Inventors: Michal Eisenbach- Schwartz, Irit Sagi, Ravid Shechter, Anat London and Ana Catarina Aidos Raposo FIELD OF THE INVENTION

[0001] The present invention relates to methods for treating central nervous system injury and, in particular, it relates to methods for treating spinal cord injury by the administration of matrix metalloproteinase MMP-13 or of resolving phenotype macrophages expressing it. BACKGROUND ART

[0002] Every year, spinal cord injury (SCI), a debilitating condition with a limited prognosis for recovery, paralyzes around 130,000 people. The poor recovery of the central nervous system (CNS), a delicate tissue that cannot tolerate toxicity, is generally attributed to the hostile local milieu created at the trauma site. Two major barriers to repair that have been identified include the local inflammatory response, acknowledged for its neurotoxic potential, and the creation of the glial scar, known to impair regeneration (Block et al , 2007, Popovich et al , 1999, Silver and Miller 2004). The axonal growth inhibitory effects of the scar matrix were supported by numerous in-vitro studies demonstrating that such molecules cause neurite retraction and growth cone collapse (Luo and Raper, 1994), along with their well- defined developmental role in formation of boundaries. Accordingly, research efforts and clinical manipulations were directed at attempts to eliminate and reorganize the chemical components of the glial scar (Bradbury et al. , 2002, Moon et al, 2001) and to suppress the ensuing immune response (Baptiste and Fehlings, 2007). Recent studies, however, indicated that the scar and some immune cell populations each have independent transient positive roles. The glial scar was shown to provide an 'SOS' response, a distress signal initiated by the tissue in response to the trauma that demarcates the lesion site and restores the isolation of the CNS from the circulation (Rolls et al, 2009; Rolls et al, 2008). Likewise, leukocytes were demonstrated to promote removal of tissue debris, secrete neurotrophic factors, and support axonal regeneration (Ma et al, 2002; Kigerl et al, 2009; Barrette et al, 2008; Stirling et al, 2009; Shechter et al, 2009; Rapalino et al, 1998).

[0003] Recently, a pivotal role for recovery was attributed to monocyte-derived macrophages that infiltrate the damaged CNS due to their non-classical anti- inflammatory/resolving properties (Kigerl et al, 2009; Shechter et al., 2009). These cells were shown to produce the anti- inflammatory cytokine, interleukin 10 (IL-10) and to terminate the local microglial response. Due to their inflammation-resolving properties, these monocyte-derived cells correspond to the previously identified macrophage subset with immunoregulatory properties, the resolving/regulatory macrophages, observed in wound healing (Gordon, 2003; Mosser and Edwards 2008) or myeloid derived suppressor cells (MDSC), which occur in cancer.

[0004] Comparable suppressive monocytes were identified in other pathologies, ranging from cancer to myocardial infarction, and tissue matrix modulation and regeneration properties were attributed to monocyte-derived macrophages, more specifically to the anti-inflammatory subset (Arnold et al., 2007; Nahrendorf et al., 2007). These recent advances revealing macrophage heterogeneity and monocyte plasticity brought this often neglected population back into the spotlight. Until now, the main factor determining the phenotype of the monocytes was thought to be the surrounding cytokine milieu (Gordon, 2003; Mosser and Edwards 2008; Qian and Pollard 2010). While a pro-inflammatory milieu, enriched in either IFN-γ or TNF- a, skews monocytes towards a classical pro-inflammatory (Ml) phenotype, a Th2/anti-inflammatory environment, composed of IL-4 and IL-13, or IL-10 and TGF , generates alternatively-activated (M2) or resolving phenotype macrophages, endowed with healing properties (Kigerl et al., 2009; Shechter et al., 2009).

[0005] The glial scar matrix component chondroitin sulfate proteoglycan (CSPG) is considered to be a major obstacle for central nervous system (CNS) recovery after injury, especially in light of its well-known activity in limiting axonal growth, and therefore, its degradation has become a key therapeutic goal in the field of CNS regeneration. CSPG was recently found to have immunomodulatory effects on microglial education, as well as on the spatial organization of infiltrating monocytes (Rolls, 2008).

[0006] Scar resolving properties were recently ascribed to macrophages in the resolution of a different kind of collagen-based scar, during hepatic fibrosis, in which matrix metalloproteinase 13 (MMP-13) plays a fundamental role (Fallowfield et al, 2007).

[0007] MMP-13 encodes for the enzyme collagenase 3, and belongs to the family of matrix metalloproteinases (MMP), involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMPs are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The main physiological substrates for MMP-13 are native collagen types I, II, III, VII, X, gelatin, Entactin, Tenascin and Aggrecan.

SUMMARY OF INVENTION

[0008] It has been found in accordance with the present invention, that culturing naive monocytes on the glial scar matrix component chondroitin sulfate proteoglycan (CSPG) causes increased expression of the anti-inflammatory cytokine IL-10 characteristic of resolving phenotype macrophages, as well as increased expression of the matrix metalloproteinase MMP-13. The IL-10 secreting macrophages have a role in promoting resolution of local inflammation and axonal regeneration. It has additionally been found in accordance with the present invention, that expression of MMP-13 in post- injury spinal cord samples was negatively affected by the depletion of the infiltrating monocytes, and that infiltrating monocytes resolve glial scar matrix accumulation via the production of MMP-13, which is essential for functional recovery from spinal cord injury. [0009] The present invention relates to a composition comprising resolving phenotype macrophages expressing MMP-13 for use in the treatment of spinal cord injury.

[0010] The present invention further relates to a method for treating spinal cord injury in a subject in need thereof, comprising administering to said subject an effective amount of resolving phenotype macrophages expressing MMP-13 to thereby treat spinal cord injury in said subject.

[0011] The present invention also provides a composition comprising resolving phenotype macrophages obtained by culturing on a substrate comprising at least one glial scar matrix component for use in the treatment of spinal cord injury.

[0012] The present invention additionally provides a method for treating spinal cord injury in a subject in need thereof, comprising administering to said subject an effective amount of resolving phenotype macrophages obtained by culturing on a substrate comprising at least one glial scar matrix component to thereby treat spinal cord injury in said subject.

[0013] The present invention further provides a composition comprising MMP-13 for use in the treatment of spinal cord injury.

[0014] The present invention also provides a method for treating spinal cord injury in a subject in need thereof, comprising administering to said subject an effective amount of MMP-13 to thereby treat said spinal cord injury.

[0015] The present invention additionally provides a method for obtaining resolving phenotype macrophages comprising culturing naive monocytes on a substrate containing at least one glial scar matrix component.

[0016] The present invention also provides a method for obtaining resolving phenotype macrophages expressing MMP-13, comprising culturing naive monocytes on a substrate containing at least one glial scar matrix component.

BRIEF DESCRIPTION OF DRAWINGS

[0017] Fig. 1 Shows simultaneous analysis of the cytokine levels at the injured spinal cord by Multiplex Bead-based Luminex Assays). Pooled samples (n=3) were analyzed. The results are presented as a ratio of cytokine levels in injured relative to the non-injured spinal cord. For illustrative purposes, the ratio of the levels of antiinflammatory cytokines in injured to non-injured spinal cord (which was less than 1) is presented as the negative of the reciprocal ratio. One representative experiment is shown out of two repetitions, conducted at three different time points during the first week post injury (days 1, 3 and 7). The same tendency was observed for each time point tested, and in each repetition. The injury skews the local environment towards a pro-inflammatory milieu. Cytokines tested (from left to right) were: proinflammatory cytokines IL-Ιβ, IL-12, IL-17, IL-6, MCP-1 and TNF-a, and antiinflammatory cytokines IL-10, IL-13 and TGF-β.

[0018] Fig. 2 shows a kinetic evaluation of IL-10 expression at the lesioned spinal cord after injury. Spinal cord sections were isolated at different time points following injury and immunostained for IL-10 (red) and glial fibrillary acidic protein (GFAP, green). Top left panel shows non-injured spinal cord, top right panel shows injured spinal cord section isolated at day 1 post injury, middle panels show injured spinal cord section isolated at days 4 (left panel) and 7 (right panel) post-injury. Bottom panels (small): non injured sections were also co-stained for the neuronal marker, Hu (green), and the cytokine, IL-10 (red). IL-10 staining only shown on left panel; Hu staining only in the middle panel; and co-staining shown at the right panel. Scale bar; 50 μπι.

[0019] Figs. 3A - 3B show that resolving phenotype macrophages are restricted to a region enriched with glial scar matrix. (A) Spinal cord sections of injured [Cx ₃ crl ^GWI+ > wild-type (wt)] bone marrow (BM) chimeras, isolated at day 7 post injury, were co-stained (left panel) for the infiltrating monocytes by GFP (green), which identifies the construct Cx ₃ crl ^GW , and for the anti-inflammatory cytokine, IL-10 (red), or (right panel) with GFP (green) and with anti-CSPG (chondroitin sulfate proteoglycan) antibody CS-56 (blue). The lesion epicenter is marked with a dashed circle. The three small panels in the middle are enlargements of a representative area from the margin of the lesion shown in the left panel, viewed through different filters (from top to bottom - for IL-10 only (red); for Cx ₃ crl ^G ™ ⁺ only (green); and for both) in order to demonstrate the overlap in expression of the two markers (B) Injured spinal cord sections, isolated at day 7 post injury, co- stained to reveal IL-10 expressing monocytes (red) and the glial scar astrocytes (GFAP, green, left and middle panels) or the matrix protein CSPG (blue, right panel), showing that resolving phenotype macrophages are restricted to the CSPG- enriched area around the lesion epicenter. The lesion epicenter is labeled "lesion" and marked with a dashed line in the middle and right panel. The middle panel is an enlargement of the region in the square in the left panel. Scale bar; 50 μπι.

