SYSTEMS AND METHODS OF GENE EDITING

CROSS-REFERENCE

[001] This application claims the benefit of U.S. Provisional Application No. 63/315,501, filed March 1, 2022, and U.S. Provisional Application No. 63/375,598, filed September 14, 2022, the entirety of which are hereby incorporated by reference herein.

SEQUENCE LISTING

[002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on February 28, 2023, is named 55190-705_601_SL.xml and is 273,513 bytes in size.

INCORPORATION BY REFERENCE

[003] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.

BACKGROUND

[004] Targeted editing of nucleic acids is a highly promising approach for studying genetic functions and for treating and ameliorating symptoms of genetic disorders and diseases. Most notable target-specific genetic modification methods involve engineering and using of zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and RNA- guided DNA endonuclease Cas. Frequency of introducing mutations such as deletions and insertions at the targeted nucleic acids through the non-homologous end joining (NHEJ) repair mechanism limits the applications of genetic targeting and editing in the development of therapeutics. Another drawback is the limitation on the size of the repair template to be inserted into the genome.

SUMMARY

[005] Accordingly, there remains a need for genetic modification method that can insert a repair template into a genome of a cell for treatment of a disease or condition, where the repair template comprises a length that is on a magnitude of kilobases. Such repair template length offers an improvement over genetic modification methods currently available, where the repair template described herein can correct multiple mutations that are far apart or encode a full- length transgene. Also, there remains a need for genetic modification method for making multiple cleavages on the genome, where the cleavages are on a magnitude of kilobases apart. Such cleavage pattern allows removal of a large genetic region associating with a disease or condition (e.g., a genetic region harboring multiple mutations or truncations) and the subsequent insertion of the repair template.

[006] Described herein, in some aspects, is a method, comprising: contacting a genomic locus of a cell with a first guide polynucleotide complexed with a first editing protein, wherein the first guide polynucleotide hybridizes to the genomic locus at a first region of the genomic locus, and the first editing protein cleaves the genomic locus at the first region of the genomic locus; and contacting the genomic locus of the cell with a second guide polynucleotide complexed with a second editing protein, wherein the second guide polynucleotide hybridizes to the genomic locus at a second region of the genomic locus, and the second first editing protein cleaves the genomic locus at the second region of the genomic locus, where a repair template is inserted between the first region and the second region, wherein the first region and the second region are at least 1000 base pairs (bp) apart. In some embodiments, the editing protein or the second editing protein creates single-stranded cleavage at the first region or at the second region. In some embodiments, the editing protein and the second editing protein creates singlestranded cleavage at the first region and at the second region. In some embodiments, the first guide polynucleotide complexed with the first editing protein and the second guide polynucleotide complexed with the second editing protein are contacted with the cell at same time. In some embodiments, the first guide polynucleotide complexed with the first editing protein and the second guide polynucleotide complexed with the second editing protein are contacted with the cell at different times. In some embodiments, the first editing protein or the second editing protein comprises a Cas protein. In some embodiments, the first editing protein or the second editing protein comprises a fusion protein. In some embodiments, the fusion protein comprises a Cas fusion protein. In some embodiments, the Cas fusion protein is encoded from a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 61-63. In some embodiments, the Cas fusion protein is encoded from a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 61-63. In some embodiments, the Cas fusion protein is encoded from a nucleic acid sequence that is any one of SEQ ID NOs: 61-63. In some embodiments, the Cas fusion protein comprises a Cas protein fused to an exonuclease or a fragment thereof. In some embodiments, the Cas fusion protein comprises a Casl2 nuclease. In some embodiments, the Casl2 nuclease comprises a polypeptide sequence that is at least 80 % identical to any one of SEQ ID NOs: 55-57. In some embodiments, the Casl2 nuclease comprises a polypeptide sequence that is at least 90 % identical to any one of SEQ ID NOs: 55-57. In some embodiments, the Casl2 nuclease comprises a polypeptide sequence that is any one of SEQ ID NOs: 55-57. In some embodiments, the Cas fusion protein comprises a Cas9 nuclease. In some embodiments, the Cas9 nuclease comprises a polypeptide sequence that is at least 80% identical to any one of SEQ ID NOs: 7-23 or SEQ ID NOs: 41-54; or a polypeptide sequence that is encoded from a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 60 In some embodiments, the Cas9 nuclease comprises a polypeptide sequence that is at least 90% identical to any one of SEQ ID NOs: 7-23 or SEQ ID NOs: 41- 54; or a polypeptide sequence that is encoded from a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 60 In some embodiments, the Cas9 nuclease comprises a polypeptide sequence that is any one of SEQ ID NOs: 7-23 or SEQ ID NOs: 41-54; or a polypeptide sequence that is encoded from a nucleic acid sequence of SEQ ID NO: 60. In some embodiments, the first editing protein or the second editing protein comprises a SluCas9 nuclease. In some embodiments, the first editing protein or the second editing protein comprises a Cas nickase. In some embodiments, the Cas nickase comprises Cas9 D10A. In some embodiments, the Cas nickase comprises Cas9 H840A. In some embodiments, the Cas nickase is fused to an exonuclease or a fragment thereof. In some embodiments, the exonuclease is Human Exol (hExol). In some embodiments, the exonuclease comprises a polypeptide sequence that is at least 80% identical to any one of SEQ ID NOs 1-3. In some embodiments, the exonuclease comprises a polypeptide sequence that is at least 90% identical to any one of SEQ ID NOs 1-3 In some embodiments, the exonuclease comprises a polypeptide sequence that any one of SEQ ID NOs 1-3. In some embodiments, the fusion protein comprises a Cas protein fused to a DNA replication ATP-dependent helicase/nuclease (DNA2). In some embodiments, the repair template is inserted between the first region of the genomic locus and the second region of the genomic locus by homology-directed repair (HDR). In some embodiments, the first region and the second region are at least 2000 bp apart. In some embodiments, the first region and the second region are at least 4000 bp apart. In some embodiments, the first region and the second region are at least 8000 bp apart. In some embodiments, the first region and the second region are at least 10000 bp apart. In some embodiments, the repair template comprises a coding sequence. In some embodiments, the repair template comprises an expression cassette. In some embodiments, the repair template comprises an exon. In some embodiments, the repair template comprises at least one exon and at least one intron. In some embodiments, the repair template comprises at least one mutation compared to an endogenous nucleic acid sequence located between the region and the second region. In some embodiments, the at least one mutation is a silent mutation. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 100-110. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 100-110. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 100-110. In some embodiments, the repair template comprises a mutated protospacer adjacent motif (PAM) sequence located at the immediate 3’ end of a cleavage site, wherein the mutated PAM sequence comprises 5’-NCG-3’ or 5’-NGC-3’. In some embodiments, the repair template comprises a mutated protospacer adjacent motif (PAM) sequence located at the immediate 3’ end of a cleavage site, wherein the mutated PAM sequence comprises 5’-NNCG-3’ or 5’-NNGC-3’. In some embodiments, the genomic locus encodes a gene associated with cancer. In some embodiments, the genomic locus encodes a gene associated with hyperphenylalaninemia. In some embodiments, the gene associated with hyperphenylalaninemia comprises phenylalanine hydroxylase (PAH). In some embodiments, the repair template comprises a coding sequence of PAH or a fragment thereof. In some embodiments, the genomic locus encodes a gene associated with hemophilia. In some embodiments, the gene associated with hemophilia comprises Factor VIII or Factor IX. In some embodiments, the repair template comprises a coding sequence of Factor VIII, Factor IX, or a fragment thereof. In some embodiments, the genomic locus encodes a gene associated with hypercholesterolemia. In some embodiments, the gene associated with hypercholesterolemia comprises apolipoprotein B (ApoB). In some embodiments, the repair template comprises a coding sequence of ApoB or a fragment thereof. In some embodiments, the genomic locus comprises at least one mutation. In some embodiments, the at least one mutation is associated with a disease or condition. In some embodiments, the Cas fusion protein or the second Cas protein generates a decreased number of INDEL in the genomic locus compared to a number of INDEL generated by a comparable wild-type Cas protein. In some embodiments, the method further comprises propagating the cell comprising the repair template inserted between the first region and the second region to obtain a plurality of cells comprising the repair template.

[007] Described herein, in some aspects, is a method, comprising editing a genomic region of one or more cells of a plurality of cells to produce edited cells, wherein at least 50% of the edited cells remain viable as measured by a resazurin assay, wherein the target genomic region edited is at least lOOObp. In some embodiments, the editing comprises: contacting the plurality of cells with a first guide polynucleotide complexed with a first Cas fusion protein or a second guide polynucleotide complexed with a second Cas fusion protein, wherein: the first guide polynucleotide hybridizes to a first region of a genomic locus, and the first Cas fusion protein cleaves the first region; and the second guide polynucleotide hybridizes to a second region of the genomic locus, and the second Cas fusion protein cleaves the second region, wherein the first region and the second region flank the target genomic region; and contacting the plurality of cells with a repair template, wherein the repair template is inserted between the first region and the second region. In some embodiments, the plurality of cells exhibits at least 10% increase in viability compared to a viability of a comparable plurality of cells contacted with Cas protein. In some embodiments, the plurality of cells exhibits at least 50% increase in viability compared to the viability of the comparable plurality of cells contacted with the Cas protein. In some embodiments, the target genomic region is at least 5000bp.

[008] Described herein, in some aspects, is a method, comprising: contacting a plurality of cells with a first guide polynucleotide complexed with a first Cas fusion protein or a second guide polynucleotide complexed with a second Cas fusion protein, wherein: the first guide polynucleotide hybridizes to a first region of a genomic locus, and the first Cas fusion protein cleaves the first region; and the second guide polynucleotide hybridizes to a second region of the genomic locus, and the second Cas fusion protein cleaves the second region; and contacting the plurality of cells with a repair template, wherein the repair template is inserted between the first region and the second region, wherein the plurality of cells exhibits an increased editing efficiency that is least 10% compared to an editing efficiency of a comparable plurality of cells edited with Cas protein. In some embodiments, the increased editing efficiency is least 50% compared to the editing efficiency of the comparable plurality of cells edited with the Cas protein. In some embodiments, the increased editing efficiency is least two-fold compared to the editing efficiency of the comparable plurality of cells edited with the Cas protein. In some embodiments, the increased editing efficiency is determined by sequencing single nucleotide polymorphism (SNP) or mutation between the first region and the second region after insertion of the repair template. In some embodiments, the first region and the second region are at least 1000 bp apart. In some embodiments, the first region and the second region are at least 2000 bp apart. In some embodiments, the first region and the second region are at least 4000 bp apart. In some embodiments, the first region and the second region are at least 8000 bp apart. In some embodiments, the first region and the second region are at least 10000 bp apart. In some embodiments, the first Cas fusion protein or the second Cas fusion protein is encoded from a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 61-63. In some embodiments, the first Cas fusion protein or the second Cas fusion protein is encoded from a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 61-63. In some embodiments, the first Cas fusion protein or the second Cas fusion protein is encoded from a nucleic acid sequence that is any one of SEQ ID NOs: 61-63. In some embodiments, the first Cas fusion protein or the second Cas fusion protein comprises a Cas protein fused to an exonuclease or a fragment thereof. In some embodiments, the first Cas fusion protein or the second Cas fusion protein comprises a Casl2 nuclease. In some embodiments, the Casl2 nuclease comprises a polypeptide sequence that is at least 80 % identical to any one of SEQ ID NOs: 55-57. In some embodiments, the Casl2 nuclease comprises a polypeptide sequence that is at least 90 % identical to any one of SEQ ID NOs: 55-57. In some embodiments, the Casl2 nuclease comprises a polypeptide sequence that is any one of SEQ ID NOs: 55-57. In some embodiments, the first Cas fusion protein or the second Cas fusion protein comprises a Cas9 nuclease. In some embodiments, the Cas9 nuclease comprises a polypeptide sequence that is at least 80% identical to any one of SEQ ID NOs: 7-23 or SEQ ID NOs: 41-54; or a polypeptide sequence that is encoded from a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 60. In some embodiments, the Cas9 nuclease comprises a polypeptide sequence that is at least 90% identical to any one of SEQ ID NOs: 7-23 or SEQ ID NOs: 41-54; or a polypeptide sequence that is encoded from a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 60. In some embodiments, the Cas9 nuclease comprises a polypeptide sequence that is any one of SEQ ID NOs: 7-23 or SEQ ID NOs: 41-54; or a polypeptide sequence that is encoded from a nucleic acid sequence of SEQ ID NO: 60.

[009] Described herein, in some aspects, is a method for treating a disease or condition in a subject, comprising contacting a cell of a subject with: a Cas fusion protein complexed with a guide polynucleotide, wherein the guide polynucleotide directs the Cas fusion protein to cleave a region in a genomic locus of the cell; and a second Cas fusion protein complexed with a second guide polynucleotide, wherein the second guide polynucleotide directs the second Cas fusion protein to cleave a second region in the genomic locus, wherein the region and the second region are at least 1000 base pairs (bp) apart, wherein a repair template is inserted between the region and the second region, and wherein the genomic locus is associated with the disease or condition.

[0010] Described herein, in some aspects, is a system comprising: a Cas fusion protein; a guide polynucleotide, wherein the guide polynucleotide directs the Cas fusion protein to cleave a first region in a genomic locus of a cell; and a second Cas fusion protein complexed with a second guide polynucleotide, wherein the second guide polynucleotide directs the second Cas protein to cleave a second region in the genomic locus. In some embodiments, the Cas fusion protein is encoded from a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 61-63. In some embodiments, the Cas fusion protein is encoded from a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 61-63. In some embodiments, the Cas fusion protein is encoded from a nucleic acid sequence that is any one of SEQ ID NOs: 61-63. In some embodiments, the region and the second region are at least 1000 bp apart. In some embodiments, the region and the second region are at least 2000 bp apart. In some embodiments, the region and the second region are at least 4000 bp apart. In some embodiments, the region and the second region are at least 8000 bp apart. In some embodiments, the region and the second region are at least 10000 bp apart. In some embodiments, the system further comprises a repair template. In some embodiments, the repair template is inserted between the region and the second region by homology-directed repair (HDR) in the cell. In some embodiments, the repair template comprises a coding sequence. In some embodiments, the repair template comprises an expression cassette. In some embodiments, the repair template comprises an exon. In some embodiments, the repair template comprises at least one exon and at least one intron. In some embodiments, the repair template comprises at least one mutation compared to an endogenous nucleic acid sequence located between the region and the second region. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 100-110. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 100-110. In some embodiments, the repair template comprises a nucleic acid sequence that is any one of SEQ ID NOs: 100-110. In some embodiments, the repair template comprises a mutated protospacer adjacent motif (PAM) sequence located at the immediate 3’ end of a cleavage site, wherein the mutated PAM sequence comprises 5’-NCG-3’ or 5’-NGC-3’. In some embodiments, the repair template comprises a mutated protospacer adjacent motif (PAM) sequence located at the immediate 3’ end of a cleavage site, wherein the mutated PAM sequence comprises 5’-NNCG-3’ or 5’- NNGC-3’.

[0011] Described herein, in some aspects, is a cell comprising the Cas fusion protein, the guide polynucleotide, the repair template, or the system described herein. In some embodiments, the cell is propagated for obtaining a plurality of cells comprising the repair templated inserted into the genomic locus.

[0012] Described herein, in some aspects, is a pharmaceutical formulation comprising one or more of: the Cas fusion, the guide polynucleotide, or the repair template described herein. In some embodiments, the pharmaceutical formulation further comprises a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical formulation is formulated for parenteral, intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, intracerebral, subarachnoid, intraocular, intrasternal, ophthalmic, endothelial, local, intranasal, intrapulmonary, rectal, intraarterial, intrathecal, inhalation, intralesional, intradermal, epidural, intracapsular, subcapsular, intracardiac, transtracheal, subcuticular, subarachnoid, or intraspinal administration. In some embodiments, the pharmaceutical formulation is in an unit dose form. [0013] Described herein, in some aspects, is a kit comprising one or more of: the editing protein, the Cas fusion protein, the repair template, the guide polynucleotide, or the pharmaceutical formulation described herein. In some embodiments, the kit further comprises instruction for carrying out methods of cell editing described herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] This patent application contains at least one drawing executed in color. Copies of this patent or patent application with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0015] Fig. 1 illustrates an exemplary experiment design and workflow for gene editing (e.g., by homology directed repair or HDR) by a Cas9 or a Cas9 fusion described herein (e.g., a Cas9- HR).

[0016] Fig. 2 illustrates increased insertion of transgene via HDR at multiple safe harbor sites (SHS).

[0017] Fig. 3 illustrates increased insertion of transgene via HDR, where larger transgene exhibited increased insertion rates.

[0018] Fig. 4 illustrates mediated HDR increases scale with insertion size.

[0019] Fig. 5 illustrates independent assay of Cdhl tagged with mCherry showing Cas9-HR- mediated HDR increase.

[0020] Fig. 6 illustrates Cas9-HR mediated integration as compared to Cas9 mediated integration.

[0021] Fig. 7 illustrates Cas9-HR increased homology-directed repair (HDR) rates for endogenous fluorescent tags.

[0022] Fig. 8 illustrates that endogenously tagged gene fluorescence localization and intensity.

[0023] Fig. 9 illustrates Cas9-HR mediated knock-in payloads up to 8,000 base pairs.

[0024] Fig. 10 illustrates Cas9-HR increased HDR rates in primary cells.

[0025] Fig. 11 illustrates Cas9-HR HDR summary.

[0026] Fig. 12 illustrates that Cas9-HR decreased on-target INDEL rates.

[0027] Fig. 13 illustrates that Cas9-HR decreased cellular toxicity in p53+ cells at sites with increased homologous rejoining (HR).

[0028] Fig. 14 illustrates data documenting improved homology-directed repair (HDR) editing rates across cell types.

[0029] Fig. 15 illustrates that Cas9-HR significantly decreased gene editing-associated genomic stress across loci.

[0030] Fig. 16 illustrates an exemplary gene editing approach for editing a gene (e.g., Factor VIII or F8) associated with a disease or condition.

[0031] Fig. 17 illustrates repair template (RT) design for F8 gene editing.

[0032] Fig. 18 illustrates restriction gel analysis of Cas9-HR mediated two guide chunk editing. [0033] Fig. 19 illustrates Sanger sequencing analysis of Cas9-HR mediated two guide chunk editing. Figure discloses SEQ ID NO: 168 and SEQ ID NO: 169, respectively, in order of appearance.

[0034] Fig. 20 illustrates an exemplary gene editing approach for editing a gene associated with a disease or condition.

[0035] Fig. 21 illustrates the averages of the three INDEL experiments (along with SEM), as well as graphs showing both raw and Cas9 normalized INDEL rates.

[0036] Fig. 22 illustrates a diagram of repair template used for simultaneous introduction of diverse edits over thousands of base-pairs in Factor 8 exon 14.

[0037] Fig. 23 illustrates Cas9-HR simultaneous targeted editing spanning thousands of basepairs in Factor 8 exon 14.

[0038] Fig. 24 illustrates individual reads demonstrating simultaneous introduction of three different mutations. Figure discloses SEQ ID NO: 170.

[0039] Fig. 25 illustrates a diagram of a repair template for simultaneous introduction of diverse edits over thousands of base pairs(bps) in phenylalanine hydroxylase (PAH) exons 6-8. [0040] Fig. 26 illustrates graphs demonstrating Cas9-HR targeted edits at viable levels spanning thousands of bps in PAH exons 6-8.

[0041] Fig. 27 illustrates double guide strategies of targeted edits at viable levels spanning thousands of bps in PAH exons 6-8.

[0042] Fig. 28 illustrates double guide cutting strategies of expected levels of INDELS in HEK293 cells at PAH local genomic regions surrounding G2 and G4.

[0043] Fig. 29 illustrates single and double guide cutting strategies leading to expected levels of INDELS in H1299 cells at PAH local genomic regions surrounding G2 and G4. Data was generated from the same experiments as Fig. 27.

[0044] Figs. 30A-F illustrate Cas9-HR and Cas9 editing of a ~3.3 kb section of F8 exon 14.

Fig. 30A: depicts a repair template design to test rewriting capabilities. Bars denote intended single base changes, arrows indicate orientation of guides and approximate location in repair template/genome, dashed lines show end of repair template relative to genomic DNA. Fig. 30B: flow chart of a general editing strategy and downstream assays used for this and all subsequent figures. Fig. 30C: graph of editing rates across 3+kb of genomic DNA using guide pair G2+G5. Cas9-HR, guides, and RT in blue; Cas9, guides, and RT in orange; Cas9-HR and RT dashed blue; Cas9 and RT dashed orange; untransfected control in dashed, black. Shading shows the SEM for each treatment, n=2-3 per treatment. Fig. 30D: graph of editing rates across 3+kb of genomic DNA using guide pair G2+G6. Cas9-HR, guides, and RT; Cas9, guides, and RT; Cas9-HR and RT; Cas9 and RT; un-transfected control. Shading shows the SEM for each treatment, n=2-3 per treatment. Fig. 30E: graph showing the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites. Error bars show SEM, n=2-3. Fig. 30F: graph showing the average editing efficiency across 5’ and 3’ of Factor 8 exon 14. Solid bars represent guide and nuclease pairs plus repair template, with semi-transparent shaded bars denoting controls using corresponding nuclease and repair template but lacking guides. Black bars to left show background levels of editing in un-transfected cells. n=2-3 per experiment, error bars represent SEM. Experiments demonstrated further dependence of chunk editing on proper guide selection, and differences seen in editing rates and success using either Cas9 or Cas9-HR.

