THEREOF

The present invention relates to a tool for the detection of neuroblastoma or cells having the potential to develop into a neuroblastoma, to diagnostic as well as pharmaceutical applications thereof, to methods for the detection of a microtubule-associated protein indicative of neuroblastoma (NB-MAP 2), to kits comprising the diagnostic tool of the invention, to specific diagnostic uses of the tool of the invention and to epitopes specific for NB-MAP2 as well as recombinant proteins/fusion proteins comprising said epitopes

Neuroblastoma is one of the most common solid tumors in children It arises in neural crest derived parts of the peripheral nervous system (PNS), most often in the adrenal medulla.

There has been considerable progress in the treatment of neuroblastoma tumors, but mortality is still high especially in advanced stages of the disease. Since the efficiency of the neuroblastoma therapy depends on the early and unambiguous diagnosis of the disease, a specific immunohistological marker or an alternative diagnostic procedure would be highly desirable.

The differential diagnosis of neuroblastoma in pathological specimens such as bioptic material or bone marrow smears may be extremely difficult yet crucial for the choice of the therapeutic strategy. Often the pathologist has to distinguish neuroblastoma from neoplasias like malignant lymphoma, nephroblastoma, rhabdomyosarcoma, Ewing's sarcoma, or primitive neuoroectodermal tumors (PNET). Electronmicroscopical investigations and immunhistocnemical typing of intermediate filaments, especially neurofilaments, allows the exclusion of lymphoma, rhabdomyosarcoma and nephroblastoma. Ewing's sarcoma and

PNET, however, cannot be distinguished from neuroblastoma by immunostaining, as all three tumors express neurofilaments.

Prior art studies on microtubule-associated protein 2 (MAP2) in human neuroblastoma cells have revealed that cell lines derived from human neuroblastoma tumors express a unique MAP2 component of 250 kDa (NB- MAP2) that is not found in normal tissues or other types of tumors of neuroectodermal origin (Kirsch et al., Characterization and intracellular distribution of microtubule-associated protein 2 in differentiating human neuroblastoma cells. J. Neurochem. 55, (1990) 1031-1041 , Kirsch et al., Differential distribution of cytoskeletal elements upon differentiation of human neuroblastoma cells: expression of a unique MAP2 species. Adv. Neuroblastoma Res. 3, (1991 ) 327-333). This MAP2 isoform was also detected in pathological specimens from neuroblastoma patients (Zutra et al., Characterization of microtubule-associated proteins in tumor derived from the human central nervous system. Proceedings of the 15th International Congress of Biochemistry (1992), 344 (Abstract)). However, prior to the present invention the genetic origin of NB- MAPs was unknown. For example, it was theoretically possible that the two MAP2 isoforms were the products of two distinct genes, or that the MAP2 gene had been mutated in neuroblastoma patients. Alternatively, it was possible that the different MAP2 isoforms arose from different posttranslational modifications.

Except for the different molecular weight, no structural differences between the two forms of microtubule-associated protein 2 were known in the art. Without the knowledge of such structural differences, the development of a convenient to use tool for detecting the 250 kD form is quite difficult. Accordingly, the technical problem underlying the present invention was to provide a structural feature that allows the differentiation between the two MAP2 forms or the genetic material encoding these forms with a further view to using this feature for the convenient diagnosis of neuroblastoma cells. The solution to this technical problem is provided by the embodiments characterized in the claims.

Thus, the present invention relates to a diagnostic tool for the detection of NB- MAP2 expression which is

(a) a pair of primers suitable for the specific amplification of DNA molecules corresponding to at least part of MAP2 transcripts wherein neither of the primers hybridizes to a nucleotide sequence downstream from the nucleotide position 4168 and upstream from nucleotide position 4510 of the sequence depicted in Fig. 2 and the corresponding antisense sequence, respectively;

(b) an oligonucleotide that hybridizes to an NB-MAP2 specific mRNA molecule or a corresponding DNA molecule wherein said DNA molecule comprises nucleotides 4168 and 4510 of Fig. 2 adjacent to one another;

(c) an antibody specific for an epitope that is generated by translation of the region comprising the splice junction of NB-MAP2 specific mRNA; or

(d) a cDNA probe obtainable by nick-translation or random priming of DNA or RNA specific for NB-MAP and obtainable from tissue or cell probes.

