BACKGROUND

The ability of T cells to recognize and kill cancer cells is well-established and exploited by immunotherapies such as vaccines, checkpoint blockade, and adoptive T cell therapies. Considerable progress has been made towards understanding the T cell repertoire and function using high throughput genomics, transcriptomics, and proteomics. However, one of the bottlenecks in the field is the identification of novel targets or targets comprised in complexes that may not readily be bound by antibodies or other known methodologies. The T cell of the invention may be used to predict the efficacy of a given y6TCR for a given patient. The T cell of the invention may be used to determine the presence of the target of a given ybTCR in a sample, cell, and/or tissue. The T cell of the invention may be used to identify the target of a given ybTCR. The population of T cells of the invention may be used to identify a y6TCR that will be active against a target cell even if the identity of the target expressed by the target cell is not known. Identifying the y6TCR that is active against given target cells, for example utilizing the provided cells and methods, will provide a basis for generation of new therapeutics.

SUMMARY

In an aspect, there is provided a T cell that comprises:

(a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of an exogenous gamma delta TCR; and

(b) a polynucleotide sequence encoding an exogenous gamma delta T cell receptor (y6TCR).

In an embodiment, there is provided a T cell, wherein upon binding of the exogenous y6TCR to a target, activation of said exogenous y6TCR occurs, which triggers transcription of the exogenous reporter sequence, said transcription being initiated by the promoter resulting in expression of the exogenous reporter encoded by the exogenous reporter sequence.

In an embodiment, the T cell is a primary T cell and/or is not a Jurkat cell or a derivative thereof and/or is not derived from tumorigenic T cells of a patient and preferably wherein the T cell is a human T cell.

In an embodiment, the T cell is an ab T cell. In an embodiment, the T cell has reduced or eliminated surface expression of an endogenous cellular receptor, optionally wherein the endogenous cellular receptor comprises an endogenous TCR.

In an embodiment, the T cell as defined above is such that the promoter sequence is a response element to a protein selected from the group consisting of: nuclear factor of activated T-cells (NFAT), Nuclear Factor kappa-light-chain-enhancer of activated B cells (NF-KB), Activator protein 1 (AP-I), Nur response element (NurRE), Interferon gamma (IFN-g), CD69, Early growth response protein 2 (EGR2), Early growth response protein 1 (EGR1) and any combination thereof, preferably wherein the promoter sequence is the NFAT response element.

In an embodiment, the T cell as defined above is such that the polynucleotide sequence encoding the exogenous reporter is selected from:

(a) a polynucleotide sequence coding for a fluorescent protein;

(b) a polynucleotide sequence coding for an enzyme whose catalytic activity can be detected, preferably wherein the catalytic activity is luminescence.

In an embodiment, the T cell as defined above is such that the exogenous reporter is a fluorescent protein or a luminescent protein, and preferably wherein the fluorescent protein is selected from the group consisting of: green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), Blue fluorescent protein (BFP), cyan fluorescent protein (CFP), red fluorescent protein (TdTomato) and violet-excitable green fluorescent (Sapphire) .

In an embodiment, the T cell as defined above is such that the exogenous gd TCR comprises: a) a g-chain selected from the group consisting of: g1 , g2, g3, g4, g5, g8, g9, g10 and g11 ; b) a d-chain selected from the group consisting: d1 , d2, d3, and d5; or c) a) and b), preferably selected from table 7.

In an embodiment, the T cell as defined above further comprises a polynucleotide encoding a chimeric bidirectional signaling transmembrane protein able to transduce at least two intracellular signals, said protein comprising:

-an extracellular ligand domain, able to interact with the extracellular domain of its interaction partner -a transmembrane domain, and

-a heterologous intracellular signaling domain transducing a first signal after binding of the extracellular ligand domain to its interaction partner.

In an embodiment, the T cell is as follows:

-the extracellular ligand domain of the chimeric bidirectional signaling transmembrane protein comprises an amino acid sequence from 41 BBL, OX40L, CD86, or RANK, and

-the heterologous intracellular signaling domain of the chimeric bidirectional signaling transmembrane protein comprises an amino acid sequence from 0X40, 41 BB, NKp80, or IL18RAP.

In an embodiment, the T cell is as follows:

-the extracellular ligand domain of the chimeric bidirectional signaling transmembrane protein comprises an amino acid sequence from 41BBL, OX40L, CD86, RANK, or CD70, and

-the heterologous intracellular signaling domain of the chimeric bidirectional signaling transmembrane protein comprises an amino acid sequence from 0X40, 41 BB, NKp80, IL18RAP, or IL2RB.In an embodiment, the T cell as defined above, is such that the polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of an exogenous gamma delta TCR and the polynucleotide sequence encoding the exogenous gamma delta T cell receptor (y6TCR) are present on two distinct vectors.

In another embodiment, the T cell as defined above, is such that the polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of an exogenous gamma delta TCR and the polynucleotide sequence encoding the exogenous gamma delta T cell receptor (y6TCR) are present on one single vector.

In a further aspect, there is provided a T cell population comprising several T cells as defined in an embodiment of the previous aspect, wherein the exogenous y6TCR comprised in at least one of the T cells is distinct from the exogenous y6TCR comprised in at least one of the other T cells within said T cell population, defining a pool of distinct exogenous y6TCR comprised within a T cell population.

In another aspect, there is provided a method for determining the presence of the target of the exogenous y6TCR defined above in a sample, said method comprising the steps of: a) contacting the sample with the T cell as defined above and b) assessing the expression of the exogenous reporter gene, which is indicative for the presence of target in the sample.

In another aspect, there is provided a method for determining the presence of the target of the exogenous y6TCR defined above in a cell comprising a potential target, said method comprising the steps of: a) contacting the cell comprising a potential target, or a tissue comprising said cell, with the T cell as defined above and b) assessing the expression of the exogenous reporter gene, which is indicative for the presence of the target in the cell.

In another aspect, there is provided a method for identifying the target of the exogenous ybTCR defined above, said method comprising the steps of: a) contacting a plurality of cells comprising a potential target, or tissues comprising said cells, each of said cells comprising a different genomic modification, said genomic modification resulting in alteration of expression of a different potential target in each cell, with the T cell as defined above b) for each cell comprising a potential target, assessing whether the expression of the exogenous reporter gene is altered relative to when the T cell is contacted with a comparable cell which does not comprise the respective genomic modification and c) identifying the target

In an embodiment, the method comprises the steps of: a) contacting a plurality of cells comprising a potential target, or tissues comprising said cells, each of said cells comprising a different genomic modification, said genomic modification resulting in reduction or elimination of expression of a different potential target in each cell, with the T cell as defined above b) for each cell comprising a potential target, assessing whether the expression of the exogenous reporter gene is decreased or eliminated relative to when the T cell is contacted with a comparable cell which does not comprise the respective genomic modification and c) identifying the target

In an embodiment, the method comprises the steps of: a) contacting a plurality of cells comprising a potential target, or tissues comprising said cells, each of said cells comprising a different genomic modification, said genomic modification resulting in increase of expression of a different potential target in each cell, with the T cell as defined above b) for each cell comprising a potential target, assessing whether the expression of the exogenous reporter gene is increased relative to when the T cell is contacted with a comparable cell which does not comprise the respective genomic modification and c) identifying the target In another aspect, there is provided a method for predicting the efficacy of a ybTCR treatment, comprising a) providing a sample from a subject in need of such treatment, b) contacting said sample with the T cell as defined above and comprising a polynucleotide sequence encoding the exogenous ybTCR of the ybTCR treatment and c) assessing the expression of the exogenous reporter gene, which is indicative for efficacy of the ybTCR treatment when applied to the subject.

In an embodiment, assessing the expression of the exogenous reporter gene in the methods defined above is combined with detection of degranulation via determination of a degranulation marker of the T cell, preferably of CD107a.

In another aspect, there is provided a method for identifying an exogenous y6TCR comprised in the T cell population as defined above and active against a given target comprised within a given target cell comprising a) providing a sample comprising said given target cell, b) contacting the T cell population as defined above with the sample and b) identifying the T cell within the T cell population whose exogenous reporter gene has been activated, which is indicative for activity of the exogenous y6TCR.

In an embodiment, identifying the T cell within the T cell population whose exogenous reporter gene has been activated involves assessing the expression of the exogenous reporter gene in combination with detection of degranulation via determination of a degranulation marker of the T cell, preferably of CD107a.

In an embodiment, the method defined above is such that the target of the exogenous y6TCR is not known at the molecular level.

INCORPORATION BY REFERENCE

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

FIG. 1A is an exemplary bicistronic lentiviral polynucleotide that comprises an inducible NFAT promoter operably linked to enhanced GFP (eGFP), upstream of a constitutive PGK promoter operably linked to truncated version of the human stem cell antigen CD34, including the QBEND10 epitope linked to a CD8 stalk (tCD34). FIG. 1B is an exemplary tricistronic lentiviral polynucleotide that comprises an MSCV promoter upstream of a gamma-chain of a TCR, P2A upstream of a polynucleotide encoding the chimeric protein comprising the 0X40 intracellular domain and the 41 BB ligand (also called the chimeric protein herein) and T2A downstream followed by a delta-TCR chain. FIG. 1C shows an exemplary RET cell (that is a TEG that comprises a polynucleotide that activates transduction of the promoter to result in expression of the exogenous reporter. The exogenous reporter polypeptide can be detected using various means provided herein.

FIG. 2A is a flow cytometry plot of T cells co-transduced with a two-vector lentiviral system or matched untransduced T cells. The plot shows the expression of an exogenous TCR introduced via one lentiviral vector and the tCD34 from the second vector applied in parallel, which comprises also the exogenous reporter sequence. When using this two-vector system, four subpopulations of T cells may be detected:

- the non- transduced T cells,

- the RET cells of the invention comprising both vectors,

- the TEG cells that do not comprise the vector with the exogenous reporter sequence (i.e. reporter vector) but comprise the vector comprising the polynucleotide encoding the exogenous y6TCR and

- the T cells that comprise the reporter vector but do not comprise the vector comprising the polynucleotide encoding the exogenous y6TCR.

FIG. 2B shows flow cytometry results of eGFP expression in RET cells co-transduced with a vector containing a ybTCR (gd TCR CL5: SEQ ID NO: 157) and a second vector encoding a polynucleotide that comprises an exogenous reporter (eGFP) (SEQ ID NO: 139) post 24-hour co-culture with wt RPMI-8226 target cells or the matched CD277 KO negative control (knocking out CD277; part of the antigen complex recognized by the exogenous TCR). No eGFP signal was detected in RET-CL5 only.

FIG. 3A shows an exemplary polynucleotide that comprises an exogenous gamma delta TCR, the chimeric protein with a small linker (black) on one vector, and a NFAT-driven reporter construct on a second vector (eGFP). FIG. 3B shows a RET cell that has been introduced with the two polynucleotides of FIG. 3A.

FIG. 4A illustrates a two-vector system to introduce subject polynucleotides that comprise sequence to subject promoters upstream of exogenous reporters (eGFP or eGFP and tCD34); and the chimeric protein (41 BBL-OX40ICD) and exogenous receptor (ybTCR). FIG. 4B illustrates a one-vector system to introduce subject polynucleotides that comprises a promoter operably linked to an exogenous reporter (eGFP), followed by an exogenous gamma delta TCR and the chimeric protein (41 BBL-OX40ICD) under a constitutive promoter. FIG. 4C shows increase in eGFP signal upon recognition of a cognate target. RET variants were generated, comprising a y962TCR CL5 and a reporter construct with different promoters, listed at the x-axis. The RETs were co-cultured with HT-29 at E:T ratio of 1 :1 with or without 5mM of Pamidronate 3-amino-l- hydro xypropylidenebisphosphonate pentahydrate (PAM) for 24h. After 24 hours eGFP signal was read by flow cytometry. FIG. 4D shows co-culture induced increase in the fraction of eGFP+ and eGFP+CD107a+ cells in RETs transduced with a single vector or with two vector constructs, a NFAT reporter construct (with or without PGK-tCD34) and a construct with ybTCR. RETs were co-cultured with cognate RPMI-8226 or non-targeted RPMI-8226 CD277 KO at E:T ratio of 1 :1 or 1 :0 (RET monoculture). After 24 hours cells were stained for CD107a, before eGFP fluorescence and cell surface CD107a staining were analyzed by flow cytometry.

FIG. 5A shows various contemplated combinations of polynucleotides to engineer cells with subject exogenous receptors, chimeric protein, and exogenous reporters (TdTomato, luciferase, and/or eGFP). FIG. 5B shows increase in luminescence orTdTomato+CD107a+ fraction of cells in RETs comprising 2 constructs, a NFAT reporter construct and a construct containing a y962TCR and 41 BBL-OX40ICD. RETs were co-cultured with targets (RPMI-8226 and MM-1S+PAM), non-targets (RPMI-8226 CD277 KO,

OPM2, MM-1 S -PAM) or as RET monoculture (effector only), with or without PAM. E:T ratio was 1 :1 or 1 :0. After 24 hours D-luciferin was added to the co-culture and luminescence was after 12 minutes incubation measured. Cells were stained for CD107a before TdTomato fluorescence and cell surface CD107a staining were analyzed by flow cytometry.

FIG. 6 illustrates an overview of the multifactorial complexity involved in CD277J expression on target cells, for example a cancer cell, and its recognition by engineered cells that comprise subject y962TCRs (TEG and RET). CD277 can be a heterodimer of BTN3-A1 and -A2 or -A3 that changes to CD277J once complexed via the intracellular binding of IPP. BTN2A1 can be used for y9TCR-binding and is therefore also involved in target recognition by subject exogenous receptors such as y962TCRs. FIG. 7 A illustrates comparison of two vector system with or without the chimeric protein in the vector expressing the exogenous y6TCR. Including the chimeric protein in the vector enhances growth of desired RET cells, results in increased cell expansion, and allows for larger scale banking of RET cells. FIG. 7B illustrates the TEG physiology driven by the chimeric protein (41 BBL-OX40ICD) upon target coculture. The two left panels (y-eGFP-d) depict flow cytometry plots without the chimeric protein before and after target stimulation. The middle panels illustrate flow cytometry plots of the corresponding conditions when TEG cells comprise constructs expressing 4-1 BB ligand lacking the cytoplasmic portion (y- 41BBLmincyto-6). The right panels illustrate the flow cytometry plots of the TEG cells containing the chimeric protein. As shown by the right panels, the TEG cells comprising the chimeric protein had enhanced fractions of Y6TCR ⁺ T cells and in particular Y6TCR ⁺ apTCR T cells compared to the others.

FIG. 8A shows percent eGFP positive RET cells post co-culture with target, pre-incubated with Pamidronate (3-amino-l- hydroxypropylidenebisphosphonate pentahydrate (PAM)), at 1 hour, 2 hours, or 4 hours. FIG. 8B illustrates reduction of noise in the monoculture when combining eGFP with CD107a. FIG. 8C shows amount of Granzyme B (endogenous factor associated with T cell activation) detected in supernatants of co-cultures of RET cells with targets, in the form of PAM-driven MZ-1851-RC recognition at 1 hour, 2 hours, or 4 hours of co-culture. FIG. 8D shows percent CD107a+ RET cells post co-culture with the same targets and time points. FIG. 8E shows percent of cells positive for both CD107a and eGFP post co-culture under the same conditions. The combination of 2 read-outs enabled the monitoring of both degranulation, via CD107a/l_AMP-1 , and a TCR activation via eGFP expressed by NFAT promoter at the single cell level. Flow cytometry-based analysis of the eGFP+, CD107a+ and eGFP+CD107a+ fraction of cells showed that monitoring co-expression of eGFP and CD107a resulted in superior signal-to-noise ratio for scoring MZ1851RC as a PAM-dependent target.

FIG. 9 illustrates reporter signal correlating to activity of TEGs versus liquid cancer cell lines (multiple myeloma (MM)). TEG-CL5 reactivity is on the X-axes (IFN-g on top, cytolysis on bottom), reported based on collective data of 3 independent experiments. Reporter signal (also called signal induced by RET) is on the Y-axes with three independent experiments shown, each with technical triplicates and using different batches of the reporter cells. The combination of 2 flow cytometry-based read-outs of RET-CL5 cells provided a quantitative correlation to target recognition by TEG-CL5.

FIG. 10A illustrates RET reporter signal correlating to reactivity of TEG versus different solid cancer cell lines. Reactivity of TEG-CL5 is on the X-axes (IFN-g on left, cytolysis on right), reported based on collective data of 3 independent experiments each. RET reporter signal is on the Y-axes and reported based on collective data of 3 independent experiments, using different batches of the RET cells. The combination of 2 flow cytometry-based read-outs of RET cells provided a quantitative correlation to target recognition by TEG-CL5. FIG. 10B shows the 3 experiments separately, which was presented as a pooled analysis in FIG. 10A. FIG. 10C illustrates correlation of cytolysis and IFN-g by TEG-CL5 in matched measurements of activity (cytolysis on the X-axes vs IFN-g on the Y-axes). Results reported based on collective data of 3 independent experiments for each read-out. Most tumor cell lines were either not inducing any TEG-CL5 activity or resulting in both target cytolysis and IFN-g production, but 3 targets (MDA-MB-231 , Caki-2+PAM and SK-CO-1 +PAM) were scored not adjudicated (positive for one while negative for the other read-out), and therefore out of scope for RET scoring.

FIG. 11 illustrates RET reporter signal titration with zoledronate (ZOL) concentration used on exemplary targets. RET reporter signal aligns quantitatively to ZOL-driven CD277J-titration on MM.1S target cells, mimicking the dose response of TEG-CL5. The RET reporter signal also shows increased resolution by measuring at the single cell level (CD107a instead of Granzyme B), resulting in superior read-out of signal-to-noise when combining eGFP with CD107a.

FIG. 12A illustrates reporter activity of RET cells comprising the chimeric protein targeting ZOL-treated MM cell lines. These cells show target antigen induced responses in a dose-dependent fashion -versus the ZOL-dependent MM.1S cells. The cells show target antigen induced responses, always/without dose response in the ZOL-independent RPMI-8226 cells (plasmacytoma; myeloma tumor cell line). A target antigen response was not induced in the non-target OPM-2 cells. Results reported based on collective data of 3 independent experiments, using different RET batches (same starting material). Fold increase measures the number of eGFP+CD107a+ double positive cells (compared to the respective monocultures) is depicted. FIG. 12B illustrates TEG-CL5 responding to two different aminobisphosphonate (nBP) treated targets in a dose dependent fashion. ZOL titration on targets led to a CD277J-driven dose response by the TEG-CL5 cells. ZOL treatment spans a wider range of different degrees ofTEG-stimulation than PAM, with limited target toxicity.

FIG. 13 illustrates RET-CL5 cells responding to ZOL-titrations after as little as 4 hours. Bottom panels illustrate measurable signals of the RET-CL5 cells 4 hours after co-culture at various ZOL concentrations. The observed trend continued through the 24 hours read-out point, depicted in the top panels of the figure.

FIG. 14A illustrates schematic representation of mutant variants of CD277 used to confirm the molecular target of TEG-CL5 and ybTCR CL5 containing RETs. FIG. 14B All the engineered T cells assayed here share specificity for CD277J. Twenty-four hours co-culture experiments followed by flow cytometry analysis were performed to measure RET activity (RET-CL5 on the left, as % CD107a+/eGFP+ cells) and TEG-CL5 reactivity (right, as % CD107+ cells). The molecular target of the RET cells matches TEG-CL5, across comparisons of wild type (WT) and mutant Butyrophilin subfamily 3 member A1 (BTN3A1)-variant expressing HEK293 cells (C1 wt and C1-352). Plots are representative data of n=3 experiments for RET- CL5, or n=2 experiments for TEG-CL5. Co-cultures were carried out in the presence or absence of PAM, or with target cells pretreated O/N with PAM plus extra PAM added during co-culture; effector only: RET- CL5 orTEG-CL5 monoculture.

FIG. 15 illustrates an exemplary flowchart of enrichment for cultures containing RET cells that comprise subject polynucleotides (promoter and exogenous reporter sequences). Additional embodiments of exemplary RET cells can include incorporation of a constitutively expressed surface protein (tCD34) in a polynucleotide that comprises an exogenous reporter, to allow higher throughput enrichment of RET cells by magnetic bead-based technologies.

FIG. 16 illustrates RET-CL5 cells detecting cognate targets among a varying ratio of matched non-target cells. A low fraction of target cells (given as percent of total target cells on the x-axis) could be selectively detected in contexts dominated by matched non-target cells. Increasing amounts of target cells (RPMI- 8226 WT) were spiked in non-responsive cells (RPMI-8226 CD277 KO) keeping total tumor cells constant at 1E5. Mixtures were co-cultured with 1 E5 RET-CL5 cells for 24 hours. Afterwards, cells were harvested, and reporter activity (eGFP) was measured by flow cytometry. Representative plot of n=4 independent experiments performed in duplicate is shown.

FIG. 17 illustrates phenotype and function of RET-CL5 cells after long-term culturing; showing robustness of relative CD277J detection after prolonged culture and expansion. (A) RET-CL5 cells containing 41 BBL-OX40ICD and NFAT driven eGFP reporter were cultured for 12 or 72 days and afterwards %CD4+ and %CD8+ was determined by flow cytometry. Differentiation phenotype (B) and TCR expression (C) after 72 days culture of the RETs was determined by flow cytometry. (D) Reactivity of RET-CL5 cells after culture for 72 days was assessed by a 24 hours co-culture with RPMI-8226 target cells or with RPMI-8226 CD277KO non-target cells at E/T ratio of 1 : 1. Percentage of total eGFP+ is shown.

FIG. 18 RETs containing a NFAT reporter construct and a construct with a g4d5 TCR, show increased levels of eGFP+ and eGFP+CD107a+ upon co-culture with cognate target cells. RETs were co-cultured with targets (HT-29), non-targeted (HT-29 EPCR KO) or alone (effector only). After 24 hours cells were stained for CD107a before eGFP fluorescence and cell surface CD107a staining were analyzed by flow cytometry. FIG. 19 shows applicability of RETs as cellular reporters for multiple y6TCRs. RETs comprising a two- vector system, a NFAT reporter with tCD34 construct and a construct with an exogenous -/6TCR, were cocultured with non-target cancer cell lines (left of each panel) and tumor cell lines expressing the respective cognate target (for each TCR, middle of each panel) or alone (RET monoculture, right of each panel). After 24 hours, reactivity of RETs as measured by the ratio of the percent eGFP+CD107a+ RETs in co-culture over the corresponding effector only condition, was analyzed by flow cytometry.

FIG. 20 illustrates the feasibility to identify RETs with a specific molecular reactivity out of a pool of RETs with varying exogenous y6TCRs. RETs expressing a two-vector system , a NFAT reporter with tCD34 construct and a construct with any one of six different exogenous y6TCRs (shown in gray) or the E57- TCR (shown in black). After 24 hours co-culture with (A) the E57-TCR non-target HT-29 EPCR KO (EPCR is recognized by E57), (B) HT-29 WT expressing the cognate target of E57 or (C) no target (effector alone), the tCD34+ -/6TCR+ RET reporter reactivity (eGFP+) was analyzed by flow cytometry.

FIG. 21 illustrates the comparison of RET signal and Jurkat J76 TPR reporter signal correlation to reactivity of TEG-CL5 versus multiple targets and non-targets, demonstrating superior correlation of RET signal with TEG-CL5 reactivity. Both reporter cells expressed y6TCR CL5 and NFAT - eGFP reporter. Reactivity of TEG-CL5 (IFNy level) is on the Y-axes, reported based on collective data of 3 independent experiments each. Reporter signal (% GFP, RET on the left and Jurkat on the right) is on the X-axes and reported on collective data of 3 replicates for each reporter cell type, obtained in the same experiment. Read-out was by flow cytometry.

FIG. 22 shows the ability of TEGs to be highly enriched for y6TCR ⁺ apTCR- single positivity after anti- CD3/CD28 activation. TEG-CL5 were stained for ybTCR and apTCR before and 7 days after activation with CD3/CD28 matrix (TransAct, 1 :100) and staining was analyzed by flow cytometry.

FIG. 23A-23B show high enrichment of RETs for y6TCR ⁺ apTCR- single positivity after TRAC knock-out (CRISPR-based). Single vector (FIG. 23A) or double vector RET-CL5 (FIG. 23B) were stained for ybTCR and apTCR after production with (left) or without (right) and analyzed by flow cytometry.

FIG. 24A-24B show RETs highly enriched for y6TCR ⁺ apTCR ^· single positivity after TRAC knock-out (CRISPR-based) have similar reporter functionality. Single vector (FIG. 24A) or double vector RET-CL5 (FIG. 24B) were cocultured with or without target and 10mM PAM (MM1 .S + PAM or effector only + PAM) After 24 hours cells were stained for CD107a. EGFP fluorescence and cell surface CD107a staining were analyzed by flow cytometry. FIG. 25A-25B illustrate the comparison of RET signal and Jurkat J76 TPR reporter signal correlation with TEG-S98 reactivity, demonstrating the superior correlation of RET signal with TEG-S98 reactivity and the false positive reactivity of Jurkat J76 TPR reporter signal. Both reporter cells expressed y6TCR S98 and NFAT - eGFP reporter. (FIG. 25A) Increase in % GFP was measured by flow cytometry after 24 hours co-culture with OPM2 and effector only as control for both Jurkat J76 TPR reporter and RET S98 (N=3) (FIG. 25 B) Measured ratio of reporter signal over effector only was correlated with the reactivity of TEG- 598 (IFNy level) after co-culture with OPM2 E:T 1 :1 is on the X-axis (N=3).

FIG. 26 illustrates the absence of CRISPR TEG alloreactivity. Mixed lymphocyte reaction assay was performed by co-culturing CRISPR TEGs, TEGs or UNTR cells with PBMCs from a different donor at 1 :2 E/T ratio. After 48 hours co-culture supernatant was harvested and IFNy levels were obtained (P<0.05).

DETAILED DESCRIPTION

Provided are T cells, T cell populations and cellular compositions comprising these cells and methods of using the same. In an aspect, there is provided a T cell, preferably an abT cell, that comprises: a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of an exogenous gamma delta T cell receptor (ybTCR); and b) a polynucleotide sequence encoding said exogenous ybTCR. Preferably, the T cell is a primary T cell and/or is not a Jurkat cell or a derivative thereof and/or is not derived from tumorigenic T cells of a patient.

In some cases, upon binding of the exogenous y6TCR to a target, activation of said exogenous y6TCR occurs, which triggers transcription of the exogenous reporter sequence, said transcription being initiated by the promoter resulting in expression of the exogenous reporter encoded by the exogenous reporter sequence.

The T cell of the invention can therefore be used to sense, detect, assess the activation of the exogenous y6TCR(s) and convert it into a detectable signal via the presence of the promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of a gamma delta TCR(s).

The T cells can be employed for a diagnostic method for determining the presence of the target or the presence of cells expressing the target inducing the activation of the ybTCR. The cells may also be used for patient stratification wherein the efficacy of a ybTCR treatment is assessed on a patient in a need thereof. Alternatively, the T cell and/or T cell population may be used for identifying potential target cells and/or tissues, cellular receptor screening, and combinations thereof. The T cells may also be employed for assessing the activity of a ybTCR even when the identity of its target is not known.

Provided herein is also a method for target screening that employs the T cell population described herein. In an embodiment, the cell population provided herein can be contacted with a target or a library of targets to ascertain various modalities including but not limited to: relevance of an ybTCR for use in immunotherapy against a target, patient stratification based on utility of a subject exogenous ybTCR and/or the presence of a target that can be bound by an exogenous ybTCR. Additional modalities include the screening of exogenous ybTCR for anti-target activity and the like.

GENERAL DEFINITIONS

A “wild type” protein amino acid sequence can refer to a sequence that is naturally occurring and encoded by a germline genome. A species can have one wild type sequence, or two or more wild type sequences (for example, with one canonical wild type sequence and one or more non-canonical wild type sequences). A wild type protein amino acid sequence can be a mature form of a protein that has been processed to remove N-terminal and/or C-terminal residues, for example, to remove a signal peptide.

An amino acid sequence that is “derived from” a wild type sequence or other amino acid sequence disclosed herein can refer to an amino acid sequence that differs by one or more amino acids compared to the reference amino acid sequence, for example, containing one or more amino acid insertions, deletions, or substitutions as disclosed herein.

Within the context of the application a protein is represented by an amino acid sequence and correspondingly a nucleic acid molecule or a polynucleotide is represented by a nucleic acid (or polynucleotide) sequence.

Identity and similarity between sequences.

Throughout this application, each time one refers to a specific amino acid sequence SEQ ID NO (take SEQ ID NO: Y as example), one may replace it by: a polypeptide represented by an amino acid sequence comprising a sequence that has at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: Y. Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 99%.

Each amino acid sequence described herein by virtue of its identity or similarity percentage with a given amino acid sequence respectively has in a further preferred embodiment an identity or a similarity of at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with the given nucleotide or amino acid sequence, respectively.

The terms “homology”, “sequence identity” and the like are used interchangeably herein. Sequence identity is described herein as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In a preferred embodiment, sequence identity is calculated based on the full length of two given SEQ ID NO’s or on a part thereof. Part thereof preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NO’s. A polypeptide (and corresponding amino acid sequence) having a given identity or similarity percentage with the core polypeptide (or with a part thereof) as defined herein will be expected to exhibit a substantial level of an activity of the core polypeptide. Within the context of the invention, a substantial level may mean at least 40%, 50%, 60%, 70%, 80%, 90%, 100% of the level of activity of the core polypeptide.

In the art, "identity" also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. The degree of sequence identity between two sequences can be determined, for example, by comparing the two sequences using computer programs commonly employed for this purpose., such as global or local alignment algorithms. Non-limiting examples include BLASTp, BI_ASTn, Clustal W, MAFFT, Clustal Omega, AlignMe, Praline, GAP, BESTFIT, or another suitable method or algorithm. A Needleman and Wunsch global alignment algorithm can be used to align two sequences over their entire length or part thereof (part thereof may mean at least 50%, 60%, 70%, 80%, 90% of the length of ths sequence), maximizing the number of matches and minimizes the number of gaps. Default settings can be used and preferred program is Needle for pairwise alignment (in an embodiment, EMBOSS Needle 6.6.0.0, gap open penalty 10, gap extent penalty: 0.5, end gap penalty: false, end gap open penalty: 10 , end gap extent penalty: 0.5 is used) and MAFFT for multiple sequence alignment (in an embodiment, MAFFT v7Default value is: BLOSUM62 [bl62], Gap Open: 1 .53, Gap extension: 0.123, Order: aligned , Tree rebuilding number: 2, Guide tree output: ON [true], Max iterate: 2 , Perform FFTS: none is used) "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called conservative amino acid substitutions. As used herein, “conservative” amino acid substitutions refer to the interchangeability of residues having similar side chains. Examples of classes of amino acid residues for conservative substitutions are given in the Tables below.

