| Document |
Document Title |
|
WO/2024/005575A1 |
The present application relates to a novel regulatory element for enhancing RNA stability or mRNA translation; ZCCHC2 interacting therewith; and uses thereof. Being capable of upregulating the expression of a target protein, the novel re...
|
|
WO/2024/006670A2 |
A stain-free quantitative viral plaque assay device uses lens-free holographic imaging and deep learning to quickly detect the plaque formations. The device captures phase and/or amplitude information of the plaque formations in containe...
|
|
WO/2024/006845A1 |
An in vitro method, composition and kit for determining the presence or absence of adenovirus, metapneumovirus, rhinovirus/enterovirus, and parainfluenza in a sample, including providing a reaction mixture containing the sample and at le...
|
|
WO/2024/006577A1 |
The present disclosure provides kits and/or methods of detecting and identifying epigenetic patterns associated with acute myeloid leukemia and other cancers. The present disclosure also relates to treating, preventing, ameliorating, or ...
|
|
WO/2024/006234A1 |
An apparatus includes a sequencing stage and an illumination assembly. The sequencing stage is configured to receive a flow cell that includes a. plurality of reaction sites. Each reaction site is configured to contain a biological sampl...
|
|
WO/2024/003260A1 |
The present disclosure relates, in general, to the methods for the rapid detection of the presence or absence of Lymphogranuloma Venereum (LGV)-causing serovars of Chlamydia trachomatis in a biological or non-biological sample. The metho...
|
|
WO/2024/004917A1 |
A nucleic acid that has been amplified in a reaction solution is detected easily and at good sensitivity. The detection system comprises a reaction unit, having an amplification unit that subjects the nucleic acid to an amplification rea...
|
|
WO/2024/003885A1 |
The present invention discloses a disease resistant cultivated basil plant and/or seed comprising a genomic sequence having an introgressed basil downy mildew (BDM) resistance or tolerance associated haplotype derived from Ocimum america...
|
|
WO/2024/006712A1 |
The technology relates in part to methods for preparation and analysis of proximity-ligated nucleic acids from single cells. This technology also relates in part to single-cell workflows for multiomic analyses of chromatin interactions, ...
|
|
WO/2024/001404A1 |
Provided are a primer group, a kit and a method for detecting various mutations of fragile X syndrome (FXS). The kit comprises the following reagents: (1) a reagent for long-fragment PCR amplification; (2) a reagent for PCR amplification...
|
|
WO/2024/001030A1 |
Disclosed in the present invention is a detection kit based on gene mutation related to recessive hereditary deafness, which relates to the technical field of kits. A reagent can be conveniently used in a special sealing mode of detachab...
|
|
WO/2024/005105A1 |
A method for measuring human cells, wherein the method includes a preparation step that prepares a sample containing human cells and non-human animal components derived from non-human animal cells, a lysis step that lyses the cell membra...
|
|
WO/2024/004648A1 |
[Problem] A mineralocorticoid receptor (MR) is activated due to various pathoses, and the excessive activation thereof is a risk factor of the onset of cerebrocardiovascular diseases. However, since there are no indicators for directly e...
|
|
WO/2024/005187A1 |
The composition according to the present disclosure includes edaravone and is used to change the expression level of a gene product in a target. The gene product is a gene product from one or more genes selected from KAZALD1, SBK1, SCN2A...
|
|
WO/2024/003350A1 |
The present invention relates to the field of oncology. More particularly, the present invention relates to a new combination therapy for use in treating melanoma.
|
|
WO/2024/000008A1 |
The present disclosure relates generally to methods and test kits for identifying SNPs associated with desirable meat eating quality traits in ovine animals. In particular, the present disclosure relates to a SNP-based diagnostic test an...
|
|
WO/2024/006983A1 |
Methods for the early detection of subjects at risk of developing rheumatoid arthritis, and subjects having early rheumatoid arthritis thus allowing for early intervention.
|
|
WO/2024/006392A1 |
Provided herein are systems and methods for processing biomolecules (e.g., nucleic acid molecules, proteins) from a sample. A method for processing biomolecules may comprise hybridizing a probe molecule to a target region of a nucleic ac...
|
|
WO/2024/002599A1 |
The present invention relates to a method for diagnosing lung cancer in a patient. In addition, the present invention relates to a method for monitoring lung cancer in a patient. Moreover, the present invention relates to a kit for carry...
|
|
WO/2024/003022A1 |
This disclosure provides processes for making three-dimensional cross-linked polymer networks having transport channels, processes for making arrays comprising the three-dimensional networks, arrays comprising the three-dimensional netwo...
|
|
WO/2024/000613A1 |
The use of MOGAT2 in the preparation of a product for diagnosis and prognosis estimation of hepatocellular carcinoma, and the use of a reagent, which is useful for detecting the expression level of MOGAT2, in the preparation of a kit for...
|
|
WO/2024/005458A1 |
The present invention relates to a method for amplifying a target nucleic acid using beta-hydroxy acid, and in particular, a loop-mediated isothermal amplification (LAMP) method. The beta-hydroxy acid used in the method according to the ...
|
|
WO/2024/003954A1 |
Method for characterizing a microbial community which provides to identify a first plurality of enzymes associated with a microbial community; selecting, within said first plurality of enzymes, a second plurality of enzymes involved in t...
|
|
WO/2024/006918A2 |
Methods of identifying an enriched heterogeneous renal cell population having therapeutic potential, enriched heterogeneous renal cell populations having therapeutic potential and uses for same.