In accordance with the present invention it was surprisingly found that the 250 kD form of the microtubule-associated protein 2 (NB-MAP2) arises from alternative splicing of the primary MAP2 transcripts. Due to the altered amino acid sequence as compared to the 270 kD isoform, the NB-MAP2 polypeptide is therefore encoded by a different nucleotide sequence and, additionally, provides at least one new epitope due to the altered amino acid sequence.

The present invention makes use of these alterations in nucleotide and amino acid sequences by providing diagnostic tools specific for the 250 kD isoform of MAP2 (NB-MAP2). Thus, one embodiment of the present invention relates to a pair of primers that are suitable for the specific amplification of DNA molecules which correspond to at least part of the MAP2 transcripts. These primers must hybridize to a nucleotide sequence upstream from position 4169 and downstream from nucleotide position 4509 of the sequence depicted in Figure 2 and the corresponding antisense sequence, respectively. In accordance with the present invention, this wording also comprises primers that extend beyond the above-

indicated limits, if a proof-reading polymerase is engaged in the amplification of said DNA sequence. This is because the proof-reading activity will remove any non-hybridizing sequences so that prior to the actual amplification process only primer sequences remain that hybridize within the above-indicated limits. Naturally, the person skilled in the art is in the position to also provide primers that hybridize 5' and/or 3', respectively, of the gene encoding MAP2 as long as these primers yield an amplification product.

This embodiment of the invention applied to a tissue or cell sample from a patient will yield an amplification product that is specific for the NB-MAP transcript. In addition, the transcript corresponding to the 270 kD isoform will be amplified (with reverse transcription). The amplification of the two isoforms may be visualized on a standard agarose gel. If the cell or tissue probe comprises transcripts encoding both isoforms, then the two bands of different molecular weight may be visible on such a gel. This result may be interpreted as indicative of a neuroblastoma or a cell capable of developing a neuroblastoma. On the other hand, if only one band is visible on such a gel, this band will represent the transcript encoding the 270 kD isoform. It is also possible that no band at all is visible in such a gel. In both cases the conclusion from such data is that there is no indication of a (developing) neuroblastoma.

In another embodiment, the diagnostic tool is an oligonucleotide that hybridizes to an NB-MAP2 specific mRNA molecule or a corresponding DNA molecule. In this case, said DNA molecule comprises nucleotides 4168 and 4510 of Figure 2 adjacent to one another. When designing said oligonucleotide, the person skilled in the art has to take into account that it must hybridize to a stretch of DNA or mRNA that comprises the splice junction. The design of such an oligonucleotide is, upon the knowledge of the DNA/mRNA sequence and of the mechanism of generating the two different isoforms as provided in accordance with the present invention within the skill of the person skilled in the art.

Another embodiment of the diagnostic tool of the invention relates to an antibody that is specific for an epitope that is generated by translating the region comprising the splice junction of NB-MAP2 specific mRNA. Due to the alteration of the primary nucleotide sequence encoding the 250 kD isoform as compared to the 270 kD isoform, the three dimensional structure of the encoded polypeptide changes. This change has a direct impact on the epitopes formed by the 250 kD isoform. In particular, it may be expected that a new epitope is formed by the region corresponding to the surroundings of the splice junction encoded amino acids and that a specific antibody recognizing said region may be generated.

As used herein, the term antibody" also comprises any derivative or fragment of an antibody that is specific for the 250 kD isoform. Such derivatives may be generated by genetic engineering or chemical modifications which are well known in the art and described, e.g., in Harlow and Lane, 'Antibodies, a Laboratory Manual" CSH Press, Cold Spring Harbor, 1988. Fragments include Fab'-, F(ab) ₂ - or Fv-fragments. Further comprised by the term 'antibody" are any chimeric or bivalent antibodies, the formation of which is well known in the art.

