SUPERIOR CONJUGATIVE PLASMIDS DELIVERED BY BACTERIA TO EUKARYOTIC CELLS

FIELD

The present disclosure relates to conjugative plasmids, more particularly to conjugative plasmids delivered by bacteria to diverse recipient eukaryotic cells.

BACKGROUND ART

The fungal kingdom is exquisitely diverse and home to countless species with profound impacts on ecological nutrient cycling, industrial manufacturing, and health and disease in humans, animals, and plants ^{1 2} Yeast species are amongst the best-studied fungi and include the common yeast Saccharomyces cerevisiae, which is a primary fermenter of beer, wine, and bread, and a ubiquitous eukaryotic model system. S. cerevisiae is also an important synthetic biology chassis for the production of insulin, vaccine components, and other critical recombinant proteins ³ . The closely-related Saccharomyces boulardii is a promising probiotic therapeutic, particularly in the context of obesity and type 2 diabetes ⁴⁵ Yeasts are also critical components of the human microbiota, including Candida species associated with vaginal yeast infections and invasive candidiasis ⁶ , as well as Malassezia species with notable associations to Crohn’s disease and pancreatic cancer ⁷⁸ . The skin-associated yeast Candida auris is an emerging fungal pathogen that can cause life-threatening infections and is highly refractory to antifungal drug treatment ^{9- 11} . These diverse and critical roles in health, disease, and industrial manufacturing highlight the importance of studying and manipulating the biology of these key yeast species.

Given the diversity of yeast species and the breadth of niches they inhabit, there is a need to develop improved and innovative methods for DNA transformation in these organisms. Genetic transformation techniques enable the manipulation of genomes of industrially important yeasts, and further promote the ability to target, modify, or damage the genomes of fungal pathogens. Indeed, genetic-editing tools such as CRISPR have a promising role as novel antimicrobial agents due to their ability to specifically target pathogen-associated genes, leading to microbial death, growth inhibition, or targeted deletion of genes involved in antimicrobial resistance or virulence ^12-18 . However, laboratory-based transformation protocols typically rely on chemical strategies to promote DNA uptake, which is not broadly applicable for manipulating yeasts in their native environments, such as those inhabiting the microbiome. One innovative strategy to promote the uptake of genetic material in situ is to exploit bacterial conjugation as a viable mechanism to transfer plasmids from bacteria to a recipient microbe via the bacterial type IV secretion system. Previous work has demonstrated the utility of conjugation for transferring plasmids, including those encoding CRISPR-based antimicrobials, between bacterial species, both in vitro™ ²⁰ and in vivo in mouse microbiome models ^21-23 . While conjugation typically occurs between bacterial species, cross-kingdom conjugation from bacteria to yeast and algae has been demonstrated ^24-27 . Despite recently optimized protocols ²⁸²⁹ , conjugation to yeast still suffers from relatively low conjugation frequency compared to prokaryotic recipients.

The pTA-Mob 2.0 plasmid ²⁸ is an example of a conjugative plasmid and it is composed of genetic elements required for plasmid maintenance and transfer ³⁰³¹ . Two regions, Tra1 and Tra2, are responsible for the transfer of plasmid DNA. Tra1 harbors the relaxase- (traH-J), primase- (traA-G), and leader- (traK-M) operons, which together coordinate mobilization of the plasmid to the recipient ³¹ . The relaxase and leader operon encode the relaxosome, a protein complex essential for initial DNA-processing during conjugation. Assembly of the protein complex (TraH-J) is initiated by TraJ binding to the 19-bp inverted repeat sequence in the origin of transfer (oriT) ^32-34 The interaction of Tral and TraJ, which is stabilized by TraH, then orients the relaxase toward the n/c-site ³⁴ After formation of the relaxosome, Tral nicks and covalently binds to the plasmid DNA, ready for transfer to the recipient cell ³⁵ ’ ³⁶ . The efficiency of the nicking reaction is attenuated by the binding of TraK to the oriT which orients the plasmid DNA into a more favorable position ³³³⁷ . TraCI , of the primase operon, is a DNA primase that co-transfers (along with singlestranded binding (SSB) proteins) with the DNA to the recipient cell where it is involved in the restoration of a double-stranded plasmid ³⁸ . The primase operon also includes the TraG protein, which couples DNA processing by the relaxosome to DNA transfer by delivering the protein-DNA complex to the mating pair formation proteins ³⁹⁴⁰ . The Tra2 region contains proteins (TrbB-L, and TraF) required for mating pair formation, many of which are associated with the cell membrane. TrbC encodes a peptide responsible for forming the pilus. This peptide undergoes maturation by proteolytic cleavage followed by cyclization by TraF resulting in rigid pili ^{41 42} The pilus allows initial contact between the two cells and enables the transfer of single stranded plasmid DNA to the recipient cell.

SUMMARY

In one embodiment, the present disclosure relates to a DNA fragment for facilitating the transfer of a plasmid transferable (“transferable plasmid”) by conjugation from a donor bacterium to a recipient eukaryotic cell, the DNA fragment comprising a mutated traJ promoter operatively linked to a traJ gene that enables transfer of the transferable plasmid by conjugation from the donor bacterium to the recipient eukaryotic cell.

In one embodiment of the DNA fragment of the present disclosure, the transferable plasmid is self-transmissible.

In another embodiment of the DNA fragment of the present disclosure, the transferable plasmid is not self-transmissible.

In another embodiment of the DNA fragment of the present disclosure, the DNA fragment is included in the genome of the donor bacterium.

In another embodiment of the DNA fragment of the present disclosure, the DNA fragment is included in the transferable plasmid.

In another embodiment of the DNA fragment of the present disclosure, the DNA fragment is included in a non-transferable plasmid within the donor bacterium.

In another embodiment of the DNA fragment of the present disclosure, the DNA fragment further comprises a gene of interest.

In another embodiment of the DNA fragment of the present disclosure, the DNA fragment is included in the transferable plasmid and gene of interest can be expressed in the recipient eukaryotic cell. In another embodiment of the DNA fragment of the present disclosure, the gene of interest encodes for a protein that kills the recipient eukaryotic cell.

In another embodiment of the DNA fragment of the present disclosure, expression of the gene of interest is inducible.

In another embodiment of the DNA fragment of the present disclosure, the recipient eukaryotic cell is a fungal cell. In one aspect, the fungal cell is a yeast cell. In aspects, the yeast cell is any one of Saccharomyces cerevisiae, Candida auris, Candida bromeliacearum, Candida tolerans, Metschnikowia gruessii, Metschnikowia borealis, Metschnikowia pulcherrima and Metschnikowia lunata.

In another embodiment of the DNA fragment of the present disclosure, the recipient eukaryotic cell is an animal kingdom cell or a plant kingdom cell.

In another embodiment of the DNA fragment of the present disclosure, the recipient eukaryotic cell is a nematode cell.

In another embodiment of the DNA fragment of the present disclosure, the recipient eukaryotic cell is an algae cell.

In another embodiment of the DNA fragment of the present disclosure, the donor bacterium is a gram-negative bacterium.

In another embodiment of the DNA fragment of the present disclosure, the gram-negative bacterium is E. coli.

In another embodiment of the DNA fragment of the present disclosure, the donor bacterium is a probiotic.

In another embodiment of the DNA fragment of the present disclosure, the trad promoter is a trad promoter of a pTA-Mob 2.0 plasmid.

The DNA fragment according to any one of claims 1 to 20, wherein the mutated trad promoter includes the nucleotide sequence ccgag (SEQ ID NO: 3). The DNA fragment according to any one of claims 1 to 20, wherein the mutated traJ promoter comprises, or consists essentially of, or consists of SEQ ID NO: 2.

In another embodiment of the DNA fragment of the present disclosure, at least one of (i) the DNA fragment, (ii) the donor bacterium, (iii) the transferable plasmid and (iv) a non- transferable plasmid within the donor bacterium, includes further mutations that in combination with the mutated traJ promoter improves the transfer of the transferable plasmid from the donor bacterium to the recipient eukaryotic cell.

In another embodiment, the present invention provides for a bacterium for facilitating the transfer of a plasmid transferable (“transferable plasmid”) by conjugation from the bacterium to a recipient eukaryotic cell, the bacterium comprising: (i) a transferable plasmid and (ii) a DNA fragment carrying a mutated traJ promoter operatively linked to a traJ gene that enables transfer of the transferable plasmid by conjugation from the donor bacterium to the recipient eukaryotic cell.

In one embodiment of the bacterium of the present disclosure, the transferable plasmid is self-transmissible.

In another embodiment of the bacterium of the present disclosure, the transferable plasmid is not self-transmissible.

In another embodiment of the bacterium of the present disclosure, the DNA fragment is included in the genome of the bacterium.

In another embodiment of the bacterium of the present disclosure, the DNA fragment is included in the transferable plasmid.

In another embodiment of the bacterium of the present disclosure, the bacterium further includes a non-transferable plasmid and the DNA fragment is included in the non- transferable plasmid.

In another embodiment of the bacterium of the present disclosure, the DNA fragment further carries a gene of interest. In another embodiment of the bacterium of the present disclosure, the DNA fragment is included in the transferable plasmid and the gene of interest is expressed in the recipient eukaryotic cell.

In another embodiment of the bacterium of the present disclosure, the gene of interest encodes for a protein that kills the recipient eukaryotic cell.

In another embodiment of the bacterium of the present disclosure, expression of the gene of interest is inducible.

In another embodiment of the bacterium of the present disclosure, the recipient eukaryotic cell is a fungal cell.

In another embodiment of the bacterium of the present disclosure, the fungal cell is a yeast cell.

In another embodiment of the bacterium of the present disclosure, the yeast cell is of any one of Saccharomyces cerevisiae, Candida auris, Candida bromeliacearum, Candida tolerans, Metschnikowia gruessii, Metschnikowia borealis, Metschnikowia pulcherrima and Metschnikowia lunata.

In another embodiment of the bacterium of the present disclosure, the recipient eukaryotic cell is an animal kingdom cell or a plant kingdom cell.

In another embodiment of the bacterium of the present disclosure, the recipient eukaryotic cell is a nematode cell.

In another embodiment of the bacterium of the present disclosure, the recipient eukaryotic cell is an algae cell.

In another embodiment of the bacterium of the present disclosure, the bacterium is a gram -negative bacterium.

In another embodiment of the bacterium of the present disclosure, the gram-negative bacterium is E. coli. In another embodiment of the bacterium of the present disclosure, the bacterium is a probiotic.

In another embodiment of the bacterium of the present disclosure, the traJ promoter is of a pTA-Mob 2.0 plasmid.

In another embodiment of the bacterium of the present disclosure, the mutated traJ promoter includes the nucleotide sequence ccgag (SEQ ID NO: 3).

In another embodiment of the bacterium of the present disclosure, the mutated traJ promoter comprises, or consists essentially of, or consists of SEQ ID NO: 2.

In another embodiment of the bacterium of the present disclosure, at least one of the DNA fragment, the bacterium and the transferable plasmid, includes further mutations that in combination with the mutated traJ improves the transfer of the transferable plasmid from the donor bacterium to the recipient eukaryotic cell.

In another embodiment, the present disclosure relates to a method of conjugatively transferring a gene of interest from a donor bacterium into a recipient eukaryotic cell, the method comprising: (a) providing the bacterium of claim 28, the transferable plasmid including a gene of interest, and (b) conjugatively transferring the transferable plasmid from the bacterium to the recipient eukaryotic cell, thereby transferring the gene of interest to the recipient eukaryotic cell.

In one embodiment of the method of conjugatively transferring a gene of interest from a donor bacterium into a recipient eukaryotic cell, the gene of interest is operably joined to a promoter functional in the recipient eukaryotic cell.

In another embodiment of the method of conjugatively transferring a gene of interest from a donor bacterium into a recipient eukaryotic cell, the gene of interest is not native to the donor bacterium.

In another embodiment of the method of conjugatively transferring a gene of interest from a donor bacterium into a recipient eukaryotic cell, the gene of interest encodes a protein that kills the recipient cell. In another embodiment of the method of conjugatively transferring a gene of interest from a donor bacterium into a recipient eukaryotic cell, the recipient eukaryotic cell is a fungal cell, and the gene of interest encodes an antifungal protein that kills the fungal cell.

In another embodiment of the method of conjugatively transferring a gene of interest from a donor bacterium into a recipient eukaryotic cell, expression of the gene of interest is inducible.

In another embodiment of the method of conjugatively transferring a gene of interest from a donor bacterium into recipient eukaryotic cell, the mutated traJ promoter includes the nucleotide sequence ccgag (SEQ ID NO: 3).

In another embodiment of the method of conjugatively transferring a gene of interest from a donor bacterium into a recipient eukaryotic cell, the mutated traJ promoter comprises, or consists essentially of, or consists of SEQ ID NO: 2.

BRIEF DESCRIPTION OF THE DRAWINGS

The present disclosure will become more fully understood from the detailed description given herein and from the accompanying drawings, which are given by way of illustration only and do not limit the intended scope of the disclosure.

Fig. 1: Experiment Design. The eight-step flowchart shows experiments and major findings described in this disclosure.

Fig. 2: Transfer of minimized plasmids from E. coli to S. cerevisiae via conjugation. The pTA-Mob 2.0 plasmid was used as a template to create versions M1 - M4. M3C1 was used as a template to create M5 - M8. When available, two clones of the same plasmid were tested (e.g., M1 C1 and C2). Error bars represent the ± 95% confidence interval (Student’s f-test was used to carry out pairwise comparisons between pTA-Mob 2.0 (control) and minimized versions of pTA-Mob 2.0: * P < 0.05, ** P < 0.01 ; *** P < 0.001 ). N = 9 for all strains except N = 27 for pTA-Mob 2.0.

Fig. 3: Identification of mutations in M3C1 responsible for improved conjugation to S. cerevisiae. S. cerevisiae transconjugant colony formation on minimal plates lacking histidine following conjugation of control: pTA-Mob 2.0, M3C1 ; hybrid: M3C1/M3C2; or mutated pTA-Mob 2.0 Tp/To plasmids from E. coli. Plasmid schematics for M3C1_F1 - F5 generated by swapping PCR-amplified fragments from M3C1 into M3C2 are shown. Green arrows represent fragments originating from M3C1 and grey arrows represent fragments originating from M3C2. Mutations in pTA-Mob 2.0 Tp/To plasmids are indicated by green stars in the schematic of traJ (Tp, a cluster of mutations; and To, a single mutation). Transconjugant colony counts are reported below the plate images.

Figs. 4A-4C: Creation and analysis of the pSC5 conjugative plasmid. 4A) Schematic of pSC5 plasmid map. N - Nourseothricin resistance gene encoded with the standard code for diatom (green) or the alternative yeast nuclear code for Candidal Metschnikowia (orange; Note - Also correctly translated in S. cerevisiae), HCA - HIS3, CEN6 and ARS4 for selection, replication, and maintenance in S. cerevisiae. 4B) Conjugation frequency of pSC5 (grey) compared to pTA-Mob 2.0 (black) in either a cis or trans setup from E. coli to S. cerevisiae. 4C) Bacterial conjugation frequency of pSC5 from E. coli to E. coli in a c/s-configuration. Error bars represent the ± 95% confidence interval (Student’s /-test: * P < 0.05, ** P < 0.01 , *** P < 0.001 ). N=3 for cis- and N=4 for frans-experiment in S. cerevisiae and N=3 for c/s-experiment in E. coli.

Figs. 5A to 5C: Conjugation of pSC5 to wild yeast strains. 5A) pSC5 conjugated to S. cerevisiae and wild yeasts M. gruessi and C. auris were plated on YPD plates supplemented with NTC (100 pg mL ^-1 ). 5B, 5C) Diagnostic double restriction enzyme digestion (EcoRI-HF and Agel-HF) of pSC5 plasmid rescued from yeast strains. The expected band sizes for pSC5 are 20,808-, 15,855-, 7,314-, 6,848-, 3,189-, 1 ,610-, and 6-bp. Cbr - C. bromeliacearum, Ct - C. tolerans, Mb - M. borealis, Mp - M. pulcherrima, Mg - M. gruessi, Ml - M. lunata, Sc - S. cerevisiae, and Ca - C. auris. Ladder: 2-log ladder.

Figs. 6A to 6C: Development of pSC5 plasmid compatible with GG assembly. 6A) Two versions of the pSC5 plasmid were created. Version 1 (pSC5GGv1 ) has the mRFP landing pad located in the middle of the plasmid, and version 2 (pSC5GGv2) has the mRFP located between yeast elements HIS3 and CEN6-ARS4. 6B) Example of GG assembly to insert a gene of interest (ShBle) into pSC5GGv1. pSC5 - original plasmid, pSCGGvl - domesticated plasmid, pSC5GGv1_ShBle - a selected E. coli colony with ShBle inserted grown on LB plates supplemented with gentamicin (40 pg mL ^-1 ). 6C) Conjugation of pSC5 and pSC5GGv1_ShBle to S. cerevisiae. NTC - nourseothricin, Zeo - zeocin.

Figs. 7A to 7B: Conjugation-based antifungal. 7A) Diagram illustrating the predicted outcomes on S. cerevisiae colony formation following delivery of various plasmids via bacterial conjugation. The control strain (left) harboring pSC5 and pAGE2.0.T selected on synthetic yeast media lacking either histidine or tryptophan will survive. Conversely, the experimental strain (right) harboring pSC5-toxic gene plasmid and pAGE2.0.T when selected on synthetic yeast medium lacking histidine will die. 7B) Assay for S. cerevisiae colony formation on -HIS or -TRP media following bacterial conjugation with three toxic plasmids. pSC5-toxic1 - partially toxic gene identified in A. laidlawii, pSC5-toxic2 - H. influenzae Hindll restriction gene inserted in pSC5GGv1 , pSC5-toxic2 - H. influenzae Hindll restriction gene inserted in pSC5GGv2.

Fig. 8: Deletion plasmid assembly strategy. Each deletion plasmid was assembled from nine standard fragments as described in (Soltysiak et al. 2019) and two modified fragments amplified with original forward primer and new reverse primer and new forward primer and original reverse primer. After assembly, each deletion was genotyped by multiplex PCR.

Fig. 9: Bacterial conjugation from S. meliloti to S. cerevisiae. Representative plates of yeast transconjugants following conjugation from three S. meliloti clones harboring either pTA-Mob 2.0 or pSC5, plated on minimal media lacking histidine and containing ampicillin (100 pg mL’ ¹ ).

Fig. 10: Quantitative real-time polymerase chain reaction (qRT-PCR) of traJ expression, trad mRNA expression in E. coli harboring the conjugative plasmids pTA- Mob 2.1 and pSC5.1 by qRT-PCR. The mean ± SE are given for six biological replicates normalized to the reference genes rrsA and cysG. Student’s T-test was used to carry out the pairwise comparison between pTA-Mob 2.1 and pSC5.1 and asterisks denote the significant difference between pairwise comparison (*, P < 0.05; **, P < 0.01 ).