[0045] Figs. 31A-B illustrate how editing efficiency generally correlated with guide INDEL generation. At least one guide generating INDELs was necessary to enable chunk editing. Fig. 31 A: graph showing the average editing efficiency across 5’ (positions 2047-2493) and 3’ (4095-5378) of Factor 8 exon 14. Solid bars denote guide and nuclease pairs plus repair template, with semi-transparent shaded bars denoting controls using corresponding nuclease and repair template but lacking guides. Black bars to left show background levels of editing in un-transfected cells. n=2-3 per experiment, error bars represent SEM. Fig. 31B: bar graph showing average percent of reads containing INDELs for each of the guide, nuclease (Cas9-HR, Cas9), and 5’ and 3’ ends as denoted by the x-axis legend, replicates and error bars are the same as in Fig. 31A

[0046] Figs. 32A-G illustrate how Two Guide strategies are necessary and sufficient to drive HDR based rewriting of ~4kb region of PAH exons 6-8. Fig. 32A: diagram showing the structure of the PAH exons 6-8 genomic region. Repair template, white bars denote specific mutations, and finally bottom shows integrated repair template with an out-out primer design. Fig. 32B: graph showing editing rates across ~4kb of genomic DNA using guide pair G2+G4. Cas9-HR, guides, and RT in gray; Cas9, guides, and RT in orange; Cas9-HR and RT dashed gray; Cas9 and RT dashed light gray; un-transfected control in dashed, black. Shading shows the SEM for each treatment, n=2-3 per treatment. Fig. 32C: graph showing editing rates across ~4kb of genomic DNA using either single guides G2 or G4. Cas9-HR, guides, and RT in blue; Cas9, guides, and RT in orange; Cas9-HR and RT dashed blue; Cas9 and RT dashed orange; un-transfected control in dashed, black. Shading shows the SEM for each treatment, n=2-3 per treatment. Fig. 32D: left graph showing guide dependent effects of editing for four distinct primer pairs: G1+G3, G1+G4, G2+G3, G2+G4. Left, Cas9-HR; right, Cas9, n=3. Graph again demonstrates the guide dependent editing of chunk editing, and hits at mechanistic and function consequences of guide choice (compare rates using G3 vs G4 as an example); right graph showing guide dependent effects of editing for four distinct guide pairs: G1+G3, G1+G4, G2+G3, G2+G4, all using Cas9, n=3. Graph again demonstrates the guide dependent editing of chunk editing, showing similar patterns as Cas9-HR, though Cas9 has higher editing rates. Guide dependent differences were seen. Fig. 32E: average editing of various double or single primer pairs divided into 5’ and 3’ regions. Cas9-HR; Cas9; un-transfected control; Cas9-HR or Cas9 and no guide RT controls. Fig. 32F: graph showing the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for single and double guide combinations. Error bars show SEM, n=2-3. Fig. 32G: left graph showing guide dependent effects of editing for four distinct single guides for PAH exons 6-8: Gl, G2, G3, G4, using Cas9-HR, n=2. Graph shows chunk editing strategy is necessary to achieve long range editing, with single guides only showing strong editing ~10bps around the cut site (as observed before) decreasing to background >100bp away; right graph showing guide dependent effects of editing for four distinct guide pairs: G1+G3, G1+G4, G2+G3, G2+G4, all using Cas9, n=2 or all except G3, n=l. Graph again demonstrates necessity of chunk editing strategy, as single guides drop to background as distance from cut site increases. Graph again shows similar patterns as Cas9-HR, though Cas9 has higher editing rates.

[0047] Figs. 33A-D illustrate how two guide strategies can drive HDR based rewriting of ~9kb region of APOB exon 30. Fig. 33A: diagram showing the structure of the APOB exon 30 genomic region. Repair template, white bars denote specific mutations, and the bottom shows integrated repair template with an out-out primer design. Fig. 33B: graph showing editing rates across ~9kb of genomic DNA using various guide pairs. Left, Cas9; right, Cas9-HR. Fig. 33C: average editing of various double primer pairs divided into 5’ and 3’ regions. Blue, Cas9-HR; Orange, Cas9; Black, un-transfected control; Grey hatched bars, Cas9-HR or Cas9 and no guide RT controls. Fig. 33D: graph showing the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for single and double guide combinations. Error bars show SEM, n=2-3.

[0048] Figs. 34A-G illustrate how SluCas9 (Staphylococcus lugdunensis Cas9, a Streptococcus pyogenes Cas9 orthologue) and SluCas9-HR, also enable Chunk editing at improved rates. Fig. 34A: diagram showing the structure of the genomic region. Repair template, white bars denote specific mutations, and finally bottom shows integrated repair template with an out-in primer design. Fig. 34B: graph showing background subtracted editing rates across ~3.3kb of genomic DNA using G2+G5 F8 guide pair. Blue, SluCas9-HR; Orange, SluCas9; Black, un-transfected control. Fig. 34C: graph showing background subtracted editing rates across ~4kb of genomic DNA using G2+G4 F8 guide pair. Blue, SluCas9-HR; Orange, SluCas9; Black, un-transfected control. Fig. 34D: average editing of various double primer pairs divided into 5’ and 3’ regions, grey, Cas9-HR; Orange, Cas9; Black, un-transfected control; Grey hatched bars, Cas9-HR or Cas9 and no guide RT controls. Fig. 34E: graph showing the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for single and double guide combinations. Error bars show SEM, n=2-3. Fig. 34F: average editing of various double primer pairs divided into 5’ and 3’ regions. Blue, Cas9-HR; Orange, Cas9; Black, un-transfected control; Grey hatched bars, Cas9-HR or Cas9 and no guide RT controls. Fig. 34G: graph showing the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for single and double guide combinations. Error bars show SEM, n=2-3.

[0049] Figs. 35A-E illustrate how Chunk editing is compatible with nickase based non-DSB approaches. Fig. 35A: diagram showing various nickase and guide combinations to allow testing of all 4 types of editing permutations. Fig. 35B: graph showing background subtracted editing rates across ~3.3kb of genomic DNA using G2+G5 F8 guide pair. Cas9-HR D10A; Cas9 D10A; -HR H840A; Cas9 H840A; un-transfected control. Fig. 35C: graph showing background subtracted editing rates across ~3.3kb of genomic DNA using G2+G6 F8 guide pair. Cas9-HR D10A; Cas9 D10A; Cas9-HR H840A; Cas9 H840A; un-transfected control. Fig. 35D: average editing of various double primer pairs divided into 5’ and 3’ regions. Blue, Cas9- HR; Orange, Cas9; Black, un-transfected control; Grey hatched bars, Cas9-HR or Cas9 and no guide RT controls. Fig. 35E: graph showing the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for single and double guide combinations. Error bars show SEM, n=2-3.

[0050] Figs. 36A-C illustrate editing of F8. Fig. 36A: graph showing editing rates across ~3.3kb of F8 exon 14 using G2+G5 F8 guide pair and increasing concentrations of ssDNA F8 RT, n=3. Editing rates are shown for one half of the editing window, with editing rates increasing with increased ssDNA throughout the entire 5’ window. Data indicates chunk editing can be used with multiple RT types, and that rates can be optimized by varying parameters such as RT type and concentration. Fig. 36B: average editing of various double guide pairs divided into 5’ and 3’ regions using ~3.3kb of F8 exon 14 using G2+G5 F8 guide pair and increasing concentrations of ssDNA F8 RT, n=3. Graph quantifies the average increase in editing rate from increasing concentrations of ssDNA. Fig. 36C: graph showing the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for guide and nickase combinations listed. Error bars show SEM, n=3. Graph demonstrates that chunk editing directly competes with INDELs for repair pathway choice, with decreasing INDEL rates seen with increasing amounts of RT tested. Points towards future safety possibilities where increased optimization and editing efficiency of chunk editing will compete with unwanted editing outcomes and increase safety. [0051] FIG. 37 illustrates an exemplary experiment design and workflow for gene editing (e.g., by homology directed repair or HDR) by a Cas9 or a Cas9 fusion described herein (e.g., a Cas9- HR), isolation of an edited cell, and propagation of the edited cell to produce a population of edited cells.

[0052] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments.

DETAILED DESCRIPTION Overview

[0053] Described herein are systems and methods for gene editing. In some embodiments, the system and method described herein can edit a genomic locus by inserting a repair template (RT) at the genomic locus. In some embodiments, the editing efficiency positively correlates with the size of the RT. For example, efficiency of insertion of a RT with 3.3 kb mediated by the system or the method described herein can be increased compared to conventional nucleic acid-guided nuclease. In some embodiments, the system or method described herein utilizes two or more guide polynucleotides to direct two or more editing proteins described here (e.g., a Cas fusion protein such as Cas9-HR) to make two or more cuts in the genomic locus for editing a gene encoded by the genomic locus. In some embodiments, the two or more cuts mediated by the editing protein can increase gene editing efficiency. For example, as shown in Fig. 26, Fig. 27, and Figs. 30-36, the use of two guide polynucleotides increased editing efficiency or editing rate for inserting the repair template into the targeted genomic locus. Also demonstrated in Figs. 30-36 are the long distance (e.g., on a magnitude of kilobases) between the cut sites made by the editing protein, where a repair template can be inserted for correcting mutations located in between the two cut sites. In some embodiments, the gene editing mediated by the system or method described herein can correct at least one mutation in a gene. For example, the system or method described herein can correct at least one mutation in Factor 8 or phenylalanine hydroxylase. In some embodiments, the system or method described herein can correct at least one mutation in a single exon. For example, As showing in Fig. 23 and Fig. 30, multiple mutations in exon 14 of Factor 9 were corrected by the Cas9-HR described herein. In some embodiments, the system or method described herein can correct at least one mutation across multiple exons. As shown in Fig. 26, Fig. 27, and Fig. 32, multiple mutations in exons 6-8 of phenylalanine hydroxylase were corrected by the Cas9-HR described herein. In some embodiments, the system and method described herein can edit a gene for treating a disease or condition associated with the gene being edited. In some embodiments, the disease or condition is hemophilia. In some embodiments, the disease or condition is hyperphenylalaninemia (HP A). In some embodiments, the disease or condition is phenylketonuria (PKU). In some embodiments, the disease or condition is hypercholesterolemia.

[0054] In some embodiments, the editing protein for cutting the genomic locus can be a Cas fusion protein. Fig. 1 illustrates examples of Cas fusion protein, where an exonuclease, a linker, and at least one nuclear localization signal (NLS) is fused to a Cas protein. In some embodiments, editing protein of the Cas fusion protein can cleave only one strand of the genomic locus. For example, the editing protein of the Cas fusion protein can comprise a Cas nickase for making a single- stranded cleavage at the genomic locus. In such case, the efficiency of inserting the repair template at the genomic locus can be increased, or the number of INDELs can be decreased compared to making a comparable gene editing with a comparable wild type Cas (e.g., without fusion) or a Cas that makes double-stranded cleavage. In some embodiments, the Cas fusion protein for making single-strand cleavage is encoded from a nucleic acid that is at least partially identical to any one of SEQ ID NOs: 61-63.

[0055] In some embodiments, the use of two guide polynucleotides can lead to two cleavages at two regions of the genomic locus. In some embodiments, the two cleaved regions are about 1,000 base pairs (bp) apart. In some embodiments, the two cleaved regions are about 2,000 bp apart. In some embodiments, the two cleaved regions are about 4,000 bp apart. In some embodiments, the two cleaved regions are about 10,000 bp apart. In some embodiments, the two cleaved regions are at least 1,000 base pairs (bp) apart. In some embodiments, the two cleaved regions are at least 2,000 bp apart. In some embodiments, the two cleaved regions are at least 4,000 bp apart. In some embodiments, the two cleaved regions are at least 10,000 bp apart. In some embodiments, the two cleaved regions are apart by about 100 bp to about 15,000 bp. In some embodiments, the two cleaved regions are apart by about 100 bp to about 500 bp, about 100 bp to about 1,000 bp, about 100 bp to about 2,000 bp, about 100 bp to about 3,000 bp, about 100 bp to about 4,000 bp, about 100 bp to about 5,000 bp, about 100 bp to about 6,000 bp, about 100 bp to about 7,000 bp, about 100 bp to about 8,000 bp, about 100 bp to about 10,000 bp, about 100 bp to about 15,000 bp, about 500 bp to about 1,000 bp, about 500 bp to about 2,000 bp, about 500 bp to about 3,000 bp, about 500 bp to about 4,000 bp, about 500 bp to about 5,000 bp, about 500 bp to about 6,000 bp, about 500 bp to about 7,000 bp, about 500 bp to about 8,000 bp, about 500 bp to about 10,000 bp, about 500 bp to about 15,000 bp, about 1,000 bp to about 2,000 bp, about 1,000 bp to about 3,000 bp, about 1,000 bp to about 4,000 bp, about 1,000 bp to about 5,000 bp, about 1,000 bp to about 6,000 bp, about 1,000 bp to about 7,000 bp, about 1,000 bp to about 8,000 bp, about 1,000 bp to about 10,000 bp, about 1,000 bp to about 15,000 bp, about 2,000 bp to about 3,000 bp, about 2,000 bp to about 4,000 bp, about 2,000 bp to about 5,000 bp, about 2,000 bp to about 6,000 bp, about 2,000 bp to about 7,000 bp, about 2,000 bp to about 8,000 bp, about 2,000 bp to about 10,000 bp, about 2,000 bp to about 15,000 bp, about 3,000 bp to about 4,000 bp, about 3,000 bp to about 5,000 bp, about 3,000 bp to about 6,000 bp, about 3,000 bp to about 7,000 bp, about 3,000 bp to about 8,000 bp, about 3,000 bp to about 10,000 bp, about 3,000 bp to about 15,000 bp, about 4,000 bp to about 5,000 bp, about 4,000 bp to about 6,000 bp, about 4,000 bp to about 7,000 bp, about 4,000 bp to about 8,000 bp, about 4,000 bp to about 10,000 bp, about 4,000 bp to about 15,000 bp, about 5,000 bp to about 6,000 bp, about 5,000 bp to about 7,000 bp, about 5,000 bp to about 8,000 bp, about 5,000 bp to about 10,000 bp, about 5,000 bp to about 15,000 bp, about 6,000 bp to about 7,000 bp, about 6,000 bp to about 8,000 bp, about 6,000 bp to about 10,000 bp, about 6,000 bp to about 15,000 bp, about 7,000 bp to about 8,000 bp, about 7,000 bp to about 10,000 bp, about 7,000 bp to about 15,000 bp, about 8,000 bp to about 10,000 bp, about 8,000 bp to about 15,000 bp, or about 10,000 bp to about 15,000 bp. In some embodiments, the two cleaved regions are apart by about 100 bp, about 500 bp, about 1,000 bp, about 2,000 bp, about 3,000 bp, about 4,000 bp, about 5,000 bp, about 6,000 bp, about 7,000 bp, about 8,000 bp, about 10,000 bp, or about 15,000 bp. In some embodiments, the two cleaved regions are apart by at least about 100 bp, about 500 bp, about 1,000 bp, about 2,000 bp, about 3,000 bp, about 4,000 bp, about 5,000 bp, about 6,000 bp, about 7,000 bp, about 8,000 bp, or about 10,000 bp. In some embodiments, the two cleaved regions are apart by at most about 500 bp, about 1,000 bp, about 2,000 bp, about 3,000 bp, about 4,000 bp, about 5,000 bp, about 6,000 bp, about 7,000 bp, about 8,000 bp, about 10,000 bp, or about 15,000 bp.

[0056] In some embodiments, the two cleaved regions can flank a coding sequence of a gene. In some embodiments, the two cleaved regions can flank at least one exon, at least one intron, or a combination thereof. In some embodiments, the two cleaved regions can flank a genomic locus that is associated with a disease or condition. For example, the two cleaved regions can flank a genomic locus of a PAH, or ApoB, or F8 gene having deleterious mutations.

[0057] In some embodiments, described herein are repair templates to be inserted between the two cleaved regions. In some embodiments, a repair template comprises a coding sequence, where upon insertion into the genomic locus, the repair template encodes a wild type or functional version of a protein, thereby treating the disease or condition associated with mutations in the genomic locus. In some embodiments, the repair template is inserted between the two cleaved regions by homology directed repair (HDR). In some embodiments, the Cas fusion protein can increase HDR in a cell as opposed to non-homologous end joining (NHEJ). In such cases, the number of INDEL introduced into the genomic locus can be decreased. In some embodiments, a Cas fusion protein generates a decreased number of INDEL in the genomic locus compared to a number of INDEL generated by a comparable wild-type Cas protein. In some embodiments, the repair template can be about the same size as the genomic locus flanked by the two cleaved regions. In some embodiments, the repair template can be a different size from the genomic locus flanked by the two cleaved regions. For example, the genomic locus flanked by the two cleaved regions can be on magnitude of kilobases, where the repair template to be inserted can be sufficiently small to only encode a functional protein for treating the disease or condition. In some embodiments, the repair template comprises at least one homology arm. In some embodiments, the homology arm can be between about 50 bp to about 1000 bp. In some embodiments, the homology arm can be between about 25 bp to about 2,000 bp. In some embodiments, the homology arm can be between about 25 bp to about 50 bp, about 25 bp to about 100 bp, about 25 bp to about 200 bp, about 25 bp to about 500 bp, about 25 bp to about 750 bp, about 25 bp to about 1,000 bp, about 25 bp to about 2,000 bp, about 50 bp to about 100 bp, about 50 bp to about 200 bp, about 50 bp to about 500 bp, about 50 bp to about 750 bp, about 50 bp to about 1,000 bp, about 50 bp to about 2,000 bp, about 100 bp to about 200 bp, about 100 bp to about 500 bp, about 100 bp to about 750 bp, about 100 bp to about 1,000 bp, about 100 bp to about 2,000 bp, about 200 bp to about 500 bp, about 200 bp to about 750 bp, about 200 bp to about 1,000 bp, about 200 bp to about 2,000 bp, about 500 bp to about 750 bp, about 500 bp to about 1,000 bp, about 500 bp to about 2,000 bp, about 750 bp to about 1,000 bp, about 750 bp to about 2,000 bp, or about 1,000 bp to about 2,000 bp. In some embodiments, the homology arm can be between about 25 bp, about 50 bp, about 100 bp, about 200 bp, about 500 bp, about 750 bp, about 1,000 bp, or about 2,000 bp. In some embodiments, the homology arm can be between at least about 25 bp, about 50 bp, about 100 bp, about 200 bp, about 500 bp, about 750 bp, or about 1,000 bp. In some embodiments, the homology arm can be between at most about 50 bp, about 100 bp, about 200 bp, about 500 bp, about 750 bp, about 1,000 bp, or about 2,000 bp. In some embodiments, the homology arm has low percentage of homology with the genomic locus.