In a further embodiment of the diagnostic tool of the present invention, a cDNA probe is provided that specifically hybridizes to the mRNA encoding the 250 kD isoform (NB-MAP2). Said cDNA probes may be, in principle, be obtained from tissue or cell probes of, e.g., a neuroblastoma or ceils or tissues expected to develop a neuroblastoma. Said cDNA probes may be used for hybridization to cells or tissue probes from a patient expected to have or develop a neuroblastoma according to standard protocols.

In a preferred embodiment, the invention relates to a diagnostic tool, wherein at least one of the primers of said pair of primers hybridizes to a nucleotide sequence comprised in the sequence of Fig. 2 and the corresponding antisense sequence, respectively.

Advantageously, at least one of the primers hybridizes within the sequence encoding MAP2. This will usually result in a better efficiency of amplification and

a reduction of costs as compared to a diagnostic design where both primers hybridize to a sequence outside of the coding region of the MAP2 transcripts. Preferably, both primers hybridize within the sequence provided in Figure 2 and its corresponding complementary strand, respectively.

In a particularly preferred embodiment of the diagnostic tool of the present invention, said pairs of primers consist of a combination of the following primers, wherein S denotes sense primer and A denotes antisense primer:

S 5'-ACCAAAGAGAATGGGATCAACGG-3 ^'

S S ^' -TCGAAGATGGAGTTCCACGATC-^

S δ ^' -GGCTAAACCTGACAAAATGGCAG-S ^'

S 5 ^' -CGTTCCCTGTAAGTTTGGAGCAAG-3 ^'

S 5 ^' -TGCCGATGTCTTGCCTAGATTCC-3 ^'

S 5 ^' -TGAGAATTTATCAGGGGAGAGTGG-3 ^*

S 5 ^, -CAGATGGCTTCAGGGCTAAACATAG-3 ^,

S 5 ^' -AGCCACAGATGAGAGAGCTGATGTC-3 ^'

S 5 -ACCATTGACGACTCCATCATGG-3-

A 5'-TCTTCCCTGCTCTGCGAATTG-3 ^'

A S'-GTGGCGGATGTTCTTCAGAGAG-S ^*

A 5--AAATATTCACAAGCCCTGCTTAGC-3 ^'

A further preferred embodiment of the present invention relates to a diagnostic tool, wherein the antibody is specific for an epitope that is formed by a NB-MAP2 specific amino acid sequence comprising the amino acid sequence WVDTQAAGGE and wherein at least part of said amino acid sequence WVDTQAAGGE contributes to the formation of said epitope. The above sequence of amino acids may be generated by translation of the NB- MAP2 specific transcript. Since it does not occur in the 270 kD isoform, the epitope to which said sequence contributes may be used to generate an antibody that specifically recognizes said NB-MAP2. Alternatively, said sequence may be obtained by standard chemical procedures or by standard procedures of molecular biology including the formation of fusion proteins.

In a particularly preferred embodiment of the present invention, the antibody referred to herein above is a polyclonal antibody.

In another particularly preferred embodiment, said antibody is a monoclonal antibody.

The production of polyclonal and monoclonal antibodies is well known in the art and is not described in any further detail herein.

A further preferred embodiment of the present invention relates to a diagnostic tool wherein the specific amplification is carried out by polymerase chain reaction

(PCR).

As is the case with the generation of antibodies, the methods for carrying out a

PCR are well known in the art; see, e.g., "Short protocols in molecular biology ¹ ,'

Ausubel, F.M. et al. (eds) 1992, D.M. Coen, The polymerase chain reaction, John

Wiley & Sons, New York.

The invention further relates to a method for the detection of MAP2 specific dimorphisms in a tissue or cell probe from a patient comprising

(a) subjecting said tissue or cell probe to a PCR using the diagnostic tool of the invention;

(b) analyzing the PCR product for the presence of a NB-MAP2 specific transcript and optionally for the presence of a MAP2 specific transcript.

The method of the invention may be carried out with any pair of primers suitable for amplifying transcripts corresponding to the two different isoforms of MAP2. These primers have been described in detail herein above. The amplification product may then be analyzed for the presence of the NB-MAP2 specific transcript. The person skilled in the art is, of course, capable of devising a variety of methods as to how to analyze for the MAP2 specific dimorphism without further ado. Particularly preferred is the gel electrophoretic analysis of the occurrence of two different bands corresponding to the two different transcripts, i.e., those resulting in translations of the transcripts encoding the 250 kD and the 270 kD isoforms.