[0020] Figs. 4A - 4K show that the glial scar component CSPG determines the resolving/anti-inflammatory phenotype of the encountering monocytes. (A) Schematic illustration showing the experimental design. BM chimeras [Cx3crl ^GFP/+ >wt] were prepared as described in the methods by irradiation and reconstitution with BM cells, resulting in their blood containing Cx3crl ^{GFP +} monocytes (green), which can be distinguished from the resident microglial cells of the central nervous system (CNS, blue). The chimeras were subjected to spinal cord injury (SCI) using an impactor, 8 weeks following BM transplantation. Scar tissue including astrocytes and CSPGs develops in the lesioned spinal cord (SC) following injury. Immediately post injury, mice were treated with xyloside, an inhibitor of CSPG production, or with phosphate buffered saline (PBS) as control twice a day for 5 consecutive days. b-ΜΦ: BM (transplanted) macrophages; m-ΜΦ: microglial (resident) macrophages. (B) Quantification of CSPG levels (in arbitrary units of CS- 56 immunoreactivity) at the lesioned spinal cord following treatment with PBS (left bar) or xyloside (right bar), as assessed immediately after the last injection (Student's t-test; ***p < 0.001). (C) Labeling of spinal cord sections for detection of CSPG (red) and GFP (for detecting Cx3crl ^GFP , green). Inhibition of CSPG synthesis by xyloside (right panel) disrupts the spatial compartmentalization of the infiltrating monocytes (Cx3crl ^GFP ), which are now located at the epicenter of the lesion, as opposed to treatment with PBS (left panel). (D) Representative pictures of the localization of IL-10-expressing monocytes (red) relative to the lesion epicenter, demarcated by GFAP expression by astrocytes (green), at day 7 post injury. Xyloside treatment abolished marginal expression of this anti-inflammatory cytokine (right panel), compared with treatment with PBS (left panel). (E) Quantitative analysis of IL-10 immunoreactivity (left panel, arbitrary units, Student's t-test; **p = 0.004) and number of IL-10 expressing cells per mm ² (right panel, Student's t-test; *p = 0.04), at day 7 post injury, in 2 mm ² isolated tissue sections, including lesion site, margin and surrounding parenchyma. Both panels - left bar - treatment with PBS, right bar- treatment with xyloside. (F) Quantification of activated microglia/macrophages according to IB-4 immunoreactivity (arbitrary units, Student's t-test; **p = 0.007), as measured at day 14 post injury in 2 mm ² tissue sections, including lesion site, margin and surrounding parenchyma. Left bar - treatment with PBS, right bar- treatment with xyloside. (G-K) In-vitro cultures of naive CD115 ⁺ monocytes seeded on poly-D-lysine (PDL) or CSPG-coated flasks (3-4 cultures per group were analyzed in each experiment). The results presented are representative of several independent experiments performed. (G, H) Flow cytometric analysis with staining for intracellular expression of IL-10 reveal two distinct cell populations (Rl and R2). (G) Left panel - monocytes seeded on PDL; right panel - monocytes seeded on CSPG; the numbers in the left and middle panels correspond to the cell count of the R2 population; FSC (forward scatter) correlates with cell size; SSC (side scatter) is related to granularity. (H) Left panel - cell count of CSPG-seeded monocytes as a function of IL-10 expression in the Rl (line with circle) and R2 (line with square) cell populations shown in (G); middle and right panels - Cell count of the R2 population as a function of IL-10 expression in CSPG- seeded monocytes (line with circle, right-hand bar) compared with PDL- seeded monocytes (line with square, left-hand bar). (Student's t-test; *p= 0.025). (I) Cultures were harvested for analysis of IL-10 mRNA expression by Real-Time PCR (Student's t-test; *p = 0.05), presented as expression relative to the housekeeping gene PpiA. Left-hand bar: seeding on PDL (P), right-hand bar - seeding on CSPG (C). (J) IL-10 protein concentration in the supernatant: 5 days following seeding, supernatants were analyzed by ELISA for IL-10 protein expression immediately (left two bars, **p = 0.0021), or 8 hours after replacing the medium with a fresh medium (right two bars, Student's t-test; *p = 0.015); in each set the left bar represents cells seeded in PDL (P) and the right bar represent cells seeded in CSPG (C). (K) Higher IL-10 mRNA expression was observed in the CSPG coated dish even in the presence of IFN-γ, indicating that CSPG is a strong determinant of the resolving phenotype, even under pro-inflammatory/Ml -skewing conditions. Scale bar; 50μπι. y-axis error bar represents standard error of the mean (SEM), left bar - cells seeded on PDL (P); right-bar - cells seeded on CSPG (C).

[0021] Figs. 5A - 51 show that infiltrating monocytes resolve glial scar matrix accumulation. (A) Flow cytometry analysis of spinal cord tissues isolated from spinal cord of injured [(¾cr/ ^{GFP +} >wt] BM chimeras at day 7 post trauma. The histograms are pre-gated according to the presented topography plot, following first gating on CDl lb ⁺ cells. The line marked with a circle represents the sample, while the line marked with a square represents isotype control. (5Ai) shows that 55% of the Cx3crl expressing cells also express CD 11c. (5Aii) shows the reciprocal, i.e. that 39% of CDl lc expressing cells also expresses Cx3crl. (B) Representative confocal micrograph of longitudinal sections isolated at day 7 post injury from injured spinal cord of [Cx3crl ^{GFP +} >wt] BM chimeras, labeled for CSPG (CS-56, blue), Cx3crl ^GFP (GFP, green), and CDl lc (red). Lower panel: z-axis projection of a single cell. Single cells are viewed from different axes, showing that CDl lc is expressed on the cell surface. The lesion epicenter is labeled as a dashed circle. (C) Schematic illustration of the experimental design: [CDllc-DTR: (¾cr/ ^{GFP +} >wt] BM chimeras were generated as described in the methods and in Fig. 4A, resulting in their blood containing CDllc- ^mR : Cx ₃ crl ^GWI+ monocytes (green). These mice were subjected to SCI, 8 weeks post BM transplantation; half of them received diphtheria toxin (DTx), which caused depletion of the BM (transplanted) macrophages (b-ΜΦ) carrying the diphtheria toxin receptor (DTR) (green) such that only the microglial (resident) macrophages (m-ΜΦ) remain. CNS - central nervous system; SC - spinal cord; (D) Flow cytometric analysis of cells from the lesion site of DTx-treated and non-treated [CDllc-OTR: <¾cr7 ^{GFP +} >wt] BM chimeras, demonstrating depletion of CDl lc-expressing monocytes but not of their resident counterparts, the microglia. The histograms were pre-gated according to the presented topographic plots with CD l ib and then with CDl lc.The line marked with a circle in the right panel represents the PBS treated control mice while the line marked with a square represents DTx treated mice. 39% of CD 11c cells also express Cx ₃ crl (the blood born cells, as also shown in Fig. 5 A), but only 12% of CD 11c cells express Cx ₃ crl after depletion with DTx. (E, F) Labeling of the spinal cord tissues sections, isolated at day 14 post injury, with GFP (green) and CS-56 (white). (E) Left panel - w/o DTx treatment; right panel - after DTx treatment. (F) Quantitative analysis of CSPG (CS-56) immunoreactivity (in arbitrary units) is presented, left bar without DTx and right bar after treatment with DTx. Depletion of monocytes by DTx dramatically increased CSPG accumulation (Student's t-test; ***p = 0.0001) (G-I) Spinal cord injured [CDllc-OTR: <¾cr7 ^{GFP +} >wt] BM chimeric mice were treated with DTx and adoptively transferred with wild-type (wt) CD 115+ monocytes (resistant to DTx treatment). Control groups included chimeric animals without monocyte transfer, with and without DTx treatment. (G) Flow cytometric analysis of the spinal cord lesion site with (right panel) or without (left panel) adoptive transfer of CD115 ⁺ monocytes (CD45.1 ⁺ ) following DTx treatment. (H,I) Spinal cord tissues sections, isolated at day 14 post injury, labeled for CSPG (with CS-56; white), with (right panel) and without (left panel) reconstitution of wild-type monocytes (H). Quantitative analysis of CSPG immunoreactivity (I). Depletion of monocytes by DTx dramatically increased CSPG accumulation, shown in arbitrary units of CS-56 immunoreactivity (middle bar), which was prevented by adoptive transfer of naive monocytes (right bar) (ANOVA; F _2;10 = 5.46; p = 0.05). Scale bar: (B) 100 μπι (bottom panel; 10 μπι); (Ε,Η) 50 μπι. y-axis error bar represents SEM. Left bar - no DTx treatment and no monocytes transfer.

