CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority from U.S. provisional application No. 63/378,473, filed October 5, 2022 the contents of which are incorporated by reference in their entirety.

SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE

[0002] The content of the electronic sequence listing (792752001540seqlist.xml;

Size: 1,083,815 bytes; and Date of Creation: October 4, 2023) is herein incorporated by reference in its entirety.

FIELD

[0003] The present disclosure relates in some aspects to compositions and methods of using antisense oligonucleotides targeting the UNC13A cryptic exon locus for increasing UNC13A protein expression.

BACKGROUND

[0004] The hallmark pathological feature of neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) is the depletion of RNA-binding protein TDP-43 from the nucleus of neurons in the brain and spinal cord. TDP-43, encoded by TARDBP, is an abundant, ubiquitously expressed RNA-binding protein that normally localizes to the nucleus. It plays a role in fundamental RNA processing activities including RNA transcription, alternative splicing, and RNA transport (1). TDP-43 can bind to thousands of premessenger RNA/mRNA targets (2, 3). Reduction in TDP-43 from an otherwise normal adult nervous system alters the splicing or expression levels of more than 1,500 RNAs, including long intron-containing transcripts (2). A major splicing regulatory function of TDP-43 is to repress the inclusion of cryptic exons during splicing (4-7). Unlike normal conserved exons, these cryptic exons are lurking in introns and normally excluded from mature mRNAs. When TDP-43 is depleted from cells, these cryptic exons get spliced into messenger RNAs, often introducing frame shifts and premature termination or even nonsense-mediated decay of the mRNA. However, cryptic splicing events that are key for disease remains to be identified. Thus, the discovery of cryptic splicing targets that are regulated by TDP-43 and also play a role in the pathogenesis of TDP-43 proteinopathies as therapeutic targets is needed. Provided herein are methods and compositions that address such and other needs.

BRIEF SUMMARY

[0005] Provided herein are antisense oligonucleotides (ASO) that modulate UNC13A splicing, wherein the ASO sequence is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene. The ASOs provided herein are between 13 to 30 nucleotides in length. Also provided are modified ASOs comprising one or more modified nucleotide, for example, a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. Also provided herein are methods of using the described ASOs. In some aspects, provided herein is a method for increasing the expression of full-length UNC13A protein in a cell by at least 10%. In other aspects, provided herein is a method of treating clinical disease, for example amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual. Also provided herein are pharmaceutical compositions and kits comprising one or more of the ASOs described herein.

[0006] Provided herein is a method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1.

[0007] Provided herein is a method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. Also provided herein is a method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NO: 20-355, 400-638, 810-957, or 961-1332. [0008] In some embodiments, the antisense oligonucleotide consists of 13 to 25 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide consists of 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: l.In some embodiments, the antisense oligonucleotide consists of 19, 20, 21, or 22 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.

[0009] In some embodiments, the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173. In some embodiments, the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935. In some embodiments, the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199. In some embodiments, the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224. In some embodiments, the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247. In some embodiments, the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270. In some embodiments, the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271- 1292. In some embodiments, antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945. In some embodiments, the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332. In some embodiments, the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.

[0010] In some embodiments, the antisense oligonucleotide of the method provided herein is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementary to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementary to the sequence set forth in SEQ ID NO:703.

[0011] In some embodiments, the antisense oligonucleotide of the method provided herein is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.

[0012] In some embodiments, prior to contacting the cell with the antisense oligonucleotide, the cell expresses a low level of UNC13A. In some embodiments, comprising measuring the level of UNC13A protein in the cell. In some embodiments, UNC13A protein level is measured by western blot, imaging, ELISA, a fluorescent reporter assay, luminescence assay, or immunohistochemistry.

[0013] In some embodiments, the secondary structure of an UNC13A mRNA is altered by binding of the antisense oligonucleotide to an UNC13A transcript. In some embodiments, the antisense oligonucleotide sterically blocks inclusion of an UNC13A cryptic exon. In some embodiments, the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO: 1.

[0014] In some embodiments, the antisense oligonucleotide of the method provided herein restores the expression of UNC13A mRNA in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.

[0015] In some embodiments, the antisense oligonucleotide of the method provided herein reduces expression of an UNC13A cryptic exon splice variant mRNA by at least 10%. In some embodiments, the antisense oligonucleotide reduces the expression of UNC13A cryptic exon mRNA by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A cryptic exon mRNA expressed in a cell treated with shRNA, miRNA, antisense oligonucleotide targeting TARDBP. In some embodiments, the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313.

[0016] In some embodiments, the UNC13A cryptic exon splice variant comprises the sequence set forth in SEQ ID NO:7 or SEQ ID NO:9.

[0017] In some embodiments, following contacting the cell with the antisense oligonucleotide, the ratio of an UNC13A transcript not comprising the cryptic exon splice variant to an UNC13A transcript comprising the cryptic exon splice variant is at least 10:1. In some embodiments, the presence and/or amount of the cryptic exon splice variant is measured using qPCR.

[0018] In some embodiments, the cell is a neuron. In some embodiments, the neuron is a motor neuron, a cortical neuron, an interneuron, or an excitatory neuron.

[0019] In some embodiments, contacting the cell with the antisense oligonucleotide of the methods provide herein increases the expression of UNC13A protein to a level sufficient to improve one or more neuronal functions. In some embodiments, the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.

[0020] In some embodiments, the antisense oligonucleotide of the methods provided herein restores the expression of UNC13A protein in a cell to at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A protein in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.

[0021] In some embodiments, the antisense oligonucleotide of the methods provided herein increases the expression of UNC13A mRNA in a cell by at least 50%, decreases the expression of UNC13A cryptic exon mRNA in the cell by at least 25%, and increases the expression of UNC13A protein in the cell by at least 50%.In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.

[0022] In some embodiments, the cell of the methods provided herein is heterozygous or homozygous for a risk allele. In some embodiments, the risk allele is selected from the group consisting of rs12608932 (hg38 chr19:17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C→A ), or any combination thereof. In some embodiments, the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).

[0023] In some embodiments, the antisense oligonucleotide is provided to the cell by transfection. In some embodiments, the cell expresses a low level of TDP-43 protein. In some embodiments, the cell is a human cell or a murine cell.

[0024] In some embodiments, the antisense oligonucleotide of the methods provided herein does not cause any cell morphology changes. In some embodiments, the antisense oligonucleotide does not cause neuronal toxicity. In some embodiments, the antisense oligonucleotide does not bind to a genomic sequence other than the sequence set forth in SEQ ID NO:1.

[0025] Also provided herein is a method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide comprising 13 to 30 nucleotides to the individual, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1, and wherein the individual is homozygous for a reference allele, homozygous for a risk allele, heterozygous for a risk allele or comprises a mutation associated with ALS or FTD. In some embodiments, the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 A), or any combination thereof. In some embodiments, the mutation associated with ALS or FTD is a mutation in TDP43.

[0026] In some embodiments, the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a locked nucleic acid (LNA) antisense oligonucleotide.

[0027] Also provided herein is an antisense oligonucleotide that modulates UNC13A splicing, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene. Also provided herein is an antisense oligonucleotide that modulates UNC13A splicing comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide comprises a sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0028] In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in any one of SEQ ID NOs: 700- 703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.

[0029] In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.

[0030] Also provided herein is an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of 13-30 nucleotides. In some embodiments, the antisense oligonucleotide consists of 13-25 nucleotides. In some embodiments, the antisense oligonucleotide consists of 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the antisense oligonucleotide consists of 19, 20, 21, or 22 nucleotides. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.

[0031] Also provided herein is an antisense oligonucleotide consisting of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. Also provided herein is an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. [0032] In some embodiments, the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173. In some embodiments, the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935. In some embodiments, the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199. In some embodiments, the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224. In some embodiments, the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247. In some embodiments, the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270. In some embodiments, the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271- 1292. In some embodiments, the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945. In some embodiments, the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332.In some embodiments, the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.

[0033] In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.

[0034] In some embodiments, the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.

[0035] In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification. In some embodiments, 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification, wherein 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide. In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide. In some embodiments, the modification is a 2’OMe antisense oligonucleotide.

[0036] Also provided herein is a pharmaceutical composition comprising the antisense oligonucleotide of any one of embodiments disclosed herein. In some embodiments, the pharmaceutical composition comprises an excipient and/or a buffer.

[0037] Also provided herein is a kit comprising the antisense oligonucleotide of some embodiments disclosed herein or the pharmaceutical composition some embodiments disclosed herein.

[0038] All publications, comprising patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0039] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The drawings illustrate certain features and advantages of this disclosure. These embodiments are not intended to limit the scope of the appended claims in any manner.

[0041] FIG. 1A and FIG. IB show the percent UNC13A mRNA upon treatment with ASO compared to treatment with a control ASO that does not affect UNC13A mRNA in TDP-43 knockdown iPSC-derived motor neurons. UNC13A mRNA was detected using qPCR. Location of the ASO target is plotted in 5’ to 3’

[0042] FIG. 2A and FIG. 2B show the percent UNC13A mRNA comprising a cryptic exon (CE) upon treatment with ASO compared to treatment with a control ASO that does not affect UNC13A CE mRNA in TDP-43 knockdown iPSC-derived motor neurons. UNC13A CE mRNA was detected using qPCR. Location of the ASO target is plotted in 5’ to 3’

[0043] FIG. 3A and FIG. 3B show the percent UNC13A mRNA, percent UNC13A mRNA comprising a cryptic exon (CE), and the expression of a control transcript STMN2 which is not targeted by the ASO in TDP-43 knockdown iPSC-derived motor neurons. Location of the ASO target is plotted in 5’ to 3’

[0044] FIG. 4 shows the percent UNC13A cryptic exon transcript and the percent UNC13A full length transcript for each of the ASOs tested in TDP-43 knockdown iPSC-derived motor neurons. ASO which both reduced UNC13A CE and increased UNC13A full length transcript are shown as squares.

[0045] FIG. 5A and FIG. 5B are maps of the UNC13A cryptic exon showing the location of active oligos shown in dark grey and inert oligos in light grey. FIG. 5B shows the four identified modulatory regions.

[0046] FIG. 6A and FIG. 6B show the effect of ASOs on UNC13A expression in TDP43 knockdown iPSC-derived motor neurons. NT, non-targeting ASO; ASO 434, inert ASO; +NT, non-targeting shRNA; +shTDP43, shRNA to TARDBP. FIG. 6C shows the effect of ASOs on TARDBP expression in iPSC derived motor neurons treated with shRNA to TDP-43 compared to control cells treated with inactive ASO. FIG. 6D shows the effect of ASOs on STMN2 expression iPSC derived motor neurons treated with shRNA to TDP-43 compared to control cells treated with inactive ASO. NT, non-targeting ASO; ASO 434, inert ASO; +NT, non-targeting shRNA; +shTDP43, shRNA to TARDBP.

[0047] FIG. 7A shows the effect of ASO 422 on percent UNC13A mRNA expression in iPSC derived motor neurons with TDP-43 knock down in extended culture compared to no ASO or a control ASO that does not target UNC13A. FIG. 7B shows the effect of ASO 422 on UNC13A cryptic exon (CE) in iPSC derived motor neurons with TDP-43 knock down in extended culture compared to no ASO or a control ASO that does not target UNC13A. FIG. 7C shows the effect of ASO 422 on TARDBP expression in iPSC derived motor neurons with TDP-43 knock down in extended culture compared to no ASO or a control ASO that does not target UNC13A.

[0048] FIG. 8A shows a western blot of UNC13 protein levels in iPSC derived motor neurons with TDP-43 knock down treated with ASOs or a control ASO (432) that does not target UNC13A. FIG. 8B shows the quantitation of UNC13A protein levels determined by western blot. [0049] FIG. 9A and FIG. 9B show the percent UNC13A mRNA expression after treatment with varying doses of ASO (0.024-3 pM) compared with a control ASO that does not affect UNC13A mRNA expression. FIG. 9C and FIG. 9D show the percent of UNC13A mRNA comprising a cryptic exon (CE) after treatment with varying doses of ASO (0.024-3 pM) compared with a control ASO that does not affect UNC13A mRNA expression. FIG. 9E and FIG. 9F show TARDBP and STMN2 expression levels after treatment with varying doses of ASO. Cells were transduced with shRNA against TARDBP or control after ASO delivery. UNC13A, UNC13A CE, STMN2, and TARDBP mRNA expression levels were detected using qPCR. ASO 432, inert ASO; +NT, non-targeting shRNA; +shTDP43, shRNA to TARDBP.

[0050] FIG. 10A shows the percent UNC13A protein expression for individual ASO treatments at varying concentrations (0.024-3 pM) in iPSC derived motor neurons with TDP-43 knock down. FIG. 10B shows the percent UNC13A protein expression for all the ASO treatment conditions. FIG. 10C shows the rank order of HiBiT signal (UNC13A protein expression) for 3 pM ASO treated neurons. FIG. 10D shows the percent of UNC13A mRNA and UNC13A protein expression for each control and UNC13A splice correcting ASO tested.

[0051] FIG. 11A shows the percent UNC13A mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in iPSC derived motor neurons with TDP-43 knockdown. FIG. 11B shows the percent UNC13A protein expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression. FIG. 11C shows the percent of UNC13A mRNA and UNC13A protein expression for each control and UNC13A splice correcting ASO tested. Cells were transduced with shRNA against TARDBP or control after ASO delivery. UNC13A, UNC13A CE, STMN2, and TARDBP mRNA expression levels were detected using qPCR. ASO 432, inert ASO; +NT, non-targeting shRNA; +shTDP43, shRNA to TARDBP.

[0052] FIG. 12A and FIG. 12B show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in GM25256 (GM) iPSC-derived motor neurons. Cells were transduced with shRNA against TARDBP or control after ASO delivery. [0053] FIG. 13A and FIG. 13B show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in NCRM-5 (005) iPSC-derived motor neurons. Cells were transduced with shRNA against TARDBP or control after ASO delivery.

[0054] FIG. 14A and FIG. 14B show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in NDS00209 (4048) iPSC-derived motor neurons. Cells were transduced with shRNA against TARDBP or control after ASO delivery.

[0055] FIG. 15A and FIG. 15B show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in NDS00235 (4157) iPSC-derived motor neurons. Cells were transduced with shRNA against TARDBP or control after ASO delivery.

[0056] FIG. 16A and FIG. 16B show the cumulative UNC13A and UNC13A CE mRNA expression data from the four iPSC lines (GM, 005, 4048, and 4157). The percent UNC13A and UNC13A CE mRNA expression after treatment with UNC13A splice blocking ASOs (0.024 pM or 3 μM) was plotted. Cells were transduced with shRNA against TARDBP or control after ASO delivery.

[0057] FIGS. 17A-17H show the percent UNC13A mRNA expression (FIG. 17A and FIG. 17B), UNC13A CE mRNA expression (FIG. 17C and FIG. 17D), TARDBP mRNA expression (FIG. 17E and FIG. 17G), and STMN2 mRNA expression (FIG. 17F and FIG. 17H) after extended culturing and multiple doses of UNC13A splice correcting ASOs or a control nontargeting ASO (432) in GM and 005 iPSC-derived motor neurons. GM and 005 cells were treated with gapmer ASOs against TARDBP or a non-targeting control gapmer prior to UNC13A splice correcting ASO dosing.

[0058] FIG. 18A shows the percent nuclear area of neurons treated with UNC13A splice blocking ASOs. FIG. 18B shows neuronal images after control or ASO treatment.

[0059] FIGS. 19A-19R show the percent UNC13A and UNC13A CE mRNA expression after treatment with ASOs (3 pM) of different lengths targeting region 2 of UNC13A CE. FIG. 19A (13mer), FIG. 19C (15mer), FIG. 19E (17mer), FIG. 19G (18mer), FIG. 191 (19mer), FIG. 19K (20mer), FIG. 19M (21mer), FIG. 190 (22mer), and FIG. 19Q (24mer) show percent of UNC13A mRNA expression. FIG. 19B (13mer), FIG. 19D (15mer), FIG. 19F (17mer), FIG. 19H (18mer), FIG. 19J (19mer), FIG. 19L (20mer), FIG. 19N (21mer), FIG. 19P (22mer), and FIG. 19R (24mer) show percent UNC13A CE mRNA expression. iPSC- derived motor neurons were transduced with shRNA against TARDBP or control after ASO delivery.

[0060] FIGS. 20A-20R show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASOs (3 pM) of different lengths targeting region 4 of UNC13A CE. FIG. 20A (13mer), FIG. 20C (15mer), FIG. 20E (17mer), FIG. 20G (18mer), FIG. 201 (19mer), FIG. 20K (20mer), FIG. 20M (21mer), FIG. 200 (22mer), and FIG. 20Q (24mer) show percent of UNC13A mRNA expression. FIG. 20B (13mer), FIG. 20D (15mer), FIG. 20F (17mer), FIG. 20H (18mer), FIG. 20J (19mer), FIG. 20L (20mer), FIG. 20N (21mer), FIG. 20P (22mer), and FIG. 20R (24mer) show percent of UNC13A CE mRNA expression. iPSC- derived motor neurons were transduced with shRNA against TARDBP or control after ASO delivery.

[0061] FIG. 21A shows the average percentage of UNC13A mRNA expression from all cells treated with child ASOs of the indicated length contained within the sequences on the left. Darker shading indicates higher UNC13A mRNA expression. FIG. 21B shows the average difference in percent UNC13A mRNA expression between cells treated with the parent 24-mer ASO indicated on the left and all cells treated with a child ASO of the indicated length contained within the parent sequence. Lighter shading indicates an increase in UNC13A mRNA expression for child ASOs of that length compared to the parent 24-mer, while darker shading indicates a decrease in UNC13A mRNA expression for child ASOs of that length compared to the parent 24- mer. Cells were transduced with shRNA against TARDBP or control after ASO delivery.

[0062] FIGS. 22A-22B show the effect on UNC13A mRNA expression of ASOs ranging from 13 nucleotide (13-mer) to 24 nucleotide (24-mer) that tile Region 2 (FIG. 22A) and Region 4 (FIG. 22B) in cells transduced with shRNA against TARDBP after ASO delivery. The top portion of the panel plots the average percentage of UNC13A expression for all ASOs overlapping each nucleotide indicated, grouped by ASO length. DETAILED DESCRIPTION

[0063] TDP-43 depletion is associated with a number of neuronal pathologies including ALS and FTD. Depletion of TDP-43 results in incorrect splicing of UNC13A mRNA and inclusion of a cryptic exon between exon 20-21. Inclusion of the UNC13A cryptic exon results in decreased UNC13A protein and is associated with such neuronal pathologies. Provided herein are antisense oligonucleotides that target UNCI 3 mRNA that reduce inclusion of the UNC13A cryptic exon by targeting four regions of the UNC13A mRNA transcript: the 5’ splice donor site, the 3’ splice acceptor site, and two regions located within the cryptic exon itself. The antisense oligonucleotides are able to restore UNC13A expression in neurons and increase the ratio of correctly spliced to incorrectly spliced UNC13A transcript.

Definitions

[0064] Prior to setting forth this disclosure in more detail, it may be helpful to an understanding thereof to provide definitions of certain terms used herein. Additional definitions are set forth throughout this disclosure.

[0065] In the present description, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer) or subranges, unless otherwise indicated. Description of a range includes description of each endpoint of the range.

[0066] As used herein, the term "about" means ± 20% of the indicated range, value, or structure, unless otherwise indicated.

[0067] It should be understood that the terms "a" and "an" as used herein refer to "one or more" of the enumerated components. The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives.

[0068] As used herein, the terms "include," "have," and "comprise" are used synonymously, which terms and variants thereof are intended to be construed as non limiting.

[0069] "Optional" or "optionally" means that the subsequently described element, component, event, or circumstance may or may not occur, and that the description includes instances in which the element, component, event, or circumstance occurs and instances in which they do not.

[0070] As used herein, "nucleic acid" or "nucleic acid molecule" or "polynucleotide" refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotide, molecules generated, for example, by the polymerase chain reaction (PCR) or by in vitro translation, and molecules generated by any of ligation, scission, endonuclease action, exonuclease action or mechanical action (e.g., shearing). Nucleic acids may be composed of a plurality of monomers that are naturally occurring nucleotides (such as deoxy ribonucleotides and ribonucleotides), analogs of naturally occurring nucleotides (e.g., a-enantiomeric forms of naturally-occurring nucleotides), or a combination of both. Modified nucleotides can have modifications in or replacement of sugar moieties, or pyrimidine or purine base moieties (e.g., morpholino nucleotides). Nucleic acid monomers of the polynucleotides can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, or the like. Nucleic acid molecules can be either single stranded or double stranded.

[0071] As used herein, “protein” or “polypeptide” as used herein refers to a compound made up of amino acid residues that are covalently linked by peptide bonds. The term “protein” may be synonymous with the term “polypeptide” or may refer, in addition, to a complex of two or more polypeptides. In certain embodiments, a polypeptide may be a fragment. As used herein, a “fragment” means a polypeptide that is lacking one or more amino acids that are found in a reference sequence. A fragment can comprise a binding domain, antigen, or epitope found in a reference sequence. A fragment of a reference 5 polypeptide can have at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of amino acids of the amino acid sequence of the reference sequence.

[0072] The term "isolated" means that a material, complex, compound, or molecule is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the co existing materials in the natural system, is isolated. Such nucleic acid could be part of a vector and/or such nucleic acid or polypeptide could be part of a composition (e.g., a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide. The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer" as well as intervening sequences (introns), if present, between individual coding segments (exons).

