TRIPLE FUNCTION ADENO-ASSOCIATED VIRUS (AAV)VECTORS FOR THE TREATMENT OF C9ORF72 ASSOCIATED DISEASES CROSS-REFERENCE TO RELATED APPLICATIONS This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No.62/924,351 filed October 22, 2019, the contents of which is incorporated herein by reference in its entirety. FIELD OF THE INVENTION The present invention relates to the field of gene therapy, including AAV vectors for expressing an isolated polynucleotides in a subject or cell. The disclosure also relates to nucleic acid constructs, promoters, vectors, and host cells including the polynucleotides as well as methods of delivering exogenous DNA sequences to a target cell, tissue, organ or organism, and methods for use in the treatment or prevention of c9orf72 associated diseases or disorders, such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). BACKGROUND Gene therapy aims to improve clinical outcomes for patients suffering from either genetic mutations or acquired diseases caused by an aberration in the gene expression profile. Gene therapy includes the treatment or prevention of medical conditions resulting from defective genes or abnormal regulation or expression, e.g., underexpression or overexpression, that can result in a disorder, disease, malignancy, etc. For example, a disease or disorder caused by a defective gene might be treated, prevented or ameliorated by delivery of a corrective genetic material to a patient, or might be treated, prevented or ameliorated by altering or silencing a defective gene, e.g., with a corrective genetic material to a patient resulting in the therapeutic expression of the genetic material within the patient. The basis of gene therapy is to supply a transcription cassette with an active gene product (sometimes referred to as a transgene or a therapeutic nucleic acid), e.g., that can result in a positive gain-of-function effect, a negative loss-of-function effect, or another outcome. Such outcomes can be attributed to expression of a therapeutic protein such as an antibody, a functional enzyme, or a fusion protein. Gene therapy can also be used to treat a disease or malignancy caused by other factors. Human monogenic disorders can be treated by the delivery and expression of a normal gene to the target cells. Delivery and expression of a corrective gene in the patient's target cells can be carried out via numerous methods, including the use of engineered viruses and viral gene delivery vectors. Adeno-associated viruses (AAV) belong to the Parvoviridae family and more specifically constitute the dependoparvovirus genus. Vectors derived from AAV (i.e., recombinant AAV (rAVV) or AAV vectors) are attractive for delivering genetic material because (i) they are able to infect (transduce) a wide variety of non-dividing and dividing cell types including myocytes and neurons; (ii) they are devoid of the virus structural genes, thereby diminishing the host cell responses to virus infection, e.g., interferon-mediated responses; (iii) wild-type viruses are considered non-pathologic in humans; (iv) in contrast to wild type AAV, which are capable of integrating into the host cell genome, replication-deficient AAV vectors lack the rep gene and generally persist as episomes, thus limiting the risk of insertional mutagenesis or genotoxicity; and (v) in comparison to other vector systems, AAV vectors are generally considered to be relatively poor immunogens and therefore do not trigger a significant immune response (see ii), thus gaining persistence of the vector DNA and potentially, long-term expression of the therapeutic transgenes. Amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD) are severe neurodegenerative diseases with no effective treatment. ALS is a fatal neurodegenerative disease characterized clinically by progressive paralysis leading to death from respiratory failure, typically within two to three years of symptom onset (Rowland and Schneider, N. Engl. J. Med., 2001, 344, 1688-1700). ALS is the third most common neurodegenerative disease in the Western world (Hirtz et al., Neurology, 2007, 68, 326-337), and there are currently no effective therapies. Approximately 10% of cases are familial in nature, whereas the bulk of patients diagnosed with the disease are classified as sporadic as they appear to occur randomly throughout the population (Chio et al., Neurology, 2008, 70, 533-537). Some patients may also develop frontotemporal dementia. Frontotemporal dementia (FTD) is a group of related conditions resulting from the progressive degeneration of the temporal and frontal lobes of the brain. Depending on the affected regions, FTD patients suffer from dementia, behavioral abnormalities, language impairment and personality changes. A strong genetic link and evidence from multiple families has been reported with autosomal dominant FTD and ALS. There is growing recognition, based on clinical, genetic, and epidemiological data, that ALS and FTD represent an overlapping continuum of disease, characterized pathologically by the presence of TDP-43 positive inclusions throughout the central nervous system (Lillo and Hodges, J. Clin. Neurosci., 2009, 16, 1131-1135; Neumann et al., Science, 2006, 314, 130-133). A mutation in the non-coding region of the C9orf72 gene has been identified as the most common genetic cause of both ALS and FTD (DeJesus-Hernandez et al., Neuron.2011 Oct 20; 72(2):245-56; Renton et al., Neuron.2011 Oct 20; 72(2):257-68). Two major mature mRNA transcript isoforms of c9orf72 are expressed, v1 & v2, with proposed distinct intracellular functions. v1 regulates Stress Granule assembly in response to cellular stress, while v2 does not appear to participate in stress granule assembly or regulation. Mutation carriers have a GGGGCC hexanucleotide repeat expansion either in the first intron or the promoter region, depending on the isoform of the c9orf72 transcript (Beck et al., Am J Hum Genet.2013 Mar 7; 92(3):345-53). Patients typically have several hundred or thousand repeats, whereas healthy controls show <33 repeats (Beck et al., 2013; van der Zee et al., Hum Mutat. 2013 Feb; 34(2):363-73). In addition to the common TDP-43 aggregates in FTD and ALS, C9orf72 mutation carriers have abundant star-shaped, TDP-43-negative neuronal cytoplasmic inclusions (NCI) particularly in the cerebellum, hippocampus and frontal neocortex that stain positive for markers of the proteasome system (UPS) such as p62 or ubiquitin (Al Sarraj et al., Acta Neuropathol. 2011 Dec; 122(6):691-702). These TDP-43-negative inclusions contain dipeptide repeat proteins (DPR) that are translated ATG-independent from both sense and antisense transcripts of the C9orf72 repeat in all reading frames (Ash et al., Neuron.2013 Feb 20; 77(4):639-46; Gendron et al., Acta Neuropathol.2013 Dec; 126(6):829-44; Mann et al., Acta Neuropathol Commun.2013 Oct 14; 1():68). Although advances have been made in recent years regarding diagnostic criteria, clinical assessment instruments, neuropsychological tests, cerebrospinal fluid biomarkers, and brain imaging techniques, to date, there is no curative treatment for ALS or FTD. The present disclosure addresses the need for effective treatment of neurodegenerative diseases, such as ALS and FTD. SUMMARY OF THE INVENTION The present disclosure describes, in part, triple function AAV vectors and their use in treating a c9orf72 associated disease, an in particular a c9orf72 hexanucleotide repeat expansion associated disease. The triple function of the AAV vectors described herein comprises c9orf72 gene supplementation, knock-down of c9orf72 sense transcripts and knock-down of c9orf72 anti-sense transcripts. According to a first aspect, the disclosure provides a nucleic acid encoding a C9ORF72 protein, wherein the nucleic acid sequence is codon optimized. According to some embodiments, the nucleic acid sequence is codon optimized to avoid siRNA knockdown. According to some embodiments, the codon optimized sequence is selected from a nucleic acid sequence set forth in Table 2. According to some embodiments, the codon optimized sequence is selected from a nucleic acid sequence selected from any one of SEQ ID NOs 14-52. According to some embodiments, the codon optimized sequence a nucleic acid sequence that is at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs 14-52. According to another aspect, the disclosure provides a transgene expression cassette comprising a promoter; and the nucleic acid of any of the aspects and embodiments herein. According to another aspect, the disclosure provides a transgene expression cassette comprising a promoter; the nucleic acid of any of the aspects and embodiments herein; a c9orf72 sense transcript specific inhibitor; and a c9orf72 antisense transcript specific inhibitor. According to some embodiments, the transgene expression cassette further comprises a c9orf72 sense transcript specific inhibitor. According to some embodiments, the nucleic acid is a microRNA (miRNA). According to some embodiments, the sense transcript inhibitor is selected from an miRNA set forth in Table 4. According to some embodiments, the antisense transcript inhibitor is selected from an miRNA set forth in Table 3. According to some embodiments, the c9orf72 sense transcript specific inhibitor is any of a nucleic acid, aptamer, antibody, peptide, or small molecule. According to some embodiments, the nucleic acid is a single-stranded nucleic acid or a double-stranded nucleic acid. According to some embodiments, the nucleic acid is a siRNA. According to some embodiments, the c9orf72 sense transcript inhibitor is an antisense compound. According to some embodiments, the antisense compound is an antisense oligonucleotide. According to some embodiments, the antisense compound is a modified oligonucleotide. According to some embodiments, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a c9orf72 sense transcript. According to some embodiments, the transgene expression cassette further comprises a c9orf72 antisense transcript specific inhibitor. According to some embodiments, the c9orf72 antisense transcript specific inhibitor is an antisense compound. According to some embodiments, the c9orf72 antisense transcript specific antisense compound is an antisense oligonucleotide. According to some embodiments, the antisense oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a c9orf72 antisense transcript. According to some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. According to some embodiments, the antisense oligonucleotide is a gapmer. According to some embodiments, the transgene expression cassette further comprises two inverted terminal repeats (ITRs). According to some embodiments, the transgene expression cassette further comprises minimal regulatory elements (MRE). According to some embodiments, the promoter is specific for expression in neurons. According to some embodiments, the promoter is human Synapsin 1 (hSyn) promoter. According to some embodiments, the nucleic acid is a human nucleic acid. According to other aspects, the disclosure provides a nucleic acid vector comprising the expression cassette of any of the aspects and embodiments herein. According to some embodiments, the vector is an adeno-associated viral (AAV) vector. According to some embodiments, the serotype of the capsid sequence and the serotype of the ITRs of said AAV vector are independently selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. According to some embodiments, the capsid sequence is a mutant capsid sequence. According to some embodiments, the vector comprises SEQ ID NO: 53. According to some embodiments, the vector comprises a nucleic acid sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 53. According to some embodiments, the vector comprises SEQ ID NO: 56. According to some embodiments, the vector comprises a nucleic acid sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 56. According to some embodiments, the vector comprises SEQ ID NO: 59. According to some embodiments, the vector comprises a nucleic acid sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 59. According to some embodiments, the vector comprises SEQ ID NO: 62. According to some embodiments, the vector comprises a nucleic acid sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 62. According to some embodiments, the vector comprises SEQ ID NO: 65. According to some embodiments, the vector comprises a nucleic acid sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 65. According to some embodiments, the vector comprises a nucleic acid sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 65. According to some embodiments, the vector comprises SEQ ID NO: 68. According to some embodiments, the vector comprises a nucleic acid sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 68. According to some embodiments, the vector comprises SEQ ID NO: 71. According to some embodiments, the vector comprises a nucleic acid sequence at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 71. According to other aspects, the disclosure provides a mammalian cell comprising the vector of any of the aspects and embodiments herein. According to other aspects, the disclosure provides a method of making a recombinant adeno-associated viral (rAAV) vector comprising inserting into an adeno-associated viral vector a promoter; and at least one nucleic acid of any of the aspects and embodiments herein. According to other aspects, the disclosure provides a method of making a recombinant adeno-associated viral (rAAV) vector comprising inserting into an adeno-associated viral vector; a promoter; at least one nucleic acid of any of the aspects and embodiments herein; a c9orf72 sense transcript specific inhibitor; and a c9orf72 antisense transcript specific inhibitor. According to some embodiments, the nucleic acid is a human nucleic acid. According to some embodiments, the serotype of the capsid sequence and the serotype of the ITRs of said AAV vector are independently selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. According to some embodiments, the capsid sequence is a mutant capsid sequence. According to other aspects, the disclosure provides a method of treating a c9orf72 associated disease, comprising administering to a subject in need thereof the vector of any of the aspects and embodiment herein, thereby treating the c9orf72 associated disease in the subject. According to other aspects, the disclosure provides a method of preventing the progression of a c9orf72 associated disease, comprising administering to a subject in need thereof the vector of any of the aspects and embodiments herein, thereby treating the c9orf72 associated disease in the subject. According to some embodiments, the c9orf72 associated disease is a c9orf72 hexanucleotide repeat expansion associated disease. According to some embodiments, the c9orf72 associated disease is a neurodegenerative disease. According to some embodiments, the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson disease, progressive supranuclear palsy, ataxia, corticobasal syndrome, Huntington disease-like syndrome, Creutzfeldt–Jakob disease and Alzheimer disease. According to some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) and/or frontotemporal dementia (FTD). According to some embodiments, the ALS is familial ALS or sporadic ALS. According to some embodiments, the subject has one or more mutations in the c9orf72 gene. According to some embodiments, the one or more mutations are selected from: one or more hexanucleotide repeat expansions, one or more nonsense mutations and one or more frame-shift mutations. According to some embodiments, the expression of c9orf72 is inhibited or suppressed. According to some embodiments, the c9orf72 is wild type c9orf72, mutated c9orf72 or both wild type c9orf72 and mutated c9orf72. According to some embodiments, the expression of c9orf72 is inhibited or suppressed by about 10% to about 100%, about 10% to about 90%, about 10% to about 70%, about 10% to about 50%, about 10% to about 30%, about 10% to about 20%, about 25% to about 75%, about 25% to about 50%, about 50% to about 75%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more. According to other aspects, the disclosure provides a method for inhibiting the expression of c9orf72 gene in a cell wherein the c9orf72 gene comprises a hexanucleotide repeat expansion, comprising administering the cell a composition comprising the vector of any of the aspects and embodiments herein. According to some embodiments, the hexanucleotide repeat expansion causes loss of function of c9orf72 protein and/or toxic gain of function from sense and antisense c9orf72 repeat RNA or from dipeptide repeats. According to some embodiments, the cell is a mammalian cell. According to some embodiments, the mammalian cell is a motor neuron or an astrocyte. According to some embodiments of any of the methods described herein, the vector is administered by intracranial administration. According to some embodiments, the intracranial administration comprises intrathecal or intracerebroventricular administration. According to other aspects, the disclosure provides a kit comprising the vector of any of the aspects and embodiments herein, and instructions for use. According to some embodiments, the kit further comprises a device for intracranial administration delivery of the vector. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1A is a schematic showing gene structure of c9orf72-AI. FIG.1B shows the corresponding nucleic acid sequence. FIG.2 is a schematic showing gene supplementation of c9orf72. FIG.3A is a schematic showing the first open reading frame of an alternative translation of c9orf72. FIG.3B shows the corresponding nucleic acid sequence. FIG.3C is a schematic showing the second open reading frame after splicing of an alternative translation of c9orf72. FIG.3D shows the corresponding nucleic acid sequence. FIG.4 shows schematic constructs with selection marker. FIG.5 is a vector map of p084_EXPR_pcDNA_CBA_WTC9-EpiTag_WPRE. FIG.6 is a vector map of p085_EXPR_pcDNA_CASI_WTC9-EpiTag_WPRE. FIG.7 is a vector map of p111_EXPR-pcDNA-CBA-C9orf72-AI-loxp-WPRE-pA. FIG.8 is a vector map of p131_Expr_pcDNA-CBA-C9-mutAI-His-HA-WPRE-pA. FIG.9 is a vector map of p132_Expr_pcDNACBA-C9-AI-stop-His-HA-WPRE-pA. FIG.10 is a vector map of p133_Expr_pcDNA-CBA-C9-AI-Myc-Stop-His-HA-WPRE- pA. FIG.11 is a vector map of p134_Expr_pcDNA-CBA-C9-AI-Myc-stop-V2-His- Wpre_pA. FIG.12 is a graph showing high dynamic range generated by different promoters. FIG.13 shows schematic constructs and dose ranges. FIG.14 shows the results of the modulator test experiment. FIG.15 is a vector map of p141_EXPR_AAV_CBA-BFP_Antisense_miRNA1. FIG.16 is a vector map of p147_EXPR_AAV_CBA-BFP_sense_miRNA41. FIG.17 is a vector map of p136_Lenti_CBA_tandomarray-Sense-GA80s-GFP-WPRE. FIG.18 is a vector map of p137_Lenti_CBA_tandomarray-AntiSense-GA80s-GFP- WPRE. FIG.19 is a vector map of p138_Lenti_CBA_flex-Chronos-GA80s-GFP-WPRE. FIG.20 shows the results of miRNA knockdown experiment. FIG.21 shows a Western blot demonstrating expression of short isoform of C9orf72 protein. DETAILED DESCRIPTION I. Definitions This disclosure is not limited to the particular methodology, protocols, cell lines, vectors, or reagents described herein because they may vary. Further, the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this disclosure belongs. The following references provide one of skill with a general definition of many of the terms used in this disclosure: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise. As used herein, “AAV” refers to adeno-associated virus, and may be used to refer to the recombinant virus vector itself or derivatives thereof. The term covers all subtypes, serotypes and pseudotypes, and both naturally occurring and recombinant forms, except where required otherwise. As used herein, the term “serotype” refers to an AAV which is identified by and distinguished from other AAVs based on its serology, e.g., there are eleven serotypes of AAVs, AAV1-AAV11, and the term encompasses pseudotypes with the same properties. As used herein, an “AAV vector” is meant to refer to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it can be referred to as “rAAV (recombinant AAV).” Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e. AAV Rep and Cap proteins). When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. A rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, e.g., an AAV particle. A rAAV vector can be packaged into an AAV virus capsid to generate a “recombinant adeno-associated viral particle (rAAV particle).” An AAV “capsid protein” includes a capsid protein of a wild-type AAV, as well as modified forms of an AAV capsid protein which are structurally and or functionally capable of packaging an AAV genome and bind to at least one specific cellular receptor which may be different than a receptor employed by wild type AAV. A modified AAV capsid protein includes a chimeric AAV capsid protein such as one having amino acid sequences from two or more serotypes of AAV, e.g., a capsid protein formed from a portion of the capsid protein from AAV5 fused or linked to a portion of the capsid protein from AAV2, and a AAV capsid protein having a tag or other detectable non-AAV capsid peptide or protein fused or linked to the AAV capsid protein, e.g., a portion of an antibody molecule which binds the transferrin receptor may be recombinantly fused to the AAV-2 capsid protein. As used herein, a “rAAV virus” or “rAAV viral particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated rAAV vector genome. As used herein, the terms “administer,” “administering,” “administration,” and the like, are meant to refer to methods that are used to enable delivery of therapeutics or pharmaceutical compositions to the desired site of biological action. According to certain embodiments, these methods include subretinal or intravitreal injection to an eye. As used herein, “antisense activity” is meant to refer to any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein product encoded by such target nucleic acid. As used herein, “antisense compound” is meant to refer to an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds. As used herein, “antisense inhibition” is meant to refer to reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound. As used herein, “antisense oligonucleotide” is meant to refer to a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid. According to some embodiments, the antisense oligonucleotides of the present disclosure comprise at least 80%, at least about 85%, at least about 90%, at least about 95% sequence complementarity to a target region within the target nucleic acid. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Antisense and other compounds of the disclosure, which hybridize to ABCD1 mRNA, are identified through experimentation, and representative sequences of these compounds are herein below identified as preferred embodiments of the disclosure. As used herein, “c9orf72 antisense transcript" means transcripts produced from the non- coding strand (also called antisense strand and template strand) of the c9orf72 gene. The c9orf72 antisense transcript differs from the canonically transcribed “c9orf72 sense transcript”, which is produced from the coding strand (also called sense strand) of the c9orf72 gene. As used herein, “c9orf72 associated disease” is meant to refer to means any disease associated with any c9orf72 nucleic acid or expression product thereof, regardless of which DNA strand the c9orf72 nucleic acid or expression product thereof is derived from. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD. As used herein, “c9orf72 hexanucleotide repeat expansion associated disease” means any disease associated with a c9orf72 nucleic acid containing a hexanucleotide repeat expansion. In certain embodiments, the hexanucleotide repeat expansion may comprise any of the following hexanucleotide repeats: GGGGCC, GGGGGG, GGGGGC, GGGGCG, GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC. In certain embodiments, the hexanucleotide repeat is repeated at least 24 times. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include ALS and FTD. As used herein, “c9orf72 nucleic acid” is meant to refer to any nucleic acid derived from the c9orf72 locus, regardless of which DNA strand the c9orf72 nucleic acid is derived from. In certain embodiments, a c9orf72 nucleic acid includes a DNA sequence encoding c9orf72, an RNA sequence transcribed from DNA encoding c9orf72 including genomic DNA comprising introns and exons (i.e., pre-mRNA), and an mRNA sequence encoding c9orf72. "c9orf72 mRNA" means an mRNA encoding a c9orf72 protein. In certain embodiments, a c9orf72 nucleic acid includes transcripts produced from the coding strand of the C9ORF72 gene. C9ORF72 sense transcripts are examples of c9orf72 nucleic acids. In certain embodiments, a c9orf72 nucleic acid includes transcripts produced from the non-coding strand of the c9orf72 gene. c9orf72 antisense transcripts are examples of c9orf72 nucleic acids. As used herein, “c9orf72 transcript” is meant to refer to an RNA transcribed from c9orf72. In certain embodiments, a c9orf72 transcript is a c9orf72 sense transcript. In certain embodiments, a c9orf72 transcript is a c9orf72 antisense transcript. As used herein, “cap structure” or “terminal cap moiety” is meant to refer to chemical modifications, which have been incorporated at either terminus of an antisense compound. As used herein, “complementarity” is meant to refer to the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid. “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid. As used herein, the term “carrier” is meant to include any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase “pharmaceutically-acceptable” refers to molecular entities and compositions that do not produce a toxic, an allergic, or similar untoward reaction when administered to a host. As used herein, the terms “expression vector,” “vector” or “plasmid” can include any type of genetic construct, including AAV or rAAV vectors, containing a nucleic acid or polynucleotide coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed and is adapted for gene therapy. The transcript can be translated into a protein. In some instances, it may be partially translated or not translated. In certain embodiments, expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding genes of interest. An expression vector can also comprise control elements operatively linked to the encoding region to facilitate expression of the protein in target cells. The combination of control elements and a gene or genes to which they are operably linked for expression can sometimes be referred to as an “expression cassette.” As used herein, the term “flanking” refers to a relative position of one nucleic acid sequence with respect to another nucleic acid sequence. Generally, in the sequence ABC, B is flanked by A and C. The same is true for the arrangement AxBxC. Thus, a flanking sequence precedes or follows a flanked sequence but need not be contiguous with, or immediately adjacent to the flanked sequence. As used herein, the term “gene delivery” means a process by which foreign DNA is transferred to host cells for applications of gene therapy. As used herein, “gene supplementation” is meant to refer to replacing, altering, or supplementing a gene that is absent or abnormal and whose absence or abnormality is responsible for the disease. According to some embodiments, the c9orf72 gene is supplemented. According to some embodiments, the c9orf72 gene is mutated. According to some embodiments, the c9orf72 gene comprises one or more nonsense mutations. According to some embodiments, the c9orf72 gene comprises one or more frame-shift mutations. As used herein, the term “heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide). Similarly, a cellular sequence (e.g., a gene or portion thereof) that is incorporated into a viral vector is a heterologous nucleotide sequence with respect to the vector. As used herein, the term “increase,” “enhance,” “raise” (and like terms) generally refers to the act of increasing, either directly or indirectly, a concentration, level, function, activity, or behavior relative to the natural, expected, or average, or relative to a control condition. As used herein, “hexanucleotide repeat expansion” is meant to refer to a series of six bases (for example, GGGGCC, GGGGGG, GGGGGC, GGGGCG, GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC) repeated at least twice. In certain embodiments, the hexanucleotide repeat may be transcribed in the antisense direction from the c9orf72 gene. In certain embodiments, a pathogenic hexanucleotide repeat expansion includes at least 24 repeats of GGGGCC, GGGGGG, GGGGGC, GGGGCG, GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC in a c9orf72 nucleic acid and is associated with disease. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by 1 or more nucleobases. In certain embodiments, a wild-type hexanucleotide repeat expansion includes 23 or fewer repeats of GGGGCC, GGGGGG, GGGGGC, GGGGCG, GGCCCC, CCCCCC, GCCCCC, and/or CGCCCC in a c9orf72 nucleic acid. In certain embodiments, the repeats are consecutive. In certain embodiments, the repeats are interrupted by 1 or more nucleobases. As used herein, “hybridization” is meant to refer to the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target. As used herein, “inhibiting expression of a c9orf72 antisense transcript” is meant to refer to reducing the level or expression of a c9orf72 antisense transcript and/or its expression products (e.g., RAN translation products). In certain embodiments, c9orf72 antisense transcripts are inhibited in the presence of an antisense compound targeting a c9orf72 antisense transcript, including an antisense oligonucleotide targeting a c9orf72 antisense transcript, as compared to expression of c9orf72 antisense transcript levels in the absence of a C9ORF72 antisense compound, such as an antisense oligonucleotide. As used herein, “inhibiting expression of a c9orf72 sense transcript” is meant to refer to reducing the level or expression of a c9orf72 sense transcript and/or its expression products (e.g., a c9orf72 mRNA and/or protein). In certain embodiments, c9orf72 sense transcripts are inhibited in the presence of an antisense compound targeting a c9orf72 sense transcript, including an antisense oligonucleotide targeting a c9orf72 sense transcript, as compared to expression of c9orf72 sense transcript levels in the absence of a c9orf72 antisense compound, such as an antisense oligonucleotide. As used herein, “inverted terminal repeat” or “ITR” sequence is meant to refer to relatively short sequences found at the termini of viral genomes which are in opposite orientation. An “AAV inverted terminal repeat (ITR)” sequence, a term well-understood in the art, is an approximately 145-nucleotide sequence that is present at both termini of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contains several shorter regions of self-complementarity (designated A, A', B, B', C, C' and D regions), allowing intrastrand base-pairing to occur within this portion of the ITR. A “wild-type ITR” ,“WT-ITR” or “ITR” refers to the sequence of a naturally occurring ITR sequence in an AAV or other Dependovirus that retains, e.g., Rep binding activity and Rep nicking ability. The nucleotide sequence of a WT-ITR from any AAV serotype may slightly vary from the canonical naturally occurring sequence due to degeneracy of the genetic code or drift, and therefore WT-ITR sequences encompassed for use herein include WT-ITR sequences as result of naturally occurring changes taking place during the production process (e.g., a replication error). As used herein, the term “terminal repeat” or “TR” includes any viral terminal repeat or synthetic sequence that comprises at least one minimal required origin of replication and a region comprising a palindrome hairpin structure. A Rep-binding sequence (“RBS”) (also referred to as RBE (Rep-binding element)) and a terminal resolution site (“TRS”) together constitute a “minimal required origin of replication” and thus the TR comprises at least one RBS and at least one TRS. TRs that are the inverse complement of one another within a given stretch of polynucleotide sequence are typically each referred to as an “inverted terminal repeat” or “ITR”. In the context of a virus, ITRs mediate replication, virus packaging, integration and provirus rescue. The term “in vivo” refers to assays or processes that occur in or within an organism, such as a multicellular animal. In some of the aspects described herein, a method or use can be said to occur “in vivo” when a unicellular organism, such as a bacterium, is used. The term "ex vivo" refers to methods and uses that are performed using a living cell with an intact membrane that is outside of the body of a multicellular animal or plant, e.g., explants, cultured cells, including primary cells and cell lines, transformed cell lines, and extracted tissue or cells, including blood cells, among others. The term “in vitro” refers to assays and methods that do not require the presence of a cell with an intact membrane, such as cellular extracts, and can refer to the introducing of a programmable synthetic biological circuit in a non-cellular system, such as a medium not comprising cells or cellular systems, such as cellular extracts. As used herein, an “isolated” molecule (e.g., nucleic acid or protein) or cell means it has been identified and separated and/or recovered from a component of its natural environment. As used herein, “locked nucleic acid” or “LNA” or “LNA nucleosides” is meant to refer to nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2' position of the nucleoside sugar unit, thereby forming a bicyclic sugar. As used herein, the term “minimize”, “reduce”, “decrease,” and/or “inhibit” (and like terms) generally refers to the act of reducing, either directly or indirectly, a concentration, level, function, activity, or behavior relative to the natural, expected, or average, or relative to a control condition. As used herein, “minimal regulatory element” is meant to refer to regulatory elements that are necessary for effective expression of a gene in a target cell and thus should be included in a transgene expression cassette. Such sequences could include, for example, promoter or enhancer sequences, a polylinker sequence facilitating the insertion of a DNA fragment within a plasmid vector, and sequences responsible for intron splicing and polyadenlyation of mRNA transcripts. In a recent example of a gene therapy treatment for achromatopsia, the expression cassette included the minimal regulatory elements of a polyadenylation site, splicing signal sequences, and AAV inverted terminal repeats. See, e.g., Komaromy et al. As used herein, “mismatch” or “non-complementary nucleobase” is meant to refer to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid. As used herein, “modified internucleoside linkage” is meant to refer to a substitution or any change from a naturally occurring internucleoside bond (i.e., a phosphodiester internucleoside bond). As used herein, “modified nucleobase” is meant to refer to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). As used herein, “modified nucleoside” is meant to refer to nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. As used herein, “modified nucleotide” is meant to refer to a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase. As used herein, “modified oligonucleotide” is meant to refer to an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and/or modified nucleobase. As used herein, a “nucleic acid” is meant to refer to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA). As used herein, “nucleobase” is meant to refer to heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein, “nucleotide” is meant to refer to a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside. As used herein, “nucleoside” is meant to refer to a nucleobase linked to a sugar. The asymmetric ends of DNA and RNA strands are called the 5′ (five prime) and 3′ (three prime) ends, with the 5' end having a terminal phosphate group and the 3' end a terminal hydroxyl group. The five prime (5’) end has the fifth carbon in the sugar-ring of the deoxyribose or ribose at its terminus. Nucleic acids are synthesized in vivo in the 5'- to 3'-direction, because the polymerase used to assemble new strands attaches each new nucleotide to the 3'-hydroxyl (- OH) group via a phosphodiester bond. The term “nucleic acid construct” as used herein refers to a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic. The term nucleic acid construct is synonymous with the term “expression cassette” when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present disclosure. A DNA sequence that “encodes” a particular PGRN protein (including fragments and portions thereof) is a nucleic acid sequence that is transcribed into the particular RNA and/or protein. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein, or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g., tRNA, rRNA, or a DNA-targeting RNA; also called "non-coding" RNA or "ncRNA"). As used herein, the terms “operatively linked” or “operably linked” or “coupled” can refer to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in an expected manner. For instance, a promoter can be operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained. As used herein, a “percent (%) sequence identity” with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in the reference polypeptide or nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid or nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software programs, for example, those described in Current Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supp.30, section 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. An example of an alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows: 100 times the fraction X/Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. For purposes herein, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows: 100 times the fraction W/Z, where W is the number of nucleotides scored as identical matches by the sequence alignment program in that program's alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C. As used herein, “pharmaceutical composition” or “composition” is meant to refer to a composition or agent described herein (e.g. a recombinant adeno-associated (rAAV) expression vector) , optionally mixed with at least one pharmaceutically acceptable chemical component, such as, though not limited to carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, excipients and the like. As used herein, “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by the definition. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of the present disclosure, a "polypeptide" refers to a protein which includes modifications, such as deletions, additions, and substitutions (generally conservative in nature), to the native sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification. As used herein, a “promoter” is meant to refer to a region of DNA that facilitates the transcription of a particular gene. As part of the process of transcription, the enzyme that synthesizes RNA, known as RNA polymerase, attaches to the DNA near a gene. Promoters contain specific DNA sequences and response elements that provide an initial binding site for RNA polymerase and for transcription factors that recruit RNA polymerase. A promoter can be said to drive expression or drive transcription of the nucleic acid sequence that it regulates. The phrases “operably linked,” “operatively positioned,” “operatively linked,” “under control,” and “under transcriptional control” indicate that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence it regulates to control transcriptional initiation and/or expression of that sequence. An “inverted promoter,” as used herein, refers to a promoter in which the nucleic acid sequence is in the reverse orientation, such that what was the coding strand is now the non-coding strand, and vice versa. Inverted promoter sequences can be used in various embodiments to regulate the state of a switch. In addition, in various embodiments, a promoter can be used in conjunction with an enhancer. A promoter can be one naturally associated with a gene or sequence, as can be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon of a given gene or sequence. Such a promoter can be referred to as “endogenous.” Similarly, in some embodiments, an enhancer can be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. In some embodiments, a coding nucleic acid segment is positioned under the control of a “recombinant promoter” or “heterologous promoter,” both of which refer to a promoter that is not normally associated with the encoded nucleic acid sequence it is operably linked to in its natural environment. A recombinant or heterologous enhancer refers to an enhancer not normally associated with a given nucleic acid sequence in its natural environment. Such promoters or enhancers can include promoters or enhancers of other genes; promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell; and synthetic promoters or enhancers that are not “naturally occurring,” i.e., comprise different elements of different transcriptional regulatory regions, and/or mutations that alter expression through methods of genetic engineering that are known in the art. The term “enhancer” as used herein refers to a cis-acting regulatory sequence (e.g., 50- 1,500 base pairs) that binds one or more proteins (e.g., activator proteins, or transcription factor) to increase transcriptional activation of a nucleic acid sequence. Enhancers can be positioned up to 1,000,000 base pars upstream of the gene start site or downstream of the gene start site that they regulate. As used herein, “recombinant” can refer to a biomolecule, e.g., a gene or protein, that (1) has been removed from its naturally occurring environment, (2) is not associated with all or a portion of a polynucleotide in which the gene is found in nature, (3) is operatively linked to a polynucleotide which it is not linked to in nature, or (4) does not occur in nature. The term “recombinant” can be used in reference to cloned DNA isolates, chemically synthesized polynucleotide analogs, or polynucleotide analogs that are biologically synthesized by heterologous systems, as well as proteins and/or mRNAs encoded by such nucleic acids. As used herein, “region” is meant to refer to a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. As used herein, “ribonucleotide” is meant to refer to a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents. As used herein, “single-stranded oligonucleotide” is meant to refer to an oligonucleotide which is not hybridized to a complementary strand. As used herein, “specifically hybridizable” is meant to refer to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments. As used herein, “stringent hybridization conditions” or “stringent conditions” is meant to refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences. As used herein, a “subject” or “patient” or “individual” to be treated by the method of the invention is meant to refer to either a human or non-human animal. A “nonhuman animal” includes any vertebrate or invertebrate organism. A human subject can be of any age, gender, race or ethnic group, e.g., Caucasian (white), Asian, African, black, African American, African European, Hispanic, Middle eastern, etc. In some embodiments, the subject can be a patient or other subject in a clinical setting. In some embodiments, the subject is already undergoing treatment. In some embodiments, the subject is a neonate, infant, child, adolescent, or adult. As used herein the term “therapeutic effect” refers to a consequence of treatment, the results of which are judged to be desirable and beneficial. A therapeutic effect can include, directly or indirectly, the arrest, reduction, or elimination of a disease manifestation. A therapeutic effect can also include, directly or indirectly, the arrest reduction or elimination of the progression of a disease manifestation. For any therapeutic agent described herein therapeutically effective amount may be initially determined from preliminary in vitro studies and/or animal models. A therapeutically effective dose may also be determined from human data. The applied dose may be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other well-known methods is within the capabilities of the ordinarily skilled artisan. General principles for determining therapeutic effectiveness, which may be found in Chapter 1 of Goodman and Gilman’s The Pharmacological Basis of Therapeutics, 10th Edition, McGraw-Hill (New York) (2001), incorporated herein by reference, are summarized below. As used herein, “targeting” or “targeted” is meant to refer to the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect. As used herein, “target nucleic acid,” “target RNA,” and “target RNA transcript” are meant to refer to a nucleic acid capable of being targeted by antisense compounds. As used herein a “target region” is meant to refer to a portion of a target nucleic acid to which one or more antisense compounds is targeted. As used herein, a “target segment” is meant to refer to the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5' target site” is meant to refer to the 5'-most nucleotide of a target segment. “3' target site” is meant to refer to the 3'-most nucleotide of a target segment. As used herein, “transgene” is meant to refer to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and/or expressed under appropriate conditions. In aspects, it confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic or diagnostic outcome. A “transgene expression cassette” or “expression cassette” comprises the gene sequences that a nucleic acid vector is to deliver to target cells. These sequences include the gene of interest (e.g., CHF nucleic acids or variants thereof), one or more promoters, and minimal regulatory elements. As used herein, “treatment” or “treating” a disease or disorder (such as, for example, a c9orf72 associated disease or a c9orf72 hexanucleotide repeat expansion associated disease, e.g. a neurodegenerative diseases, such as ALS or FTD) is meant to refer to alleviation of one or more signs or symptoms of the disease or disorder, diminishment of extent of disease or disorder, stabilized (e.g., not worsening) state of disease or disorder, preventing spread of disease or disorder, delay or slowing of disease or disorder progression, amelioration or palliation of the disease or disorder state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also refer to prolonging survival as compared to expected survival if not receiving treatment. As used herein, the phrase “unmodified nucleobases” refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases (T), cytosine (C), and uracil (U). As used herein, the term “vector” refers to a recombinant plasmid or virus that comprises a nucleic acid to be delivered into a host cell, either in vitro or in vivo. As used herein, the term “expression vector” refers to a vector that directs expression of an RNA or polypeptide from sequences linked to transcriptional regulatory sequences on the vector. The sequences expressed will often, but not necessarily, be heterologous to the cell. An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification. The term "expression" refers to the cellular processes involved in producing RNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, modification and processing. “Expression products” include RNA transcribed from a gene, and polypeptides obtained by translation of mRNA transcribed from a gene. The term “gene” means the nucleic acid sequence which is transcribed (DNA) to RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. The gene may or may not include regions preceding and following the coding region, e.g., 5’ untranslated (5’UTR) or "leader" sequences and 3’ UTR or “trailer” sequences, as well as intervening sequences (introns) between individual coding segments (exons). As used herein, a “recombinant viral vector” refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of viral origin). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one inverted terminal repeat sequence (ITR). In some embodiments, the recombinant nucleic acid is flanked by two ITRs. As used herein, “reporters” refer to proteins that can be used to provide detectable read- outs. Reporters generally produce a measurable signal such as fluorescence, color, or luminescence. Reporter protein coding sequences encode proteins whose presence in the cell or organism is readily observed. For example, fluorescent proteins cause a cell to fluoresce when excited with light of a particular wavelength, luciferases cause a cell to catalyze a reaction that produces light, and enzymes such as β-galactosidase convert a substrate to a colored product. Exemplary reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to β-lactamase, β -galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art. Transcriptional regulators refer to transcriptional activators and repressors that either activate or repress transcription of a gene of interest, such as c9orf72. Promoters are regions of nucleic acid that initiate transcription of a particular gene Transcriptional activators typically bind nearby to transcriptional promoters and recruit RNA polymerase to directly initiate transcription. Repressors bind to transcriptional promoters and sterically hinder transcriptional initiation by RNA polymerase. Other transcriptional regulators may serve as either an activator or a repressor depending on where they bind and cellular and environmental conditions. Non- limiting examples of transcriptional regulator classes include, but are not limited to homeodomain proteins, zinc-finger proteins, winged-helix (forkhead) proteins, and leucine- zipper proteins. As used herein, a “repressor protein” or “inducer protein” is a protein that binds to a regulatory sequence element and represses or activates, respectively, the transcription of sequences operatively linked to the regulatory sequence element. Preferred repressor and inducer proteins as described herein are sensitive to the presence or absence of at least one input agent or environmental input. Preferred proteins as described herein are modular in form, comprising, for example, separable DNA-binding and input agent-binding or responsive elements or domains. As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the method or composition, yet open to the inclusion of unspecified elements, whether essential or not. As used herein the term “consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment. The use of “comprising” indicates inclusion rather than limitation. The term “consisting of” refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment. As used herein the term “consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention. The term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to.” The term “such as” is used herein to mean, and is used interchangeably, with the phrase “such as but not limited to.” As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, references to “the method” includes one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth. Similarly, the word “or” is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, “e.g.” is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.” Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims. In some embodiments of any of the aspects, the disclosure described herein does not concern a process for cloning human beings, processes for modifying the germ line genetic identity of human beings, uses of human embryos for industrial or commercial purposes or processes for modifying the genetic identity of animals which are likely to cause them suffering without any substantial medical benefit to man or animal, and also animals resulting from such processes. Other terms are defined herein within the description of the various aspects of the invention. All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents. The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims. Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure. The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. II. NUCLEIC ACIDS The characterization and development of nucleic acid molecules for potential therapeutic use are provided herein. The present disclosure provides promoters, expression cassettes, vectors, kits, and methods that can be used in the treatment of a subject with a c9orf72 associated disease or a c9orf72 hexanucleotide repeat expansion associated disease (e.g., a neurodegenerative disease such as AML or FTD). In certain embodiments, the individual is at risk for developing a c9orf72 associated disease (e.g., a neurodegenerative disease, such as AML or FTD). Certain aspects of the disclosure relate to delivering a rAAV vector comprising a heterologous nucleic acid to cells which are relevant to the disease to be treated, e.g., in ALS the target cells are neurons, in particular embodiments motor neurons, and astrocytes. According to some embodiments, the expressed c9orf72 protein is functional for the treatment of treatment of a c9orf72 associated disease or a c9orf72 hexanucleotide repeat expansion associated disease (e.g., a neurodegenerative disease such as AML or FTD). In some embodiments, the expressed c9orf72 protein does not cause an immune system reaction. Gene Supplementation According to some aspects, the disclosure provides methods of treating a c9orf72 associated disease or a c9orf72 hexanucleotide repeat expansion associated disease (e.g., a neurodegenerative disease such as AML or FTD) by replacing, altering, or supplementing a c9orf72 gene that is absent or abnormal, and whose absence or abnormality is responsible for the disease. According to some embodiments, the c9orf72 gene comprises one or more nonsense mutations. According to some embodiments, the c9orf72 gene comprises one or more frame- shift mutations. According to some aspects, the disclosure provides methods of treating a c9orf72 associated disease or a c9orf72 hexanucleotide repeat expansion associated disease (e.g., a neurodegenerative disease such as AML or FTD) comprising delivery of a composition comprising rAAV vectors described herein to the subject, wherein the rAAV vector comprises a heterologous nucleic acid (e.g. a nucleic acid encoding c9orf72) and further comprising at least one AAV terminal repeat. According to some embodiments, the heterologous nucleic acid is operably linked to a promoter. According to some embodiments, the promoter is a neuron specific promoter, for example a human Synapsin 1 (hSyn) promoter. The hSyn promoter is particularly suited to use in the rAAVs described herein, due to its small size. Two major mature mRNA transcript c9orf72 isoforms are expressed, v1 & v2, with proposed distinct intracellular functions: v1) regulates stress granule assembly in response to cellular stress; v2) does not seem to participate in stress granule assembly or regulation (Maharjan N. et al.2017. Mol. Neurobiol.54:3062-3077). The gene structure of c9orf72 is shown in FIG.1. Nucleotide sequences that encode c9orf72 include, but are not limited to, the following: the complement of GENBANK Accession No. NM_001256054.1 (SEQ ID NO: 53), GENBANK Accession No. NT_008413.18 truncated from nucleobase 27535000 to 27565000 (SEQ ID NO: 54) and the complement thereof (SEQ ID NO: 55), GENBANK Accession No. BQ068108.1 (incorporated herein as SEQ ID NO: 56), GENBANK Accession No. NM_018325.3 (incorporated herein as SEQ ID NO: 57), GENBANK Accession No. DN993522.1 (incorporated herein as SEQ ID NO: 58), GENBANK Accession No. NM_145005.5 (incorporated herein as SEQ ID NO: 59), GENBANK Accession No. DB079375.1 (incorporated herein as SEQ ID NO: 60), and GENBANK Accession No. BU194591.1 (incorporated herein as SEQ ID NO: 61). According to some embodiments, the sequences described herein can further comprise one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. According to certain embodiments, the nucleic acid is a human nucleic acid (i.e., a nucleic acid that is derived from a human c9Orf72 gene). In other embodiments, the nucleic acid is a non-human nucleic acid (i.e., a nucleic acid that is derived from a non-human c9Orf72 gene). According to some embodiments, the AAV vectors comprise at least one nucleic acid region comprising one or more insertions, deletions, inversions, and/or substitutions. According to some embodiments, the AAV vectors described herein comprise at least one nucleic acid region which has been codon optimized. According to one embodiment, the nucleic acid encoding c9orf72 is codon optimized. According to one embodiment, the nucleic acid encoding c9orf72 is codon optimized for expression in a eukaryote, e.g., humans. According to some embodiments, a coding sequence encoding c9orf72 is codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, or non-human eukaryote or animal or mammal as herein discussed, e.g., mouse, rat, rabbit, dog, livestock, or non-human mammal or primate. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the "Codon Usage Database" available at www.kazusa.orjp/codon/ and these tables can be adapted in a number of ways. See Nakamura, Y., et al. "Codon usage tabulated from the international DNA sequence databases: status for the year 2000" Nucl. Acids Res.28:292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available. A nucleic acid molecule (including, for example, a c9orf72 nucleic acid) of the present disclosure can be isolated using standard molecular biology techniques. Using all or a portion of a nucleic acid sequence of interest as a hybridization probe, nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning. A Laboratory Manual.2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). A nucleic acid molecule for use in the methods of the disclosure can also be isolated by the polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based upon the sequence of a nucleic acid molecule of interest. A nucleic acid molecule used in the methods of the disclosure can be amplified using cDNA, mRNA or, alternatively, genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. Furthermore, oligonucleotides corresponding to nucleotide sequences of interest can also be chemically synthesized using standard techniques. Numerous methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which has been automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Patent No. 4,598,049; Caruthers et al. U.S. Patent No.4,458,066; and Itakura U.S. Patent Nos.4,401,796 and 4,373,071, incorporated by reference herein). Automated methods for designing synthetic oligonucleotides are available. See e.g., Hoover, D.M. & Lubowski, J. Nucleic Acids Research, 30(10): e43 (2002). Many embodiments of the disclosure involve a c9orf72 nucleic acid Some aspects and embodiments of the disclosure involve other nucleic acids, such as isolated promoters or regulatory elements. A nucleic acid may be, for example, a cDNA or a chemically synthesized nucleic acid. A cDNA can be obtained, for example, by amplification using the polymerase chain reaction (PCR) or by screening an appropriate cDNA library. Alternatively, a nucleic acid may be chemically synthesized. Antisense Oligonucleotides According to some embodiments, the disclosure provides antisense compounds. An antisense compound is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. According to certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy- based compounds. According to some embodiments, an antisense compound is targeted to a c9orf72 nucleic acid. According to some embodiments, an antisense compound that is targeted to a c9orf72 nucleic acid is 12 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits. According to some embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits. According to some embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. According to some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleosides. According to some embodiments, the antisense compound is an shRNA that is targeted to a c9orf72 nucleic acid. Exemplary shRNAs are set forth in Table 1, below: Table 1 According to some embodiments, the shRNA sequence comprises SEQ ID NO: 1. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 1. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 1. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 1. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 1. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 2. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 2. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 2. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 2. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 2. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 3. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 3. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 3. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 3. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 3. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 4. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 4. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 4. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 4. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 4. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 5. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 5. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 5. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 5. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 5. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 6. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 6. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 6. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 6. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 6. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 7. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 7. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 7. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 7. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 7. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 8. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 8. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 8. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 8. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 8. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 9. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 9. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 9. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 9. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 9. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 10. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 10. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 10. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 10. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 10. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 11. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 11. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 11. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 11. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 11. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 12. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 12. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 12. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 12. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 12. According to some embodiments, the shRNA sequence comprises SEQ ID NO: 13. According to some embodiments, the shRNA sequence is 85% identical to SEQ ID NO: 13. According to some embodiments, the shRNA sequence is 90% identical to SEQ ID NO: 13. According to some embodiments, the shRNA sequence is 95%, 96%, 97% or 98% identical to SEQ ID NO: 13. According to some embodiments, the shRNA sequence is 99% identical to SEQ ID NO: 13. According to some embodiments antisense oligonucleotides targeted to a c9orf72 nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated antisense compound targeted to a c9orf72 nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end. According to some embodiments, when a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end. Nucleotide sequences that encode c9orf72 are described above. According to some embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for c9orf72 can be obtained by accession number from sequence databases such as NCBI. In certain embodiments, a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region. Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. According to some embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. According to some embodiments, the desired effect is a reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid. A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. According to some embodiments, target segments within a target region are separated by no more than about 300 nucleotides. According to some embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. According to some embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. According to some embodiments, target segments are contiguous. Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifically exclude a certain structurally defined region such as the start codon or stop codon. The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off- target sequences). There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within a target region. According to some embodiments, reductions in c9orf72 mRNA levels are indicative of inhibition of c9orf72 expression. Reductions in levels of a c9orf72 protein are also indicative of inhibition of target mRNA expression. Reduction in the presence of expanded c9orf72 RNA foci are indicative of inhibition of c9orf72 expression. Further, phenotypic changes are indicative of inhibition of c9orf72 expression. For example, improved motor function and respiration may be indicative of inhibition of c9orf72 expression. According to some embodiments, hybridization occurs between an antisense compound disclosed herein and a c9orf72 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules. Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized. Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a c9orf72 nucleic acid. Complementarity An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a c9orf72 nucleic acid). Non-complementary nucleobases between an antisense compound and a c9orf72 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Further, an antisense compound may hybridize over one or more segments of a c9orf72 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure). According to some embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a c9orf72 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present disclosure. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403410; Zhang and Madden, Genome Res., 1997, 7, 649656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482489). According to some embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, or specified portion thereof. For example, in some embodiments, an antisense compound may be fully complementary to a c9orf72 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence. The location of a non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide. According to some embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a c9orf72 nucleic acid, or specified portion thereof. According to some embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a c9orf72 nucleic acid, or specified portion thereof. The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. According to some embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. According to some embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. According to some embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. According to some embodiments, the antisense compounds, are complementary to at least an 11 nucleobase portion of a target segment. According to some embodiments, the antisense compounds, are complementary to at least a 12 nucleobase portion of a target segment. According to some embodiments, the antisense compounds, are complementary to at least a 13 nucleobase portion of a target segment. According to some embodiments, the antisense compounds, are complementary to at least a 14 nucleobase portion of a target segment. According to some embodiments, the antisense compounds, are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values. The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence set forth herein (e.g., SEQ ID NOs 1 - 13). As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared. According to some embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein. According to some embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. According to some embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. According to some embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. According to some embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. Modifications A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide. Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity. Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides. Modified Internucleoside Linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases. Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non- phosphorous-containing linkages are well known. According to some embodiments, antisense compounds targeted to a c9orf72 nucleic acid comprise one or more modified internucleoside linkages. According to some embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. According to some embodiments, the modified internucleoside linkages are phosphorothioate linkages. According to some embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. According to some embodiments, the antisense compounds targeted to a C9ORF72 nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage. Modified Sugar Moieties Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. According to some embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R ₁ )(R ₂ ) (R, R ₁ and R ₂ are each independently H, C ₁ -C ₁₂ alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug.21, 2008 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on Jun.16, 2005) or alternatively 5'- substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group). Nucleic acid sequences described herein can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc.105:661; Belousov (1997) Nucleic Acids Res.25:3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol.68:109; Beaucage (1981) Tetra. Lett.22:1859; U.S. Pat. No.4,458,066. Nucleic acid sequences described herein can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification. For example, according to some embodiments, nucleic acid sequences described herein include a phosphorothioate at least the first, second, or third internucleotide linkage at the 5' or 3' end of the nucleotide sequence. According to some embodiments, the nucleic acid sequence can include a 2'-modified nucleotide, e.g., a 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'- O-N-methylacetamido (2'-O-NMA). According to some embodiments, the nucleic acid sequence can include at least one 2'-O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2'-O-methyl modification. Techniques for the manipulation of nucleic acids used to practice this invention, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook, ed., MOLECULAR CLONING: A LABORATORY MANUAL (2ND ED.), Vols.1-3, Cold Spring Harbor Laboratory, (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel, ed. John Wiley & Sons, Inc., New York (1997); LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY: HYBRIDIZATION WITH NUCLEIC ACID PROBES, Part I. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993). III. PROMOTERS, EXPRESSION CASSETTES AND VECTORS The promoters, c9orf72 nucleic acids, inhibitory oligonucleotides (RNAi), regulatory elements, and expression cassettes, and vectors of the disclosure may be produced using methods known in the art. The methods described below are provided as non-limiting examples of such methods. In another aspect, the present disclosure provides vector constructs comprising a nucleotide sequence encoding the antibodies of the present disclosure and a host cell comprising such a vector. Promoters A person skilled in the art may recognize that a target cell may require a specific promoter including but not limited to a promoter that is species specific, inducible, tissue- specific, or cell cycle-specific Parr et al., Nat. Med.3:1145-9 (1997); the contents of which are herein incorporated by reference in its entirety). In one embodiment, the promoter is a promoter deemed to be efficient to drive the expression of the polynucleotides described herein. Promoters for which promote expression in most tissues include, for example, but are not limited to, human elongation factor 1α-subunit (EF1α), immediate-early cytomegalovirus (CMV), the RSV LTR, the MoMLV LTR, the phosphoglycerate kinase-1 (PGK) promoter, a simian virus 40 (SV40) promoter and a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, an hAAT promoter, a LSP promoter, chimeric liver-specific promoters (LSPs), the telomerase (hTERT) promoter, chicken β-actin (CBA) and its derivative CAG, the β glucuronidase (GUSB), or ubiquitin C (UBC) . Tissue- specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes. Non-limiting example of tissue-specific expression elements for neurons include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet- derived growth factor B-chain (PDGF-β.), the synapsin (Syn), the methyl-CpG binding protein 2 (MeCP2), CaMKII, mGluR2, NFL, NFH, nβ2, PPE, Enk and EAAT2 promoters. According to some embodiments, the promoter is the chimeric CMV–chicken ß–actin promoter (CBA) promoter. In some embodiments, the promoter is capable of expressing the heterologous nucleic acid in a neuronal cell. In some embodiments, the promoter is capable of expressing the heterologous nucleic acid in a motor neuron cell. In some embodiments, the promoter is capable of expressing the heterologous nucleic acid in astrocytes. According to some embodiments, the promoter is a human Synapsin 1 (hSyn) promoter that is specific for neuronal cells. According to some embodiments, the promoter is a glial fibrillary acidic protein (GFAP) or EAAT2 promoter, that are specific for astrocytes. In one embodiment, the AAV vector genome may comprise a promoter such as, but not limited to, CMV or U6. As a non-limiting example, the promoter for the AAV comprising the nucleic acid sequence for the siRNA molecules of the present disclosure is a CMV promoter. As another non-limiting example, the promoter for the AAV comprising the nucleic acid sequence for the siRNA molecules of the present disclosure is a U6 promoter. In one embodiment, the AAV vector has an engineered promoter. In one embodiment, the AAV vector further comprises an enhancer element. In one embodiment, the vector genome comprises at least one element to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety) such as an intron. Non- limiting examples of introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), β- globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor/immunoglobin splice acceptor (500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180 bps) and hybrid adenovirus splice donor/IgG splice acceptor (230 bps). In one embodiment, the intron may be 100-500 nucleotides in length. The intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500. The promoter may have a length between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400- 500. Expression Cassettes According to another aspect, the present disclosure provides a transgene expression cassette comprises (a) a promoter; (b) a nucleic acid comprising a c9orf72 nucleic acid as described herein; and (c) minimal regulatory elements. According to another aspect, the present disclosure provides a transgene expression cassette comprises (a) a promoter; (b) a nucleic acid comprising one or more antisense compounds as described herein; and (c) minimal regulatory elements. According to another aspect, the present disclosure provides a transgene expression cassette comprises (a) a promoter; (b) a nucleic acid comprising a c9orf72 nucleic acid as described herein; (c) a nucleic acid comprising one or more antisense compounds as described herein; and (d) minimal regulatory elements. A promoter of the disclosure includes the promoters discussed supra. According to some embodiments, the promoter is hSyn. “Minimal regulatory elements” are regulatory elements that are necessary for effective expression of a gene in a target cell. Such regulatory elements could include, for example, promoter or enhancer sequences, a polylinker sequence facilitating the insertion of a DNA fragment within a plasmid vector, and sequences responsible for intron splicing and polyadenylation of mRNA transcripts. The expression cassettes of the disclosure may also optionally include additional regulatory elements that are not necessary for effective incorporation of a gene into a target cell. Vectors The present disclosure also provides vectors that include any one of the expression cassettes discussed in the preceding section. According to some embodiments, the vector is an oligonucleotide that comprises the sequences of the expression cassette. According to some embodiments, the vector is a viral vector, such as a vector derived from an adeno-associated virus, an adenovirus, a retrovirus, a lentivirus, a vaccinia/poxvirus, or a herpesvirus (e.g., herpes simplex virus (HSV)). See e.g., Howarth. In the most preferred embodiments, the vector is an adeno-associated viral (AAV) vector. Multiple serotypes of adeno-associated virus (AAV), including 12 human serotypes (AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12) and more than 100 serotypes from nonhuman primates have now been identified. Howarth JL et al., Using viral vectors as gene transfer tools. Cell Biol Toxicol 26:1-10 (2010) (hereinafter Howarth et al.). In embodiments of the present disclosure wherein the vector is an AAV vector, the serotype of the inverted terminal repeats (ITRs) of the AAV vector may be selected from any known human or nonhuman AAV serotype. In preferred embodiments, the serotype of the AAV ITRs of the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Moreover, in embodiments of the present disclosure wherein the vector is an AAV vector, the serotype of the capsid sequence of the AAV vector may be selected from any known human or animal AAV serotype. In some embodiments, the serotype of the capsid sequence of the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. In preferred embodiments, the serotype of the capsid sequence is AAV5. In some embodiments wherein the vector is an AAV vector, a pseudotyping approach is employed, wherein the genome of one ITR serotype is packaged into a different serotype capsid. See e.g., Zolutuhkin S. et al. Production and purification of serotype 1,2, and 5 recombinant adeno-associated viral vectors. Methods 28(2): 158-67 (2002). In preferred embodiments, the serotype of the AAV ITRs of the AAV vector and the serotype of the capsid sequence of the AAV vector are independently selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. In some embodiments of the present disclosure wherein the vector is a rAAV vector, a mutant capsid sequence is employed. Mutant capsid sequences, as well as other techniques such as rational mutagenesis, engineering of targeting peptides, generation of chimeric particles, library and directed evolution approaches, and immune evasion modifications, may be employed in the present disclosure to optimize AAV vectors, for purposes such as achieving immune evasion and enhanced therapeutic output. See e.g., Mitchell A.M. et al. AAV’s anatomy: Roadmap for optimizing vectors for translational success. Curr Gene Ther.10(5): 319-340. AAV vectors can mediate long term gene expression in cells (e.g. neuronal cells) and elicit minimal immune responses making these vectors an attractive choice for gene delivery. The antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be introduced into cells using any of a variety of approaches such as, but not limited to, viral vectors (e.g., AAV vectors). These viral vectors are engineered and optimized to facilitate the entry of siRNA molecule into cells that are not readily amendable to transfection. Also, some synthetic viral vectors possess an ability to integrate the shRNA into the cell genome, thereby leading to stable siRNA expression and long-term knockdown of a target gene. In this manner, viral vectors are engineered as vehicles for specific delivery while lacking the deleterious replication and/or integration features found in wild-type virus. According to some embodiments, the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure are introduced into a cell by contacting the cell with a composition comprising a lipophilic carrier and a vector, e.g., an AAV vector, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure. According to some embodiments, the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) are introduced into a cell by transfecting or infecting the cell with a vector, e.g., an AAV vector, comprising nucleic acid sequences capable of producing the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) when transcribed in the cell. According to some embodiments, the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) are introduced into a cell by injecting into the cell a vector, e.g., an AAV vector, comprising a nucleic acid sequence capable of producing the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) when transcribed in the cell. According to some embodiments, prior to transfection, a vector, e.g., an AAV vector, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be transfected into cells. According to other embodiments, the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be delivered into cells by electroporation (e.g. U.S. Patent Publication No.20050014264; the content of which is herein incorporated by reference in its entirety). Other methods for introducing vectors, e.g., AAV vectors, comprising the nucleic acid sequence for the siRNA molecules described herein may include photochemical internalization as described in U. S. Patent publication No.20120264807; the content of which is herein incorporated by reference in its entirety. According to some embodiments, the formulations described herein may contain at least one vector, e.g., AAV vectors, comprising the nucleic acid sequence encoding antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) described herein. According to some embodiments, the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may target the c9orf72 gene at one target site. According to some embodiments, the formulation comprises a plurality of vectors, e.g., AAV vectors, each vector comprising a nucleic acid sequence encoding antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) targeting the c9orf72 gene at a different target site. The c9orf72 gene may be targeted at 2, 3, 4, 5 or more than 5 sites. According to some embodiments, the vectors, e.g., AAV vectors, from any relevant species, such as, but not limited to, human, dog, mouse, rat or monkey may be introduced into cells. According to some embodiments, the vectors, e.g., AAV vectors, may be introduced into cells which are relevant to the disease to be treated. As a non-limiting example, the disease is ALS and the target cells are motor neurons and astrocytes. According to some embodiments, the vectors, e.g., AAV vectors, may be introduced into cells which have a high level of endogenous expression of the target sequence. According to some embodiments, the vectors, e.g., AAV vectors, may be introduced into cells which have a low level of endogenous expression of the target sequence. According to some embodiments, the cells may be those which have a high efficiency of AAV transduction. IV. METHODS OF PRODUCING VIRAL VECTORS The present disclosure also provides methods of making a recombinant adeno-associated viral (rAAV) vectors comprising inserting into an adeno-associated viral vector any one of the nucleic acids described herein. According to some embodiments, the rAAV vector further comprises one or more AAV inverted terminal repeats (ITRs). According to the methods of making an rAAV vector that are provided by the disclosure, the serotype of the capsid sequence and the serotype of the ITRs of said AAV vector are independently selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. Thus, the disclosure encompasses vectors that use a pseudotyping approach, wherein the genome of one ITR serotype is packaged into a different serotype capsid. See e.g., Daya S. and Berns, K.I., Gene therapy using adeno-associated virus vectors. Clinical Microbiology Reviews, 21(4): 583-593 (2008) (hereinafter Daya et al.). Furthermore, in some embodiments, the capsid sequence is a mutant capsid sequence. AAV Vectors AAV vectors are derived from adeno-associated virus, which has its name because it was originally described as a contaminant of adenovirus preparations. AAV vectors offer numerous well-known advantages over other types of vectors: wildtype strains infect humans and nonhuman primates without evidence of disease or adverse effects; the AAV capsid displays very low immunogenicity combined with high chemical and physical stability which permits rigorous methods of virus purification and concentration; AAV vector transduction leads to sustained transgene expression in post-mitotic, non-dividing cells and provides long-term gain of function; and the variety of AAV subtypes and variants offers the possibility to target selected tissues and cell types. Heilbronn R & Weger S, Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics, in M. Schäfer-Korting (ed.), Drug Delivery, Handbook of Experimental Pharmacology, 197: 143-170 (2010) (hereinafter Heilbronn). A major limitation of AAV vectors is that the AAV offers only a limited transgene capacity (<4.9 kb) for a conventional vector containing single-stranded DNA. AAV is a non-enveloped, small, single-stranded DNA-containing virus encapsidated by an icosahedral, 20nm diameter capsid. The human serotype AAV2 was used in a majority of early studies of AAV. Heilbronn. It contains a 4.7 kb linear, single-stranded DNA genome with two open reading frames rep and cap (“rep” for replication and “cap” for capsid). Rep codes for four overlapping nonstructural proteins: Rep78, Rep68, Rep52, and Rep40. Rep78 and Rep69 are required for most steps of the AAV life cycle, including the initiation of AAV DNA replication at the hairpin-structured inverted terminal repeats (ITRs), which is an essential step for AAV vector production. The cap gene codes for three capsid proteins, VP1, VP2, and VP3. Rep and cap are flanked by 145 bp ITRs. The ITRs contain the origins of DNA replication and the packaging signals, and they serve to mediate chromosomal integration. The ITRs are generally the only AAV elements maintained in AAV vector construction. To achieve replication, AAVs must be coinfected into the target cell with a helper virus (Grieger JC & Samulski RJ, 2005. Adv Biochem Engin/Biotechnol 99:119-145). Typically, helper viruses are either adenovirus (Ad) or herpes simplex virus (HSV). In the absence of a helper virus, AAV can establish a latent infection by integrating into a site on human chromosome 19. Ad or HSV infection of cells latently infected with AAV will rescue the integrated genome and begin a productive infection. The four Ad proteins required for helper function are E1A, E1B, E4, and E2A. In addition, synthesis of Ad virus-associated (VA) RNAs is required. Herpesviruses can also serve as helper viruses for productive AAV replication. Genes encoding the helicase-primase complex (UL5, UL8, and UL52) and the DNA-binding protein (UL29) have been found sufficient to mediate the HSV helper effect. In some embodiments of the present disclosure that employ rAAV vectors, the helper virus is an adenovirus. In other embodiments that employ rAAV vectors, the helper virus is HSV. Making recombinant AAV (rAAV) vectors The production, purification, and characterization of the rAAV vectors of the present disclosure may be carried out using any of the many methods known in the art. For reviews of laboratory-scale production methods, see, e.g., Clark RK, Recent advances in recombinant adeno-associated virus vector production. Kidney Int.61s:9-15 (2002); Choi VW et al., Production of recombinant adeno-associated viral vectors for in vitro and in vivo use. Current Protocols in Molecular Biology 16.25.1-16.25.24 (2007) (hereinafter Choi et al.); Grieger JC & Samulski RJ, Adeno-associated virus as a gene therapy vector: Vector development, production, and clinical applications. Adv Biochem Engin/Biotechnol 99:119-145 (2005) (hereinafter Grieger & Samulski); Heilbronn R & Weger S, Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics, in M. Schäfer-Korting (ed.), Drug Delivery, Handbook of Experimental Pharmacology, 197: 143-170 (2010) (hereinafter Heilbronn); Howarth JL et al., Using viral vectors as gene transfer tools. Cell Biol Toxicol 26:1-10 (2010) (hereinafter Howarth). The production methods described below are intended as non-limiting examples. AAV vector production may be accomplished by co-transfection of packaging plasmids (Heilbronn et al., ). The cell line supplies the deleted AAV genes rep and cap and the required helper virus functions. The adenovirus helper genes, VA-RNA, E2A and E4 are transfected together with the AAV rep and cap genes, either on two separate plasmids or on a single helper construct. A recombinant AAV vector plasmid wherein the AAV capsid genes are replaced with a transgene expression cassette (comprising the gene of interest, e.g., a c9orf72, and/or comprising the antisense compound (e.g. siRNA, shRNA, antisense oligonucleotides)) bracketed by ITRs, is also transfected. These packaging plasmids are typically transfected into 293 cells, a human cell line that constitutively expresses the remaining required Ad helper genes, E1A and E1B. This leads to amplification and packaging of the AAV vector carrying the gene of interest. Multiple serotypes of AAV, including 12 human serotypes and more than 100 serotypes from nonhuman primates have now been identified. Howarth et al. The AAV vectors of the present disclosure may comprise capsid sequences derived from AAVs of any known serotype. As used herein, a “known serotype” encompasses capsid mutants that can be produced using methods known in the art. Such methods, include, for example, genetic manipulation of the viral capsid sequence, domain swapping of exposed surfaces of the capsid regions of different serotypes, and generation of AAV chimeras using techniques such as marker rescue. See Bowles et al. Marker rescue of adeno-associated virus (AAV) capsid mutants: A novel approach for chimeric AAV production. Journal of Virology, 77(1): 423-432 (2003), as well as references cited therein. Moreover, the AAV vectors of the present disclosure may comprise ITRs derived from AAVs of any known serotype. Preferentially, the ITRs are derived from one of the human serotypes AAV1-AAV12. In some embodiments of the present disclosure, a pseudotyping approach is employed, wherein the genome of one ITR serotype is packaged into a different serotype capsid. Preferentially, the capsid sequences employed in the present disclosure are derived from one of the human serotypes AAV1-AAV12. Recombinant AAV vectors containing an AAV5 serotype capsid sequence have been demonstrated to target retinal cells in vivo. See, for example, Komaromy et al. Therefore, in preferred embodiments of the present disclosure, the serotype of the capsid sequence of the AAV vector is AAV5. In other embodiments, the serotype of the capsid sequence of the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12. Even when the serotype of the capsid sequence does not naturally target retinal cells, other methods of specific tissue targeting may be employed. See Howarth et al. For example, recombinant AAV vectors can be directly targeted by genetic manipulation of the viral capsid sequence, particularly in the looped out region of the AAV three-dimensional structure, or by domain swapping of exposed surfaces of the capsid regions of different serotypes, or by generation of AAV chimeras using techniques such as marker rescue. See Bowles et al.2003. Journal of Virology, 77(1): 423-432, as well as references cited therein. One possible protocol for the production, purification, and characterization of recombinant AAV (rAAV) vectors is provided in Choi et al. Generally, the following steps are involved: design a transgene expression cassette, design a capsid sequence for targeting a specific receptor, generate adenovirus-free rAAV vectors, purify and titer. These steps are summarized below and described in detail in Choi et al. The transgene expression cassette may be a single-stranded AAV (ssAAV) vector or a “dimeric” or self-complementary AAV (scAAV) vector that is packaged as a pseudo-double- stranded transgene. Choi et al.; Heilbronn; Howarth. Using a traditional ssAAV vector generally results in a slow onset of gene expression (from days to weeks until a plateau of transgene expression is reached) due to the required conversion of single-stranded AAV DNA into double-stranded DNA. In contrast, scAAV vectors show an onset of gene expression within hours that plateaus within days after transduction of quiescent cells. Heilbronn. However, the packaging capacity of scAAV vectors is approximately half that of traditional ssAAV vectors. Choi et al. Alternatively, the transgene expression cassette may be split between two AAV vectors, which allows delivery of a longer construct. See e.g., Daya et al. A ssAAV vector can be constructed by digesting an appropriate plasmid (such as, for example, a plasmid containing the c9orf72 gene) with restriction endonucleases to remove the rep and cap fragments, and gel purifying the plasmid backbone containing the AAVwt-ITRs. Choi et al. Subsequently, the desired transgene expression cassette can be inserted between the appropriate restriction sites to construct the single-stranded rAAV vector plasmid. A scAAV vector can be constructed as described in Choi et al. Then, a large-scale plasmid preparation (at least 1 mg) of the rAAV vector and the suitable AAV helper plasmid and pXX6 Ad helper plasmid can be purified by double CsCl gradient fractionation. Choi et al. A suitable AAV helper plasmid may be selected from the pXR series, pXR1-pXR5, which respectively permit cross-packaging of AAV2 ITR genomes into capsids of AAV serotypes 1 to 5. The appropriate capsid may be chosen based on the efficiency of the capsid’s targeting of the cells of interest. Known methods of varying genome (i.e., transgene expression cassette) length and AAV capsids may be employed to improve expression and/or gene transfer to specific cell types (e.g., neuronal cells). Next, 293 cells are transfected with pXX6 helper plasmid, rAAV vector plasmid, and AAV helper plasmid. Choi et al. Subsequently the fractionated cell lysates are subjected to a multistep process of rAAV purification, followed by either CsCl gradient purification or heparin sepharose column purification. The production and quantitation of rAAV virions may be determined using a dot-blot assay. In vitro transduction of rAAV in cell culture can be used to verify the infectivity of the virus and functionality of