Alternative conservative amino acid residue substitution classes : Alternative physical and functional classifications of amino acid residues:

For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine- glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gin or His; Asp to Glu; Cys to Ser or Ala; Gin to Asn; Glu to Asp; Gly to Pro; His to Asn or Gin; lie to Leu or Val; Leu to lie or Val; Lys to Arg; Gin or Glu; Met to Leu or lie; Phe to Met, Leu or Tyr; Ser to Thr; Thrto Ser; Trp to Tyr; Tyr to Trp or Phe; and, Val to lie or Leu.

An “antigen” is a molecule or molecular structure that an antigen receptor or an antigen-binding protein can recognize (for example, bind to). An antigen can be or can comprise, for example, a peptide, a polypeptide, a carbohydrate, a chemical, a moiety, a non-peptide antigen, a phosphoantigen, a tumor- associated antigen, a neoantigen, a tumor microenvironment antigen, a microbial antigen, a viral antigen, a bacterial antigen, an autoantigen, a glycan-based antigen, a peptide-based antigen, a lipid-based antigen, or any combination thereof. In some embodiments, an antigen is capable of inducing an immune response. In some examples, an antigen binds to an antigen receptor or antigen-binding protein, or induces an immune response, when present in a complex e.g., presented by MHC. In some cases, an antigen adopts a certain conformation in order to bind to an antigen receptor or antigen-binding protein, and/or to induce an immune response, e.g., adopts a conformation in response to the presence or absence of one or more metabolites. Antigen can refer to a target, a whole target molecule, a whole complex a complex or a fragment of a target molecule or a part of a complexthat binds to an antigen receptor or an antigen-binding protein. Antigen receptors that recognize antigens include exogenous antigen-recognition receptors and/or exogenous cellular receptors such as gd TCR disclosed herein and other receptors, such as endogenous T cell receptors. A further description of antigens is provided later herein. In an embodiment, an exogenous gd TCR disclosed herein as comprised in a T cell of the invention (which is preferably a primary T cell and/or is preferably not a Jurkat cell or a derivative thereof and/or is preferably not derived from tumorigenic T cells of a patient) binds to a target that can be present in a complex, which leads to the activation of said exogenous gd TCR.

POLYNUCLEOTIDE SEQUENCES

In a first aspect of the invention, there is provided a T cell, preferably an abT cell, that comprises: (a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence wherein said promoter is inducible upon the activation of an exogenous ybTCR; and

(b) a polynucleotide sequence encoding said exogenous ybTCR.

In some cases, upon binding of the exogenous y6TCR to a target, activation of said exogenous y6TCR occurs, which triggers transcription of the exogenous reporter sequence, said transcription being initiated by the promoter resulting in expression of the exogenous reporter encoded by the exogenous reporter sequence. Preferably, the T cell is a primary T cell and/or is preferably not a Jurkat cell or a derivative thereof and/or is preferably not derived from tumorigenic T cells of a patient and preferably wherein the T cell is a human T cell.

Throughout the whole application, the T cell also named the T cell of the invention: is preferably a primary T cell and/or is preferably not a Jurkat cell or a derivative thereof and/or is preferably not derived from tumorigenic T cells of a patient.

In an embodiment, an operably linked promoter sequence can refer to a functional relationship between two or more nucleic acids (e.g., DNA) segments. Typically, it can refer to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence. A promoter sequence can be operably linked to a coding sequence, for example an exogenous reporter, such that activation of the promoter results in expression of the reporter in a cell, preferably in T cells as defined herein. Generally, promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences, such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance. In some cases, the provided promoter sequence is operably linked via a cis-acting configuration. In other cases, a promoter sequence can be trans-acting.

In an embodiment, the promoter is such that it is inducible upon the activation of a ybTCR. It may mean that the gene (or polynucleotide sequence) linked to this promoter is a gene downstream of ybTCR signaling. In other words, the binding of the exogenous ybTCR to a target and subsequent activation thereof will lead to the activation of said promoter. In other words, a read-out for the activation of a ybTCR is the activity of this promoter and thus the induced expression of the polynucleotide sequence which is operably linked to it, that is the exogenous reporter sequence.

Within the context of the application, activation of a ybTCR may be replaced by activation of the T cell that expresses said ybTCR. Activation of a ybTCR means that said receptor interacts with (or binds with) its target at such level that it transmits a signal through the TCR complex by change in conformation and position. Kinases within the environment are recruited to the TCR, phosphorylate the ITAMs which causes binding of other kinases which will interact with other proteins. One of the proteins which is phosphorylated is NFAT. Upon phosphorylation it transfers to the nucleus to induce promoter induction of NFAT responsible genes. The activation of a ybTCR may therefore be assessed by the phosphorylation of the ITAMs, by the phosphorylation of NFAT, by the translocation of NFAT to the nucleus and/or by the activation of a NFAT responsible gene. These activities may be assessed using techniques known to the skilled person as western blotting, EMSA (Electrophoretic Mobility Shift Assay).

In the context of the invention, the activation of the ybTCR is translated into the activation of the promoter sequence which is linked to said exogenous reporter sequence, which reporter activation can be easily visualized and quantified. Activation of a T cell, preferably an abT cell, comprising (preferably expressing) an exogenous ybTCR or activation of said promoter sequence linked to said exogenous reporter sequence comprised in said cell preferably means a detectable increase of activation of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more compared to the level of said activation in the same T cell not contacted with the target, the target molecule or the target cell comprising the target molecule as defined herein. The activation may be assessed using any technique known to the skilled person such as those used in the experimental part.

In an embodiment, the promoter sequence operably linked to the exogenous reporter sequence is a promoter sequence associated with a cellular response element. In an embodiment, the exogenous reporter sequence does not comprise a transcriptional regulatory element comprised within Nur77.

In certain embodiments, a polynucleotide sequence can be present, for example on a vector, that can be episomally (i.e., extrachomosomally) maintained in a T cell. Polynucleotides of interest generally contain a promoter that is operably linked to the coding sequence of an exogenous reporter sequence. Promoters can be untranslated sequences located upstream (5') to the start codon of an exogenous reporter (generally within about 100 to 1000 bp) that control the transcription and translation of particular nucleic acid sequence to which they are operably linked. Such promoters typically fall into two classes, inducible and constitutive. Inducible promoters are promoters that initiate increased levels of transcription from DNA under their control in response to some change in conditions, e.g., the binding of an exogenous ybTCR a target. A large number of promoters recognized by a variety of potential cells are well known. Both a native promoter sequence, e.g., the promoter sequence operably linked to the wild type cellular coding sequence, and many heterologous promoters may be used to direct expression of the coding sequence for exogenous reporters as long as said promoter is inducible upon the activation of a ybTCR.

A polynucleotide may also contain a sequence for the termination of transcription and/or for (de)stabilizing the mRNA generated by the transcription of the exogenous reporter sequence. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs.

In some embodiments, a promoter sequence can initiate transcription of an exogenous reporter sequence. A reporter sequence can be a transcribable sequence, meaning that when operably linked to a cis-acting transcriptional control element, e.g., a subject promoter sequence, and when placed in the appropriate conditions, is capable of being transcribed to generate RNA, e.g., messenger RNA (mRNA).

In an embodiment, the polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence and the polynucleotide sequence encoding an exogenous gamma delta T cell receptor (ybTCR), are present on two distinct vectors.

In another embodiment, the polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence and the polynucleotide sequence encoding an exogenous gamma delta T cell receptor (ybTCR) are present on one single vector.

Various cellular response elements are known, including but not limited to those associated with cellular activation, differentiation, and/or development. In some cases, a promoter sequence is from a response element protein associated with cellular activation and especially the activation of a ybTCR. In some cases, an exogenous ybTCR can become activated following binding to a target. The binding can initiate transcription of a subject response element, such as one associated with cellular activation, especially the activation of a ybTCR. In order to initiate binding of a T cell to a target it can be contacted in vitro, ex vivo and/or in vivo. In some aspects, contacting of a T cell to a target is performed ex vivo.

In an aspect, a suitable promoter sequence can be from a response element protein selected from: nuclear factor of activated T-cells (NFAT), Nuclear Factor kappa-light-chain-enhancer of activated B cells (NF-KB), Activator protein 1 (AP-I), Nur response element (NurRE), Interferon gamma (IFN-g), CD69, Early growth response protein 1 (EGR1), Early growth response protein 2 (EGR2), IL2, and any combination thereof.

In other words, a promoter may be a response element to a protein selected from the group consisting of: nuclear factor of activated T-cells (NFAT), Nuclear Factor kappa-light-chain-enhancer of activated B cells (NF-KB), Activator protein 1 (AP-I), Nur response element (NurRE), Interferon gamma (IFN-g), CD69, Early growth response protein 1 (EGR1), Early growth response protein 2 (EGR2), and any combination thereof. In an embodiment, the promoter sequence is the NFAT response element.

In some cases, the promoter sequence is from an NFAT response element or a modified version thereof. In other words, the promoter may be a response element to NFAT or a modified version thereof. The NFAT response element may have the following DNA core sequence WGGAAA wherein the “W” stands for “A/T”. (Rao A., et al (1997), Annu. Rev. immunol., 15: 707-747), (SEQ ID NO: 153).

A modified version of a promoter sequence, especially of a modified version of a promoter as listed above means that said sequence is not identical with the wild type sequence. It may have been modified by addition, deletion, substitution of a nucleotide and the resulting promoter activity may still be the same to at least some extent. In this context “the same to at least some extent” may mean that the promoter activity of the promoter variant is at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% or 110%, 120%, 130%, 140%, 150% or more of the promoter activity of the wild type counterpart as measured under the same experimental conditions. Assessing the activity of said promoter could be carried out as in the experimental part. Usually flow cytometry or luminescence is used.

In some cases, a promoter comprises a response element from NFAT. NFAT is a family of transcription factors which can be expressed in most immune cells, especially in T cells, and more specifically in primary T cells and/or in T cells that are preferably not Jurkat cells or derivatives thereof and/or in T cells that are preferably not derived from tumorigenicT cells of a patient. Activation of transcription factors of the NFAT family can be associated with calcium signaling. As an example, T cell activation through the T cell synapse can result in calcium influx. Increased intracellular calcium levels activate the calcium- sensitive phosphatase, calcineurin, which rapidly dephosphorylates the serine-rich region (SRR) and SP- repeats in the amino termini of NFAT proteins. This results in a conformational change that exposes a nuclear localization signal promoting NFAT nuclear import and activation of target genes. An NFAT response element stimulation can lead to modulation of activity of members of the NFAT family of transcription factors. Hence, a subject cellular receptor, when bound to a suitable target, can trigger the modulation of activity of NFAT.

Provided herein is also a T cell and preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient and that comprises an exogenous reporter. As described herein, expression of a reporter can be correlated with the binding of a suitable target by a T cell thereby resulting in activation of said cell and subsequent expression of said reporter. An exogenous reporter can be a detectable reporter. Various detectable reporters can be utilized with said cell.

Within the context of the invention, the expression “exogenous reporter” may be replaced by “exogenous reporter polypeptide”. This exogenous reporter is encoded by a polynucleotide sequence. This exogenous reporter is represented by an amino acid sequence.

Within the context of the invention, the word “exogenous” is used in relation to the reporter when said reporter is present in a T cell, preferably in a primary T cell and/or in a T cell that is preferably not a Jurkat cell or a derivative thereof and/or in a T cell that is preferably not derived from tumorigenic T cells of a patient as this reporter is not naturally present in such cells. The same holds when the word “exogenous” is used in relation to the ybTCR of the T cell, cell of the invention. In one embodiment, the polynucleotide sequence encoding the exogenous reporter is selected from:

(a) a polynucleotide sequence coding for a fluorescent protein;

(b) a polynucleotide sequence coding for an enzyme whose catalytic activity can be detected, preferably wherein the catalytic activity is luminescence,

(c) (a) and (b).

In one embodiment, the exogenous reporter can code for a fluorescent protein. A fluorescent protein can be selected from the group consisting of: green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), Blue fluorescent protein (BFP, Heim R., et al. (1994), Proc. Natl. Acad. Sci., 20;91 (26): 12501-12504, and Heim R., et al (1996) Curr. Biol., 1 ;6(2):178-182), a cyan fluorescent variant known as CFP (Heim R., et al. (1996) supra; Tsien R., et al, (1998) Annu. Rev. Biochem., 67: 509-544); a yellow fluorescent variant known as YFP (Ormo M., et al. (1996), Science, 6;273(5280): 1392-1395; Wachter R.M., et al. (1998), Structure. 1998 Oct 15;6(10):1267-77. doi: 10.1016/s0969-2126(98)00127-0. PMID: 9782051); a violet-excitable green fluorescent variant known as Sapphire (Tsien 1998; Zapata- Hommer et al. (2003), BMC Biotechnol. 2003 May 22;3:5. doi: 10.1186/1472-6750-3-5. Epub 2003 May 22. PMID: 12769828; PMCID: PMC161811 . ); Td Tomato (Shaner N.C., et al. (2004) Nat Biotechnol. 2004 Dec;22(12):1567-72. doi: 10.1038/nbt1037. Epub 2004 Nov 21 . PMID: 15558047); a cyan-excitable green fluorescing variant known as enhanced green fluorescent protein (eGFP) (Yang Te-Tuan, et al. (1996), Nucleic Acids Research, Volume 24, Issue 22, 1 November 1996, Pages 4592^593, https://doi.org/10.1093/nar/24.22.4592).

In one embodiment, the exogenous reporter is a fluorescent protein or a luminescent protein, and preferably the fluorescent protein is selected from the group consisting of: green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), Blue fluorescent protein (BFP), cyan fluorescent protein (CFP), and violet-excitable green fluorescent (Sapphire).

The presence of a fluorescent protein can be assessed by live cell imaging, flow cytometry, and/or fluorescent spectrophotometry. Fluorescent reporters can be detected using various means including but not limited to microscopy, visual observation, flow cytometry, Luminex, and the like. In an aspect, a fluorescent reporter is detected using flow cytometry.

In one embodiment the exogenous reporter polynucleotide is coding for GFP. In a preferred embodiment the exogenous reporter polynucleotide is coding for luciferase (luminescence) and/or eGFP (fluorescence). The activity of luciferase can be detected by commercially available assays, e.g., by the Luciferase 1000 Assay System, Nano-Glo or the Bio-Glo (Promega). The Luciferase 1000 Assay System contains coenzyme A (CoA) besides luciferin as a substrate, resulting in a strong light intensity lasting for at least one minute. Alternatively, D-luciferin can also be utilized. In some cases, for an intracellular luciferase assay it may be helpful to lyse the cells prior to detection. The light which is produced as a byproduct of the reaction can be collected by the luminometer from the entire visible spectrum. In the examples shown herein the signal can be proportional to the amount of produced luciferase and therefore proportional to the strength of the activation of the NFAT promotor. In another embodiment a Luciferase assay is used wherein the luciferase is secreted from the cells. Hence the assay can be performed without lysis of the cells.

In one embodiment, an exogenous reporter comprises an exogenous enzyme whose catalytic activity can be detected. Examples of detectable catalytic activity can be selected from the group consisting of luciferase, beta Galactosidase, and Alkaline Phosphatase.

In an embodiment, a T cell, (preferably a primary T and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) can comprise a fluorescent reporter and a luminescent reporter. By using both fluorescent and luminescent reporters, both outputs can be detected in the absence of cell lysing.

In an embodiment, an exogenous reporter comprises a luciferase. Variants of luciferase can also be utilized. A luciferase can be selected from the group that comprises: North American firefly luciferase (Green, A.A., et al, (1956), Biochim. Biophys. Acta 1956, 20, 170- 176, DOI: 10.1016/0006- 3002(56)90275-x) Wet et al., Mol Cell Biol. 7(2):725-37 (1987), Japanese firefly (Genji-botaru ) luciferase, Italian firefly luciferase, Japanese firefly (Heike) luciferase, East European firefly luciferase, Pennsylvania firefly luciferase Ye et al., Biochim. Biophys. Acta 1339:39-52(1997), Click beetle luciferase (Contaq C.H., et al (2002) Annu Rev Biomed ENG 4: 235-60 ), Railroad worm luciferase, Renilla luciferase (Contaq C.H., et al (2002) supra), Rluc8 (mutant of Renilla luciferase) (Loening A.M. et al, (2006), Protein Eng Des Sel 19: 391-400), Green Renilla luciferase, Gaussia luciferase (Contaq C.H., et al (2002) supra), Gaussia-Dura luciferase, Cypridina luciferase, Cypridina (Vargula) luciferase, Metridia luciferase, OLuc, Nanoluc (Hall M.P., et al. (2012) Chem Biol. 2012 Nov 16;7(11):1848-57. doi: 10.1021/cb3002478), Akaluc, PpyRE9, effLuc (Rabinovich B.A., et al, (2008) Proc Natl Acad Sci U S A. 2008; 105(38): 14342- 14346. doi:10.1073/pnas.0804105105), Luc2 (Promega pGL4 luciferase reporter vectors. Promega Technical Manual. 2007. TM259), modified versions thereof, variants thereof, and the like.

A mutant or variant luciferase can also be utilized. Mutant luciferase proteins can be produced by recombinant DNA techniques or synthesized chemically. A mutant luciferase can be made by mutating a Photinus pyralis (North American or common eastern) firefly luciferase. Additionally, mutant luciferases can also be made by mutating luciferases from other species, e.g., other species of fireflies, click beetles, railroad worms, etc. The amino acids to be mutated may be identified by aligning the sequence to be mutated with the P. pyralis sequence to obtain the greatest identity (using methods known in the art and especially as explained herein), and mutating a residue (or multiple residues) that corresponds to a residue described herein, e.g., L342A; F247A; F247L;F247V; F247S; F247R; F247Q; F247T T251 N; T251Q; T251V; T251 I; T251S; L286T; L286Y; L286S; L286M; S347C; S347T; S347H; Q338W; R218 ; R218V; R218Y; R218S; R218T; A313F; A313N; A313L; A313G; L286A; S347A; A348G; E31 1 A; 1351 A; R337A and/or H245A.

Sequences of wild type luciferases that can be mutated as described herein are known in the art, e.g., as described in de Wet et al., Mol Cell Biol. 7(2):725-37 (1987) or GenBank Acc. No. AAA29795.1 (P. Pyralis); Ye et al., Biochim. Biophys. Acta 1339:39-52(1997) or GenBank Acc. No. AAB60897.1 (P. pennsylvanica); GenBank Acc. No. AAA29135.1 (L. cruciate); GenBank Acc. No. CAA47358.1 or Tatsumi et al., Biochim. Biophys. Acta 1 131 (2): 161-5 (1992) (L. lateralis); Devine et al., Biochim. Biophys. Acta 1 173(2): 121-32 (1993) or GenBank Acc. No. AAB26932.1 (L. mingrelica);

A modified version or a variant of an exogenous reporter polynucleotide sequence, especially of a modified version of an exogenous reporter polynucleotide sequence as listed above mean that said sequence is not identical with the wild type sequence. It may have been modified by addition, deletion, substitution of a nucleotide and the resulting reporter activity may still be the same to at least some extent. In this context “the same to at least some extent” may mean that the reporter activity of the reporter variant is at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% or 110%, 120%, 130%, 140%, 150% or more of the reporter activity of the wild type counterpart as measured under the same experimental conditions. The assay that may be used in known to the skilled person and may the same as those used in the experimental part. In an embodiment, the assay used is flow cytometry assay to quantify fluorescence levels or luminescence levels.

In some cases, detection of factors associated with cellular activation, differentiation, and/or development will be analyzed in conjunction with the exogenous reporter. Relevant factors associated with cellular activation can be: expansion (cellular counts), degranulation, persistence, target cytotoxicity, factor secretion, and combinations thereof. Cellular expansion can comprise quantifying the T cells (preferably the primary T cells, and/or T cells that are preferably not Jurkat cells or derivatives thereof and/or T cells that are preferably not derived from tumorigenicT cells of a patient) using for example: flow cytometry, Trypan Blue exclusion, and/or hemocytometry. Cellular activation can also be determined by analyzing expression of factors such as: CD3, CD4, CD8, L selectin (also known as CD62L), CD25, CD27, CD26, CD28, CD44, CD69, PD1 , Tim 3, CTLA4, LAG 3, CD137, CD134, TNFoc, or any combination thereof. In an embodiment, any one of the aforementioned factors can be upregulated on the surface of said cell and/or have increased expression via secretion by said cell as a result of the y6TCR activation. In other cases, cellular activation can be evaluated by determining the presence of factors and/or factor secretion such as: IFNY, TNFa, chemokines, IL-2, IL-7, IL-15, IL-6, and the like. Cellular proliferation can also be determined by detecting clumping of cells in culture. Detection of degranulation may be a preferred readout. In an aspect, degranulation, of the T cells (preferably primary T cells and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient), can be determined via CD107a analysis. In an embodiment, lysosomal-associated membrane protein-1 (LAMP-1 or CD107a) can be used as a marker of CD8+ T cell degranulation following stimulation, for example stimulation due to binding of a subject exogenous receptor on said cell to a target. In an embodiment, assessing the expression of the exogenous reporter gene is combined with detection of degranulation via determination of a degranulation marker, preferably CD107a. This combination may be beneficial for enhancing the signal-to-noise ratio.

In an embodiment, the activity of the reporter may be combined with the detection of an endogenous factor. In an embodiment, an endogenous factor can comprise a factor that is secreted upon stimulation of the T cell as disclosed herein (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient), for example by way of binding a target. In an embodiment, a secreted factor comprises a cytokine or chemokine. Cytokine or chemokine production can be evaluated using a variety of methods such as by assaying cell culture media (e.g., in vitro production) in which the cells of the invention are cultured or sera (e.g., in vivo production) obtained from a subject having such cells and target. In some embodiments, mRNA transcripts of cytokines are detected. Examples of cytokine assays include enzyme- linked immunosorbent assays (ELISA), immunoblot, immunofluorescence assays, radio-immunoassays, antibody arrays which allow various cytokines in a sample to be detected in parallel, bead-based arrays, quantitative PCR, microarray, etc. Other suitable methods may include proteomics approaches (2-D gels, MS analysis etc.).

In some cases, an endogenous factor comprises evaluating or determining a level of cellular differentiation, dedifferentiation, or transdifferentiation. Differentiation, dedifferentiation, or transdifferentation of a subject engineered cell can be determined by evaluating phenotypic expression of markers of differentiation, dedifferentiation, or transdifferentation on a cell surface by flow cytometry and/or immunohistochemistry. Various markers of cellular differentiation are provided herein and can be utilized to determine a stage of cellular differentiation, for example in response to binding to a target.

In another embodiment, a T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) as defined earlier herein can undergo stimulation with an agent, such as an immunostimulant, other than a target. Depending on the T cell, the skilled person will know which agent may be used. Such a stimulation may enhance, increase the sensitivity of the method described herein wherein the T cell (preferably primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) is used.

An immunostimulant can be used to activate such T cell, for example activation absent a target. Culturing with an immunostimulant can be performed before, during, and/or after contacting with a target. Various means are known to activate cells, such as T cells including but not limited to those that deliver signal 1 , signal, 2, signal 3, or any combination. A signal 1 can be an antigen recognition signal. For example, signal 1 can be binding of an endogenous or exogenous TCR by a peptide-MHC complex (for example in the context of alpha beta TCRs), phosphoantigen induced CD277 complex or other unknown antigens, and/or binding of agonistic antibodies directed towards CD3 that can lead to activation of the CD3 signal- transduction complex in a cell. Signal 2 can be a co-stimulatory signal. For example, a co-stimulatory signal can be anti-CD28, inducible co-stimulator (ICOS), CD27, and 4-1 BB (CD137), 0X40, which bind to ICOS-L, CD70, 4-1 BBL, OX40-L, respectively. In some cases, signal 2 can be achieved utilizing an anti- CD3 antibody or fragment thereof and/or an anti-CD28 antibody or fragment thereof. Anti-CD3 and/or anti-CD28 antibodies can be in solution or coupled to a surface. In the case where the anti-CD3 and anti- CD28 antibodies are coupled to a surface, it can be a solid surface such as a plate or a particle. A particle, such as a bead can be coated with either anti-CD3 antibody or an anti-CD28 antibody, or in some cases, a combination of the two. Signal 3 can be a cytokine signal. A cytokine can be any cytokine. A cytokine can be IL-2, IL-7, IL-12, IL-15, IL-21 , IL-23, IL-18 or any combination thereof. In some cases, IL-2, IL-7, and IL-15 are used to stimulate the T cells (preferably primary T cells and/or T cells that are preferably not Jurkat cells or derivatives thereof and/or T cells that are preferably not derived from tumorigenic T cells of a patient) provided herein.

In practicing the methods, a target, can be contacted with a T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) as earlier defined herein whose activity is to be tested. Contact of the cell can be achieved using any protocol, such as introducing the target into cell culture medium in which the cell is present, or vice versa. Contacting of said cell and a target can take any amount of time but preferably can be from 1 hour, 2 hour, 3 hour, 4 hour, 5 hour, 6 hour, 7 hour, 8 hour, 9 hour, 10 hour, 11 hour, 12 hour, 13 hour, 14 hour, 15 hour, 16 hour, 17 hour, 18 hour, 19 hour, 20 hour, 21 hour, 22 hour, 23 hour, 24 hour, 25 hour, 26 hour, 27 hour, 28 hour, 29 hour, 30 hour, 31 hour, 32 hour, 33 hour, 34 hour, 35 hour, 36 hour, 37 hour, 38 hour, 39 hour, 40 hour, 41 hour, 42 hour, 43 hour, 44 hour, 45 hour, 46 hour, 47 hour, 48 hour, 49 hour, 50 hour, 51 hour, 52 hour, 53 hour, 54 hour, 55 hour, 56 hour, 57 hour, 58 hour, 59 hour, 60 hour, 61 hour, 62 hour, 63 hour, 64 hour, 65 hour, 66 hour, 67 hour, 68 hour, 69 hour, 70 hour, 71 hour, 72 hour, 73 hour, 74 hour, 75 hour, 76 hour, 77 hour, 78 hour, 79 hour, 80 hour, 81 hour, 82 hour, 83 hour, 84 hour, 85 hour, 86 hour, 87 hour, 88 hour, 89 hour, 90 hour, 91 hour, 92 hour, 93 hour, 94 hour, 95 hour, 96 hour, 97 hour, 98 hour, 99 hour, or 100 hours. In some embodiments, contacting of said cell and a target can be from 2-4, 3-6, 4-8, and/or 5-10 hours and or 16- 26 hours.

Readings of reporter sequences, such as endogenous or exogenous reporters, by said cells can be taken at any time point. In some cases, a reading can be taken after an engineered cell is contacted with a target. A reading can be taken from 5 hours, 10 hours, 15 hours, 20 hours, 24 hours, 1 .5 days, 2 days, 3 days, 4 days, or 5 days after contacting a target. In some cases, a reading is taken from 5 to 10 hours or from 10 to 24 hours or froml to 5 hours, at least 15 hours or at least 2 days, and combinations thereof. CHIMERIC BIDIRECTIONAL SIGNALING TRANSMEMBRANE PROTEIN (also called CHIMERIC

PROTEIN)

In an embodiment, a T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient of the invention comprises:

(a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of an exogenous gamma delta TCR

(b) a polynucleotide sequence encoding said exogenous gamma delta T cell receptor (ybTCR) and further comprises a polynucleotide encoding a chimeric bidirectional signaling transmembrane protein able to transduce at least two intracellular signals, said protein comprising:

-an extracellular ligand domain, able to interact with the extracellular domain of its interaction partner

-a transmembrane domain, and

-a heterologous intracellular signaling domain transducing a first signal after binding of the extracellular ligand domain to its interaction partner.

Throughout the application, the expression “chimeric bidirectional signaling transmembrane protein” may be replaced by the expression “chimeric protein”.

Below a few definitions are provided relating to the chimeric protein.

Discovered herein is that multi-directional signal transducer proteins or chimeric proteins can be used as a strategy to overcome limitations that hamper the production and use of T cells (preferably primary T cells and/or T cells that are preferably not Jurkat cells or derivatives thereof and/or T cells that are preferably not derived from tumorigenic T cells of a patient), for example, difficulties in generating sufficient numbers of the desired cells, limited proliferative ability or lifespan of the cells, limited induction of effector function upon cell recognition of antigen, and cell exhaustion.

Therefore, these chimeric proteins can be used to improve any of the methods of the invention such as those that are designed to screen/identify a new potential drug and/or to stratify patients for the efficacy of a given drug. More details are given later herein. The inventors discovered that the expression of the chimeric protein in addition to the expression of the exogenous ybTCR and the presence of the polynucleotide comprising a promoter sequence operably linked to an exogenous reporter sequence in the T cell of the invention can result in a shorter contacting time of such T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) with a target and therefore can improve the sensitivity and efficiency of the any of the methods of the invention using such cells. Each of these methods will be described later herein. In this case, a contacting time can be taken from at least 1 hour, 2hour, 3hour, 4hour, 5hour, 6hour, 7hour, 8hour, 9hour, to at the most 10hrs. In another embodiment, T cells (preferably primary T cells and/or T cells that are preferably not Jurkat cells or derivatives thereof and/or T cells that are preferably not derived from tumorigenic T cells of a patient) that comprise the chimeric protein can also have superior signal-to-noise ratio as compared to comparable cells that lack said chimeric protein.

These chimeric proteins are engineered fusion proteins that contain an extracellular ligand domain that binds to an interaction partner, a transmembrane domain, and a heterologous intracellular signaling domain (from or derived from a different protein than the extracellular ligand domain). When the extracellular ligand binds to its interaction partner, multi-directional signaling is induced that comprises at least one “outside-in” signal mediated by the heterologous intracellular signaling domain of said chimeric protein, and at least one “inside-out” signal mediated by an intracellular signaling domain of the interaction partner.

An extracellular ligand domain can be selected based on its ability to induce signaling mediated by a desired interaction partner. In some cases, an extracellular ligand domain can be selected based on its ability to elicit signaling mediated by the heterologous intracellular signaling domain of the chimeric protein upon binding to the interaction partner. The “at least two intracellular signals” are inducible. It means that the chimeric bidirectional signaling transmembrane protein may be considered as having two configurations: one wherein no signal is induced and one wherein “at least two intracellular signals” are induced upon interaction of the extracellular ligand domain of the chimeric protein with the extracellular ligand domain of its interaction partner. These “at least two intracellular signals” may occur simultaneously or sequentially. The inducibility of these “at least two intracellular signals” is attractive as the chimeric protein is controllable by the interaction partner and vice versa. This inducibility may be assessed using techniques known to the skilled person and depending on the identity of the heterologous intracellular signaling domain of the chimeric protein and of the intracellular domain of the interaction partner. In addition, one of these “at least two intracellular signals” may depend on the activation of additional receptor, for example but not limited to the exogenous ybTCR. An extracellular ligand domain can comprise an amino acid sequence that is from or derived from a protein that is expressed on a cell surface. In some embodiments the protein expressed on a cell surface has agonist activity on a cognate receptor.

The extracellular ligand domain can comprise an amino acid sequence that is from or derived from a type I transmembrane protein. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from a type II transmembrane protein.