[0022] Figs. 6A - 6H show that infiltrating monocytes resolve glial scar matrix accumulation via the production of MMP-13. (A) Analysis of mRNA expression of various Mmp genes (from left to right: Mmp-2, Mmp-8, Mmp-9, Mmp-12 and Mmp-13) relative to the housekeeping gene PpiA in excised spinal cord tissues of [CDllc-OTR: (¾cr/ ^{GFP +} >wt] BM chimeras, with (gray, right bar of each couple) or without (black, left bar of each set) DTx treatment (Student's t-test; *p = 0.02). (B-D) Immunohistochemical labeling of the injured spinal cord sections of [Cx ₃ crl ^GFP/+ >wt] BM chimeric mice for MMP-13 (red), together with IB-4 (green) (B); or GFP (green), MMP-13 (blue) and CDl lc (red) (C, D). D is an enlargement of an area around the lesion margin in C. The lesion epicenter is marked by dashed lines. (E,F) [wt>wt] (E, left panel) or [MMP-13 ^{_ ~} >wt] (E, right two panels) BM chimeras were subjected to spinal cord injury 8 weeks following transplantation, and analyzed 14 days post trauma for CSPG immunoreactivity by staining with CS- 56. Representative pictures are presented in E. The right-most panel is an enlargement of the marked region of the middle panel. "Margin" represents the area surrounding the lesion and "site" represents the lesion area. Individual quantification of CSPG by CS-56 immunoreactivity in 2 mm ² sections, including lesion site margin and surrounding parenchyma is shown in (F). Deficiency in MMP-13 resulted in increased accumulation of CSPG (Student's t-test; n=6-7; ***p = 0.0002). Left group of diamonds - [wt>wt]; right group of squares - [MMP-13 ^A >wt]. (G,H) [CDl lc-DTR > wt] BM chimeric mice were subjected to spinal cord injury 8 weeks following BM transplantation, and CSPG (CS-56) immunoreactivity was evaluated 14 days post injury. Representative pictures are shown in G. Four groups were used: one group left untreated (top left panel), one group was treated with DTx alone (top right panel), and the other two groups received DTx in parallel to transfer with DTx-resistant monocytes isolated from either wt (bottom left panel) or MMP-13 knockout (KO) mice (bottom right panel). The right-side panel is an enlargement of the region marked in the bottom right panel. Individual quantification is shown in (H) (ANOVA; F _3;22 = 15.4; n=5-7 per group ;p <0.0001). While reconstitution with wt monocytes restored the regulation of CSPG accumulation, MMP13 ^A monocytes failed to do so. Scale bar representation; 50 μιη. Groups (from left): w/o DTx (diamonds); with DTx only (squares); with DTx and transfer of wild-type monocytes (triangles); with DTx and transfer of MMP-13 deficient monocytes (circles).

[0023] Figs. 7A - 7H show that expression of MMP-13 by infiltrating monocytes is essential for functional recovery from spinal cord injury. (A-D) [wt>wt] or [MMP-13 ^" wt] BM chimeras were subjected to spinal cord injury 8 weeks post transplantation. (A,B) Motor function evaluation was performed according to the Basso Mouse Scale (BMS). Follow up is shown in A and individual scorings at day 21 are shown in B. Deficiency in MMP-13 resulted in worse motor function (A- Repeated ANOVA; F _between _ _groups (l,16)=13.4; p<0.0001; B- Student's t-test; n= l 1 per group; ***p < 0.001). Diamonds - [wt>wt]; squares - [MMP-13 ^_ wt]. (C,D) Representative pictures of lesion sites stained for myelin integrity by luxol Nissl is presented in C. left panel - [wt>wt]; right panel - [MMP-13 ^{" _} >wt]. Individual lesion size (in mm ² ) evaluation according to luxol Nissl staining is shown in D. Diamonds - [wt>wt]; squares - [MMP-13 ^{" _} >wt]. Increased lesion size is observed in MMP-13 deficient chimeras {Student's t-test; n=5-6 per group; **p = 0.004). (E-H) [CDl lc- DTR > wt] BM chimeric mice were subjected to spinal cord injury (SCI) 8 weeks post BM transplantation. Four groups were used: one group was left untreated (diamonds), one group was treated with DTx alone (squares), and the other two groups received DTx in parallel to transfer with DTx-resistant monocytes isolated from either wild-type (triangles) or MMP-13 KO mice (circles). (E,F) Motor function evaluation was performed according to the BMS. Follow-up is shown in E and individual scorings at day 14 are shown in F. DTx depletion resulted in worse recovery. While reconstitution with wt monocytes restored lost motor function, replenishment with MMP-13 KO monocytes failed to do so (E-Repeated ANOVA; _P <0.0001; F- ANOVA; F(3,39)=44.15; p < 0.0001). Diamonds: control (no DTx); squares: with DTx; triangles: DTx and wild-type monocytes; circles: DTx and MMP13 deficient monocytes; SCI - timing of spinal cord injury. (G,H) Representative pictures of lesion sites stained for myelin integrity by luxol Nissl are presented, (G). Top left panel - control (no treatment); top right panel - DTx treatment only; bottom left panel - DTx treatment followed by transfer of wild-type monocytes; and bottom right panel - DTx treatment followed by transfer or MMP-13 deficient monocytes. Individual lesion size (mm") evaluation according to luxol Nissl staining is shown in (H) (ANOVA; n=7-8 per group; F(3,25)=15.6; p < 0.0001). Scale bar; 100 μπι. Diamonds: control (no DTx); squares: with DTx; triangles: DTx and wild-type monocytes; circles: DTx and MMP13 deficient monocytes.

[0024] Fig. 8 shows that CSPG causes increased expression of MMP-13 in monocytes. Bone-marrow-derived monocytes were cultured on CSPG or on PDL, as described with reference to Figs. 4G-K. mRNA expression of MMP-13 was measured by Real-time RT-PCR after 2 (left two bars) or 5 days (right two bars) and presented as expression relative to the housekeeping gene PpiA. Gray bars - culturing on PDL, black bars - culturing on CSPG.

DETAILED DESCRIPTION OF THE INVENTION

[0025] The present invention provides compositions and methods for treating spinal cord injury comprising administration of monocytes that have been skewed towards the anti-inflammatory phenotype by culturing on a substrate including glial scar matrix components, or administration of matrix metalloproteinase-13 (MMP- 13) or macrophages expressing it.

[0026] The inflammatory response in the injured spinal cord, an immune privileged site, has been mainly associated with poor prognosis. However, recent data demonstrated that a certain type of monocytes is pivotal for repair due to their alternative resolving phenotype. Given the pro-inflammatory milieu within the traumatized spinal cord, known to skew monocytes towards a classical phenotype, a pertinent question is how parenchymal-invading monocytes acquire resolving, antiinflammatory, properties essential for healing, under such unfavorable conditions.

[0027] It has been found, as demonstrated by Example 1, that infiltrating monocytes that acquire the resolving phenotype, as demonstrated by the high expression of IL-10, were found to concentrate at areas enriched with the glial scar- matrix molecule chondroitin sulfate glycoprotein (CSPG) and not at the epicenter of the lesion, which is devoid of scar tissue. It has also been found, as demonstrated by Example 2, that inhibiting the de novo production of CSPG following spinal cord injury by the use of xyloside, causes monocytes to be present at the epicenter of the lesion, from which they have been previously excluded, and results in reduced IL- 10 expression by the infiltrating monocytes. This demonstrates that CSPG, mainly known for its axonal growth inhibitory properties, serves as a critical template skewing the entering monocytes towards the resolving phenotype.

[0028] Additionally, as also demonstrated by Example 2, naive monocyte cultures that were seeded on a substrate containing CSPG, became enriched with a population comprised of cells expressing higher levels of IL-10.

[0029] Reciprocal conditional depletion of the infiltrating monocytes resulted in massive accumulation of CSPG around the lesion. However, replenishment with monocytes following spinal injury restored the regulation of CSPG levels, thereby revealing that these monocytes have scar matrix-resolving properties, as demonstrated by Example 3.

[0030] According to Example 4, it was found that expression of the matrix metalloproteinase MMP-13 in post-injury spinal cord samples was negatively affected by the depletion of the infiltrating monocytes. Restoration of the regulation of CSPG accumulation was dependent on MMP-13 expression by the infiltrating monocytic cell populations and therefore demonstrated that this extracellular remodeling property of the infiltrating monocytes requires their expression of the matrix-degrading enzyme, MMP-13.

[0031] It has additionally been found, as described in Example 5, that mice with a hematopoietic lineage deficient for MMP-13 had worse motor function recovery relative to controls.

[0032] Accordingly, the present invention provides a composition comprising resolving phenotype macrophages expressing MMP-13 for use in the treatment of spinal cord injury.

[0033] The term "resolving phenotype macrophages" as used herein, refers to macrophages characterized by the expression and/or secretion of the antiinflammatory cytokine IL-10. Such resolving phenotype macrophages are derived from monocytes, such as the monocytes described in the present invention that give rise to the macrophages infiltrating the damaged spinal cord. Certain conditions, in vivo or in vitro, can cause monocytes to become resolving phenotype macrophages. These conditions include, for example, the presence of CSPG, as found in the present invention.

[0034] According to some embodiments, the treatment relates to alleviation or abolishment of symptoms, or complete cure of the spinal cord injury, comprising promotion of spinal cord tissue restoration including, for example, resolving glial scar accumulation, preventing or inhibiting neuronal degeneration, promotion of neuronal survival, axonal regeneration and/or sprouting, neurogenesis in an injured spinal cord, and/or promotion of functional recovery, as measured for example by the Basso Mouse Scale (BMS) in mice, as defined hereinbelow.

[0035] Although the application discloses compositions and methods for treating spinal cord injury, the compositions and methods of the invention can also be applied to treating other CNS injuries. CNS injuries treatable by the compositions and methods of the invention may be caused, for example, by trauma, such as blunt trauma, penetrating trauma, trauma sustained during a neurosurgical operation or other procedure, brain coup or contrecoup, or stroke such as hemorrhagic stroke or ischemic stroke.

[0036] In certain embodiments, the composition may comprise resolving phenotype macrophages of the invention, suspended in a pharmaceutically acceptable carrier adapted for injection. A non-limiting example of a pharmaceutically acceptable carrier is PBS or a culture medium. However, alternative pharmaceutically acceptable carriers will readily be apparent to those skilled in the art.

[0037] In certain embodiments, the composition is formulated for injection, for example, intravenous injection or injection into the CSF.

[0038] In certain embodiments, the resolving phenotype macrophages are autologous, i.e. derived from the same individual. In certain embodiments, the resolving phenotype macrophages are allogeneic, i.e. derived from a different individual from the same species.

[0039] In certain embodiments, the resolving phenotype macrophages are obtained by culturing on a substrate comprising at least one glial scar matrix component. In some embodiments, the at least one glial scar matrix component is CSPG. In some embodiments, the CSPG is selected from neurocan, brevican, phosphacan, and versican or combinations thereof. In some embodiments, the CSPG is sulfated on carbon 4 (CSPG A) or on carbon 6 (CSPG C) of the N-acetylgalactosamine (GalNAc) sugar.