In a particulariy preferred embodiment of the method of the present invention, the analysis of the PCR product specific for the NB-MAP2 transcript is quantitative or semi-quantitative.

The (semi) quantitative analysis of the NB-MAP2 specific transcript may be used to monitor the differentiation status of the neuroblastoma tumor or of cells developing into a neuroblastoma. The results of such an analysis are therefore of potential prognostic value. Moreover, this (semi) quantitative analysis could also be used to monitor the success of the therapy and for the follow up study of patients after therapy. Methods for the quantitative or semi-quantitative analysis of DNA molecules are well known in the art. The quantitation may, e.g., be effected by referring to an internal standard.

In a particularly preferred embodiment of the present invention, said quantitation is effected by comparing the amount of NB-MAP2 specific PCR product with that of MAP2-specific PCR product.

The invention relates further to a method for the detection of NB-MAP2 specific transcripts in a tissue or cell probe from a patient comprising

(a) hybridizing RNA from said tissue or cell probe with the oligonucleotide or the cDNA of the invention; and

(b) detecting the presence or absence of said oligonucleotide or cDNA specifically bound to said RNA.

Again, hybridization and detection methods using oligonucleotides or cDNA probes are well known in the art and need not be described here any further. The knowledge of the art also comprises the appropriate conditions which should be used for an optimal hybridization of said oligonucleotide or said cDNA molecule. The detection of the presence of said oligonucleotide or cDNA may, e.g., be effected by autoradiography if the probe is radioactively labeled. Detection by conventional means may also be effected, if said oligonucleotide or cDNA is labeled with a fluorescent compound or biotinylated. However, these detection methods are only mentioned as examples and are by no means intended to exclude other detection methods from the scope of the present invention.

In a preferred embodiment of the method of the invention, said RNA is bound to a membrane.

In accordance with this preferred method of the invention, a Northern blot may be carried out before the RNA samples are probed for the presence of the NB-MAP2 specific transcript.

The invention further relates to a method for the detection of NB-MAP2 in a tissue or cell probe from a patient comprising

(a) bringing said tissue or cell probe into contact with the diagnostic tool according to the invention under suitable conditions; and

(b) detecting specifically bound diagnostic tool.

This method of the invention is particularly suitable for routine purposes in the histopathological laboratory. It will employ antibodies which are preferably monoclonal directed against an epitope generated at least in part by the amino acid sequence encoded by the splice junction specific for the NB-MAP2 isoform. As has been detailed herein above, said epitope is useful for diagnostically differentiating between MAP2 and NB-MAP2. The test will be particularly useful for the detection of a bone marrow or lung metastasis where the histopathological diagnosis of a neuroblastoma is difficult.

In a particularly preferred embodiment of the method of the present invention, said tissue or cell probe is obtained from neural crest derived parts of the peripheral nervous system, normal tissue or tumors of the neuroectodermal origin, adrenal medulla, sympathetic trunc, lymph nodes, bone, bone marrow, lung, liver, or skin, e.g., scalp.

The invention also relates to a kit comprising at least one diagnostic tool according to the invention.

Depending on the type of laboratory in which the tests for neuroblastoma or for cells having the potential of developing into a neuroblastoma are carried out, the

kit of the invention may comprise different components corresponding to the diagnostic tools of the invention. Thus, if the laboratory is a routine laboratory specialized in histopathological tissue analysis, then the kit may only comprise the antibody of the invention. On the other hand, if the laboratory is specialized in molecular biology, then the kit may only comprise at least one of the pair of primers, the oligonucleotide or the cDNA probe of the invention or any combination thereof. Naturally, the kit may also comprise any combination of the antibody with the nucleic acid tools or may comprise all diagnostic tools mentioned in connection with this invention. The kit may also comprise additional components such as buffers, diluents and so on.