The extracellular ligand domain can comprise an amino acid sequence that is from or derived from a tumor necrosis factor superfamily member. In some cases, the extracellular ligand domain comprises an amino acid sequence that is from or derived from an immune co-receptor ligand, for example, an immune co-stimulatory ligand. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from an immunoglobulin superfamily member. The extracellular ligand domain can comprise an amino acid sequence that is from or derived from 41BBL, OX40L, CD86, or RANK. The extracellular ligand domain can comprise an amino acid sequence that is from or derived from 41BBL, OX40L, CD86, RANK, or CD70. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from 41 BBL. In an embodiment, the extracellular ligand domain is from or derived from 41 BBL which is a type II transmembrane protein. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from OX40L. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from CD86. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from RANK. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from CD70.

The extracellular ligand domain can comprise an amino acid sequence that is from or derived from a receptor, for example, an ion channel, GPCR, or receptor tyrosine kinase. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from a tumor necrosis factor receptor superfamily member. In some embodiments, the extracellular ligand domain comprises an amino acid sequence that is from or derived from an immune co-receptor.

The extracellular ligand domain can comprise an amino acid sequence that is from or derived from a cytokine. The extracellular ligand domain can comprise an amino acid sequence that is from or derived from a C-type lectin. The extracellular ligand domain can comprise an amino acid sequence that is from or derived from a soluble protein, for example, a secreted or cytoplasmic protein.

An extracellular ligand domain can comprise a peptide ligand of an interaction partner, for example, a naturally-occurring or a synthetic peptide ligand.

An extracellular ligand domain can comprise an amino acid sequence that is from or derived from an antigen-binding protein. Non-limiting examples of antigen-binding proteins include antibodies, variable regions (e.g., variable chain heavy region (VH) and/or variable chain light region (VL)), short chain variable fragments (scFv), single domain antibodies, Fab, Fab', F^b^, dimers and trimers of Fab conjugates, Fv, minibodies, diabodies, triabodies, tetrabodies, affibodies, ankyrin proteins, ankyrin repeats, DARPins, monobodies, nanobodies, avimers, adnectins, anticalins, Fynomers, Kunitz domains, knottins, or b-hairpin mimetics. In some embodiments, an extracellular ligand domain comprises one or more single-chain variable fragments (scFvs). A scFv (single-chain variable fragment) is a fusion protein that can comprise VH and VL domains connected by a peptide linker. Manipulation of the orientation of the VH and VL domains and the linker length can be used to create different forms of molecules that can be monomeric, dimeric (diabody), trimeric (triabody), or tetrameric (tetrabody). Minibodies are scFv- CH3fusion proteins that assemble into bivalent dimers. In some embodiments, an extracellular ligand domain comprises one or more DARPins. In some embodiments, an extracellular ligand domain comprises one or more complementarity determining regions (CDRs) from an antibody or T cell receptor, for example, one, three or six CDRs. Antigen-binding fragments derived from monoclonal antibodies can be, for example, chimeric, humanized or fully human.

An extracellular ligand domain can be selected based on its binding affinity for a desired interaction partner. In some embodiments, an extracellular ligand domain binds to an interaction partner with a KD of, for example, less than about 500 nM, less than about 300 nM, less than about 200 nM, less than about 100 nM, less than about 90 nM, less than about 80 nM, less than about 70 nM, less than about 60 nM, less than about 50 nM, less than about 40 nM, less than about 30 nM, less than about 20 nM, less than about 10 nM, less than about 5 nM, less than about 1 nM, less than about 900 pM, less than about 800 pM, less than about 700 pM, less than about 600 pM, less than about 500 pM, less than about 400 pM, less than about 300 pM, less than about 200 pM, less than about 100 pM, less than about 50 pM, less than about 10 pM, less than about 1 pM, less than about 500 fM, or less than about 100 fM.

An extracellular ligand domain can comprise an amino acid sequence that is from or derived from a wild type protein amino acid sequence. A wild type protein amino acid sequence can refer to a sequence that is naturally occurring and encoded by a germline genome. A species can have one wild type sequence, or two or more wild type sequences (for example, with one canonical wild type sequence and one or more non-canonical wild type sequences). A wild type protein amino acid sequence can be a mature form of a protein that has been processed to remove N-terminal and/or C-terminal residues, for example, to remove a signal peptide.

An extracellular ligand domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, to achieve a desirable level of expression, surface expression, stability, resistance to aggregation, resistance to degradation, affinity for an interaction partner, or level of signaling mediated by an interaction partner. An extracellular ligand domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or an amino acid sequence disclosed herein, for example, to promote folding of the chimeric protein into a biologically active conformation. In some embodiments, part or all of an extracellular ligand domain comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro-protein).

An extracellular ligand domain can comprise, consist essentially of, or consist of an amino acid sequence with at least a minimal level of sequence identity compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein. In an embodiment, such extracellular ligand domain having at least a minimal level of sequence identity compared to a given amino acid sequence is functional and therefore encompassed by the invention as long as this extracellular ligand domain is able to bind or interact with the extracellular domain of its interaction partner. The level of binding or interaction should be detectable using an assay known to the skilled person. Examples of suitable assays are western blotting or FACS, ELISA or SPR assays. Depending on the extracellular ligand domain used, the skilled person will know which assay is the most appropriate. For example, for 0X40, NFKB signaling will be assessed, for 41 BBL the binding of 41 BB will be assessed. In an embodiment, the activity of the extracellular ligand domain is assessed when said extracellular ligand domain is still comprised within the full length transmembrane molecule it originates from. For example, an extracellular ligand domain can comprise, consist essentially of, or consist of an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.5%, at least 99%, or at least 99.5% sequence identity to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6, or 161 . In cases where part or all of an extracellular ligand domain comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro- protein), the wild type protein amino acid sequence can be inverted prior to calculating sequence identity. In some embodiments, an extracellular ligand domain can comprise, consist essentially of, or consist of an amino acid sequence that is a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6, or 161 .

Table 2 provides non-limiting examples of amino acid sequences that an extracellular domain or extracellular ligand domain of the disclosure can comprise, consist of, consist essentially of, or be derived from. EC: extracellular.

An extracellular ligand domain can comprise an amino acid sequence with one or more amino acid insertions, deletions, or substitutions compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein.

For example, an extracellular ligand domain can comprise an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 .

In some embodiments, an extracellular ligand domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 .

In some embodiments, an extracellular ligand domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 .

The one or more insertions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more insertions can be contiguous, non-contiguous, or a combination thereof.

In some embodiments, an extracellular ligand domain comprises an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 . In some embodiments, an extracellular ligand domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 .

In some embodiments, an extracellular ligand domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 .

The one or more deletions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more deletions can be contiguous, non-contiguous, or a combination thereof.

In some embodiments, an extracellular ligand domain comprises an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid substitutions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 .

In some embodiments, an extracellular ligand domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid substitutions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 .

In some embodiments, an extracellular ligand domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid substitutions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 1-6. Another example is any one of SEQ ID NOs: 1-6, or 161 .

The one or more substitutions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more substitutions can be contiguous, non-contiguous, or a combination thereof. The one or more substitutions can be conservative, non-conservative, or a combination thereof.

A conservative amino acid substitution can be a substitution of one amino acid for another amino acid of similar biochemical properties (e.g., charge, size, and/or hydrophobicity). A non-conservative amino acid substitution can be a substitution of one amino acid for another amino acid with different biochemical properties (e.g., charge, size, and/or hydrophobicity). A conservative amino acid change can be, for example, a substitution that has minimal effect on the secondary or tertiary structure of a polypeptide.

A chimeric protein can have any suitable number of extracellular ligand domains. In some embodiments a chimeric protein has one extracellular ligand domain. In some embodiments, a chimeric protein has two extracellular ligand domains. In some embodiments, a chimeric protein has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 extracellular ligand domain(s). In some embodiments, a chimeric protein has at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 extracellular ligand domain(s). In some embodiments, a chimeric protein has at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, or at most 10 extracellular ligand domain(s).

An interaction partner of an extracellular ligand domain is present on the surface of a cell and upon binding of the extracellular ligand domain to the interaction partner, signaling via an intracellular domain of the interaction partner is induced. Induction of the signaling pathway can contribute to a range of target biological outcomes and biological functions disclosed herein, for example, enhanced cellular proliferation, survival, and greater magnitude and duration of immune effector functions.

An interaction partner may be a co-immune receptor.

In an embodiment, a T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) comprises, preferably expresses the chimeric bidirectional signaling transmembrane protein and the interaction partner, each as a transmembrane protein. In an embodiment, there is no cell comprising or expressing the interaction partner and that will not comprise or will not express the signal bidirectional signaling transmembrane protein. The interaction partner may be endogenously expressed on a cell and said cell may be transduced or transform with the chimeric bidirectional signaling transmembrane protein. Alternatively, both the interaction partner and the chimeric bidirectional signaling transmembrane protein may be transduced into the same cell.

In an embodiment, the interaction partner of the chimeric bidirectional signaling transmembrane protein comprises: an extracellular domain able to interact with the extracellular ligand domain of the chimeric protein, a transmembrane domain, and an intracellular domain transducing a second signal after binding of the extracellular domain of the interaction partner to the extracellular ligand domain of the chimeric protein.

In some embodiments, binding of the extracellular ligand domain to the interaction partner modulates a second signaling pathway, for example, induces, or increases or decreases activity of the second signaling pathway. In some embodiments, the interaction partner is present in a signaling complex and upon binding of the extracellular ligand domain of the chimeric protein to the interaction partner, signaling mediated by the interaction partner is modulated, e.g., signaling mediated by the signaling complex is increased or decreased. In some embodiments, upon binding of the extracellular ligand domain to the interaction partner, activity of a first signaling pathway is reduced and a different signaling pathway is induced. An interaction partner can be selected based on its ability to modulate (e.g., induce) a signaling pathway that is associated with a desired biological outcome or biological function.

In some embodiments, the chimeric protein binds to the interaction partner as a monomer. In some embodiments, the chimeric protein forms a dimer when bound to the interaction partner. In some embodiments, the chimeric protein forms a trimer when bound to the interaction partner. In some embodiments, the chimeric protein binds to the interaction partner as a tetramer, a pentamer, a hexamer, or a multimer. When bound as a multimer (e.g., a dimer, trimer, tetramer, pentamer, hexamer, or higher order multimer), the chimeric protein can form a homo-multimer (e.g., homodimer, homotrimer, homotetramer, homopentamer, homohexamer, or higher order homomultimer). In some cases, the chimeric protein binds to the interaction partner as a hetero-multimer (e.g., a heterodimer, heterotrimer, heterotetramer, heteropentamer, heterohexamer, or higher order heteromultimer).

In some embodiments, the interaction partner that binds to the extracellular ligand domain is expressed by an immune cell. In some embodiments, the interaction partner is expressed by a leukocyte, such as a lymphocyte, e.g., a T cell. In some embodiments, the interaction partner is expressed by a cancer cell. In some embodiments, the interaction partner is expressed by a mammalian cell. In some embodiments, the interaction partner is expressed by a human cell. In some embodiments, the interaction partner is expressed by an alpha-beta T cell, a gamma delta T cell, CD4+ T cell, CD8+ T cell, a T effector cell, a lymphocyte, a B cell, an NK cell, an NKT cell, a myeloid cell, a monocyte, a macrophage, a neutrophil, a basophil, a dendritic cell, an eosinophil, a granulocyte, a helper T cell, a memory T cell, a Langerhans cell, a lymphoid cell, an innate lymphoid cell (ILC), a mast cell, a megakaryocyte, a plasma cell, a regulatory T cell, a thymocyte, a fibroblast, a keratinocyte, a mesenchymal stem cell, an endothelial cell, a stromal cell, or any mixture or combination of cells thereof. In some embodiments, the interaction partner is expressed by a primary cell. In some embodiment, the interaction partner is expressed by a T cell that is not a Jurkat cell or a derivative thereof and/or by a T cell that is not derived from tumorigenic T cells of a patient. In some embodiments, the interaction partner is expressed by a cell that is not a primary cell.

In some embodiments, the interaction partner is expressed by a cell that is the same cell type as the cell that expresses the chimeric protein (that is a T cell, preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient). In some embodiments, the chimeric protein and the interaction partner are both expressed by the same cell (that is a T cell, preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient). An interaction partner can be a receptor, for example, for example a tumor necrosis factor receptor superfamily member. The interaction partner can be, for example, 41 BB, 0X40, RANKL, or IL18RAP (IL18RB). Another example is 41 BB, 0X40, RANKL, IL18RAP, or CD27. In some embodiments, the interaction partner is 41 BB. In some embodiments, the interaction partner is 0X40. In some embodiments, the interaction partner is RANKL. In some embodiments, the interaction partner is IL18RAP. In some embodiments, the interaction partner is CD27.

In some embodiments, an interaction partner is an immunoglobulin superfamily member, or an immune co-receptor, for example an activating immune co-receptor, such as CD86. In some embodiments, an interaction partner is a cytokine receptor. In some embodiments, an interaction partner is a C-type lectin receptor. In some embodiments, the interaction partner is an ion channel, GPCR, serine peptidase, integrin, tetraspanin, or receptor tyrosine kinase. In some embodiments, an interaction partner is a tumor necrosis factor superfamily member that comprises an intracellular domain that can mediate signaling. In some embodiments, the interaction partner is 41BBL or OX40L.

In an embodiment, the at least two inducible intracellular signals transduced by the chimeric bidirectional signaling transmembrane protein contribute to an improvement of a biological parameter and/or function of a cell expressing the chimeric protein and/or an improvement of a biological parameter and/or function induced by such a cell.

In some embodiments, upon binding of the extracellular ligand domain to the interaction partner, at least one, at least two, at least three, at least four, at least five, or at least six signaling pathways are induced that are mediated by the intracellular domain of the interaction partner. In some embodiments, upon binding of the extracellular ligand domain to the interaction partner, one, two, three, four, five, or six signaling pathways are induced that are mediated by the intracellular domain of the interaction partner. In some embodiments, upon binding of the extracellular ligand domain to the interaction partner, one signaling pathway is induced that is mediated by the intracellular domain of the interaction partner.

The extracellular part of the chimeric protein can comprise one or more additional extracellular domains as well as the one or more extracellular ligand domains.

In some embodiments, a chimeric protein comprises one or more additional extracellular domains from the same protein as the extracellular ligand domain, e.g., stretches of amino acids that do not participate in binding to an interaction partner, or do not induce signaling mediated by an interaction partner that binds to the extracellular ligand domain. In some embodiments, an additional extracellular domain does not participate in binding to the interaction partner but, increases or decreases a level of signaling mediated by the interaction partner.

In some embodiments, a chimeric protein comprises an additional extracellular domain that is from or derived from the same protein as the transmembrane domain, e.g., the same protein or a different protein than the heterologous intracellular signaling domain. In some embodiments, such an additional extracellular domain does not induce signaling mediated by an interaction partner.

In some embodiments, a chimeric protein comprises an additional extracellular domain that is from or derived from the same protein as the heterologous intracellular signaling domain. In some embodiments, such an additional extracellular domain does not induce signaling mediated by an interaction partner. In some cases, an additional extracellular domain can be selected based on its ability to elicit signaling in mediated by the heterologous intracellular signaling domain of the chimeric protein upon binding of the extracellular ligand domain to the interaction partner.

An additional extracellular domain can be or can comprise a cleavage site, for example, an ADAM family cleavage site or a metalloprotease family cleavage site. An additional extracellular domain can be or can comprise a multimerization domain (e.g., a domain that facilitates formation of a homo- or hetero- dimer, trimer, tetramer, pentamer, hexamer, or higher order multimer, such as a tenascin-C oligomerization domain, a thrombospondin oligomerization domain, or a GCN4 oligomerization domain). An additional extracellular domain can be or can comprise a cellular localization motif, e.g., a lipid raft localization motif or a nuclear localization motif. An additional extracellular domain can be or can comprise a target peptide, e.g., a signal peptide. An additional extracellular domain can comprise a linker.

An additional extracellular domain can comprise an amino acid sequence that is from or derived from a wild type protein amino acid sequence. An additional extracellular domain can comprise an amino acid sequence that is from or derived from any protein or type of protein disclosed elsewhere herein. An additional extracellular domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, to achieve a desirable level of expression, surface expression, stability, resistance to aggregation, resistance to shedding, or resistance to degradation. An additional extracellular domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or an amino acid sequence disclosed herein, for example, to promote folding of the chimeric protein into a biologically active conformation. In some embodiments, part or all of an additional extracellular domain comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro-protein).

An additional extracellular domain can comprise an amino acid sequence with one or more amino acid insertions, deletions, or substitutions compared to a wild type protein amino acid sequence or any other amino acid sequence as disclosed elsewhere herein. An additional extracellular domain can comprise at least a minimal level of sequence identity compared to a wild type protein amino acid sequence or any other amino acid sequence as disclosed elsewhere herein.

Chimeric proteins comprise at least one heterologous intracellular signaling domain. “Heterologous” refers to the fact that the intracellular signaling domain is from or is derived from a different protein than the extracellular ligand domain. A signaling pathway mediated by the heterologous intracellular signaling domain is induced upon binding of the extracellular ligand domain to an interaction partner. The induction of the signaling pathway can contribute to a range of target biological outcomes and biological functions disclosed herein, for example, enhanced cellular proliferation, survival, and greater magnitude and duration of immune effector functions.

A heterologous intracellular signaling domain can be selected based on its ability to induce a signaling pathway that is associated with a desired biological outcome or biological function. A heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a transmembrane protein, for example, a protein that is expressed on a cell surface. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a type I transmembrane protein. In some embodiments, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from a type II transmembrane protein.

The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a tumor necrosis factor receptor superfamily member. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from an immunoglobulin superfamily member. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a cytokine receptor. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a C-lectin family member. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from 41 BB, 0X40, NKp80, or IL18RAP. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from 41 BB, 0X40, NKp80, IL18RAP, or IL2RB. In some embodiments, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from 41 BB. In some embodiments, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from 0X40. In some embodiment, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from 0X40 and is from or derived from a type I transmembrane 0X40 protein. In some embodiments, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from NKp80. In some embodiments, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from IL18RAP. In some embodiments, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from IL2RB.

The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a receptor, for example, an ion channel, GPCR, serine protease, an immunoglobulin superfamily member, complement receptor, TIR domain containing receptor, or receptor tyrosine kinase. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a cytokine receptor. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a C-type lectin receptor. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived a cytoplasmic protein that participates in a signaling pathway. The heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived a nuclear protein that participates in a signaling pathway.

In some embodiments, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from an intracellular domain of a tumor necrosis factor superfamily member. In some embodiments, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from an intracellular domain of an immune co-receptor. In some cases, the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from an intracellular domain of an immune co-receptor ligand that contains a signaling domain, for example, an intracellular signaling domain of an immune co-stimulatory ligand. In many cases it is not necessary to use the entire chain, for example, a truncated portion of the signaling domain can be used in the heterologous intracellular signaling domain.

The heterologous intracellular signaling domain can be structurally distinct from intracellular domains found in chimeric antigen receptors and similar chimeric proteins. For example, the heterologous intracellular signaling domain can lack one or more components associated with TCR complex signaling. In some embodiments, the heterologous intracellular signaling domain does not contain an ITAM. In some embodiments, the heterologous intracellular signaling domain contains a hemITAM but does not contain an ITAM. In some embodiments, the heterologous intracellular signaling domain is not phosphorylated upon binding of the chimeric protein to the interaction partner. In some embodiments, the heterologous intracellular signaling domain does not contain an intracellular domain from a CD3 chain, for example does not contain an intracellular domain of a CD3 zeta chain. In some embodiments, the heterologous intracellular signaling domain does not contain an intracellular domain from a TCR signaling complex. In some embodiments, the heterologous intracellular signaling domain is phosphorylated upon binding of the chimeric protein to the interaction partner.

A heterologous intracellular signaling domain can comprise an amino acid sequence that is from or derived from a wild type protein amino acid sequence. A heterologous intracellular signaling domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, to achieve a desirable level of expression, surface expression, stability, resistance to aggregation, resistance to degradation, signaling strength, or affinity for a protein that participates in downstream signaling, e.g., an adapter protein. A heterologous intracellular signaling domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or an amino acid sequence disclosed herein, for example, to promote folding of the chimeric protein into a biologically active conformation. In some embodiments, part or all of a heterologous intracellular signaling domain comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro- protein). A heterologous intracellular signaling domain can comprise, consist essentially of, or consist of an amino acid sequence with at least a minimal level of sequence identity compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein. For example, a heterologous intracellular signaling domain can comprise, consist essentially of, or consist of an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.5%, at least 99%, or at least 99.5% sequence identity to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162. In an embodiment, such heterologous intracellular signaling domain having at least a minimal level of sequence identity compared to a given amino acid sequence is functional and therefore encompassed by the invention as long as this intracellular signaling domain is able to transduce a first signal after binding of the extracellular ligand domain to its interaction partner. The first signal should be detectable using an assay known to the skilled person. Examples of suitable assays are western blotting or FACS, luminescence assays. Depending on the identity of the heterologous intracellular signaling domain used, the skilled person will know which assay is appropriate to use. A NίkB reporter assay may be used to assess the activity of said heterologous intracellular domain. In an embodiment, the activity of the heterologous intracellular signaling domain is assessed when said intracellular signaling domain is still comprised within the full-length transmembrane molecule it originates from.

In cases where part or all of a heterologous intracellular signaling domain comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro- protein), the wild type protein amino acid sequence can be inverted prior to calculating sequence identity. In some embodiments, a heterologous intracellular signaling domain can comprise, consist essentially of, or consist of an amino acid sequence that is a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

Table 3 provides non-limiting examples of amino acid sequences that intracellular domains and heterologous intracellular signaling domain of the disclosure can comprise, consist of, consist essentially of, or be derived from.

A heterologous intracellular signaling domain can comprise an amino acid sequence with one or more amino acid insertions, deletions, or substitutions compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein.

For example, a heterologous intracellular signaling domain can comprise an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

In some embodiments, a heterologous intracellular signaling domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

In some embodiments, a heterologous intracellular signaling domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

The one or more insertions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more insertions can be contiguous, non-contiguous, or a combination thereof. In some embodiments, a heterologous intracellular signaling domain comprises an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

In some embodiments, a heterologous intracellular signaling domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

In some embodiments, a heterologous intracellular signaling domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

The one or more deletions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more deletions can be contiguous, non-contiguous, or a combination thereof.

In some embodiments, a heterologous intracellular signaling domain comprises an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid substitutions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

In some embodiments, a heterologous intracellular signaling domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid substitutions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162. In some embodiments, a heterologous intracellular signaling domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid substitutions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 7-19. Another example is any one of SEQ ID NOs: 7-19, or 162.

The one or more substitutions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more substitutions can be contiguous, non-contiguous, or a combination thereof. The one or more substitutions can be conservative, non-conservative, or a combination thereof.

In some embodiments, the heterologous intracellular signaling domain signals as a monomer. In some embodiments, the heterologous intracellular signaling domain signals as a dimer. In some embodiments, the heterologous intracellular signaling domain signals as a trimer. In some embodiments, the heterologous intracellular signaling domain signals as a tetramer, a pentamer, a hexamer, or a multimer. When signaling as a multimer (e.g., a dimer, trimer, tetramer, pentamer, hexamer, or higher order multimer), the heterologous intracellular signaling domain can signal as a homo-multimer (e.g., homodimer, homotrimer, homotetramer, homopentamer, homohexamer, or higher order homomultimer).

In some cases, the heterologous intracellular signaling domain signals as a hetero-multimer (e.g., a heterodimer, heterotrimer, heterotetramer, heteropentamer, heterohexamer, or higher order heteromultimer). In some embodiments, the heterologous intracellular signaling domain signals in a different conformation or as a different multimer than a full length wild type protein from which the heterologous intracellular signaling domain is from or derived from.

A chimeric protein can have any suitable number of heterologous intracellular signaling domains. In some embodiments a chimeric protein has one heterologous intracellular signaling domain. In some embodiments, a chimeric protein has two heterologous intracellular signaling domains. In some embodiments, a chimeric protein has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 heterologous intracellular signaling domain(s). In some embodiments, a chimeric protein has at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 heterologous intracellular signaling domain(s). In some embodiments, a chimeric protein has at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, or at most 10 heterologous intracellular signaling domain(s).

In some embodiments, a chimeric protein comprises two heterologous intracellular signaling domains that are from or derived from 41 BB, 0X40, NKp80, IL18RAP, or IL2RB. In some embodiments, a chimeric protein comprises a heterologous intracellular signaling domain that is from or derived from 0X40, and a heterologous domain that is from or derived from 41 BB, NKp80, IL18RAP, or IL2RB. In some embodiments, a chimeric protein comprises a heterologous intracellular signaling domain that is from or derived from 0X40, and a heterologous intracellular signaling domain that is from or derived from IL2RB In some embodiments, upon binding of the extracellular ligand domain to the interaction partner, at least one, at least two, at least three, at least four, at least five, or at least six signaling pathways are induced that are mediated by the heterologous intracellular signaling domain. In some embodiments, upon binding of the extracellular ligand domain to the interaction partner, one, two, three, four, five, or six signaling pathways are induced that are mediated by the heterologous intracellular signaling domain. In some embodiments, upon binding of the extracellular ligand domain to the interaction partner, one signaling pathway is induced that is mediated by the heterologous intracellular signaling domain.

A chimeric protein can comprise one or more additional intracellular domains as well as the one or more heterologous intracellular signaling domains.

In some embodiments, a chimeric protein comprises one or more additional intracellular domains from or derived from the same protein as the heterologous intracellular signaling domain, e.g., stretches of amino acids that do not participate in signaling. In some embodiments, an additional intracellular domain does not directly participate in signaling (e.g., does not bind a signaling pathway component or undergo a chemical or structural change as part of a signaling pathway), but increases or decreases a level of signaling mediated by the heterologous intracellular signaling domain.

In some embodiments, a chimeric protein comprises an additional intracellular domain that is from or derived from the same protein as the transmembrane domain, which can be e.g., the same protein or a different protein than the extracellular ligand domain. Such an intracellular domain can comprise a signaling domain or can lack a signaling domain.

In some embodiments, a chimeric protein comprises an intracellular domain that is from or derived from the same protein as the extracellular ligand domain. Such an intracellular domain can lack a signaling domain or can comprise a different signaling domain to the heterologous intracellular signaling domain that is present in the chimeric protein. In some embodiments, one or more amino acids are added to achieve sequence similarity and/or structural similarity to the protein that is the source of the extracellular ligand domain. For example, in some embodiments, the amino acids MLG can be added to the intracellular N-terminus of a chimeric protein that contains a 41 BBL extracellular ligand domain.

An additional intracellular domain can be or can comprise a cleavage site, for example, an ADAM family cleavage site or a metalloprotease family cleavage site. An additional intracellular domain can be or can comprise a multimerization domain (e.g., a domain that facilitates formation of a homo- or hetero- dimer, trimer, tetramer, pentamer, hexamer, or higher order multimer, such as a tenascin-C oligomerization domain, a thrombospondin oligomerization domain, or a GCN4 oligomerization domain). An additional intracellular domain can be or can comprise a target peptide, e.g. a signal peptide. An additional intracellular domain can be or can comprise a cellular localization motif, e.g., a lipid raft localization motif or a nuclear localization motif. An additional intracellular domain can comprise a linker. An additional intracellular domain can comprise an amino acid sequence that is from or derived from a wild type protein amino acid sequence. An additional intracellular domain can comprise an amino acid sequence that is from or derived from any protein or type of protein disclosed elsewhere herein. An additional intracellular domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, to achieve a desirable level of expression, surface expression, stability, resistance to aggregation, resistance to degradation, signaling strength, or affinity for a protein that participates in downstream signaling, e.g., an adapter protein. An additional intracellular domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or an amino acid sequence disclosed herein, for example, to promote folding of the chimeric protein into a biologically active conformation. In some embodiments, part or all of an additional intracellular domain comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro-protein).

An additional intracellular domain can comprise an amino acid sequence with one or more amino acid insertions, deletions, or substitutions compared to a wild type protein amino acid sequence or any other amino acid sequence as disclosed elsewhere herein. An additional intracellular domain can comprise at least a minimal level of sequence identity compared to a wild type protein amino acid sequence or any other amino acid sequence as disclosed elsewhere herein.

In some embodiments, the entire intracellular part of the chimeric protein (containing the one or more heterologous intracellular signaling domain(s) and any additional intracellular domains) can be structurally distinct from intracellular domains found in chimeric antigen receptors and similar chimeric proteins. For example, the entire intracellular part of the chimeric protein can lack one or more components associated with TCR complex signaling. In some embodiments, the entire intracellular part of the chimeric protein does not contain an ITAM (e.g., contains a hemITAM but not an ITAM, or does not contain a hemITAM or an ITAM). In some embodiments, the entire intracellular part of the chimeric protein is not phosphorylated upon binding of the chimeric protein to the interaction partner. In some embodiments, an intracellular part of a chimeric protein is phosphorylated upon binding of the chimeric protein to the interaction partner. In some embodiments, the entire intracellular part of a chimeric protein does not contain an intracellular domain from a CD3 chain, for example does not contain an intracellular domain of a CD3 zeta chain, or does not contain an intracellular domain from any CD3 chain. In some embodiments, the entire intracellular part of a chimeric protein does not contain an intracellular domain from a TCR signaling complex.

The chimeric proteins comprise a transmembrane domain that connects the extracellular ligand domain to the heterologous intracellular signaling domain. In some embodiments, part or all of the transmembrane domain is from the same protein as the extracellular ligand domain. In cases where part or all of the transmembrane domain is from the same protein as the extracellular ligand domain, the transmembrane domain and the extracellular ligand domain can be part of a contiguous amino acid sequence (e.g., that matches or corresponds to a wild type sequence), or can be separated by one or more amino acid insertions, deletions, and/or substitutions. In an embodiment, the transmembrane domain or part thereof is from or derived from the same protein as the extracellular ligand domain.

In some embodiments, part or all of the transmembrane domain is from the same protein as the heterologous intracellular signaling domain. In cases where part or all of the transmembrane domain is from the same protein as the heterologous intracellular signaling domain, the transmembrane domain and the heterologous intracellular signaling domain can be part of a contiguous amino acid sequence (e.g., that matches or corresponds to a wild type sequence), or can be separated by one or more amino acid insertions, deletions, and/or substitutions.

In some embodiments, part or all of the transmembrane domain is from or derived from a different protein than the extracellular ligand domain and the heterologous intracellular signaling domain. As a non-limiting example, a chimeric protein may comprise an extracellular ligand domain that comprises an amino acid sequence that is from or derived from CD70, a transmembrane domain that comprises an amino acid sequence that is from or derived from 41 BBL, and a heterologous intracellular signaling domain that comprises an amino acid sequence that is from or derived from 0X40.

A transmembrane domain can comprise an amino acid sequence that is from or derived from a transmembrane protein, for example, a protein that is expressed on a cell surface. The transmembrane domain can comprise an amino acid sequence that is from or derived from a type I transmembrane protein. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from a type II transmembrane protein.