[0073] As used herein, the term "recombinant" or "genetically engineered" refers to a cell, microorganism, nucleic acid molecule, polypeptide or vector that has been genetically modified by human intervention. For example, a recombinant polynucleotide is modified by human or machine introduction of an exogenous or heterologous nucleic acid molecule, or refers to a cell or microorganism that has been altered by human or machine intervention such that expression of an endogenous nucleic acid molecule or gene is controlled, deregulated or constitutive. Human generated genetic alterations may include, for example, modifications that introduce nucleic acid molecules (which may include an expression control element, such as a promoter) that encode one or more proteins or enzymes, or other nucleic acid molecule additions, deletions, substitutions, or other functional disruption of or addition to a cell's genetic material or encoded products. Exemplary human or machine introduced modifications include those in coding regions or functional fragments thereof of heterologous or homologous polypeptides from a reference or parent molecule.

[0074] A “wild-type” gene or gene product is that which is most frequently observed in a population and is thus arbitrarily designed the “normal” or “reference” or “wildtype” form of the gene.

[0075] As used herein, "mutation" refers to a change in the sequence of a nucleic acid molecule or polypeptide molecule as compared to a reference or wild-type nucleic acid molecule or polypeptide molecule, respectively. A mutation can result in several different types of change in sequence, including substitution, insertion or deletion of nucleotide(s) or amino acid(s).

[0076] A "conservative substitution" refers to amino acid substitutions that do not significantly affect or alter binding characteristics of a particular protein. Generally, conservative substitutions are ones in which a substituted amino acid residue is replaced with an amino acid residue having a similar side chain. Conservative substitutions include a substitution found in one of the following groups: Group 1 : Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic acid (Asp or D), Glutamic acid (Glu or Z); Group 3: Asparagine (Asn or N), Glutamine (Gin or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (He or I), Leucine (Leu or L), Methionine (Met or M), Valine (Vai or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y), Tryptophan (Trp or W). Additionally or alternatively, amino acids can be grouped into conservative substitution groups by similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur-containing). For example, an aliphatic grouping may include, for purposes of substitution, Gly, Ala, Vai, Leu, and He. Other conservative substitutions groups include: sulfur- containing: Met and Cysteine (Cys or C); acidic: Asp, Glu, Asn, and Gin; small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gin; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, He, Vai, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Additional information can be found in Creighton (1984) Proteins, W.H. Freeman and Company.

[0077] The term "expression", as used herein, refers to the process by which a polypeptide is produced based on the encoding sequence of a nucleic acid molecule, such as a gene. The process may include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post-translational modification, or any combination thereof.

[0078] "Sequence identity," as used herein, refers to the percentage of nucleotides (amino acid residues) in one sequence that are identical with the nucleotides (amino acid residues) in another reference polynucleotide (polypeptide) sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The percentage sequence identity values can be generated using the NCBI BLAST2.0 software as defined by Altschul et al. (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402, with the parameters set to default values. [0079] As used herein, “UNC13A” refers to a presynaptic protein found in central and neuromuscular synapses that regulates the release of neurotransmitters, peptides, and hormones. UNC13A reference or wild type mRNA transcript contains 44 exons encoding a 1,703 amino acid protein. In embodiments, NCBI Reference Sequence: NP_001073890.2 (SEQ ID NO: 11) is an example of a wild type or reference UNC13A protein. In embodiments, NCBI Reference Sequence NM_001080421.3 (SEQ ID NO:1) is an example of a wild-type or reference UNC13A mRNA transcript. In embodiments, UNC13A includes all forms of UNC13A including wild type, splice isoforms, variants, mutants, native conformation, misfolded, and post- translationally modified. In embodiments, UNC13A does not include UNC13A cryptic exon splice variant.

[0080] As used herein, the term “pre-processed mRNA” or “pre-mRNA” or “precursor mRNA” refers to a primary transcript synthesized from transcription of a DNA template and that has not undergone processing, e.g., splicing, addition of 5’ cap, and addition of a 3’ poly A tail, in order to become a mature mRNA. The mature mRNA is capable of being translated into protein by the ribosome.

[0081] As used herein, the term “cryptic exon” or “pseudoexon” refers to an exon that is absent or not detectably used in wild-type pre-mRNA but are selected in a variant isoform, Cryptic exons may arise as a result of mutations that create new splice sites or remove the existing binding sites for splicing repressors. Cryptic exons can also emerge from transposable elements (e.g., Alu elements).

[0082] As used herein, “UNC13A cryptic exon splice variant” refers to a mRNA, or protein encoded by said mRNA, that comprises a cryptic exon between exon 20 and exon 21. The cryptic exon is obtained from intron 20-21 of the UNC13A gene. In embodiments, the cryptic exon has the nucleotide sequence of SEQ ID NO:5 or SEQ ID NO:6. In embodiments, the UNC13A cryptic exon splice variant may have the nucleotide sequence of SEQ ID NO:7, encoding a protein sequence of SEQ ID NO:8, or the nucleotide sequence of SEQ ID NO:9, encoding a protein sequence of SEQ ID NO: 10.

[0083] As used herein, “transactivation response element DNA-binding protein 43” or “TAR-DNA binding protein-43” or “TDP-43” refers to a protein of typically 414 amino acid residues encoded by TARDBP, as well as the mRNA transcript for TARDBP. In certain instances mRNA encoded by the TARDBP gene is referred to herein as TDP-43. In embodiments, wild type TDP-43 amino acid sequence is provided by Uniprot Accession number Q13148 (SEQ ID NO:378). In embodiments, TDP-43 includes all forms of TDP-43 including wild type, splice isoforms, variants, mutants, native conformation, misfolded, and post- translationally modified (e.g., ubiquitinated, phosphorylated, acetylated, sumoylated, or cleaved into C-terminal fragments) proteins.

[0084] As used herein, the “TAR-DNA binding protein-43 proteinopathy” or “TDP-43 proteinopathy” refers to a neurodegenerative disease that is characterized by the deposition of TDP-43 positive protein inclusions in the brain and/or spinal cord of subjects. Cytoplasmic inclusions of hyperphosphorylated, ubiquitinated, cleaved form of TDP-43 are a pathological feature of diseases including but not limited to amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial onset sensory and motor neuronopathy (FOSMN), hippocampal sclerosis (HS), limbic-predominant age-related TDP-43 encephalopathy (LATE), cerebral age-related TDP-43 with sclerosis (CARTS), Guam Parkinson-dementia complex (G-PDC), Guan ALS (G- ALS), Multisystem proteinopathy (MSP), Perry disease, Alzheimer's disease (AD), and chronic traumatic encephalopathy (CTE).

[0085] The terms “complementary” and “complementarity” refer to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence “A-G-T,” is complementary to the sequence “T-C-A.” Complementarity may be “partial,” in which only some of the nucleic acids’ bases are matched according to the base pairing rules, or there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. While perfect complementarity is often desired, some embodiments can include one or more but preferably 6, 5, 4, 3, 2, or 1 mismatches with respect to the target nucleic acid (e.g., RNA). Variations at any location within the oligomer are included. In certain embodiments, variations in sequence near the termini of an oligomer are generally preferable to variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 nucleotides of the 5’ and/or 3’ terminus. [0086] The terms “antisense oligomer” or “antisense compound” or “antisense oligonucleotide” or “oligonucleotide” are used interchangeably and refer to a short, singlestranded polynucleotide (e.g., 10-50 subunits) made up of DNA, RNA or both, that hybridizes to a target sequence in a nucleic acid (typically an RNA) by Watson-Crick base pairing, to form a nucleic acid: oligomer heteroduplex within the target sequence. An antisense oligonucleotide may comprise unmodified nucleotides or may contain modified nucleotides, non natural nucleotides, or analog nucleotides, such as morpholino, phosphorothioate, peptide nucleic acid, LNA, 2'-O-Me RNA, 2'F-RNA, 2'-O-MOE-RNA, 2'F-ANA, or any combination thereof.

[0087] Such an antisense oligomer can be designed to block or inhibit translation of mRNA or to inhibit natural pre-mRNA splice processing, or induce degradation of targeted mRNAs, and may be said to be “directed to” or “targeted against” a target sequence with which it hybridizes. In embodiments, the target sequence is a region surrounding or including an AUG start codon of an mRNA, a 3’ or 5’ splice site of a pre processed mRNA, or a branch point. The target sequence may be within an exon or within an intron or a combination thereof. The target sequence for a splice site may include an mRNA sequence having its 5’ end at 1 to about 25 base pairs downstream of a normal splice acceptor junction in a preprocessed mRNA. An exemplary target sequence for a splice site is any region of a preprocessed mRNA that includes a splice site or is contained entirely within an exon coding sequence or spans a splice acceptor or donor site. An oligomer is more generally said to be “targeted against” a biologically relevant target such as, in the present disclosure, a human UNC13A gene pre-mRNA encoding the UNC13A protein, when it is targeted against the nucleic acid of the target in the manner described above. Exemplary targeting sequences include those listed in Tables 2-5.

[0088] The term “oligonucleotide analog” refers to an oligonucleotide having (i) a modified backbone structure, e.g., a backbone other than the standard phosphodiester linkage found in natural oligo- and polynucleotides, and (ii) optionally, modified sugar moieties, e.g., morpholino moieties rather than ribose or deoxyribose moieties. Oligonucleotide analogs support bases capable of hydrogen bonding by Watson-Crick base pairing to standard polynucleotide bases, where the analog backbone presents the bases in a manner to permit such hydrogen bonding in a sequence-specific fashion between the oligonucleotide analog molecule and bases in a standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA).

Exemplary analogs are those having a substantially uncharged, phosphorus containing backbone.

[0089] As used herein, a "modified nucleotide " is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, an antisense oligonucleotide (ASO) contains one or more modified nucleotides. In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the nucleotides are modified. Modified nucleotides include, but are not limited to, deoxynucleotides, nucleotide mimics, abasic nucleotides (represented herein as x or ab), 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides (represented herein as invdn, invn, invn, invx), nonnatural basecomprising nucleotides, bridged nucleotides, peptide nucleic acids, 2', 3 'seco nucleotide mimics (unlocked nucleobase analogues, represented herein as nuna or nuna), locked nucleotides (represented herein as nlna or nlna), 3'-o-methoxy (2' intemucleotide linked) nucleotides (represented herein as 3'-omen), 2'-f-arabino nucleotides (represented herein as nfana or nfana), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdn), and vinyl phosphonate nucleotides (represented herein as vpn). 2'-modified nucleotides (i.e. A nucleotide with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'omethyl nucleotides (represented herein as a lower case letter 'n ¹ in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented herein as nf, also represented herein as 2'-fluoro nucleotide), 2'-deoxy nucleotides (represented herein as dn), 2'-methoxyethyl (2'-o-2-methoxylethyl) nucleotides (represented herein as nm or 2'-moe), 2'- amino nucleotides, and 2'-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification may be incorporated in a single aso or even in a single nucleotide thereof. The aso may be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification of another nucleotide.

[0090] A “subunit” of an oligonucleotide refers to one nucleotide (or nucleotide analog) unit comprising a purine or pyrimidine base pairing moiety. The term may refer to the nucleotide unit with or without the attached intersubunit linkage, although, when referring to a “charged subunit”, the charge typically resides within the intersubunit linkage (e.g., a phosphate or phosphorothioate linkage or a cationic linkage). [0091] The purine or pyrimidine base pairing moiety, also referred to herein simply as a “nucleobases,” “base,” or “bases,” may be adenine, cytosine, guanine, uracil, thymine or inosine. Also included are bases such as pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimell5thoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5 -methylcytidine), 5 -alkyluridines (e.g., ribothymidine), 5- halouridine (e.g., 5 -bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6- methyluridine), propyne, quesosine, 2-thiouridine, 4-thiouridine, wybutosine, wybutoxosine, 4- acetyltidine, 5-(carboxyhydroxymethyl)uridine, 5'-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluridine, P-D-galactosylqueosine, 1 -methyladenosine, 1- methylinosine, 2,2-dimethylguanosine, 3 -methylcytidine, 2-methyladenosine, 2- methylguanosine, N6-methyladenosine, 7-methylguanosine, 5 -methoxy aminomethy 1-2- thiouridine, 5 -methylaminomethyluridine, 5-methylcarbonyhnethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine, P-D-mannosylqueosine, uridine- 5-oxy acetic acid, 2-thiocytidine, threonine derivatives and others (Burgin et al., 1996, Biochemistry, 35:14090; Uhlman & Peyman, supra). By “modified bases” in this aspect is meant nucleotide bases other than adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), as illustrated above; such bases can be used at any position in the antisense molecule. Persons skilled in the art will appreciate that depending on the uses of the oligomers, Ts and Us are interchangeable. For instance, with other antisense chemistries such as 2’-O-methyl antisense oligonucleotides that are more RNA-like, the T bases may be shown as U.

[0092] The term “targeting sequence” is the sequence in the oligomer or oligomer analog that is complementary (meaning, in addition, substantially complementary) to the “target sequence” in the RNA genome. The entire sequence, or only a portion, of the antisense oligomer may be complementary to the target sequence. For example, in an oligomer having 20-30 bases, about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 may be targeting sequences that are complementary to the target region. Typically, the targeting sequence is formed of contiguous bases in the oligomer, but may alternatively be formed of noncontiguous sequences that when placed together, e.g., from opposite ends of the oligomer, constitute sequence that spans the target sequence. [0093] A “targeting sequence” may have “near” or “substantial” complementarity to the target sequence and still function for the purpose of the present disclosure, that is, still be “complementary.” Preferably, the oligomer analog compounds employed in the present disclosure have at most one mismatch with the target sequence out of 10 nucleotides, and preferably at most one mismatch out of 20. Alternatively, the antisense oligomers employed have at least 90% sequence identity, and preferably at least 95% sequence identity, with the exemplary targeting sequences as designated herein.

[0094] An “amino acid subunit” or “amino acid residue” can refer to an a-amino acid residue ( CO CHR-NH-) or a [β- or other amino acid residue (e.g., -CO-(CH2)nCHR-NH-), where R is a side chain (which may include hydrogen) and n is 1 to 7, preferably 1 to 4.

[0095] The term “naturally occurring amino acid” refers to an amino acid present in proteins found in nature, such as the 20 (L)-amino acids utilized during protein biosynthesis as well as others such as 4-hydroxyproline, hydroxy lysine, desmosine, isodesmosine, homocysteine, citrulline and ornithine. The term “non-natural amino acids” refers to those amino acids not present in proteins found in nature, examples include beta-alanine ([3- Ala), 6- aminohexanoic acid (Ahx) and 6 aminopentanoic acid. Additional examples of “non-natural amino acids” include, without limitation, (D)-amino acids, norleucine, norvaline, p- fluorophenylalanine, ethionine and the like, which are known to a person skilled in the art.

[0096] The term “target sequence” refers to a portion of the target RNA against which the oligonucleotide or antisense agent is directed, that is, the sequence to which the oligonucleotide will hybridize by Watson-Crick base pairing of a complementary sequence. In embodiments, the target sequence may be a contiguous region of a pre-mRNA that includes both intron and exon target sequence. In embodiments, the target sequence will consist exclusively of either intron or exon sequences.

[0097] Target and targeting sequences are described as “complementary” to one another when hybridization occurs in an antiparallel configuration. A targeting sequence may have “near” or “substantial” complementarity to the target sequence and still function for the purpose of the present disclosure, that is, it may still be functionally “complementary.” In certain embodiments, an oligonucleotide may have at most one mismatch with the target sequence out of 10 nucleotides, and preferably at most one mismatch out of 20. Alternatively, an oligonucleotide may have at least 90% sequence identity, and preferably at least 95% sequence identity, with the exemplary antisense targeting sequences described herein.

[0098] An oligonucleotide “specifically hybridizes” to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions, with a Tm substantially greater than 45°C, preferably at least 50°C, and typically 60°C-80°C or higher. Such hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide. Again, such hybridization may occur with “near” or “substantial” complementarity of the antisense oligomer to the target sequence, as well as with exact complementarity.

[0099] A “nuclease-resistant” oligomeric molecule (oligomer) refers to one whose backbone is substantially resistant to nuclease cleavage, in non-hybridized or hybridized form; by common extracellular and intracellular nucleases in the body; that is, the oligomer shows little or no nuclease cleavage under normal nuclease conditions in the body to which the oligomer is exposed.

[0100] An “effective amount” or “therapeutically effective amount” refers to an amount of therapeutic agent, such as an UNC13A cryptic splice variant inhibitor, administered to a mammalian subject, either as a single dose or as part of a series of doses, which is effective to produce a desired therapeutic effect. For an antisense oligonucleotide, this effect is typically brought about by inhibiting translation or natural splice-processing of a selected target sequence. An “effective amount,” targeted against UNC13A cryptic exon splice variant mRNA, also relates to an amount effective to modulate expression of UNC13A cryptic exon splice variant protein.

[0101] The term "inhibit" or "inhibitor" refers to an alteration, interference, reduction, down regulation, blocking, suppression, abrogation or degradation, directly or indirectly, in the expression, amount or activity of a target gene, target protein, or signaling pathway relative to (1) a control, endogenous or reference target or pathway, or (2) the absence of a target or pathway, wherein the alteration, interference, reduction, down regulation, blocking, suppression, abrogation or degradation is statistically, biologically, or clinically significant. The term "inhibit" or "inhibitor" includes gene "knock out" and gene "knock down" methods, such as by chromosomal editing. [0102] “Treatment” of an individual or a cell is any type of intervention provided as a means to alter the natural course of a disease or pathology in the individual or cell. Treatment includes, but is not limited to, administration of, e.g., a pharmaceutical composition, and may be performed either prophylactically, or subsequent to the initiation of a pathologic event or contact with an etiologic agent. Treatment includes any desirable effect on the symptoms or pathology of a disease or condition associated with inflammation, among others described herein.

[0103] Also included are “prophylactic” treatments, which can be directed to reducing the rate of progression of the disease or condition being treated, delaying the onset of that disease or condition, or reducing the severity of its onset. “Treatment” or “prophylaxis” does not necessarily indicate complete eradication, cure, or prevention of the disease or condition, or associated symptoms thereof.

I. UNC13A CRYPTIC EXON SPLICE VARIANTS

[0104] In one aspect, the present disclosure provides novel UNC13A targeting oligonucleotides that reduce cryptic splice variants that includes a cryptic exon between exons 20 and 21. These cryptic exons are absent from wild type UNC13A from neuronal nuclei and not present in any of the known isoforms of UNC13A. The cryptic exons are obtained from intron 20-21 of the UNC13A gene (SEQ ID NO:4). Depletion of TDP-43 introduces two alternative 3’ splicing acceptors in intron 20-21, one at chr19:17642591(A'P=0.05184) and the other one is at chr19:17642541(A'P=0.48865). An alternative 5’ splicing donor is also introduced at chr19: 17642414 (A'P=0.772). The chr19: 17642541 3’ splicing acceptor, which is more frequently used than the chr19: 17642591 3’ splicing acceptor, and alternative 5’ splicing donor results in a 128 bp cryptic exon having a nucleotide sequence as set forth in SEQ ID NO:5 (“cryptic exon #1”). The UNC13A cryptic exon #1 variant comprises a nucleotide sequence as set forth in SEQ ID NO:7, encoding a protein comprising an amino acid sequence as set forth in SEQ ID NO:8. The chr19: 17642591 3’ splicing acceptor and alternative 5’ splicing donor results in a 179 bp cryptic exon having a nucleotide sequence as set forth in SEQ ID NO:6 (“cryptic exon #2”). The UNC13A cryptic exon #2 variant comprises a nucleotide sequence as set forth in SEQ ID NO:9, encoding a protein comprising an amino acid sequence as set forth in SEQ ID NO: 10. [0105] UNC13A cryptic exon #1 splice variant expression level is significantly increased in frontal cortexes of frontotemporal lobar degeneration with TDP-43 inclusions (FTLD-TDP) patients compared to normal controls. UNC13A cryptic exon #1 splice variant has also been detected in disease relevant tissues of ALS patients. In embodiments, expression of UNC13A cryptic splice variant #1 or UNC13A cryptic splice variant #2 may be used as a biomarker for identifying a subject with a TDP-43 proteinopathy, e.g., FTLD or ALS.

[0106] Once TDP-43 becomes depleted from the nucleus and accumulates in the cytoplasm, it becomes phosphorylated. Hyperphosphorylated TDP-43 (pTDP-43) is a key feature of pathology of TDP-43 proteinopathies. UNC13A cryptic exon #1 splice variant is strongly associated with phosphorylated TDP-43 levels in FTD/ALS patients. In embodiments, expression of UNC13A cryptic splice variant #1 or UNC13A cryptic splice variant #2 may be used as a biomarker for phosphorylated TDP-43 level in a subject.

[0107] Several genetic mutations in intron 20-21 of UNC13A have been identified as promoting UNC13A cryptic exon inclusion upon TDP-43 depletion. Examples of such genetic mutations include rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 CATC 0-2 repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C→A). Moreover, UNC13A genetic mutations that increase cryptic exon inclusion are associated with decreased survival in FTD- ALS patients. In embodiments, identification of a genetic mutation in intron 20-21 of UNC13A in a subject may be used as a biomarker for UNC13A cryptic exon inclusion. In embodiments, identification of a genetic mutation in intron 20-21 of UNC13A in a subject with a TDP-43 proteinopathy (e.g., FTD, ALS) may be used as a biomarker for decreased survival.