[0040] According to certain embodiments, the glial scar matrix component is a different glial scar matrix component, such as heparan sulfate or keratan sulfate.

[0041] The present application further provides methods for treating spinal cord injury in a subject in need thereof, comprising administering to the subject an effective amount of resolving phenotype macrophages expressing MMP-13 to thereby treat spinal cord injury in the subject.

[0042] As used herein, the term "effective amount" refers to the quantity of a component that is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this invention.

[0043] In some embodiments, the resolving phenotype macrophages are administered as soon as possible following the time of said spinal cord injury, preferably within 14 days post injury. In some embodiments, the resolving phenotype macrophages are administered within 7 days post injury. In certain embodiments, the resolving phenotype macrophages are administered within 3 days post injury.

[0044] The present invention further provides a composition comprising resolving phenotype macrophages obtained by culturing on a substrate comprising at least one glial scar matrix component for use in the treatment of spinal cord injury. In some embodiments resolving phenotype macrophages are expressing MMP-13.

[0045] The present invention also provides a method for treating spinal cord injury in a subject in need thereof, comprising administering to said subject an effective amount of resolving phenotype macrophages obtained by culturing on a substrate comprising at least one glial scar matrix component to thereby treat spinal cord injury in the subject. [0046] The present invention additionally provides a composition comprising MMP-13 for use in the treatment of spinal cord injury.

[0047] The pharmaceutical composition provided by the present invention may further include pharmaceutically acceptable fillers, carriers or diluents, and other inert ingredients and excipients.

[0048] As used herein, a "pharmaceutically acceptable carrier" is a pharmaceutically acceptable solvent, suspending agent or vehicle, for delivering the instant compounds to the patient. The carrier may be liquid or solid and is selected with the planned manner of administration in mind. Liposomes can also be a pharmaceutical carrier.

[0049] The present invention also provides a method for treating spinal cord injury in a subject in need thereof, comprising administering to said subject an effective amount of MMP-13 to thereby treat the spinal cord injury.

[0050] According to certain embodiments, an activator or inducer of MMP-13 can be provided, to increase production of MMP-13, thereby treating the spinal cord injury. Additionally, a compound that mimics the activity of MMP-13, such as an analog having an agonistic activity can be provided.

[0051] According to certain embodiments, the MMP-13 is a recombinant MMP- 13. According to certain embodiments, the MMP-13 is administered as a vector comprising a recombinant construct encoding MMP-13, wherein the vector is optionally a virus.

[0052] In some embodiments, the protein sequence of MMP-13 used in the invention is a human MMP-13 protein sequence.

[0053] In some embodiments, the protein sequence of the MMP-13 used in the invention is the human protein sequence according to NCBI accession number NP_002418 (SEQ ID NO: 1).

[0054] In some embodiments, the protein sequence of MMP-13 used in the invention has an amino acid sequence that is at least 80%, at least 85 %, at least 90 %, or at least 95, 96, 97, 98, or 99% identical to the amino acid sequence of SEQ ID NO: l, and having an equal or substantially similar activity to that of the protein of SEQ ID NO: 1.

[0055] In some embodiments, the nucleotide sequence of MMP-13 used in the invention is a human MMP-13 cDNA sequence. In some embodiments, the nucleotide sequence of MMP-13 used in the invention is a nucleotide sequence comprising a sequence encoding the human MMP-13 protein as defined above.

[0056] According to some embodiments, the MMP-13 nucleotide sequence used with the invention is a human sequence comprising the sequence encoding SEQ ID NO: 1, for example NCBI accession NM_002427 (SEQ ID NO: 2). In some embodiments, the MMP-13 nucleotide sequence used with the invention is SEQ ID NO: 2.

[0057] In some embodiments, the recombinant MMP-13 is prepared by any suitable method, for example, preparing a construct including a nucleic acid molecule encoding for MMP-13 operably linked to a promoter suitable for driving expression in mammalian systems, in a vector suitable for expression in a mammalian system. The vector is inserted into a suitable host cell such as mouse myeloma NS0 and Chinese Hamster Ovary (CHO) cell, or a plant cell, such as tobacco, carrot or rice cell. The MMP-13 protein is purified from the host cell by any known method.

[0058] In some embodiments, the vector can be any vector suitable for expression in human cells.

[0059] Additionally, the present invention provides a method for obtaining resolving phenotype macrophages comprising culturing naive monocytes on a substrate containing a glial scar matrix component.

[0060] The present invention further provides a method for obtaining resolving phenotype macrophages expressing MMP-13, comprising culturing naive monocytes on a substrate containing at least one glial scar matrix component.

[0061] According to some embodiments, the at least one glial scar matrix component is CSPG. [0062] The present invention also provides a composition comprising resolving phenotype macrophages obtained according to the method of the invention, for use in the treatment of spinal cord injury.

EXAMPLES Experimental

[0063] Animals: Six types of mice were used: (1) C57BL/6J mice; (2) CD45.1 mice (carrying an allotypic marker, CD45.1); (3) heterozygous mutant Cx ₃ crl ^GWI+ mice (B6.129P- C¾cr7 tmlLitt/J), in which one of the CX ₃ CR1 chemokine receptor alleles is replaced with a gene encoding GFP [green fluorescent protein] (Jung et al. 2000, Mol Cell Biol 20: 4106-4114); (4) CDllc-OTR transgenic mice (B6.FVB- Tg Itgax-DTR/GFP 57Lan/J), carrying a transgene encoding a human diphtheria toxin receptor [DTR] under control of the murine CDllc promoter (Jung et al, 2002, Immunity 17: 211-220); Cx ₃ crl ^G ™ ⁺ and CDllc-OTR trans genie mice were a generous gift from Prof. Steffen Jung; (5) CDllc-OTR: Cx ₃ crl ^GWI+ transgenic mice (heterozygous for both the Cx ₃ crl ^GW locus and the CDllc-OTR transgene); and (6) MMP-13 KO mice (Inada et al, 2004, Proc Natl Acad Sci U S A 101: 17192-17197), a generous gift from Prof. Carlos Lopez-Otin. For all experiments, adult males aged 8-10 weeks were used. Animals were supplied by the Animal Breeding Center of The Weizmann Institute of Science. All animals were handled according to the regulations formulated by the Institutional Animal Care and Use Committee (IACUC).

[0064] Bone Marrow Radiation Chimeras. [Cx ₃ crl ^G ™ ⁺ > wt], [CDllc-OTR > wt], [MMP-13 ^A > wt], [wt > wt] and [CDllc-OTR: Cx ₃ crl ^G ™ ⁺ > wt] Bone marrow (BM) chimeras were prepared by subjecting gender- matched recipient mice (8-10 week old) to lethal whole-body irradiation (950 rad) while shielding the brain, as previously described (Rolls et al, 2008; Shechter et al, 2009). The mice were then reconstituted with 3-5 xlO ⁶ BM cells harvested from the hind limbs (tibia and femur) and forelimbs (humerus) of the appropriate donor mice. BM cells were obtained by flushing the bones with Dulbecco's PBS under aseptic conditions, and were then collected and washed by centrifugation (10 min, 1,000 rpm, 4°C). The chimeric mice were subjected to spinal cord contusion 8-10 weeks after BM transplantation.

[0065] Spinal Cord Injury. The spinal cords of deeply anesthetized mice were exposed by laminectomy at T12, and contusive (200 kDynes) centralized injury was performed using the Infinite Horizon spinal cord impactor (Precision Systems), as previously described (Rolls et al, 2008; Shechter et al, 2009). The animals were maintained on twice-daily bladder expression. Animals that were contused in a nonsymmetrical manner were excluded from the experimental analysis.

[0066] Xyloside Treatment. Xyloside (4-methylumbelliferyl-b-D- xylopyranoside; Sigma- Aldrich) was injected as previously described (0.8 mg/mouse, Rolls et al, 2008). Briefly, the mice were intraperitoneally (IP) injected twice daily for 5 consecutive days, starting either immediately after the injury or 2 days later. For histological analysis, mice were killed 7 days or 14 days after the injury.

[0067] Diphtheria Toxin Administration. Diphtheria toxin (DTx; 8 ng/g body weight; Sigma) was injected intraperitoneally (IP), repeatedly at 1 day intervals, starting immediately after the injury.

[0068] Adoptive Transfer of Monocytes. CD115 ⁺ monocytes were isolated as previously reported (Varol et al, 2007). Briefly, BM cells were harvested from the femora and tibiae of naive mice, and enriched for mononuclear cells on a Ficoll density gradient. The CD115 ⁺ BM monocyte population was isolated through Magnetic activated cell sorting (MACS) enrichment using biotinylated anti-CD115 antibodies and streptavidin-coupled magnetic beads (Miltenyi Biotec) according to the manufacturer's protocols. Following this procedure, monocytes (purity 90%) were intravenously (IV) injected (3.5 x 10 ⁶ cells per mouse) twice during the first week of recovery, on dO and d3 post injury.