the expression cassette. In addition to the methods described in Choi et al., various other transfection methods for production of AAV may be used in the context of the present disclosure. For example, transient transfection methods are available, including methods that rely on a calcium phosphate precipitation protocol. In addition to the laboratory-scale methods for producing rAAV vectors, the present disclosure may utilize techniques known in the art for bioreactor-scale manufacturing of AAV vectors, including, for example, Heilbronn; Clement, N. et al. Large-scale adeno-associated viral vector production using a herpesvirus-based system enables manufacturing for clinical studies. Human Gene Therapy, 20: 796-606. V. METHODS OF TREATMENT The present disclosure provides methods of gene therapy for c9orf72 associated diseases, for example neurodegenerative diseases, such as ALS and FTD. A hexanucleotide GGGGCC repeat expansion in the C9orf72 gene is the most frequent genetic cause of both ALS and FTD in Europe and North America. The vast majority (>95%) of neurologically healthy individuals have ≤11 hexanucleotide repeats in the C9orf72 gene (Rutherford et al., Neurobiol Aging.2012 Dec; 33(12):2950.e5-7). The GGGGCC-expansion lies in the 5′ region of C9orf72 intron 1. The expanded GGGGCC repeats are bidirectionally transcribed into repetitive RNA, which forms sense and antisense RNA foci (Mizielinska et al.2013. Acta Neuropathol. Dec; 126(6):845-57; Gendron et al.2013. Acta Neuropathol. Dec; 126(6):829-44). Despite being within a non-coding region of C9orf72, these repetitive RNAs can be translated in every reading frame to form five different dipeptide repeat proteins (DPRs) — poly-GA, poly-GP poly-GR, poly-PA and poly-PR — via a non-canonical mechanism known as repeat-associated non-ATG (RAN) translation (Zu et al.2013. Proc Natl Acad Sci U S A. Dec 17; 110(51):E4968-77; Mori et al., Acta Neuropathol.2013 Dec; 126(6):881-93). Three transcript variants (V1, V2, V3) have been described for the C9orf72 gene: V2 and V3 utilize exon 1a and therefore include the hexanucleotide repeat, while V1 utilizes the alternative exon 1b therefore excluding the hexanucleotide repeat, which is located upstream of the transcription start site. Competing but non-exclusive mechanisms have arisen in understanding the pathogenenic effects of hexanucleotide repeats: loss of function of C9orf72 protein, and toxic gain of function from sense and antisense C9orf72 repeat RNA or from DPRs. C9orf72 repeat expansions have also been identified as a rare cause of other neurodegenerative diseases, including Parkinson disease, progressive supranuclear palsy, ataxia, corticobasal syndrome, Huntington disease-like syndrome, Creutzfeldt–Jakob disease and Alzheimer disease. According to some embodiments, the c9orf72 associated disease is a c9orf72 hexanucleotide repeat expansion associated disease. Amyotrophic lateral sclerosis (ALS), an adult-onset neurodegenerative disorder, is a progressive and fatal disease characterized by the selective death of motor neurons in the motor cortex, brainstem and spinal cord. The incidence of ALS is about 1.9 per 100,000. Patients diagnosed with ALS develop a progressive muscle phenotype characterized by spasticity, hyperreflexia or hyporeflexia, fasciculations, muscle atrophy and paralysis. These motor impairments are caused by the denervation of muscles due to the loss of motor neurons. The major pathological features of ALS include degeneration of the corticospinal tracts and extensive loss of lower motor neurons (LMNs) or anterior horn cells (Ghatak et al.1986. J Neuropathol Exp Neurol.45, 385-395), degeneration and loss of Betz cells and other pyramidal cells in the primary motor cortex (Udaka et al.1986. Acta Neuropathol.70, 289-295; Maekawa et al., Brain, 2004, 127, 1237-1251) and reactive gliosis in the motor cortex and spinal cord (Kawamata et al., Am J Pathol., 1992, 140, 691-707; and Schiffer et al., J Neurol Sci., 1996, 139, 27-33). ALS is usually fatal within 3 to 5 years after the diagnosis due to respiratory defects and/or inflammation (Rowland L P and Shneibder N A, N Engl. J. Med., 2001, 344, 1688-1700). A cellular hallmark of ALS is the presence of proteinaceous, ubiquitinated, cytoplasmic inclusions in degenerating motor neurons and surrounding cells (e.g., astrocytes). Ubiquitinated inclusions (i.e., Lewy body-like inclusions or Skein-like inclusions) are the most common and specific type of inclusion in ALS and are found in lower motor neurons (LMNs) of the spinal cord and brainstem, and in corticospinal upper motor neurons (UMNs) (Matsumoto et al., J Neurol Sci., 1993, 115, 208-213; and Sasak and Maruyama, Acta Neuropathol., 1994, 87, 578- 585). A few proteins have been identified to be components of the inclusions, including ubiquitin, Cu/Zn superoxide dismutase 1 (SOD1), peripherin and dorfin. Neurofilamentous inclusions are often found in hyaline conglomerate inclusions (HCIs) and axonal `spheroids` in spinal cord motor neurons in ALS. Other types and less specific inclusions include Bunina bodies (cystatin C-containing inclusions) and Crescent shaped inclusions (SCIs) in upper layers of the cortex. Other neuropathological features seen in ALS include fragmentation of the Golgi apparatus, mitochondrial vacuolization and ultrastructural abnormalities of synaptic terminals (Fujita et al., Acta Neuropathol.2002, 103, 243-247). In addition, in frontotemporal dementia ALS (FTD-ALS) cortical atrophy (including the frontal and temporal lobes) is also observed, which may cause cognitive impairment in FTD- ALS patients. ALS is a complex and multifactorial disease and multiple mechanisms hypothesized as responsible for ALS pathogenesis include, but are not limited to, dysfunction of protein degradation, glutamate excitotoxicity, mitochondrial dysfunction, apoptosis, oxidative stress, inflammation, protein misfolding and aggregation, aberrant RNA metabolism, and altered gene expression. About 10%-15% of ALS cases have family history of the disease, and these patients are referred to as familial ALS (fALS) or inherited patients, commonly with a Mendelian dominant mode of inheritance and high penetrance. The remainder (approximately 85%-95%) is classified as sporadic ALS (sALS), as they are not associated with a documented family history, but instead are thought to be due to other risk factors including, but not limited to environmental factors, genetic polymorphisms, somatic mutations, and possibly gene-environmental interactions. In most cases, familial (or inherited) ALS is inherited as autosomal dominant disease, but pedigrees with autosomal recessive and X-linked inheritance and incomplete penetrance exist. Sporadic and familial forms are clinically indistinguishable suggesting a common pathogenesis. The precise cause of the selective death of motor neurons in ALS remains elusive. Progress in understanding the genetic factors in familial ALS may shed light on both forms of the disease. According to some embodiments, the present disclosure provides methods for treating a c9orf72 associated disease by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein. The ALS may be familial ALS or sporadic ALS. According to some embodiments, the c9orf72 associated disease is a c9orf72 hexanucleotide repeat expansion associated disease. According to some embodiments, the c9orf72 associated disease is ALS. According to some embodiments, the c9orf72 associated disease is FTD. According to some embodiments, the subject has one or more c9orf72 hexanucleotide repeat expansions. According to some embodiments, the subject has one or more c9orf72 nonsense mutations. According to some embodiments, the subject has one or more c9orf72 frame shift mutations. According to some embodiments, the present disclosure provides methods for treating ALS by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein. The ALS may be familial ALS or sporadic ALS. According to some embodiments, the present disclosure provides methods for treating FTD by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein. According to some embodiments, the subject is identified by the following criteria: 1) clinical behavioral biomarkers reported from physicians; 2) signs of disease progression; 3) genome and/or transcriptome sequencing for c9orf72 locus. In any of the methods of treatment, the vector can be any type of vector known in the art. According to some embodiments, the vector is a viral vector, such as a vector derived from an adeno-associated virus, an adenovirus, a retrovirus, a lentivirus, a vaccinia/poxvirus, or a herpesvirus (e.g., herpes simplex virus (HSV)). See e.g., Howarth. According to preferred embodiments, the vector is an adeno-associated viral (AAV) vector. Nucleic acid sequences described herein can be inserted into delivery vectors and expressed from transcription units within the vectors (e.g., AAV vectors). The recombinant vectors can be DNA plasmids or viral vectors. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example as described in Sambrook et al. Molecular Cloning: A Laboratory Manual. (1989)), Coffin et al. (Retroviruses. (1997)) and "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford University Press, (2000)). As will be apparent to one of ordinary skill in the art, a variety of suitable vectors are available for transferring nucleic acids of the disclosure into cells. The selection of an appropriate vector to deliver nucleic acids and optimization of the conditions for insertion of the selected expression vector into the cell, are within the scope of one of ordinary skill in the art without the need for undue experimentation. Viral vectors comprise a nucleotide sequence having sequences for the production of recombinant virus in a packaging cell. Viral vectors expressing nucleic acids of the disclosure can be constructed based on viral backbones including, but not limited to, a retrovirus, lentivirus, adenovirus, adeno-associated virus, pox virus or alphavirus. The recombinant vectors capable of expressing the nucleic acids of the disclosure can be delivered as described herein, and persist in target cells (e.g., stable transformants). According to some embodiments, the composition comprising the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure is administered to the central nervous system of the subject. In other embodiments, the composition comprising the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present disclosure is administered to motor neurons. In other embodiments, the composition comprising the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present disclosure is administered to astrocytes. According to some embodiments, the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be delivered into specific types of targeted cells, including motor neurons; glial cells including oligodendrocyte, astrocyte and microglia; and/or other cells surrounding neurons such as T cells. According to some embodiments, the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be used as a therapy for ALS. According to some embodiments, the present composition is administered as a solo therapeutics or combination therapeutics for the treatment of ALS. The vectors, e.g., AAV vectors, encoding antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) targeting the c9orf72 gene may be used in combination with one or more other therapeutic agents. By “in combination with,” it is not intended to imply that the agents must be administered at the same time and/or formulated for delivery together, although these methods of delivery are within the scope of the present disclosure. Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent. According to some embodiments, therapeutic agents that may be used in combination with the vectors, e.g., AAV vectors, encoding the nucleic acid sequence for the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure can be small molecule compounds which are antioxidants, anti-inflammatory agents, anti-apoptosis agents, calcium regulators, antiglutamatergic agents, structural protein inhibitors, and compounds involved in metal ion regulation. According to some embodiments, compounds for treating ALS which may be used in combination with the vectors described herein include, but are not limited to, antiglutamatergic agents: Riluzole, Topiramate, Talampanel, Lamotrigine, Dextromethorphan, Gabapentin and AMPA antagonist; Anti-apoptosis agents: Minocycline, Sodium phenylbutyrate and Arimoclomol; Anti-inflammatory agent: ganglioside, Celecoxib, Cyclosporine, Azathioprine, Cyclophosphamide, Plasmaphoresis, Glatiramer acetate and thalidomide; Ceftriaxone (Berry et al., Plos One, 2013, 8(4)); Beat-lactam antibiotics; Pramipexole (a dopamine agonist) (Wang et al., Amyotrophic Lateral Scler., 2008, 9(1), 50-58); Nimesulide, described in U.S. Patent Publication No.20060074991; Diazoxide, described in U.S. Patent Publication No. 20130143873); pyrazolone derivatives, described in US Patent Publication No.20080161378; free radical scavengers that inhibit oxidative stress-induced cell death, such as bromocriptine (US. Patent Publication No.20110105517); phenyl carbamate compounds discussed in PCT Patent Publication No.2013100571; neuroprotective compounds, described in U.S. Pat. Nos. 6,933,310 and 8,399,514 and US Patent Publication Nos.20110237907 and 20140038927; and glycopeptides, described in U.S. Patent Publication No.20070185012; the content of each of which is incorporated herein by reference in their entirety. According to some embodiments, therapeutic agents that may be used in combination therapy with the vectors, e.g., AAV vectors, encoding the nucleic acid sequence for the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be hormones or variants that can protect neuronal loss, such as adrenocorticotropic hormone (ACTH) or fragments thereof (e.g., U.S. Patent Publication No. 20130259875); Estrogen (e.g., U.S. Pat. Nos.6,334,998 and 6,592,845); the content of each of which is incorporated herein by reference in their entirety. According to some embodiments, neurotrophic factors may be used in combination therapy with the vectors, e.g., AAV vectors, encoding the nucleic acid sequence for the siRNA molecules of the present disclosure for treating ALS. Generally, a neurotrophic factor is defined as a substance that promotes survival, growth, differentiation, proliferation and/or maturation of a neuron, or stimulates increased activity of a neuron. In some embodiments, the present methods further comprise delivery of one or more trophic factors into the subject in need of treatment. Trophic factors may include, but are not limited to, IGF-I, GDNF, BDNF, CTNF, VEGF, Colivelin, Xaliproden, Thyrotrophin-releasing hormone and ADNF, and variants thereof. According to some embodiments, the composition of the present disclosure for treating ALS is administered to the subject in need intravenously, intramuscularly, subcutaneously, intraperitoneally, intrathecally and/or intraventricularly, allowing the siRNA molecules or vectors comprising the siRNA molecules to pass through one or both the blood-brain barrier and the blood spinal cord barrier. According to some embodiments, the method includes administering (e.g., intraventricularly administering and/or intrathecally administering) directly to the central nervous system (CNS) of a subject (using, e.g., an infusion pump and/or a delivery scaffold) a therapeutically effective amount of a composition comprising vectors, e.g., AAV vectors, encoding the nucleic acid sequence for the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure. The vectors may be used to silence or suppress c9orf72 gene expression, and/or reducing one or more symptoms of ALS in the subject such that ALS is therapeutically treated. According to some embodiments, the symptoms of ALS include, but are not limited to, motor neuron degeneration, muscle weakness, muscle atrophy, the stiffness of muscle, difficulty in breathing, slurred speech, fasciculation development, frontotemporal dementia and/or premature death are improved in the subject treated. In other aspects, the composition of the present disclosure is applied to one or both of the brain and the spinal cord. According to some embodiments, one or both of muscle coordination and muscle function are improved. According to some embodiments, the survival of the subject is prolonged. According to some embodiments, administration of the vectors, e.g., AAV vectors encoding antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the disclosure to a subject may lower mutant c9orf72 (e.g. c9orf72 comprising hexanucleotide repeat expansions) in the CNS of a subject. In another embodiment, administration of the vectors, e.g., AAV vectors, to a subject may lower wild-type c9orf72 in the CNS of a subject. In yet another embodiment, administration of the vectors, e.g., AAV vectors, to a subject may lower both mutant c9orf72 and wild-type c9orf72 in the CNS of a subject. The mutant and/or wild-type c9orf72 may be lowered by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20- 90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30- 100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50- 80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70- 90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% in the CNS, a region of the CNS, or a specific cell of the CNS of a subject. According to some embodiments, reduction of expression of the mutant and/or wild-type c9orf72 will reduce the effects of ALS in a subject. According to some embodiments, the vectors, e.g., AAV vectors described herein, may be administered to a subject who is in the early stages of ALS. Early stage symptoms include, but are not limited to, muscles which are weak and soft or stiff, tight and spastic, cramping and twitching (fasciculations) of muscles, loss of muscle bulk (atrophy), fatigue, poor balance, slurred words, weak grip, and/or tripping when walking. The symptoms may be limited to a single body region or a mild symptom may affect more than one region. As a non-limiting example, administration of the vectors, e.g., AAV vectors described herein, may reduce the severity and/or occurrence of the symptoms of ALS. According to some embodiments, the vectors, e.g., AAV vectors described herein, may be administered to a subject who is in the middle stages of ALS. The middle stage of ALS includes, but is not limited to, more widespread muscle symptoms as compared to the early stage, some muscles are paralyzed while others are weakened or unaffected, continued muscle twitchings (fasciculations), unused muscles may cause contractures where the joints become rigid, painful and sometimes deformed, weakness in swallowing muscles may cause choking and greater difficulty eating and managing saliva, weakness in breathing muscles can cause respiratory insufficiency which can be prominent when lying down, and/or a subject may have bouts of uncontrolled and inappropriate laughing or crying (pseudobulbar affect). As a non- limiting example, administration of the vectors, e.g., AAV vectors described herein, may reduce the severity and/or occurrence of the symptoms of ALS. According to some embodiments, the vectors, e.g., AAV vectors described herein, may be administered to a subject who is in the late stages of ALS. The late stage of ALS includes, but is not limited to, voluntary muscles which are mostly paralyzed, the muscles that help move air in and out of the lungs are severely compromised, mobility is extremely limited, poor respiration may cause fatigue, fuzzy thinking, headaches and susceptibility to infection or diseases (e.g., pneumonia), speech is difficult and eating or drinking by mouth may not be possible. According to some embodiments, the vectors, e.g., AAV vectors described herein, may be used to treat a subject with ALS who has a C9orf72 mutation. According to some embodiments, the vectors, e.g., AAV vectors described herein, may be used to treat a subject with ALS who has TDP-43 mutations. According to some embodiments, the vectors, e.g., AAV vectors described herein, may be used to treat a subject with ALS who has FUS mutations. According to some embodiments, the nucleic acid sequences described herein are directly introduced into a cell, where the nucleic acid sequences are expressed to produce the encoded product, prior to administration in vivo of the resulting recombinant cell. This can be accomplished by any of numerous methods known in the art, e.g., by such methods as electroporation, lipofection, calcium phosphate mediated transfection. Pharmaceutical Compositions According to some aspects, the disclosure provides pharmaceutical compositions comprising any of the vectors described herein, optionally in a pharmaceutically acceptable excipient. In addition to the pharmaceutical compositions (vectors, e.g., AAV vectors comprising the nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules), provided herein are pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats; and/or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and/or turkeys. According to some embodiments, compositions are administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase "active ingredient" generally refers either to the synthetic siRNA duplexes, the vector, e.g., AAV vector, encoding the siRNA duplexes, or to the siRNA molecule delivered by a vector as described herein. Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit. Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered. The vectors e.g., AAV vectors, comprising the nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release; or (4) alter the biodistribution (e.g., target the viral vector to specific tissues or cell types such as brain and motor neurons). According to some aspects, the disclosure provides pharmaceutical compositions comprising any of the antisense compounds described herein, optionally in a pharmaceutically acceptable excipient. Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. An antisense compound targeted to a c9orf72 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a C9ORF72 nucleic acid and a pharmaceutically acceptable diluent. According to some embodiments, the pharmaceutically acceptable diluent is PBS. According to some embodiments, the antisense compound is an antisense oligonucleotide. Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound. Formulations of the present disclosure can include, without limitation, saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics and combinations thereof. Further, the viral vectors of the present disclosure may be formulated using self-assembled nucleic acid nanoparticles. Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and/or one or more other accessory ingredients. A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1% and 99% (w/w) of the active ingredient. By way of example, the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1-30%, between 5-80%, at least 80% (w/w) active ingredient. Excipients, which, as used herein, includes, but is not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21.sup.st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, Md., 2006; incorporated herein by reference in its entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition. Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and/or combinations thereof. According to some embodiments, the formulations may comprise at least one inactive ingredient. As used herein, the term "inactive ingredient" refers to one or more inactive agents included in formulations. In some embodiments, all, none or some of the inactive ingredients which may be used in the formulations of the present disclosure may be approved by the US Food and Drug Administration (FDA). Formulations of vectors comprising the nucleic acid sequence for the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) molecules of the present disclosure may include cations or anions. According to some embodiments, the formulations include metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+ and combinations thereof. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy- ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p.1418, Pharmaceutical Salts: Properties, Selection, and Use, P. H. Stahl and C. G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1- 19 (1977); the content of each of which is incorporated herein by reference in their entirety. According to some embodiments, the vector, e.g., AAV vector, comprising the nucleic acid sequence for the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be formulated for CNS delivery. Agents that cross the brain blood barrier may be used. For example, some cell penetrating peptides that can target siRNA molecules to the brain blood barrier endothelium may be used to formulate the siRNA duplexes targeting the SOD1 gene (e.g., Mathupala, Expert Opin Ther Pat., 2009, 19, 137-140; the content of which is incorporated herein by reference in its entirety) Administration and Dosing According to the methods of treatment of the present disclosure, administering of a compositions comprising a vector described herein can be accomplished by any means known in the art. According to some embodiments, compositions of vector, e.g., AAV vector, comprising a nucleic acid sequence described herein (e.g. antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules)) may be administered in a way which facilitates the vectors or siRNA molecule to enter the central nervous system and penetrate into motor neurons. According to some embodiments, the vector, e.g., an AAV vector, comprising a nucleic acid sequence encoding antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be administered by muscular injection. According to some embodiments, AAV vectors that express antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be administered to a subject by peripheral injections and/or intranasal delivery. It was disclosed in the art that the peripheral administration of AAV vectors for siRNA duplexes can be transported to the central nervous system, for example, to the motor neurons (e.g., U. S. Patent Publication Nos.20100240739; and 20100130594; the content of each of which is incorporated herein by reference in their entirety). According to some embodiments, compositions comprising at least one vector, e.g., an AAV vector, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be administered to a subject by intracranial delivery (e.g. intrathecal or intracerebroventricular administration, see e.g., U.S. Pat. No.8,119,611; the content of which is incorporated herein by reference in its entirety). The vector, e.g., an AAV vector, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution. The antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may be formulated with any appropriate and pharmaceutically acceptable excipient. The vector, e.g., an AAV vector, comprising a nucleic acid sequence encoding the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be administered in a "therapeutically effective" amount, i.e., an amount that is sufficient to alleviate and/or prevent at least one symptom associated with the disease, or provide improvement in the condition of the subject. According to some embodiments, the vector, e.g., an AAV vector, may be administered to the CNS in a therapeutically effective amount to improve function and/or survival for a subject with ALS. As a non-limiting example, the vector may be administered intrathecally. According to some embodiments, the vector, e.g., an AAV vector, may be administered to a subject (e.g., to the CNS of a subject via intrathecal administration) in a therapeutically effective amount for the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) to target the motor neurons and astrocytes in the spinal cord and/or brain steam. As a non-limiting example, the antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may reduce the expression of c9orf72 protein or mRNA. According to some embodiments, the vector, e.g., an AAV vector, may be administered to a subject (e.g., to the CNS of a subject) in a therapeutically effective amount to slow the functional decline of a subject (e.g., determined using a known evaluation method such as the ALS functional rating scale (ALSFRS)) and/or prolong ventilator-independent survival of subjects (e.g., decreased mortality or need for ventilation support). As a non-limiting example, the vector may be administered intrathecally. According to some embodiments, the vector, e.g., an AAV vector, may be administered to the cisterna magna in a therapeutically effective amount to transduce spinal cord motor neurons and/or astrocytes. As a non-limiting example, the vector may be administered intrathecally. According to some embodiments, the vector, e.g., an AAV vector, may be administered using intrathecal infusion in a therapeutically effective amount to transduce spinal cord motor neurons and/or astrocytes. As a non-limiting example, the vector may be administered intrathecally. According to some embodiments, the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may be formulated. As a non-limiting example the baricity and/or osmolality of the formulation may be optimized to ensure optimal drug distribution in the central nervous system or a region or component of the central nervous system. According to some embodiments, the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may be delivered to a subject via a single route administration. According to some embodiments, the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may be delivered to a subject via a multi-site route of administration. A subject may be administered the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) at 2, 3, 4, 5 or more than 5 sites. According to some embodiments, a subject may be administered the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) described herein using a bolus infusion. According to some embodiments, a subject may be administered the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) described herein using sustained delivery over a period of minutes, hours or days. The infusion rate may be changed depending on the subject, distribution, formulation or another delivery parameter. According to some embodiments, the catheter may be located at more than one site in the spine for multi-site delivery. The vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may be delivered in a continuous and/or bolus infusion. Each site of delivery may be a different dosing regimen or the same dosing regimen may be used for each site of delivery. As a non-limiting example, the sites of delivery may be in the cervical and the lumbar region. As another non- limiting example, the sites of delivery may be in the cervical region. As another non-limiting example, the sites of delivery may be in the lumbar region. According to some embodiments, a subject may be analyzed for spinal anatomy and pathology prior to delivery of the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) described herein. As a non-limiting example, a subject with scoliosis may have a different dosing regimen and/or catheter location compared to a subject without scoliosis. According to some embodiments, the orientation of the spine of the subject during delivery of the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may be vertical to the ground. According to some embodiments, the orientation of the spine of the subject during delivery of the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) may be horizontal to the ground. According to some embodiments, the spine of the subject may be at an angle as compared to the ground during the delivery of the vector, e.g., an AAV vector, comprising antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules). The angle of the spine of the subject as compared to the ground may be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or 180 degrees. According to some embodiments, the delivery method and duration is chosen to provide broad transduction in the spinal cord. As a non-limiting example, intrathecal delivery is used to provide broad transduction along the rostral-caudal length of the spinal cord. As another non- limiting example, multi-site infusions provide a more uniform transduction along the rostral- caudal length of the spinal cord. As yet another non-limiting example, prolonged infusions provide a more uniform transduction along the rostral-caudal length of the spinal cord. The pharmaceutical compositions of the present disclosure may be administered to a subject using any amount effective for reducing, preventing and/or treating a c9orf72 associated disorder (e.g., ALS). The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. The compositions of the present disclosure are typically formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present disclosure may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutic effectiveness for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the siRNA duplexes employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts. According to some embodiments, the age and sex of a subject may be used to determine the dose of the compositions of the present disclosure. As a non-limiting example, a subject who is older may receive a larger dose (e.g., 5-10%, 10-20%, 15-30%, 20-50%, 25-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more) of the composition as compared to a younger subject. As another non-limiting example, a subject who is younger may receive a larger dose (e.g., 5-10%, 10-20%, 15-30%, 20-50%, 25- 50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more) of the composition as compared to an older subject. As yet another non- limiting example, a subject who is female may receive a larger dose (e.g., 5-10%, 10-20%, 15- 30%, 20-50%, 25-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more) of the composition as compared to a male subject. As yet another non-limiting example, a subject who is male may receive a larger dose (e.g., 5-10%, 10- 20%, 15-30%, 20-50%, 25-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more) of the composition as compared to a female subject. According to some embodiments, the doses of AAV vectors for delivering antisense compounds (e.g. antisense oligonucleotides, siRNA molecules, shRNA molecules) of the present disclosure may be adapted dependent on the disease condition, the subject and the treatment strategy. According to the methods of treatment of the present disclosure, the concentration of vector that is administered may differ depending on production method and may be chosen or optimized based on concentrations determined to be therapeutically effective for the particular route of administration. According to some embodiments, the concentration in vector genomes per milliliter (vg/ml) is selected from the group consisting of about 10 ⁸ vg/ml, about 10 ⁹ vg/ml, about 10 ¹⁰ vg/ml, about 10 ¹¹ vg/ml, about 10 ¹² vg/ml, about 10 ¹³ vg/ml, and about 10 ¹⁴ vg/ml. In some embodiments, the concentration is in the range of 10 ¹⁰ vg/ml - 10 ¹⁴ vg/ml, for example 10 ¹⁰ vg/ml - 10 ¹⁴ vg/ml, 0 ¹⁰ vg/ml - 10 ¹³ vg/ml, 10 ¹⁰ vg/ml - 10 ¹² vg/ml, 10 ¹⁰ vg/ml - 10 ¹¹ vg/ml, 10 ¹¹ vg/ml - 10 ¹⁴ vg/ml, 10 ¹¹ vg/ml - 10 ¹³ vg/ml, 10 ¹¹ vg/ml - 10 ¹² vg/ml, 10 ¹² vg/ml - 10 ¹⁴ vg/ml, 10 ¹² vg/ml - 10 ¹³ vg/ml, or 10 ¹³ vg/ml - 10 ¹⁴ vg/ml, delivered by intracranial injection, or intra cisterna magna injection, or intrathecal injection, or intramuscular injection, or intravitreal injection in a volume between about 0.1 ml and about 10 ml, for example between about 0.1 ml and about 10 ml, between about 0.5 ml and about 10 ml, between about 1 ml and about 10 ml, between about 5 ml and about 10 ml, between about 0.1 ml and about 5.0 ml, between about 0.1 ml and about 2.0 ml, between about 0.1 ml and about 1.0 ml, between about 0.1 ml and about 0.8 ml, between about 0.1 ml and about 0.6 ml, between about 0.1 ml and about 0.4 ml, between about 0.1 ml and about 0.2 ml, between about 0.2 ml and about 1.0 ml, between about 0.2 ml and about 0.8 ml, between about 0.2 ml and about 0.6 ml, between about 0.2 ml and about 0.4 ml, between about 0.4 ml and about 1.0 ml, between about 0.4 ml and about 0.8 ml, between about 0.4 ml and about 0.6 ml, between about 0.6 ml and about 1.0 ml, between about 0.6 ml and about 0.8 ml, between about 0.8 ml and about 1.0 ml, or about 0.1 ml, about 0.2 ml, about 0.4 ml, about 0.6 ml, about 0.8 ml, and about 1.0 ml . According to some embodiments, one or more additional therapeutic agents may be administered to the subject. The effectiveness of the compositions described herein can be monitored by several criteria. For example, after treatment in a subject using methods of the present disclosure, the subject may be assessed for e.g., an improvement and/or stabilization and/or delay in the progression of one or more signs or symptoms of the disease state by one or more clinical parameters including those described herein. Examples of such tests are known in the art, and include objective as well as subjective (e.g., subject reported) measures. In Vitro Analysis Inhibition of levels or expression of a c9orf72 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions. Quantitative Real-Time PCR Analysis of Target RNA Levels Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art. Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art. Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, Calif.). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN are taught in Jones, L. J., et al., (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence. Probes and primers are designed to hybridize to a C9ORF72 nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, Calif.). Analysis of Protein Levels Antisense inhibition of c9orf72 nucleic acids can be assessed by measuring c9orf72 protein levels. Protein levels of c9orf72 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human c9orf72 are commercially available. In Vivo Analysis Antisense compounds described herein are tested in animals to assess their ability to inhibit expression of c9orf72 and produce phenotypic changes, such as, improved motor function and respiration. According to some embodiments, motor function is measured by rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal. In certain embodiments, respiration is measured by whole body plethysmograph, invasive resistance, and compliance measurements in the animal. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from CNS tissue or CSF and changes in c9orf72 nucleic acid expression are measured. VI. KITS The rAAV compositions as described herein may be contained within a kit designed for use in one of the methods of the disclosure as described herein. According to one embodiment, a kit of the disclosure comprises (a) any one of the vectors of the disclosure, and (b) instructions for use thereof. According to some embodiments, a vector of the disclosure may be any type of vector known in the art, including a non-viral or viral vector, as described supra. According to some embodiments, the vector is a viral vector, such as a vector derived from an adeno- associated virus, an adenovirus, a retrovirus, a lentivirus, a vaccinia/poxvirus, or a herpesvirus (e.g., herpes simplex virus (HSV)). According to preferred embodiments, the vector is an adeno-associated viral (AAV) vector. According to some embodiments, the kits may further comprise instructions for use. According to some embodiments, the instructions for use include instructions according to one of the methods described herein. The instructions provided with the kit may describe how the vector can be administered for therapeutic purposes, e.g., for treating a c9orf72 associated disease (e.g. AML or FTD). According to some embodiments wherein the kit is to be used for therapeutic purposes, the instructions include details regarding recommended dosages and routes of administration. According to some embodiments, the kits further contain buffers and/or pharmaceutically acceptable excipients. Additional ingredients may also be used, for example preservatives, buffers, tonicity agents, antioxidants and stabilizers, nonionic wetting or clarifying agents, viscosity-increasing agents, and the like. The kits described herein can be packaged in single unit dosages or in multidosage forms. The contents of the kits are generally formulated as sterile and substantially isotonic solution. All patents and publications mentioned herein are incorporated herein by reference to the extend allowed by law for the purpose of describing and disclosing the proteins, enzymes, vectors, host cells, and methodologies reported therein that might be used with the present disclosure. However, nothing herein is to be construed as an admission that the disclosure is not entitled to antedate such disclosure by virtue of prior disclosure. The present disclosure is further illustrated by the following examples, which should not be construed as further limiting. The contents of all figures and all references, patents and published patent applications cited throughout this application, as well as the Figures, are expressly incorporated herein by reference in their entirety. Examples Example 1. Methods The invention was performed using, but not limited to, the following methods. The methods as described herein are set forth in PCT Application No. PCT/US2007/017645, filed on August 8, 2007, entitled Recombinant AAV Production in Mammalian Cells, which claims the benefit of U.S. Application No.11/503,775, entitled Recombinant AAV Production in Mammalian Cells, filed August 14, 2007, which is a continuation-in-part of U.S. application Serial No.10/252,182, entitled High Titer Recombinant AAV Production, filed September 23, 2002, now U.S. Patent No.7,091,029, issued August 15, 2006. The contents of all the aforementioned applications are hereby incorporated by reference in their entirety. rHSV co-infection method The rHSV co-infection method for recombinant adeno-associated virus (rAAV) production employs two ICP27-deficient recombinant herpes simplex virus type 1 (rHSV-1) vectors, one bearing the AAV rep and cap genes (rHSV-rep2capX, with “capX” referring to any of the AAV serotypes), and the second bearing the gene of interest (GOI) cassette flanked by AAV inverted terminal repeats (ITRs). Although the system was developed with AAV serotype 2 rep, cap, and ITRs, as well as the humanized green fluorescent protein gene (GFP) as the transgene, the system can be employed with different transgenes and serotype/pseudotype elements. Mammalian cells are infected with the rHSV vectors, providing all cis and trans-acting rAAV components as well as the requisite helper functions for productive rAAV infection. Cells are infected with a mixture of rHSV-rep2capX and rHSV-GOI. Cells are harvested and lysed to liberate rAAV-GOI, and the resulting vector stock is titered by the various methods described below. DOC-lysis At harvest, cells and media are separated by centrifugation. The media is set aside while the cell pellet is extracted with lysis buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl) containing 0.5% (w/v) deoxycholate (DOC) using 2 to 3 freeze-thaw cycles, which extracts cell-associated rAAV. In some instances, the media and cell-associated rAAV lysate is recombined. In situ lysis An alternative method for harvesting rAAV is by in situ lysis. At the time of harvest, MgCl2is added to a final concentration of 1 mM, 10% (v/v) Triton X-100 added to a final concentration of 1% (v/v), and Benzonase is added to a final concentration of 50 units/mL. This mixture is either shaken or stirred at 37°C for 2 hours. Quantitative real-time PCR to determine DRP yield The DNAse-resistant particle (DRP) assay employs sequence-specific oligonucleotide primers and a dual-labeled hybridizing probe for detection and quantification of the amplified DNA sequence using real-time quantitative polymerase chain reaction (qPCR) technology. The target sequence is amplified in the presence of a fluorogenic probe which hybridizes to the DNA and emits a copy-dependent fluorescence. The DRP titer (DRP/mL) is calculated by direct comparison of relative fluorescence units (RFUs) of the test article to the fluorescent signal generated from known plasmid dilutions bearing the same DNA sequence. The data generated from this assay reflect the quantity of packaged viral DNA sequences, and are not indicative of sequence integrity or particle infectivity. Green-cell infectivity assay to determine infectious particle yield (rAA V-GFP only) Infectious particle (ip) titering is performed on stocks of rAA V-GFP using a green cell assay. C12 cells (a HeLa derived line that expressed AAV2 Rep and Cap genes - see references below) are infected with serial dilutions of rAA V-GFP plus saturating concentrations of adenovirus (to provide helper functions for AAV replication). After two to three days incubation, the number of fluorescing green cells (each cell representing one infectious event) are counted and used to calculate the ip/mL titer of the virus sample. Clark KR et al. described recombinant adenoviral production in Hum. Gene Ther.1995. 6:1329-1341 and Gene Ther.1996.3:1124-1132, both of which are incorporated by reference in their entireties herein. TCID ₅₀ to determine rAAV infectivity Infectivity of rAAV particles harboring a gene of interest (rAAV-GOI) was determined using a tissue culture infectious dose at 50% (TCID ₅₀ ) assay. Eight replicates of rAAV were serially diluted in the presence of human adenovirus type 5 and used to infect HeLaRC32 cells (a HeLa-derived cell line that expresses AAV2 rep and cap, purchased from ATCC) in a 96-well plate. At three days post-infection, lysis buffer (final concentrations of 1 mM Tris-HC1 pH 8.0, 1 mM EDTA, 0.25% (w/v) deoxycholate, 0.45% (v/v) Tween-20, 0.1% (w/v) sodium dodecyl sulfate, 0.3 mg/mL Proteinase K) was added to each well then incubated at 37°C for 1 h, 55°C for 2 h, and 95°C for 30 min. The lysate from each well (2.5 μL aliquot) was assayed in the DRP qPCR assay described above. Wells with Ct values lower than the value of the lowest quantity of plasmid of the standard curve were scored as positive. TCID50 infectivity per mL (TCID50/mL) was calculated based on the Karber equation using the ratios of positive wells at 10-fold serial dilutions. Cell lines and viruses Production of rAAV vectors for gene therapy is carried out in vitro, using suitable producer cell lines such as HEK293 cells (293). Other cell lines suitable for use in the invention include Vero, RD, BHK-21, HT-1080, A549, Cos-7, ARPE-19, and MRC-5. Mammalian cell lines were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Hyclone) containing 2 - 10% (v/v) fetal bovine serum (FBS, Hyclone) unless otherwise noted. Cell culture and virus propagation were performed at 37°C, 5% CO2 for the indicated intervals. Infection cell density Cells can be grown to various concentrations including, but not limited to at least about, at most about, or about 1 x 10 ⁶ to 4 x 10 ⁶ cells/mL. The cells can then be infected with recombinant herpesvirus at a predetermined MOI. Example 2. Multi-variant (v1-NM-145005 & v2-NM-018325) c9orf72 Supplementation Codon optimization of c9orf72 to avoid miRNA knock-down c9orf72 was codon optimized to avoid miRNA knock-down. The GenSmart v1.0 algorithm was used (genscript.com/tools/ensmart-codon-optimization). Greater than 50 permutations are performed. The restriction Enzyme sites (NotI (GCG|CCGC) & AscI (GGC|GCGCC)) were avoided. GC% was ranked, as shown in Table 2. High c9orf72 expression was preferably avoided, therefore according to some embodiments, three variants are enough for supplementation purposes. The top candidates are shown in Table 2, below.. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 14, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 14. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 15, shown below. SEQ ID NO: 15