Table 1: UNC13A and TDP-43 sequences II. UNC13A SPLICE BLOCKING ANTISENSE OLIGONUCLEOTIDES

[0108] In some embodiments, provided herein are antisense oligonucleotides that target an UNC13A cryptic exon. In embodiments, the cryptic exon is obtained from intron 20-21 of the UNC13A gene. In embodiments, the cryptic exon comprises SEQ ID NO:5 or SEQ ID NO:6. In embodiments, the UNC13 cryptic exon splice variant comprises a polynucleotide sequence of SEQ ID NO:7 or SEQ ID NO:9. In embodiments, the UNC13A cryptic exon splice variant comprises the amino acid sequence of SEQ ID NO: 8 or SEQ ID NO: 10. In some embodiments the ASOs decrease the level of the UNC13A cryptic exon splice variant.

[0109] In embodiments, the antisense oligonucleotide comprises an inhibitory nucleic acid. The inhibitory nucleic acid may be an antisense oligonucleotide, siRNA, shRNA, miRNA, double-stranded RNA (dsRNAs), or esiRNA. In embodiments, the inhibitory nucleic acid comprises an antisense oligonucleotide that is complementary to: the exon 20 splice donor site region in a preprocessed mRNA encoding UNC13A; the cryptic exon splice acceptor site region in a preprocessed mRNA encoding UNC13A; the cryptic exon splice donor site region in a preprocessed mRNA encoding UNC13A; or the exon 21 splice acceptor site region in a preprocessed mRNA encoding UNC13A. In embodiments, the exon 20 splice donor site region comprises or consists of SEQ ID NO: 800. In embodiments, the cryptic exon splice acceptor site region comprises or consists of SEQ ID NO:801. In embodiments, the cryptic exon splice donor site region comprises or consists of SEQ ID NO:802. In embodiments, the exon 21 splice acceptor site comprises or consists of SEQ ID NO:803.

[0110] In embodiments, the antisense oligonucleotide selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant over full length UNC13A (wild type) or other variants thereof (i. e. , variants that do not contain a cryptic exon from intron 20-21 such as SEQ ID NO:5 or SEQ ID NO:6).

Table 2A: Antisense oligonucleotide sequences

Table 2B: Additional antisense oligonucleotide sequences [0111] The antisense oligonucleotides (ASOs) provided herein are alternatively referred to by the sequence ID number and ASO number provided in Table 2A and Table 2B. The ASO number MTx_ASO_(number) and just the number are used interchangeably. For example, MTx_ASO_280 is alternatively referred to as ASO 280. In some instances, the ASO number refers to a region that is targeted by a respective ASO. For example, MTx_ASO_Region_4_Child_l (SEQ ID NO:961) targets region 4 (SEQ ID NO:703) of the cryptic exon as described herein.

[0112] In some embodiments the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-40. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20-40. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0113] In some embodiments the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355 or SEQ ID NO: 810-957. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20-355 or SEQ ID NO: 810-975. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0114] In some embodiments the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355 or SEQ ID NO: 400-638 or SEQ ID NO: 810-957 . In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20-355 or SEQ ID NO: 400-638 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0115] In some embodiments the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NOs: 20-355, 400-638, 810-959, or 961- 1332. In some embodiments the antisense oligonucleotide is about 13-50 bases in length, for example, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0116] In some embodiments the antisense oligonucleotide is complementary to the 5’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 1 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:700. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20 or SEQ ID NO: 38. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20 or SEQ ID NO: 38 In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the cryptic 5’ donor site splice. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0117] In some embodiments the antisense oligonucleotide is complementary to the 5’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 1 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:700. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 41- 55 or SEQ ID NO: 810-825. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 41- SEQ ID NO: 55 or SEQ ID NO: 810-825. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the cryptic 5’ donor site splice. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0118] In some embodiments the antisense oligonucleotide is complementary to the 5’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 1 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:700. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 311- 325 or SEQ ID NO: 910-929. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to anyone of SEQ ID NO: 311- 325 or SEQ ID NO: 910-929. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the cryptic 5’ donor site splice. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0119] In some embodiments the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 34 -37. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 34-37. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0120] In some embodiments the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 251-265 or SEQ ID NO: 877-890. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 251-265 or SEQ ID NO: 877-890. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0121] In some embodiments the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 266 -280 or SEQ ID NO: 891-894. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 266-280 or SEQ ID NO: 891-894. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon. [0122] In some embodiments the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 281 -295 or SEQ ID NO: 895-899. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 281-295 or SEQ ID NO: 895-899. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0123] In some embodiments the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 296 -310 or SEQ ID NO: 900-909. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 296-310 or SEQ ID NO: 900-909. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0124] In some embodiments the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA or region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701 or 702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 40. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 40. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0125] In some embodiments the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA or region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701 or 702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 341-355 or SEQ ID NO: 934-957. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 341- 355 or SEQ ID NO: 934-957. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0126] In some embodiments the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 1116-1332. In some embodiments the antisense oligonucleotide is about 13-50 bases in length, for example, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 1116-1332. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A mRNA expression. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0127] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 30-33. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 21 - 31, SEQ ID NO: 33, or SEQ ID NO: 39. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0128] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 191-205 or SEQ ID NO: 851-860. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 191- 205 or SEQ ID NO: 851-860. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structures of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon. [0129] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 206-220 or SEQ ID NO: 861-863. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 206- 220 or SEQ ID NO: 861-863. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0130] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 221-234 or SEQ ID NO: 864-866. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 221- 225 or SEQ ID NO: 864-866. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0131] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 236- 250 or SEQ ID NO: 867-876. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 236- 250 or SEQ ID NO: 867-876. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0132] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 21-29, or SEQ ID NO:39. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 21-29 or SEQ ID NO:39. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0133] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 56-70 or SEQ ID NO: 826-834. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 56-70 or SEQ ID NO: 826-834. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0134] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 71-85 or SEQ ID NO: 835-837. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 71-85 or SEQ ID NO: 835-837. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0135] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 86-100. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 86-100. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0136] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO: 703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 101-115. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 101-115. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0137] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 116-130. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 116-130. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0138] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 131-145. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 131-145. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0139] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 56-70. In some embodiments the antisense oligonucleotide is about 146-160 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 146-160. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0140] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 161-175 or SEQ ID NO: 838-840. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 161- 175 or SEQ ID NO: 838-840. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0141] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 176-190 or SEQ ID NO: 841-850. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 176- 190 or SEQ ID NO: 841-850. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0142] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 326-340 or SEQ ID NO: 930-933. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 326- 340 or SEQ ID NO: 930-933. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0143] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NOs: 961-1115. In some embodiments the antisense oligonucleotide is about 13-50 bases in length, for example, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or 100% identical to any one of SEQ ID NOs: 961-1115. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A mRNA expression. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0144] In some embodiments the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 1, 2, 3, or 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to any of SEQ ID NO: 700-703. In some embodiments the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 400-638 . In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 400-638. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon. [0145] In some embodiments, the antisense oligo has least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% complementarity to any one of SEQ ID NO: 5- 10 or SEQ ID NO: 700-703. In some embodiments, In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide. In some embodiments, the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site. The antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II. The antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA. The antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon. In some embodiments, the antisense oligonucleotide increases UNC13A protein expression. In some embodiments, the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.

[0146] In some aspects, provided herein is an antisense oligonucleotide that modulates UNC13A splicing, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.

[0147] In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO: 1.

[0148] In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:700. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:700. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:700. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:701. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:702. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO: 703. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:703.

[0149] In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.

[0150] In some instances, the antisense oligonucleotide is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene, where the sequence of UNC13A is uniquely sensitive to antisense oligonucleotide binding. In some instances, a region of the UNC13A mRNA is identified as being more responsive than other regions. Herein, it is determined that these regions are sensitive to a number of factors, including but not limited to, antisense oligonucleotide length, composition, and positioning on the UNC13A mRNA. Minimal regions of the UNC13A mRNA are specifically targeted to maximize antisense oligonucleotide activity in modulating UNC13A mRNA splicing. In some embodiments, these highly responsive minimal regions of the UNC13A mRNA are referred to as hot spots.

[0151] In some embodiments, a minimal region of the UNC13A mRNA is located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene is identified as highly responsive to binding with an antisense oligonucleotide, or another similar nucleic acid probe. In some embodiments, an ASO that binds to such minimal region is effective for preventing inclusion of the UNC13A cryptic exon. In some embodiments, the minimal region is between 3 to 30, 4 to 26, 5 to 22, 6 to 18, 7 to 14, or 8 to 10 nucleotides in length. In some embodiments, the minimal region is no more than 30, no more than 25, no more than 20, or no more than 15 nucleotides in length. In some embodiments, the minimal region is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the minimal region is 18 nucleotides in length. In some embodiments, the minimal region is 29 nucleotides in length. In some embodiments, the minimal region comprises the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, binding the small region or a portion thereof with an antisense oligonucleotide results in enhanced splice modulation activity. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A protein expression. Table 3: Minimal targeting regions of the UNC13A mRNA

[0152] In some instances, the antisense oligonucleotide comprises 13 to 30 nucleotides, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.

[0153] In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in enhanced UNC13A splice modulation activity. In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in increased UNC13A mRNA expression. In some embodiments, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the expression of UNC13A mRNA is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. [0154] In some embodiments, a wild-type cell is one from an individual who does not have amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD). In some embodiments, a wild-type cell is a cell that expresses a normal level of TDP-43 protein. In some embodiments, a wild-type cell is a cell that does not produce transcripts of UNC13A comprising the cryptic exon.

[0155] In some aspects, provided herein are antisense oligonucleotides comprising the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of between 13 to 30, 15 to 28, 17 to 26, 19 to 24, or 21 to 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13, 15, 17, 18, 19, 20, 21, 22, or 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19, 20, 21, or 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of at least 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, or 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 15 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 17 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 18 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 20 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 21 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 25 nucleotides. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide. [0156] In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises a modification.

[0157] In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises a modification.

[0158] In some embodiments, the antisense oligonucleotide comprises 13 nucleobases that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116- 1145. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0159] In some embodiments, the antisense oligonucleotide comprises 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173. In some embodiments, the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0160] In some embodiments, the antisense oligonucleotide comprises 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935. In some embodiments, the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0161] In some embodiments, the antisense oligonucleotide comprises 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199. In some embodiments, the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0162] In some embodiments, the antisense oligonucleotide comprises 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224. In some embodiments, the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0163] In some embodiments, the antisense oligonucleotide comprises 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247. In some embodiments, the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0164] In some embodiments, the antisense oligonucleotide comprises 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270. In some embodiments, the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0165] In some embodiments, the antisense oligonucleotide comprises 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292. In some embodiments, the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0166] In some embodiments, the antisense oligonucleotide comprises 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0167] In some embodiments, the antisense oligonucleotide comprises 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945. In some embodiments, the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0168] In some embodiments, the antisense oligonucleotide comprises 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332. In some embodiments, the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946- 951, 1104-1115, and 1314-1332. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0169] In some embodiments, the antisense oligonucleotide comprises 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957. In some embodiments, the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

[0170] In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification. In some embodiments, the 5’ end or the 3’ end of the antisense oligonucleotide comprise a modification. In some embodiments, the 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’OMe antisense oligonucleotide.

[0171] In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’OMe antisense oligonucleotide.

[0172] In some embodiments, the antisense oligonucleotide comprises a modification, and at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification. In some embodiments, between 30% and 100%, 40% and 90%, 50% and 80%, or 60% and 70% of the nucleotides comprise a modification. In some embodiments, about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the nucleotides comprise a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’OMe antisense oligonucleotide.

[0173] In some embodiments, the antisense oligonucleotide contains one or more modified nucleotide, for example, a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide) including, but not limited to deoxynucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides, non-natural basecomprising nucleotides, bridged nucleotides, peptide nucleic acids, 2', 3 '-¬seco nucleotide mimics, locked nucleotides, 3'-O-Methoxy nucleotides, 2'-F-Arabino nucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, and vinyl phosphonate nucleotides, 2'-'O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides, and 2'-alkyl nucleotides.

[0174] In embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide. In embodiments, the modified antisense oligonucleotide comprises a phosphoramidate morpholino oligonucleotide, phosphorodiamidate morpholino oligonucleotide, phosphorothioate modified oligonucleotide, 2’ O-methyl (2’ O-Me) modified oligonucleotide, peptide nucleic acid (PNA), locked nucleic acid (LNA), phosphorodithioate oligonucleotide, 2’ O-Methoxyethyl (2’ -MOE) modified oligonucleotide, 2’-fluoro-modified oligonucleotide, 2'0,4'C-ethylene-bridged nucleic acid (ENAs), tricyclo-DNA, tricyclo-DNA phosphorothioate nucleotide, constrained ethyl bridged nucleic acid, 2'-O-[2-(N-methylcarbamoyl)ethyl] modified oligonucleotide, morpholino oligonucleotide, and peptide-conjugated phosphoramidate morpholino oligonucleotide (PPMO), or any combination thereof. In some embodiments the modification of the antisense oligonucleotide increases stability of the oligonucleotide, efficacy of decreasing the inclusion of the cryptic exon, or efficiency in decreasing the inclusion of the cryptic exon. In some embodiments, the modification of the antisense oligonucleotide improves delivery of the oligonucleotide to the UNCI 3 mRNA molecule.

[0175] In some embodiments, the ASO comprises a modification that enhances the pharmacokinetic or biodistribution properties of an ASO trigger or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some instances, binding of a group to a cell or cell receptor may initiate endocytosis. A modification can be monovalent, divalent, trivalent, tetravalent, or have higher valency.

Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules.

[0176] In some embodiments, the modification comprises modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof.

[0177] In some embodiments, the ASO comprises a modified sugar moiety. In some embodiments, the ASO comprises a sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents. In some embodiments, morpholines are modified, by adding or altering various substituent groups from the above morpholino structure.

[0178] In some embodiments, the ASO comprises modified variants of nucleosides that maintain proper base pairing. In some embodiments, the ASOs comprises modified A. modified C, modified G or modified U. In one embodiment, modified ASOs comprise modified C such as 5- methylcytosine, or 5 -hydroxymethylcytosine, modified U such as 5 -methykmdme or replacement with thymine, or modified A such as Ne-meihyladenine. In one embodiment, the ASO may comprise a mixture of non-modified and modified nucleosides.

[0179] In some embodiments, the ASO comprises a modified mtemucleotiside linkage. In some embodiments, backbone phosphate groups are modified by replacing one or more of the oxygen atoms with a different substituent, In some embodiments, the backbone is formed from m RNA (alternating phosphate and ribose), LNA (locked nucleic acid), tcDNA (tn-cyclo DMA), cEt (constrained ethyl bridged nucleic acid); ENA (ethylene-bridged nucleic acid), I-INA (hexitol nucleic acids), TNA (threose nucleic acid), PMO (phosphorodi ami date morpholino oligomer) PMO, PNA (peptide nucleic acid), 2-OMe-RNA, 2'-O-methoxyethyl (MOE) nucleic acids, or 2- O-(2-methylcarbomoyl (MCE) nucleotides, or any combination thereof.

[0180] In some embodiments, the antisense oligonucleotide is used in a method of treatment or the manufacture of a medicament for use in treating, wherein the antisense oligonucleotide is administered to a patient in need to increase the expression of UNC13A mRNA. In some embodiments, the expression of UNC13A mRNA is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the expression of UNC13A mRNA is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, the expression of UNC13A mRNA is increased in a cell by about 100%, about 200%, about 300%, about 400%, or about 500%. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A protein in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.

[0181] In some embodiments, the antisense oligonucleotide restores the expression of UNC13A mRNA in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, restores the expression of UNC13A protein in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.

[0182] In some embodiments, the antisense oligonucleotide is used in a method of treatment or the manufacture of a medicament for use m treating, wherein the antisense oligonucleotide is administered to a patient in need to decrease the expression of UNC13A cryptic exon mRNA. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by about 10%, about 20%, about 30%, about 40%, or about 50%. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.

[0183] In some embodiments, the antisense oligonucleotide reduces the expression of UNC13A cryptic exon mRNA by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A cryptic exon mRNA expressed in a cell treated with shRNA targeting TARDBP. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313.

[0184] In some embodiments, the antisense oligonucleotide is used in a method of treatment or the manufacture of a medicament for use in treating, wherein the antisense oligonucleotide is administered to a patient in need to increase the expression of UNC13A protein. In some embodiments, the expression of UNC13A protein is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the expression of UNC13A protein is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, the expression of UNC13A protein is increased in a cell by about 100%, about 200%, about 300%, about 400%, or about 500%. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.

[0185] In some embodiments, the antisense oligonucleotide is used in a method of treatment or the manufactme of a medicament for use in treating, wherein the antisense oligonucleotide is administered to a patient in need to increase the expression of UNC13A protein to a level sufficient to improve one or more neuronal functions. In some embodiments, the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide improves 1, 2, 3, 4, 5, or 6 neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide improves at least 1, at least 2, at least 3, at least 4, or at least 5 neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313.

[0186] In some embodiments, the antisense oligonucleotide restores the expression of UNC13A protein in a cell to at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.

[0187] In some embodiments, the antisense oligonucleotide increases UNC13A mRNA expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after contacting the cell with the ASO. In some embodiments, the antisense oligonucleotide is provided to the cell in multiple doses. In some embodiments, the antisense oligonucleotide increases UNC13A mRNA expression about about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after administration of the ASO. In some embodiments, the antisense oligonucleotide increases UNC13A mRNA expression such that the UNC13A expression is fully restored after administration of the ASO.

[0188] In some embodiments, the antisense oligonucleotide decreases UNC13A cryptic exon mRNA expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after contacting the cell with the ASO. In some embodiments, the antisense oligonucleotide is provided to the cell in multiple doses. In some embodiments, the antisense oligonucleotide decreases UNC13A cryptic exon mRNA expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after administration of the ASO. In some embodiments, the antisense oligonucleotide decreases UNC13A cryptic exon mRNA expression such that the UNC13A cryptic exon expression is completely reduced after administration of the ASO. [0189] In some embodiments, the antisense oligonucleotide increase UNC13A protein expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after contacting the cell with the ASO. In some embodiments, the antisense oligonucleotide is provided to the cell in multiple doses. In some embodiments, the antisense oligonucleotide increase UNC13A protein expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after administration of the ASO. In some embodiments, the antisense oligonucleotide increase UNC13A protein expression such that the increase UNC13A protein expression is completely restored after administration of the ASO.

[0190] In some embodiments, the antisense oligonucleotide is provided to a cell, wherein the cell is a human cell or a murine cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a murine cell. In some embodiments, the antisense oligonucleotide is provided to a cell, wherein the cell is a neuron. In some embodiments, the cells is a human neuron. In some embodiments, the cell is a murine neuron. In some embodiments, the neuron is a motor neuron, a cortical neuron, or an excitatory neuron. In some embodiments, the cell is heterozygous or homozygous for a risk allele. In some embodiments, the risk allele is selected from the group consisting of rs12608932 (hg38 chr19:17.641,880 A→C rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C→A), or any combination thereof. In some embodiments, the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD). In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.

[0191] In some embodiments, the antisense oligonucleotide is provided to a cell, wherein the cell is a human cell. In some embodiments, the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD). In some embodiments, the mutation is a mutation in the TDP-43 protein. In some embodiments, the mutation in the TDP-43 protein is G298S. In some embodiments, the mutation in the TDP-43 protein is A382T. In some embodiments, the cell comprises a single nucleotide polymorphism (SNP). In some embodiments, the SNP is associated with the UNC13A protein. In some embodiments, the SNP is a risk allele, wherein the cell is heterozygous or homozygous for the risk allele. In some embodiments, the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G). rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C→A), or any combination thereof. In some embodiments, the risk allele is rs12973192 (hg38 chr19: 17,642,430 C→G). In some embodiments, the antisense oligonucleotide is provided to a cell comprising a SNP, wherein the SNP is rs12973192 (hg38 chr19: 17,642,430 C→G). In some embodiments, the cell is selected from the group consisting of GM25256 (GM or GM line), NDS00262 (005 or 005 line), NDS00209 (4048 or 4048 line), and NDS00235 (4157 or 4157 line). In some embodiments, the cell is a healthy cell selected from the group consisting of GM25256 (GM or GM line) and NDS00262 (005 or 005 line). In some embodiments, the cell is a cell comprising a mutation in the TDP-43 protein selected from the group consisting of NDS00209 (4048 or 4048 line) and NDS00235 (4157 or 4157 line). In some embodiments, the cell is NDS00209 (4048 or 4048 line), wherein the mutation in the TDP- 43 protein is G298S. In some embodiments, the cell is NDS00235 (4157 or 4157 line), wherein the mutation in the TDP-43 protein is A382T. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.

[0192] In some embodiments, the antisense oligonucleotide is active in one or more iPSC neurons. In some embodiments, the antisense oligonucleotide is active in multiple regardless iPSC neurons having different genetic backgrounds, disease mutations, or UNC13A SNP status. In some embodiments, the antisense oligonucleotide is active in multiple regardless iPSC neurons having different genetic backgrounds, disease mutations, and UNC13A SNP status. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0193] In some embodiments, the antisense oligonucleotide is provided to a cell, wherein the cell expresses a low level of TDP-43 protein. In some embodiments, the cell expresses less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 1% TDP-43 protein. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. [0194] In some embodiments, the antisense oligonucleotide is provided to the cell by transfection. In some embodiments, the antisense oligonucleotide is provided to the cell by other delivery methods known in the art.