Fig. 11 : Bacterial conjugation from E. coli to diverse yeast species. Representative plates of yeast transconjugants following conjugation from E. coli harboring either pSC5 or pTA-Mob 2.0, plated on YPAD media supplemented with nourseothricin (100 pg mL’ ¹ ) and ampicillin (100 pg mL ^-1 ).

Figs. 12A to 12C: Conjugation frequency of pSC5 to Metschnikowia gruessi. 12A) Three replicates of M. gruessi transconjugants plated on five YPDA plates supplemented with nourseothricin (100 pg mL ^-1 ) and with ampicillin (100 pg mL ^-1 ). 12B) Dilution series (10’ ³ - 10 ^-5 ) of M. gruessi plated on YPDA plates supplemented with ampicillin (100 pg mL’ ¹ ). 12C) Average conjugation frequency of M. gruessi represents the mean ± standard deviation for three biological replicates.

Fig. 13: Genotyping transconjugants of diverse yeast species. Genotyping of diverse yeast strains following conjugation with E. coli harboring pSC5. Multiplex PCR was performed to amplify the nourseothricin resistance gene of amplicon size 283-bp. Ct - Candida tolerans, Cbr - Candida bromeliacearum, Mb - Metschnikowia borealis, Mp - Metschnikowia pulcherrima, Ml - Metschnikowia lunata, Cbe - Candida aff. bentonensis, Cub - Candida ubatubensis, Mg - Metschnikowia gruessi, Sc - Saccharomyces cerevisiae, Ca - Candida auris, B - big colony, M - medium colony, and S - small colony. Clones highlighted in green were further analyzed with restriction enzyme digest and a phenotypic conjugation screen (Fig. 5, Fig. 14).

Fig. 14: Phenotypic E. coli to E. coli conjugation screen of recovered transconjugant plasmids from diverse yeast species. Selected recovered pSC5 plasmids from big diverse yeast colonies and S. cerevisiae colonies were transformed into E. coli and tested for conjugation to E. coli harboring pAGEl .O. Transconjugant E. coli were spot plated on LB plates supplemented with chloramphenicol (30 pg mL’ ¹ ) and gentamicin (60 pg mL’ ¹ ). Ct - Candida tolerans, Cbr - Candida bromeliacearum, Cbe - Candida bentonensis, Cub - Candida ubatubensis, Mb - Metschnikowi borealis, Mp - Metschnikowi pulcherrima, Ml - Metschnikowi lunata, Mg - Metschnikowi gruessi, Sc - S. cerevisiae, Ca - Candida auris, Ec - Escherichia coli, B - Big colony, -ve - Negative (S. cerevisiae only).

Figs. 15A-15C. Testing of plasmid pSC6 and inducible conjugation from E. coli to E. coli. 15A: A schematic representing the movement of the inducible conjugative plasmid pSC6 which contains a gentamicin (GM) marker, to the recipient cell which contains a tetracycline (Tet) marker. It also shows arabinose binding to a regulatory protein and to enable expression of gene 11 (TrbF), enabling conjugation. 15B: During conjugation strains were either induced with arabinose (100 pg/mL) or remained uninduced. They were then plated on selection plates supplemented with gentamicin (40 pg/mL) and tetracycline (10 pg/mL). pSC5 induced and uninduced are the positive controls. 15C: Bar graph showing the average transconjugants/mL for each donor strain. A student’s T-test was performed to analyze the difference between induced pSC6, which contains our inducible cassette, and induced pSC5, the positive control. There was a significant decrease in average transconjugants/ mL in pSC6 (p = 0.00018, n = 3).

DETAILED DESCRIPTION

1. Definitions

For convenience, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

The articles "a" and "an" are used herein to refer to one or more than one (i.e. , to at least one) of the grammatical object of the article.

As used herein, the term "comprising" is intended to mean that the compounds, compositions and methods include the recited elements, but not exclude others. "Consisting essentially of' when used to define compounds, compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants, e.g., from the isolation and purification method and pharmaceutically acceptable carriers, preservatives, and the like. "Consisting of' shall mean excluding more than trace elements of other ingredients. Embodiments defined by each of these transition terms are within the scope of this technology.

All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (-) by increments of 1 , 5, or 10%. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term "about." It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.

Terms of degree such as "substantially", "about" and "approximately" as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least +/- 5% of the modified term if this deviation would not negate the meaning of the word it modifies.

A “conjugative plasmid” is a plasmid that is transferred from one organism, such as a bacterial cell, to another organism during a process termed conjugation. The term refers to a self-transmissible plasmid that carries genes promoting the plasmid’s own transfer by conjugation. C/s-conjugative plasmids carry their own origin of replication, oriV, and an origin of transfer, oriT, and genes promoting the plasmid’s own transfer by the conjugation process. When conjugation is initiated, a relaxase enzyme creates a “nick” in one plasmid DNA strand at the oriT. The enzyme may work alone or in a complex of over a dozen proteins. The transferred, or T-strand, is unwound from the plasmid and transferred into the recipient bacterium in a 5' -terminus to 3' -terminus direction through a conjugative pilus. The remaining strand is replicated, either independent of conjugative action (vegetative replication, beginning at the oriV) or in concert with conjugative replication. Conjugation functions can be plasmid encoded, but some conjugation genes can be found in the bacterial chromosome or another plasmid and can exhibit their activity in trans to a separate plasmid that encodes the oriT sequence. Numerous conjugative plasmids are known, which can transfer associated genes within one species (narrow host range) or between many species (broad host range). A Trans- conjugative plasmid is a plasmid that is mobilizable but not self-transmissible. Conjugation can occur between species classified as different at any taxonomic level — including in the extreme between domains, e.g., bacteria to eukaryotes.

“Food grade” bacteria are bacteria that are approved for human or animal consumption. oriT: Site of origin of transfer replication. The mechanism of plasmid transfer by bacterial conjugation includes a replication of the plasmid in which a break is introduced into one strand of duplex plasmid DNA, DNA replication then commences at the site of the break (oriT), together with transfer of the cut strand to the recipient cell.

Probiotic micro-organisms are known to have a beneficial effect on the health and wellbeing of the host. Typical probiotic bacteria that have been employed in this respect belong to the Lactobacillus or the Bifidobacterium genus, such as Bifidobacterium longum, Bifidobacterium lactis, Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus paracasei, Lactobacillus johnsonii, Lactobacillus plantarum, Lactobacillus salivarius, Enterococcus faecium, Saccharomyces boulardii, Lactobacillus reuteri.

“Superior conjugative plasmid” in this document, means a conjugative plasmid that promotes an increased conjugation frequency from a bacterium to a recipient eukaryotic species relative the conjugative frequency observed with pTA-Mob 2.0 when tested in cis (mobilizing itself) and/or trans (mobilizing another plasmid).

2. Overview

The present disclosure relates to improved DNA transfer from bacteria to a recipient cell of a eukaryotic species by optimizing the trad promoter.

A DNA fragment comprising cluster mutation in the relaxase operon, specifically in the trad promoter, significantly improved DNA conjugative transfer from bacteria to recipient eukaryotic cells, such as S. cerevisiae and diverse yeasts, including the emerging pathogen C. auris. Improved, streamlined, and Golden Gate assembly-compatible plasmid derivatives of pTA-Mob 2.0 have been generated to enable facile insertion of custom genetic cassettes. The designer DNA fragments of the present disclosure can be used as a novel antifungal reagent, with important applications for the development of next-generation antifungal therapeutics.

As such, in one embodiment, the present disclosure provides for a DNA fragment for facilitating superior conjugative transfer of a transferable plasmid from a donor bacterium to a recipient eukaryotic cell. In embodiments, the DNA fragment comprises a mutated traJ promoter operatively linked to a traJ gene that enables improved transfer of the transferable plasmid by conjugation from the donor bacterium to the recipient eukaryotic cell relative to a native traJ promoter. In one embodiment, the mutated traJ promoter includes the nucleotide sequence ccgag (SEQ ID NO: 3). In another embodiment, the mutated traJ promoter comprises, consists essentially of, or consists of SEQ ID NO: 2.

In embodiments the transferable plasmid is a c/s-conjugative plasmid (i.e., self- transmissible). In embodiments, the transferable plasmid is a frans-conjugative plasmid (not self-transmissible).

In one embodiment, the DNA fragment is included in the genome of the donor bacterium. In another embodiment, the DNA fragment is included in the transferable plasmid. In another embodiment, the DNA fragment is included in a non-transferable plasmid within the donor bacterium.

In embodiments, the DNA fragment includes a gene of interest. In embodiments, the gene of interest can be included in the genome of the donor bacterium or in a non- transferable plasmid within the donor bacterium.

In embodiments, the gene of interest is included in the transferable plasmid. In embodiments, when the transferable plasmid is transferred to the recipient eukaryotic cell, the gene of interest is expressed in the recipient cell to encode for a protein of interest.

In embodiments, the gene of interest is an inducible gene. The inducible gene can be located in the genome of the donor bacteria, in the transferable plasmid or on any non- transferable plasmid within the donor bacteria. In addition, the inducible gene can be transferred to a eukaryotic cell (for example to kill it) but it can also have a function in the donor bacterial cell (for example to build the conjugation machinery that allows for the transfer of DNA).

The DNA fragments carrying the mutant traJ promoter linked to the traJ gene of the present disclosure provides superior conjugative transfer of a transferable plasmid from a donor bacterial cell to a recipient cell of a eukaryotic species (i.e. , eukaryotic cell). In embodiments the eukaryotic species is a species of the fungal kingdom.

In embodiments, novel DNA fragments have been developed and validated for improved conjugation efficiency between bacteria and diverse yeast species, including Saccharomyces cerevisiae, Candida auris, Candida bromeliacearum, Candida tolerans, Metschnikowia gruessii, Metschnikowia borealis, Metschnikowia pulcherrima and Metschnikowia lunata.

In embodiments, the recipient eukaryotic cell is an animal kingdom cell or a plant kingdom cell.

In embodiments, the recipient eukaryotic cell is a nematode cell.

In embodiment, the recipient eukaryotic cell is an algae cell.

In embodiments, the donor bacterium is a gram-negative bacterium, such as E. coli.

In embodiments, the donor bacterium is a gram-positive bacterium, including probiotics.

In embodiments, at least one of (i) the DNA fragment, (ii) the donor bacterium, (iii) the transferable plasmid, and (iv) any non-transferable plasmid within the donor bacterium, includes further mutations that in combination with the mutated traJ promoter improves the transfer of the transferable plasmid from the donor bacterium to the recipient eukaryotic cell.

In another embodiment, the present disclosure provides for bacteria having a transferable plasmid and a DNA fragment of the present disclosure. As previously described, the DNA fragment can be located in the genome of the bacteria, the transferable plasmid or in any non-transferable plasmid within the bacteria. The bacteria of the present disclosure can be gram-negative such as E. coli, or grampositive. In embodiments, the bacteria are probiotic bacteria. Non-limiting examples of probiotic bacteria that can be used as donor bacteria in the present disclosure include Lactobacillus acidophilus, Lactobacillus rhamnosus GG, Saccharomyces boulardii, Bifidobacterium bifidum and Bacillus coagulans.

In one embodiment, the present disclosure provides for a method of conjugatively transferring a gene of interest from a donor bacterium into a recipient eukaryotic cell, the method comprising: (a) providing the bacterium of the present disclosure in which the transferable plasmid includes the gene of interest, and (b) conjugatively transferring the transferable plasmid from the bacterium to the recipient eukaryotic cell, thereby transferring the gene of interest to the recipient eukaryotic cell.

In one embodiment of the method of transferring the gene of interest, the gene of interest is operably joined to a promoter functional in the recipient cell of the recipient eukaryotic cell.

In another embodiment, the gene of interest is not native to the donor bacterium.

The gene of interest includes genes that provide new functions to the recipient eukaryotic cell, delete genes from the recipient eukaryotic cell, and/or kills the recipient eukaryotic cell. For example, when the recipient eukaryotic cell is a cell of the fungal kingdom, the plasmid of the present disclosure may include a gene that expresses in the recipient cell an antifungal protein. In embodiments, the gene of interest is inducible.

EXAMPLES

The examples are described for the purposes of illustration and are not intended to limit the scope of the disclosure. The Examples form part of the description.

1. MATERIALS AND METHODS

1.1 Experimental design The eight-step flowchart shows experiments and major findings of the present disclosure is described in Fig. 1 .

1.2 Microbial strains and growth conditions

Saccharomyces cerews/ae VL6-48 (ATCC MYA-3666: MATo, his3-A200, trp1-A1, ura3- 52, Iys2, ade2-101, met14, psi + c/r°) was grown at 30°C in rich medium (2 x YPDA: 20 g L’ ¹ yeast extract (BioShop Canada Inc., Cat #: YEX401.1 , Canada), 40 g L’ ¹ peptone (BioShop Canada Inc., Cat #: PEP403.1 , Canada), 40 g L’ ¹ glucose (BioShop Canada Inc., Cat #: GLU501 .205, Canada), and 200 mg L’ ¹ adenine hemi-sulfate (MilliporeSigma, Cat #: A2545, Germany) supplemented with ampicillin (100 pg mL’ ¹ ; BioBasic, Cat #: AB0028, Canada)); or, grown with selection on either: 1 ) yeast synthetic complete medium lacking histidine supplemented with adenine hemi-sulfate (Teknova, Inc., Cat #: C7112, USA), 2) yeast synthetic complete medium lacking tryptophan (Teknova, Inc., Cat #: C7131 , USA), 3) 2 x YPDA supplemented with nourseothricin (100 pg mL’ ¹ ; Jena BioScience, Cat #: AB-102XL, Germany), or 4) 2 x YPDA supplemented with zeocin (100 pg mL’ ¹ ; Invivogen, Cat #: ant-zn-5p, USA). Solid yeast media contained 2% agar (BioShop Canada Inc., Cat # AGA001.500, Canada). Following spheroplast transformation, all complete minimal media used contained 1 M sorbitol (BioShop Canada Inc., Cat #: SOR508.5, Canada). Escherichia coli Epi300 (Lucigen Corp., Cat #: LGN- EC300110, USA) was grown at 37°C in Luria Broth (LB) supplemented with appropriate antibiotics (gentamicin (40 pg mL’ ¹ ; BioBasic, Cat #: GB0217, Canada) and chloramphenicol (15 pg mL’ ¹ ; BioBasic, Cat #: CB0118, Canada)). Solid media contained 1.5% agar. For transformation of E. coli SOC medium (20 g L’ ¹ tryptone, 5 g L’ ¹ yeast extract, 0.5 g L’ ¹ NaCI, 10 mL 250 mM KCI, 5 mL 2M MgCl2, 20 mL 1 M glucose) was used during the recovery time. Diverse yeasts, Metschnikowia gruessii (H53), Metschnikowia pulcherrima (CBS 5833), Metschnikowia lunata (BS 5946), Metschnikowia borealis (SUB 99-207.1 ), C. auris, Candida tolerans (UWOPS 98-117.5), Candida bromeliacearum (UNESP 00-103), Candida pseudointermedia (UWOPS 11 -105.1 ), Candida ubatubensis (UNESP 01 -247R), and Candida aff. bentonensis (UWOPS 00-168.1 ) were grown at 30°C in 2 x YPDA (All diverse yeast were obtained from Dr. Marc-Andre Lachance collection at Western University except C. auris came from https://wwwn.cdc.gov/arisolatebank/ accession number SAMN05379609). Sinorhizobium meliloti (Rm4123 R-; obtained from Finan Lab, McMaster University) was grown at 30°C in LBmc medium (10 g L ^-1 tryptone, 5 g L ^-1 yeast extract, 5 g L ^-1 NaCI, 0.301 g L ^-1 MgSCM, and 0.277 g L ^-1 anhydrous CaCl2) supplemented with appropriate antibiotics (gentamicin 40 pg mL’ ¹ and streptomycin 100 pg mL’ ¹ ; BioBasic, Cat#: SB0494, Canada). Solid media contained 1.5% agar.

1.3 Plasmid construction

1.3.1 PCR amplification

Plasmid fragments were amplified with GXL polymerase (Takara Bio Inc., Cat #: R050A, Japan) according to the manufacturer's instructions using annealing temperatures between 50 - 60°C and 25 - 30 cycles.

1.3.2 Plasmid assembly in yeast

Plasmids were assembled in yeast as previously described ²⁸ . Primers for deletion plasmids are listed in Table 2 and all primers and templates used to generate other plasmids are listed in Table 3: 1) Single gene/fragment deletion plasmids: pTA-Mob 2.0 plasmid was used as a template. Each plasmid was created with nine standard fragments as previously described ²⁸ and two additional fragments designed as shown in Fig. 8. 2) Minimized plasmids (M1 - 8): Eight minimized conjugative plasmids (M1 - 8) were designed based on the results obtained for the pTA-Mob 2.0 deletion plasmids. pTA- Mob 2.0 or M3C1 plasmid was used as a template for PCR fragments listed in Table 3. 3) M3C1_F1-F5 hybrid plasmids: These plasmids were assembled by swapping the fragments between M3C1 and M3C2. 4) pTA-Mob 2.0 Tp and pTA-Mob 2.0 To: Primer- mediated mutagenesis was performed to introduce each mutation (Tp- in traJ promoter and To- in traJ ORF) into pTA-Mob 2.0. 5) Superior conjugative plasmid (pSC5): The pSC5 plasmid was derived from M3C1 plasmid by the addition of two versions of Nourseothricin N-acetyl transferase (NAT genes which provide resistance for nourseothricin antibiotic. The first version was amplified from a plasmid pTA-Mob-NAT (unpublished, Karas lab) allowing selection in diatoms and referred to as dNAT, and the version was amplified from pGMO1 (unpublished, Karas lab), which contained an alternative genetic code for selection in diverse yeasts as previously described ⁴³ and referred to as yNAT. The remaining fragments of the pSC5 plasmid were amplified from M3C1 as previously described ²⁸ 6) pTA-Mob 2.1/pSC5.1. These two plasmids were created lacking the second copy of traJ located in the vector backbone. 7) Domesticated pSC5 (pSC5GGv1/v2): Two Bsal cut sites located within the fcpD Promoter and traCI ORF were removed from pSC5 using primer-mediated mutagenesis. An RFP landing pad, consisting of a monomeric Red Fluorescent Protein (mRFP) gene driven by an arabinose- inducible pBAD promoter and a terminator was amplified from pAGE2.0-i (unpublished, Karas lab) using primers designed with new Bsal cut sites and homology either to directly downstream the native l-Scel restriction site (pSC5GGv1 ), or within the HIS3/CEN6/ARS4 element of the vector backbone (pSC5GGv2).