Fusion protein

[0058] Described herein are gene editing proteins, e.g., fusion proteins, for example an endonuclease fused to at least one exonuclease. In some embodiments, the programmable endonuclease can be a Cas protein. In some embodiments, the fusion protein can be a Cas fusion protein. In some embodiments, the Cas fusion protein comprises a Cas nuclease fused to an exonuclease or a fragment thereof. In some embodiments, the endonuclease and the exonuclease are connected via a peptide linker. Fig. 1 illustrates exemplary fusion proteins (Cas9-HR) described herein. In some embodiments, the programmable endonuclease comprises a programmable Cas such as Cas9. As used herein, the “Cas9,” “Cas9 domain,” or “Cas9 fragment” refers to an RNA-guided nuclease comprising a Cas9 protein, or a fragment thereof, e.g., a protein comprising an active DNA cleavage domain of Cas9. A Cas9 nuclease is sometimes referred to as a casnl nuclease or a CRISPR (clustered regularly interspaced short palindromic repeat)-associated nuclease. Cas9 nuclease sequences and structures are well known to those of ordinary skill in the art. Cas9 orthologs have been described in various species, including, but not limited to, S. pyogenes and S. thermophilus. Wild type (unmodified) Cas9 can be from any of the sequences encoded from SEQ ID NOs: 7-23, SEQ ID NOs: 41- 54, or SEQ ID NO: 60. SEQ ID NO: 41 is Cas9 (D10A): Cas9 nickase mutation, where Cas9 can only cut on the target strand, which can potentially be combined with Exol flap nuclease activity present in Cas9-HRs to increase HDR using ssODN (single strands Oligo DNA donor), dsDNA (double strand DNA) or plasmid repair templates. SEQ ID NO: 42 is Cas9 (H840A): Cas9 nickase mutation, where Cas9 can only cut on the opposite strand, which can be potentially combined with Exol flap nuclease activity present in Cas9-HRs to increase HDR using ssODN (single strands Oligo DNA donor), dsDNA (double strand DNA) or plasmid repair templates. SEQ ID NO: 43 is Cas9 (SpG), a relaxation of Cas9 PAM targeting requirements (NGG->NGN via incorporation of mutations to Cas9 which results in relaxation of NGG PAM requirement to NGN) which can be incorporated into existing Cas9-HRs to increase treatable indication and editable locations in the genome. SEQ ID NO: 44 is Cas9 (SpRY): a relaxation of Cas9 PAM targeting requirements (NGG->NRN, NYN via incorporation of mutations to Cas9) which results in relaxation of NGG PAM requirement to NRN and some NYN and can be incorporated into existing Cas9-HRs to increase treatable indication and editable locations in the genome through Cas9-HR HDR repair. SEQ ID NO: 45 is Cas9 (HF): a Cas9 variant designed to decrease off targeting events. These mutations can be introduced into Cas9-HR in combination with any other variants noted here in order to decrease off targeting events. SEQ ID NO: 46 is Cas9 (el .l): Additional Cas9 variant designed to decrease off targeting events. These mutations can be introduced into Cas9-HR in combination with any other variants noted here in order to decrease off targeting events. SEQ ID NO: 47 is AsCasl2a-HFl (Cpfl-HF with relaxed PAM requirements): Cast 2a engineered to have relaxed PAM requirements combined with mutations reducing off target cutting. Exol/Dna2 of fragments of could be fused to created Casl2a-HR, which could be used in both mammalian and agricultural settings carry out HDR mediated genetic engineering; SEQ ID NO: 48 and SEQ ID NO: 49 are Split Cas9 (2-573) and Split Cas9 (574-1368) respectively: Exol/Dna2 could be fused with either fragment of Cas9 (2-573) or (574-1368), then packed in Adenoviral vectors (AVV) and delivered in mammalian cells to achieve the same benefits seen with full length Cas9-HR HDR engineering. This can allow Cas9-HRs to be used with traditional AVV techniques. SEQ ID NO: 50 is NmCas9: Alternate Cas9 for use in Cas9-HR to enable AVV techniques or use in expanded organisms; SEQ ID NO: 51 is SaCas9: Alternate Cas9 for use in Cas9-HR to enable AVV techniques or use in expanded organisms. SEQ ID NO: 52 is CjCas9: Alternate Cas9 for use in Cas9-HR to enable AVV techniques or use in expanded organisms. SEQ ID NO: 53 is ScCas9: Alternate Cas9 for use in Cas9-HR to enable AVV techniques or use in expanded organisms. SEQ ID NO: 54 is ScCas9 (++): Alternate Cas9 with increased fidelity and activity for use in Cas9-HR to enable AVV techniques or use in expanded organisms. SEQ ID NO: 60 is SluCas9 (Staphylococcus lugdunensis Cas9, a Streptococcus pyogenes Cas9 orthologue).

[0059] In some embodiments, the programmable Cas can include Class 1 Cas polypeptides, Class 2 Cas polypeptides, type I Cas polypeptides, type II Cas polypeptides, type III Cas polypeptides, type IV Cas polypeptides, type V Cas polypeptides, and type VI CRISPR- associated (Cas) polypeptides, CRISPR-associated RNA binding proteins, or a functional fragment thereof. Further, Cas polypeptides suitable for use with the present disclosure often include Cpfl (or Casl2a), c2cl, C2c2 (or Casl3a), Casl3, Casl3a, Casl3b, c2c3, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a, Cas8al , Cas8a2, Cas8b, Cas8c, Csnl, Csxl2, Cas 10, CaslOd, CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl , Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966; any derivative thereof; any variant thereof; and any fragment thereof. In some embodiments, the programmable Cas is Casl2 such as Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl2f, or Casl2j. In some embodiments, the programmable Cas is Casl2a. Exemplary programmable Casl2 can be encoded from any of the sequences SEQ ID NOs: 55-57.

[0060] In some embodiments, the programmable Cas can be substituted with another programmable endonuclease. For example, other site-specific endonucleases that are suitable for the fusion protein composition disclosed herein often comprise zinc finger nucleases (ZFN); transcription activator-like effector nucleases (TALEN); meganucleases; RNA-binding proteins (RBP); recombinases; flippases; transposases; Argonaute (Ago) proteins (e.g., prokaryotic Argonaute (pAgo), archaeal Argonaute (aAgo), and eukaryotic Argonaute (eAgo)); or any functional fragment thereof.

[0061] The Cas9 enzymes or other programmable nuclease disclosed herein also comprises at least one nuclear localization signal (NLS), which is an amino acid sequence that attaches to a protein for import into the cell nucleus by nuclear transport. Generally, the NLS comprises one or more short sequences of positively charged lysines or arginines exposed on the protein surface. These types of classical NLSs can be further classified as either monopartite or bipartite. The major structural difference between the two is that the two basic amino acid clusters in bipartite NLSs are separated by a relatively short spacer sequence (hence bipartite - 2 parts), while monopartite NLSs are not. In some embodiments, the NLS comprises sequence PKKKRKV (SEQ ID NO: 167) of the SV40 Large T-antigen (a monopartite NLS). In other embodiments, the NLS of nucleoplasmin comprises sequence KR[PAATKKAGQA]KKKK (SEQ ID NO: 168). In some embodiments, other types of non-classical nuclear localization signals (NLSs) are used. Different types of NLSs disclosed herein are not meant to be limiting and a person of ordinary skill in the art is able to select a NLS to attach to a Cas9 protein. In some embodiments, the Cas9 protein comprises an N-terminal NLS. In other embodiments, the Cas9 protein comprises a C-terminal NLS. In yet other embodiments, the Cas9 protein comprises both N-terminal and C-terminal NLSs.

[0062] In some embodiments, the Cas fusion protein comprises a Casl2 nuclease. In some embodiments, the second Cas fusion protein comprises a Casl2 nuclease. In some embodiments, the Casl2 nuclease is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a polypeptide sequence of any one of SEQ ID NOs: 55-57. In some embodiments, the Casl2 nuclease is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a polypeptide sequence of SEQ ID NO: 55. In some embodiments, the Casl2 nuclease is SEQ ID NO: 55. In some embodiments, the Casl2 nuclease is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a polypeptide sequence of SEQ ID NO: 56 In some embodiments, the Casl2 nuclease is SEQ ID NO: 56 In some embodiments, the Casl2 nuclease is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a polypeptide sequence of SEQ ID NO: 57. In some embodiments, the Casl2 nuclease is SEQ ID NO: 57.

[0063] In some embodiments, the Cas fusion protein comprises a Cas9 nuclease. In some embodiments, the second Cas fusion protein comprises a Cas9 nuclease. In some embodiments, the Cas9 nuclease is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a polypeptide sequence of any one of SEQ ID NOs: 7- 23, SEQ ID NOs:41-54, or SEQ ID NO:60. In some embodiments, the Cas fusion protein comprises a SluCas9 nuclease. In some embodiments, the second fusion Cas protein comprises a SluCas9 nuclease. In some embodiments, the Cas fusion protein comprises a Cas nickase. In some embodiments, the Cas nickase comprises a Cas nickase variant. In some embodiments, the Cas nickase variant comprises Cas9 D10A. In some embodiments, the Cas nickase variant comprises Cas9 H840A. In some embodiments, the Cas nickase is fused to an exonuclease or a fragment thereof

[0064] In some embodiments, the Cas fusion protein is encoded from a nucleic acid that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a nucleic acid sequence of any one of SEQ ID NOs: 61-63. In some embodiments, the Cas fusion protein is encoded from a nucleic acid that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a nucleic acid sequence of SEQ ID NO: 61. In some embodiments, the Cas fusion protein is encoded from a nucleic acid that is SEQ ID NO: 61 In some embodiments, the Cas fusion protein is encoded from a nucleic acid that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a nucleic acid sequence of SEQ ID NO: 62 In some embodiments, the Cas fusion protein is encoded from a nucleic acid that is SEQ ID NO: 62 In some embodiments, the Cas fusion protein is encoded from a nucleic acid that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to a nucleic acid sequence of SEQ ID NO: 63. In some embodiments, the Cas fusion protein is encoded from a nucleic acid that is SEQ ID NO: 63. [0065] In some embodiments, the Cas fusion protein can be complexed with at least one guide polynucleotide (e.g., a gRNA) to form a fusion protein complex or a Cas fusion protein complex via a ribonucleoprotein (RNP). A RNP typically comprises at least two parts: one part comprises a programmable endonuclease such as a Cas9 or other CRISPR-related programmable endonucleases; and the other part comprises a gRNA or other specificityconveying nucleic acid. Often, a wild type Cas9 enzyme or other Cas or non-Cas programmable endonuclease can be one part of the CRISPR-Cas9 system. The modified Cas9 protein coupled to a fragment of hExol via a linker peptide can also be one part of the CRISPR-Cas9 system. Further, the modified Cas9 protein and a gRNA can form a ribonucleoprotein (RNP).

[0066] In some embodiments, the Cas fusion protein (e.g., any one of the Cas9-HR) can induce an insertion of a repair template into a genomic locus, where the repair template to be inserted comprises a nucleic acid sequence that is at least 1000 nucleotides, at least 1500 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 3500 nucleotides, at least 4000 nucleotides, at least 4500 nucleotides, at least 5000 nucleotides, at least 5500 nucleotides, at least 10000 nucleotides, or more nucleotides. In some embodiments, the Cas fusion protein (e.g., any one of the Cas9-HR) can induce an insertion of a repair template, where the length of the repair template, compared to a length of a repair template inserted by convention or wild type Cas protein, is increased by at least 500 nucleotides, at least 1000 nucleotides, at least 1500 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 3500 nucleotides, at least 4000 nucleotides, at least 4500 nucleotides, at least 5000 nucleotides, at least 5500 nucleotides, at least 10000 nucleotides, or more nucleotides.

Exonuclease

[0067] The fusion protein comprising the programmable endonuclease can be fused to an exonuclease or an exonuclease domain or fragment so as to affect the results disclosed herein. A number of exonuclease or programmable exonuclease combinations are consistent with the disclosure herein. With respect to the exonuclease, certain exemplary exonucleases suitable for use as part of the fusion protein in present application include MRE11, EXO1, EXO III, EXO VII, EXOT, DNA2, CtIP, TREX1, TREX2, Apollo, RecE, Red, T5, Lexo, RecBCD, and Mungbean nuclease. Additional suitable exonucleases are also contemplated. In some embodiments, the exonuclease comprises human Exol (hExol), or a fragment thereof. Full length hExol (SEQ ID NO: 1) can be divided into roughly two regions: the N-terminal nuclease region (1-392, SEQ ID NO: 2); and the C-terminal MLH2/MSH1 interaction region (393-846, SEQ ID NO: 3). In some embodiments, the N-terminal nuclease region of hExol (SEQ ID NO: 2) is used to covalently link to a Cas9 with at least one NLS via a peptidyl linker. In other embodiments, a fragment of SEQ ID NO: 2 or other exonuclease domain that retains the nuclease function is used herein. For example, the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to SEQ ID NO: 2. In some embodiments, the fragment may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid changes compared to SEQ ID NO: 2 or other untruncated or unmutated domain. In some embodiments, the Cas fusion protein comprises a Cas nuclease fused to a DNA replication ATP-dependent helicase/nuclease (DNA2), or fragment thereof. Full length DNA2 (SEQ ID NO: 4) can be divided into roughly two regions: the N-terminal nuclease region (1-397, SEQ ID NO: 5); and the C-terminal MLH2/MSH1 interaction region (398-1060, SEQ ID NO: 6). In some embodiments, the N- terminal nuclease region of DNA2 (SEQ ID NO: 4) is used to covalently link to a Cas9 with at least one NLS via a peptidyl linker. In other embodiments, a fragment of SEQ ID NO: 4 or other exonuclease domain that retains the nuclease function is used herein. For example, the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to SEQ ID NO: 4 In some embodiments, the fragment may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid changes compared to SEQ ID NO: 4 or other untruncated or unmutated domain. The N- terminal nuclease region of the hExol or DNA2 is exemplary, and additionally suitable Exol or other exonuclease sequences can be utilized for the purpose disclosed herein by a person of ordinary skill in the art.

Construct

[0068] Provided herein are exemplary constructs for expressing the fusion protein (e.g., Cas9- HR), guide polynucleotide, repair template, or a combination thereof. In some embodiments, the construct comprises any single or combination of components for inducing the HDR. In some embodiments, the construct can may comprise any one of: a polynucleotide comprising nucleic acid sequence encoding a promoter, any one of the Cas9-HR or Cas fusion protein described herein, a reporter, at least one guide polynucleotide, a repair template, a selection marker (e.g., antibody resistance selection marker), a fragment thereof, or any combinations thereof. In some embodiments, at least one construct is introduced into a cell harboring the endogenous genetic mutation. In some embodiments, the construct can be a vector. In some embodiments, at least two different constructs are introducing into a cell harboring the endogenous genetic mutation. In some embodiments, a fragment of the construct can be inserted into a safe harbor site (SHS) of the chromosome. Non-limiting examples of the SHS where the construct can be inserted include SHS_227_chrl_231999396-231999415; SHS_229_chr2_45708354-45708373; SHS_231_chr4_58976613-58976632;

SHS_233_chr6_l 14713905-114713924; SHS_253_chr2_48830185-48830204; SHS_255_chr5_l 9069307- 19069326; SHS_257_chr7_l 38809594-138809613 ; SHS_259_chrl4_92099558-92099577; SHS_261_chrl7_48573577-48573596; SHS_263_chrX_12590812-12590831; SHS_283_chr4_37769238-37769257; SHS_285_chr6_89574320-89574339; SHS_289_chrl_175942362-175942381; SHS 29 l_chr22_35770121-35770140; SHS_293_chr8_40727927-40727946; SHS_295_chrl2_66516386-66516405; SHS_297_chrl7_14810285-14810304; SHS_299_chr6_138972461-138972480; SHS_301_chr7_l 13327685-113327704; SHS_303_chr2_150500675-150500694; SHS_305_chr5_l 59922029-159922048; SHS_307_chrl6_19323777-19323796; SHS_309_chr20_5055245-5055264; SHS_311_chr6_134385946-134385965; SHS_313_chrX_16059732-16059751; SHS_315_chr5_7577728-7577747; SHS_317_chr2_77263930-77263949;

SHS_319_chrl l_32680546-32680565; SHS_321_chrX_79674328-79674347; SHS_323_chrl_152360840-152360859; SHS_325_chr8_68720172-68720191; SHS_327_chr5_93159222-93159241; SHS_329_chrl2_126152581-126152600; SHS 33 l_chr3_31670871-31670890; SHS_333_chrl2_27543737-27543756; SHS_AAVSl_chrl9_55625241-55629351; SHS_AAVSl_chrl9_55625241-55629351; or SHS_hROSA2_chr3_9415082-9414043.

Guide polynucleotide

[0069] A ribonucleic acid that comprises a sequence for guiding the ribonucleic acid to a target site on a gene and another sequence for binding to an endonuclease such as Cas9 enzyme is used herein. The guide polynucleotide can comprise at least one CRISPR RNA (crRNA) and at least one transactivating crRNA (tracrRNA). A crRNA can comprise the nucleic acid-targeting segment (e.g., spacer region) of the guide polynucleotide and a stretch of nucleotides that can form one half of a double-stranded duplex of the Cas protein-binding segment of the guide polynucleotide. A tracrRNA can comprise a stretch of nucleotides that forms the other half of the double-stranded duplex of the Cas protein-binding segment of the gRNA. A stretch of nucleotides of a crRNA can be complementary to and hybridize with a stretch of nucleotides of a tracrRNA to form the double-stranded duplex of the Cas protein-binding domain of the guide polynucleotide. The crRNA and tracrRNA can hybridize to form a guide polynucleotide. The crRNA can also provide a single-stranded nucleic acid targeting segment (e.g., a spacer region) that hybridizes to a target nucleic acid recognition sequence (e.g., protospacer). The sequence of a crRNA, including spacer region, or tracrRNA molecule can be designed to be specific to the species in which the guide polynucleotide is to be used. The Cas protein-binding segment of a guide polynucleotide can comprise two stretches of nucleotides (e.g., crRNA and tracrRNA) that are complementary to one another. The two stretches of nucleotides (e.g., crRNA and tracrRNA) that are complementary to one another can be covalently linked by intervening nucleotides (e.g., a linker in the case of a single guide polynucleotide). The two stretches of nucleotides (e.g., crRNA and tracrRNA) that are complementary to one another can hybridize to form a double stranded RNA duplex or hairpin of the Cas protein-binding segment, thus resulting in a stem-loop structure. The crRNA and the tracrRNA can be covalently linked via the 3’ end of the crRNA and the 5’ end of the tracrRNA. Alternatively, tracrRNA and crRNA can be covalently linked via the 5’ end of the tracrRNA and the 3’ end of the crRNA.

[0070] In some cases, the target site is a genomic locus. In some embodiments, the genomic locus encodes a gene. In some embodiments, the genomic locus does not encode a gene. In some embodiments, the genomic locus is a safe harbor site (SHS). In some embodiments, the genomic locus is associated with a disease or condition. [0071] In some embodiments, the guide polynucleotide can comprise a gRNA. In some embodiments, the gRNA is a synthetic gRNA (sgRNA). The gRNA directs the fusion protein complex to a targeted nucleotide sequence of the DNA molecule. The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-defined spacer of about 20 nucleotides in length that defines the genomic target to be modified. In some embodiments, the gRNA targets a genomic locus that encodes a gene associated with cancer. In some embodiments, the gRNA targets an oncogene. In some embodiments, the gRNA targets an oncogene a tumor suppressor gene. In some embodiments, the gene associated with the cancer is Cadherin. In some embodiments, the gene associated with the cancer is E-Cadherin. In some embodiments, the gene associated with the cancer is Catenin. In some embodiments, the gene associated with the cancer is Beta-Catenin. In some embodiments, the gRNA targets a genomic locus that encodes a gene associated with hyperphenylalaninemia or phenylketonuria (PKU). In some embodiments, the gene associated with hyperphenylalaninemia or PKU comprises phenylalanine hydroxylase (PAH). In some embodiments, the gRNA targets a genomic locus that encodes a gene associated with hemophilia. In some embodiments, the gene associated with hemophilia comprises Factor VIII. In some embodiments, the gene associated with hemophilia comprises Factor IX. In some embodiments, the gRNA targets a genomic locus that encodes a gene associated with hypercholesterolemia. In some embodiments, the gene associated with hypercholesterolemia comprises apolipoprotein B (ApoB).

[0072] In some embodiments, the repair template comprises a sequence from Table 4. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 100-110. In some embodiments, repair template comprises a coding sequence of PAH or a fragment thereof. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to any one of SEQ ID NO: 101, SEQ ID NOs: 105-106, or SEQ ID NOs: 110 In some embodiments, the repair template comprises a nucleic acid sequence that is identical to any one of SEQ ID NOs: 105- 106. In some embodiments, the repair template comprises a coding sequence of Factor 8, Factor 9, or a fragment thereof. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to any one of SEQ ID NO: 100, or SEQ ID NOs: 103- 104. In some embodiments, the repair template comprises a nucleic acid sequence that is identical to any one of SEQ ID NO: 100, or SEQ ID NOs: 103-104. In some embodiments, the repair template comprises a coding sequence of ApoB or a fragment thereof. In some embodiments, the repair template comprises a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to any one of SEQ ID NO: 102 or SEQ ID NO: 107. In some embodiments, the repair template comprises a nucleic acid sequence that is identical to any one of SEQ ID NO: 102 or SEQ ID NO: 107

[0073] In some embodiments, the genomic locus comprises at least one mutation. In some embodiments, the at least one mutation is associated with a disease or condition. In some embodiments, the genomic locus comprises at least one mutation that can be corrected by the fusion protein complex and the repair template described herein. In some embodiments, the genomic locus comprises at least two mutations that can be corrected by the fusion protein complex and the repair template described herein. In some embodiments, the genomic locus comprises at least two mutations, at least three mutations, at least four mutations, at least five mutations, at least ten mutations, at least twenty mutations, at least fifty mutations, at least one hundred mutations, or more mutations that can be corrected by the fusion protein complex inserting the repair template described herein. In some embodiments, the mutations can be spaced apart in the genomic locus by at least 200 base pair (bp), at least 300 bp, at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp, at least 900 bp, at least 1,000 bp, at least 1,100 bp, at least 1,200 bp, at least 1,300 bp, at least 1,400 bp, at least 1,500 bp, at least

I,600 bp, at least 1,700 bp, at least 1,800 bp, at least 1,900 bp, at least 2,000 bp, at least 2,500 bp, at least 3,000 bp, at least 3,500 bp, at least 4,000 bp, at least 4,500 bp, at least 5,000 bp, at least 5,500 bp, at least 6,000 bp, at least 6,500 bp, at least 7,000 bp, at least 7,500 bp, at least 8,000 bp, at least 8,500 bp, at least 9,000 bp, at least 9,500 bp, at least 10,000 bp, at least

I I,000 bp, at least 12,000 base pair (bp), at least 13,000 bp, at least 14,000 bp, at least 15,000 bp, at least 16,000 bp, at least 17,000 bp, at least 18,000 bp, at least 19,000 bp, at least 20,000 or more base pairs.