[0195] In some embodiments, the antisense oligonucleotide does not cause any cell morphology changes. In some embodiments, the antisense oligonucleotide does not cause neuronal toxicity. In some embodiments, the antisense oligonucleotide does not bind to a genomic sequence other than the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide does not have off-target effects. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.

[0196] In some embodiments, the antisense oligonucleotide described herein decreases the expression of UNC13A cryptic exon mRNA. In some instances, this reduction of UNC13A cryptic exon mRNA alone is not indicative of upregulation of full length UNC13A mRNA. In some instances, the antisense oligonucleotide interferes with proper splicing of the intron.

[0197] In some embodiments, the antisense oligonucleotide occupies an overlapping region with other antisense oligonucleotide described herein. In some instances, two antisense oligonucleotides that target adjacent and/or overlapping regions of the UNC13A mRNA have different activities, wherein a first antisense oligonucleotide is active and a second antisense oligonucleotide is inactive. In some instance, the two antisense oligonucleotides that target adjacent and/or overlapping regions of the UNC13A mRNA are of the same nucleotide length or different nucleotide length. In some instances, a single nucleotide shift in targeting sequence effects the ability of the antisense oligonucleotide to block the splicing machinery. In some instances, a single nucleotide shift in targeting sequence results in distinctly different antisense oligonucleotide activities, wherein a first antisense oligonucleotide is active and a second antisense oligonucleotide is inert.

[0198] In some instances, antisense oligonucleotides described herein consisting of at least 18 nucleotides are the more active. In some instances, antisense oligonucleotides consisting of at least 20 nucleotides are the most potent, in particular antisense oligonucleotides consisting of 20, 21, or 22 nucleotides. In some instances, select antisense oligonucleotides consisting of 13 to 17 nucleotides, in particular 13 or 15 nucleotides, are active. In some embodiments, this is indicative of a minimal region that needs to be blocked to have the desired effect. This highlights the importance of antisense oligonucleotides of both positioning on the UNC13A mRNA and length for optimal performance.

[0199] In some instances, the antisense oligonucleotide is provided to a cell for an extended period of time. In some instances, the antisense oligonucleotide restore UNC13A levels to those of a wild-type cell. In some instances, the cell is a neurons from one or more different iPSC lines, for example GM25256 (GM or GM line) and NDS00262 (005 or 005 line).

III. PHARMACEUTICAL COMPOSITIONS

[0200] In some aspects, the disclosure provides pharmaceutical compositions comprising an UNC13A cryptic exon splice variant specific inhibitor as described herein and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with cells and/or tissues without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0201] As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the cell or tissue being contacted. Additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0202] As is well known in the medical arts, the dosage for any one patient depends upon many factors, including the patient's size, weight, body surface area, age, the level of UNC13A cryptic exon splice variant specific inhibitor required to achieve a therapeutic effect, stability of the UNC13A cryptic exon splice variant specific inhibitor, specific disease being treated, stage of disease, sex, time and route of administration, general health, and other drugs being administered concurrently.

[0203] Pharmaceutical compositions may be administered in a manner appropriate to the disease or condition to be treated (or prevented) as determined by persons skilled in the medical art. An appropriate dose and a suitable duration and frequency of administration of the compositions will be determined by such factors as the health condition of the patient, size of the patient (i.e. , weight, mass, or body area), the type and severity of the patient's disease, the particular form of the active ingredient, and the method of administration. In general, an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit (such as described herein, including an improved clinical outcome, such as more frequent complete or partial remissions, or longer disease-free and/or overall survival, or a lessening of symptom severity). For prophylactic use, a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder. Prophylactic benefit of the compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.

[0204] Compositions (e.g., pharmaceutical compositions) may be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subpial, intraparenchymal, intrastriatal, intracranial, intracistemal, intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar, subcutaneous, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), mucosal, nasal, bucal, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and/or the condition of the subject. In some embodiments, compositions are directly injected into the CNS of the subject. In some embodiments, direct injection into the CNS is intracerebral injection, intraparenchymal injection, intrathecal injection, subpial injection, or any combination thereof. In some embodiments, direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, optionally wherein the direct injection is intracistemal injection, intraventricular injection, and/or intralumbar injection.

IV. METHODS OF USING UNC13A CRYPTIC SPLICE VARIANT INHIBITORS

[0205] The antisense oligonucleotides provided herein have a number of beneficial properties that make them useful for increasing UNC13A protein expression, reducing inclusion of UNC13A cryptic exon inclusion and treating neurodegenerative diseases, as further described below.

A. Method of Using ASOs to Increase UNC13A Protein Expression

[0206] Provided herein are methods increasing UNC13A protein expression in a cell comprising contacting the cell with an antisense oligonucleotide provided herein. In some embodiments, UNC13A protein expression is increased by at least 10% following contacting the cell with the antisense oligonucleotide. In some embodiments, UNC13A protein expression is increased by at least 20%, at least 30%, at least 40%, at least 50%, or at least 75% compared to the level before contact with the antisense oligonucleotide. In some embodiments, UNC13A expression is increased by at least 1.1, at least 1.2, at least 1.3, at least 1.5, at least 1.5 or at least 2 fold compared to the level before contact with the antisense oligonucleotide. In some embodiments, the amount of full length UNC13A protein is increased. In some embodiments, the ASO targets regions 1-4 of the UNC13A mRNA transcript, identified herein. In some embodiments, the ASO targets region 2 or 3 of the UNC13A mRNA transcript. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide has a modification. [0207] In some embodiments, UNC13A protein expression is increased to a normal level following contacting the cell with the antisense oligonucleotide. In some embodiments, UNC13A protein expression is increased to the level of an individual who does not have a mutation in TDP-43. In some embodiments, UNC13A protein expression is increased to the level of an individual who does not have a decrease in TDP-43 protein expression. In some embodiments, UNC13A protein expression is increased to the level of an individual who does not have a risk allele associated with ALS or FTD. In some embodiments, UNC13A expression is increased to the level of an individual who does not have ALS or FTD. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20- 355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide has a modification.

[0208] In some embodiments, prior to contacting the cell with the antisense oligonucleotide the cell has a low level of UNC13A protein expression. In some embodiments, the cell has a mutation in TDP-43, or a decrease in expression of TDP-43 protein. In some embodiments, the cell has a level of UNC13A protein expression that is associated with a TDP- 43 proteinopathy. In some embodiments, the cell has a level of UNC13A protein that is associated with a risk allele associated with ALS or FTD. In some embodiments, the cell has a level of UNC13A that is associated with ALS or FTD. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification. [0209] In some embodiments, prior to contacting the cell with the antisense oligonucleotide the cell has a reduced level of UNC13A protein expression compared to a normal or wild-type cell. In some embodiments, a normal cell is one that does not have a mutation in TDP-43, has a normal level of expression of TDP-43 protein level, does not have a risk allele associated with ALS or FTD and/or is not obtained from an individual with ALSO or FTD. In some embodiments, the cell has an undetectable level of UNC13A protein expression prior to contacting with the ASO. In some embodiments, the cell expresses less than 80%, less than 70%, less than 60%, or less than 50% of the normal level of UNC13A protein. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification.

[0210] In some aspects, provided herein is a method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some aspects, provided herein is a method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide that modulates UNC13A has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.

[0211] In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO:1. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO: 1.

[0212] In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID N0:700. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID N0:700. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID N0:700. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:701. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:702. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:703. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO:703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:703.

[0213] In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703. [0214] In some instances, the methods provided herein comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene, where the sequence of UNC13A is uniquely sensitive to antisense oligonucleotide binding. In some instances, a region of the UNC13A mRNA is identified as being more responsive than other regions. Herein, it is determined that these regions are sensitive to a number of factors, including but not limited to, antisense oligonucleotide length, composition, and positioning on the UNC13A mRNA. Minimal regions of the UNC13A mRNA are specifically targeted to maximize antisense oligonucleotide activity in modulating UNC13A mRNA splicing. In some embodiments, these highly responsive minimal regions of the UNC13A mRNA are referred to as hot spots.

[0215] In some embodiments, a minimal region of the UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene is identified as highly responsive to binding with an antisense oligonucleotide, or another similar nucleic acid probe. In some embodiments, an ASO that binds to such minimal region is effective for preventing inclusion of the UNC13A cryptic exon. In some embodiments, the minimal region is between 3 to 30, 4 to 26, 5 to 22, 6 to 18, 7 to 14, or 8 to 10 nucleotides in length. In some embodiments, the minimal region is no more than 30, no more than 25, no more than 20, or no more than 15 nucleotides in length. In some embodiments, the minimal region is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the minimal region is 18 nucleotides in length. In some embodiments, the minimal region is 29 nucleotides in length. In some embodiments, the minimal region comprises the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, binding the small region or a portion thereof with an antisense oligonucleotide results in enhanced splice modulation activity. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A protein expression.

[0216] In some instances, the methods provided herein comprise contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339- 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 1, 2,

3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 2, 3,

4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.

[0217] In some embodiments, the methods provided herein comprise contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in enhanced UNC13A splice modulation activity. In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in increased UNC13A mRNA expression. In some embodiments, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the expression of UNC13A mRNA is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.

[0218] In some embodiments, a wild-type cell is one from an individual who does not have amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD). In some embodiments, a wild-type cell is a cell that expresses a normal level of TDP-43 protein. In some embodiments, a wild-type cell is a cell that does not produce transcripts of UNC13A comprising the cryptic exon. [0219] In some aspects, provided herein are methods of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of between 13 to 30, 15 to 28, 17 to 26, 19 to 24, or 21 to 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13, 15, 17, 18, 19, 20, 21, 22, or 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19, 20, 21, or 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of at least 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, or 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 15 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 17 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 18 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 20 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 21 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 25 nucleotides. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0220] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises a modification.

[0221] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises a modification.

[0222] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0223] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173. In some embodiments, the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0224] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266,

267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851,

852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935. In some embodiments, the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0225] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199. In some embodiments, the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0226] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224. In some embodiments, the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0227] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247. In some embodiments, the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225- 1247. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0228] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270. In some embodiments, the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’0Me antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0229] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292. In some embodiments, the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0230] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293- 1313. In some embodiments, the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. [0231] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945. In some embodiments, the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0232] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332. In some embodiments, the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314- 1332. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0233] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957. In some embodiments, the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888- 890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

[0234] In some embodiments, the methods of increasing expression of UNC13A protein in a cell by at least 10% described herein comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a modification. In some embodiments, the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification. In some embodiments, the 5’ end or the 3’ end of the antisense oligonucleotide comprise a modification. In some embodiments, the 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’OMe antisense oligonucleotide.

[0235] In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide. In some embodiments, the modification is selected from the group consisting of a 2’0Me antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’0Me antisense oligonucleotide.

[0236] In some embodiments, the method of increasing expression of UNC13A protein in a cell by at least 10%, comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a modification, and at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification. In some embodiments, between 30% and 100%, 40% and 90%, 50% and 80%, or 60% and 70% of the nucleotides comprise a modification. In some embodiments, about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the nucleotides comprise a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’OMe antisense oligonucleotide.

[0237] In some instances, the method provided herein further comprises measuring the level of UNC13A protein in the cell. In some embodiments, UNC13A protein level is measured by western blot, ELISA, immune blot, immunohistochemistry, a fluorescent reporter assay, a luminescence assay, imagining, or other methods known in the art. In some embodiments, the protein level is measured prior to contacting the cell with the ASO and/or following contacting the cell with the ASO.

[0238] In some embodiments, contacting the cell with the oligonucleotide comprises administering the oligonucleotide to an individual. In some embodiments, contacting the cell with the oligonucleotide comprises incubating a cell with the oligonucleotide. In some embodiments, the cell is cultured with the oligonucleotide. In some embodiments, the ASO is provided via gymnotic delivery.

[0239] In some embodiments, provided herein is a method of treating ALS or FTD comprising administering an ASO provided herein and increasing UNC13A protein expression level. In some embodiments, provided herein is a method of treating ALSO or FTD comprising administering an ASO provided herein and increasing the ratio of full length UNC13A transcript to UNC13A transcript comprising the cryptic exon. In some embodiments, the method comprises increasing UNC13A mRNA expression. In some embodiments, the method comprises reducing the level of UNC13A transcript comprising the cryptic exon.

[0240] In some embodiments, the method increases the level of UNC13A protein is increased by blocking inclusion of a cryptic exon. In some embodiments, the UNC13A protein level is increased by reducing the amount of inclusion of a cryptic exon, which results in a lower amount of full length UNC13A protein. In some embodiments, the ASO sterically blocks inclusion of the UNC13A cryptic exon. In some embodiments, the ASO binds to the UNC13A cryptic exon and alters its secondary structure, resulting in exclusion of the cryptic exon from the UNC13A transcript. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961- 1332. In some embodiments, the antisense oligonucleotide has a modification.

[0241] In some embodiments, the method reduces inclusion of the cryptic exon by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% compared to the level before contacting the cell with the ASO. In some embodiments, the method reduces inclusion of the cryptic exon by about 30% to about 80%, about 30%, to about 70%, about 30% to about 50%, about 60% to about 80%, or about 50% to about 80% compared to the level before contacting the cell with the ASO. In some embodiments, the method reduces inclusion of the cryptic exon to an undetectable level. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification.

[0242] In embodiments, the ASO selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant over full length UNC13A (wild type) or other variants thereof (i.e., variants that do not contain a cryptic exon from intron 20-21.) In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification.

[0243] In some embodiments, the methods increase the ratio of full length UNC13A transcript that does not comprise the cryptic exon to transcript comprising the cryptic exon. In some embodiments, the ratio of full length UNC13A transcript that does not comprise the cryptic exon to transcript comprising the cryptic exon is at least about 1 : 1, at least about 2: 1, at least about 4: 1, at least about 10: 1, at least about 20: 1, at least about 50: 1, or at least about 100: 1 following contacting the cell with the ASO. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide has a modification.

[0244] In embodiments, the UNC13A cryptic exon splice variant specific inhibitor selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant over full length UNC13A (wild type) or other variants thereof. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification.

[0245] In embodiments, the methods of the present disclosure reduces UNC13A cryptic splice variant expression or activity in a cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% at least 95% or more in a cell compared to the expression level of UNC13A cryptic splice variant in a cell that has not been contacted with the ASO. In some embodiments, the methods of the present disclosure reduces UNC13A cryptic splice variant expression or activity in a cell by 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20- 95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40- 50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50- 90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70- 95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% compared to the expression level of UNC13A cryptic splice variant in a cell that has not been contacted with the ASO.

[0246] In embodiments, the methods of the present disclosure reduces UNC13A cryptic splice variant expression or activity in the CNS of a subject by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% at least 95% or more in the CNS compared to the expression level of UNC13A cryptic splice variant in the CNS of an untreated subject. In embodiments, the methods of the present disclosure reduces UNC13A cryptic splice variant expression or activity in the CNS of a subject by 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20- 90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30- 100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50- 80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70- 90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% compared to the expression level of UNC13A cryptic splice variant in the CNS of an untreated subject.

[0247] In some embodiments, the presence, absence, or amount of the UNC13A cryptic exon is measured or detected by PCR (such as by qPCR). In some embodiments, the UNC13A cryptic exon is measured or detected by fluorescence in situ hybridization or Northern Blot.

[0248] In some embodiments, the cell expresses a low level of TDP-43 protein. In some embodiments cell expresses a low level of TDP-protein in comparison to a normal or wildtype cell. In some embodiments, a normal cell is one that does not have a mutation in TDP-43, has a normal level of expression of TDP-43 protein level, does not have a risk allele associated with ALS or FTD and/or is not obtained from an individual with ALSO or FTD. In some embodiments, the cell has an undetectable level of TDP-43 protein expression prior to contacting with the ASO. In some embodiments, the cell expresses less than 80%, less than 70%, less than 60%, or less than 50% of the normal level of TDP-43 protein.

[0249] In some embodiments, the methods of the present disclosure comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by about 100%, about 200%, about 300%, about 400%, or about 500%. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0250] In some embodiments, the antisense oligonucleotide restores the expression of UNC13A mRNA in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, restores the expression of UNC13A protein in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.

[0251] In some embodiments, the methods of the present disclosure comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by about 10%, about 20%, about 30%, about 40%, or about 50%. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0252] In some embodiments, the antisense oligonucleotide reduces the expression of UNC13A cryptic exon mRNA by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A cryptic exon mRNA expressed in a cell treated with shRNA targeting TARDBP. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0253] In some embodiments, the methods of the present disclosure comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide increases the expression of UNC13A protein in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A protein in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A protein in a cell by about 100%, about 200%, about 300%, about 400%, or about 500%. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A protein in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A protein in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0254] In some embodiments, the method comprises contacting the cell with an antisense oligonucleotide, wherein contacting the cell with the antisense oligonucleotide increases the expression of UNC13A protein to a level sufficient to improve one or more neuronal functions. Without being bound by theory, restoration of UNC13A protein to at least 50% of normal levels is likely to improve neuronal function and benefit ALS and FTD patients with reduced TDP43 and UNC13A levels. In some embodiments, the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide improves 1, 2, 3, 4, 5, or 6 neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide improves at least 1, at least 2, at least 3, at least 4, or at least 5 neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0255] In some embodiments, the antisense oligonucleotide restores the expression of UNC13A protein in a cell to at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, restores the expression of UNC13A protein in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.

[0256] In some embodiments, the methods of the present disclosure comprise providing the antisense oligonucleotide to a cell, wherein the cell is a human cell or a murine cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a murine cell. In some embodiments, the antisense oligonucleotide is provided to a cell, wherein the cell is a neuron. In some embodiments, the cells is a human neuron. In some embodiments, the cell is a murine neuron. In some embodiments, the neuron is a motor neuron, a cortical neuron, or an excitatory neuron. In some embodiments, the cell is heterozygous or homozygous for a risk allele. In some embodiments, the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C→A), or any combination thereof. In some embodiments, the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD). In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. [0257] In some embodiments, the methods of the present disclosure comprise providing the antisense oligonucleotide to a cell, wherein the cell is a human cell. In some embodiments, the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD). In some embodiments, the mutation is a mutation in the TDP-43 protein. In some embodiments, the mutation in the TDP-43 protein is G298S. In some embodiments, the mutation in the TDP-43 protein is A382T. In some embodiments, the cell comprises a single nucleotide polymorphism (SNP). In some embodiments, the SNP is associated with the UNC13A protein. In some embodiments, the SNP is a risk allele, wherein the cell is heterozygous or homozygous for the risk allele. In some embodiments, the risk allele is selected from the group consisting of rs12608932 (hg38 chr19:17.641,880 A— >C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C→A), or any combination thereof. In some embodiments, the risk allele is rs 12973192 (hg38 chr19: 17,642,430 C→G). In some embodiments, the antisense oligonucleotide is provided to a cell comprising a SNP, wherein the SNP is rs12973192 (hg38 chr19: 17,642,430 C→G). In some embodiments, the cell is selected from the group consisting of GM25256 (GM or GM line), NDS00262 (005 or 005 line), NDS00209 (4048 or 4048 line), and NDS00235 (4157 or 4157 line). In some embodiments, the cell is a healthy cell selected from the group consisting of GM25256 (GM or GM line) and NDS00262 (005 or 005 line). In some embodiments, the cell is a cell comprising a mutation in the TDP-43 protein selected from the group consisting of NDS00209 (4048 or 4048 line) and NDS00235 (4157 or 4157 line). In some embodiments, the cell is NDS00209 (4048 or 4048 line), wherein the mutation in the TDP-43 protein is G298S. In some embodiments, the cell is NDS00235 (4157 or 4157 line), wherein the mutation in the TDP- 43 protein is A382T. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0258] In some embodiments, the antisense oligonucleotide of the methods described herein is active in one or more iPSC neurons. In some embodiments, the antisense oligonucleotide is active in multiple regardless iPSC neurons having different genetic backgrounds, disease mutations, or UNC13A SNP status. In some embodiments, the antisense oligonucleotide is active in multiple regardless iPSC neurons having different genetic backgrounds, disease mutations, and UNC13A SNP status. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.

[0259] In some embodiments, the methods of the present disclosure comprise providing the antisense oligonucleotide to a cell, wherein the cell expresses a low level of TDP-43 protein. In some embodiments, the cell expresses less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 1% TDP-43 protein. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0260] In some embodiments, the antisense oligonucleotide is provided to the cell by transfection. In some embodiments, the antisense oligonucleotide is provided to the cell by other delivery methods known in the art.