1.3.3 Golden Gate assembly

1) Golden Gate (GG) assembly. For GG assembly, 20 fmol of plasmid and insert were mixed in a 15 pL reaction with 1.0 pL T4 DNA ligase (New England BioLabs, Inc., Cat #: M0202L, USA), 0.5 pl Bsal-HF V2 (New England BioLabs, Inc., Cat #: R3733S, USA), using the following conditions: 10 cycles of 37°C for 5 minutes and 16°C for 10 minutes followed by incubation at 37°C for 5 minutes, 80°C for 10 minutes and infinite hold at 12°C. Primers are listed in Table 3. 2) pSC5GGv1_ShBle. The zeocin (ShBle) resistance marker cassette was amplified with flanking Bsal cut sites from pRS32 (unpublished, Shapiro Lab) and GG assembly was performed with pSC5GGv1. The primers used are listed in Table 3. 3) pSC5-toxic1, pSC5-toxic2, and pSC5-toxic3. Three versions of toxic plasmids to kill yeast cells were created, one with an Acholeplasma laidlawii toxic gene (ACL0117) ⁴⁴ and two versions with the restriction enzyme Hindll. The A. laidlawii and Hindll cassettes both contained an ACT1 yeast intron, flanking Bsal cut sites, and either an A. laidlawii or Hindll toxic gene. The A. laidlawii toxic gene cassette was amplified in three fragments: the ACT1 yeast intron from S. cerevisiae VL6-48 gDNA, and the toxic gene in two halves from A. laidlawii PG-8A gDNA with primers listed in Table 3. The A. laidlawii toxic gene cassette was then constructed through a hierarchical GG assembly. First, the ACT1 yeast intron and the second half of the A. laidlawii toxic gene were assembled by GG assembly, and then 1 pL of the product was used as a template for PCR amplification of the joined fragments. Next, GG assembly was performed with 20 fmol of the PCR product with the first half of the toxic gene, and the complete toxic gene cassette was PCR amplified. The fully constructed cassette was then mixed with pSC5GGv1 , and GG assembly was performed. The Hindll cassette split by the ACT1 intron was flanked by URA3 promoter/terminator was synthesized (BioMatik, Canada), then PCR amplified and used in GG assembly with pSC5GGv1 or pSC5GGv2.

1.4 Plasmid analysis

Screening in yeast. Following yeast assembly of the pTA-Mob 2.0 deletion plasmids, 20 individual yeast colonies were passed twice on solid media lacking histidine, and DNA was isolated and screened by multiplex PCR using the Qiagen Multiplex Kit (Qiagen, Inc., Cat #: 206143, Germany) according to the Qiagen Multiplex PCR Handbook. For all other plasmids following yeast assembly, colonies were pooled rather than individually screened. Transformation to E. coli. Total DNA was isolated as previously described ²⁴ . Isolated DNA (0.5 - 2 pL) was added to E. coli Epi300 electro-competent cells (40 pL) and electroporated using the Gene Pulser Xcell Electroporation System (2.5 kV voltage, 25 pF capacitance, 200 Q resistance). Following a recovery in 1 mL of SOC medium for 1 hour at 37°C (225 RPM), a 100 - 250 pL aliquot of the transformants were plated on LB medium supplemented with gentamicin (40 pg mL’ ¹ ). The cells transformed with Golden Gate-compatible plasmids (pSC5GGv1/v2, pSC5-toxic1 , pSC5-toxic2, and pSC5- toxic3) were instead plated on LB plates containing gentamicin (40 pg mL’ ¹ ) and arabinose (100 pg mL’ ¹ ). Screening in E. coli. For Golden Gate-compatible plasmids, white colonies were then screened by multiplex PCR for insertion of the cassette of interest. For all other assembled plasmids, the transformed E. coli was pooled and conjugated to S. cerevisiae, DNA was re-isolated and transformed back to E. coli to focus screening on functional conjugative plasmids. Once in E. coli, all plasmids were genotypically screened using multiplex PCR and restriction enzyme digest analysis. Sequencing. The plasmids, pTA-Mob 2.0 Tp/To, underwent Sanger DNA sequencing (London Regional Genomics Centre at Robarts Research Institute) to ensure the introduction of the correct mutations using the primers listed in Table 3. Selected plasmids were sequenced at CCIB DNA Core at Massachusetts General Hospital or at the Western University sequencing facility.

1.5 Conjugation

1.5.1 Both donor (E. coli) and recipient (S. cerevisiae) strains were prepared and frozen prior to conjugation experiments. For E. coli strains, saturated overnight cultures inoculated with a single colony were diluted to ODeoo of 0.1 in 50 mL of LB medium supplemented with appropriate antibiotics (Table 1 ) and grown until an ODeoo of 1.0 was reached. The cells were pelleted (3,000 x RCF, 15 minutes) in a 50 mL Falcon tube and resuspended in 500 pL ice-cold 10% glycerol. Then, 100 pL aliquots in Eppendorf tubes were frozen in a -80°C ethanol bath and stored at -80°C. For S. cerevisiae recipient strain preparation, a culture was started from a single colony and grown in 5 mL of 2 x YPDA medium supplemented with ampicillin (100 pg mL ^-1 ) for 7 hours. After, this culture was diluted in 50 mL of 2 x YPDA medium supplemented with ampicillin (100 pg mL’ ¹ ) and grown until an ODeoo of 3.0 was reached (~17 hours). The cells were pelleted (3,000 x RCF, 5 minutes) in a 50 mL Falcon tube and resuspended in 1 mL of ice-cold 10% glycerol. Then, 250 pL aliquots in Eppendorf tubes were frozen in a -80°C ethanol bath, and stored at -80°C.

On the day of conjugation, conjugation plates (20 mL, 1.8% agar, 10% LB medium, complete minimal glucose broth lacking histidine) were dried for 30 minutes. Aliquots of the donor (E. coli) and recipient (S. cerevisiae) strains were removed from the freezer and thawed on ice for approximately 20 minutes. Next, 50 pL of S. cerevisiae was added to the 100 pL of E. coli and mixed by gentle pipetting before being transferred to the plate and spread evenly. Alternatively, when the yeast toxic plasmids were being tested, 10 pL of the recipient S. cerevisiae strain was used. Once dried, the plates were incubated at 30°C for 3 hours, or 12 hours when wild yeast strains were used as the recipient. The plates were scraped with 2 mL of sterile double-distilled water (sddH2O), mixed by vortexing for 5 seconds, and 100 pL plated on respective selection media (25 mL, 2% agar supplemented with ampicillin 100 pg mL’ ¹ ) listed in Table 1 . In the case of wild yeast strains, they were plated on 1 x YPDA medium supplemented with nourseothricin (100 g mL’ ¹ ) and two technical replicates of each dilution (10° - 10’ ¹ ) were plated on selective plates. For experiments evaluating conjugation of pSC5 in cis and trans, dilution series of 10° - 10’ ² were generated and plated on selective media while dilution series of 10’ ⁴ - 10’ ⁷ were generated and plated on non-selective medium (1 x YPDA supplemented with ampicillin 100 pg mL’ ¹ ); and two technical replicates were plated for each dilution.

1.5.2 Bacterial Conjugation

1.5.2.1 E. coli to E. coli- Cis- Configuration

E. coli donor and recipient strains were prepared as in Method section 1.5.1 except the donor strains were resuspended in 5 mL of ice-cold 10% glycerol, and 500 pL aliquots were prepared in 1.5 mL Eppendorf tubes. To assess conjugation of pSC5 in bacteria, two donor strains of E. coli harboring either pSC5 or pTA-Mob 2.0 and an E. coli recipient strain harboring pAGEl .O (chloramphenicol 15 pg mL’ ¹ ; Brumwell et al. 2019; Table 1 ) were prepared and stored in the -80°C freezer. On the day of the conjugation, conjugation plates (20 mL, LB media with 1 .5% agar) were prepared, and tubes containing the E. coli strains were removed from the freezer and thawed on ice. Once thawed, 10 pL of the donor E. coli strain was added to 100 pL of the recipient E. coli strain and mixed by pipetting prior to being transferred to the plate and spread evenly. Plates were incubated at 30°C for 90 minutes and then were scraped with 1 .5 mL of sterile double distilled water and mixed thoroughly by vortexing for 5 seconds. A dilution series (10’ ¹ - 10’ ⁸ ) was created in a 96-well plate and 100 pL of dilutions 10’ ¹ - 10’ ⁴ were plated on selection plates (25 mL, LB media with 1.5% agar supplemented with chloramphenicol 15 pg mL’ ¹ and gentamicin 40 pg mL’ ¹ ). On non-selective plates (LB media with 1.5% agar supplemented with chloramphenicol 15 pg mL’ ¹ ) 100 pL of dilutions 10’ ¹ - 10’ ⁸ were plated. Plates were incubated at 37°C overnight and the following morning the colonies were counted, and conjugation frequency was calculated (transconjugant CFU I recipient CFU).

1.5.2.2 S. meliloti to S. cerevisiae - Cis- Orientation S. meliloti was prepared similarly to E. coli', overnight cultures of a single colony were diluted to ODeoo of 0.1 in 50 mL of LB media with appropriate antibiotics (streptomycin 100 pg mL ^-1 and gentamicin 40 pg mL’ ¹ ) and grown until an ODeoo of 1.0 was achieved. On the day of conjugation, the conjugation plates (20 mL, yeast synthetic complete medium lacking histidine 1 .8% agar and 10% LBmc media) were made and the S. meliloti and S. cerevisiae cells were thawed on ice for approximately 20 minutes. Once thawed, 50 pL of S. cerevisiae was added to 100 pL of S. meliloti and mixed by gentle pipetting before being transferred to the plate and spread evenly. The plates were incubated at 30°C for 3 hours. Next, the plates were scraped with 2 mL of sddhhO and mixed thoroughly by vortexing for 5 seconds. For each conjugation, 3 biological replicates and 1 technical replicate were used and 100 pL of each dilution (10° - 10’ ¹ ) for each sample was plated on selection plates (25 mL, yeast synthetic complete medium lacking histidine, 2% agar, supplemented with ampicillin (100 pg mL’ ¹ )). The plates were incubated at 30°C, were scored after 4 days, and conjugation frequency was calculated.

1.5.2.3. Conjugation from E. coli to S. cerevisiae - Cis- and Trans- Configuration

To assess bacterial conjugation of pSC5 to S. cerevisiae in c/s-orientation two donor strains of E. coli harboring either pSC5 or pTA-Mob 2.0 (gentamycin 40 pg mL’ ¹ ) were prepared as in method section 2.5, and in trans- orientation two donor strains of E. coli harboring either pSC5 and pAGE2.0.T or pTA-Mob 2.0 and pAGE2.0.T (gentamycin 40 pg mL’ ¹ and chloramphenicol 15 pg mL’ ¹ ) were prepared as in method section 2.5 and all stored in the -80°C freezer. On the day of conjugation, the conjugation plates (cis - 20 mL, yeast synthetic complete medium lacking histidine 1.8% agar and 10% LB media; trans - 20 mL, yeast synthetic complete medium lacking tryptophan 1 .8% agar and 10% LB media) were prepared and the E. coli and S. cerevisiae cells were thawed on the ice for approximately 20 minutes. Once thawed, 50 pL of S. cerevisiae was added into the E. coli tube containing 100 pL of cells and mixed by pipetting before being transferred to the plate and spread evenly. The plates were incubated at 30°C for 3 hours. Next, the plates were scraped with 2 mL of sddhhO and mixed thoroughly by vortexing for 5 seconds. A dilution series (10’° - 10’ ⁷ ) was generated and two technical replicates of 100 pL for dilutions 10° - 10’ ⁴ were plated on selection plates (cis - 25 mL, yeast synthetic complete medium lacking histidine 2% agar supplemented with ampicillin (100 pg mL’ ¹ ); trans - 25 mL, yeast synthetic complete medium lacking tryptophan 2% agar supplemented with ampicillin (100 pg mL ^-1 )); and two technical replicates of 100 pL for dilutions for each sample (1 O’ ⁴ - 10’ ⁷ ) were plated on non-selective plates (25 mL, 1 x YPDA supplemented with ampicillin (100 pg mL’ ¹ )). The plates were incubated at 30°C, were scored after 4 days, and conjugation frequency was calculated.

1.5.2.4. Conjugation from E. coli to diverse yeast and transconjugant analysis

Conjugation proceeded as described in Methods 2.5, except once dried, the conjugation plates were incubated at 30°C for 12 hours and selection plates were incubated at 30°C for 3 days before the number of colonies was counted.

To test the recovery of pSC5 plasmid from diverse yeast transconjugants, the plasmid was isolated from selected diverse yeast transconjugants. The recovered plasmids were transformed into E. coli by electroporation and re-conjugated back from E. coli to diverse yeast species following the protocol in Method 2.5, except on selective plates spot plating rather than full plates were used. After conjugation, cells were scraped with 2 mL of sddh O. These cells were serially diluted in 96-well plates and 5 pL of different dilutions (10° - 10’ ⁴ ) were spot plated in 1 x YPDA media supplemented with nourseothricin (100 pg mL’ ¹ ).

1.5.2.5. Conjugation-based Kill Assay in S. cerevisiae

To assess yeast killing facilitated by bacterial conjugation, three donor E. coli strains harboring pAGE2.0.T and either pSC5-toxic1 , pSC5-toxic2, or pSC5-toxic3 (gentamycin 40 pg mL’ ¹ and chloramphenicol 15 pg mL’ ¹ ) and the recipient S. cerevisiae were prepared as in Method section 2.5 and stored in the -80°C freezer. On the day of conjugation, the conjugation plates (20 mL, yeast synthetic complete medium lacking histidine 1 .8% agar and 10% LB media) were made and the E. coli and S. cerevisiae cells were thawed on ice for approximately 20 minutes. Once thawed, 10 pL of S. cerevisiae was added into the E. coli tube containing 100 pL of cells and mixed by pipetting before being transferred to the plate and spread evenly. The plates were incubated at 30°C for 3 hours. Next, the plates were scraped with 2 mL of sddFLO and mixed thoroughly by vortexing for 5 seconds. For each conjugation, 4 biological replicates and 1 technical replicate were used and 100 pL of each dilution (10° - 10’ ¹ ) for each sample was plated on both selective plates (25 mL, yeast synthetic complete medium lacking histidine, and yeast synthetic complete medium lacking tryptophan, 2% agar, supplemented with ampicillin (100 pg mL’ ¹ ). The plates were incubated at 30°C, colonies were scored after 4 days, and killing efficiency (CFU in -HIS media I CFU in -TRP media) was calculated.

1.6 RNA isolation and Quantitative Reverse Transcriptase-Polymerase Chain Reaction

For RNA isolation, the E. coli strains carrying conjugative plasmids pTA-Mob 2.1 and pSC5.1 were grown in LB medium supplemented with gentamicin (40 pg mL’ ¹ ) for overnight at 37°C. In the morning, 1 mL of cells was diluted into 25 mL of LB medium supplemented with gentamicin (40 pg mL’ ¹ ) and grown for 120 minutes at 37°C until optical density (ODeoo) reached 1 . Subsequently, the RNA stabilization of the culture was performed using RNAprotect Bacteria Reagent (Qiagen, Inc., Cat #: 76506, Germany). Briefly, 400 pL (2 x 10 ⁸ cells) of culture was transferred to a 15 mL Falcon tube containing 800 pL of RNAprotect Bacteria Reagent, and the suspension was vortexed for 5 seconds and incubated at room temperature for 5 minutes. Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Inc., Cat #: 74104, Germany) according to the manufacturer’s instructions. Following DNase treatment with TURBO DNA-free™ Kit (Invitrogen Cat #: AM1907, USA), the RNA concentration was determined using DeNovix (DeNovix Inc., USA) and the integrity was verified by running 400 ng of RNA on a 1 % agarose (w/v) gel. cDNA was prepared from 500 ng of RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat #: 4368814, USA). qRT-PCR was performed using six biological and three technical replicates, on a ViiA7 system of QuantStudio Real- Time PCR System (Applied Biosystems, USA) using the SYBR™ Select Master Mix (Applied Biosystems, Cat #: 472908, USA) under the following conditions: 50°C for 2 minutes, 95°C for 2 minutes followed by 40 cycles of 95°C for 1 second, 60°C for 30 seconds. Expression levels were normalized against two reference genes (rrsA and cysG) as previously described ²⁹ . Primer sequences used for the qRT-PCR expression analyses are listed in Table 3. 1.7 Statistical Analysis

The pairwise comparisons between groups were made using a Student’s f-test with either equal or unequal variance based on the result of an F-test. Data were expressed as either ± 95% confidence interval (Cl) or as mean ± standard error of the mean (SEM) of at least three biological replicates. The tests were considered statistically significant when P < 0.05 (*), P <0.01 (**), or P < 0.001 (***).

2. RESULTS

2.1. Development of streamlined conjugation plasmids.

As a first step towards creating an optimized and minimized conjugative plasmid for yeast, 55 single genes or small genetic regions were individually deleted from our previously established trans-kingdom conjugation plasmid, pTA-Mob 2.0 ²⁸ (Fig. 8, Table 2). To validate these plasmid variants, up to two clones of each were tested for conjugation from E. coli to S. cerevisiae, and the genes/regions deleted were classified as essential (no conjugation), semi-essential (decreased conjugation), or non-essential (near wild type conjugation) for bacteria-to-yeast conjugation (Table 4). Based on this data, four streamlined plasmids were created where clusters of non-essential genes were simultaneously removed (plasmids M1 - M4, Table 1 , Table 3). E. coli containing plasmids M1 - M4 were then conjugated to yeast, and we observed a significant increase in successful conjugation efficiency for plasmid M3 clone 1 (M3C1 ), monitored by yeast colony formation on selective media (Fig. 2). Sequencing both M3 clones, M3C1 and M3C2, revealed multiple mutations in each clone, which are likely responsible for the increase in conjugation efficiency for M3C1 (Table 5).

To identify which mutations in M3C1 were responsible for the increased conjugation efficiency, we performed a fragment swapping experiment between M3C1 and M3C2 to produce five hybrid plasmids M3C1_F1 - F5 (Fig. 3). Each hybrid plasmid was created from four fragments that were amplified from M3C2 and one fragment from M3C1 . Hybrid plasmid M3C1_F4 (fragment 4 originated from M3C1 ) had the closest conjugation efficiency compared to M3C1 (Fig. 3). There were two mutated regions in fragment 4 of M3C1 : a cluster of mutations in the promoter of traJ, and a single mutation in the open reading frame (ORF) of traJ (Table 5). To validate which mutation(s) contributed to the increased conjugative phenotype, the promoter or ORF traJ mutations were introduced into pTA-Mob 2.0 and tested for conjugation efficiency. Only the mutations in the promoter region of traJ improved conjugation efficiency (Fig. 2). Additionally, we continued to minimize M3C1 by creating new plasmids with additional non-essential genes removed to obtain M5 - M8 plasmids (Fig. 2). All M5 - M8 minimized plasmids still produced more colonies when conjugated to yeast as compared to the original pTA-Mob 2.0 (Fig. 2).