[0069] Immunohistochemistry. Due to technical limitations of some of the antibodies that were used, two different tissue preparations (paraffin embedded and microtomed frozen sections) were applied, as previously described (Rolls et al, 2008, Shechter et al., 2009). Whenever possible, the results were confirmed using both techniques. The following antibodies were used: rabbit anti-GFP (1: 100; MBL), rabbit anti-glial fibrillary acidic protein (GFAP; 1: 100; Dako Cytomation), goat anti-IL-10 (1 :20; R&D Systems), mouse anti-chondroitin sulfate antibody CS- 56 (1: 100; Sigma), mouse anti-Hu (1:50; Rhenium), mouse anti-MMP13 (1:50; Abeam), and hamster anti-CDl lc (1:50; Chemicon). For microglial/macrophages labeling, TRITC- or FITC-conjugated Bandeiraea simplicifolia isolectin B4 (IB-4; 1:50; Sigma- Aldrich) was added for 1 h to the secondary antibody solution. Secondary antibodies used included: Cy2-conjugated donkey anti-rabbit antibody, Cy2/Cy5 conjugated donkey anti-mouse antibody, Cy3-conjugated donkey anti- mouse, Cy3 -conjugated donkey anti-goat, and biotin goat anti-hamster (1:200; all from Jackson Immuno Research). Cy3-streptavidin was used for CDl lc staining. The slides were exposed to Hoechst stain (1:4,000; Invitrogen Probes) for 1 min. GFAP staining was used for demarcation of the lesion site.

[0070] Myelin integrity was qualitatively and quantitatively examined on paraffin-embedded sections that were stained with Luxol fast blue for myelin, and with nissl to identify the nuclei and the thin cytoplasmic layer around them. Myelin phagocytosis was analyzed in sections stained with Oil Red O (Fisher Scientific) and counterstained with Mayer's hematoxylin to identify cell nuclei, as previously described (Ma et al, 2002, J Neurosci Res 68: 691-702; Vallieres et al, 2006, Glia 53: 103-113). For microscopic analysis, a Nikon fluorescent microscope (Nikon E800) or Zeiss LSM 510 confocal laser scanning microscope were used. Longitudinal sections of the spinal cord were analyzed. Numbers of cells, immunoreactivity (density) and lesion size were all determined automatically with Image-Pro Plus 4.5 software (Media Cybernetics). To determine lesion size, demarcation of the damaged site was done according to luxol nissl staining as well as H&E staining. In order to avoid overestimation due to counting of partial cells that appeared within the section, we took special care to count only cells with intact morphology and a nucleus that was larger than 4 μπι in diameter, both in the manual and software-automated counting. The ImagePro quantification was performed in 2mm ² spinal cord tissues pictures, centralized on the lesion site, which included lesion site, the margins and still surrounding undamaged parenchyma. Three sections from different depths were assessed for each animal. 4-8 mice were tested in each group. For immunoreactivity measurement, the values are presented in arbitrary units and indicate total reactivity in the tissue. The number of cells per mm ³ was calculated by considering the thickness of the sections.

[0071] Isolation of Spinal Cord Cells and Flow Cytometric Analysis. Mice subjected to spinal cord injury were killed by an overdose of anaesthetic and their spinal cords were prepared for flow cytometric analysis by perfusion with PBS via the left ventricle. Spinal cord sections were cut from individual mice, including the injured site and adjacent margins (4 mm long in each of the sections), and tissues were homogenized using a software controlled sealed homogenization system (Dispomix; http://www.biocellisolation.com). For IL-10 staining, 2xl0 ⁶ /ml cells were cultured on 96- well plates. The following fluorochrome-labeled monoclonal antibodies were purchased from BD Pharmingen, BioLegend, or eBioscience and used according to the manufacturers' protocols: PE conjugated anti-CDl lb, IL-10 and CD115 antibodies, and allophycocyanin-conjugated anti-CD45.1, and CD l ib antibodies. Cells were analyzed on a FACSCalibur cytometer (BD Biosciences) using CellQuest software (BD Biosciences) or on a LSRII cytometer (BD Biosciences) using Flow Jo software (Tree Star). Isotype controls were routinely used in all the experiments. In addition, in each experiment, relevant negative control groups were used to identify the populations of interest and to exclude others.

[0072] Multiplex cytokine analysis system. Wild-type C57B1/6J injured and non-injured mice were killed at different time points after spinal cord injury. Samples from lesion sites (4mm length of spinal cord tissue, including lesion site, margins and surrounding non-injured parenchyma) were pooled in groups of three. The excised tissues were homogenized in PBS containing protease inhibitors (1: 100; P8340, Sigma). Four freeze-thaw cycles were performed to break the cell membranes (3 minutes each). Homogenates were then centrifuged for 10 min at 500g, and the total protein quantities in supernatants were determined by Bradford reagent. Frozen supernatants were assayed in duplicate using Multiplex Bead-based Luminex Assays (MILLIPLEX mouse cytokine/chemokine panel or TGFpi,2,3 MILLIPLEX kit; Millipore), performed by outsourcing (American Medical Laboratories), according to the manufacturer's instructions. Results are expressed as picograms of protein per milligram of total tissue protein.

[0073] Assessment of functional recovery from spinal cord injury. Recovery was evaluated by hind-limb locomotor performance, assessed according to the open-field Basso Mouse Scale (BMS) (Basso et at, 2006, J Neurotrauma 23: 635- 659), with nonlinear scores ranging from 0 (complete paralysis) to 9 (normal mobility); each score represents a distinct motor functional state. We randomly separated the mice into groups, while verifying that the average starting score was similar in all groups. Blind scoring ensured that observers were not aware of the treatment received by each mouse. Locomotor activity in an open field was monitored twice a week by placing the mouse for 4 min at the center of a circular enclosure (diameter 90 cm, wall height 7 cm) made of molded plastic with a smooth, nonslippery floor. Before each evaluation, the mice were carefully examined for peritoneal infection, wounds in the hind limbs, and tail and foot autophagia. Animals that showed a difference of more than 2 score points between their two hind limbs were excluded from the experimental analysis. The results showing functional outcomes presented in this study were, in each case, from a single experiment representative of several independent replicates, as indicated in the figure legends. As spontaneous recovery from spinal cord injury is limited, we used the previously described (Rolls et at, 2008; , Shechter et at, 2009) protocol of 45D vaccination (100 μg; emulsified in an equal volume of complete Freund's adjuvant containing Mycobacterium tuberculosis (2.5 mg/ml; Difco); 1 week prior the injury), which creates a more sensitive system to evaluate functional recovery.

[0074] Culture of monocytes. 25-cm Falcon tissue culture flasks (BD Biosciences) were coated either with poly-D-lysine (PDL) (20 μg/ml; Sigma- Aldrich) in borate buffer, pH 8 for 4 h; or CSPG (10 μ^πύ, Sigma-Aldrich) in PBS. CD115+ cells were isolated as described above. A total of 6xl0 ⁶ CD115+ cells were seeded per flask on CSPG or on the control substrate, PDL, in the following media: RPMI-1640 (Biological Industries, Beit Ha-Emek, Israel), 10% FCS, 2mM L-Gln, 100 U/ml penicillin, and 100 μg/ml streptomycin, NAA, and ImM sodium pyruvate. The purified cells were cultured in 5% CO ₂ at 37°C. The cultures were harvested 2 or 5 days later, and the supernatants collected. IFN-γ was added to some of the cultures (lOOng/μΙ), as mentioned in the text.

[0075] Quantitative Real-time PCR. Target cells or tissue were homogenized in Tri reagent (Sigma) and total RNA was extracted using Qiagen RNeasy Mini-kit. Random hexamers (AB) were used for first-strand cDNA synthesis. Both procedures were performed according to the manufacturer's instructions. The relative amounts of mRNA were calculated by using the standard curve method, and were normalized to the housekeeping gene, peptidylprolyl isomerase A (PpiA). Each RNA sample was run in triplicate, and each group was comprised of three to five animals. The primers for all genes tested were designed using the PrimerQuest software, from Integrated DNA Technologies (http://eu.idtdna.com):

Table 1: PCR primers

R: GCAACAAGGAAGAGGTTTGTGCCT

F: TTCTTGTTGAGCTGGACTCCCTGT

Mmpl3

R: TGCTCTGCAAACACAAGGTCTTCC

[0076] ELISA assay for cytokine levels: Cytokine ELISA for IL-10 was performed on culture supernatants of the in-vitro experiment, according to the manufacturer's instructions (eBioscience, Mouse Interleukin-10 Ready- SET- Go!). Each supernatant sample was run in triplicate, and a total of five supernatants were used per group. Results were expressed as picograms of protein per milliliter of supernatant.

[0077] Statistical Analysis. Data were analyzed using the Student's t-test to compare between two groups. One-way ANOVA was used to compare several groups; the Tukey's HSD procedure (p = 0.05) was used for follow-up pairwise comparison of groups. Repeated measures ANOVA was used in the functional BMS scoring with follow-up comparison of treatments for each day by contrast t- test and correction for multiple comparison by the Holm method (p = 0.05). The specific tests used to analyze each set of experiments are indicated in the figure legends. The results are presented as mean ± SE. In the graphs, y-axis error bars represent SE.

[0078] Example 1: Resolving phenotype macrophages are embedded in a proinflammatory milieu and are confined to the glial scar deposition region. Since the cytokine milieu is a major determinant of the differentiation fate of monocytes, we tested the cytokine profile that these cells encounter when reaching the injured spinal cord parenchyma. To this end, we examined the cytokine profile at the lesion site during the first week post injury. Pooled spinal cord tissues, 4 mm in length that included the lesion site, margins and surrounding undamaged parenchyma, were homogenized and freeze-thawed to extract the proteins. The extracts were tested for production of cytokines using a Multiplex system that simultaneously analyzes an array of cytokines in the same sample. Multiplex analysis of Ml/M2-skewing cytokines revealed that following trauma to the CNS, the local environment at the lesion site becomes biased towards a pro-inflammatory milieu, dominated by the most characteristic cytokine that determines the pro-inflammatory phenotype (Ml) skewing, TNFa (Fig. 1). The same tendency was observed at all tested time points, and for all repetitions, but the fold change varied. Immuno staining of spinal cord sections for IL-10, a predominant M2 (alternatively- activated, endowed with healing properties) skewing cytokine, revealed its basal expression by neurons of the healthy tissue, its down regulation thereafter, and its specific induction at later time points by macrophages surrounding the lesion site (Fig. 2). The constitutive expression of IL-10 by neurons, and the loss of this expression following injury explain the small post injury reduction seen by the Luminex analysis, which was reproduced using an ELISA specific to IL-10.