[0074] In some embodiments, the guide polynucleotide can direct the Cas9 fusion protein (e.g., any one of the Cas9-HR) to induce insertion of least two, at least three, at least four, at least five, or more polynucleotides of interest into a genomic locus, where the repair template can be the same (e.g., sharing identical nucleic acid sequences) or different (e.g., comprising different nucleic acid sequences for encoding different genes). In some embodiments, the method described herein can utilize multiple guide polynucleotides to direct the Cas9 fusion protein to insert the same repair template in multiple genomic loci. For example, the Cas9 fusion protein can be directed by a plurality of the guide polynucleotides to insert the same repair template at two, three four, five, or more genomic loci. In some embodiments, the method described herein can utilize multiple guide polynucleotides to direct the Cas9 fusion protein to insert the same repair template in multiple genomic loci. For example, the Cas9 fusion protein (e.g., any one of the Cas9-HR) can be directed by a plurality of the guide polynucleotides to insert the same repair template at two, three four, five, or more genomic loci. In some embodiments, the method described herein can utilize multiple guide polynucleotides to direct the Cas9 fusion protein to insert different polynucleotides of interest in at least one, at least two, or more genomic loci. For example, the Cas9 fusion protein (e.g., any one of the Cas9-HR) can be directed by a plurality of the guide polynucleotides to insert the different polynucleotides of interest at two or more genomic loci.

[0075] In some embodiments, the guide polynucleotide can direct the Cas9 fusion protein to induce insertion of the repair template in a genomic locus comprising a safe harbor site (SHS). In some embodiments, at least two, at least three, at least four, at least five, at least ten, at least 100, at least 500, at least 1000, at least 2000, at least 3000, at least 5000, at least 6000, at least 7000, at least 8000 or more polynucleotides can be introduced into a SHS. In some embodiments, the method described herein can utilize multiple guide polynucleotides to direct the Cas9 fusion protein to insert at least one repair template in multiple safe harbor sites. For example, the Cas9 fusion protein can be directed by a plurality of the guide polynucleotides to insert at least one repair template at two, three four, five, or more safe harbor sites. In some embodiments, the method described herein can utilize multiple guide polynucleotides to direct the Cas9 fusion protein to insert the different polynucleotides of interest in at least one, at least two, or more safe harbor sites. For example, the Cas9 fusion protein can be directed by a plurality of the guide polynucleotides to insert the different polynucleotides of interest at two or more safe harbor sites.

Repair template

[0076] Genome stability necessitates the correct and efficient repair of double strand breaks (DSBs). In eukaryotic cells, mechanistic repair of DSBs occurs primarily by two pathways: Non-Homologous End-Joining (NHEJ) and Homology Directed Repair (HDR). NHEJ is the canonical homology-independent pathway as it involves the alignment of only one to a few complementary bases at most for the re-ligation of two ends, whereas HDR uses longer stretches of sequence homology to repair DNA lesions. HDR is the more accurate mechanism for DSB repair due to the requirement of higher sequence homology between the damaged and intact donor strands of DNA. The process is error-free if the DNA template used for repair is identical to the original DNA sequence at the DSB, or it can introduce very specific mutations into the damaged DNA.

[0077] As addressed above, HDR methods provide great freedom in genomic engineering, allowing for as little as single base mutations and up to insertions or deletions of kilo-bases (kb) of DNA. In eukaryotes, HDR rate is governed by the competition between two different pathways: Homologous Recombination (HR) and Non-Homologous End Joining (NHEJ). The competition between these two pathways begins by competitive binding by either the MRN/CtIP complex or Ku 70/80 heterodimer. If MRN/CtIP binds first, they recruit other proteins, including Exonuclease I (Exol), which possess 5 ’->3’ exonuclease activity. 5’ end resection of double strand DNA breaks by either Exol or Dna2 at each side of the break commits the DSB to be repaired by the HDR pathway. Alternatively, if the Ku 70/80 heterodimer binds, it can then recruit other NHEJ pathway members, including DNA Ligase IV, and eventually repairs the double strand break via NHEJ.

[0078] A repair template comprising a HDR template sequence needs to be delivered into a cell when delivering the CRISPR-Cas9 system to the cell. HDR templates used to create specific mutations or insert new elements into a gene require a certain amount of homology surrounding the target sequence that will be modified. In some embodiments, the 5’ and 3’ homology arms start at the CRISPR-induced DSB. In general, the insertion sites of the modification can be very close to the DSB, ideally less than lObp away if possible. In some embodiments, the 5’and 3’ homology arm of the HDR template sequences are at least 80% identical to the targeted sequence. Further, in some embodiments, a single stranded donor oligonucleotide (ssDON) is utilized for smaller insertions. Each homology arm of the ssDON may comprise an about 30-80 bp nucleotide sequence. The length of the homology arm is not meant to be limiting and the length can be adjusted by a person of ordinary skill in the art according to a locus of gene interest and experimental system. For larger insertions such as fluorescent proteins or selection cassettes, a double stranded donor oligonucleotide (dsDON) can be utilized as an HDR template sequence. In some embodiments, each homology arm of the ssDON may comprise an about 800-1500 bp nucleotide sequence. To prevent the Cas9 enzyme from cleaving the HDR template, in some embodiments, a single base mutation can be introduced in the Protospacer Adjacent Motif (PAM) sequence of the HDR template.

[0079] In some embodiments, the repair template to be inserted comprises a length that is at least 1000 nucleotides, at least 1500 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 3500 nucleotides, at least 4000 nucleotides, at least 4500 nucleotides, at least 5000 nucleotides, at least 5500 nucleotides, at least 10000 nucleotides, or more nucleotides. In some embodiments, the repair template to be inserted comprises a length that is about 1,000 nucleotides to about 6,500 nucleotides. In some embodiments, the repair template to be inserted comprises a length that is about 1,000 nucleotides to about 1,500 nucleotides, about 1,000 nucleotides to about 2,000 nucleotides, about 1,000 nucleotides to about 2,500 nucleotides, about 1,000 nucleotides to about 3,000 nucleotides, about 1,000 nucleotides to about 3,500 nucleotides, about 1,000 nucleotides to about 4,000 nucleotides, about 1,000 nucleotides to about 4,500 nucleotides, about 1,000 nucleotides to about 5,000 nucleotides, about 1,000 nucleotides to about 5,500 nucleotides, about 1,000 nucleotides to about 6,000 nucleotides, about 1,000 nucleotides to about 6,500 nucleotides, about 1,500 nucleotides to about 2,000 nucleotides, about 1,500 nucleotides to about 2,500 nucleotides, about 1,500 nucleotides to about 3,000 nucleotides, about 1,500 nucleotides to about 3,500 nucleotides, about 1,500 nucleotides to about 4,000 nucleotides, about 1,500 nucleotides to about 4,500 nucleotides, about 1,500 nucleotides to about 5,000 nucleotides, about 1,500 nucleotides to about 5,500 nucleotides, about 1,500 nucleotides to about 6,000 nucleotides, about 1,500 nucleotides to about 6,500 nucleotides, about 2,000 nucleotides to about 2,500 nucleotides, about 2,000 nucleotides to about 3,000 nucleotides, about 2,000 nucleotides to about 3,500 nucleotides, about 2,000 nucleotides to about 4,000 nucleotides, about 2,000 nucleotides to about 4,500 nucleotides, about 2,000 nucleotides to about 5,000 nucleotides, about 2,000 nucleotides to about 5,500 nucleotides, about 2,000 nucleotides to about 6,000 nucleotides, about 2,000 nucleotides to about 6,500 nucleotides, about 2,500 nucleotides to about 3,000 nucleotides, about 2,500 nucleotides to about 3,500 nucleotides, about 2,500 nucleotides to about 4,000 nucleotides, about 2,500 nucleotides to about 4,500 nucleotides, about 2,500 nucleotides to about 5,000 nucleotides, about 2,500 nucleotides to about 5,500 nucleotides, about 2,500 nucleotides to about 6,000 nucleotides, about 2,500 nucleotides to about 6,500 nucleotides, about 3,000 nucleotides to about 3,500 nucleotides, about 3,000 nucleotides to about 4,000 nucleotides, about 3,000 nucleotides to about 4,500 nucleotides, about 3,000 nucleotides to about 5,000 nucleotides, about 3,000 nucleotides to about 5,500 nucleotides, about 3,000 nucleotides to about 6,000 nucleotides, about 3,000 nucleotides to about 6,500 nucleotides, about 3,500 nucleotides to about 4,000 nucleotides, about 3,500 nucleotides to about 4,500 nucleotides, about 3,500 nucleotides to about 5,000 nucleotides, about 3,500 nucleotides to about 5,500 nucleotides, about 3,500 nucleotides to about 6,000 nucleotides, about 3,500 nucleotides to about 6,500 nucleotides, about 4,000 nucleotides to about 4,500 nucleotides, about 4,000 nucleotides to about 5,000 nucleotides, about 4,000 nucleotides to about 5,500 nucleotides, about 4,000 nucleotides to about 6,000 nucleotides, about 4,000 nucleotides to about 6,500 nucleotides, about 4,500 nucleotides to about 5,000 nucleotides, about 4,500 nucleotides to about 5,500 nucleotides, about 4,500 nucleotides to about 6,000 nucleotides, about 4,500 nucleotides to about 6,500 nucleotides, about 5,000 nucleotides to about 5,500 nucleotides, about 5,000 nucleotides to about 6,000 nucleotides, about 5,000 nucleotides to about 6,500 nucleotides, about 5,500 nucleotides to about 6,000 nucleotides, about 5,500 nucleotides to about 6,500 nucleotides, about 6,000 nucleotides to about 6,500 nucleotides, or about 6,000 nucleotides to about 10,000 nucleotides. In some embodiments, the repair template to be inserted comprises a length that is about 1,000 nucleotides, about 1,500 nucleotides, about 2,000 nucleotides, about 2,500 nucleotides, about 3,000 nucleotides, about 3,500 nucleotides, about 4,000 nucleotides, about

4.500 nucleotides, about 5,000 nucleotides, about 5,500 nucleotides, about 6,000 nucleotides, about 6,500 nucleotides, about 7,000 nucleotides, about 7,500 nucleotides, about 8,000 nucleotides, about 8,500 nucleotides, about 9,000 nucleotides, about 9,500 nucleotides, or about 10,000 nucleotides. In some embodiments, the repair template to be inserted comprises a length that is at least about 1,000 nucleotides, about 1,500 nucleotides, about 2,000 nucleotides, about

2.500 nucleotides, about 3,000 nucleotides, about 3,500 nucleotides, about 4,000 nucleotides, about 4,500 nucleotides, about 5,000 nucleotides, about 5,500 nucleotides, or about 6,000 nucleotides. In some embodiments, the repair template to be inserted comprises a length that is at most about 1,500 nucleotides, about 2,000 nucleotides, about 2,500 nucleotides, about 3,000 nucleotides, about 3,500 nucleotides, about 4,000 nucleotides, about 4,500 nucleotides, about 5,000 nucleotides, about 5,500 nucleotides, about 6,000 nucleotides, about 6,500 nucleotides, about 7,000 nucleotides, about 7,500 nucleotides, about 8,000 nucleotides, about 8,500 nucleotides, about 9,000 nucleotides, about 9,500 nucleotides, or about 10,000 nucleotides. [0080] In some embodiments, the repair template comprises a HDR template. In some embodiments, the repair template comprises at least one mutation compared to an endogenous nucleic acid sequence located between the region and the second region. In some embodiments, the mutation is a silent mutation. In some embodiments, the repair template can comprise a coding sequence. In some embodiments, the repair template encodes a wide type gene or a fragment thereof for correcting at least one mutation in the genomic locus. In some embodiments, the repair template comprises a length that is sufficient to correct at least two mutations, where the mutations are spaced at least 200 bp, at least 300 bp, at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp, at least 900 bp, at least 1000 bp, at least 1100 bp, at least 1200 bp, at least 1300 bp, at least 1400 bp, at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, at least 2000 bp, at least 2500 bp, at least 3000 bp, at least 3500 bp, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000, at least 7500, at least 8000, at least 8500, at least 9000, at least 9500, at least 10000, or more base pairs.

[0081] In some embodiments, the repair template can encode a full-length transgene. In some embodiments, the repair template can encode a fragment of a transgene. In some embodiments, the repair template can encode a reporter. In some embodiments, the repair template can encode a reporter for diagnosing a disease or condition described herein. In some embodiments, the repair template can encode a regulatory element for regulating gene expression in a cell. In some embodiments, the repair template can encode at least one RNA such as a transfer RNA (tRNA), a ribosomal RNA (rRNA), an snRNA, a long non-coding RNA, a small RNA, a snoRNA, a siRNA, a miRNA, a tRNA-derived small RNA (tsRNA), an antisense RNA, an shRNA, or a small rDNA-derived RNA (srRNA) for modulating gene expression of an endogenous gene in a cell.

[0082] In some embodiments, the repair template may comprise an exon. In some embodiments, the repair template may comprise at least one exon and at least intron.

[0083] In some embodiments, the repair template comprises a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more identical to any one of SEQ ID NOs: 100-110. In some embodiments, the repair template comprises a nucleic acid sequence that is any one of SEQ ID NOs: 100-110

[0084] In some embodiments, the repair template comprises a mutated protospacer adjacent motif (PAM) sequence located at the immediate 3’ end of a cleavage site, wherein the mutated PAM sequence comprises 5’-NCG-3’ or 5’-NGC-3’. In some embodiments, the repair template comprises a mutated protospacer adjacent motif (PAM) sequence located at the immediate 3’ end of a cleavage site, wherein the mutated PAM sequence comprises 5’-NNCG-3’ or 5’- NNGC-3’.

Delivery

[0085] A construct described herein (e.g., vector encoding a Cas protein, a Cas fusion protein, a guide polynucleotide, or repair template), a Cas protein, a Cas fusion protein, a guide polynucleotide, or repair template can be introduced into a cell by any method for delivery described herein into the cell. In some embodiments, a construct, a Cas protein, a Cas fusion protein, a guide polynucleotide, or repair template is introduced into the cell by physical, chemical, or biological methods.

[0086] Physical methods for introducing a construct, a Cas protein, a Cas fusion protein, a guide polynucleotide, or repair template into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, gene gun, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are suitable for methods herein. One method for the introduction of a construct into a host cell is calcium phosphate transfection.

[0087] Biological methods for introducing a construct, a Cas protein, a Cas fusion protein, a guide polynucleotide, or repair template into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors, in some embodiments, are derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. Exemplary viral vectors include retroviral vectors, adenoviral vectors, adeno-associated viral vectors (AAVs), pox vectors, parvoviral vectors, baculovirus vectors, measles viral vectors, or herpes simplex virus vectors (HSVs). In some embodiments, the retroviral vectors include gamma-retroviral vectors such as vectors derived from the Moloney Murine Leukemia Virus (MoMLV, MMLV, MuLV, or MLV) or the Murine Stem Cell Virus (MSCV) genome. In some embodiments, the retroviral vectors also include lentiviral vectors such as those derived from the human immunodeficiency virus (HIV) genome. In some embodiments, AAV vectors include AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 serotype. In some embodiments, the viral vector is a chimeric viral vector, comprising viral portions from two or more viruses. In additional instances, the viral vector is a recombinant viral vector.

[0088] Chemical means for introducing a construct, a Cas protein, a Cas fusion protein, a guide polynucleotide, or repair template into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle). Other methods of state-of-the-art targeted delivery of nucleic acids are available, such as delivery of polynucleotides with targeted nanoparticles or other suitable submicron sized delivery system.

[0089] In some embodiments, a non-viral delivery system is utilized. In some embodiments, a non-viral delivery system comprises a liposome. In some embodiments, a lipid formulation is used for the introduction of the construct into a host cell (in vitro, ex vivo, or in vivo). In some embodiments, the nucleic acid is associated with a lipid. In some embodiments, the construct associated with a lipid is encapsulated in the aqueous interior of a liposome, or interspersed within the lipid bilayer of a liposome, or attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, or entrapped in a liposome, or complexed with a liposome, or dispersed in a solution containing a lipid, or mixed with a lipid, or combined with a lipid, or contained as a suspension in a lipid, or contained or complexed with a micelle, otherwise associated with a lipid, or combinations thereof. Lipid, lipid/DNA, or lipid/expression vector associated compositions are not limited to any particular structure in solution. In some embodiments, they are present in a bilayer structure, as micelles, or with a “collapsed” structure. In some embodiments, they are simply interspersed in a solution. In some embodiments, they may form aggregates that are not uniform in size or shape. Methods of modifying genomic locus

[0090] Described herein, in some embodiments, are methods for modifying a genomic locus by inserting a repair template. In some embodiments, the methods comprise contacting a cell with a Cas fusion protein complex comprising a Cas fusion protein (e.g., any one of the Cas9-HR) complexed with a guide polynucleotide configured to bind to a genomic locus of the cell. In some embodiments, the method further comprises contacting the same cell with a repair template comprising a nucleic acid donor sequence that is at least 1000 nucleotides, at least 1500 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 3500 nucleotides, at least 4000 nucleotides, at least 4500 nucleotides, at least 5000 nucleotides, at least 5500 nucleotides, at least 6000 nucleotides, at least 6500 nucleotides, at least 7000 nucleotides, at least 7500 nucleotides, at least 8000 nucleotides, at least 8500 nucleotides, at least 9000 nucleotides, at least 9500 nucleotides, at least 10000 nucleotides, at least 11000 nucleotides, at least 12000 nucleotides, at least 15000 nucleotides, or more nucleotides in length, not including the homology arms. In some embodiments, the Cas fusion protein complex is configured to induce homology-directed repair (HDR) of the genomic locus of a cell with the nucleic acid donor sequence to produce an edited cell. In some embodiments, the editing of the cell can be used to treat a disease or condition. In some embodiments, the edited cell can be further formulated into a pharmaceutical formulation for treating the disease or condition.

[0091] In some embodiments, the methods comprise contacting a cell with a Cas fusion protein complexed with a guide polynucleotide, wherein the guide polynucleotide directs the Cas fusion protein to cleave a region in a genomic locus of the cell. In some embodiments, the methods comprise contacting a cell with a second Cas protein complexed with a second guide polynucleotide, wherein the second guide polynucleotide directs the second Cas protein to cleave a second region in the genomic locus. In some embodiments, the region and the second region are at least 1000 base pairs (bp) apart. In some embodiments, the region and the second region are at least 2000 bp apart. In some embodiments, the region and the second region are at least 3000 bp apart. In some embodiments, the region and the second region are at least 4000 bp apart. In some embodiments, the region and the second region are at least 5000 bp apart. In some embodiments, the region and the second region are at least 6000 bp apart. In some embodiments, the region and the second region are at least 7000 bp apart. In some embodiments, the region and the second region are at least 8000 bp apart. In some embodiments, the region and the second region are at least 9000 bp apart. In some embodiments, the region and the second region are at least 10000 bp apart. In some embodiments, the region and the second region are at least 15000 bp apart. In some embodiments, the region and the second region are at least 20000 bp apart. In some embodiments, the region and the second region are at least 25000 bp apart. In some embodiments, the region and the second region are at least 50000 bp apart. In some embodiments, a repair template is inserted between the region and the second region by homology-directed repair (HDR) in the cell. In some embodiments, the Cas fusion protein or the second Cas protein creates single-stranded cleavage at the region or the second region. [0092] In some embodiments, the method can correct at least one mutation in a genomic locus. In some embodiments, the genomic locus comprising the at least one mutation can encode Cadherin, Catenin, PAH, Factor 8, Factor 9, or ApoB. In some embodiments, the genomic locus encodes a gene associated with cancer. In some embodiments, the genomic locus encodes a gene associated with hyperphenylalaninemia or PKU. In some embodiments, the genomic locus encodes a gene associated with hemophilia. In some embodiments, the genomic locus encodes a gene associated with hypercholesterolemia. In some embodiments, the gene associated with the cancer is an oncogene. In some embodiments, the gene associated with the cancer is a tumor suppressor gene. In some embodiments, the genomic locus encodes a gene associated with a kidney disease such as polycystic kidney disease. In some embodiments, the gene associated with the kidney disease is polycystin 1 (PKD1) or polycystin 2 (PKD2).

[0093] In some embodiments, the methods insert at least one repair template into a safe harbor site (SHS). In some embodiments, the methods insert a least one repair template comprising a repair template or HDR template into the SHS. In some embodiments, the repair template encodes a full-length transgene or a fragment of the transgene. In some embodiments, the methods can insert a repair template encoding full length Cadherin or Catenin. In some embodiment, the transgene gene can be a reporter for diagnosing a disease or condition described herein.