The transmembrane domain can comprise an amino acid sequence that is from or derived from a tumor necrosis factor receptor superfamily member. The transmembrane domain can comprise an amino acid sequence that is from or derived from 41 BB, 0X40, NKp80, RANK, or IL18RAP. The transmembrane domain can comprise an amino acid sequence that is from or derived from 41 BB, 0X40, NKp80, RANK, IL18RAP, or CD70. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from 41 BB. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from 0X40. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from NKp80. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from RANK. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from IL18RAP. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from CD70. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from a tumor necrosis factor superfamily member or an immunoglobulin superfamily. The transmembrane domain can comprise an amino acid sequence that is from or derived from 41 BBL,

0X40 L, CD86, or RANK. The transmembrane domain can comprise an amino acid sequence that is from or derived from 41 BBL, OX40L, CD86, RANK, or CD70. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from 41 BBL. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from OX40L. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from CD86. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from RANK. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from CD70.

The transmembrane domain can comprise an amino acid sequence that is from or derived from a receptor, for example, an ion channel, GPCR, selectin family member, cytokine receptor, adhesion molecule, or receptor tyrosine kinase. The transmembrane domain can comprise an amino acid sequence that is from or derived from a cytokine receptor. The transmembrane domain can comprise an amino acid sequence that is from or derived from a C-type lectin or C type lectin receptor. In some embodiments, the transmembrane domain comprises an amino acid sequence that is from or derived from an immune co-receptor. In some cases, the transmembrane domain comprises an amino acid sequence that is from or derived from an immune co-receptor ligand, for example, an immune costimulatory ligand.

In an aspect, a transmembrane domain is from an alpha chain of a T cell receptor (TCR), beta chain of a TCR, CD8, CD4, CD28, CD45, PD-1 and/or CD152.

A transmembrane domain can comprise an amino acid sequence that is from or derived from a wild type protein amino acid sequence. A transmembrane domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, to achieve a desirable level of expression, surface expression, stability, resistance to aggregation, resistance to degradation, signaling strength, localization, or multimerization of the chimeric protein. A transmembrane domain can comprise an amino acid sequence that is modified compared to a wild type protein amino acid sequence or an amino acid sequence disclosed herein, for example, to promote folding of the chimeric protein into a biologically active conformation. In some embodiments, part or all of a transmembrane domain comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro-protein). A transmembrane domain can comprise an artificial hydrophobic sequence. In some embodiments, a transmembrane domain can comprise a cellular localization motif, e.g., a lipid raft localization motif or a nuclear localization motif. In one non-limiting example, a chimeric protein can contain an extracellular ligand domain from RANK, and a transmembrane domain from IL18RAP. In some embodiments, inclusion of the transmembrane domain from IL18RAP induces formation of the chimeric protein into a dimeric state, unlike wild type RANK, which can function as a trimer. In the same way, transmembrane domains of the disclosure can induce formation of the chimeric protein into a monomeric or multimeric state that is different than the state adopted by the full length wild type version of the protein the extracellular ligand domain is from or derived from, and/or that is different than the full length wild type version of the protein the heterologous intracellular domain is from or derived from.

A transmembrane domain can comprise, consist essentially of, or consist of an amino acid sequence with at least a minimal level of sequence identity compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein. For example, a transmembrane domain can comprise, consist essentially of, or consist of an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.5%, at least 99%, or at least 99.5% sequence identity to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20- 27. Another example is any one of SEQ ID NOs: 20-27, or 163. In an embodiment, such transmembrane domain having at least a minimal level of sequence identity compared to a given amino acid sequence is functional and therefore encompassed by the invention as long as this transmembrane domain is able to induce a multimerisation of the chimeric bidirectional signaling transmembrane protein comprising it upon binding of the extracellular domain of its interaction partner. The level of binding or interaction should be detectable using an assay known to the skilled person. Examples of suitable assays are western blotting or FACS, single photon microscopy assays.

In cases where part or all of a transmembrane domain comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro-protein), the wild type protein amino acid sequence can be inverted prior to calculating sequence identity. In some embodiments, a transmembrane domain can comprise, consist essentially of, or consist of an amino acid sequence that is a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20-27. Another example is any one of SEQ ID NOs: 20-27, or 163.

Table 4 provides non-limiting examples of amino acid sequences that a transmembrane domain of the disclosure can comprise, consist of, consist essentially of, or be derived from.

A transmembrane domain can comprise an amino acid sequence with one or more amino acid insertions, deletions, or substitutions compared to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein.

For example, a transmembrane domain can comprise an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20-27. Another example is any one of SEQ ID NOs: 20-27, or 163. In some embodiments, a transmembrane domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, or at most 10 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20-27. Another example is any one of SEQ ID NOs: 20-27, or 163. In some embodiments, a transmembrane domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid insertions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20- 27. Another example is any one of SEQ ID NOs: 20-27, or 163. The one or more insertions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more insertions can be contiguous, non-contiguous, or a combination thereof.

In some embodiments, a transmembrane domain comprises an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20-27. Another example is any one of SEQ ID NOs: 20-27, or 163. In some embodiments, a transmembrane domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, or at most 10 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20-27. Another example is any one of SEQ ID NOs: 20-27, or 163. In some embodiments, a transmembrane domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid deletions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20- 27. Another example is any one of SEQ ID NOs: 20-27, or 163. The one or more deletions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more deletions can be contiguous, non-contiguous, or a combination thereof.

In some embodiments, a transmembrane domain comprises an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10, amino acid substitutions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20-27. Another example is any one of SEQ ID NOs: 20-27, or 163. In some embodiments, a transmembrane domain comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, or at most 10 amino acid substitutions relative to a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20-27. Another example is any one of SEQ ID NOs: 20-27, or 163. In some embodiments, a transmembrane domain comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 20-27. Another example is any one of SEQ ID NOs: 20-27, or 163. The one or more substitutions can be at the N-terminus, C- terminus, within the amino acid sequence, or a combination thereof. The one or more substitutions can be contiguous, non-contiguous, or a combination thereof. The one or more substitutions can be conservative, non-conservative, or a combination thereof.

Chimeric proteins can comprise one or more linkers that connect amino acid sequences, for example, amino acid sequences from or derived from different proteins. A linker can connect, for example, an extracellular ligand domain to a transmembrane domain, a heterologous intracellular signaling domain to a transmembrane domain, one extracellular ligand domain to a second extracellular ligand domain or an additional extracellular domain, one heterologous intracellular signaling domain to another heterologous intracellular signaling domain or an additional intracellular domain, or any domain disclosed herein to another amino acid sequence.

A linker or can allow for separation and flexibility of the domains it separates, for example, a transmembrane domain and an extracellular ligand domain. The length of a linker can be adjusted to alter the ability of a domain to bind to, for example, an interaction partner (for the extracellular ligand domain), or a factor that participates in a signaling pathway (e.g., for the heterologous intracellular signaling domain).

A linker sequence can be, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20,

21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acid residues in length. In some embodiments, a linker is at least 1 , at least 3, at least 5, at least 7, at least 9, at least 11 , or at least 15 amino acids in length. In some embodiments, a linker is at most 5, at most 7, at most 9, at most 11 , at most 15, at most 20, at most 25, or at most 50 amino acids in length.

A flexible linker can have a sequence containing stretches of glycine and serine residues. The small size of the glycine and serine residues provides flexibility, and allows for mobility of the connected functional domains. The incorporation of serine or threonine can maintain the stability of the linker in aqueous solutions by forming hydrogen bonds with the water molecules, thereby reducing unfavorable interactions between the linker and protein moieties. Flexible linkers can also contain additional amino acids such as threonine and alanine to maintain flexibility, as well as polar amino acids such as lysine and glutamine to improve solubility. A rigid linker can have, for example, an alpha helix-structure. An alpha-helical rigid linker can act as a spacer between protein domains.

A linker can comprise any of the sequences in Table 5, or repeats thereof (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats of any of SEQ ID NOs: 28-44). In some embodiments, a chimeric protein comprises a linker with at least 1 , at least 2, at least 3, at least 4, or at least 5 amino acid insertions, deletions, or substitutions relative to any of SEQ ID NOs: 28-44.

The insertions, deletions, or substitutions can be at the N-terminus, the C-terminus, within the sequence, or a combination thereof. The insertions, deletions, or substitutions can be contiguous or non-contiguous. In some cases, the substitutions are conservative. In some cases, the substitutions are non-conservative. In some embodiments, a chimeric protein does not contain any linkers, for example, the chimeric protein is a direct fusion of amino acid sequences from other proteins with no intervening amino acid sequence.

In an embodiment, the chimeric bidirectional signaling transmembrane protein able to transduce at least two inducible intracellular signals, comprises: an extracellular ligand domain, able to interact with the extracellular domain of its interaction partner a transmembrane domain, and a heterologous intracellular signaling domain transducing a first signal after binding of the extracellular ligand domain to its interaction partner, wherein the second intracellular signal is transduced via the intracellular domain of the interaction partner.

In an embodiment, the chimeric bidirectional signaling transmembrane protein able to transduce at least two inducible intracellular signals, comprises: an extracellular ligand domain, able to interact with the extracellular domain of its interaction partner wherein the extracellular ligand domain is represented by a sequence having at least 80% identity with one of SEQ ID NO: 1 -6 as identified in table 2, a transmembrane domain represented by a sequence having at least 80% identity with one of SEQ ID NO: 20-27 as identified in table 4, and a heterologous intracellular signaling domain transducing a first signal after binding of the extracellular ligand domain to its interaction partner, wherein the heterologous intracellular signaling domain is represented by a sequence having at least 80% identity with one of SEQ ID NO: 7-19 as identified in table 3, wherein the second intracellular signal is transduced via the intracellular domain of the interaction partner. In this embodiment, the sequence identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

In an embodiment, the chimeric bidirectional signaling transmembrane protein able to transduce at least two inducible intracellular signals, comprises: an extracellular ligand domain, able to interact with the extracellular domain of its interaction partner wherein the extracellular ligand domain is represented by a sequence having at least 80% identity with one of SEQ ID NO: 1-6, or 161 , as identified in table 2, a transmembrane domain represented by a sequence having at least 80% identity with one of SEQ ID NO: 20-27, or 163, as identified in table 4, and a heterologous intracellular signaling domain transducing a first signal after binding of the extracellular ligand domain to its interaction partner, wherein the heterologous intracellular signaling domain is represented by a sequence having at least 80% identity with one of SEQ ID NO: 7-19, or 162, as identified in table 3, wherein the second intracellular signal is transduced via the intracellular domain of the interaction partner. In this embodiment, the sequence identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

In one embodiment, the transmembrane domain and the extracellular ligand domain are from the same proteins. Non-limiting examples are CD86-OX40, 41 BBL-OX40, OX40L-41BB.

In an embodiment, the chimeric bidirectional signaling transmembrane protein able to transduce at least two inducible intracellular signals comprises:

(a) an extracellular ligand domain which is from or derived from a type I transmembrane protein and a heterologous intracellular signaling domain which is from or derived from a type II transmembrane protein or

(b) an extracellular ligand domain which is from or derived from a type II transmembrane protein and a heterologous intracellular signaling domain which is from or derived from a type I transmembrane protein.

Such chimeric proteins comprising part of a type I and part of a type II transmembrane protein exhibit surprising and unexpected effects, as type I and type II transmembrane proteins cannot be readily combined into a functional protein. For example, many attempts to fuse an amino acid sequence from a type I transmembrane protein to an amino acid sequence from type II transmembrane protein fail to yield a functional protein, for example, due to an altered N-terminal or C-terminal location of one of the amino acid sequences, inability of the resulting protein to adopt a functional conformation, tertiary structure, transmembrane orientation, or a combination thereof. Surprisingly some of these chimeric proteins have been successfully generated in the experimental part and have been found active.

In an embodiment, the chimeric bidirectional signaling transmembrane protein comprises: - an extracellular ligand domain comprising an amino acid sequence from a tumor necrosis factor superfamily member, a cytokine, a C-type lectin, an immunoglobulin superfamily member, or an antibody or antigen-binding fragment thereof; and

- a heterologous intracellular signaling domain comprising an amino acid sequence from a tumor necrosis factor receptor superfamily member, a cytokine receptor, or a C-type lectin receptor.

In an embodiment, the chimeric bidirectional signaling transmembrane protein comprises: an extracellular ligand domain comprising an amino acid sequence from 41 BBL, OX40L, CD86, or RANK, and a heterologous intracellular signaling domain comprising an amino acid sequence from 0X40, 41 BB, NKp80, or IL18RAP.

In an embodiment, the chimeric bidirectional signaling transmembrane protein comprises: an extracellular ligand domain comprising an amino acid sequence from 41 BBL, OX40L, CD86, RANK, or CD70, and a heterologous intracellular signaling domain comprising an amino acid sequence from 0X40, 41 BB, NKp80, IL18RAP, or IL2RB.

In an embodiment, the chimeric bidirectional signaling transmembrane protein comprises:

(a) the extracellular ligand domain comprises an amino acid sequence from 41 BBL and the heterologous intracellular signaling domain comprises an amino acid sequence from 0X40, preferably wherein the extracellular ligand domain is from or is derived from a type II transmembrane protein 41 BBL and the heterologous intracellular signaling domain is from or is derived from a type I transmembrane protein 0X40,

(b)the extracellular ligand domain comprises an amino acid sequence from CD86 and the heterologous intracellular signaling domain comprises an amino acid sequence from 0X40,

(c) the extracellular ligand domain comprises an amino acid sequence from 41 BBL and the heterologous intracellular signaling domain comprises an amino acid sequence from NKp80,

(d) the extracellular ligand domain comprises an amino acid sequence from RANK and the heterologous intracellular signaling domain comprises an amino acid sequence from IL18RAP,

(e) the extracellular ligand domain comprises an amino acid sequence from RANK and the heterologous intracellular signaling domain comprises an amino acid sequence from 0X40,

(f) the extracellular ligand domain comprises an amino acid sequence from RANK and the heterologous intracellular signaling domain comprises an amino acid sequence from 41 BB, (g) the extracellular ligand domain comprises an amino acid sequence from OX40L and the heterologous intracellular signaling domain comprises an amino acid sequence from 41 BB,or

(h) the extracellular ligand domain comprises an amino acid sequence from CD86 and the heterologous intracellular signaling domain comprises an amino acid sequence from IL18RAP.

In an embodiment, the chimeric bidirectional signaling transmembrane protein comprises:

(a) the extracellular ligand domain comprises an amino acid sequence from 41 BBL and the heterologous intracellular signaling domain comprises an amino acid sequence from 0X40, preferably wherein the extracellular ligand domain is from or is derived from a type II transmembrane protein 41 BBL and the heterologous intracellular signaling domain is from or is derived from a type I transmembrane protein 0X40,

(b)the extracellular ligand domain comprises an amino acid sequence from CD86 and the heterologous intracellular signaling domain comprises an amino acid sequence from 0X40,

(c) the extracellular ligand domain comprises an amino acid sequence from 41 BBL and the heterologous intracellular signaling domain comprises an amino acid sequence from NKp80,

(d) the extracellular ligand domain comprises an amino acid sequence from RANK and the heterologous intracellular signaling domain comprises an amino acid sequence from IL18RAP,

(e) the extracellular ligand domain comprises an amino acid sequence from RANK and the heterologous intracellular signaling domain comprises an amino acid sequence from 0X40,

(f) the extracellular ligand domain comprises an amino acid sequence from RANK and the heterologous intracellular signaling domain comprises an amino acid sequence from 41 BB,

(g) the extracellular ligand domain comprises an amino acid sequence from OX40L and the heterologous intracellular signaling domain comprises an amino acid sequence from 41 BB,or

(h) the extracellular ligand domain comprises an amino acid sequence from CD86 and the heterologous intracellular signaling domain comprises an amino acid sequence from IL18RAP.

(i) the extracellular ligand domain comprises an amino acid sequence from CD70 and the heterologous intracellular signaling domain comprises an amino acid sequence from 0X40, or

(j) the extracellular ligand domain comprises an amino acid sequence from 41 BBL and the heterologous intracellular signaling domain comprises an amino acid sequence from 0X40 and an amino acid sequence from IL2RB.

Examples of these chimeric proteins had been generated in the experimental part and their functionality has been confirmed in the experimental section herein.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under a) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 45, 46, 57, 58, 59, 60, 61 , 62, 63, 64 or 65 as identified in table 6. In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under a) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 45, 46, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 164, or 165, as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under b) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 52, 53 or 73 as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under c) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 47 or 48 as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under d) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 78 as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under e) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 76 as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under f) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 77 as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under g) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 49, 50 or 51 as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under h) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 71 or 72 as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under i) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 168 or 169 as identified in table 6.

In an embodiment, the chimeric bidirectional signaling transmembrane protein identified under j) is represented by an amino acid sequence having at least 80% identity or similarity with SEQ ID NO: 165 as identified in table 6.

In this embodiment, the sequence identity or similarity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

In an embodiment, the chimeric bidirectional signaling transmembrane protein does not contain an ITAM or an intracellular domain from a TCR signaling complex. In this context in an embodiment, an ITAM motif is ‘YxxL/l- x6-8- YxxL/l” wherein x stand for any amino acid. X6-8 means any stretch of 6, 7 or 8 amino acids, Y is Tyrosine, L is Leucine, I is Isoleucine (PFAM source https://pfam.xfam.org/family/ITAM or https://www.sciencedirect.com/science/article/abs/pii/S09628 92406001498 article).

Non-limiting examples of the chimeric protein sequences, and sequences that can be included in the chimeric proteins, are provided in Table 6.

A chimeric protein can comprise, consist essentially of, or consist of an amino acid sequence with at least a minimal level of sequence identity compared to an amino acid sequence disclosed herein. For example, a chimeric protein can comprise, consist essentially of, or consist of an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.5%, at least 99%, or at least 99.5% sequence identity to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169. In an embodiment, such chimeric bidirectional signaling transmembrane protein having at least a minimal level of sequence identity compared to a given amino acid sequence is functional and therefore encompassed by the invention as long as this chimeric protein is able to transduce at least two inducible intracellular signals and/or is able to induce an improvement of a biological parameter and/or function in a T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) expressing it and/or is able to induce an improvement of a biological parameter and/or function induced by such a cell especially when such cell is used in one of the methods of the invention. The transduction of these at least two inducible intracellular signals should be detectable using an assay known to the skilled person. Such biological parameter and/or function in a T cell of the invention that may be further improved by the expression of a chimeric protein, may be the enhanced cellular proliferation, enhanced cellular survival, and greater magnitude and persistence of immune effector functions, such as cytotoxicity and production of inflammatory mediators. The wording “target biological outcome” or “biological outcome” may be replaced by “biological parameter”.

One or multiple biological functions and/or parameters of the cell may be modulated/improved. Multiple biological functions and/or parameters may be modulated, for example, any combination of induced or reduced biological functions and/or parameters that contributes to a target biological outcome. In this context, a target biological outcome may be the treatment, cure of a disease or condition as later explained herein. For example, multiple biological functions can be induced in the T cell and/or a biological function can be induced and another one can be reduced.

Examples of suitable assays are western blotting, luminescence reporter or FACS assays. The improvement of a biological parameter and/or function should also be detectable using an assay known to the skilled person. Depending on the parameter and/or function, the skilled person would know which assay may be used.

In some embodiments, a chimeric protein can comprise, consist essentially of, or consist of an amino acid sequence that is a wild type protein amino acid sequence or any other amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76-78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169.

A chimeric protein can comprise an amino acid sequence with one or more amino acid insertions, deletions, or substitutions compared to an amino acid sequence disclosed herein.

For example, a chimeric protein can comprise an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid insertions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76-78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169.

In some embodiments, a chimeric protein comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid insertions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76- 78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169.

In some embodiments, a chimeric protein comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid insertions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76- 78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169. The one or more insertions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more insertions can be contiguous, non-contiguous, or a combination thereof.

In some embodiments, a chimeric protein comprises an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid deletions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76-78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169.

In some embodiments, a chimeric protein comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid deletions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76- 78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169.

In some embodiments, a chimeric protein comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid deletions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76- 78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169. The one or more deletions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more deletions can be contiguous, non-contiguous, or a combination thereof.

In some embodiments, a chimeric protein comprises an amino acid sequence with at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 amino acid substitutions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76-78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169.

In some embodiments, a chimeric protein comprises an amino acid sequence with at most 1 , at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11 , at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, or at most 50 amino acid substitutions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76- 78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169.

In some embodiments, a chimeric protein comprises an amino acid sequence with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 amino acid substitutions relative to an amino acid sequence disclosed herein, for example, any one of SEQ ID NOs: 45-53, 57-65,67,71-73,76- 78. Another example is any one of SEQ ID NOs: 45-53, 57-65, 67, 71-73, 76-78, 164-165, or 168-169. The one or more substitutions can be at the N-terminus, C-terminus, within the amino acid sequence, or a combination thereof. The one or more substitutions can be contiguous, non-contiguous, or a combination thereof. The one or more substitutions can be conservative, non-conservative, or a combination thereof.

Certain chimeric proteins (or chimeric bidirectional signaling transmembrane protein) disclosed herein combine an amino acid sequence from a type I transmembrane protein with an amino acid sequence from a type II transmembrane protein. In some embodiments, such chimeric proteins exhibit surprising and unexpected effects, as type I and type II transmembrane proteins cannot be readily combined into a functional protein. For example, many attempts to fuse an amino acid sequence from a type I transmembrane protein to an amino acid sequence from type II transmembrane protein fail to yield a functional protein, for example, due to an altered N-terminal or C-terminal location of one of the amino acid sequences, inability of the resulting protein to adopt a functional conformation, tertiary structure, transmembrane orientation, or a combination thereof.

In some examples provided herein, the extracellular ligand domain comprises an amino acid sequence that is from or derived from a type I transmembrane protein, and the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from a type II transmembrane protein. In some examples provided herein, the extracellular ligand domain comprises an amino acid sequence that is from or derived from a type II transmembrane protein, and the heterologous intracellular signaling domain comprises an amino acid sequence that is from or derived from a type I transmembrane protein (for example, an extracellular ligand domain from 41 BBL, and an intracellular signaling domain from 0X40).

In some embodiments, part or all of an extracellular ligand domain and/or a heterologous intracellular signaling domain of a chimeric bidirectional signaling transmembrane protein comprises an amino acid sequence that is inverted compared to a wild type amino acid sequence (i.e. expressed as a retro- protein). In some embodiments, such chimeric bidirectional signaling transmembrane protein exhibit surprising and unexpected effects, as in many cases retro-proteins do not retain the functionality of the parent protein, e.g., due to a failure to adopt a functional conformation and/or tertiary structure. In some embodiments, a chimeric bidirectional signaling transmembrane protein combines an amino acid sequence from a type I transmembrane protein with an amino acid sequence from a type II transmembrane protein, and contains at least one amino acid sequence that is inverted compared to a wild type amino acid sequence. Functionality of such a chimeric protein can be surprising and unexpected based on a lack of expectation of success combining sequences from type I and type II transmembrane proteins into a functioning fusion protein, and a lack of expectation of success in obtaining a functional retro-protein domain.

In an embodiment, an extracellular ligand domain is a tumor necrosis factor superfamily member or a molecule derived thereof and is derived from a type II transmembrane protein and is therefore a type II molecule.

In an embodiment, an extracellular ligand domain is an immunoglobulin superfamily member or is derived thereof and is derived from a type I transmembrane protein and is therefore a type I molecule.

In an embodiment, the T cell (preferably primary T cell and/or T cell that is preferably not a Jurkat cell or derivative thereof and/or T cell that is preferably not derived from tumorigenic T cells of a patient) comprises:

(a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of an exogenous gamma delta TCR;

(b) a polynucleotide sequence encoding said exogenous gamma delta T cell receptor (y6TCR) and

(c) a polynucleotide encoding a chimeric protein wherein

-its extracellular ligand domain comprises an amino acid sequence from 41 BBL, OX40L, CD86, or RANK, and

-its heterologous intracellular signaling domain comprises an amino acid sequence from 0X40, 41 BB, NKp80, or IL18RAP.

In an embodiment, the T cell (preferably primary T cell and/or T cell that is preferably not a Jurkat cell or derivative thereof and/or T cell that is preferably not derived from tumorigenic T cells of a patient) comprises:

(a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of an exogenous gamma delta TCR;

(b) a polynucleotide sequence encoding said exogenous gamma delta T cell receptor (y6TCR) and

(c) a polynucleotide encoding a chimeric protein wherein -its extracellular ligand domain comprises an amino acid sequence from 41 BBL, OX40L, CD86, RANK, or CD70, and

-its heterologous intracellular signaling domain comprises an amino acid sequence from 0X40, 41 BB, NKp80, IL18RAP, or IL2RB.

In an embodiment, a polynucleotide (i.e. an exogenous y6TCR, a promoter sequence operably linked to an exogenous reporter sequence, the chimeric protein) is introduced into a T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) utilizing a vector, electroporated into said cell, or otherwise introduced into said cell to generate a T cell of the invention. In some embodiments, a bicistronic vector is used comprising a polynucleotide encoding an exogenous y6TCR and a polynucleotide comprising a promoter sequence operably linked to an exogenous reporter sequence. Alternatively in another embodiment, two different vectors are utilized: one vector comprises a polynucleotide encoding the exogenous y6TCR and the second vector comprises the promoter sequence operably linked to an exogenous reporter sequence.

In yet another embodiment, a tricistronic vector system can be employed to deliver a polynucleotide encoding an exogenous y6TCR, a polynucleotide comprising a promoter sequence operably linked to an exogenous reporter sequence and a polynucleotide encoding the chimeric protein. A bicistronic or tricistronic vector can be organized in various configurations such that the polynucleotide encoding an exogenous y6TCR, the polynucleotide comprising a promoter sequence operably linked to an exogenous reporter sequence and the polynucleotide encoding the chimeric protein are delivered at any position in the vector.

In an embodiment, the polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence is present on one vector and another vector comprises the polynucleotide sequence encoding an exogenous gamma delta T cell receptor (y6TCR) and the polynucleotide that encodes the chimeric protein.

In an embodiment, the vector comprises:

- a promoter sequence operably linked to an exogenous reporter sequence,

- the polynucleotide sequence encoding an exogenous gamma-chain of the y6TCR,

- the polynucleotide that encodes the chimeric protein and

- the polynucleotide sequence encoding an exogenous delta-chain of the y6TCR,

Each of these polynucleotide sequences being operably linked to each other.

A T cell of the invention (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) comprises and preferably expresses an exogenous y6TCR. An exogenous y6TCR can be capable of recognizing a target as defined herein. An exogenous y6TCR is artificially introduced into the T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient), for example, a cell that does not otherwise express a TCR, or expresses a different or distinct TCR).

In an embodiment, the T cell of the invention (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient is an abT cell. In an embodiment, an exogenous y6TCR has been introduced into this abT cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient).

Therefore, in one embodiment, there is provided a abT cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) that comprises:

(a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of an exogenous y6TCR; and

(b) a polynucleotide sequence encoding said exogenous y6TCR.

In an embodiment, this T cell (preferably primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) does neither comprise nor express an endogenous y6TCR.

In an embodiment, this T cell (preferably primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient) has reduced or eliminated surface expression of an endogenous cellular receptor, optionally wherein the endogenous cellular receptor comprises an endogenous TCR. Reduced or eliminated surface expression may be assessed using FACS.

An exogenous y6TCR can be a transgenic y6TCR. An exogenous gamma delta TCR (for example, a gamma delta TCR introduced into a cell that does not otherwise express a gamma delta TCR, such as an abT cell, or a cell that expresses a different ybTCR).

An ab TCR, also referred to as an alpha-beta TCR, can be composed of two protein chains, T cell receptor a and T cell receptor b. ab TCRs recognize a composite ligand of a peptide antigen bound to an MHC molecule. MHC molecules are highly polymorphic glycoproteins encoded by genes in the major histocompatibility complex (MHC). Two classes of MHC molecules (class I and class II) are bound in their non-polymorphic (constant) domains by CD8 and CD4 molecules that distinguish two different functional classes of ab T cells. CD8 binds MHC class I molecules; CD4 binds MHC class II molecules. A TCR can be at least one of: an alpha chain of a TCR or a beta chain of a TCR. A second type of TCR, composed of a Y and a d chain, is structurally similar to the ab TCR but binds different ligands, including non-peptide antigen bound ligands. A TCR can be at least one of: a gamma-chain of a TCR or a delta-chain of a TCR.

In some embodiments, an exogenous gamma delta TCR can be introduced into an alpha-beta (ab) T cell. In an aspect, a method comprising introducing a y6TCR into a T cell (preferably a primary T cell and/or a T cell that is preferably not a Jurkat cell or a derivative thereof and/or a T cell that is preferably not derived from tumorigenic T cells of a patient), such as an abT cell, can overcome clonal heterogeneity of tumor cells in patients with advanced cancer, an improvement over c^TCR-based approaches. In an aspect, this improvement may be due to the distinct HLA-independent activation cues of the Y6TCR, such as changes in metabolism. In some embodiments, an exogenous gamma delta TCR of the disclosure binds a target, such as CD277 on a cancer cell. Binding of such a y6TCR can comprise spatial and/or conformational changes in CD277 expressed on a target.

An exogenous y6TCR can comprise a /g9\/d2 TCR or functional fragment thereof. The /g9\/d2 TCR can comprise at least one of a gamma-TCR amino acid sequence or a delta-TCR amino acid sequence capable of recognizing a CD277 protein on a cell surface of a cell (e.g. tumor cell). In some embodiments, the exogenous y6TCR comprises a variant or a fragment of at least one of a g-TCR amino acid sequence or a d-TCR amino acid sequence capable of recognizing a CD277 protein on a cell surface of a target cell.

In an embodiment, an exogenous y6TCR (also referred to as an exogenous gamma delta TCR), can comprise (a) a g-chain selected from the group consisting of g2, g3, g4, g5, g8, g9, and g11 ; (b) a d-chain selected from the group consisting of d1 , d2, d3, and d5; or (c) any combination of (a) and (b). In some embodiments, the g-chain is the g9 chain and the d-chain is the 62 chain.

In some embodiments, the g-chain is the g2 chain and the d-chain is the 61 chain. In some embodiments, the g-chain is the g3 chain and the d-chain is the 61 chain. In some embodiments, the g-chain is the g4 chain and the d-chain is the 61 chain. In some embodiments, the g-chain is the g5 chain and the 6-chain is the 61 chain. In some embodiments, the g-chain is the g8 chain and the d-chain is the 61 chain. In some embodiments, the g-chain is the g9 chain and the d-chain is the 61 chain. In some embodiments, the g-chain is the g11 chain and the d-chain is the 61 chain.

In some embodiments, the g-chain is the g2 chain and the d-chain is the 62 chain. In some embodiments, the g-chain is the g3 chain and the d-chain is the 62 chain. In some embodiments, the g-chain is the g4 chain and the d-chain is the 62 chain. In some embodiments, the g-chain is the g5 chain and the 6-chain is the 62 chain. In some embodiments, the g-chain is the g8 chain and the d-chain is the 62 chain. In some embodiments, the g-chain is the g9 chain and the d-chain is the 62 chain. In some embodiments, the g-chain is the g11 chain and the 6-chain is the 62 chain.

