96N67), DOHH (Q9BU89), DOM3Z (077932), DPCD (Q9BVM2), DPH1 (Q9BZG8), DPH2 (Q9BQC3), DPH5 (Q9H2P9), DPMI (060762), DPP3 (Q9NY33), DPP9 (Q86TI2), DPY30 (Q9C005), DPYSL2 (Q16555), DPYSL3 (Q14195), DPYSL4 (014531), DPYSL5 (Q9BPU6), DRG1 (Q9Y295), DRG2 (P55039), DSG1 (Q02413), DSP (P15924), DST (Q03001), DSTN (P60981), DTD1 (Q8TEA8), DTYMK

(P23919), DUS2L (Q9NX74), DUSP12 (Q9UNI6), DUSP23 (Q9BVJ7), DUSP3 (P51452), DYM (Q7RTS9), DYNC1 H1 (Q14204), DYNC1 I2 (Q13409), DYNC1 LI1 (Q9Y6G9), DYNC1 LI2 (043237), DYNC2H1 (Q8NCM8), DYNLL1 (P63167), DYNLL2 (Q96FJ2), DYNLRB1 (Q9NP97), DYNLT1 (P63172), ECHDC1 (Q9NTX5), ECHDC3 (Q96DC8), ECHS1 (P30084), ECM29 (Q5VYK3), EDC4 (Q6P2E9), EEA1 (Q15075), EEF1A1 (P68104), EEF1 B2 (P24534), EEF1 D (P29692), EEF1 E1 (043324), EEF1G (P26641), EEF2 (P13639), EEFSEC (P57772), EFEMP2 (095967), EFHD2 (Q96C19), EFNB2 (P52799), EFTUD1 (Q7Z2Z2), EFTUD2 (Q15029), EGFR (P00533), EHD1 (Q9H4M9), EHD2 (Q9NZN4), EHD4 (Q9H223), EIF1 (P41567), EIF1AX (P47813), EIF2A (Q9BY44), EIF2AK2 (P19525), EIF2B1 (Q14232), EIF2B2 (P49770), EIF2B3 (Q9NR50), EIF2B4 (Q9UI10), EIF2B5 (Q13144), EIF2C2 (Q9UKV8), EIF2S1 (P05198), EIF2S2 (P20042), EIF2S3 (P41091), EIF3A (Q14152), EIF3B (P55884), EIF3C (Q99613), EIF3D (015371), EIF3E (P60228), EIF3F (000303), EIF3G (075821), EIF3H (015372), EIF3I

(Q13347), EIF3J (075822), EIF3K (Q9UBQ5), EIF3L (Q9Y262), EIF3M (Q7L2H7), EIF4A1 (P60842), EIF4A2 (Q14240), EIF4A3 (P38919), EIF4E (P06730), EIF4E2 (060573), EIF4G1 (Q04637), EIF4G2 (P78344), EIF4G3 (043432), EIF4H (Q15056), EIF5 (P55010), EIF5A (P63241), EIF5B (060841), EIF6 (P56537), ELAC2 (Q9BQ52), ELAVL1 (Q15717), ELM 02 (Q96JJ3), ELP2 (Q6IA86), ELP3 (Q9H9T3), EMG1 (Q92979), EMILIN1 (Q9Y6C2), EML1 (000423), EML2 (095834), EML3 (Q32P44), EML4 (Q9HC35), ENAH (Q8N8S7), EN01 (P06733), EN02 (P09104), EN0PH1 (Q9UHY7), ENY2 (Q9NPA8), EPB41 L2 (043491), EPB41 L3 (Q9Y2J2), EPHA2 (P29317), EPHB3 (P54753), EPHX1 (P07099), EPM2AIP1 (Q7L775), EPRS (P07814), ERH (P84090), ERI1 (Q8IV48), ERI3 (043414), ERP44 (Q9BS26), ESD (P10768), ESYT1 (Q9BSJ8), ETF1 (P62495), ETFA (P13804), ETFB (P38117), EX0C1 (Q9NV70), EX0C2 (Q96KP1), EX0C3 (060645), EX0C4 (Q96A65), EX0C5 (000471), EX0C6 (Q8TAG9), EX0C7 (Q9UPT5), EX0C8 (Q8IYI6), EX0SC1 (Q9Y3B2), EX0SC2 (Q13868), EX0SC3 (Q9NQT5), EX0SC4 (Q9NPD3), EX0SC5 (Q9NQT4), EX0SC6

(Q5RKV6), EX0SC7 (Q15024), EX0SC8 (Q96B26), EX0SC9 (Q06265), EXTL3 (043909), EYA3 (Q99504), EZR (P15311), F3 (P13726), F8 (P00451), F8A1 (P23610), FABP5 (Q01469), FABP7 (015540), FADD (Q13158), FAF1 (Q9UNN5), FAH (P16930), FAHD2A (Q96GK7), FAM114A2 (Q9NRY5), FAM115A (Q9Y4C2), FAM120A (Q9NZB2), FAM125A (Q96EY5), FAM127A (A6ZKI3), FAM129B (Q96TA1), FAM136A (Q96C01), FAM168A (Q92567),

FAM175B (Q15018), FAM188A (Q9H8M7), FAM3A (P98173), FAM3C (Q92520), FAM45B (Q6NSW5), FAM49B (Q9NUQ9), FAM82B (Q96DB5), FAM84B (Q96KN1), FAM98A (Q8NCA5), FAM98B (Q52LJ0), FARP1 (Q9Y4F1), FARP2 (094887), FARSA (Q9Y285), FARSB (Q9NSD9), FASN (P49327), FAT1 (Q14517), FBL (P22087), FBLN2 (P98095), FBN1 (P35555), FBN2 (P35556), FBXL18 (Q96ME1), FBX021 (094952), FBX022 (Q8NEZ5), FDFT1 (P37268), FDPS (P14324), FEN1 (P39748), FERMT1 (Q9BQL6), FERMT2 (Q96AC1), FGF1 (P05230), FGFRL1 (Q8N441), FGGY (Q96C11), FH (P07954), FHL1 (Q13642), FHL2 (Q14192), FHL3 (Q13643), FIS1 (Q9Y3D6), FKBP1A (P62942), FKBP3 (Q00688), FKBP4 (Q02790), FKBP5 (Q13451), FLU (Q13045), FLNA (P21333), FLNB (075369), FLNC (Q14315), FL0T1 (075955), FMNL2 (Q96PY5), FN3K (Q9H479), FN3KRP (Q9HA64), FNTA (P49354), FNTB (P49356), F0LR1 (P15328), FREM2 (Q5SZK8), FRMD8 (Q9BZ67), FSCN1 (Q16658), FSD1 (Q9BTV5), FTH1 (P02794), FTL (P02792), FTO (Q9C0B1), FTSJD2 (Q8N1G2), FUBP1 (Q96AE4), FUCA2 (Q9BTY2), FUK (Q8N0W3), FXR1 (P51114), G3BP1 (Q13283), G3BP2 (Q9UN86), G6PD (P11413), GAA (P10253), GALK1 (P51570), GALK2 (Q01415), GALNT1 (Q10472), GALNT2 (Q10471), GANAB (Q14697), GAP43 (P17677), GAPDH (P04406), GAPVD1 (Q14C86), GAR1 (Q9NY12), GARS (P41250), GART (P22102), GATSL2 (A6NHX0), GBA (P04062), GBE1 (Q04446), GCLM (P48507), GCN1 L1 (Q92616), GDI1 (P31150), GDI2 (P50395), GEMIN5 (Q8TEQ6), GEMIN6 (Q8WXD5), GET4 (Q7L5D6), GFAP (P14136), GFPT1 (Q06210), GFPT2 (094808), GGCT (075223), GGPS1 (095749), GINS1 (Q14691), GINS4 (Q9BRT9), GIPC1 (014908), GIT1 (Q9Y2X7), GLA (P06280), GLB1 (P16278), GLB1 L2 (Q8IW92), GLG1

(Q92896), GLIPR2 (Q9H4G4), GLMN (Q92990), GL01 (Q04760), GL0D4 (Q9HC38), GLRX (P35754), GLRX3 (076003), GLT25D1 (Q8NBJ5), GLTP (Q9NZD2), GLTPD1 (Q5TA50), GLUD1 (P00367), GLUL (P15104), GMDS (060547), GMFB (P60983), GMPPA (Q96IJ6), GMPPB (Q9Y5P6), GMPR (P36959), GMPR2 (Q9P2T1), GMPS (P49915), GNA11 (P29992), GNA13 (Q14344), GNAI2 (P04899), GNAI3 (P08754), GNAQ (P50148), GNAS (Q5JWF2), GNB1 (P62873), GNB2 (P62879), GNB2L1 (P63244), GNB4 (Q9HAV0), GNE (Q9Y223), GNG12 (Q9UBI6), GNG4 (P50150), GNG5 (P63218), GNPDA1 (P46926), GNPNAT1

(Q96EK6), G0LGA7 (Q7Z5G4), G0LGB1 (Q14789), G0LIM4 (000461), G0LM1 (Q8NBJ4), G0LPH3 (Q9H4A6), G0RASP2 (Q9H8Y8), GPC1 (P35052), GPC4 (075487), GPC6

(Q9Y625), GPD1 L (Q8N335), GPI (P06744), GPLD1 (P80108), GPM6A (P51674), GPM6B (Q13491), GPN1 (Q9HCN4), GPR56 (Q9Y653), GPS1 (Q13098), GPX1 (P07203), GPX4 (P36969), GRB2 (P62993), GRHPR (Q9UBQ7), GRP (Q3ZCW2), GRPEL1 (Q9HAV7), GRWD1 (Q9BQ67), GSK3A (P49840), GSK3B (P49841), GSN (P06396), GSPT1 (P15170), GSS (P48637), GSTK1 (Q9Y2Q3), GSTM2 (P28161), GSTM3 (P21266), GSTM4 (Q03013), GST01 (P78417), GSTP1 (P09211), GSTT2 (P0CG29), GSTZ1 (043708), GTF2F2 (P13984), GTF2H2 (Q13888), GTF2I (P78347), GTF3C1 (Q12789), GTF3C2 (Q8WUA4), GTF3C4 (Q9UKN8), GTPBP1 (000178), GUK1 (Q16774), GYG1 (P46976), GYS1 (P13807), H2AFY (075367), H2AFZ (P0C0S5), HADH (Q16836), HAGH (Q16775), HARS (P12081), HAT1 (014929), HAUS3 (Q68CZ6), HAUS4 (Q9H6D7), HBA1 (P69905), HBB (P68871), HCFC1 (P51610), HDAC1 (Q13547), HDAC2 (Q92769), HDAC3 (015379), HDHD2 (Q9H0R4), HDLBP (Q00341), HEATR1 (Q9H583), HEATR2 (Q86Y56), HEBP1 (Q9NRV9), HECTD3 (Q5T447), HEG1 (Q9ULI3), HELZ (P42694), HERC4 (Q5GLZ8), HEXB (P07686), HGS (014964), HHIP

(Q96QV1), HIBCH (Q6NVY1), HIF1AN (Q9NWT6), HINT1 (P49773), HIP1 R (075146), HIST1 H1 B (P16401), HIST1 H1C (P16403), HIST1 H2BM (Q99879), HIST1 H2B0 (P23527), HIST1 H4A (P62805), HIST2H2AA3 (Q6FI 13), HIST2H3A (Q71 DI3), HK1 (P19367), HK2 (P52789), HLA-A (P30443), HLA-A (P01892), HLCS (P50747), HMGA1 (P17096), HMGB1 (P09429), HMGCL (P35914), HMGCS1 (Q01581), HMGN2 (P05204), HNRNPA1 (P09651), HNRNPA2B1 (P22626), HNRNPA3 (P51991), HNRNPAB (Q99729), HNRNPC (P07910), HNRNPD (Q14103), HNRNPF (P52597), HNRNPH1 (P31943), HNRNPH2 (P55795),

HNRNPH3 (P31942), HNRNPK (P61978), HNRNPL (P14866), HNRNPM (P52272), HNRNPR (043390), HNRNPU (Q00839), HNRNPUL2 (Q1 KMD3), HNRPDL (014979), HNRPLL

(Q8WVV9), H00K3 (Q86VS8), HP (P00738), HP1 BP3 (Q5SSJ5), HPCAL1 (P37235), HPRT1 (P00492), HPX (P02790), HRAS (P011 12), HS6ST2 (Q96MM7), HSD17B10 (Q99714), HSD17B4 (P51659), HSP90AA1 (P07900), HSP90AB1 (P08238), HSP90B1 (P14625), HSPA12A (043301), HSPA14 (Q0VDF9), HSPA1A (P08107), HSPA2 (P54652), HSPA4 (P34932), HSPA4L (095757), HSPA5 (P11021), HSPA8 (P11 142), HSPA9 (P38646), HSPB1 (P04792), HSPB11 (Q9Y547), HSPBP1 (Q9NZL4), HSPD1 (P10809), HSPE1 (P61604), HSPG2 (P98160), HSPH 1 (Q92598), HTATIP2 (Q9BUP3), HTRA1 (Q92743), HTT (P42858), HUWE1 (Q7Z6Z7), HY0U1 (Q9Y4L1), IARS (P41252), ICAM1 (P05362), IDE (P14735), IDH1 (075874), IDH2 (P48735), IDI 1 (Q13907), IDUA (P35475), IFI 16 (Q16666), IFI35 (P80217), IFIT5 (Q13325), IFITM3 (Q01628), IGF1 R (P08069), IGF2BP2 (Q9Y6M1), IGF2BP3 (000425), IGF2R (P1 1717), IGFBP3 (P17936), IGSF3 (075054), IGSF8 (Q969P0), IKBKAP (095163), IL1 RAP (Q9NPH3), ILF2 (Q12905), ILF3 (Q12906), ILK (Q13418), ILKAP (Q9H0C8), IMP4 (Q96G21), IMPA1 (P29218), IMPA2 (014732), IMPAD1 (Q9NX62), IMPDH2 (P12268), INF2 (Q27J81), INPP1 (P49441), INPPL1 (015357), INTS1 (Q8N201), INTS10 (Q9NVR2), INTS3 (Q68E01), INTS5 (Q6P9B9), IP01 1 (Q9UI26), IP013 (094829), IP04 (Q8TEX9), IP05

(000410), IP07 (095373), IP08 (015397), IP09 (Q96P70), IQGAP1 (P46940), IRF2BP2 (Q7Z5L9), IRF3 (Q14653), IRGQ (Q8WZA9), ISG15 (P05161), IS0C1 (Q96CN7), ISPD

(A4D126), ISYNA1 (Q9NPH2), ITFG3 (Q9H0X4), ITGA2 (P17301), ITGA3 (P26006), ITGA4 (P13612), ITGA5 (P08648), ITGA6 (P23229), ITGA7 (Q13683), ITGAV (P06756), ITGB1 (P05556), ITGB4 (P16144), ITGB8 (P26012), ITPA (Q9BY32), JAM3 (Q9BX67), JUP (P14923), KARS (Q15046), KBTBD4 (Q9NVX7), KBTBD6 (Q86V97), KCTD12 (Q96CX2), KDM1A

(060341), KEAP1 (Q14145), KHDRBS1 (Q07666), KHSRP (Q92945), KIAA0174 (P53990), KIAA0196 (Q12768), KIAA0319L (Q8IZA0), KIAA0664 (075153), KIAA0776 (094874), KIAA1033 (Q2M389), KIAA1279 (Q96EK5), KIAA1468 (Q9P260), KIAA1598 (A0MZ66), KIAA1797 (Q5VW36), KIAA1967 (Q8N163), KIF1A (Q12756), KIF3A (Q9Y496), KIF5B

(P33176), KIF5C (060282), KLC1 (Q07866), KLC2 (Q9H0B6), KLC4 (Q9NSK0), KLHDC3 (Q9BQ90), KLHL13 (Q9P2N7), KNG1 (P01042), KNTC1 (P50748), KPNA1 (P52294), KPNA2 (P52292), KPNA3 (000505), KPNA4 (000629), KPNA6 (060684), KPNB1 (Q14974), KPRP (Q5T749), KRAS (P01 116), KRIT1 (000522), KRT13 (P13646), KRT14 (P02533), KRT71 (Q3SY84), KTN1 (Q86UP2), L1 CAM (P32004), LAGE3 (Q14657), LAMA4 (Q16363), LAMA5 (015230), LAMB1 (P07942), LAMC1 (P1 1047), LAMP1 (P1 1279), LAMP2 (P13473), LANCL1 (043813), LANCL2 (Q9NS86), LAP3 (P28838), LARP1 (Q6PKG0), LARS (Q9P2J5), LASP1 (Q14847), LCAT (P04180), LCMT1 (Q9UIC8), LDHA (P00338), LDHB (P07195), LDLR

(P01 130), LEFTY2 (000292), LEPRE1 (Q32P28), LFNG (Q8NES3), LGALS1 (P09382), LGALS3 (P17931), LGALS3BP (Q08380), LHFP (Q9Y693), LIMA1 (Q9UHB6), LIMS1

(P48059), LIN7C (Q9NUP9), LIPG (Q9Y5X9), LLGL1 (Q15334), LMCD1 (Q9NZU5), LMNA (P02545), LMNB1 (P20700), L0XL4 (Q96JB6), LPL (P06858), LRBA (P50851), LRCH3

(Q96II8), LRG1 (P02750), LRP1 (Q07954), LRRC20 (Q8TCA0), LRRC40 (Q9H9A6), LRRC47 (Q8N1 G4), LRRC57 (Q8N9N7), LRSAM1 (Q6UWE0), LRWD1 (Q9UFC0), LSM1 (0151 16), LSM12 (Q3MHD2), LSM2 (Q9Y333), LSM3 (P62310), LSM4 (Q9Y4Z0), LSM6 (P62312), LSM7 (Q9UK45), LSS (P48449), LTA4H (P09960), LTBP2 (Q14767), LTBP3 (Q9NS15), LUM

(P51884), LYPLA1 (075608), LYPLA2 (095372), LYPLAL1 (Q5VWZ2), M6PR (P20645), MACF1 (Q9UPN3), MAD1 L1 (Q9Y6D9), MAD2L1 (Q13257), MAEA (Q7L5Y9), MAGEE1 (Q9HCI5), MAGOHB (Q96A72), MALT1 (Q9UDY8), MAN1 B1 (Q9UKM7), MAN2A1 (Q16706), MA NBA (000462), MAPI B (P46821), MAP1 S (Q66K74), MAP2K1 (Q02750), MAP2K2

(P36507), MAP2K3 (P46734), MAP3K4 (Q9Y6R4), MAP4 (P27816), MAP4K4 (095819), MAPK1 (P28482), MAPK12 (P53778), MAPK3 (P27361), MAPK9 (P45984), MAPKAPK2 (P49137), MAPKSP1 (Q9UHA4), MAPRE1 (Q15691), MAPRE3 (Q9UPY8), MARCKS

(P29966), MARCKSL1 (P49006), MARK2 (Q7KZI7), MARS (P56192), MAT2A (P31153), MAT2B (Q9NZL9), MATR3 (P43243), MBD3 (095983), MBNL1 (Q9NR56), MCAM (P43121), MCAT (Q8IVS2), MCM2 (P49736), MCM3 (P25205), MCM4 (P33991), MCM5 (P33992), MCM6 (Q14566), MCM7 (P33993), MCTS1 (Q9ULC4), MDH 1 (P40925), MDH2 (P40926), MDK (P21741), MDN1 (Q9NU22), ME1 (P48163), ME2 (P23368), MED1 (Q15648), MED16

(Q9Y2X0), MED17 (Q9NVC6), MED18 (Q9BUE0), MED20 (Q9H944), MED22 (Q15528), MED23 (Q9ULK4), MED27 (Q6P2C8), MED30 (Q96HR3), MED31 (Q9Y3C7), MEM01