2.2. Creation of superior conjugative plasmid pSuperCon5

Based on the identified traJ promoter mutations, we created the pSuperCon5 (pSC5) plasmid with additional elements to enable the delivery of our improved conjugative plasmids to diverse yeast and diatoms. The pSC5 plasmid was built based on M3C1 and contains two copies of the nourseothricin resistance gene (yNAT and dNAT) added: one optimized for selection in diverse yeast and one for diatoms (Fig. 4A). Conjugation frequency for pSC5 from E. coli to S. cerevisiae was increased approximately 10- or 23- fold compared to pTA-Mob 2.0 when tested in cis (mobilizing itself) or trans (mobilizing another plasmid), respectively (Fig. 4B, Table 6 and Table 7). No significant difference in conjugation frequency was observed when plasmids were transferred between E. coli strains (Fig. 4C, Table 6 and Table 7).

In order to more precisely evaluate the frequency of bacteria-to-yeast conjugation, we performed additional experiments to monitor the effect of conjugation plasmid-containing

E. coli on yeast viability. Cells from E. co//-to-yeast conjugation experiments were plated on non-selective yeast medium supplemented with ampicillin to inhibit E. coli growth.

More yeast colonies grew when pSC5 was used versus pTA-Mob 2.0 (Table 8), indicating that E. coli carrying pSC5 has fewer adverse effects on yeast when they are co-cultured. To determine if the same effect could be observed when different donor cells were used, we performed conjugation with Sinorhizobium meliloti as a donor, as it was previously shown to conjugate to yeast ²⁵ Similarly, a higher number of yeast colonies grew on non- selective plates when S. meliloti harboring pSC5 was used when compared to pTA-Mob 2.0 (Table 10). In addition, a higher number of colonies on selective plates were observed following conjugation of pSC5 from S. meliloti to S. cerevisiae compared to pTA-Mob 2.0 (Fig. 9, Table 10).

Fig. 10 shows the lower expression of traJ in E. coli harbouring plasmids carrying the promoter mutation.

2.3. Conjugation to diverse yeast species.

The significantly improved frequency of conjugation with the pSC5 plasmid suggests it may be effective for conjugation beyond a standard laboratory strain of S. cerevisiae and may have utility in transferring DNA from bacteria to diverse yeast species. To test the ability of pSC5 to transfer DNA to diverse yeast strains, we selected four Metschnikowia and six Candida species as conjugative recipients. Previously, we have demonstrated that small DNA fragments (yNAT selection marker) can be delivered to most of these species by electroporation ⁴³ . Conjugation to these diverse yeasts was performed with the same protocol used for S. cerevisiae, modified to allow for selection on complete yeast media containing antibiotics. Transconjugant colonies were obtained for all species (Fig. 5A, Fig. 11 and Figs. 12A-12C), and 1 - 8 colonies for each species were genotyped by PCR for the presence of the yNA T marker. Of the 10 species tested, seven tested positive by PCR for the presence of the yNAT marker, suggesting successful conjugation had occurred (Fig. 13). A plasmid rescue experiment, where total yeast genomic DNA is electroporated into E. coli, was performed for selected colonies for each of the seven species, as well as S. cerevisiae. pSC5 plasmids from the seven yeast species were successfully recovered in E. coli, however, all except those recovered from S. cerevisiae showed rearrangements when diagnostic restriction enzyme digestion was performed (Figs. 5B and 5C). Furthermore, only the plasmids recovered from S. cerevisiae were still able to conjugate (Fig. 14).

2.4. Domestication of pSC5 for Golden Gate assembly.

Next, we sought to modify the pSC5 plasmid to make it readily amenable to cloning for easy incorporation of any desired DNA fragment, to facilitate downstream applications of bacterial-to-yeast conjugation. To this end, we eliminated existing Bsal restriction sites from pSC5, and created a single Bsal-based Golden Gate cloning-compatible site to enable efficient plasmid manipulation ⁴⁵⁴⁶ . In addition, we incorporated a landing pad with mRFP driven by an arabinose inducible promoter (Fig. 6A). In this modified plasmid, Golden Gate assembly can readily be used to replace the mRFP gene with any gene of interest, allowing for an easy visual screen for correct gene insertion events (white versus red bacterial colonies).

To validate this system, we inserted a second antibiotic marker (ShBle) for yeast into pSC5GGv1 (Fig. 6A) to create pSC5GGv1_ShBle, which provides resistance to zeocin. White bacterial colonies were selected (Fig. 6B) and genotyped with diagnostic multiplex PCR and restriction digest (data not shown). These validated colonies were conjugated to S. cerevisiae and tested for survival on single or double antibiotic selection (Fig. 6C). Successful exconjugants which received pSC5GGv1_ShBle were able to grow on media supplemented with zeocin, nourseothricin or both (Fig. 6C).

2.5. Proof-of -concept for conjugation-mediated delivery as an antifungal.

To demonstrate that pSC5-based conjugating plasmids could be used as an antifungal, we developed a system where each donor E. coli strain carried two plasmids: a control plasmid (pAGE2.0.T) that can be selected on media lacking tryptophan and either pSC5 or pSC5-toxic gene plasmid that can be selected on media lacking histidine (Fig. 7A). We used Golden Gate assembly to create three pSC5-toxic plasmids, each carrying a gene that should be partially or fully toxic to yeast. To prevent toxicity in E. coli, we inserted a yeast ACT1 intron ⁴⁷ into each toxic gene. Next, we cloned the A. laidlawii toxic gene ⁴⁴ into pSC5GGv1 to generate pSC5-toxic1 , or an Haemophilus influenzae Hind 11 restriction gene into pSC5GGv1 and pSC5GGv2 to generate pSC5-toxic2 and pSC5-toxic3, respectively. The pSC5 and pSC5-toxic gene plasmids can act in cis, mobilizing themselves, as well as in trans, mobilizing the control plasmid pAGE2.0.T. Using a control E. coli strain carrying plasmids pSC5 and pAGE2.0.T, we observed a similar colony number on both selection plates. For conjugation with pSC5-toxic gene plasmids, substantially fewer colonies grew on minimal media lacking histidine. The most substantial difference in yeast colony formation was with donor E. coli carrying pSC5- toxic3 (Fig. 7B, Table 11 ). This provides a proof-of-concept that bacteria to yeast conjugation can be used to effectively deliver plasmid-based antifungals.

2.6 Testing of the new plasmid pSC6 and inducible conjugation from E. coli to E. coli. pSC6 plasmid construction pSC6 plasmid is a derivative of superior conjugative plasmid (pSC5). For its construction, first, we removed two Bsal cut sites present in fcpD promoter and traCI ORF of pSC5 plasmid using primer mediated mutagenesis. Out of two copies of traJ, the one which is located downstream to origin of transfer of vector backbone was removed. The remaining trad in pSC6 includes the mutation in the trad promoter of pSC5 that provides superior conjugative plasmids delivery operatively linked to the trad gene. For this we amplified the fragment spanning trad deletion using pSC5.1 as the template. The native trbF gene was also deleted from backbone. The fragment with trbF deletion was amplified using trbF knock out plasmid. Next, we amplified inducible trbF cassette with monomeric Red Fluorescent Protein (mRFP) gene fragment driven by an arabinose inducible pBAD promoter and terminator using trbF inducible plasmid as the template with primer mediated addition of Bsal restriction sites and homology to downstream of l-Scel restriction site in pSC5 backbone. All other fragments were amplified using pSC5GG-V1 as the template. Finally, these fragments were assembled in yeast to generate pSC6 plasmid.

Fig. 15A shows a schematic representing the movement of the inducible conjugative plasmid pSC6 which contains a gentamicin (GM) marker, to the recipient cell which contains a tetracycline (Tet) marker. It also shows arabinose binding to a regulatory protein and to enable expression of gene 11 (TrbF), enabling conjugation.

During conjugation strains were either induced with arabinose (100 pg/mL) or remained uninduced. They were then plated on selection plates supplemented with gentamicin (40 pg/mL) and tetracycline (10 pg/mL). pSC5 induced and uninduced are the positive controls. The results are shown in Fig. 15B.

Fig. 15C is a bar graph showing the average transconjugants/mL for each donor strain. A student’s T-test was performed to analyze the difference between induced pSC6, which contains our inducible cassette, and induced pSC5, the positive control. There was a significant decrease in average transconjugants/ mL in pSC6 (p = 0.00018, n = 3).

It should be understood that since pSC6 includes the mutated traJ promoter operatively linked to the traJ gene, pSC6 also improves conjugative transfer from a donor bacterium to yeast relative to the native pTA-Mob 2.0 plasmid. It follows that the inducible cassette of this study can be used to induce conjugation from a donor bacterium to a recipient eukaryotic cell.

3. Discussion

Conjugation-based techniques, such as the one described here, provide a unique and functional method to deliver plasmids between microbial species in vitro and in vivo. While there are innumerable possible applications for these systems, many have focused on the use of plasmid-encoded CRISPR-based genetic manipulation systems to modify the genomes of the recipient microbes ¹⁹ ’ ²³ ’ ⁴⁸ . Indeed, CRISPR-based gene targeting and manipulation systems offer a breadth of applications that can be paired with conjugation (or other methods of DNA delivery, such as phage transduction) to achieve desired manipulation of a target microbial population. The majority of this work to date has focused on bacterial species. For instance, CRISPR-based systems have been used to induce lethal DNA damage in key bacterial pathogens, including E. coli, Staphylococcus aureus, and Clostridium difficile, to effectively eradicate unwanted bacterial populations, including drug-resistant bacteria ¹³ ’ ¹⁴ ’ ⁴⁹ , and specific pathogenic species or subpopulations ¹³ ’ ^16-19 ’ ⁵⁰ ’ ⁵¹ . In addition to directly killing bacterial populations, CRISPR systems can also be applied to modify virulence determinants to erode microbial pathogenicity ⁵⁰⁵² , or alter drug-resistance genes to restore antimicrobial susceptibilities ¹⁵²³ ’ ^53-57 . To enable the application of these CRISPR systems in vivo, many have relied on the use of bacterial conjugation or phage transduction as methods to deliver the relevant CRISPR components ¹³ ’ ¹⁷ ’ ^21-23 ’ ⁵⁸ . While this has been effective for delivery to bacterial strains, it has limited the applications in fungi, which lack well- established tools for conjugation or virus-based gene delivery ⁵⁹⁶⁰ .

To address the bottleneck of improving DNA delivery to yeast, we performed experiments to optimize the conjugative plasmid pTA-Mob 2.0 ²⁸ . We first evaluated whether plasmid derivatives with targeted deletions of the conjugative plasmid could improve DNA transfer to S. cerevisiae. After testing 57 single-gene and four cluster-gene deletion plasmids, one with superior conjugative properties (M3C1 ) was identified. Sequence analysis of M3C1 revealed that in addition to the designed deletions, M3C1 had unintended mutations that were likely introduced during PCR amplification or plasmid assembly. The mutations responsible for improved conjugation to S. cerevisiae were narrowed down to the promoter region of traJ (Tp) using a fragment swapping experiment. Following this discovery, five derivative plasmids of M3C1 were built containing the Tp mutation: four minimized versions (M5 - M8) and pSuperCon5 (pSC5, containing selectable markers for diverse yeast species ⁴³ and diatoms ²⁴ ). Each derivative plasmid of M3C1 , including the smallest 31 kb plasmid M8, outperformed the original 57 kb pTA-Mob 2.0 plasmid when tested for DNA transfer to S. cerevisiae. Notably, using pSC5 compared to pTA- Mob 2.0 we observed an increase in conjugation to S. cerevisiae 10- or 23-fold in either a cis or trans setup, respectively. Yet, no increase in plasmid transfer was observed when pSC5 was conjugated between E. co// strains. This improved conjugation to S. cerevisiae could be partially explained by the increased S. cerevisiae viability during the co-culture conjugation step when plasmids harboring the Tp mutation are used. The same effect was also observed when S. meliloti was used as a conjugative donor, suggesting the mechanism may be independent of the bacterial host. We also demonstrated that the Tp mutation results in a lower expression of the traJ gene. TraJ has been demonstrated as an essential conjugative protein that negatively autoregulates the expression of the relaxase operon ⁶¹

Therefore, decreased expression of traJ could have a significant effect on the expression of all the conjugative machinery proteins. Further investigation will focus on resolving the link between traJ downregulation and increased yeast viability or DNA transfer during the co-culture conjugation step.

The significantly improved pSC5 plasmid allowed for DNA transfer to seven Metschnikowia and Candida yeast species, though relatively few colonies were obtained for each of them. One explanation for the low conjugative transfer could be that the S. cerevisiae centromere along with the origin of replication was not functional in these yeasts. In such a case, survival of these yeasts would only be possible if the conjugative plasmid was integrated into the yeast genome. Using a plasmid rescue experiment we showed that plasmids could be recovered in E. coli, although none of them had the correct size or ability to conjugate. Since E. coli can assemble linear fragments into plasmids ⁶² , it is most likely that some of the linear yeast fragments with integrated conjugative plasmids were assembled into plasmids in E. coli. Despite not being able to replicate as an episome in diverse yeasts, the improved conjugative plasmids, especially pSC5GGv1_ShBle with two antibiotic resistance genes, provide a great initial resource for DNA delivery. For applications where replicative plasmids are necessary for the yeast species of interest, specific origins and centromeres will need to be identified and incorporated into the conjugative plasmid as was done for S. cerevisiae ⁶³⁶⁴ .

Our improved conjugative plasmids hold promise as a novel antifungal. As a proof of concept, we cloned restriction nucleases onto pSC5GGv2 plasmid and demonstrated that >99% of yeast cells that receive the plasmid DNA can be eliminated. However additional improvements in the conjugation frequency will need to be achieved before this technology can be used in antifungal treatments. In the future, our Golden Gatecompatible plasmids can be engineered with programmable systems such as CRISPR/Cas9 to target specific yeast strains. This coincides with the development and optimization of numerous CRISPR-based editing platforms optimized for a diversity of yeast species ^65-69 , including Candida pathogens ⁷⁰ . Recent work has demonstrated the utility of CRISPR systems for modifying fungal genes involved in virulence ^71-78 and antifungal drug resistance ⁷¹ ’ ⁷⁴ ’ ⁷⁹⁸⁰ in diverse Candida pathogens, and combining these CRISPR systems with this trans-kingdom conjugation system could facilitate the delivery of CRISPR to fungi in different environmental contexts. Table 1. Plasmids used in this study. aacC1 provides resistance to gentamicin; cat to chloramphenicol; bla to ampicillin; yNAT to nourseothricin in diverse yeast; ShBle to zeocin resistance gene in diverse yeasts. HIS3 is required for the histidine biosynthesis; URA3 for uracil biosynthesis; TRP1 for tryptophan biosynthesis in S. cerevisiae. ¹ - duplicated copy that is present in the plasmid backbone.

Table 2. Description of pTA-Mob 2.0 deletion plasmid library. The fragment split by

PCR amplification is listed, and regions of pTA-Mob 2.0 deleted are reported with respect to the 3’ end of backbone insertion re-indexed to position 1. Diagnostic multiplex primers used to screen deletion plasmids and their respective amplicon sizes are shown. Genes either completely or partially removed from pTA-Mob 2.0 in each deletion plasmid are listed, their location within pTA-Mob 2.0 is annotated in parentheses, and the primers used to remove them are provided.

Deletion Frag °ment Reg °ion M rX _n Pri .mers Amplicon Gene(s) Deleted

Plasmid Split Deleted (bp) Or Partially Deleted

_{1 2} ⁵⁷⁴ ' F - aggcggtaaaggtgagcag 301 upfl 6.5 (574-1241)

1241 R - gaagcctgcgaagagttgc

2 2 1216- F - ctctgtttatcggcagttcg trfAl (1216-2364) &

2364 R - gtattcgtgcagggcaagat trfA2 (1216-2073)

2 2 1216- F - ctctgtttatcggcagttcg trfA2 (1216-2073) &

2073 R - tcgatggtccagcaagctac trfAl (1216-2364)

_{4 2} 2938- F - ctcggtgtcacgggtaagat

393 trbA (2884-3249)

3249 R - cacgacgtaggggttctgat

2 3583- F - tgcgctttgacagttgtttt 374 trbB (3520-4479)

4479 R - ttcgtcagccagctctcata 2 4492- F - attcaccgaaacccattgag

349 trbC (4492-4929)

4929 R - catgattcggaacgcataga

_ 4932- F - ttcttccgaaccctgatctt

304 trbD (4932-5243)

5239 R - tccttggaacgatgcttttt

₈ 2/3 ⁵²⁴⁴ ' F - gtcggtctgatcctgtggtt 338 trbE (5240-7798)

7794 R - gtctgcttttgcgacacaac g 2 7799- F - cgtctctacgacctggcact

352 trbF (7795-8553)

8553 R - gtacccgcctcccacttct 8565- F - ggtcagcaccgaaatcact

319 trbG (8565-9458) 9458 R - agctgccgtactggaggt 9462- F - acggcaagaaaaccatcatc

331 trbH (9462-9944) 9944 R - tgaggtacatcggcatgtg 9949- F - agcaacctgtatcgcctgac

313 trbl (9949- 11340) 11340 R - tcctcgattgctctggac

11357- F - gcagatgatcgccaaaaact

312 trbJ 1357-12133) 12133 R - gggcactctcaacagctc 12145- F - caaatccgtggcctctg

349 trbK (12145-12354) 12354 R - acggtcaaggtccagaacag 12361- F - gatctgccgaaggtcacg

329 trbL (12361-13947) 13947 R - ctgtggatgccgaagtacc

13971- F - gtcgacgacaacagcctt

324 fr (13971-14570) 14570 R - aagaatgtggccggaatct 14586- F - gccatgcctataccgactc

336 trbN (14586-15290) 15290 R - tgcccagtaccagaagatca F - ggcagctcatcatcaacaac

15321- R - 300 trbO (15321-15584) 15584 ccaggacgaaaacgaaaaga

15621- F - aagcgccgttgatctct

321 trbP (15621-16355) 16355 R - catggggatgtcagcagt 16372- F - acgtactacccgctgcatct

343 upf l. 7 (16372-16791) 16791 R - gatagaacgctcggtgtcc 16806- F - ataaccagctcgccatcaag