In some embodiments, the g-chain is the g2 chain and the d-chain is the 63 chain. In some embodiments, the g-chain is the g3 chain and the d-chain is the 63 chain. In some embodiments, the g-chain is the g4 chain and the d-chain is the 63 chain. In some embodiments, the g-chain is the g5 chain and the 6-chain is the 63 chain. In some embodiments, the g-chain is the g8 chain and the d-chain is the 63 chain. In some embodiments, the g-chain is the g9 chain and the d-chain is the 63 chain. In some embodiments, the g-chain is the g11 chain and the d-chain is the 63 chain.

In some embodiments, the g-chain is the g2 chain and the d-chain is the 65 chain. In some embodiments, the g-chain is the g3 chain and the d-chain is the 65 chain. In some embodiments, the g-chain is the g4 chain and the d-chain is the 65 chain. In some embodiments, the g-chain is the g5 chain and the 6-chain is the 65 chain. In some embodiments, the g-chain is the g8 chain and the d-chain is the 65 chain. In some embodiments, the g-chain is the g9 chain and the d-chain is the 65 chain. In some embodiments, the g-chain is the g11 chain and the d-chain is the 65 chain.

In some embodiments, an exogenous y6TCR receptor comprises a variable domain from a g-chain and/or a variable domain from a d-chain. Variable domains can be indicated by a V preceding the g-chain and 6- chain designations, e.g., Vy2, Vy3, Vy4, Vy5, Vy8, Vy9, Vy11 , V61 , V62, V63, and V65.

In some embodiments, where the exogenous ybTCR can comprise (a) a variable domain of a g-chain selected from the group consisting of Vy2, Vy3, Vy4, Vy5, Vy8, Vy9, and Vy11 ; (b) a variable domain of a d-chain selected from the group consisting of V61 , V62, V63, and V65; or (c) any combination of (a) and (b), e.g., as indicated herein for the g and d chains. In some embodiments, the g-chain variable domain is the ng9 and the d-chain variable domain is the V62. In some embodiments, the g-chain variable domain is the ng4 and the d-chain variable domain is the V65.

In some embodiments, an exogenous y6TCR comprises a constant domain from a g-chain and/or a constant domain from a d-chain. Constant domains can be indicated by a C preceding the g-chain and 6- chain designations, e.g., Cy1 , Cy2 and C6.

In some embodiments, where the exogenous Y6TCR can comprise (a) a constant domain of a g-chain selected from the group consisting of Cy1 and Cy2; (b) a constant domain of a d-chain C6; or (c) any combination of (a) and (b), e.g., as indicated herein for the g and d chains. In some embodiments, the g- chain constant domain is the Cy1 and the d-chain constant domain is the C6. In some embodiments, the g-chain constant domain is the Cy2 and the d-chain constant domain is the C6.

An exogenous y6TCR can comprise a VY9V62 TCR or functional fragment thereof. The VY9V62 TCR can comprise at least one of a g-TCR amino acid sequence or a d-TCR amino acid sequence capable of recognizing a CD277 protein on a cell surface of a cell (e.g. tumor cell). In some embodiments, the receptor comprises a variant or a fragment of at least one of a g-TCR amino acid sequence or a d-TCR amino acid sequence capable of recognizing a CD277 protein on a cell surface of a target cell. The present disclosure contemplates exogenous y6TCR comprising any portion or fragment or variation of a ybTCR capable of recognizing a cell (e.g. tumor cell) via a CD277 cell surface molecule.

In some embodiments, the exogenous y6TCR comprises a variant or a fragment of at least one of a g- TCR amino acid sequence and/or a d-TCR amino acid sequence capable of recognizing an EPCR protein on a cell surface of a target cell. The present disclosure contemplates exogenous y6TCR comprising any portion or fragment or variation of a Y6TCR capable of recognizing a cell (e.g. tumor cell) via an EPCR cell surface molecule. Variable domain and CDR3 regions for such a Y6TCR are identified in table 7: SEQ ID N0:101-102.

In some embodiments, the exogenous y6TCR comprises a variant or a fragment of at least one of a g- TCR amino acid sequence and/or a d-TCR amino acid sequence capable of recognizing annexin A2 on a cell surface of a target cell. The present disclosure contemplates exogenous y6TCR comprising any portion or fragment or variation of a Y6TCR capable of recognizing a cell (e.g. tumor cell) via an annexin A2 surface molecule. Variable domain and CDR3 regions for such a Y6TCR are identified in table 7: SEQ ID NO:130 and 131.

In some embodiments, the exogenous y6TCR comprises a variant or a fragment of at least one of a g- TCR amino acid sequence and/or a d-TCR amino acid sequence capable of recognizing aberrant HLA protein expression on a cell surface of a target cell. The present disclosure contemplates exogenous y6TCR comprising any portion or fragment or variation of a Y6TCR capable of recognizing a cell (e.g. tumor cell) via an aberrant HLA protein expression on the cell surface. In some embodiments, the exogenous y6TCR comprises a variant or a fragment of at least one of a g-TCR amino acid sequence and/or a d-TCR amino acid sequence capable of recognizing cancers in an MHC-unrestricted manner. Variable domain and CDR3 regions for such a Y6TCR are identified in table 6: SEQ ID NO: 82 and 85.

In some embodiments, the exogenous y6TCR comprises at least a portion of a C\ or C6 region and at least a portion of a ng or a V6 region of a Y6TCR. In some embodiments, the exogenous y6TCR comprises at least a portion of a Og or C6 region and at least a CDR3 domain of either a ng or a V6 domain of a Y6TCR. In some embodiments, the exogenous y6TCR comprises all CDR regions of the VY9V62 TCR, and all of the CDR regions can be involved in binding to a cell surface molecule (e.g. CD277 molecule) on the surface of a cell In some embodiments, the exogenous y6TCR comprises all CDR regions of the Vy4V65 TCR, and all of the CDR regions can be involved in binding to a cell surface molecule (e.g. EPCR molecule) on the surface of a cell. In some embodiments, the exogenous y6TCR comprises all CDR regions of the VY5V61 TCR, and all of the CDR regions can be involved in binding to a cell surface molecule (e.g. HLA molecule) on the surface of a cell. In some embodiments, the exogenous y6TCR comprises all CDR regions of the /g8\/d3 TCR, and all of the CDR regions can be involved in binding to a cell surface molecule (e.g. annexin A2) on the surface of a cell.

Gamma delta TCRs useful in compositions and methods of the disclosure, and sequences thereof, have been disclosed for example, in patent applications WO2013147606A1 , WO2017212074A1 , and WO2018211115A1 , each of which is incorporated herein by reference in its entirety. These sequences have been identified in table 7.

Non-limiting examples of sequences that an exogenous y6TCR of the disclosure can comprise, consist essentially of, or consist of are provided in Table 7. In some cases, a gd TCR comprises a sequence that codes a g-chain (G), d-chain (D), a variable domain (TRG, TRD), a CDR (e.g., CDR3) sequence therefrom, a constant domain (TRDC, TRGC1 , TRGC2), or a combination thereof selected from Table 8. An example of a suitable TRDC is represented by SEQ ID NO:150, an example of a suitable TRGC1 is represented by SEQ ID NO: 151 and an example of a suitable TRGC2 is represented by SEQ ID NO:

152. Example of a sequence is published (Griinder C., et al, Blood 2012; 120 (26): 5153-5162. doi: https://doi.org/10.1182/blood-2012-05-432427). In some cases, an exogenous y6TCR comprises a sequence (e.g., a CDR3 region sequence) with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or up to about 100% sequence identity to a sequence in Table 7.

The present application contemplates exogenous y6TCR comprising any portion or fragment or variation of a Y6TCR capable of recognizing a cell (e.g. tumor cell) via a CD277 cell surface molecule. A Y6TCR capable of recognizing a cell (e.g. tumor cell) via a CD277 cell surface molecule may be represented by a given amino acid sequence such as a sequence comprising as any of those identified by SEQ ID 83-84, 86-91 in table 7. It means that the application encompasses any Y6TCR capable of recognizing a cell (e.g. tumor cell) via a CD277 cell surface molecule having at least 60% identity or similarity with a sequence comprising any of the sequence SEQ ID NO: 83-84, 86-91 identified in table 7. In a further preferred embodiment an identity or a similarity is of at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ ID NO:83-84, 86-91 . In a preferred embodiment, sequence identity is calculated based on the full length of two given sequences. Alternatively, the identity or similarity is assessed on a part of a sequence. Part thereof preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of the sequence. A polypeptide (and corresponding amino acid sequence) having a given identity or similarity percentage with the core polypeptide (or with a part thereof) as defined herein will be expected to exhibit a substantial level of an activity of the core polypeptide. Within the context of the invention, a substantial level may mean at least 40%, 50%, 60%, 70%, 80%, 90%, 100% of the level of activity of the core polypeptide. In this context, a core activity of the ybTCR represented by a sequence comprising any of the sequence identified in table 7 (or having at least 60% sequence identity or similarity therewith) is to be capable of recognizing a cell (e.g. tumor cell) via a CD277 cell surface molecule.

In an embodiment, there is provided a T cell of the invention, wherein the exogenous gd TCR comprises: a) a g-chain selected from the group consisting of: g1 , g2, g3, g4, g5, g8, g9, g10 and g11 ; b) a d-chain selected from the group consisting: d1 , d2, d3, and d5; or c) a) and b), preferably selected from table 7.

In an embodiment, this T cell is a primary T cell and/or a T cell that is not a Jurkat cell or a derivative thereof and/or a T cell that is not derived from tumorigenicT cells of a patient. Table 7

Table 8

TARGETS

Provided herein are also targets that can be bound by y6TCR. A target can be associated with or linked with a disease. Various diseases can display a target including but not limited to cancer, viruses, bacteria, fungi, allergens, or a combination thereof. In some aspects, the target is associated with an infection. In some embodiments, the infection is caused by a virus. In some embodiments, the infection is caused by a bacterium. In some embodiments, the infection is caused by a fungus. In some aspects, the target is associated with an allergy. In some aspects, a target is from a cancer.

In some aspects, a cancer cell is a target and is hematological. In some embodiments, a hematological cancer comprises leukemia, myeloma, lymphoma, and/or a combination thereof. In some aspects, leukemia can be chronic lymphocytic leukemia (CLL), T cell acute lymphoblastic leukemia (T-ALL), acute myeloid leukemia (AML), B cell acute lymphoblastic leukemia (B-ALL), and/or acute lymphoblastic leukemia (ALL). In some embodiments, lymphoma can be mantle cell lymphoma (MCL), T cell lymphoma, Hodgkin's lymphoma, and/or non-Hodgkin's lymphoma. In some aspects, the cancer is a target and is solid.

In some embodiments, a target is of a cancer selected from the group comprising: nephroblastoma, Ewing's sarcoma, neuroendocrine tumor, glioblastoma, neuroblastoma, melanoma, skin cancer, breast cancer, colon cancer, rectal cancer, prostate cancer, liver cancer, kidney cancer, pancreatic cancer, lung cancer, biliary tract cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, medullary thyroid carcinoma, ovarian cancer, glioma, or bladder cancer, Acanthoma, Acinic cell carcinoma, Acoustic neuroma, Acral lentiginous melanoma, Acrospiroma, Acute eosinophilic leukemia, Acute lymphoblastic leukemia, Acute megakaryoblastic leukemia, Acute monocytic leukemia, Acute myeloblastic leukemia with maturation, Acute myeloid dendritic cell leukemia, Acute myeloid leukemia, Acute promyelocytic leukemia, Adamantinoma, Adenocarcinoma, Adenoid cystic carcinoma, Adenoma, Adenomatoid odontogenic tumor, Adrenocortical carcinoma, Adult T cell leukemia, Aggressive NK-cell leukemia, AIDS-Related Cancers, AIDS-related lymphoma, Alveolar soft part sarcoma, Ameloblastic fibroma, Anal cancer, Anaplastic large cell lymphoma, Anaplastic thyroid cancer, Angioimmunoblastic T cell lymphoma, Angiomyolipoma, Angiosarcoma, Appendix cancer, Astrocytoma, Atypical teratoid rhabdoid tumor, Basal cell carcinoma, Basal-like carcinoma, B-cell leukemia, B-cell lymphoma, Bellini duct carcinoma, Biliary tract cancer, Bladder cancer, Blastoma, Bone Cancer, Bone tumor, Brain Stem Glioma, Brain Tumor, Breast Cancer, Brenner tumor, Bronchial Tumor, Bronchioloalveolar carcinoma, Brown tumor, Burkitt's lymphoma, Cancer of Unknown Primary Site, Carcinoid Tumor, Carcinoma, Carcinoma in situ, Carcinoma of the penis, Carcinoma of Unknown Primary Site, Carcinosarcoma, Castleman's Disease, Central Nervous System Embryonal Tumor, Cerebellar Astrocytoma, Cerebral Astrocytoma, Cervical Cancer, Cholangiocarcinoma, Chondroma, Chondrosarcoma, Chordoma, Choriocarcinoma, Choroid plexus papilloma, Chronic Lymphocytic Leukemia, Chronic monocytic leukemia, Chronic myelogenous leukemia, Chronic Myeloproliferative Disorder, Chronic neutrophilic leukemia, Clear-cell tumor, Colon Cancer, Colorectal cancer, Craniopharyngioma, Cutaneous T cell lymphoma, Degos disease, Dermatofibrosarcoma protuberans, Dermoid cyst, Desmoplastic small round cell tumor, Diffuse large B cell lymphoma, Dysembryoplastic neuroepithelial tumor, Embryonal carcinoma, Endodermal sinus tumor, Endometrial cancer, Endometrial Uterine Cancer, Endometrioid tumor, Enteropathy-associated T cell lymphoma, Ependymoblastoma, Ependymoma, Epithelioid sarcoma, Erythroleukemia, Esophageal cancer, Esthesioneuroblastoma, Ewing Family of Tumor, Ewing Family Sarcoma, Ewing's sarcoma, Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Extrahepatic Bile Duct Cancer, Extramammary Paget's disease, Fallopian tube cancer, Fetus in fetu, Fibroma, Fibrosarcoma, Follicular lymphoma, Follicular thyroid cancer, Gallbladder Cancer, Gallbladder cancer, Ganglioglioma, Ganglioneuroma, Gastric Cancer, Gastric lymphoma, Gastrointestinal cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Stromal Tumor, Gastrointestinal stromal tumor, Germ cell tumor, Germinoma, Gestational choriocarcinoma, Gestational T rophoblastic T umor, Giant cell tumor of bone, Glioblastoma multiforme, Glioma, Gliomatosis cerebri, Glomus tumor, Glucagonoma, Gonadoblastoma, Granulosa cell tumor, Hairy Cell Leukemia, Hairy cell leukemia, Head and Neck Cancer, Head and neck cancer, Heart cancer, Hemangioblastoma, Hemangiopericytoma, Hemangiosarcoma, Hematological malignancy, Hepatocellular carcinoma, Hepatosplenic T cell lymphoma, Hereditary breast-ovarian cancer syndrome, Hodgkin Lymphoma, Hodgkin's lymphoma, Hypopharyngeal Cancer, Hypothalamic Glioma, Inflammatory breast cancer, Intraocular Melanoma, Islet cell carcinoma, Islet Cell Tumor, Juvenile myelomonocytic leukemia, Kaposi Sarcoma, Kaposi's sarcoma, Kidney Cancer, Klatskin tumor, Krukenberg tumor, Laryngeal Cancer, Laryngeal cancer, Lentigo maligna melanoma, Leukemia, Leukemia, Lip and Oral Cavity Cancer, Liposarcoma, Lung cancer, Luteoma, Lymphangioma, Lymphangiosarcoma, Lymphoepithelioma, Lymphoid leukemia, Lymphoma, Macroglobulinemia, Malignant Fibrous Histiocytoma, Malignant fibrous histiocytoma, Malignant Fibrous Histiocytoma of Bone, Malignant Glioma, Malignant Mesothelioma, Malignant peripheral nerve sheath tumor, Malignant rhabdoid tumor, Malignant triton tumor, MALT lymphoma, Mantle cell lymphoma, Mast cell leukemia, Mediastinal germ cell tumor, Mediastinal tumor, Medullary thyroid cancer,

Medulloblastoma, Medulloblastoma, Medulloepithelioma, Melanoma, Melanoma, Meningioma, Merkel Cell Carcinoma, Mesothelioma, Mesothelioma, Metastatic Squamous Neck Cancer with Occult Primary, Metastatic urothelial carcinoma, Mixed Mullerian tumor, Monocytic leukemia, Mouth Cancer, Mucinous tumor, Multiple Endocrine Neoplasia Syndrome, Multiple Myeloma, Multiple myeloma, Mycosis Fungoides, Mycosis fungoides, Myelodysplastic Disease, Myelodysplastic Syndromes, Myeloid leukemia, Myeloid sarcoma, Myeloproliferative Disease, Myxoma, Nasal Cavity Cancer, Nasopharyngeal Cancer, Nasopharyngeal carcinoma, Neoplasm, Neurinoma, Neuroblastoma, Neuroblastoma, Neurofibroma, Neuroma, Nodular melanoma, Non-Hodgkin Lymphoma, Non-Hodgkin lymphoma, Nonmelanoma Skin Cancer, Non-Small Cell Lung Cancer, Ocular oncology, Oligoastrocytoma, Oligodendroglioma, Oncocytoma, Optic nerve sheath meningioma, Oral Cancer, Oral cancer, Oropharyngeal Cancer, Osteosarcoma, Osteosarcoma, Ovarian Cancer, Ovarian cancer, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential Tumor, Paget's disease of the breast, Pancoast tumor, Pancreatic Cancer, Pancreatic cancer, Papillary thyroid cancer, Papillomatosis, Paraganglioma, Paranasal Sinus Cancer, Parathyroid Cancer, Penile Cancer, Perivascular epithelioid cell tumor, Pharyngeal Cancer, Pheochromocytoma, Pineal Parenchymal Tumor of Intermediate Differentiation, Pineoblastoma, Pituicytoma, Pituitary adenoma, Pituitary tumor, Plasma Cell Neoplasm, Pleuropulmonary blastoma, Polyembryoma, Precursor T-lymphoblastic lymphoma, Primary central nervous system lymphoma, Primary effusion lymphoma, Primary Hepatocellular Cancer, Primary Liver Cancer, Primary peritoneal cancer, Primitive neuroectodermal tumor, Prostate cancer, Pseudomyxoma peritonei, Rectal Cancer, Renal cell carcinoma, Respiratory Tract Carcinoma Involving the NUT Gene on Chromosome 15, Retinoblastoma, Rhabdomyoma, Rhabdomyosarcoma, Richter's transformation, Sacrococcygeal teratoma, Salivary Gland Cancer, Sarcoma, Schwannomatosis, Sebaceous gland carcinoma, Secondary neoplasm, Seminoma, Serous tumor, Sertoli-Leydig cell tumor, Sex cord-stromal tumor, Sezary Syndrome, Signet ring cell carcinoma, Skin Cancer, Small blue round cell tumor, Small cell carcinoma, Small Cell Lung Cancer, Small cell lymphoma, Small intestine cancer, Soft tissue sarcoma, Somatostatinoma, Soot wart, Spinal Cord Tumor, Spinal tumor, Splenic marginal zone lymphoma, Squamous cell carcinoma, Stomach cancer, Superficial spreading melanoma, Supratentorial Primitive Neuroectodermal Tumor, Surface epithelial-stromal tumor, Synovial sarcoma, T cell acute lymphoblastic leukemia, T cell large granular lymphocyte leukemia, T cell leukemia, T cell lymphoma, T cell prolymphocytic leukemia, Teratoma, Terminal lymphatic cancer, Testicular cancer, Thecoma, Throat Cancer, Thymic Carcinoma, Thymoma, Thyroid cancer, T ransitional Cell Cancer of Renal Pelvis and Ureter, Transitional cell carcinoma, Urachal cancer, Urethral cancer, Urogenital neoplasm, Uterine sarcoma, Uveal melanoma, Vaginal Cancer, Verner Morrison syndrome, Verrucous carcinoma, Visual Pathway Glioma, Vulvar Cancer, Waldenstrom's macroglobulinemia, Warthin's tumor, Wilms' tumor, and combinations thereof.

In some aspects, a cancer target is from a liquid cancer. A cancer target from a liquid cancer can be Acute myeloid leukemia (AML), Multiple Myeloma (MM), and Myelodysplastic syndrome (MDS). In some cases, a cancer target is from a solid cancer. A cancer target from a solid cancer can be: ovarian cancer or colon cancer.

In an aspect, a target comprises an antigen or epitope that can be displayed by a cancer cell, displayed on a solid surface (plate or dish), or be soluble. In some cases, a cancer antigen is a tumor associated antigen (TAA), neoantigen, tumor microenvironment antigen, glycanbased antigen, peptide-based antigen, lipid-based antigen, or any combination thereof. Various suitable antigens are provided herein and can be utilized in the compositions and methods of the disclosure.

In some cases, a target comprises a stromal epitope. A stromal epitope can be on the stroma of a tumor microenvironment. Stromal epitopes or antigens can be present on tumor endothelial cells, tumor vasculature, tumor fibroblasts, tumor pericytes, tumor stroma, and/or tumor mesenchymal cells, just to name a few. Non-limiting examples of stromal epitopes and antigens include CD34, MCSP, FAP, CD31 , PCNA, CD117, CD40, MMP4, and/or Tenascin.

In an embodiment, a cancer antigen can be sugar-based such as a glycan. Exemplary glycanglycan- based antigens are selected from: GD2, sialyl-Tn antigen, Thomsen-Friedenreich glycoantigen, a2-6 sialic acid, gangliosides, Tn , ST, T-antigen, MUC1-ST, KL-6, HCELL, GD3, Lewis, Sialyl Lewis, GM3.

In an embodiment, a cancer antigen can be lipid-based. Exemplary lipid-based antigens are selected from: CD1a, CD1b, CD1c, CD1b presenting lipids; including but not limited to lipid A, a-GalCer, and those provided in Uldrich, A., Le Nours, J., Pellicci, D. etal. CD1 d-lipid antigen recognition by the gd TCR. Nat Immunol 14, 1137-1145 (2013) herein incorporated by reference.

In some embodiments, a target comprises an antigen presented by a major histocompatibility complex (MHC). An MHC can be human leukocyte antigen (HLA) class I or class II. An HLA can be HLA-A, HLA-B, HLA-C, HLA-HLA-E, HLA-F, HLA-G, HLA-DP, HLA-DQ, HLA-DR, HLA-DM, or HLA-DO. In an aspect, an HLA is HLA class I. HLA class I includes but is not limited to: HLA-A, HLA-B, HLA-C, or a non-classical HLA such as HLA-G. In yet another aspect, a subject HLA is HLA-A including but not limited to HLA-A1 , HLA-A2, HLA- A3, HLA-A9, HLA-A10, HLA-A11 HLA-A19, HLA-A23, HLA-A24, HLA-A25, HLA-A26, HLA- A28, HLA-A30, HLA-A31 , HLA-A32, HLA-A33, HLA-A34 HLA-A36 HLA-A43, HLA-A66, HLA-68, HLA- A69, HLA-A74, or HLA-A80.

In an embodiment, a subject HLA is HLA-B including but not limited to HLA-B5, HLA-B7, HLA-B8, HLA- B12, HLA-B13, HLA-B14, HLA-B15, HLA-B-16, HLA-B17, HLA-B18, HLA-B21 , HLA-B22, HLA-B27, HLA- B35, HLA-B37, HLA-B38, HLA-B39, HLA-B40, HLA-B41 , HLA-B42, HLA-B46, HLA-B47, HLA-B48, HLA- B49,HLA-B50, HLA-B51 , HLA-B52, HLA-B53, HLA-B54, HLA-B55, HLA-B56, HLA-B57, HLA-B58, HLA- B59, HLA-B60, HLA-B61 , HLA-B62, HLA-B63, HLA-B64, HLA-B65, HLA-B67, HLA-B70, HLA-B71 , HLA- B73, HLA-B75, HLA-B76, HLA-B77, HLA-B78, HLA-B81 , HLA-B82, or HLA-B83.

In an embodiment, a HLA is HLA-C including but not limited to HLA-Cw1 , HLA-Cw2, HLA-Cw3, HLA-Cw4, HLA-Cw5, HLA-Cw6, HLA-Cw7, HLA-Cw8, HLA-Cw9, or HLA-Cw10. In some cases, a method provided herein comprises at least one of HLA-A2, HLA-A3, or HLA-A11 .

In an embodiment, a MHC is HLA-A and is selected from the group consisting of: A*0201 ; A*0202; A*0203; A*0204; A*0205; A*0206; A*0207; A*0214; A*0217; A*6802; A*6901 ; A*0209; A*0211 ; A*0212; A*0213; A*0215; A*0216; A*0218; A*0219; A*0220; A*0221 ; A*0222; A*0224; A*0225; A*0226; A*0227; A*0228; A*0230; A*0231 ; A*0236; A*0237; A*0238; A*0239; A*0240; A*0243; A*0244; A*0245; A*0246; A*0247; A*0248; A*0249; A*0251 ; A*0254; A*0256; A*0257; A*0258; A*0259; A*0261 ; A*0262; A*0263; A*0266; A*0267; A*0268; A*0269 A*0270; A*0271 ; A*0272; A*0274; A*0275; A*0277; A*0278; A*0279; A*0282; A*0283, A*0285; A*0286; A*6827; A*6828; A*0241 ; A*0242; A*0250; A*0260; A*0273; A*0284; A*6815; A*0301 ; A*1101 ; A*3101 ; A*3301 ; A*3303; A*2402; A*2302; A*2303; A*2304; A*2306; A*2307; A*2308; A*2310; A*2403; A*2405; A*2406; A*2408; A*2409; A*2410; A*2411 ; A*2413; A*2418; A*2420; A*2421 ; 2422; A*2423; A*2426; A*2427; A*2427; A*2428; A*2429; A*2433; A*2434; A*2435; A*2437; A*2438; A*2439; A*2440; A*2443; A*2446; A*2447; A*2448; A*2449; A*2305; A*2312; A*2417; A*2425; A*2430; A*2441 ; A*2442; A*2444; A*2452;.

In an embodiment, a first epitope and/or a second epitope can be present on HLA-A*01 , HI_A-A*02, HLA- A*03, HLA-A *11 , HLA-A*23, HLA-A*24, HLA-A*25, HLA-A*26, HLA-A*29, HLA-A*30, HLA-A*31 , HLA- A*32, HLA-A*33, or HLA-A*24, HLA-B*27, HLA-B*35, HLA-B*48, HLA-B*55, and the like.

In an embodiment, an HLA is HLA-A*2402. In another aspect, a HLA is class II and is HLA-DR, HLA-DQ, or HLA-DP. In an aspect, a subject HLA class II is HLA-DPA1 , HLA-DPB1 , HLA-DQA1 , HLA-DQB1 , HLA- DRA, or HLA-DRB1 .

In an embodiment, a HLA is HLA-DR including but not limited to HLA-DR1 , HLA-DR15, HLA-DR16, HLA-

In an embodiment, a HLA is HLA-DQ including but not limited to HLA-DQ 1 , HLA-DQ2, HLA-DQ3, HLA- DQ4, HLA-DQ5, or HLA-DQ6.

In an embodiment, a target MHC allele is an HLA including but not limited to HLA-B:58, HLA-B:57, HLA- B:57, HLA-B:58 or HLA-A*24:02. In an embodiment, a target comprises an antigen or epitope that can be displayed by an infected cell, such as, for example, by a cell that has been infected by a bacterium or virus. In an embodiment, a target comprises an antigen or epitope that can be displayed by a fungus.

In an embodiment, a target can be present in a complex, can be part of a complex and/or can be comprised in a complex An example of recognition of a target in the context of a complex has been illustrated in figure 6. A target may be recognized by an exogenous gd TCR only in the context of the method or use of the invention (such as presence of the chimeric protein in RET). In other words, the target may not be recognized by an exogenous y6TCR under other conditions, such as in Jurkat cells or derivatives thereof and/or in T cells that are derived from tumorigenic T cells of a patient. This has been nicely demonstrated in example 15. In an embodiment, a complex can comprise at least 1 , 2, 3, 4, 5, 6, 7, 8, 9 or up to about 10 entities to form the target. The word “entity” may be replaced by moiety or molecule.

In an embodiment, a target may not be reproduced or mimicked by altering the expression of the known constituents of a given complex in a healthy cell, healthy or cancer cell line and/or non-human cell lines and/or non-human primary cells.

In an embodiment, an exogenous y6TCR can bind, recognize and/or distinguish a target expressed due to a stress condition such as an infection, cancer, and/or genomic mutation trigger.

In an embodiment, the identity of the target is not known at the molecular level. In such an embodiment, the target may be comprised and may also be expressed on a target cell that may be bound, recognized and/or distinguished by the exogenous y6TCR comprised and expressed on the T cell of the invention. A target cell may be a cell associated with the disease as defined earlier herein. In an embodiment, the target cell may be a cancer or tumor cell. In such an embodiment, the T cell of the invention (preferably primary T cells and/or in T cells that are preferably not Jurkat cells or derivatives thereof and/or in T cells that are preferably not derived from tumorigenic T cells of a patient) may allow the recognition of a target, the screening for the presence of the target, the assessment of the activation of the exogenous y6TCR it comprises and expresses even without knowing the identity of the target at the molecular level.

In an exemplary embodiment, the T cells of the invention can comprise an exogenous y6TCR that bind to targets, such as phosphorylated nonpeptide antigens, called phosphoantigens (pAgs). pAgs can be produced by cellular pathogens and cancers. pAg recognition by some subject exogenous cellular receptors can involve a cell surface molecule such as a butyrophilin, butyrophilin 3A1 (BTN3A1), which can play a necessary, but not sufficient, role in the recognition process.

In an embodiment, an exogenous y6TCR binds to a complex that can comprise a phosphoantigen and/or a butyrophilin. Butyrophilins are glycoproteins built of two extracellular immunoglobulin domains, stabilized with disulfide bonds: constant IgC, and variable IgV and a transmembrane region. Most of these proteins contain a conserved domain encoded by a single exon - B30.2, also referred to as PRYSPRY. In humans, the family of butyrophilins includes 7 butyrophilin proteins, 5 butyrophilin-like proteins and the SKINT-like factor. Butyrophilins have been also demonstrated to play a role in various infections, e.g. tuberculosis or diseases that include sarcoidosis, systemic lupus erythematosus, rheumatoid arthritis, genetic metabolic diseases, ulcerative colitis, cancer and kidney disease. In humans, the family of butyrophilins includes 7 butyrophilin proteins (BTN1A1 , BTN2A1 , BTN2A2, BTN2A3,

BTN3A1 , BTN3A2, BTN3A3), 5 butyrophilin-like proteins (BTNL) (BTNL2, BTNL3, BTNL8, BTNL9, BTNL10) and the SKINT-like factor (SKINTL - selection and upkeep of intraepithelial T cells). Butyrophilins also affect gamma 9 delta 2 T lymphocytes, or exogenous y6TCR derived therefrom. These lymphocytes and their cellular receptors, such as gamma delta TCRs, are characterized by a high reactivity of small organic pyrophosphate molecules and show a strong reaction towards tumor cells and pathogens, such as Plasmodium falciparum, Mycobacterium (M.) tuberculosis and M. leprae.