[0094] In some embodiments, the methods described herein increase a HDR editing rate in a plurality of the cells contacted with Cas9 fusion protein compared to a HDR editing rate induced by a conventional or wild type Cas9 in a comparable plurality of cells. In some embodiments, the HDR editing rate induced by the Cas9 fusion protein is increased by least 10%, at least 50%, at least 100%, at least 200%, at least 300%, or more compared the HDR editing rate induced by the conventional or the wild type Cas9.

[0095] In some embodiments, the methods described herein increase a HDR editing rate in a plurality of the cells contacted with Cas9 fusion protein (e.g., any one of the Cas9-HR) compared to a HDR editing rate induced by a conventional or wild type Cas9 in a comparable plurality of cells. In some embodiments, the HDR editing rate induced by the Cas9 fusion protein is increased by least 10%, at least 50%, at least 100%, at least 200%, at least 300%, or more compared the HDR editing rate induced by the conventional or the wild type Cas9.

[0096] In some embodiments, the methods described herein increase cell viability in a plurality of the cells contacted with Cas9 fusion protein (e.g., any one of the Cas9-HR) compared to cell viability of a comparable plurality of cells contacted a conventional or wild type Cas9 in. In some embodiments, the cell viability of the plurality of cells contacted with the Cas9 fusion protein is increased by least 10%, at least 50%, at least 100%, at least 200%, at least 300%, or more compared the cell viability of the comparable plurality of cells contacted the conventional or the wild type Cas9.

[0097] In some embodiments, the methods described herein decrease cellular toxicity in a plurality of the cells contacted with Cas9 fusion protein (e.g., any one of the Cas9-HR) compared to cellular toxicity of a comparable plurality of cells contacted a conventional or wild type Cas9 in. In some embodiments, the cellular toxicity of the plurality of cells contacted with the Cas9 fusion protein is increased by least 10%, at least 50%, at least 100%, at least 200%, at least 300%, or more compared the cellular toxicity of the comparable plurality of cells contacted the conventional or the wild type Cas9.

[0098] In some embodiments, the methods described here comprises isolating an edited cell produced by the methods described herein and propagating the cell to produce a population of edited cells. The edit can comprise an edited genomic region of at least 1000 nucleotides, at least 1500 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 3500 nucleotides, at least 4000 nucleotides, at least 4500 nucleotides, at least 5000 nucleotides, at least 5500 nucleotides, at least 6000 nucleotides, at least 6500 nucleotides, at least 7000 nucleotides, at least 7500 nucleotides, at least 8000 nucleotides, at least 8500 nucleotides, at least 9000 nucleotides, at least 9500 nucleotides, at least 10000 nucleotides, at least 11000 nucleotides, at least 12000 nucleotides, at least 15000 nucleotides, or more nucleotides in length.

[0099] In some embodiments, the methods described herein decrease endogenous p53 signaling in a cell contacted with Cas9 fusion protein (e.g., any one of the Cas9-HR) compared to endogenous p53 signaling of a comparable cell contacted with a conventional or wild type Cas9. In some embodiments, the endogenous p53 signaling in the cell contracted with the Cas9 fusion protein is decreased by at least 10%, at least 50%, at least 100%, at least 200%, at least 300%, or more compared to the endogenous p53 of the comparable cell contacted with the conventional or wild type Cas9. In some embodiments, the decreased p53 signaling as induced by the Cas9 fusion protein (e.g., any one of the Cas9-HR) leads to an increase of cellular viability. In some embodiments, the decreased p53 signaling as induced by the Cas9 fusion protein (e.g., any one of the Cas9-HR) leads to a decrease of cellular toxicity. In some embodiments, the decreased p53 signaling as induced by the Cas9 fusion protein (e.g., any one of the Cas9-HR) leads to an increase of the HDR rate. In some embodiments, the decreased p53 signaling as induced by the Cas9 fusion protein (e.g., any one of the Cas9-HR), when combined with the modification of the genomic locus induced by the method described herein, can decrease cellular proliferation. In some embodiments, the decreased p53 signaling as induced by the Cas9 fusion protein (e.g., any one of the Cas9-HR), when combined with the modification of the genomic locus induced by the method described herein, can decrease cellular migration such as metastasis.

Methods of Treatment

[00100] Disclosed herein, in some embodiments, are methods for treating a disease or condition by inserting at least one repair template into a genomic locus via the use of the Cas fusion protein (e.g., any one of Cas9-HR described herein) or a Cas protein. In some embodiments, the methods comprise contacting a cell with the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof to correct at least one mutation encoded by the genomic locus. In some embodiments, the methods comprise making one cleavage in a region and a second cleavage in a second region in a genomic locus for replacing the cleaved genomic region with a repair template. In some embodiments, the cleaved region and the second cleaved region are spaced by at least one 1000 bp, by at least one 2000 bp, by at least one 3000 bp, by at least one 4000 bp, by at least one 5000 bp, by at least one 6000 bp, by at least one 7000 bp, by at least one 8000 bp, by at least one 9000 bp, by at least one 10000 bp, by at least one 15000 bp, by at least one 20000 bp, or more bp apart. In some embodiments, the genomic locus encodes a gene associated with the disease or condition. In some embodiments, the methods comprise administering the Cas fusion protein, Cas protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof to a subject in need thereof. In some embodiments, the methods comprise editing a cell with the Cas fusion protein, Cas protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof to generate an edited cell and then subsequently administering the edited cell to the subject. In some embodiments, the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell can be formulated into a pharmaceutical formulation to be administered to the subject.

[00101] In some embodiments, the Cas fusion protein, Cas protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation can be administered to the subject alone (e.g., standalone treatment). In some embodiments, the Cas fusion protein, Cas protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation is administered in combination with an additional agent. In some cases, the additional agent as used herein is administered alone. In some embodiments, the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation and the additional agent can be administered together or sequentially as a combination therapy. In some embodiments, the combination therapy can be administered within the same day, or can be administered one or more days, weeks, months, or years apart. In some embodiments, the additional agent is a p53 inhibitor.

[00102] In some embodiments, the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation is a first-line treatment for the disease or condition. In some embodiments, the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation is a second-line, or third-line, or fourth-line treatment. In some embodiments the edited cell or the pharmaceutical formulation comprises at least one, two, three, four, five, six, seven, eight, nine, 10, 20, 30 or more guide polynucleotides or polynucleotides of interest. In some embodiments, the methods comprise administering the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation by intravenous (“I. V ”) administration. In some embodiments, the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation disclosed herein may be administered by other routes, such as subcutaneous injection, intramuscular injection, intradermal injection, transdermal injection percutaneous administration, intranasal administration, intralymphatic injection, rectal administration intragastric administration, or any other suitable parenteral administration. In some embodiments, routes for local delivery closer to site of injury or inflammation may be preferred over systemic routes. Routes, dosage, time points, and duration of administrating therapeutics can be adjusted. In some embodiments, administration of therapeutics is prior to, or after, onset of either, or both, acute and chronic symptoms of the disease or condition.

[00103] Suitable dose and dosage administrated to a subject is determined by factors including, but not limited to, the particular Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation, disease condition and its severity, the identity (e.g., weight, sex, age) of the subject in need of treatment, and can be determined according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, the condition being treated, and the subject being treated.

[00104] In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein is hourly, once every 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, or 5 years, or 10 years. In some embodiments, the effective dosage ranges may be adjusted based on subject’s response to the treatment. In some embodiments, some routes of administration may require higher concentrations of effective amount of therapeutics than other routes.

[00105] In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein increases survival rate of the subject by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, or more. In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein at a dose that increases survival rate of the subject by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, or more. In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein at a schedule that increases survival rate of the subject by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, or more. In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein at a dose and a schedule that increase survival rate of the subject by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, or more.

[00106] In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein inhibits growth of the tumor by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, or more. In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein at a dose that inhibits growth of the tumor by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, or more. In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein at a schedule that inhibits growth of the tumor by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, or more. In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein at a dose and a schedule that inhibits growth of the tumor by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, or more.

[00107] In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, an edited cell, or a pharmaceutical formulation described herein to the subject is at a dose that is sufficient to treat a disease or disorder, e.g., inhibit growth of a tumor. In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein to the subject is at a schedule that is sufficient to treat a disease or disorder, e.g., inhibit growth of a tumor. In some embodiments, the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation described herein to the subject is at a dose and a schedule that are sufficient to treat a disease or disorder, e.g., inhibit growth of a tumor.

[00108] In some embodiments, where the subject’s condition does not improve, upon the doctor’s discretion the administration of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, an edited cell, or a pharmaceutical formulation described herein may be administered chronically, that is, for an extended period of time, including throughout the duration of the subject’s life in order to ameliorate or otherwise control or limit the symptoms of the subject’s disease or condition. In some embodiments, where a subject’s status does improve, the dose of the Cas fusion protein, Cas fusion protein complex, guide polynucleotide, repair template, or a combination thereof, or the edited cell, or the pharmaceutical formulation being administered can be temporarily decreased or temporarily suspended for a certain length of time (i.e., a “drug diversion”). In specific embodiments, the length of the drug diversion is between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or more than 28 days. The dose reduction during a drug diversion is, by way of example only, by 10%-100%, including by way of example only 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%. In some embodiments, the dose of the pharmaceutical formulation being administered can be temporarily decreased or temporarily suspended for a certain length of time (i.e., a “drug diversion”).

[00109] In some embodiments, once improvement of the subject’s conditions has occurred, a maintenance dose is administered if necessary. Subsequently, in some embodiments, the dosage, or the frequency of administration, or both, is decreased, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained. In some embodiments, however, the subject requires intermittent treatment on a long-term basis upon any recurrence of symptoms.

[00110] In some embodiments, toxicity and therapeutic efficacy of therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 and the ED50. The dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50. In some embodiments, the data obtained from cell culture assays and animal studies are used in formulating the therapeutically effective daily dosage range and/or the therapeutically effective unit dosage amount for use in mammals, including humans. In some embodiments, the daily dosage amount of the composition described herein lies within a range of circulating concentrations that include the ED50 with minimal toxicity. In some embodiments, the daily dosage range and/or the unit dosage amount varies within this range depending upon the dosage form employed and the route of administration utilized.

[00111] In some embodiments, the disease or condition described herein is a cancer. In some embodiments, the cancer is associated with S0S1. In some embodiments, the cancer is associated with S0S2. In some embodiments, the cancer is associated with KRAS. In some embodiments, the cancer is associated with an abnormality of KRAS-mediated signaling pathway. In some embodiments, the cancer is a lung cancer, a pancreatic cancer, or a colon cancer. Other non-limiting examples of the cancer can include Acute Lymphoblastic Leukemia, Acute Lymphocytic Leukemia (ALL), Acute Myeloid Leukemia (AML), Adenoid Cystic Carcinoma, Adrenal Gland Cancer, Adrenocortical Carcinoma, Adult Leukemia, AIDS-Related Lymphoma, Amyloidosis, Anal Cancer, Astrocytomas, Ataxia Telangiectasia, Atypical Mole Syndrome, Atypical Teratoid/Rhabdoid Tumor, Basal Cell Carcinoma, Bile Duct Cancer, Birt Hogg Dube Syndrome, Bladder Cancer, Bone Cancer, Brain Tumor, Breast Cancer, Bronchial Tumors, Burkitt Lymphoma, Carcinoid Tumor (Gastrointestinal), Carcinoma of Unknown Primary, Cardiac (Heart) Tumors, Cervical Cancer, Cholangiocarcinoma, Chordoma, Chronic Lymphocytic Leukemia (CLL), Chronic Myelogenous Leukemia, Chronic Myeloid Leukemia, Chronic Myeloproliferative Neoplasms, Colorectal Cancer, Craniopharyngioma, Cutaneous T- Cell Lymphoma, Ductal Carcinoma, Embryonal Tumors, Endometrial Cancer, Ependymoma, Esophageal Cancer, Esthesioneuroblastoma, Ewing Sarcoma, Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Eye Cancer, Fallopian Tube Cancer, Fibrous Histiocytoma of Bone, Malignant, and Osteosarcoma, Gallbladder Cancer, Gastric Cancer, Gastrointestinal Carcinoid Tumor, Gastrontestinal Stromal Tumor (GIST), Germ Cell Tumors, Gestational Trophoblastic Disease, Hairy Cell Leukemia, Head and Neck Cancer, Hepatocellular Cancer, HER2 -Positive Breast Cancer, Histiocytosis, Langerhans Cell, Hodgkin's Lymphoma, Hypopharyngeal Cancer, Intraocular Melanoma, Islet Cell Tumor, Juvenile Polyposis Syndrome, Kaposi Sarcoma, Kidney Cancer, Langerhans Cell Histiocytosis, Laryngeal Cancer, Leukemia, Lip and Oral Cavity Cancer, Liver Cancer, Lobular Carcinoma, Lung Cancer (NonSmall Cell and Small Cell), Lymphoma, Malignant Fibrous Histiocytoma of Bone and Osteosarcoma, Malignant Glioma, Melanoma, Intraocular Melanoma, Meningioma, Merkel Cell Carcinoma, Mesothelioma, Malignant, Metastatic Cancer, Metastatic Squamous Neck Cancer with Occult Primary, Midline Tract Carcinoma, Multiple Endocrine Neoplasia Syndromes, Multiple Myeloma, Plasma Cell Neoplasms, Mycosis Fungoides, Myelodysplastic Syndrome (MDS), Myeloproliferative Neoplasms, Chronic, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Neuroendocrine Tumor, Non-Hodgkin Lymphoma, Oral Cancer, Lip and Oral Cavity Cancer and Oropharyngeal Cancer, Oropharyngeal Cancer, Osteosarcoma, Ovarian Cancer, Ovarian Germ Cell Tumors, Pancreatic Cancer, Pancreatic Neuroendocrine Tumors, Papillomatosis, Paraganglioma, Paranasal Sinus and Nasal Cavity Cancer, Parathyroid Cancer, Penile Cancer, Peritoneal Cancer, Peutz-Jeghers Syndrome, Pharyngeal Cancer, Pheochromocytoma, Pituitary Tumor, Plasma Cell Neoplasm/Multiple Myeloma, Pleuropulmonary Blastoma, Polycythemia Vera, Pregnancy and Breast Cancer, Primary Central Nervous System (CNS) Lymphoma, Primary Peritoneal Cancer, Prostate Cancer, Rectal Cancer, Recurrent Cancer, Renal Cell Carcinoma, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Sarcoma, Sezary Syndrome, Skin Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Solid tumor, Squamous Cell Carcinoma of the Skin, Squamous Neck Cancer with Occult Primary, Metastatic, Stomach Cancer, T-Cell Lymphoma, Testicular Cancer, Throat Cancer, Thymoma, Thymic Carcinoma, Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Ureter, Unusual Cancers of Childhood, Ureter and Renal Pelvis, Transitional Cell Cancer, Urethral Cancer, Uterine (Endometrial) Cancer, Uterine Sarcoma, Vaginal Cancer, Vascular Tumors, Vulvar Cancer, Wilms Tumor, or a combination thereof.

[00112] In some embodiments, the disease or condition described herein is hyperphenylalaninemia or PKU. In some embodiments, the hyperphenylalaninemia or PKU is associated with phenylalanine hydroxylase (PAH).

[00113] In some embodiments, the disease or condition described herein is hemophilia. In some embodiments, the hemophilia is associated with Factor VIII or Factor IX.

[00114] In some embodiments, the disease or condition described herein is hypercholesterolemia. In some embodiments, the hemophilia is associated with apolipoprotein B (ApoB).

[00115] In some embodiments, the disease or condition described herein is a kidney disease such as polycystic kidney disease . In some embodiments, kidney disease is associated with poly cystin 1 (PKD1) or poly cystin 2 (PKD2).

Pharmaceutical formulation

[00116] Described herein, in some embodiments, are pharmaceutical formulations. In some embodiments, a pharmaceutical formulation comprises the fusion protein, the guide polynucleotide, the repair template (e.g., a repair template,) or combinations thereof. In some embodiments, the pharmaceutical formulation comprises a cell edited with the fusion protein described herein. Exemplary cells (with ATCC cell line number) that can be edited and formulated into the pharmaceutical formulation can include Embryonic Stem Cells: SRC -2002; Dermal Fibroblasts: PCS-201-010; Mixed Renal Epithelial: PCS-400-012; Corneal Cells: PCS- 700-010; Bladder smooth muscle cells: PCS-420-012; Lobar Epithelial Cells: PCS-300-015; Primary Epithelial Cells: PCS-600-010; Adipose derived Mesenchymal Stem Cells: PSC-500- 011; Primary Subcutaneous Pre-adipocytes: PCS-210-010; Aortic Endothelial Cells: PCS-100- 011; Epidermal Keratinocytes: PCS-200-010; Gingival Keratinocytes: PCS-200-014; Epidermal Melanocytes: PCS-200-012; Coronary Artery Smooth Muscle Cells: PCS-100-021; Lung Smooth Muscle Cells: PCS-130-010; and CD34+: PCS-800-012.

[00117] In some embodiments, the pharmaceutical formulation further comprises one or more of the following: a carrier, an excipient, a diluent, a nebulized inhalant, or combinations thereof. In some embodiments, the pharmaceutical formulation includes one or more active agents. In some embodiments, an active agent comprises a Cas fusion protein. In some embodiments, an active agent comprises a repair template. In some embodiments, an active agent comprises a guide polynucleotide. In some embodiments, the pharmaceutical formulation includes two or more active agents. In some embodiments, the two or more active agents are contained in a single dosage unit. In some embodiments, the two or more active agents are contained in separate dosage units. In some embodiments, practicing the methods of treatment provided herein may result in therapeutically effective amounts of a pharmaceutical formulation being administered to a mammal having a disease, disorder, or condition to be treated. In some embodiments, the mammal is a human. In some embodiments, a therapeutically effective amount may vary widely depending on the severity of the disease, the age and relative health of the subject, the potency of the therapeutic agent used and other factors. The therapeutic agents, and in some cases, compositions described herein, may be used singly or in combination with one or more therapeutic agents as components of mixtures.

[00118] The pharmaceutical formulations described herein may be administered to a subject by appropriate administration routes, including but not limited to, intravenous, intraarterial, oral, parenteral, buccal, topical, transdermal, rectal, intramuscular, subcutaneous, intraosseous, transmucosal, inhalation, or intraperitoneal administration routes. The pharmaceutical formulations described herein may include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate and controlled release formulations.

[00119] The pharmaceutical formulation may be manufactured in a conventional manner. In some embodiments, the pharmaceutical formulation may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or compression processes.

[00120] The pharmaceutical formulation may include at least an exogenous therapeutic agent as an active ingredient in free-acid or free-base form, or in a pharmaceutically acceptable salt form. In addition, the methods and compositions described herein may include the use of N- oxides (if appropriate), crystalline forms, amorphous phases, as well as active metabolites of these compounds having the same type of activity. In some embodiments, therapeutic agents may exist in unsolvated form or in solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like. The solvated forms of the therapeutic agents are also considered to be disclosed herein.

[00121] In some embodiments, the pharmaceutical formulations provided herein include one or more preservatives to inhibit microbial activity. In some embodiments, suitable preservatives include mercury-containing substances such as merfen and thiomersal; stabilized chlorine dioxide; and quaternary ammonium compounds such as benzalkonium chloride, cetyltrimethylammonium bromide and cetylpyridinium chloride. [00122] In some embodiments, the pharmaceutical formulations described herein benefit from antioxidants, metal chelating agents, thiol containing compounds and other general stabilizing agents. In some embodiments, stabilizing agents include, but are not limited to: (a) about 0.5% to about 2% w/v glycerol, (b) about 0.1% to about 1% w/v methionine, (c) about 0.1% to about 2% w/v monothioglycerol, (d) about 1 mM to about 10 mM EDTA, I about 0.01% to about 2% w/v ascorbic acid, (f) 0.003% to about 0.02% w/v polysorbate 80, (g) 0.001% to about 0.05% w/v. polysorbate 20, (h) arginine, (i) heparin, (j) dextran sulfate, (k) cyclodextrins, (1) pentosan polysulfate and other heparinoids, (m) divalent cations such as magnesium and zinc; or (n) combinations thereof.