(Q9Y316), MERIT40 (Q9NWV8), METAP1 (P53582), METAP2 (P50579), METH OD (Q86W50), METTL1 (Q9UBP6), METTL11A (Q9BV86), METTL13 (Q8N6R0), METTL2B (Q6P1 Q9), METTL5 (Q9NRN9), MFAP2 (P55001), MFAP4 (P55083), MFGE8 (Q08431), MFI2 (P08582), MGAT4B (Q9UQ53), MGAT5 (Q09328), MGEA5 (060502), MICAL1 (Q8TDZ2), MIF (P14174), MIF4GD (A9UHW6), MINA (Q8IUF8), MINK1 (Q8N4C8), MIOS (Q9NXC5), MIS12 (Q9H081), MKLN1 (Q9UL63), MLTK (Q9NYL2), MMP14 (P50281), MMS19 (Q96T76), M0B2 (Q70IA6), M0BKL1 B (Q9H8S9), M0BKL2A (Q96BX8), M0BKL3 (Q9Y3A3), M0CS2 (096033), M0N2 (Q7Z3U7), M0RC2 (Q9Y6X9), MOV10 (Q9HCE1), M0XD1 (Q6UVY6), MPI (P34949), MPP6 (Q9NZW5), MPRIP (Q6WCQ1), MPST (P25325), MPZL1 (095297), MRC2 (Q9UBG0), MRU (Q9BV20), MRT04 (Q9UKD2), MSH2 (P43246), MSN (P26038), MST01 (Q9BUK6), MTA1 (Q13330), MTA2 (094776), MTAP (Q13126), MTHFD1 (P11586), MTHFS (P49914), MTM1 (Q13496), MTMR1 (Q13613), MTMR6 (Q9Y217), MTMR9 (Q96QG7), MTOR (P42345), MTPN (P58546), MTR (Q99707), MVD (P53602), MVK (Q03426), MVP (Q14764), MYADM (Q96S97), MYBBP1A (Q9BQG0), MYCBP (Q99417), MYD88 (Q99836), MYH10 (P35580), MYH9

(P35579), MYL12B (014950), MYL6 (P60660), MY018A (Q92614), MY01 B (043795), MY01C (000159), MY01 E (Q12965), MY06 (Q9UM54), MYOF (Q9NZM1), MZT1 (Q08AG7), NAA10 (P41227), NAA15 (Q9BXJ9), NAA16 (Q6N069), NAA20 (P61599), NAA30 (Q147X3), NAA38 (095777), NAA50 (Q9GZZ1), NACA (Q13765), NADSYN1 (Q6IA69), NAE1 (Q13564), NAGK (Q9UJ70), NAGLU (P54802), NAMPT (P43490), NANS (Q9NR45), NAP1 L1 (P55209), NAP1 L4 (Q99733), NAPA (P54920), NAPG (Q99747), NAPRT1 (Q6XQN6), NARS (043776), NASP (P49321), NCAM1 (P13591), NCAPD2 (Q15021), NCAPG (Q9BPX3), NCBP1 (Q09161), NCBP2 (P52298), NCDN (Q9UBB6), NCKAP1 (Q9Y2A7), NCKIPSD (Q9NZQ3), NCL (P19338), NCS1 (P62166), NCSTN (Q92542), NDRG3 (Q9UGV2), NDRG4 (Q9ULP0), NDUFA2

(043678), NDUFA3 (095167), NDUFA5 (Q16718), NDUFAB1 (014561), NDUFS6 (075380), NEDD4L (Q96PU5), NEFL (P07196), NEK9 (Q8TD19), NES (P48681), NF1 (P21359), NFIC (P08651), NFIX (Q14938), NFKB2 (Q00653), NHLRC2 (Q8NBF2), NHP2L1 (P55769), NID1 (P14543), NIP7 (Q9Y221), NIT1 (Q86X76), NIT2 (Q9NQR4), NLE1 (Q9NVX2), NLGN4X (Q8N0W4), NLN (Q9BYT8), NMD3 (Q96D46), NME1 (P15531), NME2 (P22392), NME3 (Q13232), NME7 (Q9Y5B8), NMT1 (P30419), NNMT (P40261), N0B1 (Q9ULX3), N0L11 (Q9H8H0), N0L6 (Q9H6R4), N0M02 (Q5JPE7), NONO (Q15233), NOP10 (Q9NPE3), N0P2 (P46087), NOTCH 1 (P46531), N0TCH3 (Q9UM47), N0VA2 (Q9UNW9), NPEPPS (P55786), NPL0C4 (Q8TAT6), NPM1 (P06748), NPM3 (075607), NPTN (Q9Y639), NPW (Q8N729), NQ01 (P15559), NQ02 (P16083), NR2C2AP (Q86WQ0), NRAS (P01111), NRBP1 (Q9UHY1), NRBP2 (Q9NSY0), NRD1 (043847), NRP2 (060462), NSF (P46459), NSMAF (Q92636), NSMCE1 (Q8WV22), NSUN2 (Q08J23), NT5C (Q8TCD5), NT5DC1 (Q5TFE4), NTN1

(095631), NUBP1 (P53384), NUBP2 (Q9Y5Y2), NUCB1 (Q02818), NUDC (Q9Y266), NUDCD1 (Q96RS6), NUDCD2 (Q8WVJ2), NUDT1 (P36639), NUDT10 (Q8NFP7), NUDT12 (Q9BQG2), NUDT16 (Q96DE0), NUDT16L1 (Q9BRJ7), NUDT2 (P50583), NUDT21 (043809), NUDT4 (Q9NZJ9), NUDT5 (Q9UKK9), NUMA1 (Q14980), NUP188 (Q5SRE5), NUP37 (Q8NFH4), NUP43 (Q8NFH3), NUP54 (Q7Z3B4), NUP88 (Q99567), NUP93 (Q8N1 F7), NUTF2 (P61970), NXN (Q6DKJ4), 0BFC2B (Q9BQ15), OCRL (Q01968), 0DZ2 (Q9NT68), 0DZ3 (Q9P273), 0GF0D1 (Q8N543), OGT (015294), 0LA1 (Q9NTK5), 0LFML3 (Q9NRN5), 0PA1 (060313), OPLAH (014841), OSBP (P22059), 0SBPL1A (Q9BXW6), OSGEP (Q9NPF4), 0TUB1

(Q96FW1), 0VCA2 (Q8WZ82), 0XCT1 (P55809), 0XSR1 (095747), P4HB (P07237), PA2G4 (Q9UQ80), PAAF1 (Q9BRP4), PABPC1 (P11940), PABPC4 (Q13310), PABPN1 (Q86U42), PACSIN2 (Q9UNF0), PACSIN3 (Q9UKS6), PAF1 (Q8N7H5), PAFAH1 B1 (P43034), PAFAH1 B2 (P68402), PAFAH1 B3 (Q15102), PAICS (P22234), PAIP1 (Q9H074), PAK2 (Q13177), PALD (Q9ULE6), PALLD (Q8WX93), PANK4 (Q9NVE7), PAPOLA (P51003), PAPSS1 (043252), PARF (Q3YEC7), PARK7 (Q99497), PARN (095453), PARP1 (P09874), PARP4 (Q9UKK3), PARVA (Q9NVD7), PBK (Q96KB5), PBLD (P30039), PCBP1 (Q15365), PCBP2 (Q15366), PCDHB2 (Q9Y5E7), PCDHGB4 (Q9UN71), PCDHGC3 (Q9UN70), PCID2 (Q5JVF3), PCMT1 (P22061), PCNA (P12004), PCOLCE2 (Q9UKZ9), PCYT2 (Q99447), PDCD10 (Q9BUL8), PDCD2L (Q9BRP1), PDCD4 (Q53EL6), PDCD5 (014737), PDCD6 (075340), PDCD6IP (Q8WUM4), PDCL3 (Q9H2J4), PDDC1 (Q8NB37), PDE12 (Q6L8Q7), PDE6D (043924), PDGFC (Q9NRA1), PDIA3 (P30101), PDIA6 (Q15084), PDLIM1 (000151), PDLIM4 (P50479), PDLIM5 (Q96HC4), PDLIM7 (Q9NR12), PDRG1 (Q9NUG6), PDRO (Q6IAA8), PDS5A

(Q29RF7), PDXK (000764), PDXP (Q96GD0), PEA15 (Q15121), PEBP1 (P30086), PEF1 (Q9UBV8), PELO (Q9BRX2), PELP1 (Q8IZL8), PEPD (P12955), PFAS (015067), PFDN2 (Q9UHV9), PFDN5 (Q99471), PFDN6 (015212), PFKL (P17858), PFKM (P08237), PFKP (Q01813), PFN1 (P07737), PFN2 (P35080), PGAM1 (P18669), PGAM5 (Q96HS1), PGD (P52209), PGGT1 B (P53609), PGK1 (P00558), PGLS (095336), PGLYRP2 (Q96PD5), PGM1 (P36871), PGM2L1 (Q6PCE3), PGM3 (095394), PGP (A6NDG6), PGRMC1 (000264), PGRMC2 (015173), PHF5A (Q7RTV0), PHGDH (043175), PHKB (Q93100), PHLDA3

(Q9Y5J5), PHPT1 (Q9NRX4), PIK3CB (P42338), PIK3R4 (Q99570), PIN1 (Q13526), PIP4K2A (P48426), PI POX (Q9P0Z9), PITPNB (P48739), PKM2 (P14618), PKP1 (Q13835), PLAA (Q9Y263), PLCD3 (Q8N3E9), PLCG1 (P19174), PLD3 (Q8IV08), PLEC (Q15149), PLEKHB2 (Q96CS7), PLIN3 (060664), PL0D1 (Q02809), PL0D2 (000469), PL0D3 (060568), PLRG1 (043660), PLS1 (Q14651), PLS3 (P13797), PLSCR3 (Q9NRY6), PLTP (P55058), PLXNA1 (Q9UIW2), PLXNB2 (015031), PLXND1 (Q9Y4D7), PM20D2 (Q8IYS1), PML (P29590), PMM2 (015305), PMPCA (Q10713), PMPCB (075439), PMVK (Q15126), PNMA2 (Q9UL42), PN01 (Q9NRX1), PNP (P00491), PODXL (000592), P0LA1 (P09884), P0LD1 (P28340), P0LD2 (P49005), P0LE3 (Q9NRF9), P0LR1A (095602), P0LR1 B (Q9H9Y6), P0LR1C (015160), P0LR1 D (Q9Y2S0), P0LR1 E (Q9GZS1), P0LR2A (P24928), P0LR2B (P30876), P0LR2C (P19387), P0LR2E (P19388), P0LR2G (P62487), P0LR2H (P52434), P0LR2J (P52435), P0LR2L (P62875), P0LR3A (014802), P0LR3B (Q9NW08), P0LR3C (Q9BUI4), P0LR3F (Q9H1 D9), P0P1 (Q99575), P0P4 (095707), P0P5 (Q969H6), P0P7 (075817), PPA1 (Q15181), PPA2 (Q9H2U2), PPAT (Q06203), PPCS (Q9HAB8), PPIA (P62937), PPIB

(P23284), PPID (Q08752), PPIF (P30405), PPIH (043447), PPIL1 (Q9Y3C6), PPM1A

(P35813), PPM1 F (P49593), PPM1G (015355), PPME1 (Q9Y570), PPP1CA (P62136), PPP1CB (P62140), PPP1CC (P36873), PPP1 R7 (Q15435), PPP1 R8 (Q12972), PPP2CA (P67775), PPP2CB (P62714), PPP2R1A (P30153), PPP2R2A (P63151), PPP2R4 (Q15257), PPP2R5C (Q13362), PPP2R5D (Q14738), PPP2R5E (Q16537), PPP3CA (Q08209), PPP4C (P60510), PPP4R1 (Q8TF05), PPP5C (P53041), PPP6C (000743), PPP6R3 (Q5H9R7), PPPDE2 (Q6ICB0), PPT1 (P50897), PPWD1 (Q96BP3), PRCP (P42785), PRDX1 (Q06830), PRDX2 (P32119), PRDX3 (P30048), PRDX5 (P30044), PRDX6 (P30041), PREP (P48147), PREPL (Q4J6C6), PRIM1 (P49642), PRIM2 (P49643), PRKACA (P17612), PRKACB (P22694), PRKAG1 (P54619), PRKAR1A (P10644), PRKAR2A (P13861), PRKAR2B (P31323), PRKDC (P78527), PRMT1 (Q99873), PRMT3 (060678), PRMT5 (014744), PROM1 (043490), PROSC (094903), PRPF19 (Q9UMS4), PRPF31 (Q8WWY3), PRPF4 (043172), PRPF4B (Q13523), PRPF8 (Q6P2Q9), PRPS1 (P60891), PRPS2 (P1 1908), PRPSAP1 (Q14558), PRPSAP2 (060256), PRSS23 (095084), PRTFDC1 (Q9NRG1), PSAT1 (Q9Y617), PSMA1 (P25786), PSMA2 (P25787), PSMA3 (P25788), PSMA4 (P25789), PSMA5 (P28066), PSMA6 (P60900), PSMA7 (014818), PSMB1 (P20618), PSMB2 (P49721), PSMB3 (P49720), PSMB4 (P28070), PSMB5 (P28074), PSMB6 (P28072), PSMB7 (Q99436), PSMB8 (P28062), PSMC1 (P62191), PSMC2 (P35998), PSMC3 (P17980), PSMC4 (P43686), PSMC5 (P62195), PSMC6 (P62333), PSMD1 (Q99460), PSMD10 (075832), PSMD11 (000231), PSMD12 (000232), PSMD13 (Q9UNM6), PSMD14 (000487), PSMD2 (Q 13200), PSMD3 (043242), PSMD4 (P55036), PSMD5 (Q16401), PSMD6 (Q15008), PSMD7 (P51665), PSMD8 (P48556), PSMD9 (000233), PSME1 (Q06323), PSME2 (Q9UL46), PSME3 (P61289), PSME4 (Q14997), PSMF1 (Q92530), PSMG1 (095456), PSMG2 (Q969U7), PSMG3 (Q9BT73), PSPC1 (Q8WXF1), PSPH (P78330), PTBP1 (P26599), PTGES3 (Q15185), PTGFRN (Q9P2B2), PTGR1 (Q14914), PTGR2

(Q8N8N7), PTK2 (Q05397), PTK7 (Q13308), PTN (P21246), PTP4A1 (Q93096), PTPN1 (P18031), PTPN1 1 (Q06124), PTPN23 (Q9H3S7), PTPRA (P18433), PTPRG (P23470), PTPRZ1 (P23471), PUF60 (Q9UHX1), PUM 1 (Q14671), PURB (Q96QR8), PUS7 (Q96PZ0), PVR (P15151), PWP1 (Q13610), PXDN (Q92626), PXK (Q7Z7A4), PYCR1 (P32322), PYCRL (Q53H96), PYGB (P11216), PYGL (P06737), QARS (P47897), QDPR (P09417), QKI

(Q96PU8), QRICH1 (Q2TAL8), QS0X2 (Q6ZRP7), QTRT1 (Q9BXR0), RAB10 (P61026), RAB1 1A (P62491), RAB11 FIP1 (Q6WKZ4), RAB12 (Q6IQ22), RAB13 (P51153), RAB14 (P61 106), RAB18 (Q9NP72), RAB1A (P62820), RAB1 B (Q9H0U4), RAB21 (Q9UL25), RAB22A (Q9UL26), RAB23 (Q9ULC3), RAB27A (P51159), RAB2A (P61019), RAB34 (Q9BZG1), RAB35 (Q15286), RAB3A (P20336), RAB3GAP1 (Q15042), RAB3GAP2 (Q9H2M9), RAB4A (P20338), RAB5A (P20339), RAB5B (P61020), RAB5C (P51 148), RAB6A (P20340), RAB6B (Q9NRW1 ), RAB7A (P51 149), RAB8A (P61006), RAB8B (Q92930), RABAC1 (Q9UI 14), RABGAP1

(Q9Y3P9), RABGGTA (Q92696), RABGGTB (P53611), RABIF (P47224), RAC1 (P63000), RAD1 (060671), RAD50 (Q92878), RAE1 (P78406), RAI 14 (Q9P0K7), RALA (P1 1233), RALB (P11234), RALY (Q9UKM9), RAN (P62826), RANBP1 (P43487), RANBP2 (P49792), RANBP6 (060518), RANBP9 (Q96S59), RANGAP1 (P46060), RAP1A (P62834), RAP1 B (P61224), RAP1 GDS1 (P52306), RAP2B (P61225), RARS (P54136), RASA1 (P20936), RBBP4 (Q09028), RBBP5 (Q15291), RBBP7 (Q16576), RBBP9 (075884), RBM 12 (Q9NTZ6), RBM15 (Q96T37), RBM17 (Q96I25), RBM22 (Q9NW64), RBM4 (Q9BWF3), RBMX (P38159), RBP1 (P09455), RBPJ (Q06330), RBX1 (P62877), RCC1 (P18754), RCC2 (Q9P258), RCL (043598), RDX (P35241), RECQL (P46063), REEP5 (Q00765), REEP6 (Q96HR9), REPS1 (Q96D71), RFC4 (P35249), RFC5 (P40937), RFTN1 (Q14699), RHEB (Q15382), RHOA (P61586), RHOB (P62745), RHOC (P08134), RHOF (Q9HBH0), RHOG (P84095), RIC8A (Q9NPQ8), RMND5A (Q9H871), RNASEH2A (075792), RNASEH2C (Q8TDP1), RNF123 (Q5XPI4), RNF20 (Q5VTR2), RNF213 (Q63HN8), RNF7 (Q9UBF6), RNGTT (060942), RNH1 (P13489), RNMT (043148), RNPEP (Q9H4A4), R0BLD3 (Q9Y2Q5), R0CK1 (Q13464), R0CK2 (075116), R0R1 (Q01973), RP2 (075695), RPA1 (P27694), RPA2 (P15927), RPA3 (P35244), RPE (Q96AT9), RPF2 (Q9H7B2), RPL10 (P27635), RPL10A (P62906), RPL11 (P62913), RPL12 (P30050), RPL13 (P26373), RPL13A (P40429), RPL14 (P50914), RPL15 (P61313), RPL17 (P18621), RPL18 (Q07020), RPL18A (Q02543), RPL19 (P84098), RPL21 (P46778), RPL22 (P35268), RPL22L1 (Q6P5R6), RPL23 (P62829), RPL23A (P62750), RPL24 (P83731), RPL26 (P61254), RPL27 (P61353), RPL27A (P46776), RPL28 (P46779), RPL3 (P39023), RPL30 (P62888), RPL31 (P62899), RPL32 (P62910), RPL34 (P49207), RPL35 (P42766), RPL35A (P18077), RPL36 (Q9Y3U8), RPL36A (P83881), RPL36AL (Q969Q0), RPL37A (P61513), RPL38 (P63173), RPL4 (P36578), RPL5 (P46777), RPL6 (Q02878), RPL7 (P18124), RPL7A (P62424), RPL8 (P62917), RPL9 (P32969), RPLPO (P05388), RPLP1 (P05386), RPLP2 (P05387), RPP30 (P78346), RPP40 (075818), RPRD1A (Q96P16), RPS10 (P46783), RPS11 (P62280), RPS12 (P25398), RPS13 (P62277), RPS14 (P62263), RPS15 (P62841), RPS15A (P62244), RPS16 (P62249), RPS17 (P08708), RPS18 (P62269), RPS19 (P39019), RPS2 (P15880), RPS20 (P60866), RPS21 (P63220), RPS23 (P62266), RPS24 (P62847), RPS25 (P62851), RPS26 (P62854), RPS27 (P42677), RPS27A (P62979), RPS27L (Q71 UM5), RPS28 (P62857), RPS29 (P62273), RPS3 (P23396), RPS3A (P61247), RPS4X (P62701), RPS4Y1 (P22090), RPS5 (P46782), RPS6 (P62753), RPS6KA3 (P51812), RPS7 (P62081), RPS8 (P62241), RPS9 (P46781), RPSA (P08865), RQCD1 (Q92600), RRAGA (Q7L523), RRAS (P10301), RRAS2 (P62070), RRBP1 (Q9P2E9), RRM1 (P23921), RRM2 (P31350), RRM2B (Q7LG56), RRP12 (Q5JTH9), RRP9 (043818), RSL1 D1 (076021), RSU1 (Q15404), RTCD1 (000442), RTN3 (095197), RTN4 (Q9NQC3), RUVBL1 (Q9Y265), RUVBL2 (Q9Y230), RWDD2B (P57060), S100A10 (P60903), S100A11 (P31949), S100A13 (Q99584), S100A16 (Q96FQ6), S100A4 (P26447), S100A6 (P06703), S100A8 (P05109), SAAL1 (Q96ER3), SACS (Q9NZJ4), SAE1 (Q9UBE0), SAFB2 (Q14151), SAMHD1 (Q9Y3Z3), SAP 18 (000422), SAR1A (Q9NR31), SARM1 (Q6SZW1), SARS (P49591), SART3 (Q15020), SBDS (Q9Y3A5), SBF1 (095248), SCARB1 (Q8WTV0), SCARB2 (Q14108), SCFD1 (Q8WVM8), SCLY (Q96I15), SCP2 (P22307), SCPEP1 (Q9HB40), SCRG1 (075711), SCRIB (Q14160), SCRN1 (Q12765), SCRN2 (Q96FV2), SCYL1 (Q96KG9), SCYL2 (Q6P3W7), SDC1 (P18827), SDC2 (P34741), SDCBP (000560), SDF4 (Q9BRK5), SDHA (P31040), SDK1 (Q7Z5N4), SDSL (Q96GA7), SEC11A (P67812), SEC13 (P55735), SEC22B (075396), SEC23A (Q15436), SEC23B (Q15437), SEC23IP (Q9Y6Y8), SEC24A (095486), SEC24B (095487), SEC24C (P53992), SEC24D (094855), SEC31A (094979), SEH1 L (Q96EE3), SELH (Q8IZQ5), SEMA3A