[0261] In some embodiments, the methods of the present disclosure comprise providing the antisense oligonucleotide to a cell, wherein the antisense oligonucleotide that is provided to the cell does not cause any cell morphology changes. In some embodiments, the antisense oligonucleotide does not cause neuronal toxicity. In some embodiments, the antisense oligonucleotide does not bind to a genomic sequence other than the sequence set forth in SEQ ID NO:1. In some embodiments, the antisense oligonucleotide does not have off-target effects. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0262] In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a murine or human cell. In some embodiments, the cell is a neuron. In some embodiments, the cell is a cortical neuron, a motor neuron, or an excitatory neuron. In some embodiments, the cell engages in neuronal signaling. In some embodiments, prior to contacting the cell with the ASO, the cell has reduced neuronal function such as reduced or impaired neuronal signaling, abnormal neurite length or morphology, reduced or aberrant action potential, or reduced or aberrant neurotransmitter release. In some embodiments, the cell is an iPSC derived motor neuron. In some embodiments, the cell is an animal cell, such as a human, cow, horse, sheep, lamb, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit or guinea pig. The animal can be a mammal, such as a non-primate and a primate (e.g., monkey and human). In embodiments, a patient is a human, such as a human infant, child, adolescent or adult. [0263] In some embodiments, contacting the cell with the ASO comprises incubation with a composition the ASO. In some embodiments contacting the cell with the ASO comprises transduction or transfection with a virus or plasmid encoding the ASO.

[0264] In embodiments, the cell is within an individual In embodiments, the individual has been identified as having a UNC13A gene mutation in intron 20-21. In embodiments, the UNC13 gene mutation comprises rs12608932 (hg38 chr19: 17.641,880 A— >C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0- 2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C→A), or any combination thereof.

[0265] In some embodiments, the cell is within an non-human animal, such as cow, horse, sheep, lamb, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, primate, or guinea pig-

[0266] In some embodiments, the method improves or restores one or more neuronal functions in a cell. In some embodiments, the method improves, neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.

B. Method of Using ASOs to Treat Disease

[0267] Also provided herein are methods of treating neurodegenerative diseases such amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide provided herein to the individual. In some embodiments, the ASO targets regions 1-4 of the UNC13A mRNA transcript (SEQ ID NOs: 700-703). In some embodiments, the ASO comprises or consists of the sequence set forth in SEQ ID NO: 20-355 or SEQ ID NO: 400-638 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the ASO is a modified oligonucleotide. In some embodiments, the ASO comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.

[0268] In embodiments, the individual has a TDP-43 proteinopathy. In embodiments, the TDP-43 proteinopathy comprises amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial onset sensory and motor neuronopathy (FOSMN), hippocampal sclerosis (HS), limbic-predominant age-related TDP-43 encephalopathy (LATE), cerebral age-related TDP-43 with sclerosis (CARTS), Guam Parkinson-dementia complex (G-PDC), Guan ALS (G- ALS), Multisystem proteinopathy (MSP), Perry disease, Alzheimer's disease (AD), and chronic traumatic encephalopathy (CTE), or a combination thereof.

[0269] Also provided herein is a method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide comprising 13 to 30 nucleobases that are complementary to the sequence set forth in SEQ ID NO: 1 to the individual, wherein the individual is homozygous for a reference allele, homozygous for a risk allele, heterozygous for a risk allele or comprises a mutation associated with ALS or FTD. In some embodiments, the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats → 3-3 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C→A), or any combination thereof. In some embodiments, the mutation associated with ALS or FTD is a mutation in TDP43. In some embodiments, the mutation in the TDP-43 protein is G298S. In some embodiments, the mutation in the TDP-43 protein is A382T. In some embodiments, the cell comprises a single nucleotide polymorphism (SNP). In some embodiments, the SNP is associated with the UNC13A protein. In some embodiments, the SNP is a risk allele, wherein the cell is heterozygous or homozygous for the risk allele. In some embodiments, the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C→A), or any combination thereof. In some embodiments, the risk allele is rs12973192 (hg38 chr19: 17,642,430 C→G). In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332, as describe in the present disclosure. In some embodiments, the modification is a 2’OMe antisense oligonucleotide. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions. In some embodiments, the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. [0270] In some embodiments, a wild-type cell is one from an individual who does not have amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD). In some embodiments, a wild-type cell is a cell that expresses a normal level of TDP-43 protein. In some embodiments, a wild-type cell is a cell that does not produce transcripts of UNC13A comprising the cryptic exon.

[0271] In some embodiments, the method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO:1. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO: 1.

[0272] In some embodiments, the method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:700. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:700. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:700. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:701. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:702. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:703. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:703.

[0273] In some embodiments, the method of treating amyotrophic lateral sclerosis

(ALS) or frontal temporal dementia (FTD) in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.

[0274] In some instances, the methods provided herein for treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprise administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene, where the sequence of UNC13A is uniquely sensitive to antisense oligonucleotide binding. In some instances, a region of the UNC13A mRNA is identified as being more responsive than other regions. Herein, it is determined that these regions are sensitive to a number of factors, including but not limited to, antisense oligonucleotide length, composition, and positioning on the UNC13A mRNA. Minimal regions of the UNC13A mRNA are specifically targeted to maximize antisense oligonucleotide activity in modulating UNC13A mRNA splicing. In some embodiments, these highly responsive minimal regions of the UNC13A mRNA are referred to as hot spots.

[0275] In some embodiments, the method of treating amyotrophic lateral sclerosis

(ALS) or frontal temporal dementia (FTD) in an individual comprises administering an antisense oligonucleotide targeting a minimal region, wherein the minimal region of the UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene is identified as highly responsive to binding with an antisense oligonucleotide, or another similar nucleic acid probe. In some embodiments, an ASO that binds to such minimal region is effective for preventing inclusion of the UNC13A cryptic exon. In some embodiments, the minimal region is between 3 to 30, 4 to 26, 5 to 22, 6 to 18, 7 to 14, or 8 to 10 nucleotides in length. In some embodiments, the minimal region is no more than 30, no more than 25, no more than 20, or no more than 15 nucleotides in length. In some embodiments, the minimal region is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the minimal region is 18 nucleotides in length. In some embodiments, the minimal region is 29 nucleotides in length. In some embodiments, the minimal region comprises the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, binding the small region or a portion thereof with an antisense oligonucleotide results in enhanced splice modulation activity. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A protein expression.

[0276] In some instances, the methods provided herein treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339- 1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.

[0277] In some embodiments, the methods provided herein for treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprise administering an antisense oligonucleotide, wherein binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in enhanced UNC13A splice modulation activity. In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in increased UNC13A mRNA expression. In some embodiments, the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the expression of UNC13A mRNA is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the expression of UNC13A cryptic exon mRNA is decreased in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.

[0278] In some aspects, provided herein are methods of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of between 13 to 30, 15 to 28, 17 to 26, 19 to 24, or 21 to 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13, 15, 17, 18, 19, 20, 21, 22, or 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19, 20, 21, or 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of at least 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, or 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 15 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 17 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 18 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 20 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 21 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 25 nucleotides.

[0279] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises a modification.

[0280] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961- 1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises a modification.

[0281] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961- 983 and 1116-1145. [0282] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173. In some embodiments, the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984- 1004 and 1146-1173.

[0283] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935. In some embodiments, the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.

[0284] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199. In some embodiments, the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174- 1199.

[0285] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224. In some embodiments, the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817,

818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224.

[0286] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225- 1247. In some embodiments, the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346,

819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247.

[0287] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347,

911, 936, 937, 1059-1074, and 1248-1270. In some embodiments, the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.

[0288] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292. In some embodiments, the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.

[0289] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350,

912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313. [0290] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942- 945. In some embodiments, the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352,

820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945.

[0291] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353,

821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332. In some embodiments, the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332.

[0292] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957. In some embodiments, the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.

[0293] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a modification. In some embodiments, the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification. In some embodiments, the 5’ end or the 3’ end of the antisense oligonucleotide comprise a modification. In some embodiments, the 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O- Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’OMe antisense oligonucleotide.

[0294] In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’0Me antisense oligonucleotide.

[0295] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a modification, and at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification. In some embodiments, between 30% and 100%, 40% and 90%, 50% and 80%, or 60% and 70% of the nucleotides comprise a modification. In some embodiments, about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the nucleotides comprise a modification. In some embodiments, the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide. In some embodiments, the modification is a 2’OMe antisense oligonucleotide.

[0296] In some embodiments, the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961- 1332. In some embodiments, the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.

[0297] In embodiments, the methods for treatment of the present disclosure reduces, prevents, or slows development or progression of one or more symptom characteristic of a TDP- 43 proteinopathy (such as ALS or FTD). Examples of symptoms characteristic of TDP-43 proteinopathy include motor dysfunction, cognitive dysfunction, emotional/behavioral dysfunction, paralysis, shaking, unsteadiness, rigidity, twitching, muscle weakness, muscle cramping, muscle stiffness, muscle atrophy, difficulty swallowing, difficulty breathing, speech and language difficulties (e.g., slurred speech), slowness of movement, difficulty with walking, dementia, depression, anxiety, or any combination thereof. [0298] In embodiments, the methods for treatment of the present disclosure comprise administration of the antisense oligonucleotide (ASO) as a monotherapy or in combination with one or more additional therapies for the treatment of the TDP-43 proteinopathy. Combination therapy may mean administration of the compositions of the present disclosure (e.g., antisense oligonucleotide) to the subject concurrently, prior to, subsequent to one or more additional therapies. Concurrent administration of combination therapy may mean that the compositions of the present disclosure (e.g., antisense oligonucleotide) and additional therapy are formulated for administration in the same dosage form or administered in separate dosage forms.

[0299] In embodiments, the one or additional therapies that may be used in combination with the ASO of the present disclosure include: inhibitory nucleic acids or antisense oligonucleotides that target neurodegenerative disease related genes or transcripts (e.g., C9ORF72), gene editing agents (e.g., CRISPR, TALEN, ZFN based systems) that target neurodegenerative related genes (e.g., C9ORF72), agents that reduce oxidative stress, such as free radical scavengers (e.g., Radicava (edaravone), bromocriptine); antiglutamate agents (e.g., Riluzole, Topiramate, Lamotrigine, Dextromethorphan, Gabapentin and AMP A receptor antagonist (e.g., Talampanel)); anti-apoptosis agents (e.g., Minocycline, Sodium phenylbutyrate and Arimoclomol); anti-inflammatory agents (e.g., ganglioside, Celecoxib, Cyclosporine, Nimesulide, Azathioprine, Cyclophosphamide, Plasmapheresis, Glatiramer acetate and thalidomide); Beta-lactam antibiotics (penicillin and its derivatives, ceftriaxone, and cephalosporin); Dopamine agonists (Pramipexole, Dexpramipexole); and neurotrophic factors (e.g., IGF-1, GDNF, BDNF, CTNF, VEGF, Colivelin, Xaliproden, Thyrotrophin-releasing hormone and ADNF).

[0300] In embodiments, an antisense oligonucleotide (ASO) of the present disclosure is administered in combination with an additional therapy targeting C9ORF72. In some embodiments, the additional therapy targeting C9ORF72 comprises an inhibitory nucleic acid targeting C9ORF72 transcript, a C9ORF72 specific antisense oligonucleotide, or a C9ORF72 specific gene editing agent. Examples of C9ORF72 specific therapies are described in US Patent No. 9,963,699 (antisense oligonucleotides); PCT Publication No. WO2019/032612 (antisense oligonucleotides); US Patent No. 10,221,414 (antisense oligonucleotides); US Patent No. 10,407,678 (antisense oligonucleotides); US Patent No. 9,963,699 (antisense oligonucleotides); US Patent Publication US2019/0316126 (inhibitory nucleic acids); US Patent Publication No. 2019/0167815 (gene editing); PCT Publication No. WO2017/109757 (gene editing), each of which is incorporated by reference in its entirety.

[0301] In embodiments, the methods for treatment of the present disclosure, including treating a TDP-43 proteinopathy such as ALS or FTD, may be used in combination with an STMN2 cryptic splice variant specific inhibitor. STMN2, which encodes a regulator of microtubule stability called Stathmin-2, is the gene whose expression is most significantly reduced when TDP-43 is depleted from neurons. The stathmin-2 gene is annotated to contain 5 constitutive exons plus a proposed alternative exon between exons 4 and 5. STMN2 harbors a cryptic exon (exon 2a) contained in intron 1 that is normally excluded from the mature STMN2 mRNA. The first intron of STMN2 contains a TDP-43 binding site. When TDP-43 is lost or its function is impaired, exon2a gets incorporated into the mature mRNA. Exon 2a harbors a stop codon and a polyadenylation signal, resulting in truncated STMN2 mRNA and 8-fold reduction of Stathmin-2. Aberrant splicing and reduced Stathmin-2 levels seem to be a major feature of sporadic and familial ALS cases (except those with SOD1 mutations) and in FTLD-TDP.

[0302] In embodiments, the antisense oligonucleotide (ASO) selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant over full length UNC13A (wild type) or other variants thereof (i.e., variants that do not contain a cryptic exon from intron 20-21. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

[0303] Antisense oligonucelotides (ASOs) of the present disclosure may be administered to a subject by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subpial, intraparenchymal, intrastriatal, intracranial, intracistemal, intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar, subcutaneous, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), mucosal, nasal, bucal, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol Preferably, UNC13A cryptic splice variant specific inhibitors of the present disclosure (e.g., antisense oligonucleotide) are administered directly to the CNS of the subject, e.g., by intrathecal, subpial, intraparenchymal, intrastriatal, intracranial, intracistemal, intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar administration, or any combination thereof. V. KITS

[0304] Also provided herein are kits comprising the antisense oligonucleotides provided herein and instructions for use. In some embodiments, the kit comprises instructions for contacting a cell with an ASO provided herein. In some embodiments, the kit comprises an ASO comprising or consisting of any of SEQ ID NO: 20-638 or 810-959. In some embodiments, the kit comprises an ASO comprising or consisting of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the kit comprises an ASO comprising or consisting of 13 to 30 nucleotides, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the kit comprises an ASO comprising or consisting of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.

VI. ENUMERATED EMBODIMENTS

1. A method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 16 to 30 nucleobases that are complementary to the sequence set forth in SEQ ID NO: 1.

2. The method of embodiment 1, wherein prior to contacting the cell with the antisense oligonucleotide, the cell expresses a low level of UNC13A.

3. The method of embodiment 1 or embodiment 2, wherein UNC13A protein level is measured by western blot, imaging, ELISA, a fluorescent reporter assay, luminescence assay, or immunohistochemistry.

4. The method of any one of embodiments 1-3, wherein the secondary structure of an UNC13A mRNA is altered by binding of the antisense oligonucleotide to an UNC13A transcript.

5. The method of any one of embodiments 1-4, wherein the antisense oligonucleotide sterically blocks inclusion of an UNC13A cryptic exon. 6. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO: 1.

7. The method any one of embodiments 1-6, wherein the antisense oligonucleotide reduces expression of an UNC13A cryptic exon splice variant by at least 10%.

8. The method of embodiment 7, wherein the UNC13A cryptic exon splice variant comprises the sequence set forth in SEQ ID NO:7 or SEQ ID NO:9.

9. The method of any one of embodiments 6-8, wherein following contacting the cell with the antisense oligonucleotide, the ratio of an UNC13A transcript not comprising the cryptic exon splice variant to an UNC13A transcript comprising the cryptic exon splice variant is at least 10: 1

10. The method of any one of embodiments 7-9, wherein the presence and/or amount of the cryptic exon splice variant is measured using qPCR.

11. The method of any one of embodiments 1-10, wherein the cell is a neuron.

12. The method of embodiment 11, wherein contacting the cell with the antisense oligonucleotide results in increase of expression of UNC13A protein to a level sufficient to improve neuronal function.

13. The method of embodiment 11 or 12, wherein the neuron is a motor neuron, a cortical neuron, or an excitatory neuron.

14. The method of embodiment 12 or 13, wherein the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, and neuronal longevity. 15. The method of any one of embodiments 1-14, wherein the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).

16. The method of any one of embodiments 1-15, wherein the antisense oligonucleotide is provided to the cell by transfection.

17. The method of any one of embodiments 1-16, wherein the cell expresses a low level of TDP-43.

18. The method of any one of embodiments 1-17, wherein the cell is a human cell or a murine cell.

19. The method of any one of embodiments 1-18, wherein the antisense oligonucleotide is provided in an amount sufficient to increase UNC13A protein expression at least 20%, at least 30%, at least 40%, or at least 50%.

20. A method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide comprising 16 to 30 nucleobases that are complementary to the sequence set forth in SEQ ID NO: 1 to the individual, wherein the individual is homozygous for a reference allele, homozygous for a risk allele, heterozygous or comprises a mutation associated with ALS or FTD.

21. The method of embodiment 20, wherein the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C→A), or any combination thereof.

22. The method of embodiment 20, wherein the mutation associated with ALS or FTD is a mutation in TDP43. 23. The method of any one of embodiments 1-22, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.

24. The method of any one of embodiments 1-23, wherein the antisense oligonucleotide comprises or consists of the sequence set forth in SEQ ID NO: 20-355, SEQ ID NO: 400-638 or SEQ ID NO: 810-957.

25. The method of any one of embodiments 1-24, wherein the antisense oligonucleotide consist of 16-30 bases.

26. The method of embodiment 25, wherein the antisense oligonucleotide consists of 16-25 bases.

27. The method of embodiment 26, wherein the antisense oligonucleotide consists of 16, 17, 18, 19, 21, or 22 bases.

28. The method of any one of embodiments 1-27, wherein the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.

29. An antisense oligonucleotide that modulates UNC13A splicing, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.

30. The antisense oligonucleotide of embodiment 29, comprising at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO: 700-703. 31. An antisense oligonucleotide comprising the sequence set forth in SEQ ID NO: 20-638 or

810-959.

32. The antisense oligonucleotide of any one of embodiments 29-31, wherein the antisense oligonucleotide consists of 16-30 bases.

33. The antisense oligonucleotide of embodiment 32, wherein the antisense oligonucleotide consists of 16-25 bases.

34. The antisense oligonucleotide of embodiment 33, wherein the antisense oligonucleotide consists of 16, 17, 18, 19, 21, or 22 bases.

35. An antisense oligonucleotide consisting of the sequence set forth in SEQ ID NO: 20-638 or 810-959.

36. The antisense oligonucleotide of any one of embodiments 29-35, wherein the antisense oligonucleotide comprises a modification.

37. The antisense oligonucleotide of embodiment 36, wherein the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.

38. A pharmaceutical composition comprising the antisense oligonucleotide of any one of embodiments 25-37.

39. The pharmaceutical composition of embodiment 38, comprising an excipient and/or a buffer.

40. A kit comprising the antisense oligonucleotide of any one of embodiments 29-37 or the pharmaceutical composition of embodiment 38 or embodiment 39. VII. ADDITIONAL ENUMERATED EMBODIMENTS

1. A method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.

2. A method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.

3. The method of embodiment 1 or embodiment 2, wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NO: 20-355, 400-638, 810-957, or 961- 1332.

4. The method of any one of embodiments 1-3, wherein the antisense oligonucleotide consists of 13 to 25 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.

5. The method of any one of embodiments 1-4, wherein the antisense oligonucleotide consists of 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.

6. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 19, 20, 21, or 22 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.

7. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. 8. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.

9. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.

10. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199.

11. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224.

12. The method of any one of embodiments 1-6, wherein the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225- 1247.

13. The method of any one of embodiments 1-6, wherein the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.

14. The method of any one of embodiments 1-6, wherein the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.

15. The method of any one of embodiments 1-6, wherein the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.

16. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945. 17. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314- 1332.

18. The method of any one of embodiments 1-5, wherein the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.

19. The method of any one of embodiments 1-18, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703.

20. The method of any one of embodiments 1-19, wherein the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in any one of SEQ ID NOs: 700-703.

21. The method of any one of embodiments 1-20, wherein the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementary to the sequence set forth in SEQ ID NO:701.

22. The method of any one of embodiments 1-21, wherein the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementary to the sequence set forth in SEQ ID NO:703. 23. The method of any one of embodiments 1-22, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.

24. The method of any one of embodiments 1-21 and 23, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof.

25. The method of any one of embodiments 1-21 and 23-24, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof.

26. The method of any one of embodiments 1-20 and 22-23, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof.

27. The method of any one of embodiments 1-20, 22-23, and 26, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof.

28. The method of any one of embodiments 1-27, wherein the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least

8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.

29. The method of any one of embodiments 1-28, wherein the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least

9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. 30. The method of embodiment 29, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339.

31. The method of embodiment 29, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340.

32. The method of embodiment 29, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341.

33. The method of embodiment 29, wherein the antisense oligonucleotide is at least at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.

34. The method of any one of embodiments 1-33, wherein prior to contacting the cell with the antisense oligonucleotide, the cell expresses a low level of UNC13A.

35. The method of any one of embodiments 1-34, further comprising measuring the level of UNC13A protein in the cell.

36. The method of embodiment 35, wherein UNC13A protein level is measured by western blot, imaging, ELISA, a fluorescent reporter assay, luminescence assay, or immunohistochemistry.

37. The method of any one of embodiments 1-36, wherein the secondary structure of an UNC13A mRNA is altered by binding of the antisense oligonucleotide to an UNC13A transcript.

38. The method of any one of embodiments 1-37, wherein the antisense oligonucleotide sterically blocks inclusion of an UNC13A cryptic exon. 39. The method of any one of embodiments 1-38, wherein the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO: 1.

40. The method of any one of embodiments 1-39, wherein the antisense oligonucleotide restores the expression of UNC13A mRNA in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell.

41. The method of any one of embodiments 1-40, wherein the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.

42. The method of embodiment 40 or embodiment 41, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313.

43. The method any one of embodiments 1-42, wherein the antisense oligonucleotide reduces expression of an UNC13A cryptic exon splice variant mRNA by at least 10%.