The recognition of BTN3A1 can involve additional entities that form a complex with the pAg that is in turn recognized by a receptor, such as an exogenous y6TCR provided herein. In an embodiment, a subject pAg can be bound by a exogenous y6TCR, such as a gamma 9 domain of a cellular receptor. In another embodiment, a complex comprises an MHC-like protein or antigen-presenting protein. Some examples include EPCR, Annexin A2, MICA, CD1 -molecules, stressed induced antigens.

Provided herein are cells that comprise and preferably express exogenous y6TCR that selectively bind to a configuration of CD277 that is formed as a result of metabolic changes in distressed target cells such as cancer cells. In some embodiments, metabolic changes cause expression of generic stress molecules that are upregulated upon transformation ordistress of targets. In certain embodiments, this molecule or antigen can have a configuration that can be the J-configuration. In an embodiment, the J-configuration of CD277 is formed as a result of RhoB transmigration within a distressed cancer target such as what is disclosed in any one of: WO2018211115, Rigau, M. et al. Butyrophilin 2A1 is essential for phosphoantigen reactivity by gamma delta T cells. Science 367, 1-24 (2020), Karunakaran, M. M. et al. Butyrophilin-2A1 directly binds germline-encoded regions of the Vy9V62 TCR and is essential for phosphoantigen sensing. Immunity 52, 487-498. e6 (2020), incorporated herein by reference.

In an embodiment, a target as defined herein can be contacted with an agent. In an embodiment, the contacting is with an agent that increases an amount of an intracellular phosphoantigen in the target cancer cell. In some instances, the additional agent is a mevalonate pathway inhibitor. In some embodiments, the mevalonate pathway inhibitor is an aminobisphosphonate. In some embodiments, the aminobisphosphonate is at least one of pamidronate and zoledronate.

In some embodiments, an exogenous y6TCR described herein recognizes a CD277 (BTN3A1) protein expressed by a target cell (e.g., tumor cell). In some embodiments, an exogenous y6TCR described herein recognizes and/or senses a target wherein the target is an antigen in a complex that includes the J configuration of the CD277 protein expressed on the surface of a target cell. In an embodiment, the exogenous y6TCR senses a conformational change of CD277-isoform BTN3A1 , referred to as CD277J.

In some embodiments, a target as defined herein may have reduced or no binding to an antibody. The reduced or no binding can be because the target is unknown, and a suitable antibody does not exist. In other cases, a target comprises a complex or is part of a complex that cannot be bound by an antibody. The T cells of the invention (preferably primary T cells and/or in T cells that are preferably not Jurkat cells or derivatives thereof and/or in T cells that are preferably not derived from tumorigenic T cells of a patient) and methods of the invention allow for identification of suitable targets that may otherwise be unknown or could not be identified. In an exemplary embodiment, a exogenous gamma and/or delta- chain from a TCR binds an unknown target, such as a phosphoantigen, produced by cellular pathogens and/or overexpressed by cancers. However, in some cases, the molecular target bound by the gamma and/or delta-chain of the exogenous y6TCR is unknown. Provided T cells of the invention and compositions comprising them and methods of the invention can be utilized to identity the presence of unknown targets, such as phosphoantigens, for therapeutic, patient stratification, and/or generation of T cells expressing exogenous y6TCR.

In some embodiments, the exogenous y6TCR binds to a neoantigen or neoepitope. For example, a neoantigen can be an E805G mutation in ERBB2IP. Neoantigen and neoepitopes can be identified by whole-exome sequencing in some cases. A neoantigen and neoepitope target can be expressed by a cancer cell. In some cases, a gene that can comprise a mutation that gives rise to a neoantigen or neoepitope.

T CELLS OF THE INVENTION

In an aspect there is provided a T cell, preferably an abT cell, that comprises:

(a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of a gamma delta TCR; and

(b) a polynucleotide sequence encoding an exogenous gamma delta T cell receptor

(y6TCR).

Within the context of the invention a T cell comprising features a) and b) as defined in previous paragraphs is preferably not a Jurkat cell or a derivative thereof and/or is preferably not derived from a tumorigenic T cell of a patient and/or is preferably a primary T cell. More preferably such T cell is a human T cell. Throughout the application, the “T cell comprising features a) and b) as defined in previous paragraphs” may be replaced by an engineered T cell comprising said features or by a T cell of the invention.

A T cell suitable to be used in the context of the invention is preferably a primary T cell and/or is preferably not a Jurkat cell or a derivative thereof and/or is preferably not derived from a tumorigenicT cell of a patient.

In an embodiment, a T cell is a primary T cell.

In another embodiment, a T cell is not a Jurkat cell or a derivative thereof.

In another embodiment, a T cell is not derived from a tumorigenic T cell of a patient.

In an embodiment, the T cell is a human T cell.

In an embodiment, a T cell is an abT cell.

In an embodiment, the T cell is an iPSC (induced pluripotent stem cell).

In some embodiments wherein a T cell is an ab T cell as described herein, said ab T cell may be superior to a Jurkat cell, for example by being more representative of the reactivity of TEG products than a Jurkat cell. As a non-limiting example, a Jurkat cell expressing an exogenous ybTCR may in some cases show reactivity against a target, whereas expression of the same ybTCR in TEG products would result in no reactivity. As another non-limiting example, a Jurkat cell expressing an exogenous ybTCR may in some cases not show reactivity against a target, whereas expression of the same ybTCR in TEG products would result in reactivity. The superiority of abT cells as described herein may be particularly advantageous when complex and/or unknown targets are assessed (see example 18).

Jurkat cells have been initially isolated in the publication of Schneider U et al (1977) (Schneider U et al (1977), Int. J. Cancer, 19(5): 621-626. Since then several derivatives of Jurkat cells have been obtained. One specific Jurkat derivative is the Jurkat cell line J76 TPR, which does not express an ab TCR (Rosskopf S, (2018), Oncotarget, 9:25: 17608-17619).

The isolation of such primary T cells is known to the skilled person. Usually primary T cells are isolated from (human) blood sample and could be expanded, cultured and engineered. Primary T cells are preferred to be used as they are more representative of TEG products than T cell lines. Indeed, RET-CL5 generated from primary T cells correlated well with the reactivity of TEG products and predicted TEG-CL5 reactivity across tumor cell line targets better than Jurkat-CL5 (see example 15).

In an embodiment, even if the patient has cancer, one can use T cells of this patient which are not diseased. In this context, it is possible to isolate T cells from a cancer patient and not use tumorigenic T cells of said patient. In an embodiment, a T cell is not a Jurkat cell or a derivative thereof and/or is not derived from a tumorigenic T cell of a patient and/or is a primary T cell, and preferably wherein the T cell is a human T cell.

In an embodiment, a T cell is an iPSC. Such cells are known to the skilled person and he knows how to obtain them. Examples of methods describing how to obtain such cells are described in Staerk J., et al (2010), Cell Stem Cell., 7(1): 20-24 or Loh Y.H., et al (2010), Cell Stem Cell., 7 (1): 15-19..

In an embodiment primary T cells and/or not Jurkat cells or derivatives thereof and/or not T cells derived from a tumorigenic T cell of a patient include a natural killer T cell, a hematopoietic stem cell or a non- pluripotent stem cell. In some cases, the cell can be any T cell such as tumor infiltrating lymphocytes (TILs), such as CD3+ T cells, CD4+ T cells, CD8+ T cells, or any other type of T cell. The T cell can also include memory T cells, memory stem T cells, or effector T cells. The T cells (preferably primary T cells and/or is preferably not Jurkat cells or derivatives thereof and/or is preferably not T cells derived from tumorigenic T cells of a patient) can also be selected from a bulk population, for example, selecting T cells from whole blood. The T cells can also be expanded from a bulk population.

An exogenous y6TCR can be introduced into a T cell (preferably a primary T cell and/or preferably not into a Jurkat cell or a derivative thereof and/or preferably not into a T cell which is derived from a tumorigenic T cell of a patient) via one vector or using different vectors. An exogenous y6TCR and a chimeric bidirectional signaling transmembrane protein can be expressed as one transcript (e.g., separated by a self-cleaving peptide sequence) or as different transcripts. An exogenous y6TCR and a chimeric protein can be operably linked and under regulatory control of the same promoter or different promoters.

In some cases, an exogenous y6TCR requires an antigen to be presented by MHC for antigen-based activation to occur. In some cases, an exogenous y6TCR does not require an antigen to be presented by MHC for antigen-based activation to occur.

In an embodiment, a T cell (preferably a primary T cell and/or is preferably not a Jurkat cell or a derivative thereof and/or is preferably not a T cell derived from a tumorigenic T cell of a patient) can comprise a higher ratio of an exogenous y6TCR as compared to an endogenous cellular receptor (preferably a y6TCR or apTCR, more preferably an apTCR). In certain cases, a higher ratio may be achieved byway of preferential expansion of said T cells, benefitting the growth and survival of said T cells. As non-limiting examples, T cells comprising an exogenous ybTCR may be stimulated by anti-CD3/CD28 antibodies, by contact with antigens that are specific for the exogenous ybTCR, or with cells expressing such antigens, optionally the stimulation being serial stimulation. A further non-limiting example is provided in the experimental section herein. The preferential expansion may result in a population of said T cells with limited or absent cell surface expression of the endogenous cellular receptor (preferably a ybTCR or apTCR, more preferably an apTCR), while expressing sufficient amounts of the exogenous ybTCR (referred to as a population enriched for a single positive phenotype). Such cells may have reduced alloreactivity (e.g., graft versus host) as compared to cells having surface expression of the endogenous cellular receptor. Reduced alloreactivity may result in reducing background and potential false positive signal subsequently when such cells are used in the methods of the invention.

In certain cases, a higher ratio may be achieved by way of preferential expansion of T cells also expressing a chimeric protein, benefitting the growth and survival of said T cells. Accordingly, the skilled person understands that, in some cases, a higher ratio may be achieved by preferential expansion of T cells expressing a chimeric protein combined with stimulation as discussed above, optionally the stimulation being serial stimulation, benefitting the growth and survival of said T cells.

In other cases, a higher ratio of an exogenous y6TCR as compared to an endogenous cellular receptor can be achieved by positively or negatively selecting for cells that express the exogenous y6TCR and have reduced surface expression of the endogenous receptor or lack the endogenous receptor. In a particular embodiment, a higher ratio of an exogenous y6TCR as compared to an endogenous cellular receptor (preferably a y6TCR or apTCR, more preferably an apTCR) can be used in patient stratification and/or detection of suitable targets, as is disclosed herein.

In other cases, a higher ratio of an exogenous ybTCR as compared to an endogenous cellular receptor can be achieved via genomic modification, for example a genomic modification which results in the reduction or elimination of surface expression of the endogenous cellular receptor (preferably a ybTCR or apTCR, more preferably an apTCR). Genomic modification methods are discussed later herein. A genomic modification may be combined with preferential expansion and/or selection as discussed above.

In an embodiment, a T cell (preferably a primary T cell and/or preferably not a Jurkat cell or a derivative thereof and/or preferably not a T cell derived from a tumorigenicT cell of a patient) comprises:

(a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of a gamma delta TCR; and

(b) a polynucleotide sequence encoding an exogenous gamma delta T cell receptor (y6TCR), and said T cell has reduced or eliminated surface expression of an endogenous cellular receptor, optionally wherein the endogenous cellular receptor comprises an endogenous TCR (preferably apTCR). If the T cell (primary T cell and/or is preferably not a Jurkat cell or a derivative thereof and/or preferably not a T cell derived from a tumorigenic T cell of a patient) is an abT cell, the T cell may have reduced or eliminated endogenous ocpTCR surface expression and instead express the y6TCR.

In an embodiment, a T cell, preferably an abT cell, expressing a chimeric protein as described herein comprises a higher ratio of an exogenous gamma delta TCR to an endogenous alpha beta TCR as compared to an otherwise comparable cell that does not express the chimeric protein. In an embodiment, a T cell comprises a higher ratio of an exogenous gamma 9 delta 2 TCR to an endogenous alpha beta TCR as compared to an otherwise comparable cell that is not engineered with the chimeric protein. In an embodiment, where the T cell comprises the chimeric protein, a predominantly exogenous gamma delta single TCR positive phenotype can be achieved in combination with prolonged lifespan of the cells.

In some embodiments, a T cell, preferably an abT cell, comprises a higher ratio of an exogenous gamma delta TCR to an endogenous alpha beta TCR compared to an otherwise comparable cell that does not comprise the exogenous gamma delta TCR. Such a cell may optionally express a chimeric protein as described herein. Such as cell may be obtained for example as described earlier herein.

Any of the T cells of the invention can comprise a ratio of an exogenous y6TCR to endogenous cellular receptor (preferably a TCR, more preferably a y6TCR or ocpTCR, most preferably an c^TCR) that is at least 1 fold, 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 11 fold, 12 fold, 13 fold, 14, fold 15 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 150 fold, 200 fold, 250 fold, or 300 fold higher than in a corresponding counterpart T cell. In an embodiment, a T cell comprises an at least about 1 fold, 2 fold, 3 fold, 4 fold, to 5 fold higher ratio of an exogenous y6TCR to an endogenous cellular receptor (preferably an ocpTCR) than a corresponding counterpart cell.

A corresponding counterpart T cell may be a control or reference T cell in which no exogenous y6TCR has been expressed and no polynucleotide comprising a promoter sequence and an exogenous reporter sequence. In other words, this cell may be the initial cell used to prepare the cell of the invention.

A T cell of the invention can comprise a ratio of an exogenous y6TCR to an endogenous cellular receptor (preferably a y6TCR or apTCR) that is at least 1 :1 , 2:1 , 3:1 , 4:1 , 5:1 , 6:1 , 7:1 , 8:1 , 9:1 , 10:1 , 11 :1 , 12:1 , 13:1 , 14, :1 15:1 , 20:1 , 30:1 , 40:1 , 50:1 , 60:1 , 70:1 , 80:1 , 90:1 , 100:1 , 150:1 , 200:1 , 250:1 , or 300:1 .

In an aspect, a T cell of the invention (preferably a primary T cell and/or preferably not a Jurkat cell or a derivative thereof and/or is preferably not a T cell derived from a tumorigenic T cell of a patient) can comprise a genomic modification. A genomic modification can result in the reduction or elimination of a polypeptide that codes for an endogenous cellular receptor, such as an ab TCR. A genomic modification can be made by any number of means including but not limited to Zinc Finger, TALEN, CRISPR, and/or Argonaute-based editing. In an embodiment, a genomic modification is performed using CRISPR. Suitable targets for disrupting expression of an endogenous cellular receptor include disrupting genes or portions thereof such as, but not limited to: TRAC (TCR alpha constant chain), TRBC1 (TCR beta constant chain 1) and/or TRBC2 (TCR beta constant chain 2). Alternate means of reducing expression of an endogenous polypeptide can be achieved using RNAi, RNA editing, and siRNA approaches. Any of the above referenced engineered cells can comprise from about 1 fold, 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 11 fold, 12 fold, 13 fold, 14, fold 15 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 150 fold, 200 fold, 250 fold, or up to 300 fold higher ratio of an exogenous cellular receptor as compared to an endogenous cellular receptor. In an embodiment, said T cells (preferably primary T cells and/or preferably not Jurkat cells or derivatives thereof and/or preferably not T cells derived from a tumorigenic T cell of a patient) comprise from about 1 fold, 2 fold, 3 fold, 4 fold, to 5 fold higher ratio of an exogenous y6TCR as compared to an endogenous cellular receptor (preferably a y6TCR or apTCR, more preferably an apTCR).

In an embodiment, reduction or elimination of surface expression of an endogenous cellular receptor in T cells of the invention, such as an endogenous ybTCR or apTCR, does not result in inferior function of the T cells as compared to an otherwise comparable cell having unaffected expression of the polynucleotide.

In an embodiment, the T cells (preferably primary T cells and/or preferably not Jurkat cells or derivatives thereof and/or preferably not T cells derived from a tumorigenic T cell of a patient) comprise from about 4 fold higher ratio of an exogenous y6TCR as compared to an endogenous cellular receptor (preferably a ybTCR or apTCR, more preferably an apTCR), for example from about 20% express an endogenous alpha beta TCR, and about 80% express an exogenous gamma delta TCR. In other embodiments, on a per cell basis, a T cell can express greater than 20 fold more of an exogenous y6TCR as compared to an endogenous cellular receptor (preferably a apTCR) as measured by MFI.

In some cases, a T cell (preferably a primary T cell and/or preferably not a Jurkat cell or a derivative thereof and/or preferably not a T cell derived from a tumorigenic T cell of a patient of the invention can be assayed for marker expression to determine a level of activation, differentiation, or otherwise identify its function or status. These cells can then be qualified as: CD3+ cell, CD3- cell, a CD5+ cell, CD5- cell, a CD7+ cell, CD7- cell, a CD14+ cell, CD14- cell, CD8+ cell, a CD8- cell, a CD103+ cell, CD103- cell,

CD11 b+ cell, CD11 b- cell, a CD19+ cell, a CD19- cell, a CCR7+ cell, a CCR7- cell, a CD40L+ cell, a CD40L- cell, a PD1+ cell, a PD1- cell, a KLGR1+ cell, a KLGR1- cell, a CD58+ cell, a CD58- cell, a CD38+ cell, a CD38- cell, a BDCA1+ cell, a BDCA1- cell, an L-selectin+ cell, an L-selectin- cell, a CD25+, a CD25- cell, a CD26+ cell, a CD26- cell, a CD27+, a CD27- cell, a CD28+ cell, CD28- cell, a CD44+ cell, a CD44- cell, a CD16+ cell, a CD16- cell, a TNFa+ cell, a TNFa- cell, a HLA-DR+ cell, a HLA-DR- cell, a 41BB+ cell, 41 BB- cell, a 0X40+ cell, a 0X40- cell, a CD56+ cell, a CD56- cell, a CD57+ cell, a CD57- cell, a CD62L+ cell, a CD62L- cell, a CD69+ cell, a CD69- cell, a CD45RO+ cell, a CD45RO- cell, a CD45RA+ cell, a CD45RA- cell, a FASL+ cell, a CD45RA- cell, a CD127+ cell, a CD127- cell, a CD132+ cell, a CD132- cell, an IL-2+ cell, an IL-2- cell, a FOXP3+ cell, a FOXP3- cell, a CD15+ cell, a CD15- cell, an IL-7+ cell, an IL-7- cell, an IL-15+ cell, an IL-15- cell, a lectin-like receptor G1 positive cell, or a lectinlike receptor G1 negative cell.

In the context of activation, certain markers can be utilized to specifically assess activation of the T cells of the invention. One may then discriminate between: a CD38+ cell, a CD38- cell, an L-selectin+ cell, an L-selectin- cell, a CD25+, a CD25- cell, a CD44+ cell, a CD44- cell, a TNFa+ cell, a TNFa- cell, a HLA- DR+ cell, a HLA-DR- cell, a 41 BB+ cell, 41 BB- cell, a 0X40+ cell, a 0X40- cell, a CD69+ cell, a CD69- cell, an IL-2+ cell, an IL-2- cell, and the like.

In some cases, the cell can be any T cell such as tumor infiltrating lympocytes (TILs), such as CD3+ T cells, CD4+ T cells, CD8+ T cells, gamma delta TCR+ T cells, alpha beta TCR+ T cells, or any other type of T cell. A T cell can also include memory T cells, memory stem T cells, or effector T cells. T cells can also be selected from a bulk population, for example, selecting T cells from whole blood. The T cells can also be expanded from a bulk population. The T cells can also be skewed towards particular populations and phenotypes. The examples of factors expressed by cells is not intended to be limiting, and a person having skill in the art will appreciate that a cell may be positive or negative for any factor known in the art. In some cases, a cell may be positive for two or more factors. For example, a cell may be CD4+ and CD8+. In some cases, a cell may be CD4+. In some cases, a cell may be CD8+. In some cases, a cell may be negative for two or more factors. For example, a cell may be CD25-, CD44-, and CD69-. In some cases, a cell may be positive for one or more factors, and negative for one or more factors. For example, a cell may be CD4+ and CD8-.

A “TEG” is a T cell engineered to express a defined gd TCR as disclosed herein. In a non-limiting example, a TEG can be an alpha-beta T cell that is engineered to express a defined gd TCR. Within the context of the application, the expression “engineered cell” refers to a cell that has been modified using recombinant DNA technology. In an embodiment, an “engineered cell” has been transformed, modified or transduced to comprise a heterologous nucleic acid molecule. In an embodiment, said cell expresses a protein encoded by said nucleic acid molecule. The wording “engineered cell” may be replaced by the wording “cell comprising and preferably expressing an exogenous nucleic acid molecule”. In this context, since the nucleic acid molecule encoding the y6TCR is exogenous to said T cell, one may also say that said T cell comprises or expresses an exogenous y6TCR. A “RET” is a reporter engineered T cell. Within the context of the invention and unless otherwise specified, this T cell is a TEG cell as defined in the previous paragraph and it further comprises a nucleic acid molecule encoding an exogenous reporter linked to a promoter sequence. The wording “reporter engineered T cell” may be replaced by the wording “T cell comprising an exogenous reporter sequence”. In a preferred embodiment, a RET comprises, preferably expresses a nucleic acid molecule encoding the chimeric molecule as defined herein. A preferred chimeric molecule comprises 41BBL linked to the intracellular domain of the 0X40 (SEQ ID NO: 45) .It is clear to a skilled person that in the process of generating a RET several subpopulations of T cells may be generated as is explained in the legends of figure 2A.

In a further aspect, there is provided a T cell population comprising several T cells as defined earlier herein, wherein the exogenous y6TCR comprised in at least one of the T cell is distinct from the exogenous y6TCR comprised in at least one of the other T cells within said T cell population, defining a pool of distinct exogenous y6TCR comprised within a T cell population. Each feature defining this T cell population has already been defined when defining the T cell of the invention. Such T cell population can be used in different methods as later explained herein.

METHODS OF MAKING ENGINEERED CELLS

Disclosed herein, in some embodiments, are methods of making T cells of the invention (preferably primary T cells and/or preferably not Jurkat cells or derivatives thereof and/or preferably not T cells derived from a tumorigenic T cell of a patient). Methods can comprise contacting cells with vectors that encode polynucleotides provided herein. Methods can also comprise expanding these cells and/or cryopreserving the cells for future use.

In an embodiment, a method can comprise contacting a T cell with a polynucleotide as defined earlier herein or a vector comprising said polynucleotide. In an embodiment, the method can comprise contacting a T cell with a polynucleotide encoding an exogenous y6TCR. In an embodiment, the method can comprise contacting a T cell with a polynucleotide comprising a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of a gamma delta TCR. In an embodiment, a method can comprise contacting a cell with a polynucleotide that encodes a chimeric protein. In some cases, a method can comprise expressing the chimeric protein in at least one cell in a population of T cells, and culturing the population of cells in a condition suitable for expansion of the population of T cells. Expressing the chimeric protein in T cells (preferably primary T cells and/or preferably not Jurkat cells or derivatives thereof and/or preferably not T cells derived from a tumorigenic T cell of a patient) of the invention can increase, for example, fitness, proliferation, survival, effector function of the cells. In some embodiments, T cells of the invention expressing the chimeric protein can be cultured for extended periods without stimulation or with reduced stimulation compared to conventional methods of expanding T cells of the invention not expressing the chimeric protein, and the chimeric protein can support expansion and fitness of the population of cells. For example, the chimeric protein can provide signaling necessary to support survival and proliferation of the engineered cells, reducing or eliminating the need for exogenous stimulating agents, such as those disclosed below. In some embodiments, T cells of the invention expressing the chimeric protein can be cultured for extended periods without CD3-CD28 costimulation, and the chimeric protein can support expansion and fitness of the population of cells. In some embodiments, CD3-CD28 co-stimulating reagents are added during an editing stage (e.g., a stage where a vector is used to introduce a transgene encoding the chimeric protein), but no CD3-CD28 co-stimulating reagents are added after the chimeric protein has been introduced.

In some embodiments, methods of making T cells can comprise stimulation, such as by contact with an anti-CD3 antibody or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) sometimes in conjunction with a calcium ionophore. For co-stimulation of an accessory molecule on the surface of the T cells, a ligand that binds the accessory molecule can be used. In some cases, a population of T cells can be CD3-CD28 costimulated, for example, contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions that can stimulate proliferation of the T cells.

Conditions appropriate for T cell culture can include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 5, (Lonza)) that may contain factors necessary for proliferation and viability, including serum. In some cases, serum-free medium is used. In an aspect, cells can be maintained under conditions necessary to support growth; for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% C02).

T cells can be activated and expanded generally using methods as described, for example, in U.S. Pat. Nos. 6,352,694 (for example see example 11); 6,534,055 (see examples 8-9); 6,905,680 (See examples section); 6,692,964 (see examples section); 5,858,358 (see examples section); 6,887,466 (see examples section); 6,905,681 (see examples section); 7,144,575 (see examples section); 7,067,318 (see examples section);7, 175,843 (see examples section);6,905,874 (see examples section); 6,797,514 (see examples section); which are incorporated by reference for such disclosure. T cells, such as for example abT cells, can be obtained from any suitable source of T cells for the generation ofT cells of the invention. Cells can be primary cells. Cells can be recombinant cells. Cells can be obtained from a number of non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. Cells can be derived from a healthy donor, from a patient diagnosed with cancer, or from a patient diagnosed with an infection. Preferred cells are obtained from a healthy donor. Cells can also be obtained from a cell therapy bank. Cells can also be obtained from whole food, apheresis, or a tumor sample of a subject. A cell can be a tumor infiltrating lymphocytes (TIL). In some cases, an apheresis can be a leukapheresis.

A desirable T cell population can also be selected prior to modification. A selection can include at least one of: magnetic separation, flow cytometric selection, antibiotic selection. The one or more cells can be any blood cells, such as peripheral blood mononuclear cell (PBMC), lymphocytes, monocytes or macrophages. The one or more cells can be any immune cells such as a lymphocyte, an alpha-beta T cell, a gamma delta T cell, CD4+ T cell, CD8+ T cell, a T effector cell, an NKT cell. Methods of making T cells of the invention can comprise the use of a vector, for example, to introduce a nucleic acid sequence that encodes the chimeric protein and/or an exogenous y6TCR. An additional vector may be needed for a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, wherein said promoter is inducible upon the activation of a gamma delta TCR. Alternatively, all polynucleotides may be present on the same vector as earlier disclosed herein.

A vector can be any genetic element, e.g., a plasmid, chromosome, virus, transposon, behaving either as an autonomous unit of polynucleotide replication within a cell. (i.e. capable of replication under its own control) or being rendered capable of replication by insertion into a cell chromosome, having attached to it another polynucleotide segment, so as to bring about the replication and/or expression of the attached segment. Suitable vectors include, but are not limited to, plasmids, transposons, bacteriophages and cosmids. Vectors can contain polynucleotide sequences which are necessary to effect ligation or insertion of the vector into a desired host cell and to affect the expression of the attached segment. Such sequences differ depending on the host organism; they include promoter sequences to effect transcription, enhancer sequences to increase transcription, ribosomal binding site sequences and transcription and translation termination sequences. Alternatively, expression vectors can be capable of directly expressing nucleic acid sequence products encoded therein without ligation or integration of the vector into host cell DNA sequences. A vector can comprise a selectable marker gene. In some embodiments, the vector is an “episomal expression vector” or “episome,” which is able to replicate in a host cell, and persists as an extrachromosomal segment of DNA within the host cell in the presence of appropriate selective pressure. A polynucleotide vector useful for the methods and compositions described herein can be a good manufacturing practices (GMP) compatible vector. For example, a GMP vector can be purer than a non- GMP vector. In some cases, purity can be measured by bioburden. For example, bioburden can be the presence or absence of aerobes, anaerobes, sporeformers, fungi, or combinations thereof in a vector composition. In some cases, a pure vector can be endotoxin low or endotoxin free. Purity can also be measured by double-stranded primer-walking sequencing. Plasmid identity can be a source of determining purity of a vector. A GMP vector of the invention can be from 10% to 99% more pure than a non-GMP vector. A GMP vector can be from 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% more pure than a non-GMP vector as measured by the presence of bioburden, endotoxin, sequencing, or combinations thereof.

A variety of enzymes can catalyze insertion of foreign DNA into a host genome. Non-limiting examples of gene editing tools and techniques include CRISPR, TALEN, zinc finger nuclease (ZFN), meganuclease, Mega-TAL, and transposon-based systems.

A CRISPR system can be utilized to facilitate insertion of a polynucleotide sequence encoding a membrane protein or a component thereof into a cell genome. For example, a CRISPR system can introduce a double stranded break at a target site in a genome. There are at least five types of CRISPR systems which all incorporate RNAs and CRISPR-associated proteins (Cas). Types I, III, and IV assemble a multi-Cas protein complex that is capable of cleaving nucleic acids that are complementary to the crRNA. Types I and III both require pre-crRNA processing prior to assembling the processed crRNA into the multi-Cas protein complex Types II and V CRISPR systems comprise a single Cas protein complexed with at least one guiding RNA.

A transposon based system can be utilized for insertion of a polynucleic acid encoding a protein of the disclosure or a component thereof into a genome.

In some cases, cells are genetically engineered or modified to comprise a protein of the disclosure in vivo. In some cases, cells are genetically engineered to comprise a protein of the disclosure in vitro or ex vivo.

Methods to introduce gene editing components into a T cell include, but are not limited to, electroporation, sonoporation, use of a gene gun, lipofection, calcium phosphate transfection, use of dendrimers, micro injection, and use of viral vectors. Viral vector delivery systems can include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. Examples of viral vectors include, but are not limited to, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus (AAV) vectors, helper-dependent adenovirus vectors, hybrid adenovirus vectors, Epstein-Bar virus vectors, herpes simplex virus vectors, hemagglutinating virus of Japan (HVJ) vectors, and Moloney murine leukemia virus vectors. METHODS OF UTILIZING COMPOSITIONS OR T CELLS PROVIDED HEREIN

Provided herein are also methods that employ T cells of the invention (preferably primary T cells and/or preferably not Jurkat cells or derivatives thereof and/or preferably not T cells derived from a tumorigenic T cell of a patient), populations of such T cells and compositions that comprise such cells or T cell populations of the invention. Each feature listed in each of these methods has been defined earlier herein unless otherwise indicated. "Diagnostic” in the context of the methods of the invention may refer to an investigative method, a non-limiting example of which being determining the presence of the target or identifying the target of an exogenous ybTCR in a sample, a cell comprising a potential target, or a tissue comprising said cell, In some embodiments, the methods described herein are in vitro or ex vivo methods.

In an aspect, such cells or compositions of the invention can be utilized to determine if a subject is eligible for cellular immunotherapy, for example with a population of cells that express an exogenous y6TCR. In an embodiment, a tumor sample from a subject can be obtained and used as target, in an in vitro coculture assay with a T cell of the invention. Should contacting of the target and the T cell result in detection of a reporter, the subject can be selected to receive an immunotherapy. In an embodiment, the subject comprises the target and the immunotherapy comprise the T cell that comprises an exogenous y6TCR that is capable of binding the target and/or generating a reporter polypeptide. In specific embodiments the T cell comprising the exogenous y6TCR further comprises the chimeric protein.