(Q14563), SEPSECS (Q9HD40), 40787 (Q9NVA2), 37500 (Q15019), 38596 (Q99719), 39326 (Q16181), 39692 (Q92599), 40057 (Q9UHD8), SERBP1 (Q8NC51), SERPINA1 (P01009), SERPINA3 (P01011), SERPINA7 (P05543), SERPINB6 (P35237), SERPINB8 (P50452), SERPINE1 (P05121), SERPINE2 (P07093), SERPING1 (P05155), SERPINH1 (P50454), SETD3 (Q86TU7), SETD7 (Q8WTS6), SF3A1 (Q15459), SF3A2 (Q15428), SF3A3 (Q12874), SF3B1 (075533), SF3B14 (Q9Y3B4), SF3B2 (Q13435), SF3B3 (Q15393), SF3B4 (Q15427), SF3B5 (Q9BWJ5), SFPQ (P23246), SFRP4 (Q6FHJ7), SGTA (043765), SH3BP4 (Q9P0V3), SH3GL1 (Q99961), SH3GLB1 (Q9Y371), SHBG (P04278), SHC1 (P29353), SHMT1 (P34896), SHMT2 (P34897), SH0C2 (Q9UQ13), SHPK (Q9UHJ6), SKIV2L (Q15477), SKIV2L2 (P42285), SKP1 (P63208), SLC16A1 (P53985), SLC1A3 (P43003), SLC1A5 (Q15758), SLC29A1

(Q99808), SLC2A1 (P11166), SLC31A1 (015431), SLC3A2 (P08195), SLC44A2 (Q8IWA5), SLC5A3 (P53794), SLC7A5 (Q01650), SLC9A3R1 (014745), SLC9A3R2 (Q15599), SLIRP (Q9GZT3), SMAD4 (Q13485), SMARCA4 (P51532), SMARCA5 (060264), SMARCC1

(Q92922), SMARCC2 (Q8TAQ2), SMARCD1 (Q96GM5), SMARCD2 (Q92925), SMARCE1 (Q969G3), SMC1A (Q14683), SMC2 (095347), SMC3 (Q9UQE7), SMC4 (Q9NTJ3), SMC5 (Q8IY18), SMC6 (Q96SB8), SMCHD1 (A6NHR9), SMEK1 (Q6IN85), SMS (P52788), SMU1 (Q2TAY7), SMYD5 (Q6GMV2), SNAP23 (000161), SNAPIN (095295), SND1 (Q7KZF4), SNF8 (Q96H20), SNRNP200 (075643), SNRNP40 (Q96DI7), SNRPA1 (P09661), SNRPB (P14678), SNRPD1 (P62314), SNRPD2 (P62316), SNRPD3 (P62318), SNRPE (P62304), SNRPF (P62306), SNRPG (P62308), SNTB1 (Q13884), SNUPN (095149), SNX1 (Q13596), SNX12 (Q9UMY4), SNX17 (Q15036), SNX18 (Q96RF0), SNX2 (060749), SNX27 (Q96L92), SNX3 (060493), SNX5 (Q9Y5X3), SNX6 (Q9UNH7), SNX8 (Q9Y5X2), SNX9 (Q9Y5X1), S0D1 (P00441), SORD (Q00796), S0RT1 (Q99523), SPAG9 (060271), SPC24 (Q8NBT2), SPC25 (Q9HBM1), SPG21 (Q9NZD8), SPR (P35270), SPRYD4 (Q8WW59), SPTAN1 (Q13813), SPTBN1 (Q01082), SPTBN2 (015020), SRGAP2 (075044), SRI (P30626), SRM (P19623), SRP14 (P37108), SRP19 (P09132), SRP54 (P61011), SRP68 (Q9UHB9), SRP72 (076094), SRP9 (P49458), SRPX (P78539), SRPX2 (060687), SRR (Q9GZT4), SRRT (Q9BXP5), SRSF1 (Q07955), SRSF11 (Q05519), SRSF2 (Q01130), SRSF3 (P84103), SRSF6 (Q13247), SRSF7 (Q16629), SRSF9 (Q13242), SRXN1 (Q9BYN0), SSB (P05455), SSBP1 (Q04837), SSRP1 (Q08945), SSSCA1 (060232), ST13 (P50502), STAG2 (Q8N3U4), STAM (Q92783), STAMBP (095630), STAT1 (P42224), STAT3 (P40763), STIP1 (P31948), STK24 (Q9Y6E0), STK25 (000506), STK38L (Q9Y2H1), STOM (P27105), ST0N2 (Q8WXE9), STRAP (Q9Y3F4), STUB1 (Q9UNE7), STX12 (Q86Y82), STX4 (Q12846), STX5 (Q13190), STX7 (015400), STXBP1 (P61764), STXBP3 (000186), STYX (Q8WUJ0), SUB1 (P53999), SUDS3 (Q9H7L9), SUGT1 (Q9Y2Z0), SUM01 (P63165), SUPT16H (Q9Y5B9), SUPT4H1 (P63272), SUPT5H (000267), SUPT6H (Q7KZ85), SVEP1 (Q4LDE5), SWAP70 (Q9UH65), SYMPK (Q92797), SYNCRIP (060506), SYNE1 (Q8NF91), SYNE2 (Q8WXH0), SYNGR2 (043760), SYNJ2BP (P57105), TAB1 (Q15750), TAF9 (Q9Y3D8), TAF9 (Q16594), TAGLN (Q01995), TAGLN2 (P37802), TALD01 (P37837), TARDBP (Q13148), TARS (P26639), TATDN1 (Q6P1 N9), TAX1 BP3 (014907), TBC1 D13 (Q9NVG8), TBC1 D15 (Q8TC07), TBC1 D23 (Q9NUY8), TBC1 D24

(Q9ULP9), TBC1 D4 (060343), TBC1 D9B (Q66K14), TBCA (075347), TBCB (Q99426), TBCD (Q9BTW9), TBCE (Q15813), TBL1XR1 (Q9BZK7), TCEA1 (P23193), TCEB1 (Q15369), TCEB2 (Q15370), TCERG1 (014776), TCP1 (P17987), TDP2 (095551), TEP1 (Q99973), TEX10 (Q9NXF1), TF (P02787), TFCP2 (Q12800), TFG (Q92734), TFRC (P02786), TGFB1 (P01 137), TGFB2 (P61812), TGFBI (Q15582), TGM1 (P22735), TH1 L (Q8IXH7), THBS1 (P07996), THBS3 (P49746), THG1 L (Q9NWX6), TH0C2 (Q8NI27), TH0C3 (Q96J01), TH0C5 (Q13769), TH0C6 (Q86W42), TH0C7 (Q6I9Y2), TH0P1 (P52888), THUMPD1 (Q9NXG2), THY1

(P04216), THYN 1 (Q9P016), TIA1 (P31483), TIGAR (Q9NQ88), TIMM13 (Q9Y5L4), TIMM50 (Q3ZCQ8), TIMM8B (Q9Y5J9), TIMM9 (Q9Y5J7), TIMP1 (P01033), TIPRL (075663), TKT (P29401), TLN1 (Q9Y490), TLN2 (Q9Y4G6), TM9SF2 (Q99805), TM9SF3 (Q9HD45), TMED10 (P49755), TMED2 (Q15363), TMED7 (Q9Y3B3), TMED9 (Q9BVK6), TMEM167A (Q8TBQ9), TMEM2 (Q9UHN6), TMEM50B (P56557), TMEM87A (Q8NBN3), TM0D3 (Q9NYL9), TNC (P24821), TNP01 (Q92973), TNP02 (014787), TNP03 (Q9Y5L0), TOLLIP (Q9H0E2),

TOMM20 (Q15388), TOMM22 (Q9NS69), TOMM34 (Q15785), T0MM5 (Q8N4H5), TOMM70A (094826), T0P1 (P1 1387), T0P2B (Q02880), TOR 1 B (014657), TP53BP1 (Q12888), TP53RK (Q96S44), TPI1 (P60174), TPM3 (P06753), TPM3L (A6NL28), TPM4 (P67936), TPMT

(P51580), TPP1 (014773), TPP2 (P29144), TPR (P12270), TPRG1 L (Q5T0D9), TPRKB (Q9Y3C4), TPT1 (P13693), TRAF2 (Q12933), TRAP1 (Q12931), TRAPPC1 (Q9Y5R8), TRAPPC2L (Q9UL33), TRAPPC3 (043617), TRAPPC4 (Q9Y296), TRAPPC5 (Q8IUR0), TRAPPC6A (075865), TRAPPC6B (Q86SZ2), TRIM22 (Q8IYM9), TRIM25 (Q14258), TRIM28 (Q13263), TRIP12 (Q14669), TRIP13 (Q15645), TRIP6 (Q15654), TRMT1 (Q9NXH9),

TRMT1 12 (Q9UI30), TRMT5 (Q32P41), TRMT6 (Q9UJA5), TRMT61A (Q96FX7), TRNT1 (Q96Q1 1), TR0VE2 (P10155), TRRAP (Q9Y4A5), TSG101 (Q99816), TSKU (Q8WUA8), TSPAN14 (Q8NG11), TSPAN4 (014817), TSPAN5 (P62079), TSPAN6 (043657), TSPAN9 (075954), TSSC1 (Q53HC9), TSTA3 (Q13630), TTC1 (Q99614), TTC37 (Q6PGP7), TTC38 (Q5R3I4), TTC5 (Q8N0Z6), TTC9C (Q8N5M4), TTL (Q8NG68), TTLL12 (Q14166), TTN

(Q8WZ42), TTR (P02766), TTYH1 (Q9H313), TTYH2 (Q9BSA4), TTYH3 (Q9C0H2), TUBA1 B (P68363), TUBA1 C (Q9BQE3), TUBB (P07437), TUBB2A (Q13885), TUBB2B (Q9BVA1), TUBB2C (P68371), TUBB3 (Q13509), TUBB4 (P04350), TUBB6 (Q9BUF5), TUBG1 (P23258), TUBGCP2 (Q9BSJ2), TUBGCP3 (Q96CW5), TWF1 (Q12792), TWF2 (Q6IBS0), TXN (P10599), TXN DC 17 (Q9BRA2), TXNDC9 (014530), TXNL1 (043396), TXNL4B (Q9NX01), TXNRD1 (Q16881), TYMS (P04818), U2AF1 (Q01081), U2AF2 (P26368), UAP1 (Q16222), UBA1 (P22314), UBA2 (Q9UBT2), UBA3 (Q8TBC4), UBA5 (Q9GZZ9), UBA6 (A0AVT1), UBE2D1 (P51668), UBE2D3 (P61077), UBE2E1 (P51965), UBE2G2 (P60604), UBE2I (P63279), UBE2J2 (Q8N2K1), UBE2K (P61086), UBE2L3 (P68036), UBE2M (P61081), UBE2N (P61088), UBE20 (Q9C0C9), UBE2V1 (Q13404), UBE2V2 (Q15819), UBE2Z (Q9H832), UBE3A

(Q05086), UBE4A (Q14139), UBE4B (095155), UBL3 (095164), UBL4A (P1 1441), UBL5 (Q9BZL1), UBR1 (Q8IWV7), UBR4 (Q5T4S7), UBTD1 (Q9HAC8), UBXN1 (Q04323), UCHL1 (P09936), UCHL3 (P15374), UCHL5 (Q9Y5K5), UCK2 (Q9BZX2), UFC1 (Q9Y3C8), UFD1 L (Q92890), UFSP2 (Q9NUQ7), UGDH (060701), UGP2 (Q16851), UMPS (P1 1172), UNC119B (A6NIH7), UNC45A (Q9H3U1), UPF1 (Q92900), UPP1 (Q16831), UROD (P06132), UROS (P10746), US01 (060763), USP10 (Q14694), USP1 1 (P51784), USP14 (P54578), USP15 (Q9Y4E8), USP24 (Q9UPU5), USP39 (Q53GS9), USP5 (P45974), USP7 (Q93009), USP9X (Q93008), UTP15 (Q8TED0), UXS1 (Q8NBZ7), UXT (Q9UBK9), VAC 14 (Q08AM6), VAMP3 (Q15836), VAMP5 (095183), VAPA (Q9P0L0), VAPB (095292), VARS (P26640), VASN (Q6EMK4), VASP (P50552), VAT1 (Q99536), VAV2 (P52735), VBP1 (P61758), VCAN

(P1361 1), VCL (P18206), VCP (P55072), VIM (P08670), VPRBP (Q9Y4B6), VPS1 1 (Q9H270), VPS13C (Q709C8), VPS16 (Q9H269), VPS18 (Q9P253), VPS24 (Q9Y3E7), VPS25 (Q9BRG1), VPS26A (075436), VPS26B (Q4G0F5), VPS28 (Q9UK41), VPS29 (Q9UBQ0), VPS33A

(Q96AX1), VPS33B (Q9H267), VPS35 (Q96QK1), VPS36 (Q86VN1), VPS37B (Q9H9H4), VPS39 (Q96JC1), VPS45 (Q9NRW7), VPS4A (Q9UN37), VPS4B (075351), VPS53 (Q5VIR6), VRK1 (Q99986), VTA1 (Q9NP79), VWA1 (Q6PCB0), VWA5A (000534), WARS (P23381), WASF1 (Q92558), WASL (000401), WDFY1 (Q8IWB7), WDR1 (075083), WDR11 (Q9BZH6), WDR12 (Q9GZL7), WDR18 (Q9BV38), WDR26 (Q9H7D7), WDR33 (Q9C0J8), WDR4

(P57081), WDR43 (Q15061), WDR45L (Q5MNZ6), WDR48 (Q8TAF3), WDR5 (P61964), WDR54 (Q9H977), WDR55 (Q9H6Y2), WDR59 (Q6PJI9), WDR6 (Q9NNW5), WDR61

(Q9GZS3), WDR73 (Q6P4I2), WDR77 (Q9BQA1), WDR82 (Q6UXN9), WDR91 (A4D1 P6), WDR92 (Q96MX6), WNK1 (Q9H4A3), XPNPEP1 (Q9NQW7), XP01 (014980), XP04

(Q9C0E2), XP05 (Q9HAV4), XP06 (Q96QU8), XP07 (Q9UIA9), XPOT (043592), XRCC1 (P18887), XRCC5 (P13010), XRCC6 (P12956), XRN2 (Q9H0D6), YARS (P54577), YBX1 (P67809), YEATS4 (095619), YES1 (P07947), YIPF4 (Q9BSR8), YKT6 (015498), YPEL5 (P62699), YRDC (Q86U90), YTHDF2 (Q9Y5A9), YWHAB (P31946), YWHAE (P62258), YWHAG (P61981), YWHAH (Q04917), YWHAQ (P27348), YWHAZ (P63104), ZC3HAV1 L (Q96H79), ZCCHC3 (Q9NUD5), ZER1 (Q7Z7L7), ZFPL1 (095159), ZFR (Q96KR1), ZMAT2 (Q96NC0), ZNF259 (075312), ZW10 (043264), ZWILCH (Q9H900), ZYG1 1 B (Q9C0D3), ZYX (Q15942), ZZEF1 (043149).

Table 18: Gene names and SWISSPROT accession numbers of all 2572 proteins identified in CTX0E03 exosomes (listed in alphabetical order of gene name).

Heat shock cognate 71 kDa protein P11 142

Haptoglobin P00738

Heat shock protein HSP 90-alpha P07900

Phosphoglycerate kinase 1 P00558

Actin, alpha cardiac muscle 1 P68032

40S ribosomal protein S3 P23396

Elongation factor 1 -alpha 1 P68104

GTP-binding nuclear protein Ran P62826

Histone H2B type 1 -M Q99879

Peptidyl-prolyl cis-trans isomerase A P62937

Profilin-1 P07737

Elongation factor 2 P 13639

Fatty acid synthase P49327

Tubulin beta-2C chain P68371

Tubulin alpha-I B chain P68363

Tubulin beta chain P07437

40S ribosomal protein S11 P62280

Eukaryotic initiation factor 4A-I P60842

T-complex protein 1 subunit theta P50990

14-3-3 protein theta P27348

40S ribosomal protein S18 P62269

Tubulin beta-3 chain Q13509

T-complex protein 1 subunit beta P78371

40S ribosomal protein S16 P62249

Heat shock 70 kDa protein 1A/1 B P08107

Histone H3.2 Q71 DI3

Transketolase P29401

40S ribosomal protein SA P08865

Clusterin P10909

Fatty acid-binding protein, brain 015540

Hemopexin P02790

T-complex protein 1 subunit gamma P49368

Tubulin beta-2B chain Q9BVA1

Adenosylhomocysteinase P23526

T-complex protein 1 subunit eta Q99832

40S ribosomal protein S15a P62244

T-complex protein 1 subunit delta P50991

Vimentin P08670

Guanine nucleotide-binding protein subunit beta-2- P63244 like 1

Dihydropyrimidinase-related protein 3 Q14195

Elongation factor 1 -gamma P26641

Fascin Q 16658

Creatine kinase B-type P12277

X-ray repair cross-complementing protein 5 P13010

40S ribosomal protein S2 P15880

Histone H2A type 2-A Q6FI 13 40S ribosomal protein S4, X isoform P62701

14-3-3 protein zeta/delta P63104

Heterogeneous nuclear nbonucleoprotein A1 P09651

CD81 antigen P60033

Keratin, type I cytoskeletal 14 P02533

ATP-citrate synthase P53396

40S ribosomal protein S9 P46781

Transgelin-2 P37802

Fructose-bisphosphate aldolase A P04075

Ubiquitin-like modifier-activating enzyme 1 P22314

Peroxiredoxin-1 Q06830

40S ribosomal protein S5 P46782

T-complex protein 1 subunit epsilon P48643

60S ribosomal protein L30 P62888

T-complex protein 1 subunit alpha P17987

60S ribosomal protein L12 P30050

Cofilin-1 P23528

Heterogeneous nuclear ribonucleoproteins A2/B1 P22626

Eukaryotic translation initiation factor 5A-1 P63241

Phosphoglycerate mutase 1 P 18669

Clathrin heavy chain 1 Q00610

Dihydropyrimidinase-related protein 2 Q16555

60S ribosomal protein L35a P18077

T-complex protein 1 subunit zeta P40227

Carbonyl reductase [NADPH] 1 P16152

40S ribosomal protein S3a P61247

Ferritin heavy chain P02794

Annexin A2 P07355

Myosin light polypeptide 6 P60660

Major vault protein Q 14764

Heterogeneous nuclear nbonucleoprotein DO Q14103

60S acidic ribosomal protein P0 P05388

X-ray repair cross-complementing protein 6 P12956

40S ribosomal protein S20 P60866

Protein arginine N-methyltransferase 1 Q99873

40S ribosomal protein S10 P46783

Transaldolase P37837

Histone H2B type 1 - P23527

Triosephosphate isomerase P60174

Protein S100-A6 P06703

40S ribosomal protein S17 P08708

CD9 antigen P21926

Filamin-A P21333

Peptidyl-prolyl cis-trans isomerase FKBP4 Q02790

Programmed cell death 6-interacting protein Q8WUM4

Glutathione S-transferase P P0921 1 14-3-3 protein epsilon P62258

Table 19: 100 most abundant proteins (name and SwissProt accession number) observed in CTX0E03 exosomes

Microvesicles

2940 proteins were identified by Mass spectrometry in Microvesicles isolated from the initial stages of an Integra culture (week 2) and purified by centrifugation at 10,000 x g. The gene names and corresponding SWISSPROT accession numbers (in brackets) of all 2940 proteins are listed in Table 20 (in alphabetical order of gene name) and the 100 most abundant proteins are listed in Table 21 , in order of decreasing abundance.