|
|
WO/2024/003100A1 |
An example of a sequencing nanoparticle includes a core of a negatively chargeable, hydrophobic polymer. Alternating layers of a positively charged acrylamide hydrogel and the negatively charged polymer are positioned on the core, wherei...
|
|
WO/2024/001602A1 |
Provided is a composition for detecting gastric cancer, comprising: a detection reagent for detecting the methylation level in the following region: a region in OTX1 gene set forth in SEQ ID NO: 1; a region in ZNF671 gene set forth in SE...
|
|
WO/2024/006477A1 |
Described herein, inter alia, are multiplex dye compounds and methods of use thereof.
|
|
WO/2024/005120A1 |
Provided is a microorganism classifying method including: a step (S1) for obtaining a first mass spectrum, which is obtained by performing mass spectrometry of a first microorganism that is cultured under conditions for producing an acid...
|
|
WO/2024/003944A1 |
The present disclosure provides a trapping device for trapping microbes, the device comprises a porous polymeric structure with a proximal end and a distal end, wherein the proximal end and the distal end is optionally provided with a ho...
|
|
WO/2024/005577A1 |
The present application relates to a method for screening a regulatory element for enhancing RNA stability and/or mRNA translation, and a novel regulatory element screened by the method. A novel regulatory element for enhancing RNA stabi...
|
|
WO/2024/000778A1 |
The present invention provides a base sequence detection product for in-vitro diagnosis of brain arteriovenous malformation, comprising a primer-probe composition for detecting brain arteriovenous malformation-related base sequences. The...
|
|
WO/2024/003332A1 |
The present disclosure provides compositions and kits for the tagmentation of double stranded DNA. In some embodiments, the compositions and kits for the tagmentation of double stranded DNA include one or more histone-like proteins and/o...
|
|
WO/2024/006245A1 |
An imaging system for imaging a biological sample or another sample containing fluorescent molecules may include an optical system with a light source emitting light, wherein the light is directed by the optical system to the sample via ...
|
|
WO/2024/003311A1 |
The current invention relates to a method for incorporating a poly(dA/dT) tail to a nucleic acid sequence of interest, the method comprising: providing a backbone DNA sequence comprising a sequence of interest, encoding for a protein or ...
|
|
WO/2024/006762A1 |
Provided herein are compositions and methods for detecting bacteria associated with bacterial vaginosis.
|
|
WO/2024/004675A1 |
Provided is a method for checking the possibility of liver cancer onset. This method for checking the possibility of liver cancer onset comprises (1) a step for detecting at least one type of molecules of interest selected from the group...
|
|
WO/2024/005658A1 |
The invention relates to a novel chemical compound - a diagnostic marker for use in medicine, more specifically in cancer diagnosis, in particular the diagnosis of uterine body cancer. The invention also relates to an in vitro method for...
|
|
WO/2024/005122A1 |
This method for preparing an analysis of microorganisms using an acid shock protein comprises: a step (S1) for preparing at least one culture medium containing a pH indicator; a step (S2) for inoculating microorganisms into the culture m...
|
|
WO/2024/006552A1 |
The present disclosure provides improved compositions and methods for amplification and detection of target nucleic acid(s) at ambient temperatures.
|
|
WO/2024/005574A1 |
The present invention relates to a method for screening a regulatory element for increasing mRNA translation, a novel regulatory element resulting from the method, and a use thereof. Through the screening method of the present invention,...
|
|
WO/2024/006373A1 |
Provided herein are compositions to be used as a positive control for detection of one or more microdeletions of interest in a sample. The positive control can be used to determine an error and an efficiency rate for assays used to ident...
|
|
WO/2024/003402A1 |
The present invention relates generally to methods of analysing ribonucleic acid (RNA). In particular, the invention relates to methods of analysing RNA to assess levels of degradation of RNA molecules in an RNA sample. The methods use a...
|
|
WO/2024/006548A1 |
The present disclosure provides technologies relating to cell and/or viral particle lysis and/or nucleic acid preparation.
|
|
WO/2024/006978A2 |
Disclosed herein are methods of producing transcribed RNA product with increased yield and reduced dsRNA impurities.
|
|
WO/2024/006339A1 |
A method for concentrating a liquid sample containing pathogens. The method traps pathogens on the surface of activated carbon. Prior to release of the pathogens, the activated carbon is treated with a blocking solution that prevents the...
|
|
WO/2024/005656A1 |
The present invention relates to a non-invasive early sexing kit using real-time PCR to determine the sex of paiche (Arapaima gigas) at any age, said kit comprising one of the primer pairs of forward MSR_107 (TGGAAATCAGGGTGAAACTGT) and r...
|
|
WO/2024/000312A1 |
A base calling method and system, a gene sequencer and a storage medium. The base calling method comprises the following steps: acquiring a first image of a biochip in a red light channel and a second image of the biochip in a green ligh...
|
|
WO/2024/006457A1 |
A method of treating or preventing Alzheimer's disease or related dementias in patients previously infected with a respiratory virus such as SARS CoV2 is presented. Brain gene expression profiles of severe COVID-19 patients show increase...
|
|
WO/2024/006581A1 |
Provided herein, inter alia, are methods of treating colorectal cancer, diagnosing colorectal cancer, and monitoring colorectal cancer using biomarkers, such as miRNA, such as miR-513a- 5p, miR-628-3p, miR-193a-5p, miR-210, miR-4304, miR...
|
|
WO/2024/006878A1 |
Methods for assessing genomic instability (GI) may include selectively amplifying nucleic acid sequences at targeted locations in a tumor sample genome by a targeted panel with a low sample input to generate a plurality of nucleic acid s...
|