[00123] In some embodiments, the pharmaceutical formulations may be in a unit dose form. In some embodiments, the pharmaceutical formulations may be formulated into any suitable dosage form, including but not limited to, aqueous oral dispersions, liquids, gels, syrups, elixirs, slurries, suspensions, solid oral dosage forms, aerosols, controlled release formulations, fast melt formulations, effervescent formulations, lyophilized formulations, tablets, powders, pills, dragees, capsules, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate release and controlled release formulations. In some embodiments, the pharmaceutical formulation may be formulated for parenteral, intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, intracerebral, subarachnoid, intraocular, intrasternal, ophthalmic, endothelial, local, intranasal, intrapulmonary, rectal, intraarterial, intrathecal, inhalation, intralesional, intradermal, epidural, intracapsular, subcapsular, intracardiac, transtracheal, subcuticular, subarachnoid, or intraspinal administration. In some embodiments, a therapeutic agent as discussed herein, e.g., therapeutic agent is formulated into a pharmaceutical formulation suitable for intramuscular, subcutaneous, or intravenous injection. In some embodiments, formulations suitable for intramuscular, subcutaneous, or intravenous injection include physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, and sterile powders for rehydration into sterile injectable solutions or dispersions. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (propyleneglycol, polyethylene-glycol, glycerol, cremophor and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. In some embodiments, proper fluidity may be maintained by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In some embodiments, formulations suitable for subcutaneous injection may also contain additives such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the growth of microorganisms may be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. In some embodiments, it is desirable to include isotonic agents, such as sugars, sodium chloride, and the like. In some embodiments, prolonged absorption of the injectable pharmaceutical form may be brought about by the use of agents delaying absorption, such as aluminum monostearate and gelatin. [00124] In some embodiments, for intravenous injections or drips or infusions, a pharmaceutical formulation is formulated in aqueous solutions. In some embodiments, a pharmaceutical formulation is formulated in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological saline buffer. In some embodiments, penetrants appropriate to the barrier to be permeated are used in formulations for transmucosal administration. Such penetrants are generally known in the art. For other parenteral injections, appropriate formulations include aqueous or nonaqueous solutions, preferably with physiologically compatible buffers or excipients. Such excipients are known.

[00125] In some embodiments, parenteral injections may involve bolus injection or continuous infusion, pharmaceutical formulation for injection may be presented in unit dosage form, e.g., in ampoules or in multi dose containers, with an added preservative. In some embodiments, the pharmaceutical formulation may be in a form suitable for parenteral injection, including but not limited to sterile suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. In some embodiments, the active ingredient is in powder form for constitution with a suitable vehicle before use. In some embodiments, the suitable vehicle comprises sterile pyrogen-free water. [00126] In some embodiments, a pharmaceutical formulation is administered by inhalation. In some embodiments, a pharmaceutical formulation administered by inhalation is formulated for use as an aerosol, a mist, or a powder. In some embodiments, the pharmaceutical formulations described herein may be delivered in the form of an aerosol spray presentation from pressurized packs or nebulizers with the use of a suitable propellant. In some embodiments, a suitable propellant comprises dichlorodifluoromethane, trichlorofluoromethane, di chlorotetrafluoroethane, carbon dioxide or other suitable gasses. In some embodiments, the aerosol may be pressurized. In some embodiments, a pressurized aerosol may have the dosage unit be determined by providing a valve to deliver a metered amount. In some embodiments, the pharmaceutical formulation may be administered by way of capsules or cartridges. In some embodiments, capsules or cartridges of gelatin may be used in an inhaler or insufflator. In some embodiments, capsules or cartridges may be formulated containing a powder mix of the therapeutic agent described herein and a suitable powder base such as lactose or starch. In some embodiments, formulations that include a pharmaceutical formulation may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, fluorocarbons, and/or other solubilizing or dispersing agents known in the art. Preferably these compositions and formulations are prepared with suitable nontoxic pharmaceutically acceptable ingredients. In some embodiments, the choice of suitable carriers is dependent upon the exact nature of the nasal dosage form desired, e.g., solutions, suspensions, ointments, or gels. In some embodiments, nasal dosage forms contain large amounts of water in addition to the active ingredient. In some embodiments, minor amounts of other ingredients such as pH adjusters, emulsifiers or dispersing agents, preservatives, surfactants, gelling agents, or buffering and other stabilizing and solubilizing agents may be present. Preferably, the nasal dosage form should be isotonic with nasal secretions.

[00127] Pharmaceutical preparations for oral use may be obtained by mixing one or more solid excipients with one or more of the pharmaceutical formulations described herein, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. In some embodiments, suitable excipients may include fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methylcellulose, microcrystalline cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose; or others such as: polyvinylpyrrolidone (PVP or povidone) or calcium phosphate. In some embodiments, disintegrating agents may be added, such as the cross linked croscarmellose sodium, polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. In some embodiments, dyestuffs or pigments are added to the tablets or dragee coatings for identification or to characterize different combinations of active therapeutic agent doses.

[00128] Conventional formulation techniques include, e.g., one or a combination of methods: (1) dry mixing, (2) direct compression, (3) milling, (4) dry or non-aqueous granulation, (5) wet granulation, or (6) fusion. Other methods include, e.g., spray drying, pan coating, melt granulation, granulation, fluidized bed spray drying or coating (e.g., wurster coating), tangential coating, top spraying, tableting, extruding and the like.

[00129] In some embodiments, pharmaceutical formulation can be provided that include particles of a therapeutic agent and at least one dispersing agent or suspending agent for oral administration to a subject. The formulations may be a powder and/or granules for suspension, and upon admixture with water, a substantially uniform suspension may be obtained.

[00130] In some embodiments, the pharmaceutical formulation may include one or more pH adjusting agents or buffering agents, including acids such as acetic, boric, citric, lactic, phosphoric, and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris- hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.

[00131] In some embodiments, the pharmaceutical formulation may include one or more salts in an amount required to bring osmolality of the composition into an acceptable range. In some embodiments, these salts comprise those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate, or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.

[00132] In some embodiments, the pharmaceutical formulation may include one or more preservatives to inhibit microbial activity. Suitable preservatives comprise mercury-containing substances such as merfen and thiomersal; stabilized chlorine dioxide; and quaternary ammonium compounds such as benzalkonium chloride, cetyltrimethylammonium bromide and cetylpyridinium chloride.

[00133] In some embodiments, the pharmaceutical formulation described herein comprises at least one additional active agent other than the enucleated cell described herein. In some embodiments, the at least one additional active agent is a chemotherapeutic agent, cytotoxic agent, cytokine, growth-inhibitory agent, anti-hormonal agent, anti-angiogenic agent, cardio protectant, and/or checkpoint inhibitor.

Kit

[00134] Described herein are kits for using the compositions described herein. In some embodiments, the kits disclosed herein may be used to treat a disease or condition in a subject. In some embodiments, the kits comprise an assemblage of materials or components apart from the composition. In some embodiments, the kits comprise one or more of: the Cas fusion protein, the repair template, or the guide polynucleotide. In some embodiments, the kits comprise a pharmaceutical formulation or pharmaceutical formulation.

[00135] In some embodiments, the kits comprise components for synthesizing the constructs or vectors described herein for encoding the fusion protein, guide polynucleotide, repair template (e.g., a repair template), or a combination thereof. In some embodiments, the kits comprise components for delivering the constructs or vectors described herein into a cell. In some embodiments, the kits comprise components for selecting for a homogenous population of the edited cells. In some embodiments, the kits comprise components for selecting for a heterogenous population of the edited cells. In some embodiments, the kits comprise components for performing assays such as enzyme-linked immunosorbent assay (ELISA), single-molecular array (Simoa), PCR, and qPCR. The exact nature of the components configured in the kit depends on its intended purpose. For example, some embodiments are configured for the purpose of treating a disease or condition disclosed herein (e.g., cancer) in a subject. In some embodiments, the kits may be configured for the purpose of treating mammalian subjects. In some embodiments, the kit may be configured for the purpose of treating human subjects.

[00136] In some embodiments, instructions for use may be included in the kit. In some embodiments, the instructions describe the methods described herein. In some embodiments, the kit comprises instructions for administering the composition to a subject in need thereof. In some embodiments, the kit comprises instructions for further engineering the composition to express a biomolecule (e.g., the fusion protein described herein). In some embodiments, the kit comprises instructions thawing or otherwise restoring biological activity of the composition, which may have been cryopreserved, lyophilized, or cryo-hibernated during storage or transportation. In some embodiments, the kit comprises instructions for measure viability of the restored compositions, to ensure efficacy for its intended purpose (e.g., therapeutic efficacy if used for treating a subject).

[00137] In some embodiments, the kit may also contain other useful components, such as, diluents, buffers, pharmaceutically acceptable carriers, syringes, catheters, applicators, pipetting or measuring tools, bandaging materials, or other useful paraphernalia. In some embodiments, the materials or components assembled in the kit may be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility. In some embodiments, the components may be in dissolved, dehydrated, or in lyophilized form. In some embodiments, the components may be provided at room, refrigerated or frozen temperatures. In some embodiments, the components are contained in suitable packaging material(s).

[00138] Use of absolute or sequential terms, for example, “will,” “will not,” “shall,” “shall not,” “must,” “must not,” “first,” “initially,” “next,” “subsequently,” “before,” “after,” “lastly,” and “finally,” are not meant to limit scope of the present embodiments disclosed herein but as exemplary.

[00139] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”

[00140] As used herein, the phrases “at least one”, “one or more”, and “and/or” are open-ended expressions that are both conjunctive and disjunctive in operation. For example, each of the expressions “at least one of A, B and C”, “at least one of A, B, or C”, “one or more of A, B, and C”, “one or more of A, B, or C” and “A, B, and/or C” means A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B and C together.

[00141] As used herein, “or” may refer to “and”, “or,” or “and/or” and may be used both exclusively and inclusively. For example, the term “A or B” may refer to “A or B”, “A but not B”, “B but not A”, and “A and B”. In some cases, context may dictate a particular meaning. [00142] Any systems, methods, software, and platforms described herein are modular. Accordingly, terms such as “first” and “second” do not necessarily imply priority, order of importance, or order of acts.

[00143] The term “about” when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and the number or numerical range may vary from, for example, from 1% to 15% of the stated number or numerical range. In examples, the term “about” refers to ±10% of a stated number or value.

[00144] The terms “increased”, “increasing”, or “increase” are used herein to generally mean an increase by a statically significant amount. In some embodiments, the terms “increased,” or “increase,” mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, standard, or control. Other examples of “increase” include an increase of at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 1000-fold or more as compared to a reference level.

[00145] The terms “decreased”, “decreasing”, or “decrease” are used herein generally to mean a decrease by a statistically significant amount. In some embodiments, “decreased” or “decrease” means a reduction by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g., absent level or non-detectable level as compared to a reference level), or any decrease between 10-100% as compared to a reference level. In the context of a marker or symptom, by these terms is meant a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given disease.

[00146] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the invention be limited by the specific examples provided within the specification. While the invention has been described with reference to the aforementioned specification, the descriptions and illustrations of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. Furthermore, it shall be understood that all aspects of the invention are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is therefore contemplated that the invention shall also cover any such alternatives, modifications, variations, or equivalents. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

EXAMPLES

Example 1. Cas9-HR mediated HDR

[00147] Cas9 fusion protein (Cas9-HR) can increase rate of HDR during gene editing. Fig. 1 illustrates an exemplary experiment design and workflow for gene editing (e.g., homology directed repair or HDR) by a Cas9 or a Cas9 fusion described herein (e.g., a Cas9-HR; diagram showing Cas9 fusion with hExol, NLS sequences, and peptide linkers being black lines). Either lipofectamine or electroporation were used for all experiments. HDR rates were assayed at ~5 and/or ~14 days post-transfection Fluorescence-based HDR assays. All results were validated via deep-sequencing as well as assayed for off-target editing and integration. Fig. 2 illustrates increased insertion of transgene via HDR at multiple safe harbor sites (SHS). A549 cells transfected with Cas9-HR with various SHS-231 guides showed decreased cellular toxicity compared to Cas9 (left panel). An mNeon transgene was knocked into the SHS-231 locus using either Cas9-HR or Cas9. Imaging at 14 days post-transfection showed Cas9-HR generated ~3.5x fluorescent cells compared to Cas9 (right panel). Fig. 3 illustrates increased insertion of transgene via HDR, where larger transgene exhibited increased insertion rates. Quantification of individual cellular fluorescence levels showed no discernable difference between Cas9-HR and Cas9 indicating the increases in fluorescent cells were due to increase in HDR rates rather than non-specific integration or difference in absolute cell count. Fig. 4 illustrates HDR increased scale with insertion size. Preliminary results from insertion of a larger (~3.3kb) fluorescent transgene indicated that Cas9-HR facilitates a ~2.5x increase in HDR when inserting cAMPr transgene in H1299 cells. H1299 Cells were transfected using Lipofectamine 3000 and 500ng of pUC19-pCAG-Cas9-HR or pUC19-pCAG-Cas9 combined with 500ng of pU6-SHS-231-G3 and 50ng of SHS-231-pCAG-cAMPr linear repair template. Cells were grown for 14 days, then imaged using an epiflourescent microscope. Cells were quantified using FIJI, Cas9-HR showed -2.5X increase in fluorescent cells compared to Cas9. This experiment demonstrated that Cas9- HR’s ability to increase HDR “scales” with increasing edit size, which is particularly important for future therapeutic applications.

[00148] Fig. 5 illustrates independent assay of Cdhl tagged with mCherry showing Cas9-HR- mediated HDR increase. Independent assay of Cdhl tagged with mCherry shows Cas9-HR- mediated HDR increase (left panel). Independent assay of Cdhl tagged with mCherry shows Cas9-HR-mediated HDR increase (right panel). Fig. 6 illustrates Cas9-HR mediated integration was indistinguishable from Cas9. Sequencing of insertional junctions in H1299 cells edited with Cas9-HR or Cas9 showed no discernable differences. These results confirmed proper insertion of mCherry, maintenance of reading frame, and lack of detectable changes to flanking genomic sequences. Fig- 7 illustrates Cas9-HR increased HDR rates for endogenous fluorescent tags. Cas9-HR gave 2-2.5X increases in HDR in both H1299 and HEK293 cells, further confirming Cas9-HRs improved rates of HDR at an independent insertion site and guides. Fig. 8 illustrates that endogenously tagged gene’s fluorescence localization and intensity was dependent upon fusion partner. B-Catenin and Cdhl were membrane localized, with some putative nuclear localization in HEK293 cells for B-Catenin. Cells where LMNA was tagged with mCherry instead showed a different localization pattern, as expected as LMNA is localized to the nuclear membrane.

[00149] Fig. 9 illustrates Cas9-HR knock-in payloads up to 8kb. Western blot assay probed for anti-Cas9 demonstrated long term stable expression of proper sized Cas9-HR protein in CHO cells.

[00150] Fig. 10 illustrates Cas9-HR increased HDR rates in clinically relevant primary cells. Insertion of an mNeon transgene at SHS-231 using Cas9-HR showed a ~2x increase in HDR editing rates in Human Liver Stem Cells (hLSCs) compared to Cas9. CHO cells were transfected using Lipofectamine 3000, and 500ng of pUC19-pCAG-Cas9-HR, pU6-SHS-2 guide, and 40ng of SHS-2-pCAG-Cas9-HR-IRES-PuroR repair template. After two days, selection was initiated using Puromycin at 10 ug/mL for 14 days, after which selection was stopped. 24 days post-transfection —1/2 of cells were harvested, and total soluble protein subsequently extracted, which was then probed for Cas9-HR expression via anti-Cas9 western blot. Transfected CHO cells showed expected 200kD size band indicating stable integration and expression of the Cas9-HR transgene, control un-transfect CHO cells showed detectable staining, with recombinant Cas9 used to demonstrate expected size shift of Cas9-HR compared to Cas9. These experiments demonstrated that Cas9-HR inserted very large (~8kb) payloads into CHO cells and that expression from those insertions was stable. Fig. 11 illustrates Cas9-HR HDR summary. Cas9-HR showed significant increases in HDR editing rates across a variety of cell types, genomic loci, and multiple independent assays. Cas9-HR showed dramatic HDR increases for insertions/edits ranging from 750 to 3,300 bp. Cas9-HR also was able to knock-in a large (~8kb) transgene, which showed stable protein expression after ~1 month of constant culture. Cas9-HR show’s similar behavior for guide site performance as Cas9, simply increases efficiency, indicating great potential for plug-and-play possibilities for current protocols. Finally, Cas9-HR showed significant increases in HDR rates in clinically relevant primary cells. Primary Human Liver Stem Cells (hLSCs) were transfected with a Lonza 4D Nucleofector using an inhouse-optimized transfection protocol. Briefly, -200,000 cells were electroporated with 250ng of pUC19-pCAG-Cas9-HR or pUC19-pCAG-Cas9 combined with 250ng of pU6- SHS-231-G3 and 50ng of SHS-231-pCAG-mNeon repair template. Importantly, cells were incubated at room-temperature in the electroporation buffer for -45 minutes post-transfection, after which the cells were plated, grown for 6 days, and imaged using a Cytation5 fluorescent microscope. HDR events were quantified as previously described, two biological replicates were performed for each treatment. These experiments are particularly important as they demonstrate improvement of HDR rates in a clinically relevant cell type along with a (potentially) clinically relevant target and editing strategy. Translation of efficacy from cancer cell lines to primary cells are not always seen, therefore demonstrating increased Cas9-HR HDR rates is a significant milestone on the road to therapeutic applications.

[00151] Fig. 12 illustrates that Cas9-HR significantly decreases on-target INDEL rates. Preliminary INDEL experiments targeting AAVS1 was performed using the TIDE assay. Increased Cas9-HR-mediated HDR rates had been demonstrated in AAVS1. Cas9-HR showed significantly decreased on INDEL rate formation (-60% reduction). H1299 cells were transfected using Lipofectamine 3000 and 500ng of pUC19-pCAG-Cas9-HR, pUC19-pCAG- Cas9 or pUC19-pCAG-mNeon combined with 500ng of pU6-AAVSl-Gl . Cells were grown for two days, then genomic DNA was harvested using Zymo Quick-DNA Microprep kit following the manufactures instructions. Genomic DNA from each treatment was then amplified using primers (oCH540 + oCH541; oCH542 + oCH543) and sent for sanger sequencing. INDEL analysis was performed using the online TIDE analysis program following standard procedures, and three independent biological replicates were performed for each treatment. Raw INDEL rates were -25% for Cas9 treated cells, and -10% for Cas9-HR, equating to roughly a 60% decrease in on-target INDEL rate. As expected, if Cas9-HR increased HDR rates, INDEL rates should consequently be decreased, indicating Cas9-HR was behaving as expected. This also indicated that off-target INDEL generation was also likely significantly decreased compared to Cas9 and was an additional advantage to the Cas9-HR platform. INDEL sites were detected based on primers as shown in Table 1.

Table 1. Primer sequence for detecting INDEL sites

[00152] Fig. 13 illustrates that Cas9-HR decreases cellular toxicity in p53+ cells at sites with increased HR. Cas9-HR decreased toxicity at multiple independent genomic loci in cells with active p53 pathways (A549 cells). This reduction in toxicity was dependent on covalent linkage of Exol domain and Cas9 (simply overexpressing Exol is not sufficient to decrease toxicity). The cellular toxicity seen was dependent on p53 activity, as treatment with the cell permeable p53 antagonist a-Pifithrin increases cellular viability by 1.75X compared to solvent treatment. Cas9-HR showed no difference in cellular viability between a-Pifithrin treated or control treated cells, indicating Cas9-HR editing did not activate the p53 pathway.

[00153] Fig. 14 illustrates data documenting improved HDR editing rates across many cell types. ¹ Safe Harbor Site; ² Relative to Legacy Cas9 Enzymes; and ³ Defined as measurable increase in viable A549 cells normalized to Cas9.

[00154] Fig. 15 illustrates that Cas9-HR significantly decreased gene editing-associated genomic stress across loci. U2OS cells were transfected with Cas9-HR or Cas9 at multiple sites Presence of >10 RPA foci per cell is interpreted as an indicator of genomic stress. DAPI stained nuclei colored in various solid colors, RPA foci colocalization with DAPI shown in solid red. Cas9-HR decreases cellular toxicity at multiple different loci, virtually all showing corresponding increases in HDR rates

Cas9-HR decreases on target INDEL formation by -60% relative to Cas9. Further sequencing experiments pending; however, preliminary in-house results demonstrate that Cas9-HR likely will show significant decreases in off-target editing rates as well. Cas9-HR editing also significantly decreases genomic stress pathway activation compared to Cas9. To the best of our knowledge, this is the first ever demonstration of double-stranded break mediated editing which demonstrates decreased toxicity, decreased INDEL rates, and decreased genomic stress. Fig. 16 illustrates an exemplary gene editing approach for editing a gene (e.g., Factor 8 or F8) associated with a disease or condition. Legacy CRISPR platforms are limited in their ability to address genetic disease caused by diverse mutations. F8 has 500+ disease causing variants documented in the NIH ClinVar database, spanning over lOOkbl. Hundreds of potential genetic therapeutic targets for Cas9-HR with mutation profiles similar to F8 had been identified. Direct repair of disease-causing mutations preserves endogenous regulation and eliminates concerns about viral sequence by-stander integration and genomic stability. Prime and Base-editing represent best-in-class direct repair solutions but would require 100s of therapeutics/treatments to effectively treat complex disease. About 40% of reported pathogenic mutations causing Hemophilia A can be corrected with just 3 therapeutics/treatments. Repair templates can be created containing silent mutations creating restriction cut sites spaced roughly Ikb apart. This repair template design can allow monitoring editing efficiency throughout the repair template sequence. Preliminary data indicate that “two guide cut” cutting strategies are the most effective at introducing desired restriction site edits. The experimental design allows for simple restriction digest analysis for optimization of editing parameters, as well as high sensitivity deep sequencing to assess editing efficiency and off and on-target INDEL generation. The chunk therapeutic editing strategy relies on the fact that most human genetic diseases have diverse mutational causes. For instance, Factor VIII has 1000s of different mutations which all lead to Hemophilia A. The strategy uses an algorithmic approach to identify ~3-5kb regions which contain maximal amounts of reported clinically relevant mutations (data derived from NCBI ClinVar database), and then designing repair templates which can theoretically “fix” and deleterious mutation within that region. This approach for truly best in class genetic therapies, combined with scalability so that instead of thousands of individual therapeutics, only ~3 would be required to treat roughly half of all known Hemophilia A patients. Two cuts can be made on either side of the chunk, and a repair template containing silent mutations in exons can be used as a proxy for mutational editing efficiency (as the vast, vast majority of mutations lie within coding regions). Either restriction site assays or deep sequencing will be used to assess therapeutic editing efficiency, as well as INDEL rates, and off-target editing. Table 2 illustrates primer sequence for detecting cut sites in F8.