Accordingly, there is provided a method for predicting the efficacy of a y6TCR treatment, comprising a) providing a sample from a subject in need of such treatment, b) contacting said sample with the T cell as earlier defined herein and comprising a polynucleotide sequence encoding the exogenous y6TCR of the y6TCR treatment and c) assessing the expression of the exogenous reporter gene, which is indicative for efficacy of the y6TCR treatment when applied to the subject.

Assessing the expression of the exogenous reporter gene can be combined with detection of factors associated with cellular activation, differentiation, and/or development as discussed elsewhere herein, such as expansion (cellular counts), degranulation, persistence, target cytotoxicity, factor secretion, and combinations thereof. Detection of degranulation may be a preferred read-out.

In an embodiment, assessing the expression of the exogenous reporter gene is combined with detection of degranulation via determination of a degranulation marker of the T cell, preferably of CD107a. In an embodiment, a sample from a subject is not limited to a specific type of sample as long as it comprises tumor or infected cells or cells associated with an allergen. In an embodiment, the sample comprises tumor cells, preferably viable tumor cells. Such a sample may be a tumor biopsy or may be based on or derived from a tumor biopsy. In an embodiment, a sample is or comprises ascites, blood or may be derived from blood.

In another aspect, such cells can be employed for patient stratification. Stratification can refer to the partitioning of subjects by a factor other than the treatment given. In an embodiment, a plurality of subjects can be stratified into a group based on the presence of a target that can be bound by a subject exogenous y6TCR. In an embodiment, a T cell of the invention from a subject can be used to stratify subjects based on increasing levels of an antigen target as compared to levels of a target, for example antigen target, above a set inclusion threshold. In another embodiment, a T cell of the invention from a subject can be used to stratify subjects based on the presence or increasing levels of the target, recognized by the exogenous y6TCR, expressed by the cells. As previously described, such a cell can comprise: a higher ratio of an exogenous y6TCR as compared to an endogenous cellular receptor (such as an ybTCR or apTCR). In certain cases, a higher ratio can be achieved by way of preferential expansion, for example via expression of the chimeric protein and/or via stimulation with anti-CD3/CD28 antibodies, by contact with antigens that are specific for the exogenous ybTCR, or with cells expressing such antigens, for example resulting in (gamma delta) single TCR positive phenotype of gamma delta TCR-engineered cells, as discussed earlier herein. A higher and/or lower ratio of an exogenous y6TCR as compared to an endogenous cellular receptor can be particularly useful for patient stratification and/or detection of suitable targets. For example, in some cases, patients can be stratified based on expression of a target that may not be easily detected via an antibody or similar means as the target may be unknown. Exemplary unknown targets can comprise those such as phosphoantigens and/or targets that are comprised in complexes for which additional entities that form part of the complex are unknown. Provided T cells, compositions and methods can be utilized to identity the presence of unknown targets for purposes of identifying suitable patients/subjects to treat with T cells of the invention.

In an aspect, the subjects comprise a complexthat comprises CD277. In an embodiments, the subjects comprise a complexthat comprises CD277 but may have different cancers or disorders. For example, a subject target can be a phosphoantigen that can be produced by cellular pathogens and/or overexpressed by a variety of cancers. A subject can comprise a target, such as a phosphoantigen, that is produced by: (a) a cellular pathogen; (b) expressed or displayed by a cancer; or (c) (a) and (b).

Patients that are stratified may express the phosphoantigen but may express it due to different reasons such as those previously indicated.

In an aspect, provided herein is a method to detect the presence of a target, for example a cognate (specific) antigen, that can be comprised in a complex, unidentified, circumstantial, or any combination thereof on a target cell. In an aspect, a method can comprise measuring exogenous y6TCR mediated reactivity against a target, for example a CD277J positive cell. Within the context of the application, the wording “activation of exogenous y6TCR” may be replaced by “reactivity of an exogenous y6TCR”. In some cases, a method can comprise the use of the T cells that co-express two exogenous reporters such as, GFP and luciferase, operably linked to an NFAT promoter. In an embodiment, T cells of the invention can further comprise the chimeric protein. The chimeric protein can be co-transfected with the exogenous cellular receptor, such as a gamma delta TCR. In an embodiment, cells that further comprise the chimeric protein can generate single positive cultures. In an embodiment, cells that do not further comprise the chimeric protein can generate single positive cultures. For example, during serial culturing of abT cells expressing an exogenous ybTCR (or stimulation with an exogenous gamma delta TCR specific antigen), anti-CD3/CD28 activation, and/or stimulation with an exogenous gamma delta TCR specific antigen cells can positively select for dominantly y6TCR ⁺ apTCR single positivity, significantly reducing the alloreactive potential of these engineered cells. This may result in a subject method to generate highly ybTCR-specific and sensitive T cells with potentially decreased alloreactivity (e.g., graft versus host) as discussed earlier herein. Decreased alloreactivity may result in reduced background and potential false positive signal subsequently.

Accordingly, there is provided a diagnostic method for determining the presence of the target of an exogenous y6TCR in a sample, said method comprising the steps of: a) contacting the sample with the T cell as defined herein (preferably primary T cells and/or preferably not Jurkat cells or derivatives thereof and/or preferably not T cells derived from a tumorigenic T cell of a patient) and comprising (preferably expressing) said exogenous y6TCR and b) assessing the expression of the exogenous reporter gene whose encoding polynucleotide is present in said T cell, which is indicative for the presence of target in the sample.

There is further provided a method for determining the presence of the target of an exogenous y6TCR in a sample, said method comprising the steps of: a) contacting the sample with the T cell as defined herein (preferably a primary T cell and/or preferably not a Jurkat cell or derivatives thereof and/or preferably not a T cell derived from a tumorigenic T cell of a patient) and comprising (preferably expressing) said exogenous y6TCR and b) assessing the expression of the exogenous reporter gene whose encoding polynucleotide is present in said T cell, which is indicative for the presence of target in the sample.

Suitable samples have been defined earlier herein. In some embodiments, the potential target is not known at the molecular level.

There is further provided a method for determining the presence of the target of an exogenous ybTCR in a cell comprising a potential target, said method comprising the steps of: a) contacting the cell comprising a potential target, or a tissue comprising said cell, with the T cell as defined herein (preferably a primary T cell and/or preferably not a Jurkat cell or derivatives thereof and/or preferably not a T cell derived from a tumorigenic T cell of a patient) and comprising (preferably expressing) said exogenous ybTCR and b) assessing the expression of the exogenous reporter gene whose encoding polynucleotide is present in said T cell, which is indicative for the presence of the target in the cell.

The cells comprising a potential target preferably expresses the potential target. A potential target may be associated with or linked with a disease, as described earlier herein. Accordingly, the cell comprising a potential target may, for example, be a cancer cell, an infected cell (for example a cell infected by a virus or bacterium), a cell associated with an allergy, or a fungus. A potential target may, for example, be an antigen or epitope that can be displayed by the cell, as described earlier herein.

The methods of the invention are further particularly suited for identification of the target of an exogenous ybTCR, for example in cases wherein the target is unknown at the molecular level.

Accordingly, there is further provided a method for identifying the target of the exogenous ybTCR, said method comprising the steps of: a) contacting a plurality of cells comprising a potential target, or tissues comprising said cells, each of said cells comprising a different genomic modification, said genomic modification resulting in alteration of expression of a different potential target in each cell, with the T cell as defined herein (preferably a primary T cell and/or preferably not a Jurkat cell or derivatives thereof and/or preferably not a T cell derived from a tumorigenic T cell of a patient) and comprising (preferably expressing) said exogenous ybTCR b) for each cell comprising a potential target, assessing whether the expression of the exogenous reporter gene whose encoding polynucleotide is present in said T cell is altered relative to when the T cell is contacted with a comparable cell which does not comprise the respective genomic modification and c) identifying the target

As a non-limiting example, starting from a cell expressing a potential target, a plurality of cells may be generated each of which comprising a different (distinct) genomic modification which results in reduction, elimination, or increase of expression of a different potential target in each cell, in each case relative to a comparable cell comprising a potential target which does not comprise the respective genomic modification. The plurality of the generated cells may then be contacted with the T cell of the invention followed by assessing the expression of the exogenous reporter gene whose encoding polynucleotide is present in said T cell. Optionally, this may be performed using a high-throughput method known to the skilled person, for example by using a microarray comprising a cell comprising a potential target with a different (distinct) genomic modification (or tissue comprising said cell) in each well or any other suitable high-throughput method. The cell whose genomic modification results in a respective reduction, elimination, or increase of the expression of the exogenous reporter gene whose encoding polynucleotide is present in the T cell of the invention, relative to when the T cell is contacted with a comparable cell which does not comprise the respective genomic modification may then be determined and the target may be identified by analyzing the underlying genomic modification. Analysis of genomic modifications may be performed by any routine method available to the skilled person, for example sequencing methods such as Sanger sequencing, single-molecule real-time sequencing, ion torrent sequencing, pyrosequencing, lllumina-sequencing, combinatorial probe anchor synthesis, sequencing by ligation (SOLiD sequencing), Nanopore sequencing, GenapSys sequencing, and the like. Sequencing sample preparation, instruments, and protocols are discussed in standard handbooks like Head, Ordoukhanian and Salomon (Eds), Next Generation Sequencing: Methods and Protocols, Humana Press, NJ, USA (2018), incorporated herein by reference in its entirety, with many being commercially available, e.g. from lllumina (CA, USA), Pacific Biosciences (CA, USA), and others.

In some embodiments, there is provided a method for identifying the target of the exogenous ybTCR, said method comprising the steps of: a) contacting a plurality of cells comprising a potential target, or tissues comprising said cells, each of said cells comprising a different genomic modification, said genomic modification resulting in reduction or elimination of expression of a different potential target in each cell, with the T cell as defined herein (preferably a primary T cell and/or preferably not a Jurkat cell or derivatives thereof and/or preferably not a T cell derived from a tumorigenic T cell of a patient) and comprising (preferably expressing) said exogenous ybTCR b) for each cell comprising a potential target, assessing whether the expression of the exogenous reporter gene whose encoding polynucleotide is present in said T cell is decreased or eliminated relative to when the T cell is contacted with a comparable cell which does not comprise the respective genomic modification and c) identifying the target

The skilled person understands that reduction or elimination of expression a potential target can be achieved in multiple ways, non-limiting examples of which being introducing a genomic modification such as a mutation to the coding or regulatory region of a gene encoding a potential target and/or to a gene controlling the expression of a potential target, gene deletion, gene silencing (for example using RNA- or CRISPR-based interference methods), gene inactivation, random mutagenesis, and the like, all of which are known to the skilled person. A genomic modification may be introduced utilizing any of the methods described herein, or any other molecular toolbox methods available to the skilled person, which can be found in standard handbooks, such as Sambrook and Green, Molecular Cloning. A Laboratory Manual,

4th Edition, Cold Spring Harbor Laboratory Press (2012); Ausubel et al., Current Protocols in Molecular Biology, 3rd edition, John Wiley & Sons Inc (2003); and In Vitro Mutagenesis: Methods and Protocols (Methods in Molecular Biology 1498), 1st Edition, Reeves A. (Ed), Humana Press (2017) (all of which are incorporated herein by reference in their entireties).

In some embodiments, a genomic modification results in reduction of expression of a potential target, relative to a comparable cell comprising a potential target which does not comprise the genomic modification, of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%. In some embodiments, expression is eliminated. "Elimination” as used herein refers to expression no longer being detectable utilizing routine detection methods available to the skilled person, for example sequencing methods as discussed above, Western blotting, antibody-based methods, and the like.

In some embodiments, the reduction of expression of the exogenous reporter gene whose encoding polynucleotide is present in the T cell of the invention is at least at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%, relative to when the T cell is contacted with a comparable cell comprising a potential target which does not comprise the genomic modification. In some embodiments, expression of the exogenous reporter gene is eliminated.

In some embodiments, there is provided a method for identifying the target of the exogenous ybTCR, said method comprising the steps of: a) contacting a plurality of cells comprising a potential target, or tissues comprising said cells, each of said cells comprising a different genomic modification, said genomic modification resulting in increase of expression of a different potential target in each cell, with the T cell as defined herein (preferably a primary T cell and/or preferably not a Jurkat cell or derivatives thereof and/or preferably not a T cell derived from a tumorigenic T cell of a patient) and comprising (preferably expressing) said exogenous ybTCR b) for each cell comprising a potential target, assessing whether the expression of the exogenous reporter gene whose encoding polynucleotide is present in said T cell is increased relative to when the T cell is contacted with a comparable cell which does not comprise the respective genomic modification and c) identifying the target

The skilled person understands that increase of expression of a potential target can be achieved in multiple ways, non-limiting examples of which being introducing additional copies of a gene encoding a potential target and/or of a gene controlling the expression of the target, promoter replacement by a stronger promoter, introduction of enhancer sequences, codon optimization, random mutagenesis, and the like, all of which are known to the skilled person and which can be found in standard handbooks such as discussed above.

In some embodiments, the genomic modification results in increase of expression of a potential target, relative to a comparable cell comprising a potential target which does not comprise the genomic modification, of at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold.

In some embodiments, the increase of expression of the exogenous reporter gene whose encoding polynucleotide is present in the T cell of the invention is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 2-fold, at least 3- fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold, relative to when the T cell is contacted with a comparable cell comprising a potential target which does not comprise the genomic modification.

Assessing the expression of the exogenous reporter gene can be combined with detection of factors associated with cellular activation, differentiation, and/or development as discussed elsewhere herein, such as expansion (cellular counts), degranulation, persistence, target cytotoxicity, factor secretion, and combinations thereof. Detection of degranulation may be a preferred read-out. In an embodiment, assessing the expression of the exogenous reporter gene is combined with detection of degranulation via determination of a degranulation marker of the T cell, preferably of CD107a. The skilled person understands that in embodiments wherein the expression of the exogenous reporter gene is decreased, eliminated, or increased, CD107a may follow a similar profile. In some embodiments wherein the T cell is contacted with a cell comprising a potential target and comprising a genomic modification resulting in reduction of expression of a potential target (relative to a comparable cell comprising a potential target which does not comprise the genomic modification), the reduction of CD107a expression is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%, relative to when the T cell is contacted with a comparable cell comprising a potential target which does not comprise the genomic modification. In some embodiments, CD107a expression is eliminated. In some embodiments wherein the T cell is contacted with a cell comprising a potential target and comprising a genomic modification resulting in increase of expression of a potential target (relative to a comparable cell comprising a potential target which does not comprise the genomic modification), the increase of CD107a expression is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold, relative to when the T cell is contacted with a comparable cell comprising a potential target which does not comprise the genomic modification.

In a further aspect, the T cells of the invention (preferably primary T cell and/or preferably not Jurkat cells or derivatives thereof and/or preferably not T cells derived from a tumorigenic T cell of a patient) can be used to screen the utility of exogenous y6TCR against a target. In an aspect, a T cell that comprises an exogenous y6TCR and a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence, can robustly discriminate targets that are recognized by the exogenous y6TCR.

For example, a library of exogenous y6TCRs can independently be transduced or transfected into cells, to generate T cells of the invention, and said cells be contacted with a target. Detection of the presence of an exogenous reporter can indicate the utility of an exogenous cellular receptor against a target and the exogenous y6TCR can subsequently be selected based on the detection of the reporter.

In an aspect, there is provided a method for identifying an exogenous y6TCR comprised in the T cell population as defined herein and active against a given target comprised within a given target cell comprising a) providing a sample comprising said given target cell, b) contacting the T cell population with the sample and b) identifying the T cell within the T cell population whose exogenous reporter gene has been activated, which is indicative for activity of the exogenous y6TCR.

Identifying the T cell within the T cell population whose exogenous reporter gene has been activated may be done by assessing the expression of the exogenous reporter gene. Assessing the expression of the exogenous reporter gene can be combined with detection of factors associated with cellular activation, differentiation, and/or development as discussed elsewhere herein, such as expansion (cellular counts), degranulation, persistence, target cytotoxicity, factor secretion, and combinations thereof. Detection of degranulation may be a preferred read-out. In an embodiment, identifying the T cell within the T cell population whose exogenous reporter gene has been activated involves assessing the expression of the exogenous reporter gene in combination with detection of degranulation via determination of a degranulation marker of the T cell, preferably of CD107a. In an embodiment, the target of the exogenous y6TCR is not known at the molecular level.

Suitable samples have been defined earlier herein. Additionally suitable samples may be or may comprise or may be derived from virus infected cells. Additionally suitable samples may be or may comprise or may be derived from cell lines such as human tumor cell lines or from non-human tumor cell lines or from human cell lines or from non-human cell lines or from human cells or from non-human cells. Additionally suitable samples may be or may comprise or may be derived from tumor tissue or from organoid. Within this aspect, the sample comprises a ligand for an exogenous y6TCR. The ligand may have been randomly modified or engineered and one wishes to identify the ligand specific for the exogenous y6TCR.

In an embodiment, the T cell of the invention can be expanded and cryopreserved.

Each feature identified in the methods herein has been earlier defined herein.

In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, the verb “to consist” may be replaced by “to consist essentially of meaning that a product (T cell, T cell population), respectively a method as described herein may comprise additional component(s), respectively step(s) than the ones specifically identified, said additional component(s), respectively step(s) not altering the unique characteristic of the invention.

In addition, the verb “to consist” may be replaced by “to consist essentially of meaning that a product, respectively a method as described herein may comprise component(s), respectively step(s) than the ones specifically identified, said additional component(s), respectively step(s) not altering the unique characteristic of the invention.

Reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

As used herein, with "at least" a particular value means that particular value or more. For example, "at least 2" is understood to be the same as "2 or more" i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, ..., etc.

The word “about” or “approximately” when used in association with a numerical value (e.g. about 10) preferably means that the value may be the given value (of 10) more or less 0.1% of the value.

As used herein, the term "and/or" indicates that one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.

Various embodiments are described herein. Each embodiment as identified herein may be combined together unless otherwise indicated. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described.

KITS

Any of the compositions described herein may be comprised in a kit. In a non-limiting example, a subject engineered cell, a polynucleotide, a reporter, and reagents to generate the same may be comprised in a kit. In some cases, kit components are provided in suitable container means.

While the foregoing disclosure has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the disclosure. For example, all the techniques described above can be used in various combinations. All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually and separately indicated to be incorporated by reference for all purposes.

EXAMPLES

The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.

Example 1. Generation of Engineered Cells

Materials: cryopreserved apTCR T cells from healthy PBMC donor, TransAct 1 :100 dilution (Miltenyi),

TEG medium; TexMACS (Miltenyi), Penicillin/Streptomycin 0.5%, human serum 2.4%, IL-7 (20-2000) lU/ml, IL-15 (20-200) lU/ml, selected lentiviral vector(s). These T cells were isolated using leukophaeresis or butty coat.

Method: Cryopreserved apTCR T cells were thawed, seeded in 48 well size plate at density of 1 6 ^E 6 cells in TEG medium and directly activated with TransAct. After 24 hours the T cells were transduced with the selected lentiviral vector(s) at a prior set MOI (0.3-25) by diluting the lentivirus in TexMACS medium. Lentiviral MOI was previously determined by flow cytometry-based titration on J76 Jurkat cells. On the second day TEG medium was refreshed and T cells transferred to a 12 well plate. On day 5 TEG medium was refreshed once more and T cells were transferred to a T25 cell culture flask with a final volume of 10ml. At day 7 T cells were transferred to a T75 cell culture flask with a final volume of 25ml. After 48h TEG medium was refreshed one more time but the final volume was kept at 25ml. T cells were harvested 12 days after thawing them .

FIG. 1 shows an exemplary engineered cell that comprises a subject polynucleotide and exogenous T cell receptor. The T cells were co-transduced with 2 vectors; one comprising the gamma delta TCR clone 5 (SEQ ID NO: 90,91) and the chimeric protein 41 BBL-OX40ICD (SEQ ID NO: 45) and one comprising a NFAT-driven reporter construct with a constitutive expressed tCD34 (SEQ ID NO: 138), as to generate a method to detect presence of also very complex ligands on target cells (in this example CD277J). These cells are called RET-CL5 cells. The cells that are only transduced with the vector comprising the gamma delta TCR clone 5 and the chimeric protein 41 BBL-OX40ICD are called TEG-CL5 cells. Specifically, this method was pioneered using eGFP (and later also expanded to luciferase and TdTomato (FIG. 5A)) under a NFAT promoter as reporter gene (later also expanded to other promoters (FIG. 4A)), in addition to the chimeric transmembrane protein and the receptor for which the reactivity is being mapped. Detection of the target of gamma delta TCR clone 5, aka CD277J, was accomplished by transducing activated T cells with both the earlier described lentiviral vectors; one co-expressing the gamma delta TCR clone 5 and 41BBL-OX40ICD and the other the NFAT-eGFP reporter (FIG 3A, 3B). Generated RETs were activated with CD3/CD28 Dynabeads for 6 hours and eGFP+y6TCR+ RETs were subsequently FACSorted. The sorted RETs were expanded continuously in TexMACS medium with IL7 and IL15 cytokines, with once per 2 or 3 weeks TransAct addition (1 :100 dilution) to stimulate the RETs (FIG. 15).

To enable mass production a RET variant which could be MACS bead sorted instead of FACSorted was generated. Downstream of the NFAT-eGFP reporter cassette a constitutive tCD34 expression cassette was included (FIG. 1). An alternative is a one-vector system in which the NFAT-eGFP reporter cassette was integrated upstream of the gamma delta TCR - chimeric cassette (FIG. 4B).

Example 2: Characterization of Engineered Cells

Materials: TEGs and RETs from monocultures or target cell co-culture mixtures, FACS buffer; PBS with 2% fetal bovine serum, 4% paraformaldehyde, fixable Live/Dead (ThermoFisher), conjugated antibodies staining for (not all combined at the same time) CD4, CD8, CD3, apTCR, ybTCR, 4-1 BB, 0X40, PD-1 , CCR7, CD45RA, CD27, CD28, CD34, CD107a, and CD69.

Method: cells mixes were washed with FACS buffer and stained with selected conjugate antibodies in FACS buffer for 30min at 4 degrees Celsius. After staining cells were washed twice with FACS buffer, followed by 4% paraformaldehyde fixation for 10 min at 4 degrees Celsius and washed once more with FACS buffer before resuspending them in selected volume of FACS buffer (120-200pl). Antibody staining were measured by flow cytometry (Fortessa, BD) and resulting data was analyzed with FlowJo V10 or higher. Example 3: Cytotoxicity Assay

One-plate cytotoxicity assay

Materials: TEGs/RETs, tumor target cells, including but limited to; HT-29, MZ-1851-RC, RPMI-8226, MM1-S, OPM-2, assay medium (IMDM medium (Gibco), Penicillin/Streptomycin 0.5%, human serum 5%), when needed pamidronate (final concentration 10 mM), Xcelligence E-Plates or flat bottom 96 well plates, GRZB and IFNy ELISA kits (R&D systems).

Method: Defined amounts of targets were seeded in a 96 well plate (flat or Xcelligence), for adherent target a day before and for suspension cells at the same day as TEGs/RETs were added. As TEG/RETs start material fresh or previously cryopreserved cells were used. All co-cultures were corrected for the respective percentage of T cells expressing the ybTCR, towards the TEGs/RETs with the lowest transduction efficiency (so that all co-cultures contained identical amount of y6TCR+ TEGs/RETs). Cocultures were setup at an effector to target ratio (E:T) of 1 : 1 with or without pamidronate, added at this day. Controls utilized were matched untransduced T cells, effector only, target only; and full lysis was also taken along. After 16 hours 48 hours or 7 days the supernatant was collected from the co-cultures. For nonadherent cells, cells were resuspended gently, and cell suspension was transferred to a round bottom 96 well plate to measure cytotoxicity by flow cytometry using cell trace violet stained target cells. For adherent targets, Xcelligence based cytotoxicity data was captured in real-time along the co-culture incubation. Targets were stained with 1 .0 mM Cell trace violet according to manufacturer protocol. Data analyses were performed with Graphpad Prism software (v7.05).

Example 4: flow cytometry-based RET reactivity assay

Materials: TEGs/RETs, tumor target cells, including but limited to; HT-29, MZ-1851-RC, RPMI-8226, MM.1S, OPM-2, assay medium (IMDM medium (Gibco), Penicillin/Streptomycin 0.5%, human serum 5%), when needed pamidronate (final concentration 10 mM), Xcelligence E-Plates or flat bottom 96 well plates, GRZB ELISA kit (R&D systems).

Method: Testing of RETs was performed by co-culture with cancer cell lines (sets of both liquid and solid indications) for 4 hours and 24 hours. RETs or TEGs were stained according to manufacturer protocol with 0.5 mM cell trace violet. In a pamidronate positive condition, target cells were pretreated with pamidronate at an indicated dose for 10-16 hours. Pretreated and non-pretreated cells were co-cultured with RET or TEG-CL5. After 4 or 24 hours all cells were harvested. Reactivity was measured by flow cytometry based on CD107a (degranulation) and eGFP (NFAT activity) positivity. Reactivity of the RETs was compared to historic data of TEGs generated as described in example 3 and confirmed a correlation between the two. Example 5: Luminescence-based RET reactivity assay

Materials: TEGs or RETs, tumor target cells, including but limited to; HT-29, MZ-1851-RC, RPMI-8226, MM1-S, OPM-2, assay medium (IMDM medium (Gibco), Penicillin/Streptomycin 0.5%, human serum 5%), when needed pamidronate (final concentration 10 mM), D-luciferin (1.5 mg/mL), GRZB ELISA kit (R&D systems).

Method: Tumor target cells, including but limited to; HT-29, MZ-1851-RC, RPMI-8226, MM.1S, OPM-2, were seeded at defined concentrations in a flat bottom white 96 well plates. In a pamidronate positive condition, target cells were pretreated with pamidronate at the indicated dose for 10-16 hours.

Luciferase reporter engineered RETs were co-cultured with the pretreated and non-pretreated cells. After 4 or 24 hours 20ul of D-luciferin (1.5 mg/mL) was added to the co-culture plate and incubated for 12 minutes before measuring luminescence by Glomax(Promega).

Analyses were performed with Graphpad Prism software (v7.05).

Example 6: CD277J can be detected by RETs

This example evaluates if RETs can detect CD277J, the cognate molecular target of TEG-CL5. Alpha-beta T cells were transduced with a defined gamma delta TCR (SEQ ID NO: 90 and 91) and reporter constructs (SEQ ID NO:138 - 146) in a two vector system or an one vector system to generate RETs as outlined in example 1. The defined gamma delta TCR used in this example was the Vy9V62 TCR clone 5 (CL5) of the disclosure. The reporter constructs for a two vector system were: i. NFAT- eGFP (NFAT-eGFP cassette; NFAT response element promoter with eGFP as reporter gene) SEQ ID NO: 139 ii. NFAT- eGFP_PGK-tCD34 (NFAT-eGFP cassette followed by a PGK promoter with tCD34) SEQ ID NO: 138 iii. CD69 - eGFP (truncated CD69 promoter with eGFP as reporter gene) SEQ ID NO:140 iv. EGR1 - eGFP (truncated EGR1 promoter with eGFP as reporter gene) SEQ ID NO:141 v. IFN-gamma - eGFP (truncated IFN-gamma promoter with eGFP as reporter gene) SEQ ID NO:142 vi. NFAT - TdTomato luciferase (NFAT response element promoter with TdTomato and luciferase as reporter genes, separated by a 2A sequence) SEQ ID NO:145 vii. NFAT - eGFP luciferase (NFAT response element promoter with eGFP and luciferase as reporter genes, separated by a 2A sequence) SEQ ID NO:146

FIG. 1, 3, 4A, 4B and 5A shows schematics of the constructs used to introduce the gamma delta TCR and the other proteins. P2A and T2A represent self-cleaving peptides. The black bars N-terminal of 41BBL represents a linker sequence. The RETs were co-incubated with target tumor cells recognized by the defined gamma delta TCR as described in examples 4 and 5. The experiments included conditions with or without pamidronate pretreatment.

Expression of gamma delta TCR_41 BBL-OX40ICD and NFAT - eGFP_PGK-tCD34 of two-vector system transduced engineered cells (left) and untransduced control (right) is shown in FIG. 2A and demonstrates that both vectors can be expressed by the same cell (RET). As shown in FIG. 2B, 4C, 4D and 5B, the RETs could discriminate between CD277J+ target tumor cells (RPMI-8226, MM.1S + PAM, HT-29 +

PAM) and tumor cell lines not expressing this target (RPMI-8226 CD277 KO, OPM2, HT-29 - PAM, MM.1S - PAM).

The reporter constructs for an one-vector system were:

I. NFAT- eGFP_MSCV- gamma 41 BBL-OX40ICD delta (NFAT response element promoter with eGFP as reporter gene, followed by MSCV promoter with gamma 41BBL-OX40ICD delta, separated by 2A sequences) SEQ ID NO:144

II. NFAT- luciferase_MSCV- gamma 41 BBL-OX40ICD delta

The RETs were co-incubated with target tumor cells recognized by the defined gamma delta TCR as described in examples 4 and 5. The experiments included conditions with or without pamidronate pretreatment. As shown in FIG. 4D the RETs transduced with an one vector system (RET single vector) can discriminate between cognate target (RPMI-8226) and non-targeted (RPMI-8226 CD277KO) counterparts like the two vector system (RET-tCD34; RETs transduced with one gamma 41BBL- OX40ICD delta construct and a NFAT- eGFP_PGK-tCD34 construct).

Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 7: The chimeric protein 41BBL-OX40ICD enhances number of total engineered T cells and enriches for the Y6TCR ⁺ apTCR phenotype.

Inclusion of the chimeric protein in the engineered cells was evaluated in the context of a two-vector system (FIG 7A) shown in FIG 3A or only with one vector containing gamma delta TCR CL5 with one extra polynucleotide.

In this example, alpha beta T cells were transduced with NFAT-eGFP reporter construct (SEQ ID NO:

139) gamma delta TCR CL5 (SEQ ID NO: 90,91) with or without 41 BBL-OX40ICD (SEQ ID NO:45) and generated according to example 1 . At Day 12, expansion was determined by counting and assessment of transduction efficiency by flow cytometry according to example 2. Inclusion of 41 BBL-OX40ICD led to significantly more RETs as compared to for RETs without 41 BBL-OX40ICD (FIG. 7A). This observation corresponds with TEGs without a reporter construct, evaluated next. As shown in FIG. 7B, after one stimulation round of seven days the TEGs transduced with 41 BBL-OX40ICD were more enriched for y6TCR ⁺ apTCR T cells as compared to TEGs with exogenous eGFP or with 41 BBL-mincyto expression. Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 8: CD277J can be detected after short run time by inclusion of also CD107a with the eGFP, which increases signal-noise ratio.