A1 BG (P04217), AACS (Q86V21), AAMP (Q13685), AARS (P49588), AARSD1 (Q9BTE6), AASDHPPT (Q9NRN7), ABCA3 (Q99758), ABCC1 (P33527), ABCC4 (015439), ABCE1 (P61221), ABCF1 (Q8NE71), ABCF2 (Q9UG63), ABCF3 (Q9NUQ8), ABHD14B (Q96IU4), ABI1 (Q8IZP0), ABR (Q12979), ACAA1 (P09110), ACAA2 (P42765), ACACA (Q13085), ACADM (P11310), ACADVL (P49748), ACAT1 (P24752), ACAT2 (Q9BWD1), ACBD6 (Q9BR61), ACBD7 (Q8N6N7), ACLY (P53396), AC01 (P21399), AC02 (Q99798), ACOT1 (Q86TX2), ACOT13 (Q9NPJ3), ACOT7 (000154), ACOX1 (Q15067), ACOX3 (015254), ACP1 (P24666), ACSL1 (P33121), ACSL3 (095573), ACSL4 (060488), ACSS2 (Q9NR19), ACTC1 (P68032), ACTG1 (P63261), ACTL6A (096019), ACTN1 (P12814), ACTN4 (043707), ACTR10 (Q9NZ32), ACTR1A (P61 163), ACTR1 B (P42025), ACTR2 (P61 160), ACTR3 (P61 158), ACY1 (Q03154), ADAM 10 (014672), ADAM9 (Q13443), ADAMTS15 (Q8TE58), ADAMTS16 (Q8TE57), ADAR (P55265), ADD1 (P3561 1), ADD3 (Q9UEY8), ADH5 (P1 1766), ADK (P55263), ADO (Q96SZ5), ADPRH (P54922), ADRBK1 (P25098), ADRM1 (Q16186), ADSL (P30566), ADSS (P30520), AEBP1 (Q8IUX7), AFM (P43652), AGL (P35573), AGPS (000116), AGRN (000468), AHCY (P23526), AHCYL1 (043865), AHNAK (Q09666), AHNAK2 (Q8IVF2), AHSA1 (095433), AHSG (P02765), AIDA (Q96BJ3), AIFM1 (095831), AIMP1 (Q12904), AIMP2 (Q13155), AIP (000170), AK1 (P00568), AK2 (P54819), AK3 (Q9UIJ7), AK4 (P27144), AKAP12 (Q02952), AKAP9 (Q99996), AKR1A1 (P14550), AKR1 B1 (P15121), AKR1 C1 (Q04828), AKR7A2 (043488), AKR7A3 (095154), AKT1 (P31749), ALCAM (Q13740), ALDH16A1 (Q8IZ83), ALDH18A1 (P54886), ALDH2 (P05091), ALDH3A1 (P30838), ALDH7A1 (P49419), ALDH9A1 (P49189), ALDOA (P04075), ALDOC (P09972), ALKBH2 (Q6NS38), ALOX12B (075342), AMDHD2 (Q9Y303), AMPD2 (Q01433), ANAPC1 (Q9H1A4), ANAPC4 (Q9UJX5), ANAPC5 (Q9UJX4), ANAPC7 (Q9UJX3), ANKFY1 (Q9P2R3), ANKRD17 (075179), ANKRD28 (015084), ANKRD52 (Q8NB46), ANP32A (P39687), ANP32B (Q92688), ANP32E (Q9BTT0), ANXA1 (P04083), ANXA11 (P50995), ANXA2 (P07355), ANXA3 (P12429), ANXA4 (P09525), ANXA5 (P08758), ANXA6 (P08133), ANXA7 (P20073), AP1 B1 (Q10567), AP1 G1 (043747), AP1 M1 (Q9BXS5), AP1 S2 (P56377), AP2A1 (095782), AP2A2 (094973), AP2B1 (P63010), AP2M1 (Q96CW1 ), AP2S1 (P53680), AP3B1 (000203), AP3D1 (014617), AP3M1 (Q9Y2T2), AP3S1 (Q92572), AP4S1 (Q9Y587), APEH (P13798), APEX1 (P27695), API5 (Q9BZZ5), APIP (Q96GX9), APMAP (Q9HDC9), AP0A2 (P02652), AP0BEC3C (Q9NRW3), APOH (P02749), AP0L2 (Q9BQE5), APPL1 (Q9UKG1), APRT (P07741), AQR (060306), ARAF (P10398), ARCN1 (P48444), ARF1 (P84077), ARF4 (P18085), ARF6 (P62330), ARFGAP2 (Q8N6H7), ARFIP1 (P53367), ARFIP2 (P53365), ARG1 (P05089), ARHGAP1 (Q07960), ARHGAP5 (Q13017), ARHGDIA (P52565), ARHGEF1 (Q92888), ARHGEF10 (015013), ARHGEF6 (Q15052), ARHGEF7 (Q14155), ARIH1 (Q9Y4X5), ARIH2 (095376), ARL1 (P40616), ARL2 (P36404), ARL3 (P36405), ARL6IP1 (Q15041), ARL8A (Q96BM9), ARL8B (Q9NVJ2), ARMC10 (Q8N2F6), ARMC6 (Q6NXE6), ARMC8 (Q8IUR7), ARMC9 (Q7Z3E5), ARPC1A (Q92747), ARPC1 B (015143), ARPC2 (015144), ARPC3 (015145), ARPC4 (P59998), ARPC5 (01551 1), ARPC5L (Q9BPX5), ASAH1 (Q13510), ASCC1 (Q8N9N2), ASCC3 (Q8N3C0), ASMTL (095671), ASNA1 (043681), ASNS (P08243), ASPSCR1 (Q9BZE9), ASS1 (P00966), ATAD3A (Q9NVI7), ATE1 (095260), ATG101 (Q9BSB4), ATG16L1 (Q676U5), ATG3 (Q9NT62), ATG4B (Q9Y4P1), ATG7 (095352), ATIC (P31939), ATL3 (Q6DD88), ATM (Q13315), AT0X1 (000244), ATP1A1 (P05023), ATP1 B1 (P05026), ATP1 B3 (P54709), ATP2A2 (P16615), ATP2B1 (P20020), ATP2B4 (P23634), ATP5A1 (P25705), ATP5B (P06576), ATP5C1 (P36542), ATP5E (P56381), ATP5F1 (P24539), ATP5H (075947), ATP5I (P56385), ATP5L (075964), ATP50 (P48047), ATP6AP1 (Q15904), ATP6AP2 (075787), ATP6V0A1 (Q93050), ATP6V0D1 (P61421), ATP6V1A (P38606), ATP6V1 B2 (P21281), ATP6V1C1 (P21283), ATP6V1 D (Q9Y5K8), ATP6V1 E1 (P36543), ATP6V1G1 (075348), ATP6V1 H (Q9UI 12), ATR (Q13535), ATRN (075882), ATXN10 (Q9UBB4), B2M (P61769), B3GAT3 (094766), B3GNT1 (043505), BAG2 (095816), BAG5 (Q9UL15), BAIAP2 (Q9UQB8), BANF1 (075531), BAT1 (Q13838), BAT3 (P46379), BCAM (P50895), BCAS2 (075934), BCAT1 (P54687), BCCIP (Q9P287), BCL2L12 (Q9HB09), BDH2 (Q9BUT1), BICD2 (Q8TD16), BLMH (Q13867), BLVRA (P53004), BLVRB (P30043), BMP1 (P13497), B0LA2 (Q9H3K6), B0P1 (Q14137), BPGM (P07738), BPNT1 (095861), BRCC3 (P46736), BRE (Q9NXR7), BRIX1 (Q8TDN6), BROX (Q5VW32), BRP16L (P0CB43), BSG (P35613), BST1 (Q10588), BTAF1 (014981), BUB3 (043684), BUD31 (P41223), BYSL (Q13895), BZW1 (Q7L1 Q6), BZW2 (Q9Y6E2), C10orf119 (Q9BTE3), C10orf58 (Q9BRX8), C10orf76 (Q5T2E6), C11 orf54 (Q9H0W9), C11 orf68 (Q9H3H3), C12orf10 (Q9HB07), C12orf57 (Q99622), C14orf149 (Q96EM0), C14orf166 (Q9Y224), C14orf21 (Q86U38), C15orf58 (Q6ZNW5), C16orf13 (Q96S19), C16orf61 (Q9NRP2), C16orf80 (Q9Y6A4), C18orf21 (Q32NC0), C18orf8 (Q96DM3), C1 orf123 (Q9NWV4), C1orf128 (Q9GZP4), C1 orf57 (Q9BSD7), C20orf11 (Q9NWU2), C20orf4 (Q9Y312), C21orf33 (P30042), C21orf59 (P57076), C22orf28 (Q9Y3I0), C3orf10 (Q8WUW1), C3orf26 (Q9BQ75), C3orf75 (Q0PNE2), C4orf27 (Q9NWY4), C4orf41 (Q7Z392), C4orf43 (Q96EY4), C5orf33 (Q4G0N4), C6orf211 (Q9H993), C7orf28B (P86790), C7orf50 (Q9BRJ6), C7orf59 (Q0VGL1), C8orf33 (Q9H7E9), C9orf142 (Q9BUH6), C9orf23 (Q8N5L8), C9orf41 (Q8N4J0), C9orf64 (Q5T6V5), CA11 (075493), CA12 (043570), CA2 (P00918), CAB39 (Q9Y376), CACNA2D1 (P54289), CACYBP (Q9HB71), CAD (P27708), CADM1 (Q9BY67), CADM4 (Q8NFZ8), CALB1 (P05937), CALD1 (Q05682), CALM1 (P62158), CALR (P27797), CALU (043852), CAMK1 (Q14012), CAMK2D (Q13557), CAMKV (Q8NCB2), CAND1 (Q86VP6), CANX (P27824), CAP1 (Q01518), CAPN1 (P07384), CAPN2 (P17655), CAPN5 (015484), CAPN7 (Q9Y6W3), CAPNS1 (P04632), CAPRIN1 (Q14444), CAPS (Q13938), CAPZA1 (P52907), CAPZA2 (P47755), CAPZB (P47756), CARHSP1 (Q9Y2V2), CARKD (Q8IW45), CARM1 (Q86X55), CARS (P49589), CASK (014936), CASP14 (P31944), CASP3 (P42574), CASP7 (P55210), CAT (P04040), CBFB (Q13951), CBR1 (P16152), CBR3 (075828), CBS (P35520), CBX1 (P83916), CBX3 (Q13185), CBX5 (P45973), CC2D1A (Q6P1 N0), CCAR1 (Q8IX12), CCBL2 (Q6YP21), CCDC102B (Q68D86), CCDC22 (060826), CCDC25 (Q86WR0), CCDC93 (Q567U6), CCND2 (P30279), CCNY (Q8ND76), CCT2 (P78371), CCT3 (P49368), CCT4 (P50991), CCT5 (P48643), CCT6A (P40227), CCT7 (Q99832), CCT8 (P50990), CD109 (Q6YHK3), CD151 (P48509), CD276 (Q5ZPR3), CD44 (P16070), CD46 (P15529), CD47 (Q08722), CD58 (P19256), CD59 (P13987), CD63 (P08962), CD81 (P60033), CD9 (P21926), CD97 (P48960), CD99 (P14209), CDC123 (075794), CDC16 (Q13042), CDC23 (Q9UJX2), CDC34 (P49427), CDC37 (Q16543), CDC40 (060508), CDC42 (P60953), CDC42BPB (Q9Y5S2), CDC5L (Q99459), CDCP1 (Q9H5V8), CDH2 (P19022), CDK1 (P06493), CDK2 (P24941), CDK4 (P11802), CDK5 (Q00535), CDK5RAP3 (Q96JB5), CDK7 (P50613), CDKN2A (P42771), CDKN2AIP (Q9NXV6), CECR5 (Q9BXW7), CELF1 (Q92879), CELSR1 (Q9NYQ6), CELSR2 (Q9HCU4), CFL1 (P23528), CFL2 (Q9Y281), CHCHD3 (Q9NX63), CHD4 (Q14839), CHEK2 (096017), CHERP (Q8IWX8), CHID1 (Q9BWS9), CHMP1A (Q9HD42), CHMP1 B (Q7LBR1), CHMP2A (043633), CHMP4A (Q9BY43), CHMP4B (Q9H444), CHMP5 (Q9NZZ3), CHMP6 (Q96FZ7), CHN1 (P15882), CH0RDC1 (Q9UHD1), CHP (Q99653), CHRAC1 (Q9NRG0), CHST3 (Q7LGC8), CIA01 (076071), CIAPIN1 (Q6FI81), CIRBP (Q14011), CIRH1A (Q969X6), CISD2 (Q8N5K1), CKAP4 (Q07065), CKAP5 (Q14008), CKB (P12277), CLASP1 (Q7Z460), CLIC1 (000299), CLIC4 (Q9Y696), CLLD6 (Q5W111), CLNS1A (P54105), CLPB (Q9H078), CLTA (P09496), CLTC (Q00610), CLTCL1 (P53675), CLU (P10909), CMBL (Q96DG6), CMC1 (Q7Z7K0), CMPK1 (P30085), CMTM6 (Q9NX76), CNBP (P62633), CNDP2 (Q96KP4), CNN2 (Q99439), CNN3 (Q15417), CNNM3 (Q8NE01), CN0T1 (A5YKK6), CNOT10 (Q9H9A5), CN0T6L (Q96LI5), CNP (P09543), COASY (Q13057), COBRA 1 (Q8WX92), C0G1 (Q8WTW3), C0G3 (Q96JB2), C0G4 (Q9H9E3), C0G5 (Q9UP83), C0G6 (Q9Y2V7), C0L11A1 (P12107), C0L14A1 (Q05707), C0L18A1 (P39060), C0L6A1 (P12109), COMMD10 (Q9Y6G5), C0MMD2 (Q86X83), C0MMD3 (Q9UBI1), C0MMD5 (Q9GZQ3), C0MMD8 (Q9NX08), C0MMD9 (Q9P000), COMT (P21964), COPA (P53621), C0PB1 (P53618), C0PB2 (P35606), COPE (014579), COPG (Q9Y678), C0PG2 (Q9UBF2), C0PS2 (P61201), C0PS3 (Q9UNS2), COPS4 (Q9BT78), COPS5 (Q92905), COPS6 (Q7L5N1), COPS7A (Q9UBW8), COPS7B (Q9H9Q2), COPS8 (Q99627), COR01 B (Q9BR76), COR01C (Q9ULV4), COR02B (Q9UQ03), COR07 (P57737), COTL1 (Q14019), COX4NB (043402), COX5A (P20674), COX5B (P10606), COX6C (P09669), CP (P00450), CPD (075976), CPNE1 (Q99829), CPNE2 (Q96FN4), CPNE3 (075131), CPNE4 (Q96A23), CPNE7 (Q9UBL6), CPOX (P36551), CPSF1 (Q10570), CPSF2 (Q9P2I0), CPSF3 (Q9UKF6), CPSF3L (Q5TA45), CPSF6 (Q16630), CPSF7 (Q8N684), CPXM1 (Q96SM3), CRABP2 (P29373), CRIP2 (P52943), CRK (P46108), CRLF3 (Q8IUI8), CRNKL1 (Q9BZJ0), CRTAP (075718), CRYAB (P02511), CRYM (Q14894), CRYZ (Q08257), CRYZL1 (095825), OS (075390), CSDE1 (075534), CSE1 L (P55060), CSK (P41240), CSNK1A1 (P48729), CSNK2A1 (P68400), CSNK2A2 (P19784), CSNK2B (P67870), CSRP1 (P21291), CSRP2 (Q16527), CSTB (P04080), CSTF1 (Q05048), CSTF2T (Q9H0L4), CSTF3 (Q12996), CTBP1 (Q13363), CTBP2 (P56545), CTNNA1 (P35221), CTNNAL1 (Q9UBT7), CTNNB1 (P35222), CTNNBL1 (Q8WYA6), CTNND1 (060716), OTPS (P17812), CTPS2 (Q9NRF8), CTR9 (Q6PD62), CTSC (P53634), CTSD (P07339), CTSF (Q9UBX1), CTSL2 (060911), CTTN (Q14247), CTU1 (Q7Z7A3), CUL1 (Q13616), CUL2 (Q13617), CUL3 (Q13618), CUL4A (Q13619), CUL4B (Q13620), CUL5 (Q93034), CUL7 (Q14999), CXADR (P78310), CXCL14 (095715), CXorf26 (Q9BVG4), CXorf38 (Q8TB03), CYB5R3 (P00387), CYC1 (P08574), CYCS (P99999), CYFIP1 (Q7L576), CYFIP2 (Q96F07), CYR61 (000622), DAB1 (075553), DAD1 (P61803), DAG1 (Q14118), DAK (Q3LXA3), DAPK3 (043293), DARS (P14868), DAZAP1 (Q96EP5), DBI (P07108), DBN1 (Q16643), DBNL (Q9UJU6), DCAF7 (P61962), DCAF8 (Q5TAQ9), DCBLD2 (Q96PD2), DCK (P27707), DCLK1 (015075), DCPS (Q96C86), DCTD (P32321), DCTN1 (Q14203), DCTN2 (Q13561), DCTN3 (075935), DCTN4 (Q9UJW0), DCTN5 (Q9BTE1), DCTN6 (000399), DCUN1 D1 (Q96GG9), DCUN1 D3 (Q8IWE4), DCUN1 D5 (Q9BTE7), DCXR (Q7Z4W1), DDA1 (Q9BW61), DDAH1 (094760), DDAH2 (095865), DDB1 (Q16531), DDB2 (Q92466), DDI2 (Q5TDH0), DDOST (P39656), DDR1 (Q08345), DDT (P30046), DDX1 (Q92499), DDX17 (Q92841), DDX18 (Q9NVP1), DDX19A (Q9NUU7), DDX20 (Q9UHI6), DDX21 (Q9NR30), DDX23 (Q9BUQ8), DDX24 (Q9GZR7), DDX27 (Q96GQ7), DDX39 (000148), DDX3X (000571), DDX46 (Q7L014), DDX47 (Q9H0S4), DDX49 (Q9Y6V7), DDX5 (P17844), DDX50 (Q9BQ39), DDX51 (Q8N8A6), DDX52 (Q9Y2R4), DDX54 (Q8TDD1), DDX55 (Q8NHQ9), DDX56 (Q9NY93), DDX6 (P26196), DECR1 (Q16698), DECR2 (Q9NUI1), DEF (Q68CQ4), DEK (P35659), DENR (043583), DERA (Q9Y315), DFFA (000273), DFFB (076075), DHCR24 (Q15392), DHCR7 (Q9UBM7), DHFR (P00374), DHPS (P49366), DHRS11 (Q6UWP2), DHRS4 (Q9BTZ2), DHX15 (043143), DHX16 (060231), DHX29 (Q7Z478), DHX30 (Q7L2E3), DHX32 (Q7L7V1), DHX36 (Q9H2U1), DHX37 (Q8IY37), DHX38 (Q92620), DHX9 (Q08211), DIAPH1 (060610), DIAPH2 (060879), DIMT1 L (Q9UNQ2), DIP2A (Q14689), DIP2B (Q9P265), DIP2C (Q9Y2E4), DIS3 (Q9Y2L1), DIS3L2 (Q8IYB7), DKC1 (060832), DLAT (P10515), DLD (P09622), DLG1 (Q12959), DLGAP4 (Q9Y2H0), DLST (P36957), DMD (P11532), DNAJA1 (P31689), DNAJA2 (060884), DNAJB1 (P25685), DNAJB11 (Q9UBS4), DNAJB4 (Q9UDY4), DNAJB6 (075190), DNAJC13 (075165), DNAJC2 (Q99543), DNAJC3 (Q13217), DNAJC7 (Q99615), DNASE1 L1 (P49184), DNM1 (Q05193), DNM1 L (000429), DNM2 (P50570), DNMT1 (P26358), DNPEP (Q9ULA0), D0CK1 (Q14185), D0CK4 (Q8N1 I0), D0CK5 (Q9H7D0), D0CK7 (Q96N67), D0CK9 (Q9BZ29), DOHH (Q9BU89), DPCD (Q9BVM2), DPH2 (Q9BQC3), DPH5 (Q9H2P9), DPMI (060762), DPM3 (Q9P2X0), DPP3 (Q9NY33), DPP9 (Q86TI2), DPY30 (Q9C005), DPYSL2 (Q16555), DPYSL3 (Q14195), DPYSL4 (014531), DPYSL5 (Q9BPU6), DRG1 (Q9Y295), DRG2 (P55039), DSC1 (Q08554), DSG1 (Q02413), DSP (P15924), DST (Q03001), DSTN (P60981), DTD1 (Q8TEA8), DTNA (Q9Y4J8), DTYMK (P23919), DUS2L (Q9NX74), DUS3L (Q96G46), DUSP12 (Q9UNI6), DUSP3 (P51452), DYM (Q7RTS9), DYNC1 H1 (Q14204), DYNC1 I2 (Q13409), DYNC1 LI1 (Q9Y6G9), DYNC1 LI2 (043237), DYNC2H1 (Q8NCM8), DYNLL1 (P63167), DYNLL2 (Q96FJ2), DYNLRB1 (Q9NP97), DYNLT1 (P63172), EBNA1 BP2 (Q99848), ECE1 (P42892), ECHDC1 (Q9NTX5), ECHS1 (P30084), ECM29 (Q5VYK3), EDC3 (Q96F86), EDC4 (Q6P2E9), EEA1 (Q15075), EEF1A1 (P68104), EEF1 B2 (P24534), EEF1 D (P29692), EEF1 E1 (043324), EEF1G (P26641), EEF2 (P13639), EEF2K (000418), EEFSEC (P57772), EFEMP2 (095967), EFHD2 (Q96C19), EFTUD1 (Q7Z2Z2), EFTUD2 (Q15029), EGFR (P00533), EHD1 (Q9H4M9), EHD2 (Q9NZN4), EHD3 (Q9NZN3), EHD4 (Q9H223), EIF1AX (P47813), EIF2A (Q9BY44), EIF2AK2 (P19525), EIF2AK4 (Q9P2K8), EIF2B1 (Q14232), EIF2B2 (P49770), EIF2B3 (Q9NR50), EIF2B4 (Q9UI10), EIF2B5 (Q13144), EIF2C1 (Q9UL18), EIF2C2 (Q9UKV8), EIF2S1 (P05198), EIF2S2 (P20042), EIF2S3 (P41091 ), EIF3A (Q14152), EIF3B (P55884), EIF3C (Q99613), EIF3D (015371), EIF3E (P60228), EIF3F (000303), EIF3G (075821), EIF3H (015372), EIF3I (Q13347), EIF3J (075822), EIF3K (Q9UBQ5), EIF3L (Q9Y262), EIF3M (Q7L2H7), EIF4A1 (P60842), EIF4A2 (Q14240), EIF4A3 (P38919), EIF4E (P06730), EIF4G1 (Q04637), EIF4G2 (P78344), EIF4H (Q15056), EIF5 (P55010), EIF5A (P63241), EIF5B (060841), EIF6 (P56537), ELAC2 (Q9BQ52), ELAVL1 (Q15717), ELM02 (Q96JJ3), ELP2 (Q6IA86), ELP3 (Q9H9T3), EMD (P50402), EMG1 (Q92979), EML1 (000423), EML2 (095834), EML3 (Q32P44), EML4 (Q9HC35), ENAH (Q8N8S7), ENC1 (014682), EN01 (P06733), EN02 (P09104), EN0PH1 (Q9UHY7), ENY2 (Q9NPA8), EPB41 L2 (043491), EPB41 L3 (Q9Y2J2), EPDR1 (Q9UM22), EPHA2 (P29317), EPHB2 (P29323), EPHB3 (P54753), EPHB4 (P54760), EPHX1 (P07099), EPM2AIP1 (Q7L775), EPN1 (Q9Y6I3), EPRS (P07814), ERBB2IP (Q96RT1), ERGIC1 (Q969X5), ERH (P84090), ERI1 (Q8IV48), ERI3 (043414), ERLIN2 (094905), ER01 L (Q96HE7), ERP29 (P30040), ERP44 (Q9BS26), ESD (P10768), ESYT1 (Q9BSJ8), ETF1 (P62495), ETFA (P13804), ETFB (P38117), EX0C1 (Q9NV70), EX0C2 (Q96KP1), EX0C3 (060645), EX0C4 (Q96A65), EX0C5 (000471), EX0C6 (Q8TAG9), EX0C6B (Q9Y2D4), EX0C7 (Q9UPT5), EX0C8 (Q8IYI6), EX0SC1 (Q9Y3B2), EXOSC10 (Q01780), EX0SC2 (Q13868), EX0SC3 (Q9NQT5), EX0SC4 (Q9NPD3), EX0SC5 (Q9NQT4), EX0SC6 (Q5RKV6), EX0SC7 (Q15024), EX0SC8 (Q96B26), EX0SC9 (Q06265), EZR (P15311), F11 R (Q9Y624), F8 (P00451), F8A1 (P23610), FABP5 (Q01469), FABP7 (015540), FADD (Q13158), FAH (P16930), FAHD1 (Q6P587), FAHD2A (Q96GK7), FAM 115A (Q9Y4C2), FAM 120A (Q9NZB2), FAM 125A (Q96EY5), FAM127A (A6ZKI3), FAM 129A (Q9BZQ8), FAM 129B (Q96TA1), FAM 136A (Q96C01), FAM 175B (Q15018), FAM3C (Q92520), FAM45B (Q6NSW5), FAM49B (Q9NUQ9), FAM82B (Q96DB5), FAM84B (Q96KN1), FAM96B (Q9Y3D0), FAM98A (Q8NCA5), FAM98B (Q52LJ0), FANCI (Q9NVI 1), FAR1 (Q8WVX9), FARP1 (Q9Y4F1), FARP2 (094887), FARSA (Q9Y285), FARSB (Q9NSD9), FAS (P25445), FASN (P49327), FAT1 (Q14517), FAU (P62861), FBL (P22087), FBLN2 (P98095), FBN1 (P35555), FBN2 (P35556), FBXL18 (Q96ME1), FBX021 (094952), FBX022 (Q8NEZ5), FBXW11 (Q9UKB1), FCF1 (Q9Y324), FDFT1 (P37268), FDPS (P14324), FDXR (P22570), FEN1 (P39748), FERMT1 (Q9BQL6), FERMT2 (Q96AC1), FFR (Q9UID3), FGFBP3 (Q8TAT2), FH (P07954), FHL1 (Q13642), FHL2 (Q14192), FHL3 (Q13643), FIBP (043427), FKBP10 (Q96AY3), FKBP1A (P62942), FKBP2 (P26885), FKBP3 (Q00688), FKBP4 (Q02790), FKBP5 (Q13451), FLG (P20930), FLG2 (Q5D862), FLU (Q13045), FLNA (P21333), FLNB (075369), FLNC (Q14315), FL0T1 (075955), FL0T2 (Q14254), FMNL2 (Q96PY5), FN3K (Q9H479), FN3KRP (Q9HA64), FNTA (P49354), FNTB (P49356), F0LR1 (P15328), FREM2 (Q5SZK8), FRG1 (Q14331), FRMD5 (Q7Z6J6), FRMD8 (Q9BZ67), FRYL (094915), FSCN1 (Q16658), FSD1 (Q9BTV5), FTH1 (P02794), FTL (P02792), FTO (Q9C0B1), FTSJD2 (Q8N1 G2), FUBP1 (Q96AE4), FUBP3 (Q96I24), FUCA2 (Q9BTY2), FUK (Q8N0W3), FUS (P35637), FXR1 (P511 14), FXR2 (P511 16), FYC01 (Q9BQS8), FYN (P06241), G3BP1 (Q13283), G3BP2 (Q9UN86), G6PD (P11413), GAA (P10253), GALK1 (P51570), GALK2 (Q01415), GALNT1 (Q10472), GALNT2 (Q10471), GALNT7 (Q86SF2), GAN (Q9H2C0), GANAB (Q14697), GAP43 (P17677), GAPDH (P04406), GAPVD1 (Q14C86), GAR1 (Q9NY12), GARS (P41250), GART (P22102), GATSL2 (A6NHX0), GBA (P04062), GBE1 (Q04446), GBF1 (Q92538), GCDH (Q92947), GCLC (P48506), GCLM (P48507), GCN1 L1 (Q92616), GDI1 (P31 150), GDI2 (P50395), GEMIN4 (P57678), GEMIN5 (Q8TEQ6), GEMIN6 (Q8WXD5), GET4 (Q7L5D6), GFAP (P14136), GFM1 (Q96RP9), GFPT1 (Q06210), GFPT2 (094808), GGCT (075223), GGPS1 (095749), GINS1 (Q14691), GINS2 (Q9Y248), GINS4 (Q9BRT9), GIPC1 (014908), GIT1 (Q9Y2X7), GLA (P06280), GLB1 L2 (Q8IW92), GLE1 (Q53GS7), GLG1 (Q92896), GLIPR2 (Q9H4G4), GLMN (Q92990), GL01 (Q04760), GL0D4 (Q9HC38), GLRX (P35754), GLRX3 (076003), GLT25D1 (Q8NBJ5), GLT25D2 (Q8IYK4), GLTP (Q9NZD2), GLUD1 (P00367), GLUL (P15104), GMDS (060547), GMFB (P60983), GMPPA (Q96IJ6), GMPPB (Q9Y5P6), GMPR (P36959), GMPR2 (Q9P2T1), GMPS (P49915), GNA11 (P29992), GNA12 (Q03113), GNA13 (Q14344), GNAI1 (P63096), GNAI2 (P04899), GNAI3 (P08754), GNAQ (P50148), GNAS (Q5JWF2), GNB1 (P62873), GNB1 L (Q9BYB4), GNB2 (P62879), GNB2L1 (P63244), GNB4 (Q9HAV0), GNE (Q9Y223), GNG10 (P50151), GNG12 (Q9UBI6), GNG4 (P50150), GNG5 (P63218), GNL3 (Q9BVP2), GNPDA1 (P46926), GNPNAT1 (Q96EK6), G0LGA7 (Q7Z5G4), G0LM1 (Q8NBJ4), G0LPH3 (Q9H4A6), G0RASP2 (Q9H8Y8), G0T1 (P17174), G0T2 (P00505), GPC1 (P35052), GPC4 (075487), GPC6 (Q9Y625), GPD1 L (Q8N335), GPHN (Q9NQX3), GPI (P06744), GPM6A (P51674), GPN1 (Q9HCN4), GPR50 (Q13585), GPR56 (Q9Y653), GPS1 (Q13098), GPSM1 (Q86YR5), GPX1 (P07203), GPX4 (P36969), GRB2 (P62993), GRHPR (Q9UBQ7), GRP (Q3ZCW2), GRWD1 (Q9BQ67), GSDMA (Q96QA5), GSK3A (P49840), GSK3B (P49841), GSN (P06396), GSPT1 (P15170), GSR (P00390), GSS (P48637), GSTK1 (Q9Y2Q3), GSTM2 (P28161), GSTM3 (P21266), GSTM4 (Q03013), GST01 (P78417), GSTP1 (P09211), GSTT2 (P0CG29), GSTZ1 (043708), GTF2E2 (P29084), GTF2F2 (P13984), GTF2H3 (Q13889), GTF2I (P78347), GTF3C2 (Q8WUA4), GTF3C3 (Q9Y5Q9), GTF3C4 (Q9UKN8), GTPBP1 (000178), GTPBP4 (Q9BZE4), GUK1 (Q16774), GYG1 (P46976), GYS1 (P13807), H1 F0 (P07305), H1 FX (Q92522), H2AFX (P16104), H2AFY (075367), H2AFZ (P0C0S5), HADH (Q16836), HADHA (P40939), HARS (P12081), HAT1 (014929), HAUS3 (Q68CZ6), HAUS4 (Q9H6D7), HBA1 (P69905), HBB (P68871), HBS1 L (Q9Y450), HBXIP (043504), HCFC1 (P51610), HDAC1 (Q13547), HDAC2 (Q92769), HDDC2 (Q7Z4H3), HDGF (P51858), HDGFRP2 (Q7Z4V5), HDHD2 (Q9H0R4), HDLBP (Q00341), HEATR1 (Q9H583), HEATR2 (Q86Y56), HEBP1 (Q9NRV9), HECTD3 (Q5T447), HERC4 (Q5GLZ8), HEXB (P07686), HGS (014964), HHIP (Q96QV1), HINT1 (P49773), HINT2 (Q9BX68), HINT3 (Q9NQE9), HIP1 R (075146), HIST1 H 1 B (P16401), HIST1 H1 C (P16403), HIST1 H1 D (P16402), HIST1 H1 E (P10412), HIST1 H2AD (P20671), HIST1 H2BJ (P06899), HIST1 H2BM (Q99879), HIST1 H2B0 (P23527), HIST1 H4A (P62805), HIST2H2AA3 (Q6FI 13), HIST2H2AB (Q8IUE6), HIST2H2BE (Q16778), HIST2H3A (Q71 DI3), HIST3H2BB (Q8N257), HK1 (P19367), HK2 (P52789), HLA-A (P30443), HLA-A (P01892), HLA-B (P03989), HMGA1 (P17096), HMGB1 (P09429), HMGB2 (P26583), HMGCL (P35914), HMGCS1 (Q01581), HMGN1 (P05114), HMGN2 (P05204), HMGN4 (000479), HNRNPAO (Q13151), HNRNPA1 (P09651), HNRNPA2B1 (P22626), HNRNPA3 (P51991), HNRNPAB (Q99729), HNRNPC (P07910), HNRNPD (Q14103), HNRNPF (P52597), HNRNPH1 (P31943), HNRNPH2 (P55795), HNRNPH3 (P31942), HNRNPK (P61978), HNRNPL (P14866), HNRNPM (P52272), HNRNPR (043390), HNRNPU (Q00839), HNRNPUL1 (Q9BUJ2), HNRNPUL2 (Q1 KMD3), HNRPDL (014979), HNRPLL (Q8WVV9), H00K3 (Q86VS8), HP (P00738), HP1 BP3 (Q5SSJ5), HPCAL1 (P37235), HPRT1 (P00492), HPX (P02790), HRAS (P01 112), HRNR (Q86YZ3), HSD17B10 (Q99714), HSD17B12 (Q53GQ0), HSD17B4 (P51659), HSDL2 (Q6YN16), HSP90AA1 (P07900), HSP90AB1 (P08238), HSP90B1 (P14625), HSPA12A (043301), HSPA14 (Q0VDF9), HSPA1A (P08107), HSPA4 (P34932), HSPA4L (095757), HSPA5 (P11021), HSPA8 (P11 142), HSPA9 (P38646), HSPB1 (P04792), HSPBP1 (Q9NZL4), HSPD1 (P10809), HSPE1 (P61604), HSPG2 (P98160), HSPH1 (Q92598), HTRA1 (Q92743), HTT (P42858), HUWE1 (Q7Z6Z7), HY0U1 (Q9Y4L1), IARS (P41252), ICAM1 (P05362), IDE (P14735), IDH1 (075874), IDH2 (P48735), IDH3A (P50213), IDI 1 (Q13907), IFI 16 (Q16666), IFIT5 (Q13325), IFITM3 (Q01628), IFRD2 (Q12894), IFT172 (Q9UG01), IGF1 R (P08069), IGF2BP2 (Q9Y6M1), IGF2BP3 (000425), IGF2R (P11717), IGFBP3 (P17936), IGFBP5 (P24593), IGHG1 (P01857), IGHG2 (P01859), IGSF3 (075054), IGSF8 (Q969P0), IKBKAP (095163), IKBKB (014920), IL1 RAP (Q9NPH3), ILF2 (Q12905), ILF3 (Q12906), ILK (Q13418), ILKAP (Q9H0C8), IMMT (Q16891), IMP3 (Q9NV31), IMPA1 (P29218), IMPA2 (014732), IMPAD1 (Q9NX62), IMPDH1 (P20839), IMPDH2 (P12268), INA (Q16352), INF2 (Q27J81), INPP1 (P49441), INPPL1 (015357), INTS10 (Q9NVR2), INTS3 (Q68E01), INTS7 (Q9NVH2), INTS8 (Q75QN2), IP01 1 (Q9UI26), IP04 (Q8TEX9), IP05 (000410), IP07 (095373), IP08 (015397), IP09 (Q96P70), IQGAP1 (P46940), IRF2BP2 (Q7Z5L9), IRF3 (Q14653), IRGQ (Q8WZA9), IS0C1 (Q96CN7), ISYNA1 (Q9NPH2), ITFG3 (Q9H0X4), ITGA2 (P17301), ITGA3 (P26006), ITGA4 (P13612), ITGA5 (P08648), ITGA6 (P23229), ITGA7 (Q13683), ITGAV (P06756), ITGB1 (P05556), ITGB1 BP1 (014713), ITGB3 (P05106), ITGB4 (P16144), ITGB5 (P18084), ITGB8 (P26012), ITPA (Q9BY32), JAM3 (Q9BX67), JUP (P14923), KARS (Q15046), KATNB1 (Q9BVA0), KBTBD6 (Q86V97), KCTD21 (Q4G0X4), KDM1A (060341), KEAP1 (Q14145), KHDRBS1 (Q07666), KHSRP (Q92945), KIAA0020 (Q15397), KIAA0090 (Q8N766), KIAA0174 (P53990), KIAA0196 (Q12768), KIAA0664 (075153), KIAA0776 (094874), KIAA1033 (Q2M389), KIAA1279 (Q96EK5), KIAA1598 (A0MZ66), KIAA1797 (Q5VW36), KIAA1949 (Q6NYC8), KIAA1967 (Q8N163), KIDINS220 (Q9ULH0), KIF1A (Q12756), KIF2A (000139), KIF5B (P33176), KIF5C (060282), KLC1 (Q07866), KLHDC4 (Q8TBB5), KLHL13 (Q9P2N7), KLHL22 (Q53GT1), KLHL26 (Q53HC5), KNTC1 (P50748), KPNA1 (P52294), KPNA2 (P52292), KPNA3 (000505), KPNA4 (000629), KPNA6 (060684), KPNB1 (Q14974), KPRP (Q5T749), KRAS (P01 1 16), KRIT1 (000522), KRT13 (P13646), KRT14 (P02533), KRT71 (Q3SY84), KTN1 (Q86UP2), L1CAM (P32004), LACTB2 (Q53H82), LAMA1 (P25391), LAMA4 (Q16363), LAMA5 (015230), LAMB1 (P07942), LAMB2 (P55268), LAMC1 (P11047), LAMP1 (P11279), LAMP2 (P13473), LANCL1 (043813), LANCL2 (Q9NS86), LAP3 (P28838), LARP1 (Q6PKG0), LARS (Q9P2J5), LAS1 L (Q9Y4W2), LASP1 (Q14847), LBR (Q14739), LCMT1 (Q9UIC8), LDHA (P00338), LDHB (P07195), LDLR (P01 130), LEFTY2 (000292), LEPRE1 (Q32P28), LGALS1 (P09382), LGALS3 (P17931), LGALS3BP (Q08380), LGALS7 (P47929), LIMA1 (Q9UHB6), LIMS1 (P48059), LIN7C (Q9NUP9), LIPG (Q9Y5X9), LLGL1 (Q15334), LMAN1 (P49257), LMAN2 (Q12907), LMCD1 (Q9NZU5), LMNA (P02545), LMNB1 (P20700), LMNB2 (Q03252), LNPEP (Q9UIQ6), L0H12CR1 (Q969J3), L0NP1 (P36776), LOR (P23490), L0XL4 (Q96JB6), LPHN2 (095490), LPL (P06858), LRBA (P50851), LRG1 (P02750), LRP1 (Q07954), LRPPRC (P42704), LRRC1 (Q9BTT6), LRRC40 (Q9H9A6), LRRC47 (Q8N1 G4), LRRC57 (Q8N9N7), LRRC59 (Q96AG4), LRRC8A (Q8IWT6), LRSAM1 (Q6UWE0), LSM1 (0151 16), LSM 12 (Q3MHD2), LSM2 (Q9Y333), LSM4 (Q9Y4Z0), LSM6 (P62312), LSM7 (Q9UK45), LSS (P48449), LTA4H (P09960), LTBP2 (Q14767), LTBP3 (Q9NS15), LTN1 (094822), LUC7L (Q9NQ29), LUC7L2 (Q9Y383), LUC7L3 (095232), LYAR (Q9NX58), LYPLA1 (075608), LYPLA2 (095372), LYPLAL1 (Q5VWZ2), LZTR1 (Q8N653), M6PR (P20645), MACF1 (Q9UPN3), MACF1 (Q96PK2), MACR0D1 (Q9BQ69), MAD1 L1 (Q9Y6D9), MAD2L1 (Q13257), MAGEE1 (Q9HCI5), MAK16 (Q9BXY0), MALT1 (Q9UDY8), MAN1A2 (060476), MAN 1 B1 (Q9UKM7), MAN2C1 (Q9NTJ4), MAP1 B (P46821), MAP1 LC3A (Q9H492), MAP1 LC3B2 (A6NCE7), MAP2K1 (Q02750), MAP2K2 (P36507), MAP2K3 (P46734), MAP2K4 (P45985), MAP2K7 (014733), MAP4 (P27816), MAP4K4 (095819), MAPK1 (P28482), MAPK14 (Q16539), MAPK3 (P27361), MAPKSP1 (Q9UHA4), MAPRE1 (Q15691), MAPRE3 (Q9UPY8), MARCKS (P29966), MARCKSL1 (P49006), MARK2 (Q7KZI7), MARS (P56192), MAT2A (P31153), MAT2B (Q9NZL9), MATR3 (P43243), MBD3 (095983), MBLAC2 (Q68D91), MBNL1 (Q9NR56), MBNL2 (Q5VZF2), MCAM (P43121), MCM2 (P49736), MCM3 (P25205), MCM4 (P33991), MCM5 (P33992), MCM6 (Q14566), MCM7 (P33993), MCTS1 (Q9ULC4), MDH1 (P40925), MDH2 (P40926), MDK (P21741), MDN1 (Q9NU22), ME1 (P48163), ME2 (P23368), MED1 (Q15648), MEDIO (Q9BTT4), MED11 (Q9P086), MED17 (Q9NVC6), MED18 (Q9BUE0), MED20 (Q9H944), MED23 (Q9ULK4), MED24 (075448), MED28 (Q9H204), MED31 (Q9Y3C7), MEM01 (Q9Y316), MEN1 (000255), MERIT40 (Q9NWV8), METAP1 (P53582), METAP2 (P50579), METHOD (Q86W50), METTL1 (Q9UBP6), METTL11A (Q9BV86), METTL13 (Q8N6R0), METTL2B (Q6P1Q9), METTL5 (Q9NRN9), METTL9 (Q9H1A3), MFAP2 (P55001), MFAP4 (P55083), MFGE8 (Q08431), MFI2 (P08582), MGEA5 (060502), MICA (Q29983), MICAL1 (Q8TDZ2), MIF (P14174), MINA (Q8IUF8), MIOS (Q9NXC5), MKI67IP (Q9BYG3), MLEC (Q14165), MLLT4 (P55196), MLST8 (Q9BVC4), MLTK (Q9NYL2), MMP14 (P50281), MMP2 (P08253), MMS19 (Q96T76), M0B2 (Q70IA6), M0BKL1 B (Q9H8S9), M0BKL2A (Q96BX8), M0BKL3 (Q9Y3A3), M0CS2 (096033), MOGS (Q13724), M0N2 (Q7Z3U7), M0RC2 (Q9Y6X9), MOV10 (Q9HCE1), M0XD1 (Q6UVY6), MPG (P29372), MPI (P34949), MPP6 (Q9NZW5), MPRIP (Q6WCQ1), MPST (P25325), MPZL1 (095297), MRC2 (Q9UBG0), MRE11A (P49959), MRU (Q9BV20), MRPS27 (Q92552), MRPS28 (Q9Y2Q9), MRPS33 (Q9Y291), MRPS34 (P82930), MRPS6 (P82932), MRT04 (Q9UKD2), MSH2 (P43246), MSH3 (P20585), MSH6 (P52701), MSN (P26038), MST01 (Q9BUK6), MTA1 (Q13330), MTA2 (094776), MTAP (Q13126), MTHFD1 (P11586), MTHFS (P49914), MTM1 (Q 13496), MTMR1 (Q 13613), MTMR2 (Q 13614), MTMR6 (Q9Y217), MTMR9 (Q96QG7), MTOR (P42345), MTPN (P58546), MTR (Q99707), MTRR (Q9UBK8), MVD (P53602), MVK (Q03426), MVP (Q14764), MX1 (P20591), MYADM (Q96S97), MYBBP1A (Q9BQG0), MYCBP (Q99417), MYD88 (Q99836), MYH10 (P35580), MYH14 (Q7Z406), MYH9 (P35579), MYL12B (014950), MYL6 (P60660), MY018A (Q92614), MY01 B (043795), MY01C (000159), MY01 E (Q12965), MY05A (Q9Y4I1), MY06 (Q9UM54), MYOF (Q9NZM1), NAA10 (P41227), NAA15 (Q9BXJ9), NAA16 (Q6N069), NAA25 (Q14CX7), NAA38 (095777), NAA50 (Q9GZZ1), NACA (Q13765), NAE1 (Q13564), NAGK (Q9UJ70), NAGLU (P54802), NAMPT (P43490), NANS (Q9NR45), NAP1 L1 (P55209), NAP1 L4 (Q99733), NAPA (P54920), NAPG (Q99747), NAPRT1 (Q6XQN6), NARFL (Q9H6Q4), NARS (043776), NASP (P49321), NAT 10 (Q9H0A0), NAT9 (Q9BTE0), NCAM1 (P13591), NCAN (014594), NCAPD2 (Q15021), NCAPG (Q9BPX3), NCBP1 (Q09161), NCCRP1 (Q6ZVX7), NCDN (Q9UBB6), NCKAP1 (Q9Y2A7), NCKIPSD (Q9NZQ3), NCL (P19338), NCLN (Q969V3), NCS1 (P62166), NCSTN (Q92542), ND0R1 (Q9UHB4), NDRG3 (Q9UGV2), NDRG4 (Q9ULP0), NDUFA2 (043678), NDUFA7 (095182), NDUFAB1 (014561), NDUFB4 (095168), NDUFC2 (095298), NDUFS5 (043920), NDUFS6 (075380), NEDD8 (Q15843), NEFL (P07196), NEFM (P07197), NEK6 (Q9HC98), NEK9 (Q8TD19), NES (P48681), NF1 (P21359), NF2 (P35240), NFIX (Q14938), NHLRC2 (Q8NBF2), NHP2L1 (P55769), NID1 (P14543), NIP7 (Q9Y221), NIPSNAP1 (Q9BPW8), NIT1 (Q86X76), NIT2 (Q9NQR4), NKRF (015226), NLE1 (Q9NVX2), NLGN4X (Q8N0W4), NLN (Q9BYT8), NMD3 (Q96D46), NME2 (P22392), NME3 (Q13232), NME7 (Q9Y5B8), NMT1 (P30419), NNMT (P40261), N0B1 (Q9ULX3), N0C2L (Q9Y3T9), N0C3L (Q8WTT2), N0C4L (Q9BVI4), NOG (Q13253), N0L11 (Q9H8H0), N0L6 (Q9H6R4), N0L9 (Q5SY16), N0M02 (Q5JPE7), NONO (Q15233), NOP10 (Q9NPE3), NOP16 (Q9Y3C1), NOP2 (P46087), NOP56 (000567), NOP58 (Q9Y2X3), NOS1AP (075052), NOSIP (Q9Y314), NOTCH2 (Q04721), NOVA2 (Q9UNW9), NPC1 (015118), NPC2 (P61916), NPEPPS (P55786), NPLOC4 (Q8TAT6), NPM1 (P06748), NPTN (Q9Y639), NPW (Q8N729), NQ01 (P15559), NQ02 (P16083), NRAS (P01111), NRBP1 (Q9UHY1), NRD1 (043847), NRP1 (014786), NRP2 (060462), NSDHL (Q15738), NSF (P46459), NSUN2 (Q08J23), NSUN5 (Q96P11), NSUN6 (Q8TEA1), NT5C (Q8TCD5), NT5C2 (P49902), NT5C3L (Q969T7), NT5E (P21589), NTN1 (095631), NUBP1 (P53384), NUBP2 (Q9Y5Y2), NUCB1 (Q02818), NUCKS1 (Q9H1 E3), NUDC (Q9Y266), NUDCD1 (Q96RS6), NUDCD2 (Q8WVJ2), NUDT1 (P36639), NUDT10 (Q8NFP7), NUDT16 (Q96DE0), NUDT16L1 (Q9BRJ7), NUDT21 (043809), NUDT4 (Q9NZJ9), NUDT5 (Q9UKK9), NUMA1 (Q14980), NUP188 (Q5SRE5), NUP210 (Q8TEM1), NUP37 (Q8NFH4), NUP43 (Q8NFH3), NUP54 (Q7Z3B4), NUP62 (P37198), NUP85 (Q9BW27), NUP88 (Q99567), NUP93 (Q8N1 F7), NUTF2 (P61970), NXF1 (Q9UBU9), NXN (Q6DKJ4), NXT1 (Q9UKK6), OAT (P04181), 0BSL1 (075147), OCRL (Q01968), 0DR4 (Q5SWX8), 0DZ2 (Q9NT68), 0DZ3 (Q9P273), 0GF0D1 (Q8N543), OGT (015294), 0LA1 (Q9NTK5), 0LFML3 (Q9NRN5), 0PA1 (060313), 0RC3 (Q9UBD5), OSBP (P22059), 0SBPL6 (Q9BZF3), OSGEP (Q9NPF4), 0TUB1 (Q96FW1), 0VCA2 (Q8WZ82), 0XCT1 (P55809), 0XSR1 (095747), P4HA1 (P13674), P4HB (P07237), PA2G4 (Q9UQ80), PAAF1 (Q9BRP4), PABPC1 (P11940), PABPC4 (Q13310), PABPN1 (Q86U42), PACSIN2 (Q9UNF0), PACSIN3 (Q9UKS6), PAF1 (Q8N7H5), PAFAH1 B1 (P43034), PAFAH1 B2 (P68402), PAFAH1 B3 (Q15102), PAICS (P22234), PAIP1 (Q9H074), PAK1 IP1 (Q9NWT1), PAK2 (Q13177), PALD (Q9ULE6), PALLD (Q8WX93), PANK4 (Q9NVE7), PAPOLA (P51003), PAPSS1 (043252), PARK7 (Q99497), PARN (095453), PARP1 (P09874), PARP4 (Q9UKK3), PARVA (Q9NVD7), PBLD (P30039), PCBD1 (P61457), PCBP1 (Q15365), PCBP2 (Q15366), PCDHB2 (Q9Y5E7), PCDHGC3 (Q9UN70), PCID2 (Q5JVF3), PCMT1 (P22061), PCNA (P12004), PC0LCE2 (Q9UKZ9), PCY0X1 (Q9UHG3), PCY0X1 L (Q8NBM8), PCYT2 (Q99447), PDCD10 (Q9BUL8), PDCD11 (Q14690), PDCD4 (Q53EL6), PDCD5 (014737), PDCD6 (075340), PDCD6IP (Q8WUM4), PDCL3 (Q9H2J4), PDDC1 (Q8NB37), PDE12 (Q6L8Q7), PDGFRA (P16234), PDIA3 (P30101), PDIA4 (P13667), PDIA5 (Q14554), PDIA6 (Q15084), PDLIM1 (000151), PDLIM4 (P50479), PDLIM5 (Q96HC4), PDLIM7 (Q9NR12), PDRO (Q6IAA8), PDS5A (Q29RF7), PDS5B (Q9NTI5), PDXK (000764), PDXP (Q96GD0), PEA15 (Q15121), PEBP1 (P30086), PECI (075521), PEF1 (Q9UBV8), PELO (Q9BRX2), PELP1 (Q8IZL8), PEPD (P12955), PES1 (000541), PFAS (015067), PFDN1 (060925), PFDN2 (Q9UHV9), PFDN4 (Q9NQP4), PFDN5 (Q99471), PFDN6 (015212), PFKL (P17858), PFKM (P08237), PFKP (Q01813), PFN1 (P07737), PFN2 (P35080), PGAM1 (P18669), PGAM5 (Q96HS1), PGD (P52209), PGGT1 B (P53609), PGK1 (P00558), PGLS (095336), PGLYRP2 (Q96PD5), PGM1 (P36871), PGM2L1 (Q6PCE3), PGM3 (095394), PGP (A6NDG6), PGRMC1 (000264), PGRMC2 (015173), PHB (P35232), PHB2 (Q99623), PHF5A (Q7RTV0), PHF6 (Q8IWS0), PHGDH (043175), PHKB (Q93100), PHLDA1 (Q8WV24), PHLDA3 (Q9Y5J5), PHLDB1 (Q86UU1), PHPT1 (Q9NRX4), PI15 (043692), PI4KA (P42356), PICALM (Q13492), PIGT (Q969N2), PIK3CA (P42336), PIK3R4 (Q99570), PIN1 (Q 13526), PIP4K2A (P48426), PIP4K2B (P78356), PIP4K2C (Q8TBX8), PIPOX (Q9P0Z9), PIPSL (A2A3N6), PITPNB (P48739), PKM2 (P14618), PKP1 (Q13835), PLAA (Q9Y263), PLCB3 (Q01970), PLCD1 (P51178), PLCD3 (Q8N3E9), PLCG1 (P19174), PLCG2 (P16885), PLD3 (Q8IV08), PLEC (Q15149), PLIN2 (Q99541), PLIN3 (060664), PLK1 (P53350), PL0D1 (Q02809), PL0D2 (000469), PL0D3 (060568), PLRG1 (043660), PLS1 (Q14651), PLS3 (P13797), PLSCR3 (Q9NRY6), PLTP (P55058), PLXNA1 (Q9UIW2), PLXNB2 (015031), PLXND1 (Q9Y4D7), PMM2 (015305), PMPCA (Q10713), PMPCB (075439), PMVK (Q15126), PNMA2 (Q9UL42), PNN (Q9H307), PN01 (Q9NRX1), PNP (P00491), PNPLA2 (Q96AD5), PODXL (000592), P0LD1 (P28340), P0LD2 (P49005), P0LE3 (Q9NRF9), P0LR1A (095602), P0LR1 B (Q9H9Y6), P0LR1C (015160), P0LR1 D (Q9Y2S0), P0LR2A (P24928), P0LR2B (P30876), P0LR2C (P19387), P0LR2E (P19388), P0LR2G (P62487), P0LR2H (P52434), P0LR2J (P52435), P0LR2K (P53803), P0LR3A (014802), P0LR3B (Q9NW08), P0LR3C (Q9BUI4), P0P1 (Q99575), P0P4 (095707), P0P7 (075817), POR (P16435), PPA1 (Q15181), PPA2 (Q9H2U2), PPAN (Q9NQ55), PPAP2A (014494), PPAT (Q06203), PPCS (Q9HAB8), PPFIBP1 (Q86W92), PPIA (P62937), PPIB (P23284), PPIC (P45877), PPID (Q08752), PPIF (P30405), PPIH (043447), PPIL1 (Q9Y3C6), PPM1 F (P49593), PPM1G (015355), PPME1 (Q9Y570), PPP1CA (P62136), PPP1CB (P62140), PPP1CC (P36873), PPP1 R14B (Q96C90), PPP1 R7 (Q15435), PPP1 R8 (Q12972), PPP2CA (P67775), PPP2CB (P62714), PPP2R1A (P30153), PPP2R2A (P63151), PPP2R2D (Q66LE6), PPP2R4 (Q15257), PPP2R5D (Q14738), PPP2R5E (Q16537), PPP3CA (Q08209), PPP4C (P60510), PPP4R1 (Q8TF05), PPP5C (P53041), PPP6C (000743), PPP6R3 (Q5H9R7), PPPDE2 (Q6ICB0), PPT1 (P50897), PPWD1 (Q96BP3), PRCP (P42785), PRDX1 (Q06830), PRDX2 (P32119), PRDX3 (P30048), PRDX4 (Q13162), PRDX6 (P30041), PREP (P48147), PREPL (Q4J6C6), PRIM1 (P49642), PRIM2 (P49643), PRKAA1 (Q13131), PRKACA (P17612), PRKACB (P22694), PRKAG1 (P54619), PRKAR1A (P10644), PRKAR2A (P13861), PRKCA (P17252), PRKCI (P41743), PRKCSH (P14314), PRKDC (P78527), PRKRA (075569), PRMT1 (Q99873), PRMT10 (Q6P2P2), PRMT3 (060678), PRMT5 (014744), PRMT7 (Q9NVM4), PROSC (094903), PRPF19 (Q9UMS4), PRPF3 (043395), PRPF31 (Q8WWY3), PRPF4 (043172), PRPF40A (075400), PRPF4B (Q13523), PRPF6 (094906), PRPF8 (Q6P2Q9), PRPS1 (P60891), PRPS2 (P11908), PRPSAP2 (060256), PRRC1 (Q96M27), PRSS23 (095084), PRTFDC1 (Q9NRG1), PSAP (P07602), PSAT1 (Q9Y617), PSD3 (Q9NYI0), PSENEN (Q9NZ42), PSIP1 (075475), PSMA1 (P25786), PSMA2 (P25787), PSMA3 (P25788), PSMA4 (P25789), PSMA5 (P28066), PSMA6 (P60900), PSMA7 (014818), PSMB1 (P20618), PSMB2 (P49721), PSMB3 (P49720), PSMB4 (P28070), PSMB5 (P28074), PSMB6 (P28072), PSMB7 (Q99436), PSMC1 (P62191), PSMC2 (P35998), PSMC3 (P17980), PSMC4 (P43686), PSMC5 (P62195), PSMC6 (P62333), PSMD1 (Q99460), PSMD10 (075832), PSMD11 (000231), PSMD12 (000232), PSMD13 (Q9UNM6), PSMD14 (000487), PSMD2 (Q13200), PSMD3 (043242), PSMD4 (P55036), PSMD5 (Q16401), PSMD6 (Q15008), PSMD7 (P51665), PSMD8 (P48556), PSMD9 (000233), PSME1 (Q06323), PSME2 (Q9UL46), PSME3 (P61289), PSME4 (Q14997), PSMG1 (095456), PSMG2 (Q969U7), PSPC1 (Q8WXF1), PSPH (P78330), PTBP1 (P26599), PTGES2 (Q9H7Z7), PTGES3 (Q15185), PTGFRN (Q9P2B2), PTGR1 (Q14914), PTHLH (P12272), PTK2 (Q05397), PTK7 (Q13308), PTMA (P06454), PTN (P21246), PTP4A1 (Q93096), PTPN1 (P18031), PTPN11 (Q06124), PTPN23 (Q9H3S7), PTPRA (P18433), PTPRE (P23469), PTPRG (P23470), PTPRJ (Q12913), PTPRZ1 (P23471), PUF60 (Q9UHX1), PURA (Q00577), PURB (Q96QR8), PUS1 (Q9Y606), PUS7 (Q96PZ0), PVR (P15151), PVRL2 (Q92692), PWP1 (Q13610), PWP2 (Q15269), PXDN (Q92626), PXK (Q7Z7A4), PXN (P49023), PYCR1 (P32322), PYCRL (Q53H96), PYGB (P11216), PYGL (P06737), QARS (P47897), QDPR (P09417), QKI (Q96PU8), QTRT1 (Q9BXR0), RAB10 (P61026), RAB1 1A (P62491), RAB1 1 FIP1 (Q6WKZ4), RAB12 (Q6IQ22), RAB13 (P51 153), RAB14 (P61 106), RAB18 (Q9NP72), RAB1A (P62820), RAB1 B (Q9H0U4), RAB21 (Q9UL25), RAB22A (Q9UL26), RAB23 (Q9ULC3), RAB27A (P51 159), RAB2A (P61019), RAB2B (Q8WUD1), RAB32 (Q13637), RAB34 (Q9BZG1), RAB35 (Q15286), RAB3A (P20336), RAB3GAP1 (Q15042), RAB3GAP2 (Q9H2M9), RAB4A (P20338), RAB5A (P20339), RAB5B (P61020), RAB5C (P51 148), RAB6A (P20340), RAB7A (P51 149), RAB8A (P61006), RAB8B (Q92930), RABAC1 (Q9UI 14), RABGAP1 (Q9Y3P9), RABGGTA (Q92696), RABGGTB (P53611), RABL2A (Q9UBK7), RABL3 (Q5HYI8), RAC1 (P63000), RAC3 (P60763), RAD23B (P54727), RAD50 (Q92878), RAE1 (P78406), RAF1 (P04049), RALA (P11233), RALB (P11234), RALY (Q9UKM9), RAN (P62826), RANBP1 (P43487), RANBP2 (P49792), RANGAP1 (P46060), RAP1A (P62834), RAP1 B (P61224), RAP1GDS1 (P52306), RAP2B (P61225), RAPH1 (Q70E73), RARS (P54136), RASA1 (P20936), RASA3 (Q14644), RBBP4 (Q09028), RBBP5 (Q15291), RBBP7 (Q16576), RBM 12 (Q9NTZ6), RBM14 (Q96PK6), RBM15 (Q96T37), RBM22 (Q9NW64), RBM25 (P49756), RBM26 (Q5T8P6), RBM28 (Q9NW13), RBM39 (Q14498), RBM4 (Q9BWF3), RBM8A (Q9Y5S9), RBMX (P38159), RBP1 (P09455), RBPJ (Q06330), RBX1 (P62877), RCC1 (P18754), RCC2 (Q9P258), RCL (043598), RCL1 (Q9Y2P8), RCN1 (Q15293), RDH 11 (Q8TC12), RDH 13 (Q8NBN7), RDX (P35241), RECQL (P46063), RELA (Q04206), REPS1 (Q96D71), RETSAT (Q6NUM9), RFC2 (P35250), RFC3 (P40938), RFC4 (P35249), RFC5 (P40937), RFFL (Q8WZ73), RFTN1 (Q14699), RHEB (Q15382), RHOA (P61586), RHOB (P62745), RHOC (P08134), RHOF (Q9HBH0), RHOG (P84095), RHOT2 (Q8IXI 1), RIC8A (Q9NPQ8), RNASEH2C (Q8TDP1), RNF114 (Q9Y508), RNF20 (Q5VTR2), RNF213 (Q63HN8), RNF7 (Q9UBF6), RNGTT (060942), RNH1 (P13489), RNMT (043148), RNPEP (Q9H4A4), R0BLD3 (Q9Y2Q5), R0CK1 (Q13464), R0CK2 (0751 16), RP2 (075695), RPA1 (P27694), RPA2 (P15927), RPA3 (P35244), RPE (Q96AT9), RPF2 (Q9H7B2), RPIA (P49247), RPL10 (P27635), RPL10A (P62906), RPL1 1 (P62913), RPL12 (P30050), RPL13 (P26373), RPL13A (P40429), RPL14 (P50914), RPL15 (P61313), RPL17 (P18621), RPL18 (Q07020), RPL18A (Q02543), RPL19 (P84098), RPL21 (P46778), RPL22 (P35268), RPL22L1 (Q6P5R6), RPL23 (P62829), RPL23A (P62750), RPL24 (P83731), RPL26 (P61254), RPL26L1 (Q9UNX3), RPL27 (P61353), RPL27A (P46776), RPL28 (P46779), RPL29 (P47914), RPL3 (P39023), RPL30 (P62888), RPL31 (P62899), RPL32 (P62910), RPL34 (P49207), RPL35 (P42766), RPL35A (P18077), RPL36 (Q9Y3U8), RPL36A (P83881), RPL36AL (Q969Q0), RPL37 (P61927), RPL37A (P61513), RPL38 (P63173), RPL4 (P36578), RPL5 (P46777), RPL6 (Q02878), RPL7 (P18124), RPL7A (P62424), RPL7L1 (Q6DKI 1), RPL8 (P62917), RPL9 (P32969), RPLPO (P05388), RPLP1 (P05386), RPLP2 (P05387), RPN1 (P04843), RPN2 (P04844), RPP30 (P78346), RPP38 (P78345), RPRD1A (Q96P16), RPRD1 B (Q9NQG5), RPS10 (P46783), RPS11 (P62280), RPS12 (P25398), RPS13 (P62277), RPS14 (P62263), RPS15 (P62841), RPS15A (P62244), RPS16 (P62249), RPS17 (P08708), RPS18 (P62269), RPS19 (P39019), RPS2 (P15880), RPS20 (P60866), RPS21 (P63220), RPS23 (P62266), RPS24 (P62847), RPS25 (P62851), RPS26 (P62854), RPS27 (P42677), RPS27A (P62979), RPS27L (Q71 UM5), RPS28 (P62857), RPS29 (P62273), RPS3 (P23396), RPS3A (P61247), RPS4X (P62701 ), RPS4Y1 (P22090), RPS5 (P46782), RPS6 (P62753), RPS6KA1 (Q15418), RPS6KA3 (P51812), RPS7 (P62081), RPS8 (P62241), RPS9 (P46781), RPSA (P08865), RQCD1 (Q92600), RRAGC (Q9HB90), RRAS2 (P62070), RRBP1 (Q9P2E9), RRM1 (P23921), RRM2 (P31350), RRM2B (Q7LG56), RRP1 (P56182), RRP12 (Q5JTH9), RRP1 B (Q14684), RRP7A (Q9Y3A4), RRP9 (043818), RRS1 (Q15050), RSL1 D1 (076021), RSL24D1 (Q9UHA3), RSPRY1 (Q96DX4), RSU1 (Q15404), RTCD1 (000442), RTKN (Q9BST9), RTN3 (095197), RTN4 (Q9NQC3), RUVBL1 (Q9Y265), RUVBL2 (Q9Y230), RWDD2B (P57060), S100A10 (P60903), S100A11 (P31949), S100A13 (Q99584), S100A16 (Q96FQ6), S100A2 (P29034), S100A4 (P26447), S100A6 (P06703), S100A7 (P31 151), S100A8 (P05109), S100A9 (P06702), SAAL1 (Q96ER3), SACS (Q9NZJ4), SAE1 (Q9UBE0), SAMHD1 (Q9Y3Z3), SAP18 (000422), SAR1A (Q9NR31), SARM1 (Q6SZW1 ), SARNP (P82979), SARS (P49591), SARS2 (Q9NP81), SART3 (Q15020), SBDS (Q9Y3A5), SBF1 (095248), SCARB1 (Q8WTV0), SCARB2 (Q14108), SCCPDH (Q8NBX0), SCFD1 (Q8WVM8), SCFD2 (Q8WU76), SCP2 (P22307), SCPEP1 (Q9HB40), SCRG1 (075711), SCRIB (Q14160), SCRN1 (Q12765), SCRN2 (Q96FV2), SCYL1 (Q96KG9), SDC2 (P34741), SDC4 (P31431), SDCBP (000560), SDCCAG1 (060524), SDCCAG3 (Q96C92), SDHA (P31040), SDHB (P21912), SDK1 (Q7Z5N4), SDSL (Q96GA7), SEC13 (P55735), SEC14L2 (076054), SEC22B (075396), SEC23A (Q15436), SEC23B (Q15437), SEC23IP (Q9Y6Y8), SEC24A (095486), SEC24B (095487), SEC24C (P53992), SEC24D (094855), SEC31A (094979), SEC61 B (P60468), SEC61G (P60059), SEH1 L (Q96EE3), SELH (Q8IZQ5), SELO (Q9BVL4), SEMA3A (Q14563), SENP3 (Q9H4L4), SEPSECS (Q9HD40), 40422 (Q9P0V9), 40787 (Q9NVA2), 37500 (Q15019), 38596 (Q99719), 39326 (Q16181), 40057 (Q9UHD8), SERBP1 (Q8NC51), SERPINB12 (Q96P63), SERPINB3 (P29508), SERPINB6 (P35237), SERPINH1 (P50454), SESN2 (P58004), SET (Q01105), SETD3 (Q86TU7), SF3A1 (Q15459), SF3A2 (Q15428), SF3A3 (Q12874), SF3B1 (075533), SF3B14 (Q9Y3B4), SF3B2 (Q13435), SF3B3 (Q15393), SF3B4 (Q15427), SF3B5 (Q9BWJ5), SFN (P31947), SFPQ (P23246), SFRP4 (Q6FHJ7), SFXN3 (Q9BWM7), SGTA (043765), SH3BGRL3 (Q9H299), SH3BP4 (Q9P0V3), SH3GL1 (Q99961), SH3GLB1 (Q9Y371), SHC1 (P29353), SHMT1 (P34896), SHMT2 (P34897), SHOC2 (Q9UQ13), SHPK (Q9UHJ6), SIRT5 (Q9NXA8), SKIV2L (Q15477), SKIV2L2 (P42285), SKP1 (P63208), SLC12A2 (P55011), SLC12A4 (Q9UP95), SLC16A1 (P53985), SLC1A3 (P43003), SLC1A5 (Q15758), SLC25A10 (Q9UBX3), SLC25A11 (Q02978), SLC25A13 (Q9UJS0), SLC25A22 (Q9H936), SLC25A3 (Q00325), SLC25A5 (P05141), SLC25A6 (P12236), SLC26A2 (P50443), SLC29A1 (Q99808), SLC29A2 (Q14542), SLC2A1 (P11166), SLC30A1 (Q9Y6M5), SLC38A1 (Q9H2H9), SLC3A2 (P08195), SLC44A2 (Q8IWA5), SLC4A2 (P04920), SLC4A7 (Q9Y6M7), SLC5A3 (P53794), SLC5A6 (Q9Y289), SLC6A8 (P48029), SLC7A1 (P30825), SLC7A5 (Q01650), SLC9A3R1 (014745), SLC9A3R2 (Q15599), SLIRP (Q9GZT3), SLK (Q9H2G2), SMAD1 (Q15797), SMAD2 (Q15796), SMARCA4 (P51532), SMARCA5 (060264), SMARCB1 (Q12824), SMARCC1 (Q92922), SMARCC2 (Q8TAQ2), SMARCD2 (Q92925), SMC1A (Q14683), SMC2 (095347), SMC3 (Q9UQE7), SMC4 (Q9NTJ3), SMC5 (Q8IY18), SMCHD1 (A6NHR9), SMEK1 (Q6IN85), SMG1 (Q96Q15), SMN1 (Q16637), SMS (P52788), SMU1 (Q2TAY7), SMYD3 (Q9H7B4), SMYD5 (Q6GMV2), SNAP23 (000161), SND1 (Q7KZF4), SNF8 (Q96H20), SNRNP200 (075643), SNRNP40 (Q96DI7), SNRNP70 (P08621), SNRPA1 (P09661), SNRPB (P14678), SNRPB2 (P08579), SNRPD1 (P62314), SNRPD2 (P62316), SNRPD3 (P62318), SNRPE (P62304), SNRPF (P62306), SNRPG (P62308), SNTB1 (Q13884), SNTB2 (Q13425), SNX1 (Q13596), SNX12 (Q9UMY4), SNX17 (Q15036), SNX18 (Q96RF0), SNX2 (060749), SNX27 (Q96L92), SNX3 (060493), SNX5 (Q9Y5X3), SNX6 (Q9UNH7), SNX9 (Q9Y5X1), S0D1 (P00441), S0D2 (P04179), SORD (Q00796), S0RT1 (Q99523), SPATS2L (Q9NUQ6), SPC24 (Q8NBT2), SPCS2 (Q15005), SPCS3 (P61009), SPG21 (Q9NZD8), SPIN1 (Q9Y657), SPR (P35270), SPRR1 B (P22528), SPRR2E (P22531), SPTAN1 (Q13813), SPTBN1 (Q01082), SPTBN2 (015020), SR140 (015042), SRBD1 (Q8N5C6), SRCRL (A1 L4H1), SRGAP2 (075044), SRI (P30626), SRM (P19623), SRP14 (P37108), SRP19 (P09132), SRP54 (P61011), SRP68 (Q9UHB9), SRP72 (076094), SRP9 (P49458), SRPK1 (Q96SB4), SRPR (P08240), SRPRB (Q9Y5M8), SRPX (P78539), SRPX2 (060687), SRR (Q9GZT4), SRRM1 (Q8IYB3), SRRM2 (Q9UQ35), SRRT (Q9BXP5), SRSF1 (Q07955), SRSF10 (075494), SRSF11 (Q05519), SRSF2 (Q01130), SRSF3 (P84103), SRSF5 (Q13243), SRSF6 (Q13247), SRSF7 (Q16629), SRSF9 (Q13242), SRXN1 (Q9BYN0), SSB (P05455), SSBP1 (Q04837), SSR1 (P43307), SSR3 (Q9UNL2), SSRP1 (Q08945), SSSCA1 (060232), SSU72 (Q9NP77), ST13 (P50502), STAG1 (Q8WVM7), STAM (Q92783), STAMBP (095630), STAT1 (P42224), STAT2 (P52630), STAT3 (P40763), STAU1 (095793), STIP1 (P31948), STK10 (094804), STK24 (Q9Y6E0), STK25 (000506), STK38 (Q15208), STK38L (Q9Y2H1), STOM (P27105), STOML2 (Q9UJZ1), STON2 (Q8WXE9), STRAP (Q9Y3F4), STT3A (P46977), STUB1 (Q9UNE7), STX12 (Q86Y82), STX4 (Q12846), STX5 (Q13190), STXBP1 (P61764), STXBP3 (000186), STYX (Q8WUJ0), SUB1 (P53999), SUCLA2 (Q9P2R7), SUCLG2 (Q96I99), SUGT1 (Q9Y2Z0), SULF2 (Q8IWU5), SUM01 (P63165), SUPT16H (Q9Y5B9), SUPT4H1 (P63272), SUPT5H (000267), SUPT6H (Q7KZ85), SUSD5 (060279), SVEP1 (Q4LDE5), SVIL (095425), SWAP70 (Q9UH65), SYMPK (Q92797), SYNCRIP (060506), SYNGR2 (043760), SYNJ2BP (P57105), SYNM (015061), SYPL1 (Q16563), TAB1 (Q15750), TAF9 (Q9Y3D8), TAGLN (Q01995), TAGLN2 (P37802), TALD01 (P37837), TA0K1 (Q7L7X3), TARDBP (Q13148), TARS (P26639), TATDN1 (Q6P1 N9), TAX1 BP3 (014907), TBC1 D13 (Q9NVG8), TBC1 D15 (Q8TC07), TBC1 D23 (Q9NUY8), TBC1 D24 (Q9ULP9), TBC1 D4 (060343), TBC1 D9B (Q66K14), TBCA (075347), TBCB (Q99426), TBCC (Q15814), TBCD (Q9BTW9), TBCE (Q15813), TBK1 (Q9UHD2), TBL1XR1 (Q9BZK7), TBL2 (Q9Y4P3), TBL3 (Q12788), TBPL1 (P62380), TCEA1 (P23193), TCEB1 (Q15369), TCEB2 (Q15370), TCERG1 (014776), TCF25 (Q9BQ70), TCP1 (P17987), TEL02 (Q9Y4R8), TEX10 (Q9NXF1), TEX15 (Q9BXT5), TF (P02787), TFCP2 (Q12800), TFG (Q92734), TFRC (P02786), TGFB1 (P01137), TGFB2 (P61812), TGFBI (Q15582), TGFBRAP1 (Q8WUH2), TGM1 (P22735), TGM3 (Q08188), TH1 L (Q8IXH7), THBS1 (P07996), THBS3 (P49746), THG1 L (Q9NWX6), TH0C2 (Q8NI27), TH0C3 (Q96J01), TH0C5 (Q13769), TH0C6 (Q86W42), TH0C7 (Q6I9Y2), TH0P1 (P52888), THTPA (Q9BU02), THUMPD1 (Q9NXG2), THUMPD3 (Q9BV44), THY1 (P04216), THYN1 (Q9P016), TIA1 (P31483), TIAL1 (Q01085), TIGAR (Q9NQ88), TIMM13 (Q9Y5L4), TIMM44 (043615), TIMM50 (Q3ZCQ8), TIMM8A (060220), TIMM8B (Q9Y5J9), TIMM9 (Q9Y5J7), TIMP2 (P16035), TIPRL (075663), TJP1 (Q07157), TKT (P29401), TLN1 (Q9Y490), TLN2 (Q9Y4G6), TM9SF3 (Q9HD45), TMED10 (P49755), TMED2 (Q15363), TMED5 (Q9Y3A6), TMED7 (Q9Y3B3), TMED9 (Q9BVK6), TMEFF2 (Q9UIK5), TM EM 132 A (Q24JP5), TMEM2 (Q9UHN6), TMEM30A (Q9NV96), TMEM33 (P57088), TM0D3 (Q9NYL9), TMPO (P42166), TMX1 (Q9H3N1), TNC (P24821), TNKS1 BP1 (Q9C0C2), TNP01 (Q92973), TNP02 (014787), TNP03 (Q9Y5L0), T0M1 L2 (Q6ZVM7), TOMM20 (Q15388), TOMM34 (Q15785), T0MM5 (Q8N4H5), TOMM70A (094826), T0P1 (P11387), T0P2A (P11388), T0P2B (Q02880), TP53I3 (Q53FA7), TP53RK (Q96S44), TPBG (Q13641), TPD52 (P55327), TPI1 (P60174), TPM1 (P09493), TPM2 (P07951), TPM3 (P06753), TPM3L (A6NL28), TPM4 (P67936), TPP2 (P29144), TPT1 (P13693), TRA2A (Q13595), TRA2B (P62995), TRAF2 (Q12933), TRAP1 (Q12931), TRAPPC1 (Q9Y5R8), TRAPPC2L (Q9UL33), TRAPPC3 (043617), TRAPPC4 (Q9Y296), TRAPPC5 (Q8IUR0), TRIM16 (095361), TRIM22 (Q8IYM9), TRIM25 (Q14258), TRIM26 (Q12899), TRIM28 (Q13263), TRIM47 (Q96LD4), TRIM5 (Q9C035), TRIO (075962), TRIP13 (Q15645), TRIP6 (Q15654), TRMT1 (Q9NXH9), TRMT1 12 (Q9UI30), TRMT5 (Q32P41), TRMT6 (Q9UJA5), TRMT61A (Q96FX7), TRNT1 (Q96Q1 1), TROVE2 (P10155), TRRAP (Q9Y4A5), TSG101 (Q99816), TSKU (Q8WUA8), TSN (Q15631), TSPAN14 (Q8NG11), TSPAN6 (043657), TSR1 (Q2NL82), TSSC1 (Q53HC9), TSTA3 (Q13630), TTC1 (Q99614), TTC15 (Q8WVT3), TTC27 (Q6P3X3), TTC37 (Q6PGP7), TTC38 (Q5R3I4), TTC7B (Q86TV6), TTC9C (Q8N5M4), TTL (Q8NG68), TTLL12 (Q14166), TTN (Q8WZ42), TTYH1 (Q9H313), TTYH3 (Q9C0H2), TUBA1 B (P68363), TUBA4A (P68366), TUBB (P07437), TUBB2B (Q9BVA1), TUBB2C (P68371), TUBB3 (Q13509), TUBB6 (Q9BUF5), TUBG1 (P23258), TUBGCP2 (Q9BSJ2), TUBGCP3 (Q96CW5), TUFM (P4941 1), TWF1 (Q12792), TWF2 (Q6IBS0), TXN (P10599), TXNDC17 (Q9BRA2), TXNDC5 (Q8NBS9), TXNDC9 (014530), TXNL1 (043396), TXNRD1 (Q16881), TYK2 (P29597), TYMS (P04818), U2AF1 (Q01081), U2AF2 (P26368), UAP1 (Q16222), UBA1 (P22314), UBA2 (Q9UBT2), UBA3 (Q8TBC4), UBA52 (P62987), UBA6 (A0AVT1), UBE2D1 (P51668), UBE2D3 (P61077), UBE2E1 (P51965), UBE2G2 (P60604), UBE2I (P63279), UBE2J2 (Q8N2K1), UBE2K (P61086), UBE2L3 (P68036), UBE2M (P61081), UBE2N (P61088), UBE20 (Q9C0C9), UBE2S (Q16763), UBE2V1 (Q13404), UBE2V2 (Q15819), UBE3A (Q05086), UBE3C (Q15386), UBE4A (Q14139), UBE4B (095155), UBFD1 (014562), UBL3 (095164), UBL4A (P11441), UBL5 (Q9BZL1), UBLCP1 (Q8WVY7), UBP1 (Q9NZI7), UBQLN2 (Q9UHD9), UBR1 (Q8IWV7), UBR4 (Q5T4S7), UBTD1 (Q9HAC8), UBXN1 (Q04323), UBXN6 (Q9BZV1), UCHL1 (P09936), UCHL3 (P15374), UCHL5 (Q9Y5K5), UCK2 (Q9BZX2), UFC1 (Q9Y3C8), UFD1 L (Q92890), UGDH (060701), UGGT1 (Q9NYU2), UGP2 (Q16851), ULK3 (Q6PHR2), UMPS (P11 172), UNC1 19B (A6NIH7), UNC45A (Q9H3U 1), UPF1 (Q92900), UPP1 (Q16831), UQCRC1 (P31930), UQCRC2 (P22695), UQCRFS1 (P47985), URB1 (060287), URB2 (Q14146), UROD (P06132), UROS (P10746), US01 (060763), USP10 (Q14694), USP11 (P51784), USP13 (Q92995), USP14 (P54578), USP15 (Q9Y4E8), USP24 (Q9UPU5), USP39 (Q53GS9), USP5 (P45974), USP7 (Q93009), USP9X (Q93008), UTP15 (Q8TED0), UTP18 (Q9Y5J1), UTP20 (075691), UTP6 (Q9NYH9), UTRN (P46939), UXS1 (Q8NBZ7), UXT (Q9UBK9), VAC 14 (Q08AM6), VAMP3 (Q15836), VAMP5 (095183), VAPA (Q9P0L0), VAPB (095292), VARS (P26640), VASP (P50552), VAT1 (Q99536), VAV2 (P52735), VBP1 (P61758), VCAN (P13611), VCL (P18206), VCP (P55072), VDAC1 (P21796), VDAC2 (P45880), VDAC3 (Q9Y277), VIM (P08670), VPRBP (Q9Y4B6), VPS1 1 (Q9H270), VPS13A (Q96RL7), VPS13C (Q709C8), VPS16 (Q9H269), VPS18 (Q9P253), VPS24 (Q9Y3E7), VPS25 (Q9BRG1), VPS26A (075436), VPS26B (Q4G0F5), VPS28 (Q9UK41), VPS29 (Q9UBQ0), VPS33A (Q96AX1), VPS33B (Q9H267), VPS35 (Q96QK1), VPS36 (Q86VN1), VPS37B (Q9H9H4), VPS39 (Q96JC1), VPS41 (P49754), VPS45 (Q9NRW7), VPS4A (Q9UN37), VPS4B (075351), VPS53 (Q5VIR6), VPS8 (Q8N3P4), VRK1 (Q99986), VTA1 (Q9NP79), VWA1 (Q6PCB0), VWA5A (000534), WARS (P23381), WASF2 (Q9Y6W5), WASL (000401), WBSCR22 (043709), WDFY1 (Q8IWB7), WDR1 (075083), WDR11 (Q9BZH6), WDR12 (Q9GZL7), WDR18 (Q9BV38), WDR26 (Q9H7D7), WDR3 (Q9UNX4), WDR36 (Q8NI36), WDR4 (P57081), WDR43 (Q15061), WDR45L (Q5MNZ6), WDR48 (Q8TAF3), WDR5 (P61964), WDR54 (Q9H977), WDR6 (Q9NNW5), WDR61 (Q9GZS3), WDR73 (Q6P4I2), WDR74 (Q6RFH5), WDR75 (Q8IWA0), WDR77 (Q9BQA1), WDR82 (Q6UXN9), WDR92 (Q96MX6), WHSC2 (Q9H3P2), WRNIP1 (Q96S55), XP32 (Q5T750), XPC (Q01831), XPNPEP1 (Q9NQW7), XP01 (014980), XP04 (Q9C0E2), XP05 (Q9HAV4), XP06 (Q96QU8), XP07 (Q9UIA9), XPOT (043592), XRCC1 (P18887), XRCC5 (P13010), XRCC6 (P12956), XRN2 (Q9H0D6), YARS (P54577), YBX1 (P67809), YES1 (P07947), YKT6 (015498), YRDC (Q86U90), YTHDC1 (Q96MU7), YTHDF2 (Q9Y5A9), YWHAB (P31946), YWHAE (P62258), YWHAG (P61981), YWHAH (Q04917), YWHAQ (P27348), YWHAZ (P63104), ZC3H15 (Q8WU90), ZC3HAV1 (Q7Z2W4), ZC3HAV1 L (Q96H79), ZCCHC3 (Q9NUD5), ZFAND1 (Q8TCF1), ZFR (Q96KR1), ZMAT2 (Q96NC0), ZNF259 (075312), ZNF326 (Q5BKZ1), ZNF330 (Q9Y3S2), ZNF622 (Q969S3), ZNF765 (Q7L2R6), ZNFX1 (Q9P2E3), ZW10 (043264), ZWILCH (Q9H900), ZYG1 1 B (Q9C0D3), ZYX (Q 15942).