Table 2. Primer sequence for detecting cut sites

[00155] Fig. 17 illustrates repair template (RT) design for F8 gene editing. Diagram of F8 repair template. Arrows denote primers used to amplify the 5’ region for restriction digest analysis or to amplify repair template sequence (so denote the start and end of the repair template). Guide arrows denote guides used to target Cas9-HR. Dark gray arrows indicate mutations introduced to prevent guide binding and cutting of repair template. Silent restriction sites introduced are indicated by various colored rectangles.

[00156] Fig. 18 illustrates restriction Gel analysis of Cas9-HR mediated two guide chunk editing. H1299 cells were transfected using lipofectamine with 500ng of pUC19-pCAG-Cas9- HR + either pU6-F8-Gl and pU6-F8-G5 or pUC19-pCAG-mNeon (control) plus 50ng of F8- Repair Template. Genomic DNA was harvested three days post-transfection and amplified using primers as noted in 29.1. The reaction was then split in two, with half untreated, while the other half was cut using either Agel or Xhol, with representative gels images shown. Cas9-HR showed significant reduction of non-edited (full length) PCR band intensity compared to control reactions, indicating the desired edits were being introduced. This assay demonstrated the ability to “rewrite” large discontinuous sections of genomic DNA using Cas9-HR. Con= Cas9-HR8 + F8-RT; Gl+G5= Cas9-HR8 + F8-G1 + F8-G5 + F8-RT

[00157] Fig. 19 illustrates Sanger sequencing analysis of Cas9-HR mediated two guide chunk editing. Cells transfected as above except using F8-G1 + G8-G6 were grown until day 9, when DNA was again extracted as before. The region was amplified using the same primers and sent for Sanger sequencing using the sequencing primer (oCH0854), which demonstrated the expected editing at the Agel cut site (T->C). This further confirms desired the desired chunk edits are being made via Cas9-HR. Fig. 20 illustrates another exemplary gene editing approach for editing a gene associated with a disease or condition. Using the previously demonstrated Cas9-HR high insertion efficiency Safe Harbor Sites SHS-231 or AAVS1 to introduce therapeutically relevant transgenes (Txl as a stand-in). This approach can take advantage of established high HDR rates for Cas9-HR mediated transgene introduction, offers a complementary approach to editing technique. Table 3 illustrates exemplary guide sequences for editing a gene associated with a disease or condition. Table 4 illustrates repair template sequences for repairing a gene associated with a disease or condition. Fig. 21 illustrates the averages of the three INDEL experiments (along with SEM), as well as graphs showing both raw and Cas9 normalized INDEL rates.

Table 3. Guide sequences for editing a gene associated with a disease or condition

Table 4. Repair template sequences for repairing a gene associated with a disease or condition

AAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAG

GTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT

TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAA

TACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAA

TGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATT

TCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTT

TTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGA

TCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAG

CGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAAT

GATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCG

TATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTC

TCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCT

TACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAA

CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCG

GAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGAT

CATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCC

ATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGC

AACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGC

TTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTG

CAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG

CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTG

CAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCT

ACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAG

ATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCA

GACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATT

TTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCAT

GACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGA

CCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCT

GCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAG

CGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA

AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTC

TAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCAC

CGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGC

CAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATA

GTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGT

GCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGA

TACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGG

GAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACA

GGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCT

TTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTT

TTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG

CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCT

CACATGT _

F8el GTGGAATTACAAGAAAATTAATTTTATATATTTATTTTCTTGCTGA 135

6-18 CTATAATGTATTCCCACTTTTGGAAATTTTTAAAGTATAGAAAAA

TAATTCCATAATTATCTTTGTGTACGTTCTATTTTTCCTATGTATTT

T

_T T TC T _T T TC TC TT AT CA TT AG ATA AT T _A TC TA CA AA C _A TT TA CT AA T _A CC AA AT CG AC TA TG T _C A TA TT AT CC GT TG CA AT TT TC AT ATG A

AACACTTCCTATGTATGTTTTTAAAATACTGCATAATAGTCTATTA

Example 2. Gene editing of Factor 8

[00158] Example 1 illustrates gene editing of Factor 8 with the Cas9-HR described herein. Fig. 22 illustrates a diagram of repair templates used for simultaneous introduction of diverse edits over thousands of base-pairs in Factor 8 exon 14. The unmodified (light grey) genomic region of Factor 8 exon 14 and surrounding introns are shown on top, whereas the repair template containing various (white bars) single base-pair mutations are shown in the middle. The bottom diagram shows a representation of our targeted changes in genome which is subsequently amplified using the primer pairs shown. This repair template contains multiple types of mutations (transition, transversion, etc.) scattered along >3 kb of DNA, which allows not only assessment of DNA editing rates at any one site, but also how these rates vary as a factor of distance from the cut-sites.

[00159] Fig. 23 illustrates Cas9-HR could uniquely make simultaneous targeted edits spanning thousands of base-pairs in Factor 8 exon 14. This graph showed editing rates in genomic DNA extracted from H1299 transfected with Cas9-HR, F8el4-G2+F8e-14-G4, F8el4-RT (Cas9-HR, dashed with circles); Cas9, F8el4-G2+F8e-14-G4, F8el4-RT (Cas9, dashed with squares); or F8el4-G2+F8e-14-G4, F8el4-RT (control or Con, dotted with triangles) five days posttransfection. Cas9-HR showed significantly increased levels of editing (>10X) compared to Cas9 or control (Con) treated cells.

[00160] Fig. 24 illustrates individual reads demonstrating simultaneous introduction of three different mutations. Raw reads visualized in IGV showed simultaneous insertion of 3 independent mutations spanning ~70 bps. This “all-or-none” pattern was very consistent outside of mutations extremely close to the guide site (the sharp peak seen at C1036G as an example). Demonstration of simultaneous “re-writing” of multiple edits was another key factor in successful use of Cas9-HR “gene-writing” for therapeutic applications.

Example 3. Gene editing of phenylalanine hydroxylase (PAH)

[00161] Example 3 illustrates gene editing of Factor 8 phenylalanine hydroxylase with the Cas9-HR described herein. Fig. 25 illustrates a diagram of repair templates used for simultaneous introduction of diverse edits over thousands of base-pairs in phenylalanine hydroxylase exons 6-8. The unmodified (light grey) genomic region of PAH exons 6-8 and surrounding introns are shown on top, whereas the repair template containing various (white bars) single base-pair mutations are shown in the middle. The bottom diagram shows a representation of the targeted changes in genome which is subsequently amplified using the primer pairs shown. This repair template contains multiple types of mutations (transition, transversion, etc.) scattered along >4kb of DNA, which will allow not only assessment of DNA editing rates at any one site, but also how these rates vary as a factor of distance from the cutsites. Fig. 26 illustrates graphs demonstrating Cas9-HR could uniquely make simultaneous targeted edits at viable levels spanning thousands of bps in PAH exons 6-8. This graph showed editing rates in genomic DNA extracted from HEK293 transfected with Cas9-HR and combinations of PAHe6-8 G1+G3 (dashed squares), G1+G4 (dotted triangles), G2+G3 (dashed circles), G2+G4 (dotted squares), or no guides (dashed triangles) all with PAHe6-8 RT, and finally PAHe6-8 RT alone (Con+RT) five days post-transfection. Optimal PAH guide combinations Cas9-HR showed significantly increased levels of editing (>6X) compared to Cas9-HR or control (Con) treated cells, with different “peaks” seen based on guides used, demonstrating effect of guide choice on local editing rates. Importantly, Cas9-HR showed remarkably even levels of throughout greater than 4kb of DNA, an important factor if large- scale gene-writing is to be used therapeutically. Additionally, these experiments demonstrated that Cas9-HR enable gene-writing could be conducted at multiple loci and cell types, demonstrating this technique was not solely limited to a single locus or cell type. [00162] Fig. 27 illustrates double guide strategies could uniquely make simultaneous targeted edits at viable levels spanning thousands of bps in PAH exons 6-8. This graph showed editing rates in genomic DNA extracted from H1299 transfected with Cas9-HR and combinations of PAHe6-8 G2+G4 (dotted triangles), G2 alone (dashed circles), or G4 alone (dotted squares), all with PAHe6-8 RT five days post-transfection. G2 only showed good levels of editing close to the cut site, but with dramatic reductions to background levels when assayed ~2kb away from the cut site. Conversely G4 showed good editing rates around its corresponding cut site, and again levels decrease to background upon moving ~3kb away. Finally, G2+G4 had slightly local decreased levels of editing around the corresponding cut sites but maintain this level of editing throughout ~4kb of the gene-writing target. These experiments demonstrated the importance of two-guide mediated cutting to Cas9-HR gene-writing. Fig. 28 illustrates double guide cutting strategies leading to expected levels of INDELS in HEK293 cells at PAH local genomic regions surrounding G2 and G4. Data was generated from the same experiments as Fig. 26: Cas9-HR, PAHe6-8 G2+G4, PAHe6-8 RT (HEK293-G2+G4, horizontal hatch); Cas9- HR PAHe6-8 RT (HEK293 -HR-Con, dots); or PAHe6-8 RT (HEK293-Con, crossed hatch). Indel rates corresponded to rates of editing seen at various sites, with HEK293-G2+G4 showing significant (~8%) INDEL production at both surrounding areas of G2 and G4, HEK293 -HR- Con and HEK293-Con showing negligible levels of INDEL production. As Cas9-HR directed repair pathway choice away from NHEI and towards HR, the relatively low rate of INDEL production was expected.

[00163] Fig. 29 illustrates single and double guide cutting strategies leading to expected levels of INDELS in H1299 cells at PAH local genomic regions surrounding G2 and G4. Data was generated from the same experiments as Fig. 27: PAHe6-8 G2+G4 (H1299-G2+G4, vertical slants), G2 alone (H1299-G2, left slants), or G4 alone (H1299-G4, right slants), all with PAHe6-8 RT. Indel rates corresponded to rates of editing seen at various sites, with H1299- G2+G4 showing significant (~5 and 3%) INDEL production at both surrounding areas of G2 and G4, and H1299-G2 and H1299-G4 only showing INDELs at G2 and G4 surrounding regions respectively (~7% and 4% respectively). This data simultaneously demonstrated INDEL production correlated (as expected) with gene-writing rates. Additionally, the increased INDELs using single guides at their corresponding sites also correlated to the slight local increases in editing efficiency seen using single guides compared to dual guide strategies. These experiments further demonstrated Cas9-HR mediated gene-writing had predictable effects and local effects dependent on guides used. Example 4. Method for gene editing

Cell Culture and transfection

[00164] HEK293 and H1299 cells were maintained in RPMI1640 and 50/50 F12/DMEM both supplemented with 10% FBS respectively. Wells were plated in 24 well plates at -50,000 cells per well and were transfected using Lipofectamine 3000 two days post seeding (approximately 70% confluency). 500 ng of Cas9-HR or 500 ng of Cas9 were transfected along with 250 ng either one or multiple plasmids containing U6 driven SpCas9 guide expression cassettes, and -50 ng of linear dsDNA repair templates (shown in Fig. 22 and Fig. 25). Transfected cells were subsequently lysed and gDNA on either Day 3 or day 5 (post-transfection) extracted using a Quick-DNA miniprep kit (Zymo Research). Table 5 illustrates sequences of a PAH repair template.

Table 5. Repair template sequences for repairing a gene associated with a disease or condition

DNA extraction. Amplicon generation. Library Preparation and Bioinformatic analysis [00165] Genomic DNA was subsequently amplified using Primestar GXL polymerase (Takeda) and gene specific primers. Amplicons were subsequently run on 1% agarose TAE gels and extracted using GeneJet Gel Extraction Kits (Thermo). Libraries were subsequently prepared using DNA Tagmentation and Library Prep kits (Illumina), then sequenced using on an MiSeq (Illumina). Reads were trimmed using trimmomatic, aligned using Bowtie 2, and then subsequently analyzed using custom scripts designed to quantify desired editing as well INDEL rates surrounding guide sites and plotted using custom python scripts. Table 6 illustrates sequences of the primers used for the nucleic acid analysis. Table 6. Oligonucleotide sequences

Cas9 and Cas9-HR in-vitro activity model

[00166] The models showed the expected difference between the in-vitro cleavage pattern of Cas9 and the Cas9-HR series. Cas9 bound to the intended site, cut, and then remained bound until digested away with proteinase K. As Cas9-HR possess additional 5 ’->3’ exonuclease activity, a more complex pattern was expected. Importantly, it has been shown that hExol has roughly 10X the affinity for Phosphorylated 5 ’-double strand DNA ends as for unphosphorylated. This led to two important consequences. First, there could be some small digestion of the PCR without addition of any gRNA, which was not generally expected to happen with Cas9. Changing the nature of the primers used to amply the DNA fragment (either with 5 ’-phosphates or thioester bonds) should either increase or decrease this degradation respectively. Next, since cleavage of ds-DNA produces ds-ends with 5 ’-phosphates, it was expected that either the original Cas9-HR or other unbound Cas9-HR molecules could resect the dsDNA in 5’->3’ generating a mix of various dsDNA, ds:ssDNA, and ssDNA products. Cas9 and Cas9-HR Gel Prediction

[00167] Visualization of expected results from in-vitro Cas9 or Cas9-HR cleavage assays. The results could be similar to the predicated model, with Cas9-HR 3 appearing to have had less nuclease activity than Cas9. Cas9-HR 3 could have had less nuclease activity than Cas9 (NT). Cas9-HR 4 and 8 can perform better in-vitro, as they appear the be the most effective in-vivo. Example 5. Chunk editing from ~4 — 8kb with DSB and non-DSB HDR

Two Guide HDR based strategies using both Cas9-HR and Cas9 can be used to introduce 12 simultaneous single base changes in an over 4kb editing window editing [00168] A two-guide strategy, where two guides cutting determines the editing window, combined with a linear dsDNA template to mimic natural homologous recombination templates was used to direct the endogenous recombination machinery to read all the way through the intended editing window, allowing for both dramatically extended window size and even edit distribution (e.g., a linear vs U-shaped editing efficiency graph).

[00169] The first target was exon 14 of the Factor VIII gene, a therapeutically relevant target with over 65 individual mutations classified as severe or likely-severe for Hemophilia A in NCBIs Clin-var. Initially H1299 cells were transfected with plasmids encoding Cas9-HR or Cas9, dual guides under the pU6 promoter, and a PCR generated linear dsDNA template. The repair template was designed to introduce 9 silent mutations in the exon 14 coding sequence, roughly scattered throughout the 4kb editing window, with 4 mutations destroying intronic PAM sites at identified guide sites (Fig. 30A). Fig, 30A illustrates repair template design used to test rewriting capabilities. White bars denote intended single base changes, arrows indicate orientation of guides and approximate location in repair tempi ate/genome, dashed lines show end of repair template relative to genomic DNA. After transfection, various time-points (1, 3, 5, 10 days) post-transfection were assayed via amplification and restriction digest, with day 3 showing the most consistent editing (data not shown). As days 2-3 are very common time points for other CRISPR editing assays, day 3 was used for all subsequent experiments unless noted. The NGS based protocol shown in Fig. 30B was used. Initially, 4 guide pairs were designed, with two of those (2+5, 2+6) showing good editing activity across the window. Fig. 30B illustrates an exemplary flow chart showing general editing strategy and downstream assays used for this and all subsequent figures. Roughly, cells are transfected, lysed after 3 days, specific regions are amplified, prepared for next generation Illumina sequencing, reads were filtered and aligned using standard strategies, and editing rates and INDEL rates quantified using custom in-house generated scripts.

[00170] Custom scripts were used to align, filter, and quantify desired editing at intended locations. Even editing rates were observed across the entire editing window with both Cas9 and Cas9-HR (Fig. 30C). Fig. 30C illustrates editing rates across 3+kb of genomic DNA using guide pair G2+G5. Cas9-HR, guides, and RT in blue; Cas9, guides, and RT in orange; Cas9-HR and RT dashed blue; Cas9 and RT dashed orange; untransfected control in dashed, black. Shading shows the SEM for each treatment, n=2-3 per treatment. Experiment demonstrates chunk editing strategy can generate relatively even edits across multiple Kb of DNA.

[00171] Another guide pair also showed good editing levels, though Cas9-HR showed lower background and more even editing than Cas9 (Fig. 30D). Fig. 30D illustrates editing rates across 3+kb of genomic DNA using guide pair G2+G6. Cas9-HR, guides, and RT in blue; Cas9, guides, and RT in orange; Cas9-HR and RT dashed blue; Cas9 and RT dashed orange; untransfected control in dashed, black. Shading shows the SEM for each treatment, n=2-3 per treatment. Experiment demonstrated chunk editing strategy could generate relatively even edits across multiple Kb of DNA using multiple guide combinations.

[00172] Analysis of NGS sequencing showed consistent INDEL generation for both G2 and G5, though G6 showed less (Fig. 30E), with editing rates and INDEL resulted from all guide pairs shown in Fig. 31A and Fig. 31B. Fig. 30E illustrates average percent of reads containing INDELs for each of the guide, nuclease and 5’ and 3’ ends as denoted by the x-axis legend, n=2-3 and error bars are SEM. Data showed INDEL production (or lack thereof) correlated with editing success seen in Figs. 30A-E, further emphasizing chunk editing was dependent on targeted cutting of DNA, and not some other random repair process. Again, INDEL dependent editing was observed, though only one guide out of the pair appeared necessary to effectively produce INDELs for chunk editing to succeed. Fig. 30F illustrates the average editing efficiency across 5’ and 3’ of Factor 8 exon 14. Solid bars represent denoted guide and nuclease pairs plus repair template, with semi-transparent shaded bars denoting controls using corresponding nuclease and repair template but lacking guides. Black bars to left show background levels of editing in untransfected cells. n=2-3 per experiment, error bars represent SEM. Experiments demonstrated further dependence of chunk editing on proper guide selection and differences seen in editing rates and success using either Cas9 or Cas9-HR.

Two guide editing strategies are necessary and sufficient to drive long-range editing in a second 4,5kb region

[00173] Following the prior results, another locus was assayed, this time the region encompassing exons 6-8 in the PAH gene, with 3 silent mutations, one in each exon, and again 4 PAM destroying mutations in the surrounding intronic regions (Fig. 32A). Fig. 32A illustrates structure of the PAH exons 6-8 genomic region. Repair template, white bars denote specific mutations, and finally bottom shows integrated repair template with an out-out primer design. Again, four different 2-guide combinations were tested, with the best performing shown in Fig. 32B. Again, both Cas9-HR and Cas9 showed relatively consistent editing levels throughout the editing window, though this time with Cas9 showed higher levels of editing than Cas9-HR, while background was very low for all types of controls. Each guide was individually tested to determine if two combinations were necessary to achieve this editing (Fig. 32C) and a drop in editing efficiency outside of the traditional ~10bp window was observed. The single guides showed both higher editing and INDEL efficiency at 5’ or 3’ (depending on which site was targeted), indicating that levels of nuclease could be limiting when multiple guides are added. Additionally, similar guide dependent effects on editing were observed (Fig. 32D left and right) as when targeting Factor 8 exon 14, further confirming these results were dependent on direct genome modification, and not some other non-nuclease mediated effects. Fig. 32D, left graph, illustrates guide dependent effects of editing for four distinct guide pairs for PAH exons 6-8: G1+G3, G1+G4, G2+G3, G2+G4, using Cas9-HR, n=3. Graph again demonstrates the guide dependent editing of chunk editing, and hits at mechanistic and function consequences of guide choice (compare rates using G3 vs G4 as an example). Fig. 32D, right graph illustrates guide dependent effects of editing for four distinct guide pairs: G1+G3, G1+G4, G2+G3, G2+G4, all using Cas9, n=3. Graph again demonstrates the guide dependent editing of chunk editing, showing similar patterns as Cas9-HR, though Cas9 had higher editing rates. Guide dependent differences were observed. Average editing rates for the 5’ and 3’ regions as well as INDEL rates surrounding the cut sites were quantified, as shown in Fig. 32E and Fig. 32F. INDEL efficiency largely showed good correlation with editing rate, while Cas9-HR showing decreased INDELs compared to Cas9. Fig. 32E illustrates average editing of various double or single primer pairs divided into 5’ and 3’ regions, using either Cas9-HR or Cas9, n=3-l, see previous figures. Graph demonstrated correlation between guide targeting and subsequent chunk editing, with single guides generally showing distance restricted editing and chunk editing showing editing throughout the entire editing window. Fig. 32F illustrates the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for single and double guide combinations. Error bars showed SEM, n=2-3. Graph shows excellent INDEL correlation to guide targeting. As an example, G3 showed ineffective INDEL production, also showed no standard editing, and low chunk editing. In contrast, G2 and G4 showed good INDEL production, and good chunk editing. Fig. 32G, left graph, illustrates guide dependent effects of editing for four distinct single guides for PAH exons 6-8: Gl, G2, G3, G4, using Cas9-HR, n=2. Graph shows chunk editing strategy was necessary to achieve long range editing, with single guides only showing strong editing -10bps around the cut site (as observed before) decreasing to background >100bp away. Fig. 32G, right graph, illustrates guide dependent effects of editing for four distinct guide pairs: G1+G3, G1+G4, G2+G3, G2+G4, all using Cas9, n=2 or all except G3, n=l. Graph demonstrates necessity of chunk editing strategy, as single guides drop to background as distance from cut site increases. Graph again shows similar patterns as Cas9-HR, though Cas9 had higher editing rates.