In this example the shortening of the run time of RETs and the signal-noise ratio were evaluated. Alpha beta T cells were transduced with NFAT-eGFP reporter construct and gamma delta TCR CL5 with 41 BBL-OX40ICD (SEQ ID NO: 13945, 90-91), and generated according to example 1 . RETs were assayed according to example 4 with an incubation time of 1 , 2 or 4 hours. Already at one hour, an increase in TCR activity was detected (FIG. 8A) in co-culture with MZ-1851-RC with pamidronate pretreatment compared to without pamidronate pretreatment. The detected eGFP signal was mirrored in the corresponding Granzyme B levels (FIG. 8C). As shown in FIG. 8B, plotting CD107a (degranulation marker) versus eGFP (gamma delta TCR activity) showed background signal for both. To reduce background signal only CD107a+eGFP+ cells were selected. This increased the signal-noise ratio compared to using eGFP+ or CD107a+ on their own (FIG. 8A,D,E).

Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 9: RET reporter signal correlates with TEG-CL5 IFN-gamma levels and cytolysis percentage after recognition of a target.

This example evaluates if RET reporter signal correlates with the historic IFN-gamma levels and cytolysis percentage obtained with TEG-CL5. Alpha beta T cells were transduced with NFAT-eGFP reporter construct and gamma delta TCR CL5 with 41 BBL-OX40ICD (SEQ ID NO: 139, 45, 90-91), and generated according to example 1 . RETs were assayed according to example 4 after co-inoculation with 8 selected adherent cell lines (HT-29, WiDr, Caki-2, SK-OV-3, SK-CO-1 , MZ-1851-RC, MDA-MB-231 and MCF-12- F) and 3 selected multiple myeloma cell lines (RPMI-8226, MM.1S, OPM2). TEG-CL5 was assayed according example 3. As shown in FIG. 9 for selected multiple myeloma cell lines and in FIG. 10 for selected adherent tumor cell lines, the percentage CD107a+eGFP+ cells correlated with IFN-gamma levels and the percentage cytolysis for both sets of tumor cell lines. TEG-CL5 co-culture conditions/targets that resulted in only IFN-gamma detection or only cytolysis (FIG. 10C) were considered non-adjudicated and out of scope for the evaluation of the correlation to the corresponding reporter signal. IFN-gamma levels were obtained from the harvested supernatant of the co-culture using a commercial Human IFN-gamma DuoSet ELISA assay (cat nr. DY285B-05, R&D Systems, Minneapolis, MN, US), according to manufacturer’s instructions. This is a standard sandwich ELISA using a plate- bound capture antibody and a detection antibody both specific for IFN-g. The detection antibody is linked to an enzyme which can convert a substrate into an absorbance signal which is measured with a plate reader. The internal standard curve allows absorbance values to be calculated into the IFN-y concentration (pg/mL) released into the supernatants. Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 10: RET reporter signal responds dose dependent to the amount of CD277J on target cells

This example evaluates if the degree of gamma delta TCR recognition by RETs, vs increasing levels of CD277J on target cells, is mirrored by dose dependent increase in the percentage of the CD107a+eGFP+ population in the RET cells. Pretreatment with increasing concentrations of zoledronate leads to increased CD277J target induction in tumor cell lines and should lead to increased recognition and signal by TEGs and RETs. Alpha beta T cells were transduced with NFAT-eGFP reporter construct and gamma delta TCR CL5 with 41 BBL-OX40ICD (SEQ ID NO: 139, 45, 90-91), and generated according to example 1 . RETs were assayed according to example 4. MM.1S was taken as model and was pretreated with zoledronate ranging from 0.2 to 5 mM. As shown in FIG. 11, both the percentage of eGFP+ and CD107a+ RETs increased with the concentration of zoledronate (left set of bars per diagram). Considering only the cells coexpressing eGFP+ and CD107a+ (top panels), an improved relative fold increase over monoculture of these RETs was observed (right panels). The relative increase of recognition with the dose of zoledronate seen for MM.1 S was not observed for the PAM-independent target RPMI-8226 or the non-targeted OPM2 cell line (FIG. 12A) and correlated with increase in IFN-gamma detected in TEG-CL5 co-culture performed according to example 3 (FIG. 12B).

To evaluate if CD277J dose dependency was observed also for adherent cell lines, four targets that varied in TEG-CL5 recognition from high to non-targeted were selected. Dose dependency for zoledronate was observed when co-cultured with all targets and not with the non-targeted cell line MCF- 12-F (FIG. 13).

To evaluate the RET reporter signal specificity at a molecular level, endogenous BTN3A1 , 2 and 3 was knocked out of HEK293 cells and then rescued by ectopic expression of BTN3A2 and 3 combined with wildtype BTN3A1 (C1 wt) or BTN3A with a point mutation at amino acid 352 (C1-352). Mutation of amino acid 352 will lead to a reduction of CD277J compared to BTN3A1 wt, due to impaired binding of IPP to the 30.2 domain (FIG. 14A). A co-culture was performed according to example 3. RET-CL5 and TEG-CL5 both showed a reduction of signal for HEK293 C1-352 compared to HEK293 C1-wt (FIG. 14B), confirming molecular level specificity of RET-CL5 signal for CD277J. Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05). Example 11: minimal ratio of cognate vs matched non-target cells needed for RETs to show a significant increase in reporter signal

In this example we determined the minimal ratio of cognate vs matched non-target cells needed to obtain a significant increase in percentage of eGFP+ RETs. Alpha beta T cells were transduced with the NFAT- eGFP reporter construct and gamma delta TCR CL5 with 41 BBL-OX40ICD (SEQ ID NO: 139, 45, 90-91), and generated according to example 1. RETs were assessed according to example 4 with a mixture of target (RPMI-8226) and non-target (RPMI-8226 CD277KO). The fraction of RPMI-8226 was increased in the mixture from 0 to 100 percent. The minimal fraction of RPMI-8226 required to generate significant increase in eGFP+ RETs percent above background was ~3% when starting with 1E5 effectors and the percentage eGFP+ then dose dependently increased up to 50% RPMI-8226 in the target mixture (FIG. 16).

Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 12: phenotype and function of RETs after prolonged culture without feeders

In this example the phenotype and function of RETs was assessed after long term culture. Alpha beta T cells were transduced with NFAT-eGFP reporter construct and gamma delta TCR CL5 with 41 BBL- OX40ICD (SEQ ID NO: 139, 45, 90-91), and generated according to example 1. After 72 days of culture RETs were phenotyped and functionally tested. An increase in CD8+ T cells was observed compared to Day 12. Cells were dominantly effector memory cells and ybTCRpos/apTCRneg and could still discriminate between targets and non-targets, demonstrated by a significant increase in eGFP+ RETs obtained by a RET assay according to example 4 (FIG. 17).

Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 13: Evaluation RETs with additional gamma delta TCRs

In this example RETs with alternative gamma delta TCRs were evaluated to assess broad applicability. Alpha beta T cells were transduced with NFAT-eGFP reporter construct (SEQ ID NO: 2, or NFAT- eGFP_PGK-tCD34 reporter construct (SEQ ID NO: 138) and gamma delta TCR CL3, E57 or An2 (SEQ ID NO: 88-89, 111-112, 132-133), and generated according to example 1. The function of these RETs was assessed according to example 4. As shown in FIG. 18, RETs with E57 gamma delta TCR could discriminate the HT-29 (a E57 target) from HT-29 EPCR KO E57 (non-target) by exhibiting significantly different percentage of (CD107a+) eGFP+ RET vs these matched tumor cell lines. FIG. 19 shows discrimination between cognate targets (middle of each panel) and tumor cells that are only poorly or not recognized (left of each panel) for each of three different gamma delta TCRs. Specifically, a significant increase in CD107a+eGFP+ was obtained vs the cognate targets for the CL3 and An2 gamma delta TCRs, besides the E57. Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 14: Evaluation of ability to identify RETs with a specific molecular reactivity out of a pool of engineered RETs that collectively bear a set of diverse exogenous gamma delta TCRs

This example evaluated the feasibility to employ the RETs to identify an antigen-specific gamma delta TCR within a pool of different gamma delta TCRs. For this purpose, six different RET batches, each with a different gamma delta TCR, were pooled together. Before this, one batch of RETs (expressing the E57 gamma delta TCR) was CTV labeled, while the other RET types were left unlabeled, to visualize selectivity. To generate these RETs alpha beta T cells were transduced with NFAT-eGFP_PGK-tCD34 reporter construct (SEQ ID NO: 138) and gamma delta TCR CL3, E57, An2, CL5, Fe11 , Zi11 or S07 (SEQ ID NO: 88-89, 111-112, 132-133, 90-91 , 92-93, 107-108, 136-137) and expanded according to example 1 . As shown in FIG. 20, the RET pool was co-cultured with E57 non-target HT-29 EPCR KO (A), E57 target HT-29 (B) or as effector only (C) and assessed according to example 4. In the HT-29 EPCR KO sample, some RETs in the unlabeled pool (gray) showed increased eGFP expression as compared to the effector only sample, while the CTV labeled E57 RETs did not show any eGFP increase. In contrast, the HT-29 target cell co-cultures specifically induced the majority of the CTV labeled E57 RETs to express increased levels of eGFP. This demonstrates the feasibility to use the engineered pool of RET cells to selectively identify gamma delta TCRs that recognize a certain molecular target (in this case EPCR-reactive E57).

Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 15: Superior correlation of RET signal, compared to Jurkat reporter cell signal, with TEG- CL5 reactivity

This example compared the reporter signal of RET with the corresponding Jurkat reporter cell. Jurkat reporter cells were generated by transducing Jurkat cell line J76 TPR, which does not express an ab TCR (Rosskopf S, 2018, Oncotarget, 9:17608-17619), with gd TCR CL5 (SEQ ID NO: 90, 91). RET-CL5 was generated as described in example 1 and comprised the NFAT-eGFP reporter construct and gamma delta TCR CL5 with 41 BBL-OX40ICD (SEQ ID NO: 139, 45, 90-91). Both were assessed for reactivity by measuring GFP reporter signal which was downstream a NFAT response element in both cells after coculture for 44 hours with tumor cell lines HT-29, MZ1851 RC and RPMI-8226 at E:T 1 :1 , with or without 5mM pamidronate (PAM) as described in example 4. Analyzed GFP signal was correlated with the IFNY obtained as described in example 9 (FIG. 21). RET-CL5 signal correlated with the IFNy levels produced by TEG-CL5 vs the same targets. Jurkat reporter cell signal did not correlate with IFNy levels of TEG- CL5, as non-targets MZ1851RC and HT29 demonstrated a higher reporter signal than TEG-CL5 target RPMI-8226 and no significant increase in signal was observed between HT29 (not recognized as a target) and HT29+PAM (target). This demonstrates that RET are superior to Jurkat reporter cells for to measure presence of complex targets like CD277J.

Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 16: Y6TCR ⁺ apTCR enrichment by serial stimulation with CD3/CD28

In this example assessed the capacity of enriching for y6TCR ⁺ apTCR- single positive cells by serial stimulation of CD3/CD28. Alpha beta T cells were transduced with constructs encoding ybTCR (SEQ ID NOs: 90,91) and generated following the procedure described in Example 1. After production 5E6 cells were rested for 3 days followed by CD3/CD28 stimulation (TransAct, 1 : 100) in 5ml TEG medium. Before and 7 days after CD3/CD28 stimulation cells were stained for ybTCRand apTCR and analyzed by flow cytometry. As shown in FIG. 22 after CD3/CD28 stimulation cells were enriched for y6TCR ⁺ apTCR ^_ single positive cells. This demonstrated that TEG and subsequent RETs can be enriched for y6TCR ⁺ apTCR ^_ single positive cells by serial stimulation with CD3/CD28. Data analyses were performed with FlowJo (V10 or higher)

Example 17: Non-inferior function of CRISPR RETs compared to RETs

In this example RETs with TRAC knockout by CRISPR (CRISPR RETs) were compared to RETs generated following the procedure described in Example 1. The RETs with TRAC knockout were generated as following; cryopreserved T cells (ab T cells or J76 Jurkat cells) were thawed, seeded in 48 well plates at density of 1 .6 x10 ^L 6 cells per well in TEG medium (ab T cells or IMDM medium (Jurkat cells). The ab T cells were activated with CD3/CD28 TransAct for 24h, then transduced with the selected lentiviral vector at a prior set multiplicity of infection (MOI; 0.3-25) by diluting the lentivirus in TexMACS medium. Lentiviral MOI was determined by FACS based titration on J76 Jurkat cells similar to Pirona et al. 2020 (Biol Methods Protoc 5(1):bpaa005). On the second day medium was refreshed and T cells (ab T cells or J76 Jurkat cells) transduced with a vector containing a ybTCR encoding sequence were transferred to T25 flasks with a final volume of 5ml. ab T cells were nucleofected with protein-RNA complexes of SpCAS9 and single guide RNA (CAS9:sgRNA) using a nucleofector 2b, program T-023 and Nucleofector kit T (Lonza) according to general guidelines of Synthego. sgRNAs used were ACAAAACUGUGCUAGACAUG (SEQ ID NO: 158), GAGAAUCAAAAUCGGUGAAU (SEQ ID NO: 159), CUCUCAGCUGGUACACGGCA (SEQ ID NO: 160) for TRAC to generate CRISPR RETs. On day 6 medium was refreshed once more, and T cells were transferred to a T75 cell culture flask with a final volume of 10ml.

Both CRISPR RETs and RETs were transduced with single vector (SEQ ID NO: 144) or NFAT- eGFP_LUC_PGK-tCD34_Q8 reporter construct (SEQ ID NO: 174) and construct encoding gamma delta TCR CL5 (SEQ ID NO: 90,91). After generation, cells were washed with FACS buffer (PBS with 2% fetal bovine serum), and stained for Y6TCR and apTCR with selected fluorescently-conjugated antibodies in FACS buffer for 30min at 4 degrees Celsius. After staining, cells were washed twice with FACS buffer, and fixed by 4% paraformaldehyde for 10 min at 4 degrees Celsius. Following fixation, cells were washed once more with FACS buffer, before resuspension in 100-200 pi of FACS buffer, followed by flow cytometric analysis. As shown in FIG. 23A and FIG. 23B, CRISPR RETs are highly enriched for YbTCR+apTCR- single positive cells compared to RETs.

The function of these RETs was assessed according to example 4. Target was MM1.S with 10mM PAM and controls were effector only + 10mM PAM and target only. As shown in FIG. 24, CRISPR RET-CL5S showed non-inferior increase in CD107a+eGFP+ cells compared to RET-CL5 without CRISPR both for single vector (FIG. 24A) and double vector (FIG. 24B). Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 18: Superior correlation of RET signal, compared to Jurkat reporter cell signal, with TEG- 598 reactivity

This example compared the reporter signal of RETs with corresponding Jurkat reporter cells. Jurkat reporter cells were generated by transducing Jurkat cell line J76 TPR, which does not express an ab TCR (Rosskopf S, 2018, Oncotarget 9:25: 17608-17619), with constructs encoding gd TCR S98 (SEQ ID NO: 172, 173). RET-S98 was generated following the procedure described in example 1 and comprised the NFAT-eGFP tCD34 reporter construct and gamma delta TCR S98 (SEQ ID NO: 174, 172, 173). Both were assessed for reactivity by measuring GFP reporter signal which was downstream a NFAT response element in both cells. After a 24 hours co-culture with tumor cell line OPM2 at E:T 1 :1 , as described in Example 4, analyzed GFP signal was compared between the two (FIG. 25A) and was correlated with the IFNY obtained, as described in Example 9 (FIG. 25B). No significant increase in signal compared to effector only was observed in RET-S98 while Jurkat reporter cell showed significant increased signal. RET-S98 signal correlated with the IFNY level produced by TEG-S98 vs OPM2. Jurkat reporter cell signal did not correlate with IFNY levels ofTEG-S98. This demonstrates that RET are superior to Jurkat reporter cells for identifying the presence of complex targets like CD277J and S98 target.

Data analyses were performed with FlowJo (V10 or higher) and Graphpad Prism software (v7.05).

Example 19: CRISPR TEGs have neglectable alloreactivity

In this example CRISPR TEGs were generated as described for CRISPR RETs in example 17. Mixed lymphocyte reaction assay was performed with CRISPR TEGs, TEGs and untransduced alpha beta T cells (UNTR) and PBMCs from a different donor at 1 :2 E/T ratio. After 48 hours co-culture supernatant was harvested and IFNY levels were obtained as described in example 9. As shown in FIG. 26 CRISPR TEGs co-culture produced significant less IFNy compared to TEGs and UNTR (P<0.05) and levels were almost neglectable, demonstrating that enriching for ybTCR+apTCR- single positivity reduces alloreactivity, reducing background and potential false positive signal subsequently.

EMBODIMENTS

Embodiment 1 A T cell that comprises: a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence; and an exogenous y6TCR, wherein upon binding of the exogenous y6TCR to a target, transcription of the exogenous reporter sequence is initiated by the promoter resulting in expression of an exogenous reporter.

Embodiment 2 The cell of embodiment 1 , wherein the cell has reduced or eliminated surface expression of an endogenous cellular receptor on the surface of the cell.

Embodiment 3 The cell of embodiment 2, wherein the endogenous cellular receptor is a T cell receptor (TCR).

Embodiment 4 The cell of any one of embodiments 2-3, wherein a genomic disruption in a polynucleic acid that encodes the endogenous cellular receptor results in the reduced or the eliminated surface expression of the endogenous cellular receptor.

Embodiment 5 The cell of any one of embodiments 1 -4, wherein the cell is an immortalized cell. Embodiment 6 The cell of embodiment 5, wherein the engineered cell is the primary cell and is a T cell. Embodiment 7 The cell of embodiment 6, wherein the T cell is an alpha beta T cell.

Embodiment 8 The cell of any one of embodiments 1 -7, wherein the promoter sequence is selected from the group consisting of: nuclear factor of activated T-cells (NFAT), Nuclear Factor kappa-light-chain- enhancer of activated B cells (NF-KB), Activator protein 1 (AP-I), Nur response element (NurRE), Interferon gamma (IFN-gamma), CD69, Early growth response protein 1 (EGR1), and any combination thereof.

Embodiment 9 The cell of embodiment 8, wherein the promoter sequence is the NFAT promoter. Embodiment 10 The cell of any one of embodiments 1-9, wherein the exogenous reporter is a fluorescent protein.

Embodiment 11 The cell of embodiment 10, wherein the fluorescent protein is selected from the group consisting of: green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), Blue fluorescent protein (BFP), cyan fluorescent protein (CFP), and violet-excitable green fluorescent (Sapphire).

Embodiment 12 The cell of embodiment 11 , wherein the fluorescent protein comprises the GFP. Embodiment 13 The cell of any one of embodiments 1 -12, wherein the TCR is an alpha beta TCR. Embodiment 14 The cell of any one of embodiments 1 -13, wherein the TCR is a gamma delta TCR, and wherein the gamma delta TCR comprises: a) a gamma -chain selected from the group consisting of: gamma 2, gamma 3, gamma 4, gamma 5, gamma 8, gamma 9, and gamma 11 ; b) a delta-chain selected from the group consisting: delta 1 , delta 2, delta 3, and delta 5; c) any combination of a) and b).

Embodiment 15 The cell of embodiment 14, wherein the gamma -chain is the gamma 9, and wherein the delta-chain is the delta2.

Embodiment 16 The cell of embodiment 14 or 15, wherein the gamma delta TCR is expressed at a ratio that is at least 1-fold higher on the surface of the engineered cell as compared to an endogenous alpha beta TCR.

Embodiment 17 The cell of embodiment 16, wherein the gamma delta TCR is expressed at a ratio that is at least 10-fold higher on the surface of the engineered cell as compared to an endogenous alpha beta TCR.

Embodiment 18 The engineered cell of any one of embodiments 14-17, wherein the gamma delta TCR comprises a gamma-chain that comprises a CDR sequence with at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to SEQ ID NO:85, 86, 87, 94, 95, 96, 101 , 113, 115, 117, 119, 127, 130, 134, 170, and wherein the gamma delta TCR comprises a delta-chain that comprises a CDR sequence with at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to SEQ ID NO: 82, 83, 84, 97, 98, 99, 100, 102, 114, 116, 118, 126, 131 , 135, 171.

Embodiment 19 The cell of any one of embodiments 1 -18, wherein the target comprises an antigen or a cell displaying an antigen.

Embodiment 20 The cell of embodiment 19, wherein the target comprises the cell displaying the antigen. Embodiment 21 The cell of any one of embodiments 19-20, wherein the antigen comprises a cancer antigen, viral antigen, bacterial antigen, fungi antigen, allergen, or a combination thereof.

Embodiment 22 The cell of embodiment 21 , wherein the antigen comprises the cancer antigen. Embodiment 23 The cell of any one of embodiments 20-22, wherein the antigen is comprised in a complex.

Embodiment 24 The cell of embodiment 23, wherein the complex comprises at least one or two entities in association with the antigen.

Embodiment 25 The cell of any one of embodiments 22-24, wherein the cancer antigen is a tumor associated antigen (TAA), neoantigen, tumor microenvironment antigen, sugar-based antigen, peptide- based antigen, lipid-based antigen, or any combination thereof.

Embodiment 26 The cell of any one of embodiments 21-25, wherein the cancer is a liquid cancer. Embodiment 27 The cell of embodiment 26, wherein the liquid cancer is selected from the group consisting of: Acute myeloid leukemia (AML), Multiple Myeloma (MM), and Myelodysplastic syndrome (MDS).

Embodiment 28 The cell of any one of embodiments 21-25, wherein the cancer is a solid cancer. Embodiment 29 The cell of embodiment 28, wherein the solid cancer is ovarian cancer or colon cancer. Embodiment 30 The cell of any one of embodiments 23-29, wherein the complex comprises CD277. Embodiment 31 The cell of embodiment 30, wherein the CD277 is in a CD277J configuration. Embodiment 32 The cell of any one of embodiments 23-31 , wherein the complex comprises an MHC-like protein or antigen-presenting protein.

Embodiment 33 The cell of any one of embodiments 1-32, wherein an antibody has reduced binding to the target or does not bind the target.

Embodiment 34 The cell of any one of embodiments 1-33, wherein the target is unidentified.

Embodiment 35 The cell of any one of embodiments 1 -34, wherein the engineered T cell further comprises a chimeric bidirectional signaling transmembrane protein.

Embodiment 36 An alpha beta T cell that comprises: a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence; and an exogenous cellular receptor, wherein the engineered alpha beta T cell has reduced or eliminated surface expression of an endogenous cellular receptor, and wherein upon binding of the exogenous cellular receptor to a target, transcription of the exogenous reporter sequence is initiated by the promoter resulting in expression of an exogenous reporter.

Embodiment 37 The cell of embodiment 36, wherein the alpha beta T cell is a CD8 T cell.

Embodiment 38 The cell of embodiment 1-37, wherein the gamma delta TCR comprises: a) a gamma -chain that comprises a CDR sequence with at least about 65%, 70%, 75%, 80%, 85%,

90%, 95%, 97%, 99%, or 100% identity to SEQ ID NO: 85, 86, 87, 94, 95, 96, 101 , 113, 115, 117, 119, 127, 130, 134, 170; b) a delta-chain that comprises a CDR sequence with at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to SEQ ID NO:82, 83, 84, 97, 98, 99, 100, 102, 114, 116, 118, 126, 131 , 135, 171 ; or c) a) and b).

Embodiment 39 The cell of any one of embodiments 1-38, wherein the engineered T cell further comprises a chimeric bidirectional signaling transmembrane protein.

Embodiment 40 The cell of any one of embodiments 36-39, wherein a genomic disruption in a polynucleic acid that encodes the endogenous cellular receptor results in the reduced or the eliminated surface expression of the endogenous cellular receptor. Embodiment 41 The cell of any one of embodiments 36-40, wherein the target comprises an antigen or a cell displaying an antigen.

Embodiment 42 The cell of embodiment 41 , wherein the target comprises the cell displaying the antigen. Embodiment 43 The cell of embodiment 42, wherein the cell is a cancer cell.

Embodiment 44 The cell of any one of embodiments 41-43, wherein the antigen comprises a cancer antigen, viral antigen, bacterial antigen, fungi antigen, allergen, or a combination thereof.

Embodiment 45 The cell of embodiment 44, wherein the antigen comprises the cancer antigen. Embodiment 46 The cell of embodiment 45, wherein the cancer antigen is comprised in a complex. Embodiment 47 The cell of embodiment 46, wherein the complex comprises at least one or two entities in association with the cancer antigen.

Embodiment 48 The cell of any one of embodiments 45-47, wherein the cancer antigen is a tumor associated antigen (TAA), neoantigen, tumor microenvironment antigen, sugar-based antigen, peptide- based antigen, lipid-based antigen, or any combination thereof.

Embodiment 49 The cell of any one of embodiments 45-47, wherein the cancer is a liquid cancer. Embodiment 50 The cell of embodiment 49, wherein the liquid cancer is selected from the group consisting of: Acute myeloid leukemia (AML), Multiple Myeloma (MM), and Myelodysplastic syndrome (MDS).

Embodiment 51 The cell of any one of embodiments 45-47, wherein the cancer is a solid cancer. Embodiment 52 The cell of embodiment 51 , wherein the solid cancer is ovarian cancer or colon cancer. Embodiment 53 The cell of any one of embodiments 45-52, wherein the complex comprises CD277. Embodiment 54 The cell of embodiment 53, wherein the CD277 is in a CD277J configuration. Embodiment 55 The cell of any one of embodiments 45-54, wherein the complex comprises a major histocompatibility complex (MHC)-like protein or antigen-presenting protein.

Embodiment 56 The cell of any one of embodiments 36-55, wherein an antibody has reduced or no binding to the target.

Embodiment 57 The cell of any one of embodiments 36-56, wherein the target is unidentified. Embodiment 58 The cell of any one of embodiments 36-57, wherein the cell is a primary cell.

Embodiment 59 The cell of any one of embodiments 36-58, wherein the cell is an immortalized cell.

Embodiment 60 The cell of embodiment 58, wherein the primary cell is an immune cell.

Embodiment 61 The cell of embodiment 60, wherein the immune cell is a T cell or NKT cell.

Embodiment 62 The cell of embodiment 61 , wherein the immune cell is the T cell, and wherein the T cell is an alpha beta T cell.

Embodiment 63 The cell of any one of embodiments 61 , wherein the cell is an IPSC derived T cell. Embodiment 64 The cell of any one of embodiments 36-63, wherein the promoter sequence is selected from the group consisting of: nuclear factor of activated T-cells (NFAT), Nuclear Factor kappa-light-chain- enhancer of activated B cells (NF-KB), Activator protein 1 (AP-I), Nur response element (NurRE), Interferon gamma (IFN-gamma), CD69, Early growth response protein 1 (EGR1), and any combination thereof.

Embodiment 65 The cell of embodiment 64, wherein the promoter sequence is the NFAT promoter. Embodiment 66 The cell of any one of embodiments 36-65, wherein the exogenous reporter is a fluorescent protein.

Embodiment 67 The cell of any one of embodiments 36-66, wherein the cell further comprises an endogenous reporter.

Embodiment 68 The cell of embodiment 66, wherein the fluorescent protein is selected from the group consisting of: green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), Blue fluorescent protein (BFP), cyan fluorescent protein (CFP), and violet-excitable green fluorescent (Sapphire).

Embodiment 69 The cell of embodiment 68, wherein the fluorescent protein is the GFP.

Embodiment 70 The cell of any one of embodiments 36-69, wherein the exogenous cellular receptor is a chimeric antigen receptor (CAR) or T cell receptor (TCR).

Embodiment 71 The cell of embodiment 70, wherein the exogenous cellular receptor is a TCR. Embodiment 72 The cell of embodiment 71 , wherein the TCR is a gamma delta TCR, and wherein the gamma delta TCR comprises: a) a gamma -chain selected from the group consisting of: gamma 2, gamma 3, gamma 4, gamma 5, gamma 8, gamma 9, and gamma 11 ; b) a delta-chain selected from the group consisting: deltal , delta2, delta3, and delta5; c) any combination of a) and b).

Embodiment 73 The cell of embodiment 72, wherein the gamma -chain is the gamma 9, and wherein the delta-chain is the delta2.

Embodiment 74 The cell of embodiment 73, wherein the gamma delta TCR comprises: a) a gamma-chain that comprises a CDR sequence with at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to SEQ ID NO:85, 86, 87, 94, 95, 96, 101 , 113, 115, 117, 119, 127,

130, 134, 170; b) a delta-chain that comprises a CDR sequence with at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to SEQ ID NO:82, 83, 84, 97, 98, 99, 100, 102, 114, 116, 118, 126, 131 , 135, 171 ; or c) a) and b).

Embodiment 75 The cell of any one of embodiments 36-74, wherein the alpha beta T cell further comprises a chimeric bidirectional signaling transmembrane protein. Embodiment 76 An alpha beta T cell that comprises:

(a) a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence; and

(b) an exogenous gamma delta T cell Receptor, wherein upon binding of the exogenous gamma delta TCR to a target, transcription of the exogenous reporter sequence is initiated by the promoter resulting in expression of an exogenous reporter.

Embodiment 77 A method for target screening, the method comprising:

(a) contacting an alpha beta T cell with a target, wherein the alpha beta T cell comprises: a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence; and an exogenous y6TCR; and

(b) detecting expression of an exogenous reporter encoded by the exogenous reporter sequence, wherein upon binding of the exogenous TCR to the target, transcription of the exogenous reporter sequence is initiated by the promoter thereby generating the exogenous reporter.

Embodiment 78 The method of embodiment 77, wherein the alpha beta T cell has reduced or eliminated surface expression of an endogenous cellular receptor.

Embodiment 79 A method for target screening, the method comprising:

(a) contacting an alpha beta T cell with a target, wherein the alpha beta T cell comprises: a polynucleotide sequence that comprises a promoter sequence operably linked to an exogenous reporter sequence; and an exogenous gamma delta T cell receptor that comprises: i) a gamma -chain that comprises a CDR sequence with at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to SEQ ID NO:85, 86, 87, 94, 95, 96, 101 , 113, 115, 117, 119, 127,

130, 134, 170; ii) a delta-chain that comprises a CDR sequence with at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to SEQ ID NO:82, 83, 84, 97, 98, 99, 100, 102, 114, 116, 118, 126, 131 , 135, 171 ; or iii) i) and ii); and b) detecting expression of an exogenous reporter encoded by the exogenous reporter sequence, wherein upon binding of the exogenous gamma delta T cell receptor to the target, transcription of the exogenous reporter sequence is initiated by the promoter thereby generating the exogenous reporter.

Embodiment 80 The method of any one of embodiments 77-79, wherein the alpha beta T cell further comprises a chimeric bidirectional signaling transmembrane protein.

Embodiment 81 A pharmaceutical composition that comprises a cell that comprises an exogenous y6TCR that binds a target identified by the method of any one of embodiments 77-80, and a pharmaceutically- acceptable excipient, carrier or diluent.

Embodiment 82 A method of treatment, comprising administering to a subject in need thereof the pharmaceutical composition of embodiment 81 . Embodiment 83 The method of embodiment 82, further comprising expanding the population of cells. Embodiment 84 The method of any one of embodiments 82-83, wherein the subject in need thereof has cancer.

While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only.

Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.