[0079] Since these results suggest that the cytokine milieu was unlikely to account for the differentiation of the infiltrating monocytes to resolving phenotype macrophages, we hypothesized that other predominant factor(s) are likely to play a fundamental role in this process. Matrix molecules influence immune cell behavior during autoimmune disease, and robust alterations in the extracellular matrix are observed in the traumatized CNS (Sofroniew, 2009); thus, in light of the recently identified immunomodulatory role of CSPG, the predominant extracellular component of the glial scar matrix, endowing microglia/macrophages with neuroprotective properties, characterized by their production of insulin like growth factor 1 (IGF-1), we assessed the contribution of this matrix to monocyte skewing towards their essential resolving properties.

[0080] Although the monocyte- and resident-derived macrophage populations are functionally distinct, there is currently no differential morphological marker that can distinguish between them. Thus, in the present study, we used a well-established bone marrow (BM) chimera model (Simard et al., 2006), in which the BM of irradiated (using head shielding) host mice, is replaced in adulthood by genetically labeled BM expressing green fluorescent protein (GFP) under the control of the myeloid promoter, Cx ₃ crl, enabling the clear distinction of infiltrating monocyte- derived macrophages (GFP ⁺ ) from resident microglia (non-fluorescent), as reported previously (Shechter et al, 2009; Mildner et al, 2007). The mice were analyzed for their chimerism 8 weeks following transplantation, and were subjected to spinal cord injury. Immunohistochemical analysis of the injured spinal cord parenchyma 7 days post injury revealed that the skewed monocytes (Cx ₃ crl ^GFP ) that acquired a resolving phenotype (demonstrated by the high expression of the anti-inflammatory cytokine, interleukin IL-10, the hallmark of this subset, as previously shown (Shechter et al, 2009), and as verified herein below in Fig. 3A), were found here to concentrate at areas enriched with the glial scar-matrix molecule CSPG (Fig. 3B). As was previously demonstrated (Shechter et al, 2009), no resolving IL-10 producing monocytes accumulated in the epicenter of the lesion, despite the abundant accumulation of other macrophages there; notably, this area is devoid of scar tissue.

[0081] Example 2: The glial scar matrix molecule CSPG determines the resolving phenotype of the monocytes that encounter it. The spatial association between the glial scar matrix CSPG and the infiltrating monocytes, in light of the immunomodulating properties attributed to this scaffold, prompted us to test whether this matrix is involved in the immune- skewing of the infiltrating monocytes towards their resolving, anti-inflammatory phenotype. Using de-novo inhibition of CSPG biosynthesis via the administration of the pharmacological inhibitor xyloside, previously used in both in-vitro and in-vivo studies (Rosamond et al, 1987), we have previously shown that CSPG is fundamental for the repair following spinal cord injury (Rolls et al, 2008). In the same study, we suggested that this matrix modulates the macrophages/microglia that encounter it to attain non-cytotoxic neuroprotective properties, characterized by reduced TNFa and increased IGF-1. Although in our previous study, we did not address the functional relevance of the infiltrating monocytes, we already reported that such treatment disrupts the spatial organization of monocytes around the lesion epicenter. As we found that the resolving phenotype monocyte-derived macrophages concentrated at the lesion margins in association with CSPG deposition, we next tested whether the same in- vivo strategy for inhibition of CSPG biosynthesis would affect not only the location of these cells but also their properties.

[0082] To that end, [<¾cr7 ^{GFP +} >wt] BM chimeric mice, created following irradiation and reconstitution with labeled BM, were subjected to spinal cord injury 8 weeks post transplantation, and were treated twice a day for 5 consecutive days with either PBS or xyloside, starting immediately following the contusion (Fig. 4A). Such a treatment with xyloside, which led to a 50% reduction in CSPG deposition at the lesion margins when analyzed immediately after the last xyloside injection (Fig. 4B), resulted in monocyte infiltration into the epicenter of the lesion at day 7 post injury, an area from which they were excluded in the presence of CSPG (Fig. 4C). Notably, the changes in the spatial compartmentalization of the infiltrating GFP monocytes were not accompanied by any alteration in their cell numbers (Student's t-test; p = 0.365). Yet, this early inhibition of CSPG production had a detrimental impact on their acquisition of an anti-inflammatory phenotype, manifested by reduced IL-10 expression at day 7 post injury, as quantified using the ImagePro software on 2mm ² antibody- labeled spinal cord sections that included the lesion site, margins and surrounding parenchyma (Fig. 4D, E). The reduction of the suppressive potency of the monocytes was accompanied by enhanced activation of the resident microglia, as indicated by the immunoreactivity of the microglial specific IB-4 at day 14 post injury and its evaluation by ImagePro as above (Fig. 4F). Although only partial, inhibition of CSPG had a dramatic effect on the resolving phenotype of the infiltrating monocyte-derived macrophages, suggesting the fundamental biological significance of this matrix. As the extracellular matrix around the site is a complex branched structure, it is likely that such partial inhibition has dramatic effect on the local organization of the perineuronal network created around the lesion site following injury. We can suggest that the complex structure limits the spread of the toxic material concentrated at the epicenter, and prevents the infiltrating cells from coming into contact with this disrupted milieu (enriched for Ml-skewing cytokines), by serving as a physical barrier. In this manner, even partial inhibition would hurt this matrix capacity to serve as a structure insulating the two compartments from each other.

[0083] Notably, the observed alterations following xyloside treatment were not due to non-specific effects of the drug, as slightly delayed administration of xyloside, starting at day 2 post injury (for 5 consecutive days), as was previously shown (Rolls et al. , 2008), did not lead to increased microglial activation, nor did it affect the spatial organization of the infiltrating monocytes. In addition, such delayed administration did not affect IL-10 production by these monocytes (data now shown). As the levels of IL-10 immunoreactivity at the site measured on day 7 post injury were not affected by the delayed application of xyloside, the reduction in IB- 4 immunoreactivity observed at day 14 post injury cannot be attributed to the antiinflammatory nature of the infiltrating monocytes. We thus suspect that the delayed inhibition has other effect(s) that result in such IB-4 regulation. These can be immune- (monocytes/microglia) or even astrocyte-mediated, a phenomenon that requires further investigation.

[0084] As the injured spinal cord is known to contain a large amount of myelin debris, factors that were previously shown to have modulatory M1/M2 effects following their engulfment by macrophages (Boven et al, 2006; Sun et al, 2010), we next tested whether such myelin uptake can be responsible for monocyte skewing towards their IL-10-expressing phenotype. Phagocytosis by macrophages of degradation products of myelin was tested using Oil Red O (ORO) staining, as previously described (Ma et al, 2002, J Neurosci Res 68: 691-702; Vallieres et al, 2006, Glia 53: 103-113). ORO staining of spinal cord sections taken at day 7 post injury revealed equal distribution of macrophages that engulfed myelin in the lesion epicenter and at its margins (data now shown). This unified distribution of macrophage uptake of myelin was not in spatial correlation with the resolving, IL- 10 producing phenotype of the macrophages, and thus was not likely to participate in their skewing. To verify that the observed effect seen following immediate xyloside treatment could not be attributed to changes in myelin engulfment, we ORO stained spinal cord sections isolated from either PBS or xyloside -treated mice (day 7 post injury). Although significant reduction was observed in IL-10 immunoreactivity following xyloside treatment, no noteworthy differences were observed between the two groups in the myelin engulfment by macrophages. This suggests that while an M1/M2 modulating effect has been attributed to myelin engulfment, the resolving phenotype of macrophages at the injured spinal cord, characterized by the secretion of the anti-inflammatory cytokine IL-10, does not seem to be related to myelin uptake.

[0085] To reveal the direct effect of CSPG on monocyte skewing, we employed an in-vitro assay using primary cultures of naive CD115 ⁺ monocytes seeded on CSPG or on an inert substrate, Poly-D-lysine (PDL), as a basal reference. Flow cytometric analysis of the cultured cells showed that these substrates induced the development of two populations that differed in their morphology (based on size and granularity) as well as in their IL-10 expression levels (Fig. 4G). However, the CSPG cultures became enriched with the population comprised of cells expressing higher levels of IL-10 (R2; Fig. 4H). Similarly, increased overall IL-10 expression was observed in CSPG-cultured monocytes even 8 hours after harvesting the cells and replacing the medium with fresh medium (Fig. 41, J). Enhanced expression of this antiinflammatory cytokine was also observed in the presence of IFN-γ, a potent Ml- skewing factor (Fig. 4K), suggesting that the glial scar matrix plays a predominant role determining the phenotype of the monocytes that encounter it, even in a proinflammatory setting. Thus, our data demonstrate that the glial scar matrix molecule, CSPG, is a critical immunoregulatory scaffold, inducing the monocytes towards the resolving phenotype subset, characterized by their production of the anti-inflammatory cytokine, IL-10.

[0086] Example 3: Infiltrating monocytes promote glial scar matrix resolution. The well recognized matrix degrading properties and tissue remodeling of macrophages as part of peripheral wound healing, and especially of the resolving phenotype monocyte-derived macrophages, prompted us to examine whether the infiltrating monocytes are not only affected by CSPG, but might in turn, regulate the resolution of this scar matrix molecule, which is known to be a major obstacle for CNS regeneration in the chronic phase.