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 15. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 16, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 16. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 17, shown below. SEQ ID NO: 17

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 17. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 18, shown below. SEQ ID NO: 18

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 18. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 19, shown below. SEQ ID NO: 19

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 19. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 20, shown below. CACCAGCGTGCAGGAGAGAGATGTTCTGATGACCTTCTGA According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 20. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 21, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 21. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 22, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 22. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 23, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 23. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 24, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 24. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 25, shown below. SEQ ID NO: 25

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 25. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 26, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 26. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 27, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 27. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 28, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 28. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 29, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 29. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 30, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 30. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 31, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 31. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 32, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 32. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 33, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 33. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 34, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 34. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 35, shown below. SEQ ID NO: 35

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 35. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 36, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 36. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 37, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 37. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 38, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 38. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 39, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 39. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 40, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 40. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 41, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 41. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 42, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 42. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 43, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 43. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 44, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 44. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 45, shown below. SEQ ID NO: 45

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 45. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 46, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 46. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 47, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 47. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 48, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 48. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 49, shown below.

According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 49. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 50, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 50. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 51, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 51. According to some embodiments, the codon optimized sequence comprises SEQ ID NO: 52, shown below. According to some embodiments, the codon optimized sequence is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 52. Gene structure of multiplexed expression of c9orf72 with artificial intron (A.I.) The gene structure of c9orf72-AI (artificial intron) is shown in FIG.1A. The corresponding nucleic acid sequence is shown in FIG.1B. The artificial structures for c9orf72 supplementation are shown in FIG.2. A customer designed artificial intron harboring His-cMyc tags and His-HA tags were added for v1 and v3 transcript, respectively. The A.I. sequence was tested in vitro using plasmid transfection. Final AAV construct size The final size of the AAV construct is about 4.8 kb. The promoters employed for the final AAV version were: a hSyn promoter (neuron specific), a CBA promoter (ubiquitous), or a CASI promoter (ubiquitous). Multi-variant (v1-NM-145005 & v2-NM-018325) c9orf72 supplementation Wildtype (WT) cells express predominantly v1 (NM-145005) & v2 (NM-018325). An “Alternative Stop-or-Go” design was proposed for v1 & v2 cistronic variants. The splicing efficiency of artificial “intron” was found to be less than 100%. The v1 variant came from translation read-through on non-spliced mRNA. The v2 variant came from spliced mRNA. The ratio of v1/v2 was balanced by changing artificial intron properties. Schematic constructs of alternative translation are shown in FIGs.3A – 3D. FIG.3A is a schematic showing the first open reading frame of an alternative translation of c9orf72. FIG.3B shows the corresponding nucleic acid sequence. FIG.3C is a schematic showing the second open reading frame after splicing of an alternative translation of c9orf72. FIG.3D shows the corresponding nucleic acid sequence. Experimental design validating cistronic v1 & v2 supplementation The testing construct carried BSD or Puro element as selection marker. BSD: blasticidin resistant to ensure v1 & v2 expression ratio measure. Blasticidin resistance ensures non- transduced cells expressing WT c9orf72 variants will die off. Therefore, recombinant v1 vs v2 ratio was measured. The final AAV constructdid not include the BSD marker. FIG.4 shows a schematic of constructs with selection marker. The following multi-variant c9orf72 constructs were prepared: (1) p084_EXPR_pcDNA_CBA_WTC9-EpiTag_WPRE. This construct comprises CBA promoter, wildtype C9orf72 sequence (long isoform) tagged with His and HA tag, TK polyA signal. Ampicillin resistance gene. The vector map is shown in FIG.5. According to some embodiments, the nucleic acid sequence of p084_EXPR_pcDNA_CBA_WTC9-EpiTag_WPRE comprises SEQ ID NO: 53. According to some embodiments, the nucleic acid sequence of p084_EXPR_pcDNA_CBA_WTC9-EpiTag_WPRE is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 53, shown below.

According to some embodiments, p084_Expr_pcDNA_CBA_WTC9-EpiTag_WPRE_2- FP-CBA _(forward primer) (1195 bp) comprises SEQ ID NO: 54. According to some embodiments, p084_Expr_pcDNA_CBA_WTC9-EpiTag_WPRE_2- RP-WPRE_reverse primer (1212 bp) comprises SEQ ID NO: 55.

(2) p085_EXPR_pcDNA_CASI_WTC9-EpiTag_WPRE. This construct comprises CASI promoter, wildtype C9orf72 sequence (express only long isoform) tagged with His and HA tag, TK polyA signal. Ampicillin resistance gene. The vector map is shown in FIG.6. According to some embodiments, the nucleic acid sequence of p085_EXPR_pcDNA_CASI_WTC9-EpiTag_WPRE comprises SEQ ID NO:56. According to some embodiments, the nucleic acid sequence of p085_EXPR_pcDNA_CASI_WTC9- EpiTag_WPRE is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 56, shown below. TCTAAATGGAGAAATCCTTCGAAATGCAGAGAGTGGTGCTATAGATGTAAAGTTTTTTGT CTTG TCTGAAAAGGGAGTGATTATTGTTTCATTAATCTTTGATGGAAACTGGAATGGGGATCGC AGCA CATATGGACTATCAATTATACTTCCACAGACAGAACTTAGTTTCTACCTCCCACTTCATA GAGT GTGTGTTGATAGATTAACACATATAATCCGGAAAGGAAGAATATGGATGCATAAGGAAAG ACAA GAAAATGTCCAGAAGATTATCTTAGAAGGCACAGAGAGAATGGAAGATCAGGGTCAGAGT ATTA TTCCAATGCTTACTGGAGAAGTGATTCCTGTAATGGAACTGCTTTCATCTATGAAATCAC ACAG TGTTCCTGAAGAAATAGATATAGCTGATACAGTACTCAATGATGATGATATTGGTGACAG CTGT CATGAAGGCTTTCTTCTCgtaagtCACCACCACCACCACCACGAGCAGAAGCTGATCTCC GAGG AGGACCTGTAAatcaaggttacaagacaggAATAAAtttaaggagaccaatagaaactgg gctt gtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatcca cttt gcctttctctccacagAATGCCATCAGCTCACACTTGCAAACCTGTGGCTGTTCCGTTGT AGTA GGTAGCAGTGCAGAGAAAGTAAATAAGATAGTCAGAACATTATGCCTTTTTCTGACTCCA GCAG AGAGAAAATGCTCCAGGTTATGTGAAGCAGAATCATCATTTAAATATGAGTCAGGGCTCT TTGT ACAAGGCCTGCTAAAGGATTCAACTGGAAGCTTTGTGCTGCCTTTCCGGCAAGTCATGTA TGCT CCATATCCCACCACACACATAGATGTGGATGTCAATACTGTGAAGCAGATGCCACCCTGT CATG AACATATTTATAATCAGCGTAGATACATGAGATCCGAGCTGACAGCCTTCTGGAGAGCCA CTTC AGAAGAAGACATGGCTCAGGATACGATCATCTACACTGACGAAAGCTTTACTCCTGATTT GAAT ATTTTTCAAGATGTCTTACACAGAGACACTCTAGTGAAAGCCTTCCTGGATCAGGTCTTT CAGC TGAAACCTGGCTTATCTCTCAGAAGTACTTTCCTTGCACAGTTTCTACTTGTCCTTCACA GAAA AGCCTTGACACTAATAAAATATATAGAAGACGATACGCAGAAGGGAAAAAAGCCCTTTAA ATCT CTTCGGAACCTGAAGATAGACCTTGATTTAACAGCAGAGGGCGATCTTAACATAATAATG GCTC TGGCTGAGAAAATTAAACCAGGCCTACACTCTTTTATCTTTGGAAGACCTTTCTACACTA GTGT GCAAGAACGAGATGTTCTAATGACTTTTCACCACCACCACCACCACTACCCCTACGACGT GCCC GACTACGCCTAAACAACTTTGTATAATAAAGTTGTAaatcaacctctggattacaaaatt tgtg aaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctt taat gcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatc ctgg ttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcact gtgt ttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccggga cttt cgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctg gaca ggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtccttt cctt ggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtccctt cggc cctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcg tctt cgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctgAACCCAGC TTTc ttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccct ctcc tcggtctcgattctacgcgtaccggttagtaatgagtttaaacgggggaggctaactgaa acac ggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaa cgca cgggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcg atac cccaccgagaccccattggggccaatacgcccgcgtttcttccttttccccaccccaccc ccca agttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagca gatc tgcgcagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcgg cggg tgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctccttt cgct ttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggg ctcc ctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtg atgg ttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccac gttc tttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattct tttg atttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaa aatt taacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctcc ccag caggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccc cagg ctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtccc gccc ctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggc tgac taattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagt agtg aggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccat tttc ggatctgatcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataat acga caaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccctcattga aaga gcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagct ctct

(3) p111_EXPR-pcDNA-CBA-C9orf72-AI-loxp-WPRE-pA. This construct comprisess CBA promoter, polyA signal, Ampicillin resistance gene. This construct carry a C9orf72 sequence designed to express long C9orf72 protein isoform tagged with His and HA, a short C90rf72 protein isoform tagged with His and Myc tag. The vector map is shown in FIG.7. According to some embodiments, the nucleic acid sequence of p111_EXPR-pcDNA-CBA- C9orf72-AI-loxp-WPRE-pA comprises SEQ ID NO: 59. According to some embodiments, the nucleic acid sequence of p111_EXPR-pcDNA-CBA-C9orf72-AI-loxp-WPRE-pA is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 59, shown below.