Table 20: Gene names and SWISSPROT accession numbers of all 2940 proteins identified in CTX0E03 microvesicles (listed in alphabetical order of gene name).

Histone H2B type 3-B Q8N257

Tubulin alpha-I B chain P68363

40S ribosomal protein S3 P23396

40S ribosomal protein S3a P61247

Histone H2A type 1 -D P20671

Elongation factor 2 P 13639

Heat shock protein HSP 90-alpha P07900

GTP-binding nuclear protein Ran P62826

60S ribosomal protein L4 P36578

40S ribosomal protein S9 P46781

Profilin-1 P07737

60S ribosomal protein L13a P40429

Phosphoglycerate kinase 1 P00558

Fatty acid synthase P49327

Annexin A1 P04083

Histone H2A.Z P0C0S5

Vimentin P08670

40S ribosomal protein S6 P62753

Moesin P26038

Peptidyl-prolyl cis-trans isomerase A P62937

60S ribosomal protein L26 P61254

60S ribosomal protein L3 P39023

40S ribosomal protein S8 P62241

60S ribosomal protein L28 P46779

Ezrin P1531 1

40S ribosomal protein S4, X isoform P62701

60S ribosomal protein L7a P62424

60S ribosomal protein L13 P26373

60S ribosomal protein L7 P18124

40S ribosomal protein S23 P62266

60S ribosomal protein L5 P46777

Eukaryotic initiation factor 4A-I P60842

40S ribosomal protein S24 P62847

Tubulin beta-2B chain Q9BVA1

60S ribosomal protein L8 P62917

60S ribosomal protein L15 P61313

60S ribosomal protein L10 P27635

Peroxiredoxin-1 Q06830

Keratin, type I cytoskeletal 14 P02533

14-3-3 protein theta P27348

40S ribosomal protein S18 P62269

Transketolase P29401

60S ribosomal protein L24 P83731

Histone H1.5 P16401

Cofilin-1 P23528

Dihydropyrimidinase-related protein 3 Q14195 60S ribosomal protein L21 P46778

60S ribosomal protein L36 Q9Y3U8

Sodium/potassium-transporting ATPase subunit P05023

alpha-1

40S ribosomal protein S16 P62249

T-complex protein 1 subunit gamma P49368

Heterogeneous nuclear ribonucleoprotein A1 P09651

60S ribosomal protein L14 P50914

Heat shock 70 kDa protein 1A/1 B P08107

T-complex protein 1 subunit theta P50990

60S ribosomal protein L30 P62888

Protein S100-A6 P06703

40S ribosomal protein SA P08865

CD44 antigen P16070

60S ribosomal protein L35a P18077

Tubulin beta-3 chain Q13509

T-complex protein 1 subunit delta P50991

4F2 cell-surface antigen heavy chain P08195

T-complex protein 1 subunit beta P78371

Myosin-9 P35579

Adenosylhomocysteinase P23526

Filamin-A P21333

Fatty acid-binding protein, brain 015540

Myristoylated alanine-rich C-kinase substrate P29966

T-complex protein 1 subunit eta Q99832

Fascin Q 16658

Fructose-bisphosphate aldolase A P04075

60S ribosomal protein L27 P61353

60S ribosomal protein L17 P18621

Heterogeneous nuclear ribonucleoproteins A2/B1 P22626

60S ribosomal protein L10a P62906

60S ribosomal protein L35 P42766

Table 21 : 100 most abundant proteins (name and SwissProt accession number) in CTX0E03 microvesicles

Discussion of proteomic data

CD63 (also known as MLA1 and TSPAN30), TSG101 (also known as ESCRT-I complex subunit TSG101), CD109 (also known as 150 kDa TGF-beta-1 -binding protein) and thy-1 (also known as CD90) were detected in both exosomes and microvesicles.

Other tetraspanins were also detected: Tetraspanin-4, -5, -6, -9 and 14 were detected in the exosome fraction; tetraspanins-6 and -14 were detected in the microvesicles. CD133 (also known as AC133, Prominin-1 , PROM 1 , PROM L1 and MSTP061 ) was detected in the exosomes but not the microvesicles. CD53 (also known as MOX44 and TSPAN25), CD82 (also known as KAI 1 , SAR2, ST6 and TSPAN27), CD37 (also known as TSPAN26) and CD40 ligand (also known as CD40LG, CD40L and TNFSF5) were not detected in the exosomes or the microvesicles.

Nestin, GFAP and tubulin beta-3 chain (also known as TUBB3) were detected in both the exosome and microvesicle fractions, with tubulin beta-3 chain being particularly prominent within the top 100 proteins in both fractions. Sox2, DCX, GALC, GDNF and IDO were not detected.

Selectins and TNFRI (also known as TNF receptor 1 , TNFRSF1A, TNFAR and TNFR1 ) were not detected.

Integrin alpha-2, -3, -4, -5, -6, -7, -V and integrin beta-1 , -4 and -8 were detected in both exosome and microvesicle fractions. Integrin beta-3 and -5 were detected in the microvesicles only.

MHC Class I antigens (e.g. HLA_A1 , HLA-A2 and HLA-B27) were detected in both the exosomes and microvesicles.

Cell-adhesion molecules (e.g. CADM 1 , CADM4, ICAM 1 , JAM3, L1 CAM, NCAM) were detected in both the exosomes and microvesicles.

Cytoskeletal proteins (e.g. actin, vimentin, keratins, catenins, dystroglucan, neurofilament polypeptide, microtubule-associated protein, tubulin, desmoplaktin, plectin, plakophilin, septin, spectrin, talin, vinculin and zyxin) were detected in both the exosome and microvesicle fractions.

GTPases, clathrin, chaperones, heat-shock proteins (e.g. Hsp90, Hsp70), splicing factors, translation factors, annexins and growth factors (e.g. TGF-beta) were detected in both the exosomes and microvesicles. Galectin-3, TIMP-1 , thrombosponding-1 , EGF receptor and CSK were detected in both the exosomes and microvesicles. Figure 18 compares the proteomic data from the exosomes and microvesicles. Figure 18A illustrates the number of unique proteins within each micro particle population, isolated from week 2 Integra culture system. Figure 18B compares the biological processes associated with the identified proteins within each micro particle population, isolated from week 2 Integra system. The proteins identified within exosomes and microvesicles are associated with very similar biological processes.

Proteins associated with biotin metabolism were only found in exosomes and proteins involved in tryptophan biosynthesis and taurine/alpha-linolenic acid metabolism were only identified in microvesicles.

Figure 18C compares the CTX0E03 proteome to the Mesenchymal Stem Cell exosome proteome disclosed in Lai et al 2012, in which a total of 857 proteins were identified in exosomes released from mesenchymal stem cells.

Figure 18D compares the biological processes associated with the identified proteins within the MSC derived exosomes (Lim 2012) with the neural stem cell derived exosomes of the invention. The three biological processes found to be associated with the MSC derived exosomes only are (in decreasing order of significance): Asthma; phenylalanine, tyrosine and tryptophan biosynthesis; and primary immunodeficiency. The thirty biological processes found to be associated only with the neural stem cell derived exosomes are shown in Figure 19; the most significant biological function identified relates to RNA polymerase.

A further comparison of the 197 biological processes shared by both MSC derived exosomes and NSC derived exosomes shows that NSC exosomes contain notably more processes involved in RNA degradation, the Ribosome and spliceosomes, when compared to MSC exosomes.

The above comparison indicates a number of significant differences between NSC derived exosomes and MSC derived exosomes (as characterised by Lim et al 2012). The 4 most significant biological differences identified as present in NSC exosomes compared to being very low/absent in those identified by the Lim's group, all involve proteins associated with the production, packaging, function and degradation of genetic material, i.e RNA polymerase, RNA degradation, Ribosome and spliceosomes.

Example 14: Size distribution of Microparticles NanoSight analysis was undertaken to determine the particle size and concentration of microvesicles ("mv1" to "mv6") and exosomes ("exol" to "exo6") isolated from CTX0E03 cells cultured in the Integra Celline system for 1 , 2, 3, 4, 5 and 6 weeks. All results are based on 5 replicate measurements.

Particle size distribution was measured using Nanoparticle Tracking Analysis (NTA). NTA detects the movement of particles in solution and relates it to particle size. Mode and median particle size was calculated for all samples. Exosome samples were analysed using the most sensitive camera settings in order to capture the smallest vesicles. Microvesicle samples were analysed using less sensitive camera settings to prevent over exposure of the larger vesicles. As a result, some smaller vesicles were not detected in the samples. Although smaller vesicles were present in the MV samples, these represent a small percentage of the sample in terms of mass. A proportion of Exo1 was labelled with a fluorescent membrane-specific dye (CellMask™) and a combination of NTA analysis with the CellMask™ labelling confirmed that the events detected by NTA correspond to membrane vesicles (data not shown).

The results are shown in Table 22 below, and in Figure 17.

The exosomes show a drop in size at week six, from a mode of approximately 110nm to approximately 70nm, or from a median of approximately 130nm to approximately 75nm. The overall size range, from 70nm to 150nm, is consistent with the size of exosomes from other cell types, described in the art. The observed reduction in size of the exosomes to around 70nm diameter after culturing the cells for 6 weeks correlates with the increased efficacy of exosomes isolated from CTX0E03 cells that have been cultured in a multi-compartment bioreactor for 6 weeks correlates, as reported in Example 8 and Figure 6.

It is also noted that the concentration of microvesicles and exosomes decreases over the six week period of Figure 17, broadly mirroring the improved efficacy observed over time.

The microvesicles are, as expected, larger, with a mode diameter of approximately 150nm - 200nm, or a median diameter of approximately 180nm - 350nm.

Concentration

Sample Count Dilution xl0 12 /ml Mode (nm) Median (nm)

Exol (1) 5.204 10000 32.26 107 151

Exol (2) 1.734 10000 10.75 135 164

Exol (3) 6.55 10000 40.61 108 128 Exo2 14.33 10000 88.85 118 153

Exo3 (1)* 2.52 10000 15.62 89 115

Exo3 (2) 10.06 10000 62.37 115 146

Exo3 (3) 8.98 10000 55.68 128 147

Exo4 (1) 3.04 10000 18.85 111 136

Exo4 (2) 2.89 10000 17.92 110 120

Exo4 (3) 2.77 10000 17.17 116 134

Exo5 (1) 2.34 100 0.15 99 117

Exo5 (2) 2.02 100 0.13 102 124

Exo 5 (3) 2.08 100 0.13 116 127

Exo6 (1) 1.45 100 0.09 68 74

Exo6 (2) 1.19 100 0.07 69 75

MV1 (1) 9.314 200 1.15 183 212

MV1 (2) 10.76 200 1.33 161 214

MV1 (3) 10.738 200 1.33 173 198

MV2 5.89 1000 3.65 177 194

MV3 (1)* 5.68 2000 7.04 150 186

MV3 (2) 11.5 2000 14.26 221 351

MV3 (3) 9.57 2000 11.87 214 270

MV4 (1) 4.894 400 1.21 209 240

MV4 (2) 2.934 1000 1.82 195 212

MV4 (3) 2.55 1000 1.58 184 221

MV5 (1) 1.086 200 0.13 164 237

MV5 (2) 1.458 200 0.18 205 205

MV 5 (3) 1.3 200 0.16 219 210

MV6 (1) 0.346 200 0.04 171 186

MV6 (2) 0.37 200 0.05 168 212

Media 0.14 10 0.00 100 149

* large aggregates.

Table 22: Size distribution of CTX0E03 microvesicles and exosomes. REFERENCES

Ambros et al RNA 2003. 9: 277-279

Banerjee, S., Williamson, D., Habib, N., Gordon, M., Chataway, J. (201 1) Age and Ageing 40:7- 13

Chung ef a/.,Cell Stem Cell, 2, 113-117, 2008

Ding, D. C, Shyu, W. C, Lin S. Z. (2011) Cell Transplant 20: 5-14

Einstein, O., Ben-Hur, T. (2008) Arch Neurol 65:452-456

Gennaro (2000) Remington: The Science and Practice of Pharmacy. 20th edition, ISBN: 0683306472

Hassani Z, O'Reilly J, Pearse Y, Stroemer P, Tang E, Sinden J, Price J, Thuret S. "Human neural progenitor cell engraftment increases neurogenesis and microglial recruitment in the brain of rats with stroke." PLoS One. 2012;7(1 1):e50444. doi: 10.1371/journal. pone.0050444. Epub 2012 Nov 21.

Hodges et al. Cell Transplant. 2007;16(2): 101 -15

Horie, N., Pereira, N.P., Niizuma, K. Sun, G. et al. (2011) Stem Cells 29:274-285.

Katsuda, Kosaka, Takeshita, Ochiya. Proteomics 2013, 00, 1 -17

Katsuda, Tsuchiya, Kosaka, Yoshioka, Takagaki, Oki, Takeshita, Sakai, Kuroda, Ochiya. Scientific Reports 2013, 3: 1 197, p1 -1 1.

Klimanskaya et al., 2006, Nature 444:481 -485

Kornblum, Stroke 2007, 38:810-816

Lai et al "Proteolytic Potential of the MSC Exosome Proteome: Implications for an Exosome- Mediated Delivery of Therapeutic Proteasome". International Journal of Proteomics (2012) Article ID 971907, 14 pages.

Littlewood, T. D., Hancock, D. C, Danielian, P. S. et al. (1995) Nucleic Acid Research 23:1686- 1690.

Miljan, E.A. & Sinden, J.D. (2009) Current Opinion in Molecular Therapeutics 4:394-403

Miljan EA, Hines SJ, Pande P, Corteling RL, Hicks C, Zbarsky V, Umachandran, M, Sowinski P, Richardson S, Tang E, Wieruszew M, Patel S, Stroemer P, Sinden JD. Implantation of c-mycER TAM immortalized human mesencephalic-derived clonal cell lines ameliorates behavior dysfunction in a rat model of Parkinson's disease. Stem Cells Dev. 2009 Mar; 18(2):307-19 Mitchell et al Journal of Immunological Methods 335 (2008) 98-105

Pollock et al, Exp Neurol. 2006 May; 199(1): 143-55.

Mark F Pittenger; Alastair M Mackay; Stephen C Beck; Rama K Jaiswal; et al Science; Apr 2, 1999; 284, 541 1

Smith, E. J., Stroemer, R.P., Gorenkova, N., Nakajima, M. et al. (2012) Stem Cells 30:785-796. Stevenato, L, Corteling, R., Stroemer, P., Hope, A. et al. (2009) BMC Neuroscience 10:86 Stroemer, P., Patel, S., Hope, A., Oliveira, C, Pollock, K., Sinden, J. (2009) Neurorehabil Neural Repair 23: 895-909. Thery, C, Ostrowski, M., Segura, E. et al. (2009) Nature Reviews Immunology 9: 581-593 Their et al, "Direct Conversion of Fibroblasts into Stably Expandable Neural Stem Cells". Cell Stem Cell. 2012 Mar 20.

Timmers, L, Lim, S. K., Arslan, F., Armstrong, J. S. et al. (2007) Stem Cell Res 1 : 129-137 Yuan, S.J., Martin, J„ Elia, J., Flippin, J. et al. (2011) PLoS ONE 6:e17540




 
Previous Patent: ELECTRICAL CONNECTORS

Next Patent: WELLBORE COMPLETION