44. The method of any one of embodiments 1-43, wherein the antisense oligonucleotide reduces the expression of UNC13A cryptic exon mRNA by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A cryptic exon mRNA expressed in a cell treated with shRNA, miRNA, antisense oligonucleotide targeting TARDBP.

45. The method of any one of embodiments 1-44, wherein the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. 46. The method of embodiment 44 or embodiment 45, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313.

47. The method of any one of embodiments 38-46, wherein the UNC13A cryptic exon splice variant comprises the sequence set forth in SEQ ID NO:7 or SEQ ID NO:9.

48. The method of any one of embodiments 38-47, wherein following contacting the cell with the antisense oligonucleotide, the ratio of an UNC13A transcript not comprising the cryptic exon splice variant to an UNC13A transcript comprising the cryptic exon splice variant is at least 10:1.

49. The method of any one of embodiments 38-49, wherein the presence and/or amount of the cryptic exon splice variant is measured using qPCR.

50. The method of any one of embodiments 1-49, wherein the cell is a neuron.

51. The method of any one of embodiments 1-50, wherein contacting the cell with the antisense oligonucleotide increases the expression of UNC13A protein to a level sufficient to improve one or more neuronal functions.

52. The method of any one of embodiments 1-51, wherein the antisense oligonucleotide restores the expression of UNC13A protein in a cell to at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell.

53. The method of any one of embodiments 1-52, wherein the antisense oligonucleotide increases the expression of UNC13A protein in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. 54. The method of embodiment 52 or embodiment 53, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313.

55. The method of embodiment any one of embodiments 1-54, wherein the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by at least 50%, decreases the expression of UNC13A cryptic exon mRNA in the cell by at least 25%, and increases the expression of UNC13A protein in the cell by at least 50%.

56. The method of any one of embodiments 1-6, 13-15, and 19-55, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.

57. The method of any one of embodiments 1-6, 13-15, and 19-56, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103.

58. The method of any one of embodiments 1-6, 13-15, and 19-56, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313.

59. The method of any one of embodiments 50-58, wherein the neuron is a motor neuron, a cortical neuron, an interneuron, or an excitatory neuron.

60. The method of any one of embodiments 51-59, wherein the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.

61. The method of any one of embodiments 1-60, wherein the cell is heterozygous or homozygous for a risk allele. 62. The method of embodiment 61, wherein the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C→A), or any combination thereof.

63. The method of any one of embodiments 1-62, wherein the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).

64. The method of any one of embodiments 1-63, wherein the antisense oligonucleotide is provided to the cell by transfection.

65. The method of any one of embodiments 1-64, wherein the cell expresses a low level of TDP-43 protein.

66. The method of any one of embodiments 1-65, wherein the cell is a human cell or a murine cell.

67. The method of any one of embodiments 1-66, wherein the antisense oligonucleotide does not cause any cell morphology changes.

68. The method of any one of embodiments 1-67, wherein the antisense oligonucleotide does not cause neuronal toxicity.

69. The method of any one of embodiments 1-68, wherein the antisense oligonucleotide does not bind to a genomic sequence other than the sequence set forth in SEQ ID NO: 1.

70. A method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide comprising 13 to 30 nucleotides to the individual, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1, and wherein the individual is homozygous for a reference allele, homozygous for a risk allele, heterozygous for a risk allele or comprises a mutation associated with ALS or FTD.

71. The method of embodiment 70, wherein the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A→C), rs12973192 (hg38 chr19: 17,642,430 C→G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C→A), or any combination thereof.

72. The method of embodiment 70, wherein the mutation associated with ALS or FTD is a mutation in TDP43.

73. The method of any one of embodiments 1-72, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.

74. The method of any one of embodiments 1-73, wherein the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a locked nucleic acid (LNA) antisense oligonucleotide.

75. An antisense oligonucleotide that modulates UNC13A splicing, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.

76. An antisense oligonucleotide that modulates UNC13A splicing comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide comprises a sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. 77. The antisense oligonucleotide of embodiment 75 or embodiments 76, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.

78. The antisense oligonucleotide of any one of embodiments 75-77, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703.

79. The antisense oligonucleotide of any one of embodiments 75-78, comprising at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in any one of SEQ ID NOs: 700-703.

80. The antisense oligonucleotide of any one of embodiments 75-79, comprising at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701.

81. The antisense oligonucleotide of any one of embodiments 75-79, comprising at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.

82. The antisense oligonucleotide of any one of embodiments 75-81, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339- 1342 or a portion thereof.

83. The antisense oligonucleotide of any one of embodiments 75-80 and 82-83, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof.

84. The antisense oligonucleotide of any one of embodiments 75-80 and 82-84, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. 85. The antisense oligonucleotide of any one of embodiments 75-79 and 81-82, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof.

86. The antisense oligonucleotide of any one of embodiments 75-79, 81-82, and 85, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof.

87. The antisense oligonucleotide of any one of embodiments 75-86, wherein the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.

88. The antisense oligonucleotide of any one of embodiments 75-87, wherein the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.

89. The antisense oligonucleotide of embodiment 88, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339.

90. The antisense oligonucleotide of embodiment 88, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340.

91. The antisense oligonucleotide of embodiment 88, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. 92. The antisense oligonucleotide of embodiment 88, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.

93. An antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

94. The antisense oligonucleotide of any one of embodiments 75-93, wherein the antisense oligonucleotide consists of 13-30 nucleotides.

95. The antisense oligonucleotide of any one of embodiments 75-94, wherein the antisense oligonucleotide consists of 13-25 nucleotides.

96. The antisense oligonucleotide of any one of embodiments 75-95, wherein the antisense oligonucleotide consists of 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

97. The antisense oligonucleotide of any one of embodiments 75-96, wherein the antisense oligonucleotide consists of 19, 20, 21, or 22 nucleotides.

98. The antisense oligonucleotide of any one of embodiments 75-97, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.

99. An antisense oligonucleotide consisting of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.

100. An antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.

101. The antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145.

102. The antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.

103. The antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.

104. The antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174- 1199.

105. The antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224. 106. The antisense oligonucleotide of any one of embodiments 75-100, wherein the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042- 1058, and 1225-1247.

107. The antisense oligonucleotide of any one of embodiments 75-100, wherein the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.

108. The antisense oligonucleotide of any one of embodiments 75-100, wherein the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.

109. The antisense oligonucleotide of any one of embodiments 75-100, wherein the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.

110. The antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232,

247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945.

111. The antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946- 951, 1104-1115, and 1314-1332.

112. The antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.

113. The antisense oligonucleotide of any one of embodiments 75-80 and 82-112, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof.

114. The antisense oligonucleotide of any one of embodiments 75-80 and 82-113, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof.

115. The antisense oligonucleotide of any one of embodiments 75-79 and 81-112, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. 116. The antisense oligonucleotide of any one of embodiments 75-79, 81-112, and 115, wherein the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof.

117. The antisense oligonucleotide of any one of embodiments 75-116, wherein the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.

118. The antisense oligonucleotide of any one of embodiments 75-117, wherein the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.

119. The antisense oligonucleotide of embodiment 118, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339.

120. The antisense oligonucleotide of embodiment 118, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340.

121. The antisense oligonucleotide of embodiment 118, wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341.

122. The antisense oligonucleotide of embodiment 118, wherein the antisense oligonucleotide is at least at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342. 123. The antisense oligonucleotide of any one of embodiments 75-100, 107-109, and 113-122, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.

124. The antisense oligonucleotide of any one of embodiments 75-123, wherein the antisense oligonucleotide comprises a modification.

125. The antisense oligonucleotide of any one of embodiments 75-124, wherein the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification.

126. The antisense oligonucleotide of any one of embodiments 75-125, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification, wherein 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide.

127. The antisense oligonucleotide of any one of embodiments 75-126, wherein at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification.

128. The antisense oligonucleotide of any one of embodiments 75-127, wherein the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O- Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.

129. The antisense oligonucleotide of any one of embodiments 75-128, wherein the modification is a 2’OMe antisense oligonucleotide.

130. A pharmaceutical composition comprising the antisense oligonucleotide of any one of embodiments 75-129.

131. The pharmaceutical composition of embodiment 130, comprising an excipient and/or a buffer. 132. A kit comprising the antisense oligonucleotide of any one of embodiments 75-129 or the pharmaceutical composition of embodiment 130 or embodiment 131.

EXAMPLES

[0305] The following examples are included for illustrative purposes only and are not intended to limit the scope of the present disclosure.

Example 1: Screening antisense oligonucleotide (ASO) to identify exemplary ASOs for modulating UNC13A transcript levels

[0306] This example describes the screening of candidate splice blocking antisense oligonucleotides (ASO) in human motor neurons for efficacy in increasing full-length UNC13A mRNA transcripts and reducing UNC13A mRNA transcripts containing the cryptic exon (UNC13A CE). This example demonstrates that UNC13A splice blocking ASOs have variable effects on modulating UNC13A and UNC13A cryptic exon (CE) transcript levels depending on the cryptic exon locus binding location.

Differentiation of human iPSCs into motor neurons

[0307] Human iPSC lines were obtained from public biobanks (Coriell Institute, NINDS) and maintained in mTeSRl media (StemCell Technologies) on Matrigel (Coming). iPSCs were fed daily and split every 4-7 days using ReLeSR (StemCell Technologies) according to manufacturer's instructions. Differentiation of iPSCs into motor neurons was carried out using 3D developmental pathways. iPSCs were dissociated and placed in ultra-low adhesion flasks (Coming) to form 3D spheroids in media containing DMEMF12/Neurobasal (Thermo Fisher), N2 supplement (Thermo Fisher), and B-27 supplement-Xeno free (Thermo Fisher). Small molecules were added to induce neuronal progenitor patterning of the spheroids, (LDN193189, SB-431542, Chir99021; Sigma), followed by motor neuron induction (RA, SAG, DAPT; Sigma). After 14 days, neuronal spheroids were dissociated with Papain and DNAse (Worthington Biochemical) and plated on Poly-D-Lysine/Laminin (Thermo Fisher) coated plates in Neurobasal medium (Thermo Fisher) containing neurotrophic factors (BDNF, GDNF, CNTF; R&D Systems). For viral transductions, neuronal cultures were incubated for 18 hours with media containing lentivirus particles. Infection efficiency of over 90% was assessed by GFP/RFP expression. Antisense oligonucleotide (ASO) screens

[0308] To determine ASO sequences that alter UNC13A levels upon reduction in TDP-43 levels, 118 splice blocking ASOs were designed to tile the cryptic exon region between exons 20 and 21 of the UNC13A transcript. Human iPSC line GM25256 was differentiated into motor neurons for 14 days using a 3D embryonic body (EB) developmental differentiation protocol. On Day 14, EBs were dissociated and plated on PDL/Laminin coated 96-well plates at a density of 35,000 cells/well. 5-6 days later, ASOs (with PS backbone and 2’MOE sugar modifications at 3pM) were added to cells through gymnotic delivery. 48 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TARDBP (sh3TDP43; AGATCTTAAGACTGGTCATTC (SEQ ID NO: 1343)) or a non-targeting shRNA (shNT; Cat # SHCTL-NT-pRSI16, Cellecta). 24 hours after viral transduction, a media exchange was performed to remove virus. Cells were lysed for RT-qPCR 9 days after viral transduction. RT-qPCR was performed using the TaqMan Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions with the following primer/probe sets: TARDBP (Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584_ml; Thermo Fisher), STMN2 (Assay ID: Hs00199796_ml; Thermo Fisher), UNC13A CE (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO: 1338)), and TBP (housekeeper; Assay ID: Hs00427620_ml; Thermo Fisher). Percent expression of each target was calculated using the delta delta CT method and normalized against the ASO 432 (SEQ ID NO:958) + shNT or ASO 434 (SEQ ID NO:959) + shNT treatment conditions (for UNC13A and STMN2) or the ASO 432 (SEQ ID NO:958) + sh3TDP43 or ASO 434 (SEQ ID NO:959) + sh3TDP43 treatment conditions (for UNC13A CE) . The change in UNC13A mRNA levels (FIGS. 1A and IB) and UNC13A CE mRNA levels (FIGS. 2A and 2B) upon TARDBP knockdown with ASO addition were plotted as a function of ASO location.

[0309] Of the 118 candidate ASOs tested, varying levels of recovery in UNC13A mRNA levels were seen upon ASO addition. Notably, these data revealed that there are specific regions of the UNC13A cryptic exon locus where ASO targeting exhibited a greater level of UNC13A modulation (FIGS. 1A, IB, 2A, and 2B). Targeting specific regions of the UNC13A cryptic exon locus was observed to improve the rescue of full-length UNC13A transcript levels and/or improve the attenuation of UNC13A CE levels. The data also revealed specific regions where ASOs exhibited correlated rescue of full-length UNC13A protein and reduction of UNC13A CE levels (FIGS. 3 A and 3B), depending on where they bind along the cryptic exon locus. In addition to the 5’ and 3’ splice junction site, strong modulation of UNC13A was also observed for ASOs targeting the middle of the cryptic exon locus (FIGS. IB, 2B, and 3B).

[0310] To control for possible off-target effects of ASO treatment in TDP-43 knockdown neurons, the change in STMN2 mRNA levels was plotted as a function of ASO targeting location on the UNC13A cryptic exon locus (FIGS. 3A and 3B; dashed line). These data show that candidate ASOs targeting the UNC13A cryptic exon locus are specific to UNC13A, as STMN2 levels were not altered upon treatment with ASOs.

Antisense oligonucleotide (ASO) selection

[0311] To select for top performing antisense oligonucleotides (ASOs), the percent of UNC13A full-length expression (x-axis) was plotted against the percent UNC13A CE expression (y-axis) for each ASO in the motor neuron sh3TDP43 -treated condition (FIG. 4). Top performing ASOs were selected based on two cutoff criteria that were likely to result in a significant biological effect: 1) ASOs that showed > 32% UNC13A full-length expression levels and 2) ASOs that showed < 83% UNC13A CE levels. This filtering resulted in the selection of ASO candidates comprising SEQ ID N0:20-40 provided in Table 4. The genomic location of these filtered ASO candidates on the UNC13A cryptic exon locus is further depicted in FIG. 5A, along with the four modulatory regions identified, shown in FIG. 5B.

Table 4: Top performing antisense oligonucleotides (ASO) sequences

[0312] The results indicate that select ASOs exhibited efficacy in modulating UNC13A mRNA levels upon TDP-43 knockdown, where full-length UNC13A mRNA levels were increased and/or UNC13A CE mRNA levels were reduced. These results support the use of select ASOs for increasing full-length UNC13A mRNA levels impacted by TDP43-associated pathologies.

Example 2: Antisense oligonucleotide (ASO) validation in cultured motor neurons

[0313] This example describes the validation of exemplary antisense oligonucleotides (ASO) identified in Example 1 in the modulation of UNC13A mRNA transcripts using cultured human motor neurons. This example demonstrates that UNC13A splice blocking ASOs significantly increase full-length UNC13A mRNA transcripts and significantly reduce UNC13A mRNA transcripts containing the cryptic exon (UNC13A CE).

Antisense oligonucleotide (ASO) validation in vitro

[0314] To validate selected antisense oligonucleotides (ASOs) from the screen described in Example 1, selected ASOs, locus-tiled inactive ASOs that were identified in the initial screen (431, 339, and 402), and control (non-UNC13A transcript targeting) ASOs (434) were used on iPSC line GM25256 derived motor neurons at a concentration of 3 pM. As a further control, some neurons were not treated with any ASOs (NT). Selected ASOs showed a sizable rescue of UNC13A transcript levels upon TDP-43 knock-down compared to controls (434 and NT conditions) and locus-tiled inactive ASOs (FIG. 6A). Selected ASOs achieved a maximum 50% expression of shNT treated UNC13A transcript levels, representing a nearly 3- fold increase from control samples with sh3TDP43 treatment, further validating the results of the initial screen. Select ASOs also showed a sizable depletion of UNC13A cryptic exon levels upon TDP-43 knock-down compared to controls and locus-tiled inactive ASOs (FIG. 6B). Selected ASOs achieved a maximum depletion of just below 50% UNC13A CE levels, validating the results of the initial screen.

[0315] As a control, TARDBP expression was assessed after ASO addition and showed no difference compared to control ASO samples (FIG. 6C). To control for possible off- target effects, changes in STMN2 mRNA levels upon TDP-43 knockdown were assessed and showed no difference compared to control ASO samples (FIG. 6D). This data showed that these ASOs are specific to UNC13A as they do not alter STMN2 levels upon TDP-43 knockdown.

Hit validation using extended neuronal culture and multiple ASO treatments

[0316] To test if extending neuronal culture time and thus neuronal maturation, as well as multiple dosings of ASOs, improved ASO potency, iPSC line GM26256 derived motor neurons were plated at a density of 50,000 neurons/well in a 96 well plate. Rat astrocytes (Lonza) at -8000 astrocytes/well were added to the cells at two weeks post culturing. At 23 days post plating, a control ASO (434; SEQ ID NO:959) or exemplary ASO 422 (SEQ ID NO:36) were added at 3 pM to the cells through gymnotic delivery. At 26 days post plating, lentivirus was added to the cells encoding one of three scrambled control microRNAs (miRs) (TTCATAGCCAAGATACGACTCC (SEQ ID NO: 1346);

AAGAGTAGGCCATAAAAATGGG (SEQ ID NO: 1347); TCATACTACGGTTTCATGCCTC (SEQ ID NO: 1348)) or one of three TDP-43 targeting miRs (TTCATAGCGTTGATACGACTCC (SEQ ID NO: 1349); TTGGCTTTGCTTAGAATTAGGA (SEQ ID NO: 1350); GAATGACCAGTCTTAAGATCTT (SEQ ID NO: 1351)). At 34 days post plating cells were re-dosed with the ASOs as done at day 23. At 48 days post plating, cells were lysed with the TaqMan Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific). Reverse transcriptase cDNA synthesis was performed according to the manufacturer's instructions. cDNA was used in a qPCR assay with human specific Taqman probes for TARDBP ((Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse:

TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584; Thermo Fisher), UNC13A CE (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO:1338)), and HPRT (Housekeeper; Assay ID: Hs99999909_ml; Thermo Fisher) as a housekeeper gene. Expression levels were determined by the delta delta CT method using one control miR, no ASO population as the baseline.

[0317] Expression data showed that with knockdown of TDP-43, UNC13A levels were reduced to less than 20% in neurons untreated with ASOs (FIG.7A; right panel). In neurons treated with splice modulating ASO 422, there showed marked and complete UNC13A level restoration (over 100%), similar to cells that did not undergo TDP-43 knockdown. Splice modulating ASO 422 also significantly reduced UNC13A cryptic exon levels to the level of cells that did not undergo TDP-43 knockdown (FIG. 7B; right panel). Further, it was demonstrated that treatment with ASO 422 did not alter TDP-43 levels (FIG.7C; right panel).

[0318] These results demonstrate that splice modulating ASOs can completely restore UNC13A levels to wild-type levels in neurons having significantly reduced TDP-43 levels. These data support the use of select ASOs in the treatment of TDP-43 -associated UNC13A deficiency pathologies.

Example 3: Antisense oligonucleotides (ASO) increase protein expression of UNC13A in cultured motor neurons

[0319] This example describes the assessment of UNC13A protein expression changes in cultured neurons in response to treatment with exemplary antisense oligonucleotides (ASO) described in Examples 1-2. This example demonstrates that several exemplary UNC13A splice blocking ASOs significantly increase UNC13A protein levels by western blot analysis.

[0320] To evaluate if UNC13A splice modulating ASOs restore UNC13A protein levels, GM25256 iPSC derived motor neurons were plated at the density of 3.5xl0 ⁵ cells/well. 5- 6 days later, ASOs (3 pM) were added to cells through gymnotic delivery. 48 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TDP-43 (sh3TDP43; AGATCTTAAGACTGGTCATTC (SEQ ID NO: 1343)) or a non-targeting shRNA (shNT; Cat # SHCTL-NT-pRSI16, Cellecta). 24 hours after viral transduction, a media exchange was performed to remove virus. Cells were lysed for immunoblotting 14 days after viral transduction in RIPA buffer. Cells were lysed in ice-cold RIPA buffer (Teknova) supplemented with protease inhibitor cocktail (Thermo Fisher) and PMSF (Cell Signaling Technologies). Lysates were then sonicated in a water bath for 5 minutes and pelleted in a centrifuge at maximum speed for 10 minutes at 4°C. A bicinchoninic acid assay was run on the harvested lysate supernatants to determine protein concentration. 32-35pg of protein for each sample was denatured, loaded onto aNuPage 3-8% Tris Acetate gel, and run for ~lhr at 200V. The gel was then transferred onto a 0.45 pm nitrocellulose membrane at 100V for 2 hours on ice using a wet transfer method. Membranes were blocked for 30 minutes in a 1:1 ratio of Intercept Blocking Buffer to TBS then incubated overnight at 4°C in a 1 :2 ratio of Intercept Blocking Buffer to TBST containing antibodies against UNC13A (Synaptic Systems) and GAPDH (R&D System). Membranes were subsequently incubated for 1 hour at room temperature in a 1 :2 ratio of Intercept Blocking Buffer to TBST containing 680RD donkey anti-rabbit IgG (Li-Cor) for UNC13A or 800CW donkey anti -goat IgG (Li-Cor) for GAPDH. Blots were imaged on the Li- Cor Odyssey Fc instrument. The intensity of each band was quantified using Empiria Studio software and UNC13A bands were normalized to their respective GAPDH signals. Percent UNC13A protein levels were calculated normalized to the ASO 432 plus shNT sample.