According to some embodiments, p111_EXPR-pcDNA-CBA-C9orf72-AI-loxp-WPRE- pA_4-RP-WPRE-01 (645 bp) comprises SEQ ID NO: 61, shown below.

(4) p131_Expr_pcDNA-CBA-C9-mutAI-His-HA-WPRE-pA. This construct comprises CBA promoter, polyA signal, Ampicillin resistance gene. This construct carry a C9orf72 sequence designed to express long C9orf72 protein isoform tagged with His and HA, a short C90rf72 protein isoform tagged with no tag. The vector map is shown in FIG.8. According to some embodiments, the nucleic acid sequence of p131_Expr_pcDNA-CBA-C9-mutAI-His-HA- WPRE-pA comprises SEQ ID NO: 62. According to some embodiments, the nucleic acid sequence of p131_Expr_pcDNA-CBA-C9-mutAI-His-HA-WPRE-pA is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 62, shown below.

(5) p132_Expr_pcDNACBA-C9-AI-stop-His-HA-WPRE-pA. This construct comprises a C9orf72 sequence designed to express long C9orf72 protein isoform tagged with His and HA, a short C90rf72 protein isoform tagged with no tag. The vector map is shown in FIG.9. According to some embodiments, the nucleic acid sequence of p132_Expr_pcDNACBA-C9-AI- stop-His-HA-WPRE-pA comprises SEQ ID NO: 65. According to some embodiments, the nucleic acid sequence of p132_Expr_pcDNACBA-C9-AI-stop-His-HA-WPRE-pA is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 65, shown below.

(6) p133_Expr_pcDNA-CBA-C9-AI-Myc-Stop-His-HA-WPRE-pA. This construct comprises CBA promoter, bGH polyA signal, Ampicillin resistance gene. This construct carry a C9orf72 sequence designed to express long C9orf72 protein isoform tagged with His and HA, a short C90rf72 protein isoform tagged with Myc tag The vector map is shown in FIG.10. According to some embodiments, the nucleic acid sequence of p133_Expr_pcDNA-CBA-C9- AI-Myc-Stop-His-HA-WPRE-pA comprises SEQ ID NO: 68. According to some embodiments, the nucleic acid sequence of p133_Expr_pcDNA-CBA-C9-AI-Myc-Stop-His-HA-WPRE-pA is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 68, shown below.

(7) p134_Expr_pcDNA-CBA-C9-AI-Myc-stop-V2-His-Wpre_pA. This construct comprises CBA promoter, bGH polyA signal, Ampicillin resistance gene. This construct carry a C9orf72 sequence designed to express long C9orf72 protein isoform tagged with His, a short C90rf72 protein isoform tagged with Myc tag. The vector map is shown in FIG.11. According to some embodiments, the nucleic acid sequence of p134_Expr_pcDNA-CBA-C9-AI-Myc-stop- V2-His-Wpre_pA comprises SEQ ID NO: 71. According to some embodiments, the nucleic acid sequence of p134_Expr_pcDNA-CBA-C9-AI-Myc-stop-V2-His-Wpre_pA is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 71. Dynamic range control of gene expression levels It is possible that over expression of c9orf72 will be toxic, over long term in vivo. Thus, precise expression levels of both v1 & v2 variants are key requirements. A 3D mRNA attenuator (~ 200 nt) was used to tune expression levels. This creates a “High Dynamic Range” of expression level control. FIG.12 is a graph showing the high dynamic range that was generated by different promoters. A 3D mRNA attenuator can be placed into the 3’ UTR or in artificial introns. 3’ UTR placement will control the overall expression levels. Artificial intron placement will control the ratio of v1/v2 variants. The promoter used determines the upper and lower boundaries of expressions. FIG.13 shows schematic constructs and dose ranges. FIG.14 shows the result of a 3D mRNA attenuator test experiment. From the intensity of the fluorescence, it can be seen that different 3D mRNA attenuators have different influence on the gene’s expression level. In vitro validation in HEK293 cells Experiments were performed to detect the expression of C9orf72 protein. Breifly, HEK293 cells were transfected and selected with Puro+ or BSD+, or Hygro+ . 48 – 72 hrs later, Western Blots were prepared. Epitope tags His, cMyc, HA were used for detection. Results are shon in FIG.21. From this data, it was confirmed that short isoform of C9orf72 protein was successfully expressed. HEK293 mRNA sequencing data Both 1 and V2 variant mRNA should be detected V1 variant mRNA length is expected to be ~ 3,795 bp (including IVS: 960 bp). V2 variant mRNA length is expected to be ~ 2,835 bp (excluding IVS: 960 bp). HEK293 IHC staining data In a set of experiments, expression of the V1 and V2 variants will be determined in HEK293 cells in vitro using immunohistochemistry. V1 will be detected by cMyc tagged antibody, V2 will be detected by FLAG tagged antibody. V1 variant will specifically detected using cMyc (Green channel). V2 variant will specifically detected using FLAG (Red channel).

₁ .v ⁰ ₁ ⁶ ₀ ³ ₇ ¹ ₃ ¹ _E M

₁ .v ⁰ ₁ ⁶ ₀ ³ ₇ ¹ ₃ ¹ _E M

₁ .v ⁰ ₁ ⁶ ₀ ³ ₇ ¹ ₃ ¹ _E M

₁ .v ⁰ ₁ ⁶ ₀ ³ ₇ ¹ ₃ ¹ _E M

₁ .v ⁰ ₁ ⁶ ₀ ³ ₇ ¹ ₃ ¹ _E M

₁ .v ⁰ ₁ ⁶ ₀ ³ ₇ ¹ ₃ ¹ _E M ₁ .v ⁰ ₁ ⁶ ₀ ³ ₇ ¹ ₃ ¹ _E M The following miRNA constructs were prepared: (1) p141_EXPR_AAV_CBA-BFP_Antisense_miRNA1. This construct comprises CBA promoter, BFP sequence, miRNA1 targeting antisense C9orf72, bGH polyA signal. Ampicillin resistance gene. The vector map is shown in FIG.15. According to some embodiments, the nucleic acid sequence of p141_EXPR_AAV_CBA-BFP_Antisense_miRNA1 comprises SEQ ID NO: 74. According to some embodiments, the nucleic acid sequence of p141_EXPR_AAV_CBA-BFP_Antisense_miRNA1 is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 74, shown below.

(2) p147_EXPR_AAV_CBA-BFP_sense_miRNA41. This construct comprises CBA promoter, BFP sequence, miRNA41 targeting sense C9orf72, bGH polyA signal. Ampicillin resistance gene. The vector map is shown in FIG.16. According to some embodiments, the nucleic acid sequence of p147_EXPR_AAV_CBA-BFP_sense_miRNA41 comprises SEQ ID NO: 77. According to some embodiments, the nucleic acid sequence of p147_EXPR_AAV_CBA-BFP_sense_miRNA41 is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 77, shown below.

According to some embodiments, p147_EXPR_AAV_CBA- BFP_sense_miRNA41_attb1_Sequencing result (953 bp) comprises SEQ ID NO: 78, shown below.

Reporter with Target Tandem Arrays (Puro+) transfection in HEK293 cells. Next, tandem array constructs were prepared. Use of Puro+ ensured only cells that were transduced with reporter constructs survived. Use of BSD+ ensured only cells that were transduced with miRNA constructs survived. Double selection ensured accurate knock-down efficiency. The following tandem array constructs were prepared: (1) p136_Lenti_CBA_tandomarray-Sense-GA80s-GFP-WPRE. This construct comprises CBA promoter, tandomArray-sense(miRNA targeting site C9orf72 on sense sequence), Glycine Alanine repeat sequence tagged with GFP gene, WPRE, Ampicillin resistance gene, lentivirus production gene. The vector map is shown in FIG.17. According to some embodiments, the nucleic acid sequence of p136_Lenti_CBA_tandomarray-Sense-GA80s- GFP-WPRE comprises SEQ ID NO: 80. According to some embodiments, the nucleic acid sequence of p136_Lenti_CBA_tandomarray-Sense-GA80s-GFP-WPRE is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 80, shown below.

(2) p137_Lenti_CBA_tandomarray-AntiSense-GA80s-GFP-WPRE. This construct comprises CBA promoter, tandomArray-antisense(miRNA targeting site C9orf72 on antisense sequence), Glycine Alanine repeat sequence tagged with GFP gene, WPRE, Ampicillin resistance gene, lentivirus production gene. The vector map is shown in FIG.18. According to some embodiments, the nucleic acid sequence of p137_Lenti_CBA_tandomarray-AntiSense- GA80s-GFP-WPRE comprises SEQ ID NO: 83. According to some embodiments, the nucleic acid sequence of p137_Lenti_CBA_tandomarray-AntiSense-GA80s-GFP-WPRE is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to

(3) p138_Lenti_CBA_flex-Chronos-GA80s-GFP-WPRE. This construct comprises CBA promoter, partial of Chronos GFP sequence, Glycine Alanine repeat sequence tagged with GFP gene, WPRE, Ampicillin resistance gene, lentivirus production gene. The vector map is shown in FIG.19. According to some embodiments, the nucleic acid sequence of p138_Lenti_CBA_flex-Chronos-GA80s-GFP-WPRE comprises SEQ ID NO: 86. According to some embodiments, the nucleic acid sequence of p138_Lenti_CBA_flex-Chronos-GA80s-GFP- WPRE is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 86, shown below.

According to some embodiments, p138_Lenti_CBA_flex-Chronos-GA80s-GFP- WPRE_10-FP-CBA_sequencing result (801 bp) comprises SEQ ID NO: 87, shown below_. According to some embodiments, p138_Lenti_CBA_flex-Chronos-GA80s-GFP- WPRE_10-RP-WPRE-01 (862 bp) comprises SEQ ID NO: 88, shown below. miRNA Knockdown Based on algorithms, a total of 80 miRNA constructs were designed to target the C9orf72 gene. A cell model-based screening will be performed to find the top candidates. The screening will be performed on stable cell model generated by p136_Lenti_CBA_tandomarray- Sense-GA80s-GFP-WPRE or p137_Lenti_CBA_tandomarray-AntiSense-GA80s-GFP-WPRE Experiments will be performed using cells transfected with: (1) p136_Lenti_CBA_tandomarray-Sense-GA80s-GFP-WPRE; (2) p137_Lenti_CBA_tandomarray-AntiSense-GA80s-GFP-WPRE or (3) p138_Lenti_CBA_flex-Chronos-GA80s-GFP-WPRE. Untransfected cells served as control. One day after transfection, cells will be infected with virus carrying the top miRNA constructs. At day 3, cell will be stained with anti-GFP antibody and GFP fluorescence will be detected to determine c9orf72 knockdown. This experiment will be used to demonstrate the efficiency of miRNA knockdown. FIG.20 shows the results of another set of experiments, which demonstrated that using p136_Lenti_CBA_tandomarray-Sense-GA80s-GFP-WPRE or p137_Lenti_CBA_tandomarray- AntiSense-GA80s-GFP-WPRE, a fluorescence reporter system can be built that can be used to evaluate the efficiency of miRNA knockdown. Puro & BSD positive selection for 3, 6, 9, 12 days. Puro+ selection will be effective from 24 hrs. BSD+ selection will take longer, which is advantageous for quantifying protein knock- down turnover. Samples will be collected at 3, 6, 9, 12, 15 days for quantification. Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the following claims.

References Angela Schoolmeesters, M. L. K., Annaleen Vermeulen, Anja Smith, *Mayya Shveygert, *Xin Zhou, *Robert Blelloch (2017). "Smart-Lenti-miRNA-Vector " Keystone Pposter. Barta, T., et al. (2016). "miRNAsong: a web-based tool for generation and testing of miRNA sponge constructs in silico." Sci Rep 6: 36625. Bofill-De Ros, X. and S. Gu (2016). "Guidelines for the optimal design of miRNA-based shRNAs." Methods 103: 157-166. Bofill-De Ros, X., et al. (2019). "Structural Differences between Pri-miRNA Paralogs Promote Alternative Drosha Cleavage and Expand Target Repertoires." Cell Rep 26(2): 447-459 e444. Bofill-De Ros, X., et al. (2019). "S1-Structural Differences between Pri-miRNA Paralogs Promote Alternative Drosha Cleavage and Expand Target Repertoires." Chen, Z., et al. (2006). "Modeling CTLA4-linked autoimmunity with RNA interference in mice." Proc Natl Acad Sci U S A 103(44): 16400-16405. DeJesus-Hernandez, M., et al. (2011). "Suppl. Infor. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS." Neuron. DeJesus-Hernandez, M., et al. (2011). "Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS." Neuron 72(2): 245-256. Dow, L. E., et al. (2012). "Suppl. Infor. A pipeline for the generation of shRNA transgenic mice." Nat Protoc. Dow, L. E., et al. (2012). "A pipeline for the generation of shRNA transgenic mice." Nat Protoc 7(2): 374-393. Farg, M. A., et al. (2014). "C9ORF72, implicated in amytrophic lateral sclerosis and frontotemporal dementia, regulates endosomal trafficking." Hum Mol Genet 23(13): 3579-3595. Fellmann, C., et al. (2013). "Suppl. Infor. An optimized microRNA backbone for effective single-copy RNAi." Cell Rep. Fellmann, C., et al. (2013). "An optimized microRNA backbone for effective single-copy RNAi." Cell Rep 5(6): 1704-1713. Hauser, F., et al. (2013). "A genomic-scale artificial microRNA library as a tool to investigate the functionally redundant gene space in Arabidopsis." Plant Cell 25(8): 2848-2863. Hu, J. et al., , J., et al. (2015). "Engineering Duplex RNAs for Challenging Targets: Recognition of GGGGCC/CCCCGG Repeats at the ALS/FTD C9orf72 Locus." Chem Biol 22(11): 1505- 1511. Jiang, J., et al. (2016). "Gain of Toxicity from ALS/FTD-Linked Repeat Expansions in C9ORF72 Is Alleviated by Antisense Oligonucleotides Targeting GGGGCC-Containing RNAs." Neuron 90(3): 535-550. Jiang, L., et al. (2017). "NEAT1 scaffolds RNA-binding proteins and the Microprocessor to globally enhance pri-miRNA processing." Nat Struct Mol Biol 24(10): 816-824. Martier, R., et al. (2019). "Targeting RNA-Mediated Toxicity in C9orf72 ALS and/or FTD by RNAi-Based Gene Therapy." Mol Ther Nucleic Acids 16: 26-37. Martier, R., et al. (2019). "Suppl. Infor. Artificial MicroRNAs Targeting C9orf72 Can Reduce Accumulation of Intra-nuclear Transcripts in ALS and FTD Patients." Mol Ther Nucleic Acids. Martier, R., et al. (2019). "Artificial MicroRNAs Targeting C9orf72 Can Reduce Accumulation of Intra-nuclear Transcripts in ALS and FTD Patients." Mol Ther Nucleic Acids 14: 593-608. Miniarikova, J., et al. (2016). "Design, Characterization, and Lead Selection of Therapeutic miRNAs Targeting Huntingtin for Development of Gene Therapy for Huntington's Disease." Mol Ther Nucleic Acids 5: e297. Riba, A., et al. (2017). "Explicit Modeling of siRNA-Dependent On- and Off-Target Repression Improves the Interpretation of Screening Results." Cell Syst 4(2): 182-193 e184. Urbanek-Trzeciak, M. O., et al. (2018). "miRNAmotif-A Tool for the Prediction of Pre- miRNA(-)Protein Interactions." Int J Mol Sci 19(12). Urbanek-Trzeciak, M. O., et al. (2018). "Supplementary Information miRNAmotif-A Tool for the Prediction of Pre-miRNA(-)Protein Interactions." Int J Mol Sci. Watanabe, C., et al. (2016). "S1-Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi." RNA Biol. Watanabe, C., et al. (2016). "Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi." RNA Biol 13(1): 25-33. Watanabe, C., et al. (2016). "S2-Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi." RNA Biol. Watanabe, C., et al. (2016). "S3-Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi." RNA Biol. Zhang, X., et al. (2016). "Cell-free 3D scaffold with two-stage delivery of miRNA-26a to regenerate critical-sized bone defects." Nat Commun 7: 10376.