[0087] To this end, we searched for an in-vivo cell ablation strategy targeting monocytes in close proximity to the glial scar matrix. Approximately 50% of the monocytes infiltrating the lesioned spinal cord were found to be CDl lc ⁺ at day 7 post injury (Fig. 5A), and those CDl lc ⁺ Cx3crl ^GW monocytes resided at the margin of the site in close association with CSPG enriched areas (Fig. 5B). We therefore used a previously employed (Shechter et al, 2009) conditional in-vivo cell ablation strategy targeting monocytes by virtue of their CD 11c promoter activity. Specifically, we generated [CDllc-OTR: Cx ₃ crl ^G ™ ⁺ > wt] BM chimeras, as previously described in Shechter et al, in which GFP expression allowed us to trace the infiltrating monocytes, and the Diphtheria Toxin Receptor (DTR) transgene enabled us to specifically deplete this cell population upon their up- regulation of CD 11c (Fig. 5C). The chimeras were tested for their chimerism 8 weeks following the BM transplantation, and then were immediately subjected to spinal cord contusion, and treated with Diphtheria Toxin (DTx). As previously reported, such treatment resulted in the specific depletion of GFP ⁺ cells, corresponding to the infiltrating monocytes, without affecting their CNS counterparts, the resident microglia (GFP ) (Fig. 5D). DTx-dependent depletion of monocytes in close proximity to scar deposition resulted in a higher level of CSPG immunoreactivity, as evaluated on day 14 post injury, the peak of CSPG accumulation, using computerized ImagePro analysis of images of 2mm ² spinal cord sections (Fig. 5E, F). Restoration of the monocyte pool of DTx treated chimeras by intravenous injection of wt CD115 ⁺ monocytes (injected on day 0 and day 3 post injury; carrying the allotypic marker, CD45.1) that did not harbor the CDllc-OTR transgene, and whose descendants were therefore resistant to the toxin treatment, resulted in their infiltration to the injured spinal cord (Fig. 5G; as previously reported in Shechter et al, 2009), and was found here to be sufficient to restore the lost regulation of the glial scar matrix deposition observed in the depleted mice (Fig. 5H, I). While DTx-treated chimeras showed massive accumulation of CSPG around the lesion epicenter at day 14 post injury, reconstitution of DTx-treated mice with monocytes resistant to the depletion resulted in decreased accumulation of this scar matrix. These results demonstrate a novel aspect of the resolving properties of the recruited monocytes associated with the resolution/termination of the glial scar deposition.

[0088] Example 4: Infiltrating monocytes promote glial scar matrix resolution via the production of MMP-13. The well recognized matrix degradation enzymes have been suggested to mediate the tissue-remodeling properties of macrophages (Fallowfield et at, 2007). We next asked whether this crucial matrix resolving function of the entering monocytes is mediated via the regulation of the matrix- degrading enzymes MMPs. Even though the majority of the matrix degrading enzymes tested showed increased levels following injury (data not shown), only MMP-13 was negatively affected by the depletion of monocytes by DTx, as evaluated at day 5 post-injury by RT-PCR of tissue spinal cord samples (Fig. 6A). Immuno staining of spinal cord sections confirmed that CDl lc ⁺ monocyte-derived macrophages that localized to the lesion margins are a major source of MMP-13 (Fig. 6B-D). MMP-13 showed highly restricted expression around the lesion site. This location at the margins of the injury site appears to be ideal for mediating glial scar- matrix degradation.

[0089] We next tested if MMP-13 expression by the infiltrating monocytes is essential for their scar remodeling capacity. To this end, we took advantage of MMP-13 knockout (KO) mice (Inada et al, 2004, Proc Natl Acad Sci U S A 101: 17192-17197). We first used [MMP-13 ^_ wt] BM chimeras, in which the host BM is replaced with BM isolated from the KO mice. In the resulting chimeras, the hematopoietic lineage is MMP-13 deficient, while the CNS tissue is of host (wild- type) origin. The mice were subjected to spinal cord injury 8 weeks post BM transplantation. Comparative analysis for CSPG immunoreactivity in spinal cord sections 14 days post trauma revealed CSPG accumulation in the MMP-13 KO chimeras (Fig. 6E, F). To further attribute this functionality to MMP13 expression by monocytes, we used the depletion-restoration strategy. DTx depleted [CDllc- DTR> wt] BM chimeras, were replenished with CD115 ⁺ monocytes (via intravenous administration on day 0 and day 3 post injury), isolated from either wild-type mice, or from MMP-13 KO mice. Non-DTx treated chimeric mice served as a control. The mice were tested for CSPG immunoreactivity 14 days post injury. As reported above (Fig. 5H, I), monocyte depletion via DTx treatment resulted in increased CSPG accumulation, whereas reconstitution with wt monocytes led to a reduction in CSPG levels relative to the non-reconstituted mice (Fig. 6G, H). Importantly, while reconstitution with wt monocytes restored the regulation of CSPG accumulation, replenishment with MMP-13 KO monocytes failed to do so (Fig. 6G, H). Altogether, these results highlight the importance of monocytes as critical regulators of scar deposition, in particular its extracellular matrix CSPG, via the expression of the matrix degradation enzyme MMP-13.

[0090] Example 5: Production of MMP-13 by monocytes is essential for the functional recovery from spinal cord injury. In light of the tissue remodeling function attributed here to the infiltrating monocytes, together with the well- established phenomenon that CSPG degradation augments functional recovery following spinal cord injury (Silver and Miller, 2004; Bradbury et al, 2002; Rolls et al, 2008), we next aimed to test if such remodeling property of these cells has functional implications to the repair process. We therefore repeated the experiments in the MMP-13 deficient mice, as described above, while evaluating the functional recovery of the hind limbs following spinal cord contusion according to the Basso Mouse Scale (BMS). In this non-linear scale, 0 represents complete paralysis of the hind limb, while a score of 9 represents normal mobility (Basso et al, 2006, J Neurotrauma 23: 635-659). Mice in which the hematopoietic lineage lacked MMP- 13, [MMP-13 ^{" _} >wt], had worse motor function recovery of the hind limbs, relative to their controls [wt > wt] chimeras (Fig. 7A, B). Evaluation of lesion size according to myelin integrity staining, using luxol Nissl, further confirmed these results (Fig. 7C, D). To attribute this essential function to the monocyte subset, we again employed the depletion-restoration strategy; [CDl lc-DTR > wt] BM chimeric mice were subjected to spinal cord injury 8 weeks post transplantation. Four groups were used: one group was left untreated, one group was treated with DTx, and the other two groups received DTx and passive transfer of DTx-resistant monocytes isolated either from wt or from MMP-13 KO mice, as described above. The mice were followed for motor function performance of the hind limbs, and scored according to the BMS. As previously reported by us (Shechter et at, 2009), DTx depletion of monocyte-derived cells resulted in worse motor function performance post spinal cord injury, while reconstitution of the depleted mice with monocytes resistant to the toxin, restored the lost motor function (Fig. 7E, F). In contrast, transfer of MMP-13 -deficient monocytes failed to restore recovery, and resulted in similar motor function as that observed in the DTx-treated mice that did not receive monocytes (Fig. 7E, F). Evaluation of lesion size confirmed these results (Fig. 7G, H). Altogether these results attribute a critical functional relevance to the infiltrating monocytes via the expression of the matrix remodeling enzyme MMP-13.

[0091] The two essential characteristics of the infiltrating monocytes following spinal cord injury, the anti-inflammatory nature described by us before (Shechter et at, 2009) and the scar degradation property identified here, are not contradictory. These two properties should be viewed as two complementary aspects of their resolving phenotype. These cells are endowed with a panel of properties to resolve the first phase of the dynamic response post injury, which is characterized by both intense inflammation and scar formation. In fact, the connection between the capacity of monocytes to remodel cellular matrix and promote regeneration and between their anti-inflammatory essential properties was suggested previously in peripheral tissue healing (Arnold et at, 2007; Nahrendorf et at, 2007). Interestingly, in-vitro cultures of naive monocytes revealed enhanced mRNA expression of the Mmp-13 transcript when the cells were grown on a CSPG substrate (Fig. 8) compared with a PDL substrate, raising the possibly of an endogenous feedback loop, in which the glial scar matrix induces its own degradation. [0092] Example 6: treatment of a subject with a composition comprising resolving phenotype macrophages expressing MMP-13. BM cells are harvested by a standard procedure from the pelvic bone of a patient suffering from a spinal cord injury following an accident. The cell population is enriched for mononuclear cells on a Ficoll density gradient and monocytes (CD 14+, CD 16+) are isolated using Magnetic Activated Cell Sorting (MACS) using biotinylated anti-CD115 antibodies as described above. The isolated monocytes are seeded in tissue culture flasks on CSPG, as described above and harvested after 5 days. The presence of IL- 10 and MMP-13 in the supernatant is confirmed by ELISA assays according to standard methods or as described above. A composition comprising a therapeutically effective amount of the cells, which have now turned into resolving phenotype macrophages, is injected intravenously to the patient, to treat the spinal cord injury.