[0321] The western blot results demonstrate that several UNC13A splice blocking ASOs significantly increase UNC13A protein expression (FIG. 8A). Western blot bands were quantified to determine the percent increase in UNC13A protein expression upon exemplary ASO treatment (FIG. 8B). UNC13A protein expression was maximally increased to 65% of control levels in TDP-43 knockdown neurons treated with exemplary ASOs, compared to about 15% in TDP-43 knockdown neurons treated with a control ASO.

[0322] These results demonstrate for the first time that treatment of TDP-43 knockdown neurons with ASOs increases the protein expression of UNC13A. Further, these results demonstrate that ASOs targeting the interior region of the UNC13A cryptic exon locus, for example, ASO 422, significantly increase the UNC13A protein expression in TDP-43 knockdown neurons. These results support the use of ASOs, including ASOs targeting the interior region of the UNC13A cryptic exon locus, for increasing full-length UNC13A protein levels in subjects impacted by TDP-43-associated pathologies.

Example 4: Antisense oligonucleotide (ASO) dose response analysis in neuronal cell culture

[0323] To assess if ASOs can change UNC13A levels in a dose response manner, GM25256 iPSC derived motor neurons were incubated with varying amounts of ASOs. 48 hours after ASO addition, cells are transduced with lentivirus expressing an shRNA targeting TDP-43 (sh3TDP43) or a non-targeting shRNA (shNT). RT-qPCR is used to determine expression of UNC13A.

[0324] This example describes the dose response analysis for exemplary antisense oligonucleotides (ASO) in cultured neuronal cells, assessing changes in UNC13A expression, UNC13A cryptic exon (CE) expression, and UNC13A protein expression levels. This example demonstrates that several UNC13A splice blocking ASOs i) increase UNC13A expression levels, ii) reduce UNC13A CE expression, and iii) increase UNC13A protein levels in TDP43- depleted cells in a dose dependent manner.

Differentiation of human iPSCs into motor neurons

[0325] Human iPSC lines were obtained from public biobanks (GM25256, NDS00262, NDS00209, NDS00235) and maintained in mTeSRl media (StemCell Technologies) on Matrigel (Coming). iPSCs were fed daily and split every 4-7 days using ReLeSR (StemCell Technologies) according to manufacturer's instructions. Differentiation of iPSCs into motor neurons was carried out using 3D developmental pathways. iPSCs were dissociated and placed in ultra-low adhesion flasks (Coming) to form 3D spheroids in media containing DMEMF12/Neurobasal medium (Thermo Fisher), N2 Supplement (Thermo Fisher), and B-27 Supplement-Xeno Free (Thermo Fisher). Small molecules were added to induce neuronal progenitor patterning of the spheroids, (LDN193189, SB-431542, Chir99021), followed by motor neuron induction (RA, SAG, DAPT). After 14 days, neuronal spheroids were dissociated with Papain and DNAse (Worthington Biochemical) and plated on Poly-D- Lysine/Laminin (Thermo Fisher) coated 96-well plates (Perkin Elmer) in Neurobasal medium (Thermo Fisher) containing neurotrophic factors (BDNF, GDNF, CNTF; R&D Systems). Infection efficiency of over 90% was assessed by GFP/RFP expression.

Assessing antisense oligonucleotide (ASO) RNA dose response

[0326] To assess if exemplary modified ASOs (with PS backbone and 2’MOE sugar modifications) can change UNC13A RNA levels in a dose response manner, GM25256 (GM) iPSC derived motor neurons were plated on PDL/Laminin coated 96-well plates at a density of 35,000 cells/well. 6 days later, ASOs (3 pM, 0.6 pM, 0.12 pM, or 0.024 pM) were added to cells through gymnotic delivery. 48 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TDP43 (sh3TDP43; AGATCTTAAGACTGGTCATTC (SEQ ID NO: 1343)) or a non-targeting shRNA (shNT; Cat # SHCTL-NT-pRSI16, Cellecta). 24 hours after viral transduction, a media exchange was performed to remove virus. Cells were lysed for RT-qPCR 11 days after viral transduction. RT-qPCR was performed using the TaqMan Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions for TARDBP (Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584_ml; Thermo Fisher), STMN2 (Assay ID: Hs00199796_ml; Thermo Fisher), UNC13A Cryptic Exon (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO: 1338)), and TBP (housekeeper; Assay ID: Hs00427620_ml; Thermo Fisher). Percent expression of each target was calculated using the delta delta CT method and normalized against the ASO 432 plus shNT treatment condition (except UNC13A CE, which was normalized to the ASO 432 plus sh3TDP43 treatment condition).

[0327] Results of this assessment showed that treatment with select ASOs increased full-length UNC13A expression levels in neurons with TDP-43 knockdown in a dose dependent manner (FIGS. 9A and 9B). For each ASO treatment condition, the greatest increase was observed with 3 pM ASO concentration. ASOs 355-357 increased the UNC13A expression in TDP43 knockdown neurons to over 55% of UNC13A expression cells that did not undergo TDP- 43 knockdown, representing a significant improvement over neurons with TDP-43 knockdown treated with ASO 432 (non-targeting ASO control). Similarly, treatment with select ASOs decreased the expression of UNC13A CE in a dose-dependent manner (FIGS. 9C and 9D). Marked decreases were observed for UNC13A CE expression when treating with, for example, ASOs 355-363, where UNC13A CE expression was reduced to under 40% compared to neurons with TDP43 knockdown treated with ASO 432 (non-targeting ASO control). These data show that ASOs have varying degrees of activities.

[0328] Control experiments for TDP-43 (FIG. 9E) and STMN2 (FIG. 9F) expression levels are shown. In FIG. 9E, TDP-43 expression levels for each ASO treatment condition were compared to the mean and standard deviation of TDP-43 knockdown cells with non-targeting ASO, represented by the dotted line and gray bar. In FIG. 9F, STMN2 expression levels for each ASO treatment condition were compared to the mean and standard deviation of TDP-43 knockdown cells with non-targeting ASO, represented by the dotted line and gray bar. These data suggest that treatment with ASOs at each of the four doses is specific for UNC13A splice blocking and does not affect TDP-43 or STMN2 expression levels.

[0329] These results demonstrate that UNC13A splice blocking ASOs can substantially restore full-length UNC13A expression levels and significantly reduce UNC13A CE expression in TDP-43-depleted cells in a dose dependent manner.

Generating HiBit cell line to measure UNC13A protein levels

[0330] HiBiT is a small 11 -amino acid epitope tag that enables the detection of tagged endogenous proteins. Using bioluminescence-based detection, the HiBiT assay allows for rapid quantification of HiBiT tagged proteins within a wide dynamic range, and is especially useful for detecting endogenous proteins without overexpression. To generate a HiBit cell line for quantifying endogenous UNCA13A protein, GM25256 from Cori ell Institute (GM) iPSCs were dissociated into single cells using Accutase (StemCell Technologies) and 800,000 cells were resuspended in 100 pL of Lonza P3 Primary Cell Nucleofector Solution with Supplement 1 (Lonza). Separately, 10 pg of HiFi Cas9 v3 (IDT) and 8 pg of sgRNA (UCGGCCGACCGCCCGCGCUAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 1352); IDT) targeting the C-terminus of UNC13A were incubated together for 10 minutes at room temperature to form a ribonucleoprotein (RNP) complex, and then immediately placed on ice. The RNP solution and 400 pmol of the HiBit tag-containing ssODN (CACGCGCTCCGCCGAGGAGGGCGGTGCCGCGCCTGCGCCTGGCTCGAGCGGCGTGA GCGGCTGGCGGCTGTTCAAGAAGATTAGCTAGCGCGGGCGGTCGGCCGAGCGGCAC TGCGCCTGCGCGGAGG (SEQ ID NO: 1353); IDT) were added to the cell suspension and gently mixed. The cell suspension was moved into the Nucleocuvette Vessel (Lonza) and electroporated with the 4D-Nucleofector (Lonza) using the CA-137 protocol. 500pL of prewarmed mTeSRl (StemCell Technologies) supplemented with Y-27632 (lOpM, Sigma- Aldrich), and 10% CloneR (StemCell Technologies) was added directly to the cuvette and allowed to incubate at room temperature for 2 minutes. The cell suspension was then seeded very sparsely into 6-well plates (Coming) with mTeSRl (StemCell Technologies) supplemented with Y-27632 (lOpM, Sigma-Aldrich), 10% CloneR (StemCell Technologies) and IpM Alt-R HDR enhancer (IDT) and incubated at 37°C with 5% C02 to allow for individual colony formation. Media was changed 24 hours later. Once individual colonies had grown to a reasonable size, they were picked into 96-well plates and expanded. To check for correct HiBit tag insertion, gDNA was extracted from each clone. PCR was performed to amplify UNC13A around the HiBit tag insertion and the resulting PCR products were purified and sent out for Sanger Sequencing (Genewiz). Sequencing results were analyzed using ICE analysis software (Synthego) to identify successfully engineered clones with homozygous knock-in of the HiBit tag. To check for functional HiBit tag expression, potential engineered HiBit-tagged iPSC clones underwent a differentiation into motor neurons alongside unedited GM iPSCs. The resulting motor neurons from both iPSC types were plated at different densities. Cells were lysed for HiBit assay 14 after plating. The HiBit assay was performed using the Nano-Gio HiBit Lytic Detection System (Promega) according to the manufacturer's instructions. Luminescence signal was measured using the Envision 2104 plate reader (Perkin Elmer). Only engineered HiBit-tagged cells produced a luminescence signal compared to unedited GM cells, and this luminescence signal was proportional to cell density. Additionally, UNC13A levels were perturbed in potential engineered HiBit-tagged motor neurons by transduction with a lentivirus expressing an shRNA targeting TDP43 (sh3TDP43) 7 days after plating. 24 hours after viral transduction, a media exchange was performed to remove virus. Cells were lysed for HiBit assay 7 days after viral transduction. Luminescence signal was significantly reduced in sh3TDP43 treated neurons compared to non-treated neurons, helping to confirm that UNC13A was correctly tagged with HiBit in these cells. A cell pellet of the final engineered HiBit-tagged line was sent out for Agilent 180K Standard aCGH+SNP microarray testing (Cell Line Genetics) to ensure normal karyotyping and clonality of the line.

Measuring antisense oligonucleotide (ASO) protein dose response with HiBit cell line

[0331] To assess if antisense oligonucleotides (ASO) alter UNC13A protein levels in a dose dependent manner, HiBit-tagged iPSC derived motor neurons were plated on PDL/Laminin coated 96-well plates at a density of 35,000 cells/well. 6 days later, varying concentrations of ASOs (3 pM, 0.6 pM, 0.12 pM, or 0.024 pM) were added to cells through gymnotic delivery. 48 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TDP43 (sh3TDP43) or a non-targeting shRNA (shNT). 24 hours after viral transduction, a media exchange was performed to remove virus. Cells were lysed for HiBit assay 14 days after viral transduction. The HiBit assay was performed using the Nano-Gio HiBit Lytic Detection System (Promega) according to the manufacturer's instructions. Half of the HiBit lysates were taken for a cell viability assay using the CellTiter-Glo 2.0 Cell Viability Assay (Promega) according to the manufacturer's instructions. Luminescence signal was measured using the Envision 2104 plate reader (Perkin Elmer) and the HiBit signal was normalized to the cell viability signal. Percent HiBit signal was calculated by normalizing to the ASO 432 plus shNT treatment condition.

[0332] These results showed that treatment with select ASOs increased full-length UNC13A protein levels in neurons with TDP43 knockdown in a dose dependent manner (FIGS. 10A and 10B). Individual dose-dependent results for each ASO treatment condition are shown in FIG. 10A, and all ASO treatment conditions are shown together in FIG. 10B. For nearly all ASOs, the greatest increase was observed with 3 pM ASO concentration. ASOs 355-357, 363, and 421 increased the UNC13A protein expression to over 75% of shNT treated neurons, representing a significant improvement over neurons with TDP43 knockdown treated with ASO 432 (non-targeting ASO control). The observed rank order of increased the UNC13A protein expression with 3 pM ASO is shown in FIG. 10C. Further, the observed correlation of UNC13A mRNA expression and UNC13A protein expression for the four-point dose response analysis is shown in FIG. 10D. These data show that ASOs have varying degrees of activities.

[0333] These results demonstrate that UNC13A splice blocking ASOs substantially restore full-length UNC13A protein levels in TDP43 -depleted cells in a dose dependent manner. Collectively, these results demonstrate that UNC13A splice blocking ASOs significantly i) increase UNC13A expression levels, ii) reduce UNC13A CE expression, and iii) increase UNC13A protein levels in TDP43 -depl eted cells in a dose dependent manner.

Example 5: Antisense oligonucleotide (ASO) restoration of UNC13A RNA and protein in cultured neurons

[0334] This example describes the dose response analysis for exemplary antisense oligonucleotides (ASO) in cultured neuronal cells, where changes in UNC13A RNA and protein expression levels are assessed in parallel. This example demonstrates that several UNC13A splice blocking ASOs increase UNC13A expression levels and UNC13A protein levels in TDP43 -depleted cells in a dose dependent manner. Assessing UNC13A RNA and protein restoration

[0335] HiBit-tagged iPSC derived motor neurons were plated on PDL/Laminin coated 96-well plates at a density of 35,000 cells/well. 6 days after plating, cells were treated w/ 5-Fluoro-2’-deoxyuridine (5FU) (4 pg/mL, Sigma-Aldrich). 24 hours after 5FU addition, a media exchange was performed to remove 5FU. 10 days after plating, varying concentrations of modified ASOs (with PS backbone and 2’MOE sugar modifications; at 3 pM or 0.024 pM) were added to cells through gymnotic delivery. 72 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TDP43 (sh3TDP43) or a non-targeting shRNA (shNT). 24 hours after viral transduction, a media exchange was performed to remove virus. 15 days after viral transduction, cells were lysed for either RT-qPCR or HiBit assay. RT-qPCR was performed using the TaqMan Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions for TARDBP (Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584_ml (Thermo Fisher)), STMN2 (Assay ID: Hs00199796_ml (Thermo Fisher)), UNC13A Cryptic Exon (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO: 1338)), and TBP (housekeeper; Assay ID: Hs00427620_ml (Thermo Fisher)). Percent expression of each target was calculated using the delta delta CT method and normalized against the ASO 432 plus shNT treatment condition. The HiBit assay was performed using the Nano-Gio HiBit Lytic Detection System (Promega) according to the manufacturer's instructions. Half of the HiBit lysates were taken for a cell viability assay using the CellTiter-Glo 2.0 Cell Viability Assay (Promega) according to the manufacturer's instructions. Luminescence signal was measured using the Envision 2104 plate reader (Perkin Elmer) and the HiBit signal was normalized to the cell viability signal. Percent HiBit signal was calculated by normalizing to the ASO 432 plus shNT treatment condition.

[0336] Results from the two-point dose response assessment showed that TDP43- depleted cultured neurons treated with select ASOs increased UNC13A full-length mRNA expression levels (FIG. 11A) and UNC13A protein expression levels (FIG. 11B). ASOs 355 - 363 and 421-423 increased UNC13A mRNA expression levels to over 50% of control (shNT plus ASO 432) when administered at 3 pM concentration (FIG. 11A). Similarly, ASOs 355 - 363, 419, and 421-423 increased UNC13A protein expression levels to over 75% of control (shNT plus ASO 432) when administered at 3 pM concentration (FIG. 11B). ASOs 355 - 357 also increased UNC13A protein expression levels to over 75% of control (shNT plus ASO 432) when administered at 0.024 pM concentration. TDP43 -depleted neurons treated with ASO 356 showed UNC13A protein expression restored to over 90% of control (shNT plus ASO 432). Further, UNC13A mRNA and protein levels after treatment with exemplary ASOs showed good correlation, as shown in FIG. 11C. Together, these expression data for both UNC13A mRNA and protein levels showed that ASOs have varying degrees of activities.

[0337] These results demonstrated that UNC13A splice blocking ASOs significantly restore full-length UNC13A mRNA and protein levels in TDP43 -depleted cells, and these increases in UNC13A mRNA and protein levels are correlated.

Example 6: Validating exemplary antisense oligonucleotide (ASO) in additional human iPSC lines

[0338] ASOs identified in regions 1-4 of the UNC13A mRNA transcript are validated in additional iPSC lines according to the methods provided in Example 1. Additional iPSC lines may include patient iPSCs, iPSC lines with TDP-43 mutations, iPSC lines with UNC13A risk alleles, and/or iPSC lines without UNC13A risk alleles.

[0339] This example describes the effect of exemplary antisense oligonucleotides (ASO) to modulate UNC13A mRNA expression and UNC13A cryptic exon (CE) expression in multiple human iPSC-derived lines, including control human iPSC lines and TDP-43 mutant patient lines. This example demonstrates that UNC13A cryptic exon (CE) splice blocking ASOs i) increase UNC13A expression levels and ii) reduce UNC13A CE expression in multiple different genetic backgrounds, including patient iPSC-derived TDP-43 mutant neurons.

Differentiation of human iPSCs into motor neurons

[0340] To test whether ASOs can perform similarly across different genetic backgrounds, select ASOs were evaluated across four different human iPSC lines for changes in UNC13A and of UNC13A cryptic exon (CE) expression levels. Of the four human iPSC lines used in this evaluation, two lines were derived from healthy individual lines (GM25256 from Coriell Institute (GM/WTC11), NCRM-5 fromNINDS (005)) and two lines were derived from TDP43 mutant variant patient lines (4048 and 4157). Briefly, human iPSC lines were obtained from public biobanks (GM and (005), (4048), (4157)) and maintained in mTeSRl media (StemCell Technologies) on Matrigel (Coming). iPSCs were fed daily and split every 4-7 days using ReLeSR (StemCell Technologies) according to manufacturer's instructions. Differentiation of iPSCs into motor neurons was carried out using 3D developmental pathways. iPSCs were dissociated and placed in ultra-low adhesion flasks (Coming) to form 3D spheroids in media containing DMEMF12/Neurobasal medium (Thermo Fisher), N2 Supplement (Thermo Fisher), and B-27 Supplement-Xeno Free (Thermo Fisher). Small molecules were added to induce neuronal progenitor patterning of the spheroids, (LDN193189, SB-431542, Chir99021), followed by motor neuron induction (RA, SAG, DAPT). After 14 days, neuronal spheroids were dissociated with Papain and DNAse (Worthington Biochemical) and plated on Poly-D- Lysine/Laminin (Thermo Fisher) coated 96-well plates (Perkin Elmer) in Neurobasal medium (Thermo Fisher) containing neurotrophic factors (BDNF, GDNF, CNTF; R&D Systems). Infection efficiency of over 90% was assessed by GFP/RFP expression.

Assessing antisense oligonucleotide (ASO)-dependent changes in UNC13A and UNC13A cryptic exon (CE) expression in multiple human iPSC lines

[0341] iPSC derived motor neurons were plated on PDL/Laminin coated 96-well plates at a density of 35,000 cells/well. 5 days later, varying concentrations of ASOs (with PS backbone and 2’MOE sugar modifications at 3 pM and 0.12 pM) were added to cells through gymnotic delivery. 48 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TDP43 (sh3TDP43) or a non-targeting shRNA (shNT). 24 hours after viral transduction, a media exchange was performed to remove virus. Cells were lysed for RT-qPCR 9 days after viral transduction. RT-qPCR was performed using the TaqMan Fast Advanced Cells- to-CT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions for TARDBP (Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584_ml (Thermo Fisher)), STMN2 (Assay ID: Hs00199796_ml (Thermo Fisher)), UNC13A Cryptic Exon (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO: 1338)), and TBP (housekeeper; Assay ID: Hs00427620_ml (Thermo Fisher)). Percent expression of each target was calculated using the delta delta CT method and normalized against the ASO 432 plus shNT treatment condition (except UNC13A CE, which was normalized to the ASO 432 plus sh3TDP43 treatment condition).

[0342] Treatment of four different iPSC-derived motor neurons with exemplary ASOs was investigated. For both iPSC lines derived from healthy control patients with shRNA mediated TDP-43 depletion, treatment with ASOs showed an increase in UNC13A mRNA expression (FIG. 12A; GM line and FIG. 13A; 005 line). ASOs 355-363 increased UNC13A mRNA expression to over 40% of shNT treated neurons in the GM line and to over 45% of shNT treated neurons in the 005 line at 3 pM ASO concentration. Further, there was a decrease in UNC13A CE expression compared to control (ASO 432 +sh3TDP43) after the select ASOs were delivered to the GM (FIG. 12B) and 005 (FIG. 13B) neuronal cultures. A reduction of at least 50% of the UNC13A CE isoform was observed for both control lines when treated with ASOs 355-363, 419, 421, and 423.

[0343] Two iPSC-derived motor neurons were differentiated from patients with a TDP-43 mutation (4048 line and 4157 line). When treated with exemplary ASOs, the 4048 line (FIG. 14A) and 4157 line (FIG. 15A) showed similar increases in UNC13A mRNA expression. ASOs 355-363 increased UNC13A mRNA expression to over 50% of shNT treated cells in the 4048 line (FIG. 14A) and over 65% of shNT treated cells in the 4157 line (FIG. 15A). A significant decrease in UNC13A CE expression was also observed in both TDP-43 mutant lines after being treated with select ASOs compared to control (ASO 432 + sh3TDP43) (FIG. 14B; 4048 line and FIG. 15B;4157 line).