The present invention additionally relates to the use of the diagnostic tool of the invention or the kit of the invention for the detection of a neuroblastoma or a cell capable of developing into a neuroblastoma in a patient. Said detection may be in vitro or in vivo. Particularly useful for the in vivo embodiment is the antibody of the invention. The physician in charge of the treatment of a patient in need of such a diagnosis is able to select an appropriate formulation, route of application and concentration of the diagnostic tool of the invention for detecting said neuroblastoma or cells. Preferably, said diagnostic tool is labeled with a marker that is externally detectable. Methods for detecting such markers are also well known in the art.

Further, the present invention relates to the use of the diagnostic tool of the invention or the kit of the invention for monitoring the success of bone marrow purging. The monitoring of the success of bone marrow purging is particularly important when homologous transplantation is envisaged. In the case that tumor cells are detected in accordance with this embodiment of the invention, the intended transplantation should be postponed until all remaining tumor cells have been eliminated from the bone marrow. In either case RNA is purified from samples of bone marrow according to standard art protocols. cDNAs are transcribed from this RNA and subjected to the polymerase chain reaction using said NB-MAP2 specific oligonucleotide primers. To monitor the development of

the therapy, this procedure has to be repeated at defined time intervals. The person skilled in the art is capable of performing such reactions.

The invention further relates to an epitope that is formed by a NB-MAP2 specific amino acid sequence comprising the amino acid sequence WVDTQAAGGE wherein at least part of said amino acid sequence WVDTQAAGGE contributes to the formation of said epitope.

Additionally, the present invention relates to a recombinant protein and a recombinant fusion protein comprising the epitope of the invention. There is ample knowledge in the art as to the production of such recombinant protein/fusion proteins. It is important for the purposes of the present invention that the above epitope is comprised in such a way in said recombinant proteins/fusion proteins that it is exposed to the environment. This exposure is necessary in order to induce a specific antibody response.

Furthermore, the invention relates to a method of generating NB-MAP 2 specific antibodies comprising immunizing an appropriate animal with NB-MAP 2 or the recombinant protein/fusion protein of the invention and isolating antibodies/antisera generated.

The antibodies induced by the immunization may be isolated as polyclonal or monoclonal antibodies.

Also, the present invention relates to the use of the epitope of the invention, the recombinant fusion protein of the invention or NB-MAP2 for the generation of NB- MAP2 specific antibodies.

Finally, the present invention relates to a pharmaceutical composition comprising an antisense-oligonucleotide capable of hybridizing to a sequence in the NB-MAP mRNA or a corresponding DNA molecule wherein said sequence in said DNA comprises nucleotides 4168 and 4510 of Figure 2, adjacent to one another, and a pharmaceutically acceptable carrier.

In other words, the oligonucleotide comprised in the pharmaceutical composition of the present invention is inverse complementary to a nucleotide sequence comprising the NB-MAP2 specific splice junction that has been discovered in accordance with the present invention. The oligonucleotide of the invention therefore inhibits the expression of NB-MAP 2 protein. This inhibition is expected to lead to a differentiation of the neuroblastoma to a normal ganglioneuron. This differentiation process results in a significant reduction of the malignancy of the primary tumor and is therefore of paramount therapeutic importance.

The actual length and nucleotide sequence of the oligonucleotide comprised in the pharmaceutical composition of the invention may vary and can be determined by the person skilled in the art. The only prerequisite is that said oligonucleotide hybridizes under suitable conditions intracellularly to its target, such that expression of the NB-MAP2 protein is inhibited or reduced to a significant extent. Preferably, said oligonucleotide is at least 15 nucleotides long. The actual formulation and the best method of application of the pharmaceutical composition of the invention are also well within the skill of the art.

The figures show:

Figure 1 :

• Schematic representation of the normal human and NB-MAP2 cDNA. The coding region is symbolized by a box, non-coding regions are indicated by a line. The nucleotide sequence encoding the microtubule binding domain is presented by oblique lines. The region between positions 4169 and 4509 including these positions (grey) is not present in NB-MAP2.

Figure 2:

• Complete sequence of the human MAP gene including the 3' untranslated region. The nucleotide sequence is shown in accordance with the correct codon usage resulting in the proper translation product.

The examples illustrate the invention.

Example 1 : Tissue culture of neuroblastoma cells.