Two guide editing strategies can perform long-range editing over ~8kb genomic region [00174] Limits of the editing strategy were tested by attempting to perform edits over an almost ~8kb region. This region included the ~7.5kb exon 30 of the ApoB gene, which contains roughly -50% of all likely and confirmed pathogenic mutations in the ApoB gene. A repair template was created, ~9kb in length, consisting of 17 individual mutations spanning ~8kb (Fig. 33A) and tested with four different 2-guide combinations. Fig. 33A illustrates the structure of the APOB exons 30 genomic region. Repair template, white bars denote specific mutations, and finally bottom shows integrated repair template with an out-out primer design. Repair template editing rates were the lowest observed compared to prior experiments, ranging from 0.2-0.8% depending on guide and editing position (Fig. 33B, left). Unlike for Factor 8 or PAH, Cas9-HR was not able to drive significant editing above background levels across the whole editing window (Fig. 33B, right), demonstrating that different nucleases might show different efficiencies based on genomic targets. Fig. 33B, left graph, illustrates editing rates across ~8kb of APOB exon 30 using Cas9-HR and guide pairs G1+G2, G1+G3, G2+G3, G2+G4 (see legend). Cas9-HR showed barely above background editing for sites around guide targets, dropping to background further away. Fig. 33B, right graph, illustrates editing rates across ~8kb of APOB exon 30 using Cas9 and guide pairs G1+G2, G1+G3, G2+G3, G2+G4 (see legend). In contrast to Cas9-HR, Cas9 showed strongly above background editing for sites around guide targets and drops but still well above background all the way through the editing region. Experiment demonstrated that chunk editing can edit regions up to 7.5kb in length.

[00175] Guide dependent effects on editing rates were observed, though this time with more pronounced spikes around the cut sites compared to the two prior loci tested. Finally, editing and INDEL rates were quantified for all guides as shown previously (Fig. 33C and Fig. 33D). Fig. 33D illustrates the average percentage of reads containing INDELs for APOB exon 30 around +/- 25 of 5’ and 3’ cut sites for double guide combinations. Error bars show SEM, n=2. INDEL data demonstrates that all guides create INDELs, interestingly guides different INDEL rates (G1 vs G2) showed different chunk editing rates. Cas9-HR had decreased INDELs compared to Cas9, with good INDEL production from all guide combinations tested. These results demonstrated that the editing window could be extended to over 8,000 base-pairs.

Two guide editing strategies are compatible with other nucleases

[00176] The prior strategies were then tested with the SluCas9 nuclease, which has a very similar PAM (NNGG compared to NGG) which would allow use of previously identified guides even though they are shifted by one base-pair, though is smaller and would enable AAV based editing. A single PCR strategy, similar to those used in Fig. 32 and Fig. 33, was used rather than the two-piece PCR strategy used in Fig. 30 (Fig. 34A). Fig. 34A illustrates the structure of the genomic region F8 and new amplification strategy. Repair template, white bars denote specific mutations, and finally bottom shows integrated repair template with the new out-in primer design. Since SluCas9 has a very similar PAM site (NNGG vs NGG for SpCas9) virtually the same guides could be reused, and simply shifted by one base. New guides were designed and tested with SluCas9 or SluCas9-HR for the ability to edit Factor 8 exon 14 and PAH exons 6-8, using the optimal guide pairs (G2 and G5; and G2 and G4 respectively), with background subtracted results shown in Fig. 34B and Fig. 34C respectively. Fig. 34B illustrates background subtracted editing rates across ~3.3kb of F8 exon 14 using G2+G5 F8 guide pair and two different nucleases SluCas9 and SluCas9-HR, n=2. SluCas9 and SluCas9-HR both showed consistent editing throughout the editing window, though SluCas9 was significantly more consistent than SluCas9-HR. This experiment demonstrates chunk editing can be performed by multiple nucleases, opening up future opportunities to explore other classes of nucleases in the future. Fig. 34C illustrates background subtracted editing rates across ~4kb of genomic DNA using G2+G4 F8 guide pair and SluCas9 and SluCas9-HR. While editing rates were low, both SluCas9 and SluCas9-HR showed editing well above background throughout the entire editing window. This experiment further demonstrated SluCas9-HR and SluCas9 could be used for chunk editing at multiple genomic loci. Both nucleases showed the ability to edit across the previously established windows, with SluCas9 showing more consistent editing than SluCas9-HR. Average editing efficiencies across F8 (Fig. 34D) and PAH (Fig. 34F) correlated with INDEL levels (Fig. 34E and Fig. 34G, respectively), with Cas9-HR showing decreased levels of INDELs compared to Cas9. Fig. 34D illustrates average editing rate of various double SluCas9 and SluCas9-HR guide pairs divided into 5’ and 3’ regions for F8 G2+G5, n=2. Graph demonstrates different nucleases can have different chunk editing rates, indicating nuclease choice is one option for future optimization. Fig. 34E illustrates the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for SluCas9-HR and SluCas9 double guide combinations for 5’ and 3’ F8 G2+G5. Error bars show SEM, n=2. Graph shows that different nucleases can have different INDEL patterns (not particularly surprising), but further demonstrates the flexibility of chunk editing. Fig. 34F illustrates average editing rate of various double SluCas9 and SluCas9-HR guide pairs divided into 5’ and 3’ regions for PAH exons 6-8, n=2. Graph demonstrates different nucleases could have different chunk editing rates, indicating nuclease choice was one option for future optimization. Fig. 34G illustrates the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for SluCas9-HR and SluCas9 double guide combinations for PAH exons 6-8. Error bars show SEM, n=2. Graph shows that different nucleases can have different INDEL patterns (not particularly surprising), but further demonstrates the flexibility of chunk editing. While both SpCas9 and SluCas9 (and -HRs) performed chunk editing, INDEL patterns differed between the two. Fig. 36A illustrates editing rates across ~3.3kb of F8 exon 14 using G2+G5 F8 guide pair and increasing concentrations of ssDNA F8 RT, n=3. Editing rates are shown for one half of the editing window, with editing rates increasing with increased ssDNA throughout the entire 5’ window. Data indicates chunk editing could be used with multiple RT types, and that rates could be optimized by varying parameters such as RT type and concentration. Fig. 36B illustrates average editing of various double guide pairs divided into 5’ and 3’ regions using ~3.3kb of F8 exon 14 using G2+G5 F8 guide pair and increasing concentrations of ssDNA F8 RT, n=3. Graph quantifies the average increase in editing rate from increasing concentrations of ssDNA. Fig. 36C illustrates the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for guide and nickase combinations listed. Error bars show SEM, n=3. Graph demonstrates that chunk editing directly competes with INDELs for repair pathway choice, with decreasing INDEL rates seen with increasing amounts of RT tested, which pointed towards safety possibilities where increased optimization and editing efficiency of chunk editing could compete with unwanted editing outcomes and increase safety. These results confirmed that chunk editing could be performed by multiple different nucleases.

Non DSB based staggered nickase strategies also enable chunk editing

[00177] Chunk editing was then tested for non-DSB based applications. Two different approaches were designed, both using the previously established F8 chunk editing assays. First, four different nickase variants were created: Cas9 D10A, Cas9-HR D10A, Cas9 H840A, Cas9- HR H840A. Nickase mutants D10A and H840A cut opposite strands of DNA, and the testing was designed to measure if resection of the individual nicks via the exonuclease domain of Cas9-HR could increase rates of chunk editing. Since plasmid-based transfection was used and was unable to simultaneously use D10A and H840A nucleases, alternate orientation of previously identified guide pairs G2-G5 (same strand), and G2-G6 (opposite strands) was used, and by using either D10A or H840A variants all various permutations of strand nicking could be tested (Fig. 35A). Fig. 35A illustrates various nickase and guide combinations to allow testing of all 4 types of editing permutations. Same-strand targeting of both guides (G2-G5) was tested first with results and editing efficiencies predictably low, with most not reaching above background levels (Fig. 35B, quantified in Fig. 35D). Fig. 35B illustrates background subtracted editing rates across ~3.3kb of F8 exon 14 using G2+G5 F8 guide pair (targeting same strand either top or bottom), n=3. While editing rates remained very low for all nucleases tested, H840A Cas9 and Cas9-HR did show consistent if low editing above background for the entire editing window. Data indicates as expected that same strand nicking leads to inefficient chunk editing. Fig. 35D illustrates average editing of various double guide pairs divided into 5’ and 3’ regions using nickase and guide combinations shown in the graph, n=3. Graph shows the dramatic increase in editing rates from using same strand vs alternate strand nickase strategies, and that different nickases can have different effects on editing rates. Data demonstrated various nucleases/nickase combinations for optimize editing. [00178] Differences between D10A and H840A were seen, with H840A actually showing slightly higher editing rates than D10A. Cas9-HR did not seem to have any appreciable effect, with nickase strand showing much larger effects. The next tested experiment asked whether staggard targeting strands would increase editing efficiency. As seen in Fig. 35C and quantified in Fig. 35E, staggard targeting dramatically increased chunk editing efficiency with rates reaching >10% for certain positions. Fig. 35C illustrates background subtracted editing rates across ~3.3kb of F8 exon 14 using G2+G6 F8 guide pair, n=3. Editing rates for all nucleases were well above background, with the highest rates reaching 5-10%. As with G2+G5, H840A versions showed higher editing rates than D10A. Data demonstrates that targeting alternate strands is a highly effective way to achieve chunk editing. Fig. 35E illustrates the average percentage of reads containing INDELs around +/- 25 of 5’ and 3’ cut sites for guide and nickase combinations listed. Error bars show SEM, n=3. INDELs confirm nickases dramatically decrease INDEL production to background levels (~0.4-.8% compared to the 2-4% seen in DSB experiments). Demonstrates definitively that chunk editing can be performed without creating DSBs.

[00179] As same strand targeting, the identity of the nickase (D10A or H840A) had a much stronger effect on editing efficiency than whether Cas9 or Cas9-HR were used. Finally, analysis of INDELs around the cut sites confirmed that all versions of nickases did not create INDELs over background, confirming that these nucleases do not create double-strand breaks. These results demonstrate that non-DSB based chunk editing is possible.

Methods of Example 5

General PCR and cloning methods

[00180] DNA amplification was performed using PCR with PrimeSTAR GXL (Takara) using standard protocols and 35 cycles unless otherwise specified. Molecular cloning was performed using PCR to generate fragments with 15 bp overlapping ends and then assembling the fragments using In-Fusion Enzyme (Takara Bio) prior to transformation into chemically competent E. coli. Plasmid DNA for transfection was isolated from E. coli using the ZymoPure Plasmid Miniprep Kit (Zymo Research Corporation) or PureLink Fast Low-Endotoxin Midi Plasmid Purification Kit (Thermo Fisher Scientific), both which remove bacterial endotoxins. Repair templates were constructed using primer generated mutagenesis and subsequent primer stitching, then cloned as above, with sequences in Table 7.

Table 7. Repair template sequences

Cell culture conditions

[00181] H1299, HEK293T, and human liver stem cells (hLSCs) were grown in RPMI-1640 (Coming), Dulbecco’s Modified Eagle Medium (DMEM, Corning), and SuperCult Human Liver Stem Cell Growth Media (Creative Bioarray), respectively, each supplemented with 10% fetal bovine serum. All cell types were maintained at 37°C with 5% CO2.

H1299 tissue culture transfection protocol and genomic DNA preparation

[00182] H1299 cells were seeded on 24-well plates. Two days post-seeding, cells were transfected at approximately 80% confluency with Lipofectamine 3000 Transfection reagent (Thermo Fisher Scientific) according to the manufacturer’s protocols and 500 ng of Cas9-HR or Cas9-NT plasmid, 300 ng of sgRNA plasmid, and 30-50 ng of PCR product repair template. Cells were cultured for 3-5 days post-transfection after which genomic DNA was extracted using the Quick-DNA Microprep Kit (Zymo Research Corporation).

Next-generation DNA sequencing of genomic DNA regions of interest

[00183] Genomic regions of interest were amplified from genomic DNA by PCR. Primers and PCR conditions are listed in Table 8 and Table 9 respectively. The 5867 bp genomic region spanning the PAH-e6-8 repair template was amplified using flanking primers oCH987 and oCH988 at 58°C annealing temperature and 7 min extension. The genomic region spanning the F8-el4 repair template was amplified in two overlapping parts. The 2257 bp 5’ segment was amplified using flanking primer oCH963 and internal primer oCH964 at 63 °C annealing temperature and 2:45 min extension. The 3314 bp 3’ segment was amplified using internal primer oCH1325 and flanking primer oCH1328 at 55°C annealing temperature and 4 min extension. PCR products were then run on an agarose gel and the desired band was excised and purified using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific). Table 8. Primer sequences

Table 9. Primers and PCR conditions for amplifying genomic DNA regions of interest for

NGS

[00184] Purified PCR products were prepared for sequencing using the standard Illumina DNA Prep protocol and reagents (Illumina DNA Prep (M), IPB), and subsequently sequenced using the MiSeq (Illumina) and MiSeq Reagent Kit v3 (Illumina, MS-102-3001) using standard sequencing conditions.

[00185] Illumina BaseSpace was used for fastq generation from raw BCL files. Subsequently, fastqs were trimmed using Trimmomatic with the parameters of SLIDINGWINDOW: 10:30 and MINLEN:60 for quality trimming and ILLUMINACLIP:NexteraPE-PE.fa:2:30: 10:2:True for adapter trimming. The trimmed sequence data were then aligned using bowtie2 with their respective reference sequences extracted from GRCh38 via NCBI. Custom python code using the pysam library (samtools/htslib) was used to generate a pileup of the number of nucleotides read at each position in the reference sequence, as well as parse individual reads into a CSV format, including INDEL statistics per read.

[00186] Pileup data were used to quantify editing rate by calculating the percentage of read nucleotides at a given position that matched the intended edit at that position. Two types of editing rate datasets were produced: background-subtracted and non-background-subtracted. Background subtracted datasets had their editing rates subtracted by the editing rate percentage from the respective nuclease and repair template only control for each replicate. Non- background-subtracted datasets used the raw editing rate calculated from the pileup data. Readlevel data were filtered down to a 50 bp window at the cut site for each guide, +- 25 bp flanking each side. A percentage was then calculated for reads overlapping this window, creating datasets with the number of INDELs at each cleavage area. These datasets were then averaged across replicates, again producing mean and standard error of the mean values.

PCR Conditions

[00187] All reactions used PrimeStar (Takeda) polymerase, 10-50ng genomic DNA, standard thermocycler. genomic PCR amplification conditions'.

F8 5' PCR: oCH0963 + oCH0964, 63 C, 2:45 min, 2257 bp

F8 3' PCR: oCH 1325 + oCH 1328, 55 C, 4 min, 3314 bp F8 V2 PCR: oCH1512 + oCH1515, 62 C, 5 min, 4526 bp PAH: oCH987 + oCH988, 58 C, 7 min, 5867 bp ApoB: OCH1332 + oCH 1333, 55 C, 9 min, 8513 bp

Repair template amplification conditions'.

F8-RT PCR: oCH0005 + 0CHOOI6, 62 C, 4 min, 5102 bp PAH-RT PCR: oCH0804 + oCH0807, 58 C, 5 min, 5490 bp APOB-RT PCR: oCH0891 + oCH0892, 58 C, 8 min, 8401 bp Example 6. Delivery of construct

[00188] A construct described herein (e.g., vector encoding a Cas protein, a Cas fusion protein, a guide polynucleotide, or repair template), a Cas protein, a Cas fusion protein, a guide polynucleotide, or repair template can be introduced into a cell by any method for delivering the composition described herein into the cell. The construct or nucleic acid encoding the Cas protein, the Cas fusion protein, the guide polynucleotide, or the repair template can be a plasmid, a single-stranded DNA (ssDNA), a double-stranded (dsDNA), or a combination thereof. Plasmid DNA repair template can be prepared as standard and transfected along with plasmids, RNA, protein (nuclease only), nucleic acid encoding guide polynucleotide or Cas nuclease, or a combination thereof. For delivery of dsDNA alone, standard primers can be used to amplify DNA from a plasmid containing the repair template (RT) donor sequence. DNA (e.g., for encoding guide polynucleotide, Cas nuclease, or Cas fusion protein) can be gel extracted and purified as standard then transfected along with plasmids/RNA/protein (e.g., nuclease). For dsDNA and protein complex delivery, dsDNA can be prepared as above, then complexed with various purified dsDNA binding proteins (histones, Cas, helicases, etc.). dsDNA and protein complex can then be transfected with plasmids/RNA/protein encoding guides and nuclease.

[00189] The nucleic acid described herein can be chemically modified. For example, the nucleic acid encoding the Cas fusion protein, the guide polynucleotide, or the repair template can be chemically modified with modification of phosphate backbone, replacement of phosphate moiety, substitution of phosphate group, modification of ribophosphate backbone, modification of sugar, modification of a constituent of ribose sugar, modifications on base of nucleotide, or a combination thereof. For dsDNA modified with phosphorothioate delivery, one or two primers containing 3’ or more 5’ phosphorothioated nucleotides are used to amplify DNA as above. DNA is gel extracted and purified as standard, then transfected along with plasmids/RNA/protein (e.g., nuclease) encoding guides and nuclease.

[00190] For ssDNA delivery, one standard primer and one 5' biotinylated primer can be used to amplify DNA from a plasmid containing the RT donor sequence. Streptavidin beads can be used to remove the strand containing the biotin tag, resulting in ssDNA. ssDNA is purified using alcohol precipitation, then transfected with plasmids/RNA/protein (e.g., nuclease) encoding guides and nuclease. For ssDNA and protein delivery, one standard primer and one 5’ biotinylated primer can be used to amplify DNA from a plasmid containing the RT donor sequence. Streptavidin beads can be used to remove the strand containing the biotin tag, resulting in ssDNA. ssDNA can be purified using alcohol precipitation, then complexed with various ssDNA proteins/complexes (RPA, RAD51, etc.) and transfected with plasmids/RNA/protein (e.g., nuclease) encoding guides and nuclease. For ssDNA modified with phosphorothioate, one primer containing 3’ or more 5’ phosphorothioated nucleotides and one 5’ biotinylated primer can be used to amplify DNA from a plasmid containing the RT donor sequence. Streptavidin beads can be used to remove the strand containing the biotin tag, resulting in ssDNA. ssDNA can be purified using alcohol precipitation, then transfected with plasmids/RNA/protein (e.g., nuclease) encoding guides and nuclease. For AAV delivery, repair template can be cloned into plasmids containing (standard or synthetic) ITR repeats then transfected into host cells with capsid and helper plasmids to produce AAVs containing desired capsid type and RT sequence. AAVs are purified either by centrifugation or column then transfected at various MOI into target cells, along with plasmids/RNA/protein (e.g., nuclease) encoding guides and nuclease.

Example 7. Cell gene editing and propagation

[00191] A cell can be modified with a Cas protein, a Cas fusion protein, a guide polynucleotide, a repair template, or a combination thereof, where the repair template is inserted into the genome of the cell. The cell can be an autologous cell or an allogenic cell. The cell can be first isolated or obtained from a subject. The cell can then be modified and expanded. The expanded cells with the repair templated inserted into their genomes can then be administered back to the subject for treating a disease or condition in the subject. The edited cell can also be directly administered to the subject, where the edited cell then propagates in the subject for treating the disease or condition.

[00192] While the foregoing disclosure has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the disclosure. For example, all the techniques and apparatus described above can be used in various combinations. All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually and separately indicated to be incorporated by reference for all purposes.

SEQUENCES

-Ill-