[0093] Example 7: treatment of a subject with a composition comprising MMP-13. A recombinant construct encoding the human MMP-13 is prepared by standard methods, including cloning the human MMP-13 according to the nucleotide sequence of SEQ ID NO: 2 using a standard mammalian expression system. The expressed MMP-13 protein is extracted using standard procedures and a pharmaceutical composition including a pharmaceutically effective amount of the expressed MMP-13 and a pharmaceutically effective carrier is injected directly to the area of the lesion in a patient with a spinal cord injury, to treat the spinal cord injury. For cloning, expression and extraction of MMP-13 protein according to this example, standard molecular biological methods are used, as described, e.g., in Maniatis et al., Molecular Cloning: A Laboratory Manual, 1982, Cold Spring Harbor Laboratory, Cold Spring Harbor Press; Sambrook et al., Molecular Cloning: A Laboratory Manual, (2d ed.), Vols 1-3, 1989, Cold Spring Harbor Press, NY; or Ausubel, et al. (1987 and Supplements), Current Protocols in Molecular Biology, Greene/Wiley, New York. Discussion

[0094] This application demonstrated that two main phenomena that occur in the injured CNS, the inflammatory response and accumulation of glial scar, which were generally assumed to be independent and separately detrimental, are in fact tightly connected in an intimate relationship that promotes their mutual potential to benefit healing. The glial scar matrix was found here to serve as a necessary scaffold, skewing monocytes towards the resolving phenotype, characterized by the secretion of the anti-inflammatory cytokine IL-10, thereby promoting resolution (termination) of the local inflammation, mainly manifested by the resident microglia. The immunosuppressive nature of CSPG in the response to trauma, as observed here, is consistent with data demonstrating that scar-associated astrocytes are required to maintain a balanced inflammatory response. The immunoregulatory nature of this matrix molecule is substantiated by our previous observation that it promotes neurotrophic factor production by the resident microglia. The immunoregulatory feature of the scar appears to be a general feature of tissue healing, as proteoglycans are key immune-modulators following trauma to internal organs. Such function performed by the matrix is essential under the unfavorable milieu that exists at the site of trauma, which is laden with factors known to mediate Ml skewing. As the extracellular matrix around the site is a complex structure, built like a branched tree, it seems that every component within it has a dramatic effect on the local organization of the perineuronal network created around the lesion site following injury. We can suggest that this complex structure can, on the one hand, have a direct effect on the encountering cells, and on the other hand serve as a physical barrier isolating these cells from the material concentrated at the epicenter, which possesses Ml-skewing properties.

[0095] Scar deposition is an essential response to the trauma that should be tightly controlled; although it is essential for the repair at the acute phase, the scar becomes an obstacle in the subsequent phases. Such timely regulation of scar deposition is achieved by the bi-directional interaction between the glial scar and the monocytes; macrophages, which use the scar for their own education, were identified here as the cellular component that promotes scar degradation via the secretion of matrix degradation enzymes. In support of our in vivo observation, in vitro skewing of macrophages towards M2 phenotype was recently shown to promote axonal regeneration (Kigerl et a/^2009).

[0096] Our results, also published in Shechter et at, 2011, which is incorporated herein by reference, indeed suggest MMP-13 as key enzyme associated with matrix remodeling beneficial for recovering from CNS injury, via alternative molecular mechanisms than the direct clearance of CSPG. We thus propose that MMP-13 cleaves matrix components such as collagen, gelatin and aggrecans. The later may enhance neuroplasticity via matrix remodeling or destabilization of matrix components which are substrates to MMP-13. The inhibition of CSPG may be part of this or may be viewed as the consequence of matrix remodeling. It is interesting to note that MMP-13 was not previously described to have a role in spinal cord repair, but was recently suggested via in-vitro studies to degrade CSPG.

[0097] It is also worth mentioning that the basal levels of MMPs are usually very low at the CNS. Elevated levels of distinct MMPs are detected only under pathological stages. This suggests that such key proteolytic enzyme target specific substrates within the CNS. Yet, the elevated levels are apparently insufficient for timely remodeling or destabilization of the matrix components and exogenous intervention with this enzyme is the essence of the present invention.

[0098] Hence, our work identifies and further refines the physiological molecular mechanism of CNS recovery via a "non-trivial" enzyme, MMP-13, for which CSPG, the main inhibitor for CNS regeneration, is not the direct substrate. MMP- 13 may regulate other components of the perineuronal net, such as Tenascin and Aggrecan, which are known to be ligands for this enzyme and critical components of the glial scar, further highlighting its functional relevance to the dynamic repair response post trauma.

[0099] Thus resolution/termination of inflammation and tissue remodeling are tightly interconnected and seem to be a general phenomenon of wound healing macrophages. In fact, one can view the two essential characteristics of the infiltrating monocytes for the recovery from spinal cord injury, the antiinflammatory properties described by us before (Shechter et al, 2009) and scar degradation properties of these cells revealed here, as two aspects of their resolving phenotype. These cells 'resolve' the first phase of the dynamic response to the injury, which is characterized by both intense inflammation and scar formation.

[00100] The identified monocyte-glial scar interplay thus primes the resolution phase of CNS tissue healing, thereby providing a platform for the repair response. Revealing the underlying mechanism behind this necessary dialogue might enable the development of novel therapeutic approaches to fine-tune it. The recognition of a novel enzyme that modulates CSPG deposition and has a fundamental contribution to the repair process indicates a potential target for future therapies. Our findings harbor significant clinical implications not only for the repair of CNS injuries, but also for the resolution of autoimmune diseases of the CNS, in which inflammation goes awry. REFERENCES

Arnold L, Henry A, Poron F, Baba-Amer Y, van Rooijen N, et al. (2007) Inflammatory monocytes recruited after skeletal muscle injury switch into antiinflammatory macrophages to support myogenesis. J Exp Med 204: 1057-1069.

Baptiste DC, Fehlings MG (2007) Update on the treatment of spinal cord injury. Prog Brain Res 161: 217-233.

Barrette B, Hebert MA, Filali M, Lafortune K, Vallieres N, et al. (2008) Requirement of myeloid cells for axon regeneration. J Neurosci 28: 9363-9376.

Block ML, Zecca L, Hong JS (2007) Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci 8: 57-69.

Boven LA, Van Meurs M, Van Zwam M, Wierenga-Wolf A, Hintzen RQ, et al. (2006) Myelin-laden macrophages are anti-inflammatory, consistent with foam cells in multiple sclerosis. Brain 129: 517-526.

Bradbury EJ, Moon LD, Popat RJ, King VR, Bennett GS, et al. (2002) Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature 416: 636-640. Fallowfield JA, Mizuno M, Kendall TJ, Constandinou CM, Benyon RC, et al. (2007) Scar-associated macrophages are a major source of hepatic matrix metalloproteinase-13 and facilitate the resolution of murine hepatic fibrosis. J Immunol 178: 5288-5295.

Gordon S (2003) Alternative activation of macrophages. Nat Rev Immunol

3: 23-35.

Kigerl KA, Gensel JC, Ankeny DP, Alexander JK, Donnelly DJ, et al. (2009) Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. J Neurosci 29: 13435-13444.

Luo Y, Raper JA (1994) Inhibitory factors controlling growth cone motility and guidance. Curr Opin Neurobiol 4: 648-654.

Mildner A, Schmidt H, Nitsche M, Merkler D, Hanisch UK, et al. (2007) Microglia in the adult brain arise from Ly-6ChiCCR2+ monocytes only under defined host conditions. Nat Neurosci 10: 1544-1553.

Moon LD, Asher RA, Rhodes KE, Fawcett JW (2001) Regeneration of CNS axons back to their target following treatment of adult rat brain with chondroitinase ABC. Nat Neurosci 4: 465-466.

Mosser DM, Edwards JP (2008) Exploring the full spectrum of macrophage activation. Nat Rev Immunol 8: 958-969.

Nahrendorf M, Swirski FK, Aikawa E, Stangenberg L, Wurdinger T, et al. (2007) The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions. J Exp Med 204: 3037-3047.

Popovich PG, Guan Z, Wei P, Huitinga I, van Rooijen N, et al. (1999) Depletion of hematogenous macrophages promotes partial hindlimb recovery and neuroanatomical repair after experimental spinal cord injury. Exp Neurol 158: 351- 365.

Qian BZ, Pollard JW (2010) Macrophage diversity enhances tumor progression and metastasis. Cell 141: 39-51. Rapalino O, Lazarov-Spiegler O, Agranov E, Velan GJ, Yoles E, et al. (1998) Implantation of stimulated homologous macrophages results in partial recovery of paraplegic rats. Nat Med 4: 814-821.

Rolls A, Shechter R, London A, Segev Y, Jacob-Hirsch J, et al. (2008) Two faces of chondroitin sulfate proteoglycan in spinal cord repair: a role in microglia/macrophage activation. PLoS Med 5: el71.

Rolls A, Shechter R, Schwartz M (2009) The bright side of the glial scar in CNS repair. Nat Rev Neurosci 10: 235-241.

Rosamond S, Brown L, Gomez C, Braciale TJ, Schwartz BD (1987) Xyloside inhibits synthesis of the class II-associated chondroitin sulfate proteoglycan and antigen presentation events. J Immunol 139: 1946-1951.

Shechter R, London A, Varol C, Raposo C, Cusimano M, et al. (2009) Infiltrating blood-derived macrophages are vital cells playing an anti-inflammatory role in recovery from spinal cord injury in mice. PLoS Med 6: elOOOl 13.

Shechter R, Raposo C, London A, Sagi I, Schwartz M (2011) The Glial Scar-

Monocyte Interplay: A Pivotal Resolution Phase in Spinal Cord Repair. PLoS ONE 6(12): e27969

Silver J, Miller JH (2004) Regeneration beyond the glial scar. Nat Rev Neurosci 5: 146-156.

Simard AR, Soulet D, Gowing G, Julien JP, Rivest S (2006) Bone marrow- derived microglia play a critical role in restricting senile plaque formation in Alzheimer's disease. Neuron 49: 489-502.

Sofroniew MV (2009) Molecular dissection of reactive astrogliosis and glial scar formation. Trends Neurosci 32: 638-647.

Stirling DP, Liu S, Kubes P, Yong VW (2009) Depletion of Ly6G/Gr-l leukocytes after spinal cord injury in mice alters wound healing and worsens neurological outcome. J Neurosci 29: 753-764.

Sun X, Wang X, Chen T, Li T, Cao K, et al. (2010) Myelin activates FAK/Akt/NF-kappaB pathways and provokes CR3-dependent inflammatory response in murine system. PLoS One 5: e9380. Varol C, Landsman L, Fogg DK, Greenshtein L, Gildor B, et al. (2007) Monocytes give rise to mucosal, but not splenic, conventional dendritic cells. J Exp Med 204: 171-180.