Neuroblastoma cells of the cell line IMR-32 (ATCC CCL 127), SK-N-SH (ATCC HTB11) or LA-N1 were grown in flasks containing 20 ml medium (RPMI): to each 500 ml of RPMI without L-glutamine were added the following components prior to use: 10 ml of 200 mM stock solution L-glutamine, 5 ml of penicillin/streptomycin stock solution with 10,000 units/ml and 50 ml of pre- warmed fetal calf serum (FCS). Cells were incubated at 37°C in 5% CO ₂ and divided 1 :5 every fourth day.

Example 2: Extraction of RNA from neuroblastoma ceils.

All cells from flasks with a sufficiently high titer were scraped from the walls of said flasks and resuspended in 5 ml 1x PBS. The cells were centrifuged for 5 minutes at 2000 rpm and 4°C. After resuspension of the cell pellet in 1 ml ice cold 1x PBS the cells were again centrifuged at 2000 rpm and 4°C. This resuspension and centrifugation step was repeated once more. To the cell pellet were then added 750 μl RNA-extraction buffer (0.14 M NaCl, 1.5 mM MgCI ₂ , 10 mM Tris-HCl; pH 8.6, 0.5% Nonidet P-40, 1 mM DTT) and 2.5 μl RNAse-inhibitor (Boehringer-Mannheim). Cells were vortexed for 15 minutes and put for 5 minutes on ice. Afterwards, cells were centrifuged for exactly 90 seconds at 12,000 φm at 4°C. The supernatant was transferred to a new vial and 750 μl proteinase digestion buffer (0.2 M Tris-HCl, pH 8.0, 25mM EDTA, pH 8.0, 0.3 M NaCl, 2% SDS) were added. The vial was vortexed for 5 seconds and afterwards 4 μl of proteinase K (50 microgram/ml) were added. Cells and proteinase K were mixed by inverting. Afterwards, the mixture was incubated for 30 minutes at 37 ^β C. Subsequently, an equal amount of phenol/chloroform (1 :1, vol/vol) was

added. The mixture was vortexed for several seconds and centrifuged for 5 minutes at 15,000 rpm and 4°C.

The aqueous phase was removed and precipitated with the same volume of ice cold isopropanol for 30 minutes on ice. The precipitate was centrifuged for 10 minutes at 12,000 rpm and 4°C, the supernatant was discarded and the pellet washed with 1 ml of 70% (vol/vol) ice cold ethanol. Finally, the precipitate was centrifuged for 10 minutes at 15,000 rpm and 4°C, the supernatant was discarded and the pellet dried, resuspended in water and stored at minus 70°C. The RNA was used for the purposes of the present invention within several weeks. If a longer storage was desired, the RNA was kept in 70% ethanol.

Example 3: Reverse transcription and PCR

For reverse transcription, the following protocol yielded satisfying results, especially when large PCR products were to be obtained.

50 μg of total cytoplasmic RNA prepared according to Example 2, 100 pmol backward primer, 6 μl 3M sodium acetate and 200 μl absolute ethanol were combined. The RNA and the oligonucleotide primers were co-precipitated for 15 minutes at -70°C. The precipitate was then centrifuged for 15 minutes at 12,000 rpm at 4°C whereupon the supernatant was discarded. The pellet was washed with 200 μl of 70% ethanol in water and dried for 3 minutes in a "speedvac" centrifuge. The pellet was resuspended in 4 μi of 5x RT-buffer (Gibco) and 10 μl of water. This solution was incubated for one minute at 95°C, for 5 minutes at 67 ^β C and for 1 minute at 52°C. The vial was spinned for a few seconds and 1 μl RNAse-inhibitor (Boehringer-Mannheim) was added. Then 2 μl dNTPs (5 mmol each), 2 μl 0.1 DTT and 2 μl reverse transcriptase (Superscript, Gibco) were added, the solution was incubated for 2 hours at 27 ^β C, incubated for a further two hours at 37 ^β C and finally the reverse transcriptase was inactivated by incubation for 5 minutes at 60 ^β C. For PCR, a total volume of 50 μl was used. To 10 μl of

the reverse transcribed RNA 30 μl of water, 5 μl of 10x PCR buffer including magnesium, 2 μl dNTPs (5 mmol each), 100 pM sense-primer and 1 μl Taq- polymerase were added. The reaction mixture was overlaid with 1 to 2 drops of light mineral oil whereupon the thermocycler was started. The cycler was programmed as follows:

Stepl 92°C 30 sec Step 2 54X 1 min Step 3 72°C 1 min

Steps 1 to 3 were repeated 35 times. Before applying the reaction product on an agarose gel, to each vial 1 μl RNAse was added and the solution was incubated for 30 minutes at 37°C. Subsequently, the reaction product was analyzed on a 1% agarose gel, which was run for one hour at 100 volts.

The following oligonucleotides were used in the experiments : ( F = forward / sense-Primer B = backward / antisense-Primer)

name sequence Tm ("Celsius)

1 F 5 ^' -ACCAAAGAGAATGGGATCAACGG-3 ^' 58,0

1 B 5'-TTAGGGAGGTCAATGCCAGGTAC-3 ^" 56,0

2F 5 ^' -TCGAAGATGGAGTTCCACGATC-3 ^' 55,5

2B 5 ^' -TGGTGCTTCTGCCATTTTGTC-3 ^" 55,1

3F 5--GGCTAAACCTGACAAAATGGCAG-3 ^' 56,7

3B 5 ^* -TGATGTTGCAGCTCCAACTCCTTC-3 ^' 59,3

4F 5'-CGTTCCCTGTAAGTTTGGAGCAAG-3 ^' 58,1

4B 5 -CGGAAGCCAGAGGAGAAAGATC-3 ^' 56,0

5F 5 ^* -TGCCGATGTCTTGCCTAGATTCC-3 ^' 59,1

5B 5'-CTGCTGCCAGTTTCACTTCAATC-3 ^' 55,5

6F S'-TGAGAATTTATCAGGGGAGAGTGG-S ^' 55,4

6B 5 ^* -ATGAGGGGGTCATGTCCTGTGTAG-3 ^' 57,8

7F S ^' -CAGATGCCTTCAGGGCTAAACATAG-S ^' 57,3

7B 5 ^* -TCGTTTCATGCAATGGCTCTG-3 ^' 56,0

8F 5'-AGCCACAGATGAGAGAGCTGATGTC-3 ^' 57,8

8B 5'-CCATGATGGAGTCGTCAATGGTG-3 ^' 58,7

9F 5'-ACCATTGACGACTCCATCATGG-3 ^' 55,9

9B 5'-TCTTCCCTGCTCTGCGAATTG-3 ^* 56,8

10F 5'-CTCCCAAGACCTTCCTCCATTC-3 ^' 55,5

10B 5 ^' -GTGGCGGATGTTCTTCAGAGAG-3 ^' 55,3

MTB-F 5"-CACTGCCAGACCTGAAGAAT-3 ^" 49,0

MTB-B 5 ^' -AAATATTCACAAGCCCTGCTTAGC-3 ^* 55,1

The following table provides an overview of the primer pair's use, the size of the product that should be obtained, the first (begin) and the last (end) nucleotide sequence from Figure 2 (which corresponds to the cDNA sequence of the MAP2 gene) that was amplified.

primerpair size of product begin end

(bp) (bp) (bp)

1F/1 B 542 208 749

2F/2B 681 457 1137

3F/3B 547 1107 1653

4F/4B 696 1481 2176

5F/5B 654 2099 2752

6F/6B 587 2646 3232

7F/7B 511 3151 3661

8F/8B 599 3540 4138

9F/9B 634 4117 4750

10F/1 OB 531 4609 5139

MTB-B/MTB-F 493 4988 5481

The PCR experiments provided the following results:

From calculations that were based on the prior art knowledge, PCR with primer pairs 9B/9F should result only in a single band of 634 bp size, 10B/9F of 1022 bp and MTB-B/9F of 1364 bp. But in all 3 PCRs appeared an additional band, each about 340 bp smaller.

A Southern blot with these PCR gels gave two strong signals after hybridizing with ³² P-labeled MAP27cDNA.