[0344] The data from all four tested lines for UNC13A mRNA expression was cumulatively plotted in FIG. 16A. Similarly, the cumulative data for UNC13A CE expression across the four tested lines was plotted in FIG. 16B. These results showed that the ASOs have similar activities and potencies across multiple iPSC-derived neuronal lines with different genetic backgrounds. These results demonstrate that UNC13A splice blocking ASOs significantly i) increase UNC13A mRNA expression and ii) decrease UNC13A CE expression in multiple patient cell lines of varying genetic backgrounds, including healthy human iPSC lines and TDP-43 mutant patient lines. Example 7: Evaluation of culture length impact on antisense oligonucleotide (ASO) restoration of UNC13A expression

[0345] This example describes the evaluation of the impact of extended culture conditions on antisense oligonucleotide (ASO) activity. This example demonstrates that a longer culture allowed for a full restoration of UNC13A expression in multiple iPSC lines with depleted TDP43.

ASO Hit validation using extended neuronal culture and multiple ASO dosing in multiple iPSC lines

[0346] To test if extending neuronal culture time and thus neuronal maturation, as well as multiple doses of modified ASOs (with PS backbone and 2’MOE sugar modifications), effects ASO potency, GM25256 from Cori ell Institute (GM/WTC11; GM line) and NCRM-5 from NINDS (005 line) iPSC-derived motor neurons were plated and cultured at a density of 50,000 cells/well in 96-well plates. Rat astrocytes at about 8,000 astrocytes/well were added to the cells at two weeks post culturing. 22 days post plating, TDP43 was knocked down with a Gapmer ASO (AAGGCTTCATATTGTACTTT; SEQ ID NO: 1344) or treated with a control gapmer (GCGACTATACGCGCAATATG; SEQ ID NO: 1345) at 3 different doses (3, 0.1, or 0.3 pM) through gymnotic delivery. 26 days post culturing, a control ASO (432 (GM) or 431 (005)) or one of two select UNC13A splice blocking ASOs (359 and 422) were added at 3 pM via gymnotic delivery. At 33 days post plating cells were re-dosed with the control ASO or select UNC13A splice blocking ASOs, as was done at day 26 post culturing. At 41 days post plating, cells were lysed for RT-qPCR. RT-qPCR was performed using the TaqMan Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions for TARDBP (Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584_ml (Thermo Fisher)), STMN2 (Assay ID: Hs00199796_ml (Thermo Fisher)), UNC13A Cryptic Exon (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO: 1338)), an&HPRTl (housekeeper; Assay ID: Hs99999909_ml (Thermo Fisher)). Expression levels were determined by the delta delta CT method using the control gapmer, ASO 432 (or 431) population as the baseline (except for UNC13A CE, which was was normalized to the ASO 432 (or 431) plus TDP43 gapmer condition).

[0347] Neuronal maturity increases by extending the cell culture duration. Here, the effect of extending culturing and treatment time, as well as treatment with multiple doses of ASOs, was investigated in the GM line and 005 line. In the GM line, UNC13A expression data showed that with medium and high levels of TDP43 knockdown, UNC13A expression levels were less than 20% of control conditions. In neurons treated with splice modulating ASOs, UNC13A expression levels were fully restored to the level of control cells that did not undergo TDP43 knockdown (FIG. 17A). Similar results were obtained for the 005 line, as shown in FIG. 17B, demonstrating full rescue of UNC13A expression with splice correcting ASOs in two independent iPSC lines. Further, splice modulating ASOs also reduced UNC13A cryptic exon levels to those of cells with TDP-43 (FIG. 17C-17D) without altering TARDBP (FIG. 17E and FIG. 17G) or STMN2 (FIG. 17F and FIG. 17H) expression levels in the GM and 005 lines, respectively .

[0348] These results demonstrate that longer neuronal culturing and multiple dosing of splice modulating ASOs completely restore UNC13A expression levels in multiple lines with significantly reduced levels of TDP-43 levels.

Example 8: Evaluation of antisense oligonucleotide (ASO) off-target effects

[0349] Off-target effects of the ASOs identified in regions 1-4 of the UNC13A mRNA transcript according to the methods provided in Example 1.

[0350] This example describes the evaluation of off-target effects on neuronal health and morphology following antisense oligonucleotide (ASO) treatment, where ASOs were modified with PS backbone and 2’MOE sugar modifications. This example demonstrates that ASOs generally do not impact neurite morphology or health. Further, this example identifies ASOs that negatively impact neurite morphology, highlighting the importance of evaluating off- target effects.

[0351] iPSC derived motor neurons were plated on PDL/Laminin coated 96-well plates at a density of 10,000 cells/well. 6 days later, ASOs (3pM) were added to cells through gymnotic delivery. On Day 14 after plating, ASOs (3pM) were added to cells through gymnotic delivery again for a second dose. Cells were fixed for imaging 17 days after plating (11 days after first ASO dose). Cells were stained for Tujl (801201; BioLegend) and Isletl (AF1837; R&D Systems) and imaged using an Operetta CLS (PerkinElmer).

[0352] The morphology and health of the treated neurons were evaluated to assess morphological changes and possible toxicity associated with ASO treatment. As shown in FIG. 18A, treated neurons were assessed for nuclear area after treatment with ASOs. Nearly all treated samples displayed a nuclear area comparable to control neurons, suggesting that ASO treatment is generally not associated with morphological changes. ASOs 323 and 426, which target Region 1, were observed to have a decreased nuclear area (FIG. 18A). Neurons treated with ASOs 323 and 426 displayed visible morphological changes as assessed through Tuj 1 staining for neurites, that were not seen in neurons treated with other ASOs (FIG. 18B).

[0353] These results demonstrate that treatment with ASOs is rarely associated with changes in neuron nuclear area or other morphological changes. These results support further investigation to determine the full safety and efficacy profile for the clinical use of ASOs.

Example 9: Antisense oligonucleotide (ASO) sequence modification and optimization

[0354] This example describes the sequence optimization of UNC13A antisense oligonucleotides (ASO) for improved efficacy, for example, increasing UNC13A protein levels in a subject impacted by TDP43-associated pathologies.

[0355] Modified UNC13A splice blocking ASO sequences are generated having variable lengths and a variable number of modifications targeting identified region 1-4 of the UNCI 3 mRNA transcript. Exemplary modified ASOs range in length between 16-25 nucleotides. Other exemplary modified ASOs contain one or more modified nucleotide, for example, a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide) including, but not limited to deoxynucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides, non-natural base-comprising nucleotides, bridged nucleotides, peptide nucleic acids, 2',3'-seco nucleotide mimics, locked nucleotides (e.g., LNAs), 3'-O- Methoxy nucleotides, 2'-F- Arabino nucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, and vinyl phosphonate nucleotides, 2'-O-methyl nucleotides, 2'-deoxy-2'- fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxy ethyl nucleotides, 2'-amino nucleotides, and 2'-alkyl nucleotides. [0356] Modified UNC13A splice blocking ASOs were tested in freshly prepared motor neurons as described in Examples 1, 2, and 3.

Example 10: Antisense oligonucleotide (ASO) sequence modification and optimization

[0357] This example describes the investigation of antisense oligonucleotide (ASO) sequence length modification on ASO potency and safety for select ASOs. This example demonstrates that ASOs of different lengths targeting two select regions of the UNC13A cryptic exon have varied activity. This example also demonstrates that ASOs containing between 13-17 nucleotides increase UNC13A expression and reduce UNC13A cryptic exon (CE) expression.

Optimizing and modifying ASO sequences

[0358] Modified ASOs (with PS backbone and 2’MOE sugar modifications) of varying sequence length were screened in human iPSC-derived neurons to determine the effects of ASO length on potency (13-24mer nucleotides across two select regions of UNC13A cry ptic exon identified from our initial ASO screen as described in Examples 1-9). GM25256 from Coriell Institute (GM/WTC11) iPSC-derived motor neurons were plated on PDL/Laminin coated 96-well plates at a density' of 35,000 cells/well. 5 days later, ASOs (3 pM) were added to cells through gymnotic delivery. 48 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TDP43 (sh3TDP43) or a non-targeting shRNA (shNT). 24 hours after viral transduction, a media exchange was performed to remove virus. Cells were lysed for RT-qPCR 9 days after viral transduction. RT-qPCR was performed using the TaqMan Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions for TARDBP (Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584_ml (Thermo Fisher)), STMN2 (Assay ID: Hs00199796_ml (Thermo Fisher)), UNC13A Cryptic Exon (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO: 1338)), and TBP (housekeepeing; Assay ID: Hs00427620_ml (Thermo Fisher ) ). Percent expression of each target was calculated using the delta delta CT method and normalized against the ASO 432 plus shNT treatment condition.

[0359] Select ASOs (SEQ ID NOs: 960-1332; Table 2B), which target an extended region 2 (GGTGAATGAATGAATGATTGAACAGATGAATGAGTGATGAGT; SEQ ID NO: 1340) and an extended region 4 (GAGAGATGGGTGAGTACATGGATGGATAGATGGAT; SEQ ID NO: 1342) of the UNC13A cry ptic exon and have different nucleotide lengths (between 13-24 nucleotides), were tested in GM iPSC-derived motor neurons to determine changes in UNC13A and UNC13A CE expression levels (FIGS. 19A-19R, targeting region 2; and 20A-20R, targeting region 4). For each region tested, ASOs having 13 nucleotides (FIGS. 19A-19B and 20A-20B), 15 nucleotides (FIGS. 19C-19D and 20C-20D), 17 nucleotides (FIGS. 19E-19F and 20E-20F), 18 nucleotides (FIGS. 19G-19H and 20G-20H), 19 nucleotides (FIGS. 191-19 J and 201-20 J), 20 nucleotides (FIGS. 19K-19L and 20K-20L), 21 nucleotides (FIGS. 19M-19N and 20M-20N), 22 nucleotides (FIGS. 19O-19P and 200-20P), or 24 nucleotides (FIGS. 19Q-19R and 20Q-20R) nucleotides were tested. These results showed that ASOs of different length increase UNC13A expression and reduce have UNC13A CE expression with varied activities.

[0360] As shown in FIGS. 19A-19R, ASOs between 13-24 nucleotides in length targeting region 2 generally increased UNC13A expression and reduced UNC13 A CE expression proportionally to ASO length. For example, the least amount of activity was observed for 13mer ASOs (FIGS. 19A-19B) and the most amount of activity was observed for 20mer, 21mer, 22mer, and 24mer ASOs (FIGS. 19K-19R). Select results are summarized in Table 5.

[0361] For 13mer ASOs targeting region 2, UNC13A expression was elevated about 5-10% from control neurons treated with sh3TDP43 (FIG. 19A). The 13mer ASOs targeting region 2 also reduced UNC13A CE expression by about 5-10% from control neurons treated with sh3TDP43 (FIG. 20B). ASO activities related to increasing UNC13A expression and decreasing UNC13A CE expression improved for 15mer (FIGS. 19C-19D) and 17mer (FIGS. 19E-19F) ASOs targeting region 2, where at least 25% UNC13A expression compared to control (non-targeting, shNT) was achieved for 7.1% (2/28) of 15mer ASOs (FIG. 19C) and 38.5% (10/26) of 17mer ASOs (FIG. 19E). UNC13A CE expression for 15mer and 17mer ASOs targeting region 2 decreased to 75% or less compared to control (sh3TDP43) for 14.3% (4/28) of 15mer ASOs (FIG. 19D) and 26.9% (7/26) of 17mer ASOs (FIG. 19F). ASO activities related to increasing UNC13A expression and decreasing UNC13A CE expression improved further for 18mer (FIGS. 19G-19H) and 19mer (FIGS. 191- 19 J). ASOs targeting region 2, where at least 25% UNC13A expression compared to control (non-targeting, shNT) was achieved for 52% (13/25) of 18mer ASOs (FIG. 19G) and 65.2% (15/23) of 19mer ASOs (FIG. 191). UNC13A CE expression for 18mer and 19mer ASOs targeting region 2 decreased to 75% or less compared to control (sh3TDP43) for 32% (8/25) of 18mer ASOs (FIG. 19H) and 30.4% (7/23) of 19mer ASOs (FIG. 19J)

Table 5. Antisense oligonucleotides (ASO) targeting region 2 with elevated UNC13A splice modulation activity

[0362] The highest levels of activity were observed for 20mer, 21mer, 22mer, and

24mer ASOs targeting region 2 (FIGS. 19K-19R), where 87% (20/23) of 20mer ASOs (FIG. 19K), 90.1% (20/22) of 21mer ASOs (FIG. 19M), 90.5% (19/21) of 21mer ASOs (FIG. 190), and 78.9% (15/19) of 24mer ASOs (FIG. 19Q) achieved at least 25% UNC13A expression compared to control (non-targeting, shNT). UNC13A CE expression for 20mer, 21mer, 22mer, and 24mer ASOs targeting region 2 decreased to 75% or less compared to control (sh3TDP43) for 30.4% (7/23) of 20mer ASOs (FIG. 19L), 36.4% (8/22) of 21mer ASOs (FIG. 19N), 23.8% (5/21) of 22mer ASOs (FIG. 19P), and 21.1 % (4/19) of 24mer ASOs (FIG. 19R). UNC13A CE expression for 21mer ASOs targeting region 2 decreased to 50% or less compared to control (sh3TDP43) for 13.6% (3/22) (FIG. 19N).

[0363] As shown in FIGS. 20A-20R, ASOs between 13-24 nucleotides in length targeting region 4 generally increased UNC13A expression and reduced UNC13A CE expression. Each length tested (e.g., 13mer to 24mer ASOs) demonstrated high levels of activity, for example, at least 25% UNC13A expression compared to control (shNT) and 75% or less UNC13A CE expression compared to control (sh3TDP43), for two or more of the ASOs tested (Table 6). Table 6. Antisense oligonucleotides (ASO) targeting region 4 with elevated UNC13A splice modulation activity

[0364] The results showed that ASO activities for 13mer ASOs targeting region 4 increased UNC13A expression and decreased UNC13A CE expression (FIGS. 20A-B), where at least 25% UNC13A expression compared to control (non-targeting, shNT) was achieved for 8.7% (2/23) of 13mer ASOs (FIG. 20A). Further, UNC13A CE expression was decreased to 75% or less compared to control (sh3TDP43) for 17.4% (4/23) of 13mer ASOs targeting region 4 (FIG. 20B). The maximum activity for a 13mer ASO was observed for ASO Region 4 child 13 (SEQ ID NO:973) where about 35% UNC13A expression compared to control (non-targeting, shNT) was achieved, and UNC13A CE expression was decreased to about 35% compared to control (sh3TDP43).

[0365] ASO activities related to increasing UNC13A expression and decreasing UNC13A CE expression were observed for 15mer (FIGS. 20C-20D) and 17mer (FIGS. 20E- 20F) ASOs targeting region 4, where at least 25% UNC13A expression compared to control (non-targeting, shNT) was achieved for 23.8% (5/21) of 15mer ASOs (FIG. 20C) and 36.8% (7/19) of 17mer ASOs (FIG. 20E). UNC13A CE expression for 15mer and 17mer ASOs targeting region 4 decreased to 75% or less compared to control (sh3TDP43) for 33.3% (7/21) of 15mer ASOs (FIG. 20D) and 47.4%% (9/19) of 17mer ASOs (FIG. 20F). The maximum activity for a 15mer ASO targeting region 4 was Child_35 (SEQ ID NO995) with about 35% UNC13A expression increase compared to control (non-targeting, shNT), and UNC13A CE expression decreased to about 40% compared to control (sh3TDP43). The 17mer ASO Child 55 (SEQ ID NO: 1015) targeting region 4 achieved the highest increase of UNC13A expression observed. Child 55 increased UNC13A expression to over 45% compared to control (nontargeting, shNT) and expression of UNC13A CE decreased to less than 30%.

[0366] ASO activities related to increasing UNC13A expression and decreasing UNC13A CE expression were observed for 18mer (FIGS. 20G-20H) and 19mer (FIGS. 201- 20J) ASOs targeting region 4, where at least 25% UNC13A expression compared to control (non -targeting ASOs) was achieved for 38.9%% (7/18) of 18mer ASOs (FIG. 20G) and 64.7% (11/17) of 19mer ASOs (FIG. 201). UNC13A CE expression for 18mer and 19mer ASOs targeting region 4 decreased to 75% or less for 72.2% (13/18) of 18mer ASOs (FIG. 20H) and 82.4% (14/17) of 19mer ASOs (FIG. 20J). Several 18mer ASOs, for example Child _71 (SEQ ID NO: 1031), Child_72 (SEQ ID NO: 1032), and Child_73(SEQ ID NO: 1033), increased UNC13A expression to above 35% compared to control (non-targeting ASOs) and decreased UNC13A CE expression to below 30%. Several 19mer ASOs, for example Child 88 and Child_90-93 (SEQ ID NOs:1049, and 1051-1054) also increased UNC13A expression to about 35% compared to control (non-targeting ASOs) and decreased UNC13A CE expression to about 25%.

[0367] ASO splice modulation activity was observed for 20mer, 21mer, 22mer, and 24mer ASOs targeting region 4 (FIGS. 20K-20R), where 68.8% (11/16) of 20mer ASOs (FIG. 20K), 73.3% (11/15) of 21mer ASOs (FIG. 20M), 92.9% (13/14) of 22mer ASOs (FIG. 200), and 91.7% (11/12) of 24mer ASOs (FIG. 20Q) achieved at least 25% UNC13A expression compared to control (non-targeting ASOs). UNC13A CE expression for 20mer, 21mer, 22mer, and 24mer ASOs targeting region 4 decreased to 75% or less for 93.8% (15/16) of 20mer ASOs (FIG. 20L), 100% (15/15) of 21mer ASOs (FIG. 20N), 92.9% (13/14) of 22mer ASOs (FIG. 20P), and 100% (12/12) of 24mer ASOs (FIG. 20R) UNC13A CE expression for 21mer ASOs targeting region 4 decreased to 50% or less for 80% (12/15) of 21mer ASOs tested (FIG. 20N), 85.7% (12/14) of 22mer ASOs tested (FIG. 20P) , and 66.7% (8/12) of 24mer ASOs tested (FIG. 20R).

[0368] These results showed that ASOs of different length targeting region 4 each increase UNC13A mRNA expression decrease UNC13A CE mRNA expression. Additional analysis methods and results for multilength antisense oligonucleotide (ASO) experiments

[0369] Analysis of antisense oligonucleotide (ASO) ‘parent’ and ASO ‘child’ relationships and relative UNC13A rescue performance were performed using custom Python scripts. Each child sequence was linked to a longer parent sequence based on the child sequence being fully contained within the parent sequence. Cells were transduced with shRNA against TARDBP or control after ASO delivery.

[0370] To determine the interactions between ASO length and UNC13A cryptic exon binding position, we visualized the mean UNC13A mRNA expression performance of groups of ASO child sequences versus corresponding parent ASO sequences, for each parent sequence (FIGS. 21A-21B), noting that child sequences may share ASO parent sequences and vice versa. These analyses demonstrated discrete regions, for example, where region refers to sub-sequences or portion of the UNC13A cryptic exon, of peak enrichment of the relative performance of 20- mer and 21-mer ASOs versus longer ASOs (FIG. 21A). The average percentage of UNC13A mRNA expression from all cells treated with child ASOs of the indicated length contained within the sequences on the left is shown, where darker shading indicates higher UNC13A mRNA expression. In FIG. 21B, regions of peak depletion of the performance of 13- to 18-mer ASO child sequences are shown. Lighter shading indicated an increase in UNC13A mRNA expression for child ASOs of that length compared to the parent 24-mer, while darker shading indicates a decrease in UNC13A mRNA expression for child ASOs of that length compared to the parent 24-mer.

[0371] In a parallel analysis, every nucleotide within the UNC13A cryptic exon was mapped to every ASO with predicted base-pairing to that nucleotide. The average percent of UNC13A mRNA expression from each of these ASOs was then assigned to that nucleotide. The precent of UNC13A expression was plotted as a function of nucleotide location (FIGS. 22A- 22B), segmenting by the length of ASOs. ASOs targeting region 2 (FIG. 22A) and region 4 (FIG. 22B) with length <18 nucleotides demonstrated poorer restoration of the UNC13A mRNA expression in TDP-43 depleted cells. Interestingly, the location of ASOs providing peak restoration of UNC13A mRNA varied along the locus dependent on ASO length. For example, in Region 4 (FIG. 22B), a more 5’ ASO location provided greatest UNC13A mRNA expression for shorter ASOs, while longer ASOs induced stronger overall UNC13A mRNA expression and the peak of this expression increase came from ASOs that were located in a more 3’ position on the locus.

[0372] These data demonstrate a complex relationship between ASO cryptic exon binding position and length that affects ASO performance, highlighting the importance of testing of both ASO length and UNC13A cryptic exon binding sequence.

[0373] The present disclosure is not intended to be limited in scope to the particular disclosed embodiments, which are provided, for example, to illustrate various aspects of the present disclosure. Various modifications to the compositions and methods described will become apparent from the description and teachings herein. Such variations may be practiced without departing from the true scope and spirit of the disclosure and are intended to fall within the scope of the present disclosure.