318 fiwA (16806-17501) 17501 R - cagcaccaggaacatcgtc

17537- F - cgagctgctgaacaaggtt

303 upf32.8 (17537-18199) 18199 R - gagccaggtcaaacgagtgt F - gactacaccgagggggaaag parAl (18223-18882)

18223- R - gagaaggacaccgaccgtta 331 &parA2 (18223- 18882

18846)

18223- ^F ' gactacaccgagggggaaag parA2 (18223-18846)

18846 ^R ' gtgggtcaacatggagctg 326 &parAl (18223-

18882)

F - tctcctggcgtcaagatc parB (18843-19376) &

18843- ^R ' tccgtcatgtcgatgtcag parC (19373-19666)

217 &parAl (18223-

19688

18882) & par A 2 (18223-18846)

19373- F - tgctgtctaccagcacgtc

318 parC (19373-19666)

19666 R - tccgtcatgtcgatgtcag

19817- F - catggcgcattacagcaata parD (19817-20068)

20068 R - gggaaagagtcgctcatgt ^{3 4} & parE (20065-20376)

23490- F - cgaggtggtggtaatcgt __ _o istB (23489-24286)

24286 R - gccgcatagtgtagccagat

24763- F - agactagccaccaccatgc

328 aphA (24763-24993)

24993 R - acggaggtagcagcagaaaa

25077- F - tgcaattcatctcctgctg

308 traA (25077 -25367)

25367 R - cgcaacgtctaccagtcag

25377- F - gtgacgatgatgctgtgg

347 traB (25375-25815)

25815 R - gccaggtgagaagtgctgtc F - acctcatggtcagccattc traCl (25831-29016)

25831-

6/7 R - gagtcgacccggaagaag 314 & traC2 (25831-

29016 28071)

F - acctcatggtcagccattc traC2 (25831-28071)

25831-

6 R - atcaaggcgctacaagagga 308 &. traCl (25831- 28071

29016)

29023- F - tgtaacgcttcccggtagtc

7 340 traD (29023-29286)

29286 R - agtctccgagctgcacaagt

29292- F - accaggtcaatgtcgctctc

7 342 traE (29292-31505)

31505 R - gccgaggtctgctatgtc

31520- F - tagtcctccgggtctagcaa

7 345 traF (31520-32053)

32049 R - gcgacatggtgtgtacgtc

32054- F - gcttttggtggtgtgacct

7 316 traG (32050-33957)

33953 R - tgatatgttggtgcgctgt

33958- F - tttttcgcccgtatctgtg traH (34253-34612) &

7/8

36131 R - gtatccaacggcgtcagaat tral (33954-36152)

34253- F - gcaccagaatctcgtcgtt traH (34253-34612) &

7

34612 R - gtcaacggcacagcagagt ³¹⁶ traI (33954-36152)

36149- F - ctcggtctgcctgctc traX (36149-36190)

8 36190 ^{R - gtatccaacggcgtcagaat} 488 traI (33954-36152) & traJ (36187-36558)

36187- F - gcgaagtcgctctctgat traJ (36187-36558) &

8

36558 R - gctctttggcatcgtctctc ³³³ traX (36149-36190)

36796- F - tcgctataatgaccccgaag

8 338 traK (36796-37200)

37199 R - gttgcgcgagttaatttcgt

37201- F - aacggggaaggtcaagtct

8 335 traL (37200-37925)

37921 R - tgatggtatgcaggatcagc

37926- F - ggcaagagcttgagcagat

8 312 traM (37922-38359)

38359 R - tgtcaaacaagcccagctaa

38411 - F - ggcgaaggtaatgaaggaca

8 348 upf54.4 (38412-39758)

39758 R - tgcgaaaagcatcacctatg

40292- F - tggtctcggtctggacaat

8/9 305 kfrA (40292-41218)

41218 R - acctgccgttaagtcgagaa

41932- F - ggatagctgcaacatcagga

9 295 korF (41941-42444)

42444 R - acccggacaagctgaaaaag

44843- F - tggtgaacatagcggtga

9 313 klaC (44843-45796)

45792 R - gtcagacgacgctcatcaa

45793- F - ctggtcgctgaatgtcgat klaB (45793-46929) &

9/10

46875 R - gctcatcaccaccaagaaca ³⁹ klaC (44843-45796)

46947- F - catgtcgaaggcgacgatag

10 317 klaA (46947-47720)

47720 R - tcgatggatgttgcttg

47843- ^F ’ gacagctcgtgaggg^ ⁰ kleFl (47843-48157)

10 ' R - ggtactgaccgcactcacct 332 & kleF2 (47843- o 1 /

48013)

F - caaaacctccccctcaatc kleF2 (47843-48013)

10 . „ _n , ' R - ttgagcaatgccaagacag 318 & kleFl (47843- 4ovl

48157)

48185 - F - ctccggattgaaccagtacg

10 341 kleE (48185-48508) 48508 R - aagtcaccaagtgggtcgag 54 10 ⁴ . ⁸ _e ⁶ 2°’ F - cacgcctgggaacttgataa ₃₁₉ (48620-48838)

48838 R - gaatgctattgccgagaagc

55 10 4l908 ⁴ 4; R - caggggaaaggtgttttcaa 324 kleC (48854-49084)

56 10 ⁴ , ⁹ ”’’ ' Scwc'cggcaatagcattc _{33g tZeB} (49237^9452)

49452 R - actggtccacccaggaagtc

5’ 10 T ₍₄ 9 ₅ OM9734)

49734 R - actttacgccaagggagagg

Table 2 continued

Deletion Plasmid Additional primers for splitting the fragment of interest

Top primer pairs with the original reverse primer for the fragment of interest. Bottom primer pairs with the original forward primer of the fragment of interest.

1 gcggcagagatgaacacgaccatcagcggctgcacagcgccattgacccaggcgtgttcc tgcgaggcagcggcctggtggaacacgcctgggtcaatggcgctgtgcagccgctgatg

2 tggctgctgaacccccagccggaactgaccccacaaggcctcaccctccttgcgggattg tgccccggcgtgagtcggggcaatcccgcaaggagggtgaggccttgtggggtcagttcc

3 tggctgctgaacccccagccggaactgaccccacaaggccagttcctcgcgtgtcgatgg aggtttggcgaagtcgatgaccatcgacacgcgaggaactggccttgtggggtcagttcc

4 atttttcaccaacatccttcgtctgctcgatgagcggggccgccaagggttagggcttgc tagcggctaaagaaggaagtgcaagccctaacccttggcggccccgctcatcgagcagac

5 gaccatcaaggagcgggccaagcgcaagctggaacgcgacggagtatttccaatgacaac tcagacggaacggaacagccgttgtcattggaaatactccgtcgcgttccagcttgcgct

6 cggccagtacatcaccaaaaccctgtaaggagtatttccatcatggctctgcgcacgatc ttgcctgcgcgacggatggggatcgtgcgcagagccatgatggaaatactccttacaggg

7 atgccgtgcgtgcggtagcggctggacggctcgcctaatcatgatccaagcaattgcgat cgccgaggcccgcgattgcaatcgcaattgcttggatcatgattaggcgagccgtccagc

8 ccgcgagaacaccaatagccaagggaagcaataccgatgaatgagttttgcagacacgat tcttgaagatcaagcccttgatcgtgtctgcaaaactcattcatcggtattgcttccctt

9 ccggggcctcgcccttgatgaatacctggaggcagcatgaggcactgaattatgaaaaag aggaccaaagcaaacagttcctttttcataattcagtgcctcatgctgcctccaggtatt

10 gggacttctcctggtcgagacttctgtgaggcactgaattaccatgcgtaagattctgac tggccgcgagtgcgatgacggtcagaatcttacgcatggtaattcagtgcctcacagaag

11 cagccaggaccgcgtgaccatttcaagggggaactaaaccgccaatgagcgaagatcaaa tggcgatgcgtccggtgccatttgatcttcgctcattggcggtttagttcccccttgaaa

12 atggtcccggccggcgcatgggttcggaaggagtaagccactccaaggagtaacttatga aacattcttagcgagcttcttcataagttactccttggagtggcttactccttccgaacc

13 ccctaccaggcgtttgactattaactccaaggagtaacttggggaggcgcgatgaagaaa gcaactgcgatgaagttggatttcttcatcgcgcctccccaagttactccttggagttaa

14 accgcgcaagcccgtctaagacctggtgaggggaggcgcgtgacgtatgaaaatccagac ccgcgagcgcggcagctctagtctggattttcatacgtcacgcgcctcccctcaccaggt

15 aggcttcaagcccagcgaaaagaaagagtggtgatgacgtaacgactcttaggagctacg gcttttttcagttgcatggtcgtagctcctaagagtcgttacgtcatcaccactctttct

16 agcccgcccaatcctgaaacgactcttaggagctacgaccggggaggggatagcgatgcc gtgccagcagcttggcaaacggcatcgctatcccctccccggtcgtagctcctaagagtc

17 cgcctaccgtcggttcgagcggtaaggggaggggatagcgggaggaacggccgtttagcg gaatgcccataggctttagccgctaaacggccgttcctcccgctatcccctccccttacc cacgccataaggaggaacggccgtttagcggctaaagcctcgccctgcagggcgttctta tcatgccctcccccttggagtaagaacgccctgcagggcgaggctttagccgctaaacgg atagcgccctgcagggcgttcttactccaagggggagggccctttgagattccaatatgc ggtgcatttctgagcaatgcatatggaatctcaaagggccctcccccttggagtaag gcgggctactgtttttcacctgacctttgagattccaatggggagggcggcggatgctg aggaagcccttcaaccgtgtcagcatccgccgccctccccatggaatctcaaaggtcag cgctgacgatgcgaagttctactgaggggagggcggcggctacaaccgtgcgcaaggcg tacatacatcctccctaatgcgccttgcgcacggtgtagccgccgccctcccctcagta tctgactacaaccgtgcgcaaggcgcattagggaggatgtgaaaagccgggcactgcccg cgcagcagcaaaaataaagccgggcagtgcccggcttttcacatcctccctaatgcgcct gggacgcgaaaaggtgagaaaagccgggcactgcccggctttccacggctcgacggcgtg tcggcctctggtccgatccgcacgccgtcgagccgtggaaagccgggcagtgcccggctt gggacgcgaaaaggtgagaaaagccgggcactgcccggctccttcgtccctccggtgtt ggaaatggcgacgcgagagcaacaaccggagggacgaaggagccgggcagtgcccggctt tgctcgtccgtactggcgcgcaggtagatgcgggcgacctggcgcattacagcaatacgc gcgctaggcgcatttaaatgcgtatgctgtaatgcgccaggtcgcccgcatctacctg agcgcggcagcggcgcgcagcatggcgtagcttcggcgctttgggcctagtctagccggc gtattgctgtaatgcgccatgccggctagactaggcccaaagcgccgaagctacgccatg tgtgctaatgtggttacgtgtattttatggaggtatccacggcctacatcctcacggct cgtagatcggcttcggcctcagccgtgaggatgtaggccgtggataacctccataaaata ggaacatcgaccactgagtgcctatgaggagctgttgtgacgaaagtatctagcgggca accgttatttgccattttcatgcccgctaagatactttcgtcacaacagctcctcatagg gaacgatattgatcgagaagagccctgcgcagccgctgccggcgatgccccctcgacctc tcctgaacgcctccctgatcgaggtcgagggggcatcgccggcagcggctgcgcagggct ctcacaaagaaagccgggcaatgcccggctttttctgctgacgcctcctagatcgagcgc aaggccgagcagaaacgctcgcgctcgatctaggaggcgtcagcagaaaaagccgggcat gaaaatcgtgcgggtacgcctcgatgttcatacgcctcctacgctctagttctcctagt gcaacgccgcgcgagaacctactaaggagaactagagcgtaggaggcgtatgaacatcga gtgccccgatctgtactttgttcatacgctctagttctccagccaatacctcccgtcat cacgacgaccgcggccgccaatgacgggaggtaatggctggagaactagagcgtatgaa gtgccccgatctgtactttgttcatacgctctagttctccagtgccccctgcgcaggct aacgacccagcaggccatcgagcctgcgcagggggcaactggagaactagagcgtatgaa cctgctcgtggaacggctttttgacctctgccatagccaacgctttcactcctggttggt acagcaaaggccgtaacggcaccaaccaggagtgaaagcgtggctatggcagaggtcaa aagtcgtcctgctgcacggtctgggatcattcatcgctatatccccctaccctcacca tcatcaggccggtctgacctggtgagggtagggggatataagcgatgaatgatcccaag gcgatacaaggcgttcaaatgcatatatccccctaccctcatatcgtgatcccctccc gacggccaccgtcgaggaaggggaggggatcacgatatgagggtagggggatatatgcaa cgatggcgacgtactggtgaggcgctggaagcggctcattcatctactcctacctcggg gcgaggctccctaaaactacccgaggtaggagtagatgaatgagccgcttccagcgcct cccgtatctgtggccccacggcgtgtttcggttctcatggggacgtgctggcaatca aacggccggggggtgcgcgtgatgccaagcacgtccccatgaagaaccgaaacaacgc tcggcaacatatttctcggccgccgcgatctgttcgggctgtgctgctccttcgtcagt gagcgccgccgtcaagaactactgacgaaggagcaagcacagcccgaacagatcgcggcg tcgctcttctgatggagcgcatggggacgtgctggcaaggctctgccctcgggcggac gcaaggtcatgatgggcgtggtccgcccgagggcagagccttgccaagcacgtccccatg aatcacgcgcaccccccggccgttttagcggctaaaaaagccgctgccgaattctgacg ttcctggtgtatccaacggcgtcagaattcggcaagcggcttttttagccgctaaaacg atgcaggaaatactgaactgaggggacaggcgagagacgatggcgaaaattcacatggt ccccgccctgccctgcaaaaccatgtgaattttcgccatcgtctctcgcctgtcccctc 43 caccttcaacccaacaccggacaaaaaggatctactgtaaatgagcgaccagattgaaga ccgcaatctcccggatcagctcttcaatctggtcgctcatttacagtagatcctttttgt

44 cggcctgtttgaacagctcgacgcggcggccgtgctatgaatcgcagaggcgcagatgaa gcccggcaacgccgggctttttcatctgcgcctctgcgattcatagcacggccgccgcgt

45 gcagatgaaaaagcccggcgttgccgggcttgtttttgcggacgcctccctttttagccg cgcactcgttagagttttagcggctaaaaagggaggcgtccgcaaaaacaagcccggcaa

46 ttgttccatctattttagtgaactgcgttcgatttatcaggttggctccggtaattggta ggtaagagtattattattcttaccaattaccggagccaacctgataaatcgaacgcagtt

47 cttgcaacatcaggagccgtttcttttgttcgtcagtcattcttcggtcctccttgtagc gccgcacagacaacggttccgctacaaggaggaccgaagaatgactgacgaacaaaagaa

48 aaaacaaaagcccggaaaccgggctttcgtctcttgccgctcatacggactcctgttggg ccagcccgtgcgcgagctggcccaacaggagtccgtatgagcggcaagagacgaaagccc

49 aggccgcctacctgggcgaaaacatcggtgtttgtggcatgtcgaaggcgacgatagggg aacgacgcacgacgccaaggcccctatcgtcgccttcgacatgccacaaacaccgatgtt

50 tgcgtcgttttcagtgcgttcatagggttctcccgccgtgtcgatacaccctcgcggtgg tccatcgaaaagcaattaacccaccgcgagggtgtatcgacacggcgggagaaccctatg

51 ccgctaaaatttggggacaggtcatttacagaaagccagctgctcaaagctccttgaagg ggagggtcaagcaagcggccccttcaaggagctttgagcagctggctttctgtaaatgac

52 ttagccgctaaaatttggggacaggtcatttacagaaagcgccccagccctcggcctccg atcggcgtactggttcaatccggaggccgagggctggggcgctttctgtaaatgacctgt

53 cctgtcttggcattgctcaaagctccttgaaggggccgcttgcttgaccctccacggcga ctggacgaattgaacacgcatcgccgtggagggtcaagcaagcggccccttcaaggagct

54 atcgaggtcaagcgccccggagaaatccggggcgtcatcccatcatcccctggcgtcagt ggcgaaattccgggccggtcactgacgccaggggatgatgggatgacgccccggatttct

55 agttcaccctatctcctacttgcatcatcatcccctggcgcggattggcctccggtaatt gccgggtagattcccaggtcaattaccggaggccaatccgcgccaggggatgatgatgca

56 gaggcgtcatgcttgaaaacacctttcccctggcgtgcaaggccctatctccttgagaga ggcccggctacggtcgggcctctctcaaggagatagggccttgcacgccaggggaaaggt

57 ctcctgagagaggcccgaccgtagccgggcctcgtccgcggggtgatcctccggttg gggcacttcgcccaggtcagcaaccggaggatcaaccccgcggaacgaggcccggctacg

Table 3. List of primers used to amplify the assembly fragments and genotype the plasmids created in this study.