Subcloning in pBluescript and sequencing of the lower band finally revealed a new splice variant of MAP2 in human neuroblastoma cells, in which nucleotides

4169 to 4509 of Fig. 2 were missing.

Example 4: Southern blots

After electrophoresis the agarose gels were put into 250 mM HCl for 5 minutes at room temperature. The gels were briefly rinsed with water and the DNA subsequently denatured for 30 minutes at 1.5M NaOH. The gel was briefly rinsed with water and finally put into renaturation solution (3M NaCl, 0,5M Tris-HCl, pH 7.5).

The gels thus prepared were overlaid with a nylon membrane, and with Whatman papers, according to standard procedures, and blotted overnight. DNA was fixed, e.g., by using UV-crossl inking. Hybridization was effected overnight at 42 to 45°C, then the membrane was washed at 68°C for 15 minutes in 2 x SSC, 0.1 % SDS (twice) and 0.1 x SSC, 0.5% SDS (once). Subsequently, the membranes were exposed to autoradiographic films for about 12 hours.

Example 5: Design of recombinant protein/fusion proteins

The recombinant proteins/fusion proteins comprising the epitope generated by the different splicing that is indicative of the 250 kD isoform may be used to prepare NB-MAP2 specific monoclonal or polyclonal antibodies or any derivative thereof as outlined above.

The strategy of generating said recombinant protein/fusion proteins used was the following: a) Synthesis of a new primer pair (NB4F and NB4B), which produces the correct cDNA for expression of fusion proteins

NB4F : 5' - AGGTGCCAGGGAGGAATTTG - 3', begin at position 3777 of human NB-MAP2/cDNA.

NB4B : 5' - GTGTGCGTGAAGAATAACTTGGTG - 3', end at position 4828 of human NB-MAP2 CDNA.

18 b) PCR with NB4 on RNA from neuroblastoma cells according to the protocol outlined in Example 3.

c) Subcloning and sequencing of the lower molecular weight band after gel electrophoresis corresponding to the NB-MAP2 specific transcript.

d) Use of modified primers in order to introduce restriction enzyme cutting sites in a PCR, using subcloned NB4-cDNA as a template.

Modified NB4 primer for introduction of restriction sites :

FBNB4F: 5' - CGGGATCCAGGTGCCAGGGAGGAATTTG - 3' FBNB4B: 5' - CCCAAGCTTGTGTGCGTGAAGAATAACTTGGTG - 3'

PCR : The reaction mixture consisted of 10 ng cDNA cloned in pBluescript, 5 μl 10x PCR-buffer, 2 μl dNTP (δmmol each), 50 ng FPNB4F primer, 50 ng FPNB4B primer, 1 μl Taq-polymerase, water up to 50 μl.

Step l: 95°C 3 min

Step 2: 54°C 45 sec

Step 3: 72 ^β C 45 sec

Step 4: 95 ^β C 30 sec

Steps 2-4 were repeated 35 times.

e) Restriction of amplified, renatured DNA (now bearing the restriction sites) with restriction enzymes BamHI and Hindlll.

f) Subcloning of the fragment of interest in expression vectors Quiagen pQE31 and 41.

pQE 31 : EcORI/RBS-ATGAGAGGATCT-6xHistidine-AC-BamHI-Sphl- Sacl-Kpnl-Smal-Sall-Pstl-Hindlll-AATTAGCTGAG-to

pQE 41 : EcORI/RBS-ATGAGAGGATCG-6xHistidine-BamHI-DHFRS- GGTTC-Bglll-Sphl-Sacl-Kpnl-Smal-Sall-Pstl-Hindlll-AATTAGCTGA G- to

g) Transformation of E. coli M15 cells (or other commonly used laboratory strains of E. coli like XL1-blue, or JMNalpha) with the recombinant vectors specified in step f), plating and liquid cultures in LB-medium containing ampicillin according to standard procedures.

h) Induction with isopropylthio-β-D-galactoside (IPTG) (1mMol) and purification of the expressed protein/fusion protein on Ni-affinity according to the manufacturer's instructions (Quiagen) with subsequent dialysis against an appropriate volume of phosphate buffered saline.