Fragment Primer Sequence (5’ to 3’) Template

Ml

_F1 F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt ₅₇₈₂ pTA-Mob 2 0

R tttaacctacttcctttggttccgggggatctcgcgactc

_F2 F atcgaagagaagcaggacga _{6373 pTA.Mob 2 0}

R tgctggtccatgaagatgaa

F3 f tcgagctgatgtttgacgac ₆₁₃₇ pTA-Mob 2.0

R ggacttgaggttgctctgct

F gtggacattggtttcagcaa

F4 gcgagaacctactaaggagaactagagcgtacgtgcttcg 3693 pTA-Mob 2.0 aaccactcggagggacggtt

_{F5 F} aaccgtccctccgagtggttcgaagcacgtacgctctagtt ₃₄₇₆ pTA-Mob 2 0 ctccttagtaggttctcgc R aagcgatgaatgatcccaag

F gagcaatggatagccgatgt

F6 6206 pTA-Mob 2.0

R aagcgatgaatgatcccaag

F tgtaacgcttcccggtagtc

F7 6295 pTA-Mob 2.0

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F8 6259 pTA-Mob 2.0

R aggcccttgccaatgaat

F ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc 6000

F9 pTA-Mob 2.0

R cgttcccgcctgcccctgattggcccgctgatcgaccgct

F aatgttgcaaggcgatcag

F10 5745 pTA-Mob 2.0

R agccctcccgtatcgtagtt

M2

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl 5782 pTA-Mob 2.0

R tttaacctacttcctttggttccgggggatctcgcgactc

F atcgaagagaagcaggacga

F2 6373 pTA-Mob 2.0

R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac

F3 6137 pTA-Mob 2.0

R ggacttgaggttgctctgct

P ggaccaggcgcagtccaccatcaacggcctgatgagcgc

F4 c 6000 pTA-Mob 2.0

R atcggcgtgaagcccaacagggcca

F gtggacattggtttcagcaa

F5 6273 pTA-Mob 2.0

R agctcatgcatcacaacagc

F gagcaatggatagccgatgt

F6 6206 pTA-Mob 2.0

R aagcgatgaatgatcccaag

F tgtaacgcttcccggtagtc

F7 6295 pTA-Mob 2.0

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F8 6259 pTA-Mob 2.0

R aggcccttgccaatgaat

F ttctttgaatgcgcgggcgtcctgg

F9 tgaacacgcatcgccgtggagggtcaagcagcggcaag 4224 pTA-Mob 2.0 agacgaaagcccggtttccggg

P cccggaaaccgggctttcgtctcttgccgctgcttgaccctc

F1O cacggcgatgcgtgttca 2664 pTA-Mob 2.0

R agccctcccgtatcgtagtt

M3

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl 5782 pTA-Mob 2.0

R tttaacctacttcctttggttccgggggatctcgcgactc

F atcgaagagaagcaggacga

F2 6373 pTA-Mob 2.0

R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac

F3 6137 pTA-Mob 2.0

R ggacttgaggttgctctgct

P ggaccaggcgcagtccaccatcaacggcctgatgagcgc

F4 c 6000 pTA-Mob 2.0

R atcggcgtgaagcccaacagggcca

F gtggacattggtttcagcaa

F5 gcgagaacctactaaggagaactagagcgtacgtgcttcg 3693 pTA-Mob 2.0 aaccactcggagggacggtt P aaccgtccctccgagtggtcgaagcacgtacgctctagt

3476

F6 ctccttagtaggtctcgc pTA-Mob 2.0

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc

F7 6295 pTA-Mob 2.0

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F8 6259 pTA-Mob 2.0

R aggcccttgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F9 6000 pTA-Mob 2.0

R cgtcccgcctgcccctgattggcccgctgatcgaccgct

F aatgttgcaaggcgatcag

F10 5745 pTA-Mob 2.0

R agccctcccgtatcgtagt

M4

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl 5782 pTA-Mob 2.0

R ttaacctactccttggtccgggggatctcgcgactc

F atcgaagagaagcaggacga

F2 6373 pTA-Mob 2.0

R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac

F3 6137 pTA-Mob 2.0

R ggactgaggtgctctgct

P ggaccaggcgcagtccaccatcaacggcctgatgagcgc

F4 c 6000 pTA-Mob 2.0

R atcggcgtgaagcccaacagggcca

F gtggacattggtttcagcaa

F5 _R ggtctgacctggtgagggtagggggatatacgtgctcga 3476 pTA-Mob 2.0 accactcggagggacggt

„ aaccgtccctccgagtggtcgaagcacgtatatcccccta r 3655

F6 ccctcaccaggtcagaacc pTA-Mob 2.0

R tgtaacgctcccggtagtc

F gatccgctcctgaactctg

F7 6259 pTA-Mob 2.0

R aggccctgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F8 6000 pTA-Mob 2.0

R cgtcccgcctgcccctgatggcccgctgatcgaccgct

F aatgtgcaaggcgatcag

F9 5745 pTA-Mob 2.0

R agccctcccgtatcgtagt

M5

Fl F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

11593 M3C1

R tgctggtccatgaagatgaa

F tcgagctgatgttgacgac

F2 _R tcatcaggccggtctgacctggtgagggtagggggatat 8884 M3C1 cgctatcccctccccttacc

P ggtaaggggaggggatagcgatatccccctaccctcacc

F3 aggtcagaaccggcctgatga 3675 M3C1

R catgcaaagcgactgatgt

F gatccgctcctgaactctg

F4 6253 M3C1

R aggccctgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F5 10447 M3C1

R agccctcccgtatcgtagt

M6

Fl aaaacaaaagcccggaaaccgggcttcgtctctgccgc 12900 M3C1 cggggtgatcctccggtg R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac

F2 tcatcaggccggttctgacctggtgagggtagggggatat 11800 M3C1 cgctatcccctccccttacc

P ggtaaggggaggggatagcgatatccccctaccctcacc

F3 aggtcagaaccggcctgatga 3675 M3C1

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F4 6253 M3C1

R aggcccttgccaatgaat

F ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc

F5 _R gggcacttcgcccaggtcagcaaccggaggatcaacccc 4262 M3C1 ggcggcaagagacgaaagccc

M7

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl

_R tgccccggcgtgagtcggggcaatcccgcaaggagggt 5132 M3C1 gaccgcttgccctcatctgtta p ctggccggctaccgccggcgtaacagatgagggcaagc

F2 ggtcaccctcctgcgggatg 3819 M3C1

R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac

F3 tcatcaggccggttctgacctggtgagggtagggggatat 8884 M3C1 cgctatcccctccccttacc

P ggtaaggggaggggatagcgatatccccctaccctcacc

F4 aggtcagaaccggcctgatga 3675 M3C1

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F5 6253 M3C1

R aggcccttgccaatgaat

F ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc

F6 10447 M3C1

R agccctcccgtatcgtagtt

M8

P aaaacaaaagcccggaaaccgggctttcgtctcttgccgc

Fl cggggttgatcctccggttg _{66 W}

M3C1 tgccccggcgtgagtcggggcaatcccgcaaggagggt gaccgcttgccctcatctgtta

_F ctggccggctaccgccggcgtaacagatgagggcaagc ggtcaccctccttgcgggattg

F2 M3C1 tgacctggtgagggtagggggatatcgctatcccctcccc ggtcgtagctcctaagagtc

P agcccgcccaatcctgaaacgactcttaggagctacgacc

F3 ggggaggggatagcgatatc 3710 M3C1

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F4 M3C1

R aggcccttgccaatgaat

F ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc

F5 _R gggcacttcgcccaggtcagcaaccggaggatcaacccc 4262 M3C1 ggcggcaagagacgaaagccc

M3C1 F1

Fl F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt M3C1

R tgctggtccatgaagatgaa F tcgagctgatgttgacgac

F2 11800 M3C2

R atcggcgtgaagcccaacagggcca

F gtggacattggtttcagcaa

F3 6500 M3C2

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc

F4 11797 M3C2

R aggcccttgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F5 10447 M3C2

R agccctcccgtatcgtagt

M3C1 F2

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl 11593 M3C2

R tgctggtccatgaagatgaa

F tcgagctgatgttgacgac

F2 11800 M3C1

R atcggcgtgaagcccaacagggcca

F gtggacatggttcagcaa

F3 6500 M3C2

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc

F4 11797 M3C2

R aggccctgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F5 10447 M3C2

R agccctcccgtatcgtagt

M3C1 F3

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl 11593 M3C2

R tgctggtccatgaagatgaa

F tcgagctgatgttgacgac

F2 11800 M3C2

R atcggcgtgaagcccaacagggcca

F gtggacatggttcagcaa

F3 6500 M3C1

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc

F4 11797 M3C2

R aggccctgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F5 10447 M3C2

R agccctcccgtatcgtagt

M3C1 F4

Fl F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

11593 M3C2

R tgctggtccatgaagatgaa

F tcgagctgatgttgacgac

F2 11800 M3C2

R atcggcgtgaagcccaacagggcca

F gtggacatggttcagcaa

F3 6500 M3C2

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc

F4 11797 M3C1

R aggccctgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F5 10447 M3C2

R agccctcccgtatcgtagt

M3C1 F5

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl 11593 M3C2

R tgctggtccatgaagatgaa

F tcgagctgatgttgacgac

F2 11800 M3C2

R atcggcgtgaagcccaacagggcca

F gtggacatggttcagcaa

F3 6500 M3C2

R aagcgatgaatgatcccaag

F4 F tgtaacgctcccggtagtc 11797 M3C2 R aggccctgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F5 10447 M3C1

R agccctcccgtatcgtagt pTA-Mob 2.0 Tp

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl 5752 pTA-Mob 2.0

R ttaacctactccttggtccgggggatctcgcgactc

F atcgaagagaagcaggacga

F2 6374 pTA-Mob 2.0

R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac 6137 pTA-Mob2.0

F3

R ggactgaggtgctctgct

F ggaccaggcgcagtccaccatcaacggcctgatgagcgc

F4 6000 pTA-Mob 2.0 c/

R atcggcgtgaagcccaacagggcca

F gtggacattggtttcagcaa

F5 6273 pTA-Mob 2.0

R agctcatgcatcacaacagc

F gagcaatggatagccgatgt

F6 6206 pTA-Mob 2.0

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc

F7 6295 pTA-Mob 2.0

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F8a atccaacggcgtcagccgagggcaagcggatggctgatg 1881 pTA-Mob 2.0 aaaccaagccaaccaggaagg

P ccttcctggtggctggtttcatcagccatccgctgccctc

F8b ggctgacgccgtggat 4435 pTA-Mob 2.0

R aggccctgccaatgaat

F tcttgaatgcgcgggcgtcctggtgagcgtagtccagc

F9 6000 pTA-Mob 2.0

R cgtcccgcctgcccctgatggcccgctgatcgaccgct

F aatgtgcaaggcgatcag

F10 5745 pTA-Mob 2.0

R agccctcccgtatcgtagt pTA-Mob 2.0 To

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl 5752 pTA-Mob 2.0

R ttaacctactccttggtccgggggatctcgcgactc

F atcgaagagaagcaggacga

F2 6374 pTA-Mob 2.0

R tgctggtccatgaagatgaa

F tcgagctgatgttgacgac 6137 pTA-Mob2.0

F3

R ggactgaggtgctctgct

F ggaccaggcgcagtccaccatcaacggcctgatgagcgc

F4 ₆₀₀₀ pTA-Mob 2.0 c

R atcggcgtgaagcccaacagggcca

F gtggacatggttcagcaa

F5 _62?3 pTA-Mob 2.0

R agctcatgcatcacaacagc

F gagcaatggatagccgatgt

F6 ₆₂₀₆ pTA-Mob 2.0

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc

F7 ₆₂₉₅ pTA-Mob 2.0

R catgcaaagcgactgatgt

F8a F gatccgctcctgaactctg 1821 pTA-Mob 2.0 gcagcccacctatcaaggtgtactgccttccagacgaacg aagagcgattgaggaaaagg taggccgacaggctcatgccggccgccgccgccttttcct

F8b caatcgctcttcgttcgtct 4526 pTA-Mob 2.0 aggcccttgccaatgaat ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc

F9 ₆₀₀₀ pTA-Mob 2.0 cgtcccgcctgcccctgattggcccgctgatcgaccgct aatgttgcaaggcgatcag

F10 pTA-Mob 2.0 agccctcccgtatcgtagtt

Sequencing primers to check mutations in traJ region gtttcagcaggccgcccagg

Fl cgctgcataaccctgcttcg pSC5 tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt pTA-Mob 2.0-

Fl 7280 tttaacctacttcctttggttccgggggatctcgcgactc NAT atcgaagagaagcaggacga

F2 6373 M3C1 tgctggtccatgaagatgaa tcgagctgatgtttgacgac

F3 11800 M3C1 atcggcgtgaagcccaacagggcca gtggacattggtttcagcaa

F4 caagcattgggttccgtatctaaccatgaccgtgcttcgaac 3692 M3C1 cactcggagggacggttt aaaccgtccctccgagtggttcgaagcacggtcatggttag atacggaacccaatgcttg

F5 2573 pGMOl aggagaactagagcgtaattaccctgttatccctacaaaca ccctttcaatgggcttcga cattgaaagggtgtttgtagggataacagggtaattacgctc

F6 tagttctccttagtaggt 3477 M3C1 aagcgatgaatgatcccaag tgtaacgcttcccggtagtc

F7 11797 M3C1 aggcccttgccaatgaat ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc

F8 10447 M3C1 cgttcccgcctgcccctgattggcccgctgatcgaccgct aatgttgcaaggcgatcag

F9 5745 MV3C1 agccctcccgtatcgtagtt pSC5GGvl tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl taattagcatttttcgctttattctgttgtcgagatcttctccttg 6112 pSC5 caggttcaacaact aagatctcgacaacagaataaagcgaaaaatgctaataat gcactaacactcaggcctc

F2 7196 pSC5

(To domesticate Bsal site) tgctggtccatgaagatgaa tcgagctgatgtttgacgac

F3 6137 pSC5 ggacttgaggttgctctgct ggaccaggcgcagtccaccatcaacggcctgatgagcgc

F4 c 6000 pSC5

R atcggcgtgaagcccaacagggcca

F5 F gtggacattggtttcagcaa 11926 pSC5 caatgtctgatgcaatatggacaattggtttcttggtctcatta

R ccctgttatccctaca accttcgggtgggcctttctgcgtttataggtctcatgcttac

F gctctagttctccttag

F6 pSC5 cgaattgaaacggagggcgacaagaagggcgagaagtc

R gggcttctacgtcggccacctc cgacttctcgcccttcttgtcgccctccgtttcaattcggtgct

F tcttgccgtccatga 8239

F7 pSC5

(To domesticate Bsal site)

R cattgcaaagcgactgatgt F

F8 gatccgctccttgaactctg 6256 pSC5 R aggcccttgccaatgaat F aatgttgcaaggcgatcag

F9 ₄₉₂₈ pSC5

R agccctcccgtatcgtagtt attgaaagggtgtttgtagggataacagggtaatgagacca

F agaaaccaattgtccatat

F10 (To amplify RFP Gene) Tl pAGE2.0-i

Gagaacctactaaggagaactagagcgtaagcatgagac

R ctataaacgcagaaaggccca

(To amplify RFP Gene)

Sh ble fragment for Golden Gate assembly

F ggtctcagtaatatcaagcttg pRS32 (From

Sh ble gene R taggtctcaagcaactggatggcg Shapiro lab)

Hindll fragment for Golden Gate assembly ggtctcagtaaggcgcgcccttggcagaacatatccatcg

F pUC57 Hindll

Hindll toxic cgtccgccatctccagcagc plasmid gene ggtctcagatttatcttcgtttcctgcaggtttttgttctgtgca (Synthesized

R gttgggttaagaata vector)

A. laidlawii toxic gene fragments for Golden Gate assembly ggtctcagtaaggtaatgcttggcatgttcatatagatggttt

F A. laidlawii

1 ^st half of Al aacagatcattataaag

2072 strain PG-8A toxic gene ggtctcatagtgcattaaatcctggaggcgttaatttacttcta

R gDNA tgtgcttcaaaggctt ggtctcaactagtatgttctagcgcttgcaccatcccatttaa

F ct .S', cerevisiae

ACT1 intron gtaagaagaattgca 327 ggtctcactaaacatataatatagcaacaaaaagaatgaag gDNA

R caatcgatgttagtacatg ggtctcattagtctaatgaaggtttacttcaatattacgcttcat

F A. laidlawii

2 ^nd half of Al taaatggtttaactg

1061 strain PG-8A toxic gene ggtctcaagcaggaccataagaagtccgaaaaactattaat

R gDNA ctgtccaaaatgtttaata

Genotyping NAT marker

F tccagttgatccaccattga

NAT gene 283 R caaccacaaatgaccagcac

_P SC5GGv2

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt pSC5GGvl C8

Fl atatggacaattggtttcttggtctcattacatatatacacatgt 4235

R atatatatcgtatgc tgggcctttctgcgtttataggtctcatgctgtatacctatgaa pSC5GGvl C8

F2 F 3149 tgtcagtaagtatgta R tttaacctacttcctttggttccgggggatctcgcgactc

F taggagtgcggttggaacgt pSC5GGvl C8

F3 6177

R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac pSC5GGvl C8

F4 6137

R ggacttgaggttgctctgct

P ggaccaggcgcagtccaccatcaacggcctgatgagcgc pSC5GGvl C8

F5 c 6000

R atcggcgtgaagcccaacagggcca

F gtggacattggtttcagcaa pSC5GGvl C8

F6 aggagaactagagcgtaattaccctgttatccctacaaaca 6300 ccctttcaatgggcttcga

„ cattgaaagggtgtttgtagggataacagggtaattacgctc r ₃₅₁₂ pSC5GGvl C8

F7 tagttctccttagtaggt

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc pSC5GGvl C8

F8 6295

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg pSC5GGvl C8

F9 6253

R aggcccttgccaatgaat

F ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc

F10 6000 pSC5GGvl C8

R cgtcccgcctgcccctgattggcccgctgatcgaccgct

F aatgttgcaaggcgatcag

Fl 1 4928 pSC5GGvl C8

R agccctcccgtatcgtagtt gcatacgatatatatacatgtgtatatatgtaatgagaccaag

F aaaccaattgtccatat

(To amplify RFP Gene)

F12 1276 pAGE2.0-i tacatacttactgacattcataggtatacagcatgagacctat

R aaacgcagaaaggccca

(To amplify RFP Gene) pTA-Mob 2.1

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl gggagtatctggctgggccaacgttccaaccgcactccta 5259 pTA-Mob 2.0 ccggccagcctcgcagagca gcggtgctcaacgggaatcctgctctgcgaggctggccg

F2 gtaggagtgcggttggaacgt 6177 pTA-Mob 2.0

R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac

F3 6137 pTA-Mob 2.0

R ggacttgaggttgctctgct

„ ggaccaggcgcagtccaccatcaacggcctgatgagcgc r

F4 c 6000 pTA-Mob 2.0

R atcggcgtgaagcccaacagggcca

F gtggacattggtttcagcaa

F5 6289 pTA-Mob 2.0

R agctcatgcatcacaacagc

F gagcaatggatagccgatgt

F6 6204 pTA-Mob 2.0

R aagcgatgaatgatcccaag

F tgtaacgcttcccggtagtc

F7 6295 pTA-Mob 2.0

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F8 6256 pTA-Mob 2.0

R aggcccttgccaatgaat

F9 F ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc 6000 pTA-Mob 2.0 R cgtcccgcctgcccctgattggcccgctgatcgaccgct

F aatgttgcaaggcgatcag

F10 4928 pTA-Mob 2.0

R agccctcccgtatcgtagtt pSC5.1

F tgccgccgcgcgcatggtcgtaatgggaccgatagcccgt

Fl cacgcgacaagcacgagcgagatatcccaatcaagctag 6757 pSC5 tccggccagcctcgcagagca gcggtgctcaacgggaatcctgctctgcgaggctggccg

F2 gtaggagtgcggttggaacgt 6177 pSC5

R tgctggtccatgaagatgaa

F tcgagctgatgtttgacgac

F3 6137 pSC5

R ggacttgaggttgctctgct

P ggaccaggcgcagtccaccatcaacggcctgatgagcgc

F4 c 6000 pSC5

R atcggcgtgaagcccaacagggcca

F gtggacattggtttcagcaa

F5 9812 pSC5

R aagcgatgaatgatcccaag

F tgtaacgctcccggtagtc

F6 6295 pSC5

R cattgcaaagcgactgatgt

F gatccgctccttgaactctg

F7 6256 pSC5

R aggcccttgccaatgaat

F ttctttgaatgcgcgggcgtcctggtgagcgtagtccagc

F8 10549 pSC5

R agccctcccgtatcgtagtt qPCR primers

F ctcttgccatcggatgtgccca pTA-Mob 2.1 rrsA gene 106 and pSC5.1 ccagtgtggctggtcatcctctca cDNA

F ttgtcggcggtggtgatgtc pTA-Mob 2.1 cysG gene 136 and pSC5.1 atgcggtgaactgtggaataaacg cDNA

F acgacgcccgtgattttgtag pTA-Mob 2.1 traJ gene P gccttccagacgaacgaaga 109 and pSC5.1 cDNA

Table 4. Conjugation phenotype of pTA-Mob 2.0 deletion plasmid library.

Conjugation phenotypes of pTA-Mob 2.0 deletion strains displayed as the ratio of the number of deletion plasmids transconjugants relative to pTA-Mob2.0 transconjugants. All clones were tested using 1 biological and 3 technical replicates, except for deletion plasmid 32 C2* where 6 biological and 1 -3 technical replicates were used. Additional replicas were performed for plasmid 32 C2 due to the high variations in the initial experiments. Deletions were categorized as either non-essential (dark grey; 0.51 -5.98), semi-essential (light-grey; 0.06-0.50), or essential (black; 0-0.05) based on their bacterial conjugation ratio. Contradictory results for clones for the same genes could be due to mutations introduced during the PCR fragment amplification or yeast assembly.

Deletion Plasmid Clone name Ratio for Clone 1 Ratio for Clone 2

1 Cl, C2 0.36 1.04

14 Cl, C2 2.37 3.60

15 Cl, C5

16 Cl, C5

17 C2, C3 N/D 0.12

18 C2, C3 1.31 1.11

19 C4, C5 N/D 0.15

20 C2, C3 0.54 0.39

21 C4, C5 0.31 0.98

22 C2, C3 0.53 0.64

23 Cl, C2 0.51 0.46

24 C3, C16 0.63 1.03

25 Cl, C2.1 N/D N/D

26 C2.2, C3 0.52 1.39

27 Cl, C2 2.06 0.11

28 C2 N/D 0.34

29 C2, C5 0.98 0.00

30 C6, C7 4.36 1.22

31 Cl, C2 0.57 1.47

32 Cl, C2* 0.75 5.98*

33 C3, C6 0.20 0.24

34 Cl, C3 0.00 0.51

35 Cl.l, C6 0.33 1.09

36 Cl, C2

37 C2

38 C2, C3

39 C2, C8

40 Cl, C5

41 C5, C7

47 Cl, C5 0.65 1.49

48 Cl 0.05 N/D

49 Cl, C5 0.32 0.41

50 C4, C5 0.39 0.67

51 C3, C5 N/D N/D

52 Cl, C2 1.81 0.61

53 C2 N/D 0.69

54 Cl, C2 0.00 0.00

55 Cl, C5 0.43 0.41

56 C2, C3 0.46 0.60

57 Cl, C5 0.65 1.03

Table 5. Whole plasmid sequencing of minimal conjugative plasmid 3 (M3C1 and

M3C2). Mutations in M3C1 and M3C2 identified by next-generation sequencing and alignment to the reference sequence: pTA-Mob 2.0. Nucleotide numbering begins at the forward primers of Fragment 1 . Note: The 4,912 bp is designed deletion.

Plasmid Fragment Plasmid Nucleotide Amino Acid Gene position Mutation Mutation

M3C1 Fragment 1 3,342 1 bp insertion (T)

M3C1 Fragment 2 14,111 G731 T R ₂₄ 4 L trbF

M3C1 Fragment 2 20,676 G505 T DI ₆₉ Y trbN

M3C1 Fragment s 25,788 C138 — > A

M3C1 Fragment s 26,489 4,912 bp Deletion URA3

M3C1 Fragment 4 37,156 T77 — > G E26 — > A traJ

M3C1 Fragment 4 37,242 - GA ATT

37,246 CTCGG

M3C2 Fragment 3 25,787 C138 — > A pctrE

M3C2 Fragment s 26,488 4,912 bp Deletion URA3

M3C2 Fragment 4 37,458 G ^ T

M3C2 Fragment s 48,347 A47 G L _i6 S klctA

Table 6. Cis- and trans- conjugation of super conjugative plasmid (pSC5). S. cerevisiae transconjugant concentrations following bacterial conjugation of pSC5 compared to pTA-Mob 2.0 in either cis- (self-transmissible) or trans- (mobilization of a secondary plasmid - pAGE2.0.T) and E. coli transconjugant colony counts following bacterial conjugation of pSC5 compared to pTA-Mob 2.0 in cis- from E. coli (Fig. 4). Results are shown as colony-forming units per mL (CFU mL’ ¹ ) for four biological replicates each with two technical replicates.

Configuration Plasmid Rep 1 Rep 2 Rep 3 Rep 4 Average

Table 7. Recipient yeast cell concentrations used in conjugation experiments of Fig. 4. Counts of S. cerevisiae colonies formed on the non-selective plate (1 x YPAD supplemented with ampicillin 100 pg mL’ ¹ ) following the bacterial conjugation of pSC5 and pTA-Mob 2.0 in cis- and trans- configuration. Colony-forming units are presented per mL (CFU mL ^-1 ) for four biological replicates each with two technical replicates.

Configuration Plasmid Rep 1 Rep 2 Rep 3 Rep 4 Average pTA-Mob 2.0 1.3 x lO ⁷ 1.5 x 10 ⁷ 3.9 x 10 ⁷ 4.7 x 10 ⁷ 2.9 x 10 ⁷

Cis

P ^SC5 6.7 x lO ⁷ 6.9 x lO ⁷ 1.1 x lO ⁸ 1.1 x 10 ⁸ 9.1 x 10 ⁷ pTA-Mob 2.0 8.0 x 10 ^s 4.0 x 10 ^s 4.3 x 10 ⁷ 3.7 x 10 ⁷ 2.3 x 10 irans ⁷ pSC5 1.2 x 10 ⁷ 1.5 x 10 ⁷ 9.5 x 10 ⁷ 9.3 x 10 ⁷ 5.4 x 10 ⁷

Table 8. S. cerevisiae cell viability following conjugation with different E. coli strains. S. cerevisiae cell concentrations obtained by hemocytometer (all cells) or plating on non-selective (1 x YPAD supplemented with ampicillin 100 pg mL’ ¹ ) plates (live cells) following a 3-hour incubation at 30°C alone or with E. coli either harboring no plasmid, pTA-Mob 2.0, or pSC5.

Colony Count (CFU mL ¹ ) Hemocytometer Cell Count

Donor (D) / Recipient (R) (Cells mL ¹ ) Technical replicas Average

D: no E. coli 5.08 x 10 ⁸ 2.01 x 10 ⁸ 2.08 x 10 ⁸ R: S. cerevisiae 2.27 x IO ⁸

1.97 x IO ⁸

2.05 x IO ⁸

D: E.co Epi300 _{6 14x 10} 8 _{2.37x 10} 8 _{2. 19x 10} 8

R: o. cerevisiae

2.15 x 10 ⁸

1.4 x 10 ⁷

D: E. coli Epi300 with pTA-Mob 2.0 2.56 x 10 ⁸ 1.0 xlO ⁷ 1.63 x 10 ⁷

R: S. cerevisiae

2.5 x 10 ⁷

1.41 x 10 ⁸

D: E. coli Epi300 with pSC5 4.06 xlO ⁸ 1.45 x IO ⁸ 1.44 x IO ⁸

R: S. cerevisiae

1.47 x IO ⁸

Table 9. S. cerevisiae cell viability following conjugation with different S. meliloti strains. S. cerevisiae cell counts by hemocytometer (all cells) or plating on non-selective (1 x YPAD supplemented with ampicillin 100 pg mL ^-1 ) plates (live cells) following a 3-hour incubation at 30°C alone or with S. meliloti either harboring pTA-Mob 2.0 or pSC5.

Hemocytometer Cell Count (Cells ml ¹ ) Colony Count (CFU mL ^-1 )

Biological Biological

Donor (D) / Recipient (R) replicas Average replicas Average

D no S. meliloti 3.04 xlO ⁸ 3.04 x 10 ⁸ 1.27 x 10 ⁸ 1.27 x 10 ⁸

R: A cerevisiae

D: A meliloti Rm4126 3.16 x 10 ⁸ 9.70 x 10 ⁷

R" with pTA-Mob 2.0

R: A cerevisiae 3.48 x 10 ⁸ 3.07 x 10 ⁸ l.lOx lO ⁸ 8.47 x 10 ⁷

2.58 xlO ⁸ 4.70 x 10 ⁷

3.84xl0 ⁸ 4.11 x 10 ⁸ 1.85 x l0 ⁸ 1.60x l0 ⁸ D: S. meliloti Rm4126 4.52 x IO ⁸ 1.67 x 10 ⁸ R’ with pSC5 R: S. cerevisiae 3.98 x IO ⁸ 1.27 x 10 ⁸

Table 10. S. cerevisiae transconjugant colony count following conjugation with S. meliloti. Colony counts of S. cerevisiae transconjugant re-suspension (2 mL) following bacterial conjugation with three biological replicates of S. meliloti (Rm4126) harboring either pTA-Mob 2.0 or pSC5, plated on complete synthetic yeast media lacking histidine and supplemented with ampicillin (100 pg mL’ ¹ ) (Fig. 9).

Colony Count (CFU)

Plasmid 100 pL 50 pL pTA-Mob 2.0 #1 114 53 pTA-Mob 2.0 #2 108 34 g pTA-Mob 2.0 #3 92 46

'g pSC5 #1 2514 1341

> pSC5 #2 2399 1254 pSC5 #3 2504 1220 pTA-Mob 2.0 #1 147 68

£ pTA-Mob 2.0 #2 123 54 g pTA-Mob 2.0 #3 87 39

'g pSC5 #1 1044 546

> pSC5 #2 2145 1159 pSC5 #3 572 260

Table 11. Yeast transconjugant colony counts for the conjugation-based antifungal experiment (Fig. 7). S. cerevisiae transconjugant colony counts following bacterial conjugation with E. coli harboring pAGE2.0.T and either pSC5, pSC5-toxic1 , pSC5-toxic2, or pSC5-toxic3. Note: Colonies were counted from plating 100 pL of undiluted (1 X) and diluted (10 X) yeast transconjugant re-suspension (2 mL) on synthetic yeast media lacking either histidine or tryptophan. Colonies were counted manually, tmtc - too many to count.

Yeast Selection Marker (CFU)

HIS3 TRP1 Ratio

Plasmid _ Rep 1 Rep 2 Rep 3 Average Rep 1 Rep 2 Rep 3 Average HIS3/TRP1 pSC5 tmtc tmtc 592 592.00 tmtc tmtc 302 302.0 1.960

X pSC5-toxicl tmtc tmtc 230 230.00 tmtc tmtc 264 264.0 0.871 pSC5-toxic2 25 17 5 15.67 594 tmtc 169 381.5 0.041 pSC5-toxic3 2 1 0 1.00 428 tmtc 188 308.0 0.003 pSC5 208 436 55 233 174 262 33 156.3 1.490

X pSC5-toxicl 62 105 27 64.7 107 149 23 93 0.695

2 pSC5-toxic2 4 1 0 1.7 66 72 18 52 0.032 pSC5-toxic3 0 0 0 0 50 107 17 58 0

Sequence Listing

SEQ ID NO: 1 traJ (wild type)

Underlined - traJ promoter region

Non-underlined - traJ open reading frame

Bolded - wild type partial promoter region - does not improve conjugation from bacteria to eukaryotic cell cgtctctcgcctgtcccctcagttcagtaatttcctgcatttgcctgtttccagtcggta gatattccacaaaacagcagggaagcagcgcttttc cgctgcataaccctgcttcggggtcattatagcgattttttcggtatatccatccttttt cgcacgatatacaggattttgccaaagggttcgtgta gactttccttggtgtatccaacggcgtcagaattcggcaagcggatggctgatgaaacca agccaaccaggaagggcagcccacctatca aggtgtactgccttccagacgaacgaagagagattgaggaaaaggcggcggcggccggca tgagcctgtcggcctacctgctggccgtc ggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgc atcaatggcgacctgggccgcctgggcg gcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacga tcctcgccctgctggcgaagatcgaagag aagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatga

SEQ ID NO: 2 traJ (mutated)

Underlined - traJ promoter region

Non-underlined - traJ open reading frame

Bolded - mutated partial promoter region responsible for conjugation improvement from bacteria to eukaryotic cell cgtctctcgcctgtcccctcagttcagtaatttcctgcatttgcctgtttccagtcggta gatattccacaaaacagcagggaagcagcgcttttc cgctgcataaccctgcttcggggtcattatagcgattttttcggtatatccatccttttt cgcacgatatacaggattttgccaaagggttcgtgta gactttccttggtgtatccaacggcgtcagccgagggcaagcggatggctgatgaaacca agccaaccaggaagggcagcccacctatc aaggtgtactgccttccagacgaacgaagagagattgaggaaaaggcggcggcggccggc atgagcctgtcggcctacctgctggccgt cggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccg catcaatggcgacctgggccgcctgggc ggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacg atcctcgccctgctggcgaagatcgaaga gaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatg a

SEQ ID NO: 3: ccgag REFERENCES

(1 ) Fisher, M. C., Gurr, S. J., Cuomo, C. A., Blehert, D. S., Jin, H., Stukenbrock, E. H., Stajich, J. E., Kahmann, R., Boone, C., Denning, D. W., Gow, N. A. R., Klein, B. S., Kronstad, J. W., Sheppard, D. C., Taylor, J. W., Wright, G. D., Heitman, J., Casadevall, A., and Cowen, L. E. (2020) Threats posed by the fungal kingdom to humans, wildlife, and agriculture. MBio. 11, e00449-20.

(2) Hyde, K. D., Xu, J., Rapior, S., Jeewon, R., Lumyong, S., Niego, A. G. T., Abeywickrama, P. D., Aluthmuhandiram, J. V. S., Brahamanage, R. S., Brooks, S., Chaiyasen, A., Chethana, K. W. T., Chomnunti, P., Chepkirui, C., Chuankid, B., de Silva, N. I., Doilom, M., Faulds, C., Gentekaki, E., Gopalan, V., Kakumyan, P., Harishchandra, D., Hemachandran, H., Hongsanan, S., Karunarathna, A., Karunarathna, S. C., Khan, S., Kumla, J., Jayawardena, R. S., Liu, J.-K., Liu, N., Luangharn, T., Macabeo, A. P. G., Marasinghe, D. S., Meeks, D., Mortimer, P. E., Mueller, P., Nadir, S., Nataraja, K. N., Nontachaiyapoom, S., O’Brien, M., Penkhrue, W., Phukhamsakda, C., Ramanan, U. S., Rathnayaka, A. R., Sadaba, R. B., Sandargo, B., Samarakoon, B. C., Tennakoon, D. S., Siva, R., Sriprom, W., Suryanarayanan, T. S., Sujarit, K., Suwannarach, N., Suwunwong, T., Thongbai, B., Thongklang, N., Wei, D., Wijesinghe, S. N., Winiski, J., Yan, J., Yasanthika, E., and Stadler, M. (2019) The amazing potential of fungi: 50 ways we can exploit fungi industrially. Fungal Divers. 97, 1-136.

(3) Parapouli, M., Vasileiadis, A., Afendra, A.S., and Hatziloukas, E. (2020) Saccharomyces cerevisiae and its industrial applications. AIMS Microbiol. 6, 1-31.

(4) Edwards-Ingram, L., Gitsham, P., Burton, N., Warhurst, G., Clarke, I., Hoyle, D., Oliver, S. G., and Stateva, L. (2007) Genotypic and physiological characterization of Saccharomyces boulardii, the probiotic strain of Saccharomyces cerevisiae. Appt. Environ. Microbiol. 73, 2458-2467.

(5) Everard, A., Matamoros, S., Geurts, L., Delzenne, N. M., and Cani, P. D. (2014) Saccharomyces boulardii administration changes gut microbiota and reduces hepatic steatosis, low-grade inflammation, and fat mass in obese and type 2 diabetic db/db mice. MBio. 5, e01011-14.

(6) Pappas, P. G., Lionakis, M. S., Arendrup, M. C., Ostrosky-Zeichner, L., and Kullberg, B. J. (2018) Invasive candidiasis. Nature Reviews Disease Primers. 4, 1-20.

(7) Limon, J. J., Tang, J., Li, D., Wolf, A. J., Michelsen, K. S., Funari, V., Gargus, M., Nguyen, C., Sharma, P., Maymi, V. I., Iliev, I. D., Skalski, J. H., Brown, J., Landers, C., Borneman, J., Braun, J., Targan, S. R., McGovern, D. P. B., and Underhill, D. M. (2019) Malassezia is associated with Crohn’s disease and exacerbates colitis in mouse models. Cell Host Microbe. 25, 377-388. e6.

(8) Aykut, B., Pushalkar, S., Chen, R., Li, Q., Abengozar, R., Kim, J. I., Shadaloey, S. A., Wu, D., Preiss, P., Verma, N., Guo, Y., Saxena, A., Vardhan, M., Diskin, B., Wang, W., Leinwand, J., Kurz, E., Kochen Rossi, J. A., Hundeyin, M., Zambrinis, C., Li, X., Saxena, D., and Miller, G. (2019) The fungal mycobiome promotes pancreatic oncogenesis via activation of MBL. Nature. 574, 264-267.

(9) Proctor, D. M., Dangana, T., Sexton, D. J., Fukuda, C., Yelin, R. D., Stanley, M., Bell, P. B., Baskaran, S., Deming, C., Chen, Q., Conlan, S., Park, M., NISC Comparative Sequencing Program, Welsh, R. M., Vallabhaneni, S., Chiller, T., Forsberg, K., Black, S. R., Pacilli, M., Kong, H. H., Lin, M. Y., Schoeny, M. E., Litvintseva, A. P., Segre, J. A., and Hayden, M. K. (2021 ) Integrated genomic, epidemiologic investigation of Candida auris skin colonization in a skilled nursing facility. Nat. Med. 27, 1401-1409.

(10) Du, H., Bing, J., Hu, T., Ennis, C. L., Nobile, C. J., and Huang, G. (2020) Candida auris: Epidemiology, biology, antifungal resistance, and virulence. PLoS Pathog. 16, e 1008921.

(11 ) Geddes-McAlister, J., and Shapiro, R. S. (2019) New pathogens, new tricks: emerging, drug-resistant fungal pathogens and future prospects for antifungal therapeutics. Ann. N. Y. Acad. Sci. 1435, 57-78. (12) Palacios Araya, D., Palmer, K. L., and Duerkop, B. A. (2021 ) CRISPR-based antimicrobials to obstruct antibiotic-resistant and pathogenic bacteria. PLoS Pathog. 17, e1009672.

(13) Citorik, R. J., Mimee, M., and Lu, T. K. (2014) Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat. Biotechnol. 32, 1141-1145.

(14) Kiga, K., Tan, X.-E., Ibarra-Chavez, R., Watanabe, S., Aiba, Y., Sato’o, Y., Li, F.-Y., Sasahara, T., Cui, B., Kawauchi, M., Boonsiri, T., Thitiananpakorn, K., Taki, Y., Azam,

A. H., Suzuki, M., Penades, J. R., and Cui, L. (2020) Development of CRISPR-Cas1 Sabased antimicrobials capable of sequence-specific killing of target bacteria. Nat.

Com mu n. 11, 2934.

(15) Chavez, A., Pruitt, B. W., Tuttle, M., Shapiro, R. S., Cecchi, R. J., Winston, J., Turczyk, B. M., Tung, M., Collins, J. J., and Church, G. M. (2018) Precise Cas9 targeting enables genomic mutation prevention. Proc. Natl. Acad. Sci. U. S. A. 115, 3669-3673.

(16) Gomaa, A. A., Klumpe, H. E., Luo, M. L., Selle, K., Barrangou, R., and Beisel, C. L. (2014) Programmable removal of bacterial strains by use of genome-targeting CRISPR- Cas systems. mBio. 5, e00928-13.

(17) Selle, K., Fletcher, J. R., Tuson, H., Schmitt, D. S., McMillan, L., Vridhambal, G. S., Rivera, A. J., Montgomery, S. A., Fortier, L.-C., Barrangou, R., Theriot, C. M., and Ousterout, D. G. (2020) In vivo targeting of Clostridioides difficile using phage-delivered CRISPR-Cas3 antimicrobials. MBio. 11, e00019-20.

(18) Bikard, D., Euler, C. W., Jiang, W., Nussenzweig, P. M., Goldberg, G. W., Duportet, X., Fischetti, V. A., and Marraffini, L. A. (2014) Exploiting CRISPR-Cas nucleases to produce sequence-specific antimicrobials. Nat. Biotechnol. 32, 1146-1150.

(19) Hamilton, T. A., Pellegrino, G. M., Therrien, J. A., Ham, D. T., Bartlett, P. C., Karas,

B. J., Gloor, G. B., and Edgell, D. R. (2019) Efficient inter-species conjugative transfer of a CRISPR nuclease for targeted bacterial killing. Nat. Commun. 10, 4544. (20) Lopez-lgual, R., Bernal-Bayard, J., Rodriguez-Paton, A., Ghigo, J.-M., and Mazel, D. (2019) Engineered toxin-intein antimicrobials can selectively target and kill antibiotic- resistant bacteria in mixed populations. Nat. Biotechnol. 37, 755-760.

(21 ) Neil, K., Allard, N., Roy, P., Grenier, F., Menendez, A., Burrus, V., and Rodrigue, S. (2021 ) High-efficiency delivery of CRISPR-Cas9 by engineered probiotics enables precise microbiome editing. Mol. Syst. Biol. 17, e10335.

(22) Neil, K., Allard, N., Grenier, F., Burrus, V., and Rodrigue, S. (2020) Highly efficient gene transfer in the mouse gut microbiota is enabled by the Incl 2 conjugative plasmid TP 114. Communications biology. 3, 1-9.

(23) Rodrigues, M., McBride, S. W., Hullahalli, K., Palmer, K. L., and Duerkop, B. A. (2019) Conjugative delivery of CRISPR-Cas9 for the selective depletion of antibiotic- resistant enterococci. Antimicrob. Agents Chemother. 63, e01454-19.

(24) Karas, B. J., Diner, R. E., Lefebvre, S. C., McQuaid, J., Phillips, A. P. R., Noddings, C. M., Brunson, J. K., Valas, R. E., Deerinck, T. J., Jablanovic, J., Gillard, J. T. F., Beeri, K., Ellisman, M. H., Glass, J. I., Hutchison, C. A., 3rd, Smith, H. O., Venter, J. C., Allen, A. E., Dupont, C. L., and Weyman, P. D. (2015) Designer diatom episomes delivered by bacterial conjugation. Nat. Commun. 6, 6925.

(25) Brumwell, S. L., MacLeod, M. R., Huang, T., Cochrane, R., Meaney, R. S., Zamani, M., Matysiakiewicz, O., Dan, K. N., Janakirama, P., Edgell, D. R., Charles, T. C., Finan, T. M., and Karas, B. J. (2019) Designer Sinorhizobium meliloti strains and multifunctional vectors enable direct inter-kingdom DNA transfer. PLoS One. 14, e0206781 .

(26) Hayman, G. T., and Bolen, P. L. (1993) Movement of shuttle plasmids from Escherichia coli into yeasts other than Saccharomyces cerevisiae using trans-kingdom conjugation. Plasmid. 30, 251-257.

(27) Moriguchi, K., Edahiro, N., Yamamoto, S., Tanaka, K., Kurata, N., and Suzuki, K. (2013) Transkingdom genetic transfer from Escherichia coli to Saccharomyces cerevisiae as a simple gene introduction tool. Appl. Environ. Microbiol. 79, 4393-4400. (28) Soltysiak, M. P. M., Meaney, R. S., Hamadache, S., Janakirama, P., Edgell, D. R., and Karas, B. J. (2019) Trans-kingdom conjugation within solid media from Escherichia coli to Saccharomyces cerevisiae. int. J. Mol. Sci. 20, 5212.

(29) Zoolkefli, F. I. R. M., Moriguchi, K., Cho, Y., Kiyokawa, K., Yamamoto, S., and Suzuki, K. (2021) Isolation and analysis of donor chromosomal genes whose deficiency is responsible for accelerating bacterial and trans-kingdom conjugations by IncPI T4SS machinery. Front. Microbiol. 12, 971.

(30) Norberg, P., Bergstrom, M., Jethava, V., Dubhashi, D., and Hermansson, M. (2011 ) The lncP-1 plasmid backbone adapts to different host bacterial species and evolves through homologous recombination. Nat. Commun. 2, 268.

(31 ) Pansegrau, W., Lanka, E., Barth, P. T., Figurski, D. H., Guiney, D. G., Haas, D., Helinski, D. R., Schwab, H., Stanisich, V. A., and Thomas, C. M. (1994) Complete nucleotide sequence of Birmingham IncPa plasmids: compilation and comparative analysis. J. Mol. Biol. 239, 623-663.

(32) Ziegelin, G., Furste, J. P., and Lanka, E. (1989) TraJ protein of plasmid RP4 binds to a 19-base pair invert sequence repetition within the transfer origin. J. Biol. Chem.

264, 11989-11994.

(33) Furste, J. P., Pansegrau, W., Ziegelin, G., Kroger, M., and Lanka, E. (1989) Conjugative transfer of promiscuous IncP plasmids: interaction of plasmid-encoded products with the transfer origin. Proc. Natl. Acad. Sci. U. S. A. 86, 1771-1775.

(34) Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., and Lanka, E. (1990) In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proc. Natl. Acad. Sci. U. S. A. 87, 6555-6559.

(35) Pansegrau, W., Schroder, W., and Lanka, E. (1993) Relaxase (Tral) of IncP alpha plasmid RP4 catalyzes a site-specific cleaving-joining reaction of single-stranded DNA. Proc. Natl. Acad. Sci. U. S. A. 90, 2925-2929.

(36) Pansegrau, W., and Lanka, E. (1996) Mechanisms of initiation and termination reactions in conjugative DNA processing: independence of tight substrate binding and catalytic activity of relaxase (Tral) of IncPa plasmid RP4 *. J. Biol. Chem. 271, 13068- 13076.

(37) Ziegelin, G., Pansegrau, W., Lurz, R., and Lanka, E. (1992) TraK protein of conjugative plasmid RP4 forms a specialized nucleoprotein complex with the transfer origin. J. Biol. Chem. 267, 17279-17286.

(38) Rees, C. E., and Wilkins, B. M. (1990) Protein transfer into the recipient cell during bacterial conjugation: studies with F and RP4. Mol. Microbiol. 4, 1199-1205.

(39) Cabezon, E., Sastre, J. I., and de la Cruz, F. (1997) Genetic evidence of a coupling role for the TraG protein family in bacterial conjugation. Mol. Gen. Genet. 254, 400-406.

(40) Grahn, A. M., Haase, J., Bamford, D. H., and Lanka, E. (2000) Components of the RP4 conjugative transfer apparatus form an envelope structure bridging inner and outer membranes of donor cells: implications for related macromolecule transport systems. J. Bacteriol. 182, 1564-1574.

(41 ) Eisenbrandt, R., Kalkum, M., Lurz, R., and Lanka, E. (2000) Maturation of IncP pilin precursors resembles the catalytic dyad-like mechanism of leader peptidases. J. Bacteriol. 182, 6751-6761.

(42) Eisenbrandt, R., Kalkum, M., Lai, E. M., Lurz, R., Kado, C. I., and Lanka, E. (1999) Conjugative pili of IncP plasmids, and the Ti plasmid T pilus are composed of cyclic subunits. J. Biol. Chem. 274, 22548-22555.

(43) Gordon, Z. B., Soltysiak, M. P. M., Leichthammer, C., Therrien, J. A., Meaney, R. S., Lauzon, C., Adams, M., Lee, D. K., Janakirama, P., Lachance, M.-A., and Karas, B.

J. (2019) Development of a transformation method for Metschnikowia borealis and other CUG-Serine Yeasts. Genes. 10, 78.

(44) Karas, B. J., Tagwerker, C., Yonemoto, I. T., Hutchison, C. A., 3rd, and Smith, H. O. (2012) Cloning the Acholeplasma laidlawii PG-8A genome in Saccharomyces cerevisiae as a yeast centromeric plasmid. ACS Synth. Biol. 1, 22-28. (45) Marillonnet, S., and Grutzner, R. (2020) Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline. Curr. Protoc. Mol. Biol. 130, e115.

(46) Engler, C., Kandzia, R., and Marillonnet, S. (2008) A one pot, one step, precision cloning method with high throughput capability. PLoS One. 3, e3647.

(47) Ng, R., and Abelson, J. (1980) Isolation and sequence of the gene for actin in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U. S. A. 77, 3912-3916.

(48) Ruotsalainen, P., Penttinen, R., Mattila, S., and Jalasvuori, M. (2019) Midbiotics: conjugative plasmids for genetic engineering of natural gut flora. Gut Microbes. 10, 643-653.

(49) Hullahalli, K., Rodrigues, M., and Palmer, K. L. (2017) Exploiting CRISPR-Cas to manipulate Enterococcus faecalis populations. Elife. 6, e26664.

(50) Ram, G., Ross, H. F., Novick, R. P., Rodriguez-Pagan, I., and Jiang, D. (2018) Conversion of staphylococcal pathogenicity islands to CRISPR-carrying antibacterial agents that cure infections in mice. Nat. Biotechnol. 36, 971-976.

(51 ) Lam, K. N., Spanogiannopoulos, P., Soto-Perez, P., Alexander, M., Nalley, M. J., Bisanz, J. E., Nayak, R. R., Weakley, A. M., Yu, F. B., and Turnbaugh, P. J. (2021 ) Phage-delivered CRISPR-Cas9 for strain-specific depletion and genomic deletions in the gut microbiome. Cell Rep. 37, 109930.

(52) Vercoe, R. B., Chang, J. T., Dy, R. L., Taylor, C., Gristwood, T., Clulow, J. S., Richter, C., Przybilski, R., Pitman, A. R., and Fineran, P. C. (2013) Cytotoxic chromosomal targeting by CRISPR/Cas systems can reshape bacterial genomes and expel or remodel pathogenicity islands. PLoS Genet. 9, e1003454.

(53) Kim, J.-S. , Cho, D.-H., Park, M., Chung, W.-J., Shin, D., Ko, K. S., and Kweon, D - H. (2016) CRISPR/Cas9-mediated re-sensitization of antibiotic-resistant Escherichia coli harboring extended-spectrum [3-lactamases. J. Microbiol. Biotechnol. 26, 394-401 . (54) Wang, P., He, D., Li, B., Guo, Y., Wang, W., Luo, X., Zhao, X., and Wang, X.

(2019) Eliminating mcr-1 -harbouring plasmids in clinical isolates using the CRISPR/Cas9 system. J. Antimicrob. Chemother. 74, 2559-2565.

(55) Valderrama, J. A., Andres Valderrama, J., Kulkarni, S. S., Nizet, V., and Bier, E. (2019) A bacterial gene-drive system efficiently edits and inactivates a high copy number antibiotic resistance locus. Nature Communications. 10, 1-8.

(56) Wang, K., and Nicholaou, M. (2017) Suppression of antimicrobial resistance in MRSA using CRISPR-dCas9. Clin. Lab. Sci. 30, 207-213.

(57) Li, Q., Zhao, P., Li, L., Zhao, H., Shi, L., and Tian, P. (2020) Engineering a CRISPR interference system to repress a class 1 integron in Escherichia coli. Antimicrob. Agents Chemother. 64, e01789-19.

(58) Park, J. Y., Moon, B. Y., Park, J. W., Thornton, J. A., Park, Y. H., and Seo, K. S. (2017) Genetic engineering of a temperate phage-based delivery system for CRISPR/Cas9 antimicrobials against Staphylococcus aureus. Sci. Rep. 7, 44929.

(59) Gietz, R. D., and Woods, R. A. (2001 ) Genetic transformation of yeast. Biotechniques. 30, 816-20, 822-6, 828 passim.

(60) Martin, J. F. (2015) Fungal transformation: from protoplasts to targeted recombination systems, in Genetic Transformation Systems in Fungi, Volume 1 (van den Berg, M. A., and Maruthachalam, K., Eds.), pp 3-18. Springer International Publishing, Cham.

(61 ) Zatyka, M., Jagura-Burdzy, G., and Thomas, C. M. (1994) Regulation of transfer genes of promiscuous IncP alpha plasmid RK2: repression of Tra1 region transcription both by relaxosome proteins and by the Tra2 regulator TrbA. Microbiology. 140 (Pt 11), 2981-2990.

(62) Kostylev, M., Otwell, A. E., Richardson, R. E., and Suzuki, Y. (2015) Cloning should be simple: Escherichia coli DH5a-mediated assembly of multiple DNA fragments with short end homologies. PLoS One. 10, e0137466. (63) Stinchcomb, D. T., Struhl, K., and Davis, R. W. (1979) Isolation and characterisation of a yeast chromosomal replicator. Nature. 282, 39-43.

(64) Clarke, L., and Carbon, J. (1980) Isolation of a yeast centromere and construction of functional small circular chromosomes. Nature. 287, 504-509.

(65) Cai, P., Gao, J., and Zhou, Y. (2019) CRISPR-mediated genome editing in non- conventional yeasts for biotechnological applications. Microb. Cell Fact. 18, 63.

(66) Morio, F., Lombardi, L., and Butler, G. (2020) The CRISPR toolbox in medical mycology: state of the art and perspectives. PLoS Pathog. 16, e1008201.

(67) Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., and Vogl, T. (2018) Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: current state and future prospects. Biotechnol. Adv. 36, 641-665.

(68) Stovicek, V., Holkenbrink, C., and Borodina, I. (2017) CRISPR/Cas system for yeast genome engineering: advances and applications. FEMS Yeast Res. 17.

(69) Shan, L., Dai, Z., and Wang, Q. (2021 ) Advances and opportunities of CRISPR/Cas technology in bioengineering non-conventional yeasts. Front Bioeng. Biotechnol. 9, 765396.

(70) Uthayakumar, D., Sharma, J., Wensing, L., and Shapiro, R. S. (2021 ) CRISPR- based genetic manipulation of Candida species: historical perspectives and current approaches. Frontiers in Genome Editing. 2, 606281 .

(71 ) Vyas, V. K., Barrasa, M. I., and Fink, G. R. (2015) A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Sci. Adv. 1, e1500248.

(72) Enkler, L., Richer, D., Marchand, A. L., Ferrandon, D., and Jossinet, F. (2016) Genome engineering in the yeast pathogen Candida glabrata using the CRISPR-Cas9 system. Sci. Rep. 6, 35766. (73) Rosiana, S., Zhang, L., Kim, G. H., Revtovich, A. V., Uthayakumar, D., Sukumaran, A., Geddes-McAlister, J., Kirienko, N. V., and Shapiro, R. S. (2021 ) Comprehensive genetic analysis of adhesin proteins and their role in virulence of Candida albicans. Genetics. 217, iyab003.

(74) Shapiro, R. S., Chavez, A., Porter, C. B. M., Hamblin, M., Kaas, C. S., DiCarlo, J. E., Zeng, G., Xu, X., Revtovich, A. V., Kirienko, N. V., Wang, Y., Church, G. M., and Collins, J. J. (2018) A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nat. Microbiol. 3, 73-82.

(75) Zoppo, M., Luca, M. D., Villarreal, S. N., Poma, N., Barrasa, M. I., Bottai, D., Vyas, V. K., and Tavanti, A. (2019) A CRISPR/Cas9-based strategy to simultaneously inactivate the entire ALS gene family in Candida orthopsilosis. Future Microbiol. 14, 1383-1396.

(76) Santana, D. J., and O’Meara, T. R. (2021 ) Forward and reverse genetic dissection of morphogenesis identifies filament-competent Candida auris strains. Nature Communications. 12, 1-13.

(77) Huang, M. Y., Woolford, C. A., May, G., McManus, C. J., and Mitchell, A. P. (2019) Circuit diversification in a biofilm regulatory network. PLoS Pathog. 15, e1007787.

(78) Min, K., Biermann, A., Hogan, D. A., and Konopka, J. B. (2018) Genetic analysis of NDT80 family transcription factors in Candida albicans using new CRISPR-Cas9 approaches. mSphere. 3, e00545-18.

(79) Wensing, L., Sharma, J., Uthayakumar, D., Proteau, Y., Chavez, A., and Shapiro, R. S. (2019) A CRISPR interference platform for efficient genetic repression in Candida albicans. mSphere. 4, e00002-19.

(80) Ennis, C. L., Hernday, A. D., and Nobile, C. J. (2021 ) A markerless CRISPR- mediated system for genome editing in Candida auris reveals a conserved role for Cas5 in the caspofungin response. Microbiol. Spectr. 9, e0182021.